Science.gov

Sample records for 5s ribosomal dna

  1. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    PubMed

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  2. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA.

  3. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    PubMed

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  4. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    PubMed

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  5. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).

    PubMed

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  6. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    PubMed Central

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  7. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  8. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus.

    PubMed

    Caradonna, Fabio; Bellavia, Daniele; Clemente, Ann Maria; Sisino, Giorgia; Barbieri, Rainer

    2007-09-01

    In this paper the chromosomal localization and molecular cloning and characterization of three 5S rDNA clusters of 700 bp (base pairs), 900 bp, and 950 bp in the sea urchin Paracentrotus lividus are reported. Southern blot hybridization demonstrated the existence of three 5S rDNA repeats of differing length in the P. lividus genome. Fluorescence in situ hybridization analysis, performed in parallel on both haploid and diploid metaphases and interphase nuclei using different 5S rDNA units as probes, localized these 5S rDNA clusters in 3 different pairs of P. lividus chromosomes. This is the first complete gene mapping not only in a sea urchin but also in the phylum of echinoderms as a whole. PMID:17893727

  9. [Chromosomal localization of 5S and 45S ribosomal DNA in species of Linum L. section Linum (syn=Protolinum and Adenolinum)].

    PubMed

    Muravenko, O V; Amosova, A V; Samatadze, T E; Semenova, O Iu; Nosova, I V; Popov, K V; Shostak, N G; Zoshchuk, S A; Zelenin, A V

    2004-02-01

    Fluorescence in situ hybridization (FISH) was for the first time used to study the chromosomal location of the 45S (18-2.5S-26S) and 5S ribosomal genes in the genomes of five flax species of the section Linum (syn. Protolinum and Adenolinum). In L. usitatissimum L. (2n = 30), L. angustifolium Huds. (2n = 30), and L. bienne Mill. (2n = 30), a major hybridization site of 45S rDNA was observed in the pericentric region of a large metacentric chromosome. A polymorphic minor locus of 45S rDNA was found on one of the small chromosomes. Sites of 5S rDNA colocalized with those of 45S rDNA, but direct correlation between signal intensities from the 45S and 5S rDNA sites was observed only in some cases. Other 5S rDNA sites mapped to two chromosomes in these flax species. In L. grandiflorum Desf. (2n = 16) and L. austriacum L. (2n = 18), large regions of 45S and 5S rDNA were similarly located on a pair of homologous satellite-bearing chromosomes. An additional large polymorphic site of 45S and 5S rDNA was found in the proximal region of one arm of a small chromosome in the L. usitatissimum. L. angustifolium, and L. bienne karyotypes. The other arm of this chromosome contained a large 5S rDNA cluster. A similar location of the ribosomal genes in the pericentric region of the pair of satellite-bearing metacentrics confirmed the close relationships of the species examined. The difference in chromosomal location of the ribosomal genes between flax species with 2n = 30 and those with 2n = 16 or 18 testified to their assignment to different sections. The use of ribosomal genes as chromosome markers was assumed to be of importance for comparative genomic studies in cultivated flax, a valuable crop species of Russia, and in its wild relatives. PMID:15065434

  10. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product.

  11. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. PMID:26789074

  12. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    PubMed Central

    2010-01-01

    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  13. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status.

  14. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. PMID:23933480

  15. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  16. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces.

  17. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  18. A tandem array of 5S ribosomal RNA genes in Pythium irregulare.

    PubMed

    Belkhiri, A; Intengan, H; Klassen, G R

    1997-02-28

    The 5S ribosomal RNA genes of the oomycete Pythium irregulare exist in tandem arrays unlinked to the rDNA repeat unit. A clone with a 9.2-kb insert containing an array of 5S genes was identified in a lambda genomic library and was characterized by restriction mapping and partial sequencing. The array consisted of 9 apparently identical 5S genes and their spacers in tandem, followed by a diverged 5S-like sequence that is likely to be a pseudogene. This gene arrangement, although almost universal in plants and animals, is rare in fungi and protists.

  19. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    PubMed

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  20. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  1. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  2. Ultraviolet damage and nucleosome folding of the 5S ribosomal RNA gene.

    SciTech Connect

    Liu, X; Mann, David B.; Suquet, C; Springer, David L. ); Smerdon, Michael J.

    2000-01-25

    The Xenopus borealis somatic 5S ribosomal RNA gene was used as a model system to determine the mutual effects of nucleosome folding and formation of ultraviolet (UV) photoproducts (primarily cis-syn cyclobutane pyrimidine dimers, or CPDs) in chromatin. We analyzed the preferred rotational and translational settings of 5S rDNA on the histone octamer surface after induction of up to 0.8 CPD/nucleosome core (2.5 kJ/m(2) UV dose). DNase I and hydroxyl radical footprints indicate that UV damage at these levels does not affect the average rotational setting of the 5S rDNA molecules. Moreover, a combination of nuclease trimming and restriction enzyme digestion indicates the preferred translational positions of the histone octamer are not affected by this level of UV damage. We also did not observe differences in the UV damage patterns of irradiated 5S rDNA before or after nucleosome formation, indicating there is little difference in the inhibition of nucleosome folding by specific CPD sites in the 5S rRNA gene. Conversely, nucleosome folding significantly restricts CPD formation at all sites in the three helical turns of the nontranscribed strand located in the dyad axis region of the nucleosome, where DNA is bound exclusively by the histone H3-H4 tetramer. Finally, modulation of the CPD distribution in a 14 nt long pyrimidine tract correlates with its rotational setting on the histone surface, when the strong sequence bias for CPD formation in this tract is minimized by normalization. These results help establish the mutual roles of histone binding and UV photoproducts on their formation in chromatin.

  3. Identification of the gene encoding the 5S ribosomal RNA maturase in Bacillus subtilis: mature 5S rRNA is dispensable for ribosome function.

    PubMed Central

    Condon, C; Brechemier-Baey, D; Beltchev, B; Grunberg-Manago, M; Putzer, H

    2001-01-01

    Over 25 years ago, Pace and coworkers described an activity called RNase M5 in Bacillus subtilis cell extracts responsible for 5S ribosomal RNA maturation (Sogin & Pace, Nature, 1974, 252:598-600). Here we show that RNase M5 is encoded by a gene of previously unknown function that is highly conserved among the low G + C gram-positive bacteria. We propose that the gene be named rnmV. The rnmV gene is nonessential. B. subtilis strains lacking RNase M5 do not make mature 5S rRNA, indicating that this process is not necessary for ribosome function. 5S rRNA precursors can, however, be found in both free and translating ribosomes. In contrast to RNase E, which cleaves the Escherichia coli 5S precursor in a single-stranded region, which is then trimmed to yield mature 5S RNA, RNase M5 cleaves the B. subtilis equivalent in a double-stranded region to yield mature 5S rRNA in one step. For the most part, eubacteria contain one or the other system for 5S rRNA production, with an imperfect division along gram-negative and gram-positive lines. A potential correlation between the presence of RNase E or RNase M5 and the single- or double-stranded nature of the predicted cleavage sites is explored. PMID:11233981

  4. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron.

    PubMed Central

    MacKay, R M; Salgado, D; Bonen, L; Stackebrandt, E; Doolittle, W F

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are (formula: see text), respectively. Specific phylogenetic relationships of P. denitrificans with purple non-sulphur bacteria, and of Prochloron with cyanobacteria are demonstrated, and unique features of potential secondary structure are described. PMID:7099971

  5. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  6. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    PubMed

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production.

  7. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  8. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    PubMed

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-11-11

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  9. Satellite DNA derived from 5S rDNA in Physalaemus cuvieri (Anura, Leiuperidae).

    PubMed

    Vittorazzi, S E; Lourenço, L B; Del-Grande, M L; Recco-Pimentel, S M

    2011-01-01

    In the present study, we describe for the first time a family of 190-bp satellite DNA related to 5S rDNA in anurans and the existence of 2 forms of 5S rDNA, type I (201 bp) and type II (690 bp). The sequences were obtained from genomic DNA of Physalaemus cuvieri from Palmeiras, State of Bahia, Brazil. Analysis of the nucleotide sequence revealed that the satellite DNA obtained by digestion with EcoRI, called PcP190EcoRI, is 70% similar to the coding region of type I 5S rDNA and 66% similar to the coding region of type II 5S rDNA. Membrane hybridization and PCR amplification of the sequence showed that PcP190EcoRI is tandemly repeated. The satellite DNA as well as type I and type II 5S rDNA were localized in P. cuvieri chromosomes by fluorescent in situ hybridization. The PcP190EcoRI sequence was found in the centromeres of chromosomes 1-5 and in the pericentromeric region of chromosome 3. Type I 5S rDNA was detected in chromosome 3, coincident with the site of PcP190EcoRI. Type II 5S rDNA was located interstitially in the long arm of chromosome 5. None of these sequences co-localized with nucleolar organizer regions. Our data suggests that this satellite DNA originates from the 5S ribosomal multigene family, probably by gene duplication, nucleotide divergence and sequence dispersion in the genome.

  10. 5S rDNA genome regions of Lens species.

    PubMed

    Fernández, M; Ruiz, M L; Linares, C; Fominaya, A; Pérez de la Vega, M

    2005-10-01

    The length variability of the nontranscribed spacer (NTS) of the 5S rDNA repeats was analyzed in species of the genus Lens by means of PCR amplification. The NTS ranged from approximately 227 to approximately 952 bp. The polymorphism detected was higher than previous NTS polymorphisms described in this genus. Three NTS length variants from Lens culinaris subsp. culinaris and 2 from Lens culinaris subsp. orientalis were sequenced. The culinaris NTS fragment lengths were 239, 371, and 838 bp, whereas the orientalis ones were 472 bp and 506 bp, respectively. As a result of sequence similarities, 2 families of sequences were distinguished, 1 including the sequences of 838 and 506 bp, and others with the sequences of 239, 371, and 472 bp. The 1st family was characterized by the presence of a repeated sequence designated A, whereas the 2nd family showed a single A sequence and other repeated sequences designated B, C, and D. The presence of an (AT)n microsatellite was also observed in the 2nd family of sequences. The fragments, which included the 239-bp and 838-bp NTS sequences, as well as the intergenic spacer (IGS) of the 18S-5.8S-26S ribosomal DNA also from L. culinaris subsp. culinaris, were used to localize the nucleolar organizer region (NOR) and the 5S rDNA loci in the chromosomes of several species of the genus Lens by means of fluorescence in situ hybridization (FISH). The selective hybridization of the 2 NTS probes allowed us to distinguish between different 5S rDNA chromosomal loci.

  11. Chemical accessibility of the 4.5S RNA in spinach chloroplast ribosomes.

    PubMed Central

    Kumagai, I; Bartsch, M; Subramanian, A R; Erdmann, V A

    1983-01-01

    We have examined the accessibility to diethylpyrocarbonate of spinach chloroplast 4.5S ribosomal RNA when free and when it is part of the ribosomal structure. The modifications in free 4.5S RNA were found mostly in single-stranded regions of the secondary structure model proposed in our previous paper (Kumagai, I. et al. (1982) J.B.C. 257, 12924-28): adenines at positions 17, 19, 33, 36, 54, 55, 60, 64, 68, 72, 77, 86 and 87 were identified as the reactive residues. On the other hand, in 4.5S RNA in 70S ribosomes or 50S subunits, adenine 33 was exclusively modified, and its reactivity was much higher than in free 4.5S RNA. This highly accessible A33 of spinach 4.5S RNA is located within a characteristic seven nucleotide sequence, which is found in the 4.5S rRNAs from spinach, tobacco and a fern but deleted in 4.5S RNAs from maize and wheat. Images PMID:6828382

  12. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  13. Heterochromatin polymorphism and physical mapping of 5S and 18S ribosomal DNA in four populations of Hypostomus strigaticeps (Regan, 1907) from the Paraná River basin, Brazil: evolutionary and environmental correlation.

    PubMed

    Baumgärtner, Lucas; Paiz, Leonardo Marcel; Zawadzki, Cláudio Henrique; Margarido, Vladimir Pavan; Castro, Ana Luiza de Brito Portela

    2014-10-01

    A cytogenetic analysis was performed on four populations of Hypostomus strigaticeps from the Paraná River basin, Brazil. Two populations were collected from the large channel river at the Itaipu reservoir area and the other two were from the upper stretches of tributaries of the Paraná River. All populations showed 2n=72 chromosomes (12m+12sm+18st+30a), intra- and interpopulation 18S rDNA site polymorphisms (two to three acrocentric chromosome pairs), and multiple 5S rDNA sites in three chromosome pairs (4, 21, and 28). C-banding revealed heterochromatin located in the centromere and pericentromere regions of most chromosome; however, large heterochromatic blocks (CMA3(-)/DAPI(+)) on the long arm of acrocentric chromosomes identified intra- and interpopulation polymorphism. The amount and distribution of heterochromatin seem to be correlated to biogeographical characteristics of H. strigaticeps along the Paraná River. Morphometric results also showed diversity among the populations, suggesting phenotypic plasticity of this species. Evolutionary, taxonomy, and biogeographical approaches with regard to H. strigaticeps and interrelationships in Hypostomus are discussed.

  14. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  15. Characterization and physical mapping of 18S and 5S ribosomal genes in Indian major carps (Pisces, Cyprinidae).

    PubMed

    Ravindra Kumar; Kushwaha, Basdeo; Nagpure, Naresh S

    2013-06-01

    Characterization of the major (18S) and minor (5S) ribosomal RNA genes were carried out in three commercially important Indian major carp (IMC) species, viz. Catla catla, Labeo rohita and Cirrhinus mrigala along with their physical localizations using dual colour fluorescence in situ hybridization. The diploid chromosome number in the above carps was confirmed to be 50 with inter-species karyo-morphological variations. The 18S rDNA signals were observed on 3 pair of chromosomes in C. catla and L. rohita, and two pairs in C. mrigala. The 5S rDNA signal was found on single pair of chromosome in all the species with variation in their position on chromosomes. The sequencing of 18S rDNA generated 1804, 1805 and 1805 bp long fragments, respectively, in C. catla, L. rohita and C. mrigala with more than 98% sequence identity among them. Similarly, sequencing of 5S rDNA generated 191 bp long fragments in the three species with 100% identity in coding region and 23.2% overall variability in non-transcribed spacer region. Thus, these molecular markers could be used as species-specific markers for taxonomic identification and might help in understanding the genetic diversity, genome organization and karyotype evolution of these species.

  16. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  17. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease.

  18. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    PubMed Central

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  19. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  20. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  1. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

    PubMed

    Galián, J A; Rosato, M; Rosselló, J A

    2012-06-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  2. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    PubMed

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  3. In vitro synthesis of ribosomal proteins directed by Escherichia coli DNA.

    PubMed

    Kaltschmidt, E; Kahan, L; Nomura, M

    1974-02-01

    In vitro synthesis of a number of E. coli 30S ribosomal proteins has been demonstrated in a cell-free system consisting of ribosomes, initiation factors, RNA polymerase, a fraction containing soluble enzymes and factors, and E. coli DNA. DNA-dependent synthesis of the following 30S proteins has been demonstrated: S4, S5, S7, S8, S9, S10, S13, S14, S16, S19, and S20.

  4. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  5. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection

    PubMed Central

    2011-01-01

    Background The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. Results The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. Conclusions These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection. PMID:22004418

  6. Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

    NASA Technical Reports Server (NTRS)

    Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

    1985-01-01

    The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

  7. Extrachromosomal circular ribosomal DNA in the yeast Saccharomyces carlsbergensis.

    PubMed Central

    Meyerink, J H; Klootwijk, J; Planta, R J; van der Ende, A; van Bruggen, E F

    1979-01-01

    Purified ribosomal DNA from Saccharomyces carlsbergensis contains a small proportion of circular DNA molecules with a contour length of 3 micron or integral multiples thereof. Hybridization of yeast ribosomal DNA with 26 S rRNA, using the R-loop technique, reveals that these circular molecules contain sequences complementary to yeast ribosomal RNA. We suggest that these extrachromosomal rRNA genes may be intermediates in the amplification of rRNA genes in yeast. Images PMID:493145

  8. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    PubMed

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  9. Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

    PubMed Central

    Carol, P; Rozier, C; Lazaro, E; Ballesta, J P; Mache, R

    1993-01-01

    The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain. Images PMID:8441674

  10. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  11. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    NASA Astrophysics Data System (ADS)

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  12. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae)

    PubMed Central

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-01-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at −25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  13. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    PubMed

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.

  14. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    PubMed

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  15. Chromosomal localization of 18S and 5S rDNA using FISH in the genus Tor (Pisces, Cyprinidae).

    PubMed

    Singh, Mamta; Kumar, Ravindra; Nagpure, N S; Kushwaha, B; Gond, Indramani; Lakra, W S

    2009-12-01

    Dual color fluorescence in situ hybridization (FISH) was performed to study the simultaneous chromosomal localization of 18S and 5S ribosomal genes in the genus Tor for the first time. The 18S and 5S rDNAs in four Tor species were amplified, sequenced and mapped on the metaphase chromosomes. The number and distribution of 18S and 5S rDNA clusters were examined on metaphase chromosome spreads using FISH. The specimens of T. chelynoides, T. putitora and T. progeneius showed six bright fluorescent signals of 18S rDNA and T. tor exhibited ten such signals. The 5S rDNA signals were present only on one pair of chromosomes in all the four Tor species. Ag-NORs were observed on two pairs of chromosomes in T. chelynoides, T. putitora, T. progeneius and four pairs in T. tor. Comparison of the observed 18S rDNA FISH signals and Ag-NORs strongly suggested a possible inactivation of NORs localized at the telomeres of a subtelocentric and telocentric chromosome pairs in all four species. The 5S rDNA contained an identical 120 bp long coding region and 81 bp long highly divergent non-transcribed spacers in all species examined. 18S and 5S rDNA sequencing and chromosomal localization can be a useful genetic marker in species identification as well as phylogenetic and evolutionary studies.

  16. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    PubMed

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  17. Concerted copy number variation balances ribosomal DNA dosage in human and mouse genomes.

    PubMed

    Gibbons, John G; Branco, Alan T; Godinho, Susana A; Yu, Shoukai; Lemos, Bernardo

    2015-02-24

    Tandemly repeated ribosomal DNA (rDNA) arrays are among the most evolutionary dynamic loci of eukaryotic genomes. The loci code for essential cellular components, yet exhibit extensive copy number (CN) variation within and between species. CN might be partly determined by the requirement of dosage balance between the 5S and 45S rDNA arrays. The arrays are nonhomologous, physically unlinked in mammals, and encode functionally interdependent RNA components of the ribosome. Here we show that the 5S and 45S rDNA arrays exhibit concerted CN variation (cCNV). Despite 5S and 45S rDNA elements residing on different chromosomes and lacking sequence similarity, cCNV between these loci is strong, evolutionarily conserved in humans and mice, and manifested across individual genotypes in natural populations and pedigrees. Finally, we observe that bisphenol A induces rapid and parallel modulation of 5S and 45S rDNA CN. Our observations reveal a novel mode of genome variation, indicate that natural selection contributed to the evolution and conservation of cCNV, and support the hypothesis that 5S CN is partly determined by the requirement of dosage balance with the 45S rDNA array. We suggest that human disease variation might be traced to disrupted rDNA dosage balance in the genome.

  18. Regulation of ribosomal DNA amplification by the TOR pathway

    PubMed Central

    Jack, Carmen V.; Cruz, Cristina; Hull, Ryan M.; Keller, Markus A.; Ralser, Markus; Houseley, Jonathan

    2015-01-01

    Repeated regions are widespread in eukaryotic genomes, and key functional elements such as the ribosomal DNA tend to be formed of high copy repeated sequences organized in tandem arrays. In general, high copy repeats are remarkably stable, but a number of organisms display rapid ribosomal DNA amplification at specific times or under specific conditions. Here we demonstrate that target of rapamycin (TOR) signaling stimulates ribosomal DNA amplification in budding yeast, linking external nutrient availability to ribosomal DNA copy number. We show that ribosomal DNA amplification is regulated by three histone deacetylases: Sir2, Hst3, and Hst4. These enzymes control homologous recombination-dependent and nonhomologous recombination-dependent amplification pathways that act in concert to mediate rapid, directional ribosomal DNA copy number change. Amplification is completely repressed by rapamycin, an inhibitor of the nutrient-responsive TOR pathway; this effect is separable from growth rate and is mediated directly through Sir2, Hst3, and Hst4. Caloric restriction is known to up-regulate expression of nicotinamidase Pnc1, an enzyme that enhances Sir2, Hst3, and Hst4 activity. In contrast, normal glucose concentrations stretch the ribosome synthesis capacity of cells with low ribosomal DNA copy number, and we find that these cells show a previously unrecognized transcriptional response to caloric excess by reducing PNC1 expression. PNC1 down-regulation forms a key element in the control of ribosomal DNA amplification as overexpression of PNC1 substantially reduces ribosomal DNA amplification rate. Our results reveal how a signaling pathway can orchestrate specific genome changes and demonstrate that the copy number of repetitive DNA can be altered to suit environmental conditions. PMID:26195783

  19. Regulation of ribosomal DNA amplification by the TOR pathway.

    PubMed

    Jack, Carmen V; Cruz, Cristina; Hull, Ryan M; Keller, Markus A; Ralser, Markus; Houseley, Jonathan

    2015-08-01

    Repeated regions are widespread in eukaryotic genomes, and key functional elements such as the ribosomal DNA tend to be formed of high copy repeated sequences organized in tandem arrays. In general, high copy repeats are remarkably stable, but a number of organisms display rapid ribosomal DNA amplification at specific times or under specific conditions. Here we demonstrate that target of rapamycin (TOR) signaling stimulates ribosomal DNA amplification in budding yeast, linking external nutrient availability to ribosomal DNA copy number. We show that ribosomal DNA amplification is regulated by three histone deacetylases: Sir2, Hst3, and Hst4. These enzymes control homologous recombination-dependent and nonhomologous recombination-dependent amplification pathways that act in concert to mediate rapid, directional ribosomal DNA copy number change. Amplification is completely repressed by rapamycin, an inhibitor of the nutrient-responsive TOR pathway; this effect is separable from growth rate and is mediated directly through Sir2, Hst3, and Hst4. Caloric restriction is known to up-regulate expression of nicotinamidase Pnc1, an enzyme that enhances Sir2, Hst3, and Hst4 activity. In contrast, normal glucose concentrations stretch the ribosome synthesis capacity of cells with low ribosomal DNA copy number, and we find that these cells show a previously unrecognized transcriptional response to caloric excess by reducing PNC1 expression. PNC1 down-regulation forms a key element in the control of ribosomal DNA amplification as overexpression of PNC1 substantially reduces ribosomal DNA amplification rate. Our results reveal how a signaling pathway can orchestrate specific genome changes and demonstrate that the copy number of repetitive DNA can be altered to suit environmental conditions.

  20. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.

    PubMed

    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa

    2011-03-01

    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained.

  1. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.

    PubMed

    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa

    2011-03-01

    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained. PMID:21429462

  2. 5 S and 5.8 S ribosomal RNA sequences and protist phylogenetics.

    PubMed

    Walker, W F

    1985-01-01

    More than 100 5 S 5.8 S rRNA sequences from protists, including fungi, are known. Through a combination of quantitative treeing and special consideration of "signature' nucleotide combinations, the most significant phylogenetic implications of these data are emphasized. Also, limitations of the data for phylogenetic inferences are discussed and other significant data are brought to bear on the inferences obtained. 5 S sequences from red algae are seen as the most isolated among eukaryotics. A 5 S sequence lineage consisting of oomycetes, euglenoids, most protozoa, most slime molds and perhaps dinoflagellates and mesozoa is defined. Such a lineage is not evident from 5.8 S rRNA or cytochrome c sequence data. 5 S sequences from Ascomycota and Basidiomycota are consistent with the proposal that each is derived from a mycelial form with a haploid yeast phase and simple septal pores, probably most resembling present Taphrinales. 5 S sequences from Chytridiomycota and Zygomycota are not clearly distinct from each other and suggest that a major lineage radiation occurred in the early history of each. Qualitative biochemical data clearly supports a dichotomy between an Ascomycota-Basidiomycota lineage and a Zygomycota-Chytridiomycota lineage.

  3. Contrasting patterns of the 5S and 45S rDNA evolutions in the Byblis liniflora complex (Byblidaceae).

    PubMed

    Fukushima, Kenji; Imamura, Kaori; Nagano, Katsuya; Hoshi, Yoshikazu

    2011-03-01

    To clarify the evolutionary dynamics of ribosomal RNA genes (rDNAs) in the Byblis liniflora complex (Byblidaceae), we investigated the 5S and 45S rDNA genes through (1) chromosomal physical mapping by fluorescence in situ hybridization (FISH) and (2) phylogenetic analyses using the nontranscribed spacer of 5S rDNA (5S-NTS) and the internal transcribed spacer of 45S rDNA (ITS). In addition, we performed phylogenetic analyses based on rbcL and trnK intron. The complex was divided into 2 clades: B. aquatica-B. filifolia and B. guehoi-B. liniflora-B. rorida. Although members of the complex had conservative symmetric karyotypes, they were clearly differentiated on chromosomal rDNA distribution patterns. The sequence data indicated that ITS was almost homogeneous in all taxa in which two or four 45S rDNA arrays were frequently found at distal regions of chromosomes in the somatic karyotype. ITS homogenization could have been prompted by relatively distal 45S rDNA positions. In contrast, 2-12 5S rDNA arrays were mapped onto proximal/interstitial regions of chromosomes, and some paralogous 5S-NTS were found in the genomes harboring 4 or more arrays. 5S-NTS sequence type-specific FISH analysis showed sequence heterogeneity within and between some 5S rDNA arrays. Interlocus homogenization may have been hampered by their proximal location on chromosomes. Chromosomal location may have affected the contrasting evolutionary dynamics of rDNAs in the B. liniflora complex.

  4. Release of ribosome-bound 5S rRNA upon cleavage of the phosphodiester bond between nucleotides A54 and A55 in 5S rRNA.

    PubMed

    Holmberg, L; Nygård, O

    2000-11-01

    Reticulocyte lysates contain ribosome-bound and free populations of 5S RNA. The free population is sensitive to nuclease cleavage in the internal loop B, at the phosphodiester bond connecting nucleotides A54 and A55. Similar cleavage sites were detected in 5S rRNA in 60S subunits and 80S ribosomes. However, 5S rRNA in reticulocyte polysomes is insensitive to cleavage unless ribosomes are salt-washed. This suggests that a translational factor protects the backbone surrounding A54 from cleavage in polysomes. Upon nuclease treatment of mouse 60S subunits or reticulocyte lysates a small population of ribosomes released its 5S rRNA together with ribosomal protein L5. Furthermore, rRNA sequences from 5.8S, 28S and 18S rRNA were released. In 18S rRNA the sequences mainly originate from the 630 loop and stem (helix 18) in the 5' domain, whereas in 28S rRNA a majority of fragments is derived from helices 47 and 81 in domains III and V, respectively. We speculate that this type of rRNA-fragmentation may mimic a ribosome degradation pathway.

  5. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    PubMed

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-01

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  6. Taxonomy of 5 S ribosomal RNA by the linguistic technique: probing with mitochondrial and mammalian sequences.

    PubMed

    Guimarães, R C; Trifonov, E N; Lagunez-Otero, J

    1997-09-01

    Linguistic similarities and dissimilarities between 5 S rRNA sequences allowed taxonomical separation of species and classes. Comparisons with the molecule from mammals distinguished fungi and plants from protists and animals. Similarities to mammalians progressively increased from protists to invertebrates and to somatic-type molecules of the vertebrates lineage. In this, deviations were detected in avian, oocyte type, and pseudogene sequences. Among bacteria, actinobacteria were most similar to the mammalians, which could be related to the high frequency of associations among members of these groups. Some archaebacterial species most similar to the mammalians belonged to the Thermoproteales and Halobacteria groups. Comparisons with the soybean mitochondrial molecule revealed high internal homogeneity among plant mitochondria. The eubacterial groups most similar to it were Thermus and Rhodobacteria gamma-1 and alpha-2. Other procedures have already indicated similarities of Rhodobacteria alpha to mitochondria but the linguistic similarities were on the average higher with the first two groups.

  7. Evolutionary dynamics of the 5S rDNA gene family in the mussel Mytilus: mixed effects of birth-and-death and concerted evolution.

    PubMed

    Freire, Ruth; Arias, Alberto; Insua, Ana M; Méndez, Josefina; Eirín-López, José M

    2010-05-01

    In higher eukaryotes, the gene family encoding the 5S ribosomal RNA (5S rRNA) has been used (together with histones) to showcase the archetypal example of a gene family subject to concerted evolution. However, recent studies have revealed conspicuous features challenging the predictions of this model, including heterogeneity of repeat units, the presence of functional 5S gene variants as well as the existence of 5S rDNA divergent pseudogenes lacking traces of homogenization. In the present work, we have broadened the scope in the evolutionary study of ribosomal gene families by studying the 5S rRNA family in mussels, a model organism which stands out among other animals due to the heterogeneity it displays regarding sequence and organization. To this end, 48 previously unknown 5S rDNA units (coding and spacer regions) were sequenced in five mussel species, leading to the characterization of two new types of units (referred to here as small-beta 5S rDNA and gamma-5S rDNA) coexisting in the genome with alpha and beta rDNA units. The intense genetic dynamics of this family is further supported by the first description of an association between gamma-5S rDNA units and tRNA genes. Molecular evolutionary and phylogenetic analyses revealed an extensive lack of homology among spacer sequences belonging to different rDNA types, suggesting the presence of independent evolutionary pathways leading to their differentiation. Overall, our results suggest that the long-term evolution of the 5S rRNA gene family in mussels is most likely mediated by a mixed mechanism involving the generation of genetic diversity through birth-and-death, followed by a process of local homogenization resulting from concerted evolution in order to maintain the genetic identities of the different 5S units, probably after their transposition to independent chromosomal locations.

  8. Eukaryotic origins: string analysis of 5S ribosomal RNA sequences from some relevant organisms.

    PubMed

    Nanney, D L; Mobley, D O; Preparata, R M; Meyer, E B; Simon, E M

    1991-04-01

    Using the PHYLOGEN tree-forming programs, we evaluate the published 5S rRNA sequences in certain of the files in the Berlin DataBank in an attempt to identify the connection between archaebacteria and the eukaryotic protists. These programs are based on methods of string analysis developed by Sankoff and others. Their discriminatory power is derived from their continuous realignment of sequences through repeated assessment of insertions and deletions as well as substitutions. The programs demonstrate that even these small molecules (ca. 120 bases) retain substantial records of evolutionary events that occurred over a billion years ago. The eukaryotes seem to have been derived from ancestors near the common origins of the halobacterial and Methanococcales groups. Identifying what might have been a primordial eukaryote is more difficult because several of the species considered as early derivatives from the common root are isolated species with large genetic differences from each other and from all other extant forms that have been sequenced. The ameboid, flagellated, and ciliated protists seem to have emerged nearly simultaneously from an ancient cluster, but the sarcodinid protozoa have preference as the group of most ancient origin. The euglenozoa and the ciliates are of later derivation. Our ability to tease plausible trees from such small molecules suggests that the mode of analysis rather than the size of the molecule is often a major limitation in the reconstruction of acceptable ancient phylogenics.(ABSTRACT TRUNCATED AT 250 WORDS)

  9. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    PubMed

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. PMID:24643007

  10. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    PubMed

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome.

  11. Common DNA structural features exhibited by eukaryotic ribosomal gene promoters.

    PubMed Central

    Marilley, M; Pasero, P

    1996-01-01

    Nucleotide sequences of DNA regions containing eukaryotic ribosomal promoters were analysed using strategies designed to reveal sequence-directed structural features. DNA curvature, duplex stability and pattern of twist angle variation were studied by computer modelling. Although ribosomal promoters are known to lack sequence homology (unless very closely related species are considered), investigation of these structural characteristics uncovered striking homologies in all the taxonomic groups examined so far. This wide conservation of DNA structures, while DNA sequence is not conserved, suggests that the determined structures are fundamental for ribosomal promoter function. Moreover, this result agrees well with the recent observations showing that RNA polymerase I transcription factors have not evolved as intensively as previously suspected. PMID:8710487

  12. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  13. Species-genomic relationships among the tribasic diploid and polyploid Carthamus taxa based on physical mapping of active and inactive 18S-5.8S-26S and 5S ribosomal RNA gene families, and the two tandemly repeated DNA sequences.

    PubMed

    Agrawal, Renuka; Tsujimoto, Hisashi; Tandon, Rajesh; Rao, Satyawada Rama; Raina, Soom Nath

    2013-05-25

    In the genus Carthamus (2n=20, 22, 24, 44, 64; x=10, 11, 12), most of the homologues within and between the chromosome complements are difficult to be identified. In the present work, we used fluorescent in situ hybridisation (FISH) to determine the chromosome distribution of the two rRNA gene families, and the two isolated repeated DNA sequences in the 14 Carthamus taxa. The distinctive variability in the distribution, number and signal intensity of hybridisation sites for 18S-26S and 5S rDNA loci could generally distinguish the 14 Carthamus taxa. Active 18S-26S rDNA sites were generally associated with NOR loci on the nucleolar chromosomes. The two A genome taxa, C. glaucus ssp. anatolicus and C. boissieri with 2n=20, and the two botanical varieties of B genome C. tinctorius (2n=24) had diagnostic FISH patterns. The present results support the origin of C. tinctorius from C. palaestinus. FISH patterns of C. arborescens vis-à-vis the other taxa indicate a clear division of Carthamus taxa into two distinct lineages. Comparative distribution and intensity pattern of 18S-26S rDNA sites could distinguish each of the tetraploid and hexaploid taxa. The present results indicate that C. boissieri (2n=20) is one of the genome donors for C. lanatus and C. lanatus ssp. lanatus (2n=44), and C. lanatus is one of the progenitors for the hexaploid (2n=64) taxa. The association of pCtKpnI-2 repeated sequence with rRNA gene cluster (orphon) in 2-10 nucleolar and non-nucleolar chromosomes and the consistent occurrence of pCtKpnI-1 repeated sequence at the subtelomeric region in all the taxa analysed indicate some functional role of these sequences.

  14. A 5 S rRNA gene is present in the mitochondrial genome of the protist Reclinomonas americana but is absent from red algal mitochondrial DNA.

    PubMed

    Lang, B F; Goff, L J; Gray, M W

    1996-09-01

    Except in the case of land plants, mitochondrial ribosomes apparently lack a 5 S rRNA species, even though this small RNA is a component of all prokaryotic, chloroplast and eukaryotic cytosol ribosomes. In plants, the mitochondrial 5 S rRNA is encoded by mtDNA and differs in sequence from the 5 S rRNA specified by plant nuclear and chloroplast genomes. A distinctive 5 S rRNA component has not been found in the mitochondrial ribosomes of non-plant eukaryotes and, with the notable exception of the chlorophycean alga, Prototheca wickerhamii, a 5 S rRNA gene has not been identified in those non-plant mtDNAs characterized to date. Here, we report the presence of a 5 S rRNA gene in the mtDNA of the heterotrophic flagellate Reclinomonas americana. This unicellular eukaryote is a member of the jakobid flagellates, an early-diverging group of protists that share ultrastructural characteristics with the retortamonads, primitive protists that lack mitochondria. We report sequence data from the mtDNAs of the red algae Porphyra purpurea and Gracilariopsis lemaneiformis, which we use to evaluate a recent claim that a 5 S rRNA gene exists in the mtDNA of a third rhodophyte alga, Chondrus crispus. Our results lead us to the opposite conclusion: that a 5 S rRNA gene is not encoded by red algal mtDNA. In view of the accumulating evidence favoring a monophyletic origin of the mitochondrial genome, it is likely that a 5 S rRNA gene was present in an ancestral proto-mitochondrial genome, and that contemporary mtDNA-encoded 5 S rRNA genes have all descended from this ancestral gene. Considering the highly restricted phylogenetic distribution of identified mtDNA-encoded 5 S rRNA genes, it follows that the mitochondrial 5 S rRNA gene must have been lost multiple times during evolutionary diversification of the eukaryotic lineage.

  15. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy

    2012-01-01

    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  16. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA.

    PubMed

    Kumke, Katrin; Macas, Jiří; Fuchs, Jörg; Altschmied, Lothar; Kour, Jasmeet; Dhar, Manoj K; Houben, Andreas

    2016-01-01

    B chromosomes are supernumerary dispensable parts of the karyotype which appear in some individuals of some populations in some species. Using advanced sequencing technology, we in silico characterized the high-copy DNA composition of Plantago lagopus with and without B chromosomes. The nuclear genome (2.46 pg/2C) was found to be relatively rich in repetitive sequences, with highly and moderately repeated elements making up 68% of the genome. Besides a centromere-specific marker, we identified a B-specific satellite and a repeat enriched in polymorphic A chromosome segments. The B-specific tandem repeat PLsatB originated from sequence amplification including 5S rDNA fragments. PMID:27173804

  17. Molecular dissection of the rDNA array and of the 5S rDNA gene in Meloidogyne artiellia: phylogenetic and diagnostic implications.

    PubMed

    Veronico, Pasqua; De Luca, Francesca; De Giorgi, Carla

    2004-06-01

    The sequence of a 13.423 nucleotide genomic fragment has been determined for the plant parasitic nematode Meloidogyne artiellia. It contains an entire rDNA cluster, the bordering intergenic regions and portions of the flanking coding regions. The sequence analysis of the rDNA repeats suggests homogeneity in M. artiellia, thus providing a further indication of the usefulness of these genes for the diagnostic identification of this species. The comparison of the secondary structures of the internal transcribed spacer 2 region in several Meloidogyne species indicates that RNA folding predictions can be used as a tool of potential diagnostic relevance. The other ribosomal gene, 5S rDNA, has been demonstrated to be functional and located near the trans-spliced leader sequences, in the same arrangement found in the distantly related nematode Caenorhabditis elegans but never in other Meloidogyne thus providing species-specific markers for the identification of several Thylenchida parasitic nematodes. PMID:15135452

  18. The Evolution of Ribosomal DNA: Divergent Paralogues and Phylogenetic Implications

    PubMed Central

    Buckler-IV, E. S.; Ippolito, A.; Holtsford, T. P.

    1997-01-01

    Although nuclear ribosomal DNA (rDNA) repeats evolve together through concerted evolution, some genomes contain a considerable diversity of paralogous rDNA. This diversity includes not only multiple functional loci but also putative pseudogenes and recombinants. We examined the occurrence of divergent paralogues and recombinants in Gossypium, Nicotiana, Tripsacum, Winteraceae, and Zea ribosomal internal transcribed spacer (ITS) sequences. Some of the divergent paralogues are probably rDNA pseudogenes, since they have low predicted secondary structure stability, high substitution rates, and many deamination-driven substitutions at methylation sites. Under standard PCR conditions, the low stability paralogues amplified well, while many high-stability paralogues amplified poorly. Under highly denaturing PCR conditions (i.e., with dimethylsulfoxide), both low- and high-stability paralogues amplified well. We also found recombination between divergent paralogues. For phylogenetics, divergent ribosomal paralogues can aid in reconstructing ancestral states and thus serve as good outgroups. Divergent paralogues can also provide companion rDNA phylogenies. However, phylogeneticists must discriminate among families of divergent paralogues and recombinants or suffer from muddled and inaccurate organismal phylogenies. PMID:9055091

  19. Evolutionary Mobility of the Ribosomal DNA Array in Yeasts

    PubMed Central

    Proux-Wéra, Estelle; Byrne, Kevin P.; Wolfe, Kenneth H.

    2013-01-01

    The ribosomal DNA (rDNA) of eukaryotes is organized as large tandem arrays. Here, we compare the genomic locations of rDNA among yeast species and show that, despite its huge size (>1 Mb), the rDNA array has moved around the genome several times within the family Saccharomycetaceae. We identify an ancestral, nontelomeric, rDNA site that is conserved across many species including Saccharomyces cerevisiae. Within the genus Lachancea, however, the rDNA apparently transposed from the ancestral site to a new site internal to a different chromosome, becoming inserted into a short intergenic region beside a tRNA gene. In at least four other yeast lineages, the rDNA moved from the ancestral site to telomeric locations. Remarkably, both the ancestral rDNA site and the new site in Lachancea are adjacent to protein-coding genes whose products maintain the specialized chromatin structure of rDNA (HMO1 and CDC14, respectively). In almost every case where the rDNA was lost from the ancestral site, the entire array disappeared without any other rearrangements in the region, leaving just an intergenic spacer of less than 2 kb. The mechanism by which this large and complex locus moves around the genome is unknown, but we speculate that it may involve the formation of double-strand DNA breaks by Fob1 protein or the formation of extrachromosomal rDNA circles. PMID:23419706

  20. Abridged 5S rDNA units in sea beet (Beta vulgaris subsp. maritima).

    PubMed

    Turner, Daniel J; Brown, Terence A

    2005-04-01

    Amplification by polymerase chain reaction of the 5S rDNA repeat units of Beta vulgaris subsp. maritima resulted in a 350-bp product corresponding to the full-length 5S unit, but also revealed 4 abridged unit classes, each with a deletion that removed most of the spacer and 12-76 bp of the coding sequence. Each abridged type lacks at least 1 of the conserved elements involved in transcription of the 5S gene, and so appear to be nonfunctional. Network analysis revealed that the abridged units are evolving in the same manner as the full-length versions.

  1. Ribosomal DNA Comparisons of Globodera from Two Continents

    PubMed Central

    Ferris, V. R.; Miller, L. I.; Faghihi, J.; Ferris, J. M.

    1995-01-01

    Ribosomal DNA (rDNA) sequence data were compared for five species of Globodera, including G. rostochiensis, G. pallida, G. virginiae, and two undescribed Globodera isolates from Mexico collected from weed species and maintained on Solanum dulcamara. The rDNA comparisons included both internal transcribed spacers (ITS1 and ITS2), the 5.8S rRNA gene, and small portions of the 3' end of the 18S gene and the 5' end of the 28S gene. Phylogenetic analysis of the rDNA sequence data indicated that the two potato cyst nematodes, G. pallida and especially G. rostochiensis, are closely related to the Mexican isolates, whereas G. virginiae is relatively dissimilar to the others and more distantly related. The data are consistent with the thesis that Mexico is the center of origin for the potato cyst nematodes. PMID:19277290

  2. Diagnostics of neisseriaceae and moraxellaceae by ribosomal DNA sequencing: ribosomal differentiation of medical microorganisms.

    PubMed

    Harmsen, D; Singer, C; Rothgänger, J; Tønjum, T; de Hoog, G S; Shah, H; Albert, J; Frosch, M

    2001-03-01

    Fast and reliable identification of microbial isolates is a fundamental goal of clinical microbiology. However, in the case of some fastidious gram-negative bacterial species, classical phenotype identification based on either metabolic, enzymatic, or serological methods is difficult, time-consuming, and/or inadequate. 16S or 23S ribosomal DNA (rDNA) bacterial sequencing will most often result in accurate speciation of isolates. Therefore, the objective of this study was to find a hypervariable rDNA stretch, flanked by strongly conserved regions, which is suitable for molecular species identification of members of the Neisseriaceae and Moraxellaceae. The inter- and intrageneric relationships were investigated using comparative sequence analysis of PCR-amplified partial 16S and 23S rDNAs from a total of 94 strains. When compared to the type species of the genera Acinetobacter, Moraxella, and Neisseria, an average of 30 polymorphic positions was observed within the partial 16S rDNA investigated (corresponding to Escherichia coli positions 54 to 510) for each species and an average of 11 polymorphic positions was observed within the 202 nucleotides of the 23S rDNA gene (positions 1400 to 1600). Neisseria macacae and Neisseria mucosa subsp. mucosa (ATCC 19696) had identical 16S and 23S rDNA sequences. Species clusters were heterogeneous in both genes in the case of Acinetobacter lwoffii, Moraxella lacunata, and N. mucosa. Neisseria meningitidis isolates failed to cluster only in the 23S rDNA subset. Our data showed that the 16S rDNA region is more suitable than the partial 23S rDNA for the molecular diagnosis of Neisseriaceae and Moraxellaceae and that a reference database should include more than one strain of each species. All sequence chromatograms and taxonomic and disease-related information are available as part of our ribosomal differentiation of medical microorganisms (RIDOM) web-based service (http://www.ridom.hygiene.uni-wuerzburg.de/). Users can submit a

  3. DNA homologies of ribosomal RNA genes of Neurospora species

    SciTech Connect

    Mukhopadhyay, D.K.; Mimiko, R.; Dutta, S.K.

    1980-01-01

    Ribosomal RNA genes (rDNAs) of Neurospora crassa contain DNA sequences which code for 17S, 5.8S, and 26S rRNAs, in addition to internal and external spacers. As has been reported for many eukaryotes, the DNA sequences which code for 17S, 5.8S, and 26S rRNAs in Neurospora species are probably conserved while the internal and external spacer regions are probably variable sequences. Extensive electron microscopic studies of 45S precursor rRNA of several cold and warm blooded animals confirm that spacer regions vary extensively from species to species. It was desirable to know whether such differences in rDNA sequences exist between Neurospora species. Any such difference should be detectable using standard procedures for DNA homology studies rDNA sequences were isolated from N. crassa mycelial cells using the procedure described previously. The purified rDNA was /sup 3/H-labeled (by nick translation) and reassociated with total DNA isolated from the heterothallic species N. crassa and from three homothalliospecies: N. dodgei, N. lineolata, and N. africana. In addition, /sup 32/P-labeled total DNA of N. crassa was reannealed with unlabeled bulk DNA from N. crassa, N. dodgei, and N. lineolata.

  4. Ribosomal DNA variations in Erianthus, a wild sugarcane relative (Andropogoneae-Saccharinae).

    PubMed

    Besse, P; McIntyre, C L; Berding, N

    1996-05-01

    Variation at the 18S+26S and 5S ribosomal DNA loci was assessed on 62 Erianthus Michx. clones, representing 11 species, and 15 clones from two Saccharum L. species used as a reference. Genus-specific markers for Erianthus Michx. sect. Ripidium Henrard (Old World species) were identified. Ribosomal DNA units in Erianthus sect. Ripidium exhibited an additional BamHI site compared to Saccharum, and 5S units showed length and restriction-site differences between Erianthus and Saccharum. These markers will be useful to follow introgression in Saccharum x Erianthus hybrids. Six ribosomal units (for 18+26S genes) were revealed in Erianthus sect. Ripidium, differing by restriction-site positions and/or length. These results provided new information on species relationships and evolution within the genus Erianthus. The Indonesian and Indian forms of E. arundinaceus (Retz.) Jeswiet gave different restriction patterns, which were similar to those of E. bengalense (Retz.) R. C. Bharadwaja and E. procerus (Roxb.) Raizade, respectively. The two 2n=20 species, E. ele-phantinus Hook.f. and E. ravennae (L.) P. Beauv., could also be differentiated at this locus. Two of the New World Erianthus species studied, E. rufipilus (Steud.) Griseb. and E. longisetosus Andersson, appeared more like Erianthus sect. Ripidium, whereas E. trinii Hack, and E. brevibardis Michx. showed patterns consistent with Miscanthus sinensis Andersson and S. spontaneum L., respectively. Finally, the comparison of rDNA restriction maps among Erianthus sect. Ripidium, Saccharum, sorghum and maize, led to unexpected conclusions concerning the relationships between the different genera and the position of Erianthus in the "Saccharum complex".

  5. Two sequence classes of kinetoplastid 5S ribosomal RNA gene revealed among bodonid spliced leader RNA gene arrays.

    PubMed

    Santana, D M; Lukes, J; Sturm, N R; Campbell, D A

    2001-11-13

    The spliced leader RNA genes of Bodo saltans, Cryptobia helicis and Dimastigella trypaniformis were analyzed as molecular markers for additional taxa within the suborder Bodonina. The non-transcribed spacer regions were distinctive for each organism, and 5S rRNA genes were present in Bodo and Dimastigella but not in C. helicis. Two sequence classes of 5S rRNA were evident from analysis of the bodonid genes. The two classes of 5S rRNA genes were found in other Kinetoplastids independent of co-localization with the spliced leader RNA gene.

  6. Nucleolar association and transcriptional inhibition through 5S rDNA in mammals.

    PubMed

    Fedoriw, Andrew M; Starmer, Joshua; Yee, Della; Magnuson, Terry

    2012-01-01

    Changes in the spatial positioning of genes within the mammalian nucleus have been associated with transcriptional differences and thus have been hypothesized as a mode of regulation. In particular, the localization of genes to the nuclear and nucleolar peripheries is associated with transcriptional repression. However, the mechanistic basis, including the pertinent cis- elements, for such associations remains largely unknown. Here, we provide evidence that demonstrates a 119 bp 5S rDNA can influence nucleolar association in mammals. We found that integration of transgenes with 5S rDNA significantly increases the association of the host region with the nucleolus, and their degree of association correlates strongly with repression of a linked reporter gene. We further show that this mechanism may be functional in endogenous contexts: pseudogenes derived from 5S rDNA show biased conservation of their internal transcription factor binding sites and, in some cases, are frequently associated with the nucleolus. These results demonstrate that 5S rDNA sequence can significantly contribute to the positioning of a locus and suggest a novel, endogenous mechanism for nuclear organization in mammals.

  7. Molecular organization of the 5S rDNA gene type II in elasmobranchs

    PubMed Central

    Castro, Sergio I.; Hleap, Jose S.; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    ABSTRACT The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  8. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  9. [An intriguing model for 5S rDNA sequences dispersion in the genome of freshwater stingray Potamotrygon motoro (Chondrichthyes: Potamotrygonidae)].

    PubMed

    Cruz, V P; Oliveira, C; Foresti, F

    2015-01-01

    5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion.

  10. [An intriguing model for 5S rDNA sequences dispersion in the genome of freshwater stingray Potamotrygon motoro (Chondrichthyes: Potamotrygonidae)].

    PubMed

    Cruz, V P; Oliveira, C; Foresti, F

    2015-01-01

    5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion. PMID:26107907

  11. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    PubMed

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  12. Physical mapping of 5S rDNA in two species of Knifefishes: Gymnotus pantanal and Gymnotus paraguensis (Gymnotiformes).

    PubMed

    da Silva, M; Matoso, D A; Vicari, M R; de Almeida, M C; Margarido, V P; Artoni, R F

    2011-01-01

    Physical mapping of 5S rDNA in 2 species of knifefishes, Gymnotuspantanal and G. paraguensis (Gymnotiformes), was performed using fluorescence in situ hybridization with a 5S rDNA probe. The 5S rDNA PCR product from the genomes of both species was also sequenced and aligned to determine non-transcribed spacer sequences (NTS). Both species under study had different patterns of 5S rDNA gene cluster distribution. While in the karyotype of G. pantanal two 5S rDNA-bearing pairs were observed, the karyotype of G. paraguensis possessed as many as 19 such pairs. Such multiplication of 5S rDNA gene clusters might be caused by the involvement of transposable elements because the NTS of G. paraguensis was 400 bp long with high identity (90%) with a mobile transposable element called Tc1-like transposon, described from the cyprinid fish Labeo rohita.

  13. Analysis of 5S rDNA organization and variation in polyploid hybrids from crosses of different fish subfamilies.

    PubMed

    Qin, Qinbo; He, Weiguo; Liu, Shaojun; Wang, Jing; Xiao, Jun; Liu, Yun

    2010-07-15

    In this article, sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) were conducted in red crucian carp (RCC), blunt snout bream (BSB), and their polyploid offspring. Three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) of RCC were characterized by distinct NTS types (designated NTS-I, II, and III for the 83, 220, and 357 bp monomers, respectively). In BSB, only one monomeric 5S rDNA was observed (designated class IV: 188 bp), which was characterized by one NTS type (designated NTS-IV: 68 bp). In the polyploid offspring, the tetraploid (4nRB) hybrids partially inherited 5S rDNA classes from their female parent (RCC); however, they also possessed a unique 5S rDNA sequence (designated class I-L: 203 bp) with a novel NTS sequence (designated NTS-I-L: 83 bp). The characteristic paternal 5S rDNA sequences (class IV) were not observed. The 5S rDNA of triploid (3nRB) hybrids was completely inherited from the parental species, and generally preserved the parental 5S rDNA structural organization. These results first revealed the influence of polyploidy on the organization and evolution of the multigene family of 5S rDNA of fish, and are also useful in clarifying aspects of vertebrate genome evolution.

  14. The 5S rDNA gene family in mollusks: characterization of transcriptional regulatory regions, prediction of secondary structures, and long-term evolution, with special attention to Mytilidae mussels.

    PubMed

    Vizoso, Miguel; Vierna, Joaquín; González-Tizón, Ana M; Martínez-Lage, Andrés

    2011-01-01

    Several reports on the characterization of 5S ribosomal DNA (5S rDNA) in various animal groups have been published to date, but there is a lack of studies analyzing this gene family in a much broader context. Here, we have studied 5S rDNA variation in several molluskan species, including bivalves, gastropods, and cephalopods. The degree of conservation of transcriptional regulatory regions was analyzed in these lineages, revealing a conserved TATA-like box in the upstream region. The evolution of the 120 bp coding region (5S) was also studied, suggesting the occurrence of paralogue groups in razor clams, clams, and cockles. In addition, 5S rDNA sequences from 11 species and 7 genus of Mytilidae Rafinesque, 1815 mussels were sampled and studied in detail. Four different 5S rDNA types, based on the nontranscribed spacer region were identified. The phylogenetic analyses performed within each type showed a between-species gene clustering pattern, suggesting ancestral polymorphism. Moreover, some putative pseudogenized 5S copies were also identified. Our report, together with previous studies that found high degree of intragenomic divergence in bivalve species, suggests that birth-and-death evolution may be the main force driving the evolution of 5S rDNA in these animals, even at the genus level.

  15. 16S ribosomal DNA amplification for phylogenetic study.

    PubMed

    Weisburg, W G; Barns, S M; Pelletier, D A; Lane, D J

    1991-01-01

    A set of oligonucleotide primers capable of initiating enzymatic amplification (polymerase chain reaction) on a phylogenetically and taxonomically wide range of bacteria is described along with methods for their use and examples. One pair of primers is capable of amplifying nearly full-length 16S ribosomal DNA (rDNA) from many bacterial genera; the additional primers are useful for various exceptional sequences. Methods for purification of amplified material, direct sequencing, cloning, sequencing, and transcription are outlined. An obligate intracellular parasite of bovine erythrocytes, Anaplasma marginale, is used as an example; its 16S rDNA was amplified, cloned, sequenced, and phylogenetically placed. Anaplasmas are related to the genera Rickettsia and Ehrlichia. In addition, 16S rDNAs from several species were readily amplified from material found in lyophilized ampoules from the American Type Culture Collection. By use of this method, the phylogenetic study of extremely fastidious or highly pathogenic bacterial species can be carried out without the need to culture them. In theory, any gene segment for which polymerase chain reaction primer design is possible can be derived from a readily obtainable lyophilized bacterial culture.

  16. Ribosomal DNA nanoprobes studied by Fourier transform infrared spectroscopy.

    PubMed

    Fagundes, Jaciara; Castilho, Maiara L; Téllez Soto, Claudio A; Vieira, Laís de Souza; Canevari, Renata A; Fávero, Priscila P; Martin, Airton A; Raniero, Leandro

    2014-01-24

    Paracoccidioides brasiliensis (P. brasiliensis) is a thermo-dimorphic fungus that causes paracoccidioidomycosis. Brazil epidemiological data shows that endemic areas are the subtropical regions, especially where agricultural activities predominate such as the Southeast, South, and Midwest. There are several tests to diagnose paracoccidioidomycosis, but they have many limitations such as low sensitivity, high cost, and a cross-reacting problem. In this work, gold nanoprobes were used to identify P. brasiliensis as an alternative diagnostic technique, which is easier to apply, costs less, and has great potential for application. The specific Ribosomal sequence of P. brasiliensis DNA was amplified and used to design the nanoprobes using a thiol-modified oligonucleotide. The results of positive and negative tests were done by UV-visible and Fourier Transform Infrared (FT-IR) measurements. The deconvolution of FT-IR sample spectra showed differences in the vibrational modes from the hydrogen bridge NHN and NHO bands that form the double helix DNA for samples matching the DNA sequence of nanoprobes that could be used to classify the samples.

  17. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    PubMed

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  18. Chromosomal localization of 5S rDNA in Chinese shrimp ( Fenneropenaeus chinensis): a chromosome-specific marker for chromosome identification

    NASA Astrophysics Data System (ADS)

    Huan, Pin; Zhang, Xiaojun; Li, Fuhua; Zhao, Cui; Zhang, Chengsong; Xiang, Jianhai

    2010-03-01

    Chinese shrimp ( Fenneropenaeus chinensis) is an economically important aquaculture species in China. However, cytogenetic and genomic data is limited in the organism partly because the chromosomes are difficult to isolate and analyze. In this study, fluorescence in-situ hybridization (FISH) was used to identify the chromosomes of F. chinensis. The 5S ribosomal RNA gene (rDNA) of F. chinensis was isolated, cloned and then used as a hybridization probe. The results show that the 5S rDNA was located on one pair of homologous chromosomes in F. chinensis. In addition, triploid shrimp were used to evaluate the feasibility of chromosome identification using FISH and to validate the method. It was confirmed that 5S rDNA can be used as a chromosome-specific probe for chromosome identification in F. chinensis. The successful application of FISH in F. chinensis shows that chromosome-specific probes can be developed and this finding will facilitate further research on the chromosomes of penaeid shrimps.

  19. Functional analysis of transcribed spacers of yeast ribosomal DNA.

    PubMed Central

    Musters, W; Boon, K; van der Sande, C A; van Heerikhuizen, H; Planta, R J

    1990-01-01

    Making use of an rDNA unit, containing oligonucleotide tags in both the 17S and 26S rRNA gene, we have analyzed the effect of various deletions in the External Transcribed Spacer (ETS) and in one of the Internal Transcribed Spacers 1 (ITS1) on the process of ribosome formation in yeast. By following the fate of the tagged transcripts of this rDNA unit in vivo by Northern hybridization we found that deleting various parts of the ETS prevents the accumulation of tagged 17S rRNA and its assembly into 40S subunits, but not the formation of 60S subunits. Deleting the central region of ITS1, including a processing site that is used in an early stage of the maturation process, was also found to prevent the accumulation of functional 49 S subunits, whereas no effect on the formation of 60S subunits was detected. The implications of these findings for yeast pre-rRNA processing are discussed. Images Fig. 3. Fig. 4. Fig. 6. Fig. 7. PMID:2249660

  20. Heterochromatin patterns and ribosomal DNA loci distribution in diploid and polyploid Crotalaria species (Leguminosae, Papilionoideae), and inferences on karyotype evolution.

    PubMed

    Mondin, Mateus; Aguiar-Perecin, Margarida L R

    2011-09-01

    Most Crotalaria species display a symmetric karyotype with 2n = 16, but 2n = 14 is found in Chrysocalycinae subsection Incanae and 2n = 32 in American species of the section Calycinae. Seven species of the sections Chrysocalycinae, Calycinae, and Crotalaria were analyzed for the identification of heterochromatin types with GC- and AT-specific fluorochromes and chromosomal location of ribosomal DNA loci using fluorescent in situ hybridization (FISH). A major 45S rDNA locus was observed on chromosome 1 in all the species, and a variable number of minor ones were revealed. Only one 5S rDNA locus was observed in the species investigated. Chromomycin A(3) (CMA) revealed CMA(+) bands colocalized with most rDNA loci, small bands unrelated to ribosomal DNA on two chromosome pairs in Crotalaria incana, and CMA(+) centromeric bands that were quenched by distamycin A were detected in species of Calycinae and Crotalaria sections. DAPI(+) bands were detected in C. incana. The results support the species relationships based on flower specialization and were useful for providing insight into mechanisms of karyotype evolution. The heterochromatin types revealed by fluorochromes suggest the occurrence of rearrangements in repetitive DNA families in these heterochromatic blocks during species diversification. This DNA sequence turnover and the variability in number/position of rDNA sites could be interpreted as resulting from unequal crossing over and (or) transposition events. The occurrence of only one 5S rDNA locus and the smaller chromosome size in the polyploids suggest that DNA sequence losses took place following polyploidization events.

  1. Heterochromatin patterns and ribosomal DNA loci distribution in diploid and polyploid Crotalaria species (Leguminosae, Papilionoideae), and inferences on karyotype evolution.

    PubMed

    Mondin, Mateus; Aguiar-Perecin, Margarida L R

    2011-09-01

    Most Crotalaria species display a symmetric karyotype with 2n = 16, but 2n = 14 is found in Chrysocalycinae subsection Incanae and 2n = 32 in American species of the section Calycinae. Seven species of the sections Chrysocalycinae, Calycinae, and Crotalaria were analyzed for the identification of heterochromatin types with GC- and AT-specific fluorochromes and chromosomal location of ribosomal DNA loci using fluorescent in situ hybridization (FISH). A major 45S rDNA locus was observed on chromosome 1 in all the species, and a variable number of minor ones were revealed. Only one 5S rDNA locus was observed in the species investigated. Chromomycin A(3) (CMA) revealed CMA(+) bands colocalized with most rDNA loci, small bands unrelated to ribosomal DNA on two chromosome pairs in Crotalaria incana, and CMA(+) centromeric bands that were quenched by distamycin A were detected in species of Calycinae and Crotalaria sections. DAPI(+) bands were detected in C. incana. The results support the species relationships based on flower specialization and were useful for providing insight into mechanisms of karyotype evolution. The heterochromatin types revealed by fluorochromes suggest the occurrence of rearrangements in repetitive DNA families in these heterochromatic blocks during species diversification. This DNA sequence turnover and the variability in number/position of rDNA sites could be interpreted as resulting from unequal crossing over and (or) transposition events. The occurrence of only one 5S rDNA locus and the smaller chromosome size in the polyploids suggest that DNA sequence losses took place following polyploidization events. PMID:21864195

  2. Interaction of ribosomal proteins S5, S6, S11, S12, S18 and S21 with 16 S rRNA.

    PubMed

    Stern, S; Powers, T; Changchien, L M; Noller, H F

    1988-06-20

    We have examined the effects of assembly of ribosomal proteins S5, S6, S11, S12, S18 and S21 on the reactivities of residues in 16 S rRNA towards chemical probes. The results show that S6, S18 and S11 interact with the 690-720 and 790 loop regions of 16 S rRNA in a highly co-operative manner, that is consistent with the previously defined assembly map relationships among these proteins. The results also indicate that these proteins, one of which (S18) has previously been implicated as a component of the ribosomal P-site, interact with residues near some of the recently defined P-site (class II tRNA protection) nucleotides in 16 S rRNA. In addition, assembly of protein S12 has been found to result in the protection of residues in both the 530 stem/loop and the 900 stem regions; the latter group is closely juxtaposed to a segment of 16 S rRNA recently shown to be protected from chemical probes by streptomycin. Interestingly, both S5 and S12 appear to protect, to differing degrees, a well-defined set of residues in the 900 stem/loop and 5'-terminal regions. These observations are discussed in terms of the effects of S5 and S12 on streptomycin binding, and in terms of the class III tRNA protection found in the 900 stem of 16 S rRNA. Altogether these results show that many of the small subunit proteins, which have previously been shown to be functionally important, appear to be associated with functionally implicated segments of 16 S rRNA.

  3. Phylogenetic relationships among diploid Aegilops species inferred from 5S rDNA units.

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2009-10-01

    Relationships among the currently recognized 11 diploid species within the genus Aegilops have been investigated. Sequence similarity analysis, based upon 363 sequenced 5S rDNA clones from 44 accessions plus 15 sequences retrieved from GenBank, depicted two unit classes labeled the long AE1 and short AE1. Several different analytical methods were applied to infer relationships within haplomes, between haplomes and among the species, including maximum parsimony and maximum likelihood analyses of consensus sequences, "total evidence" phylogeny analysis and "matrix representation with parsimony" analysis. None were able to depict suites of markers or unit classes that could discern among the seven haplomes as is observed among established haplomes in other genera within the tribe Triticeae; however, most species could be separated when displayed on gene trees. These results suggest that the haplomes currently recognized are so refined that they may be relegated as sub-haplomes or haplome variants. Amblyopyrum shares the same 5S rDNA unit classes with the diploid Aegilops species suggesting that it belongs within the latter. Comparisons of the Aegilops sequences with those of Triticum showed that the long AE1 unit class of Ae. tauschii shared the clade with the equivalent long D1 unit class, i.e., the putative D haplome donor, but the short AE1 unit class did not. The long AE1 unit class but not the short, of Ae. speltoides and Ae. searsii both share the clade with the previously identified long {S1 and long G1 unit classes meaning that both Aegilops species can be equally considered putative B haplome donors to tetraploid Triticum species. The semiconserved nature of the nontranscribed spacer in Aegilops and in Triticeae in general is discussed in view that it may have originated by processes of incomplete gene conversion or biased gene conversion or birth-and-death evolution.

  4. Genetic variants of ribosomal DNA and mitochondrial DNA between swamp and river buffaloes.

    PubMed

    Amano, T; Miyakoshi, Y; Takada, T; Kikkawa, Y; Suzuki, H

    1994-06-01

    To clarify the genetic relationship between Swamp and River buffaloes, the restriction fragment length polymorphisms (RFLPs) of nuclear genomic ribosomal DNA (rDNA) and cytoplasmic mitochondrial DNA (mtDNA) were analysed. Blood or liver samples from 73 Swamp and three River buffaloes were collected in East and South-east Asian countries. DNA samples from cattle, goats and sheep were used for comparisons. The analysis of rDNA allowed water buffaloes, cattle, goats and sheep to be characterized by four distinct repeat-types. However, swamp and river buffaloes showed the same repeat-type. Divergence of water buffalo and cattle is considered to have occurred approximately four to six million years ago. The RFLPs for mtDNA divided water buffaloes into three haplotypes, swamp-1, swamp-2 and river types. Swamp-1 accounted for 91% of all swamp buffaloes while swamp-2 was observed only in water buffaloes from Thailand (9%). All river buffaloes were of the same haplotype. No differences were observed between swamp and river buffaloes at the rDNA level. In contrast, a few distinct differences between them were found at the mtDNA level. Therefore, mtDNA polymorphisms provide an adequate means for classifying water buffaloes into either swamp or river buffaloes.

  5. Different conformations of ribosomal DNA in active and inactive chromatin in Xenopus laevis.

    PubMed

    Spadafora, C; Riccardi, P

    1985-12-20

    The chromatin structure of the ribosomal DNA in Xenopus laevis was studied by micrococcal nuclease digestions of blood, liver and embryonic cell nuclei. We have found that BglI-restricted DNA from micrococcal nuclease-digested blood cell nuclei has an increased electrophoretic mobility compared to the undigested control. Micrococcal nuclease digestion of liver cell nuclei causes a very slight shift in mobility, only in the region of the spacer containing the "Bam Islands". In contrast, the mobility of ribosomal DNA in chromatin of embryonic cells, under identical digestion conditions, remains unaffected by the nuclease activity. Denaturing gels or ligase action on the nuclease-treated DNA abolishes the differences in the electrophoretic mobility. Ionic strength and ethidium bromide influence the relative electrophoretic migration of the two DNA fragment populations, suggesting that secondary structure may play an important role in the observed phenomena. In addition, restriction analysis under native electrophoretic conditions of DNA prepared from blood, liver and embryonic cells shows that blood cell DNA restriction fragments always have a faster mobility than the corresponding fragments of liver and embryo cell DNA. We therefore propose that nicking activity by micrococcal nuclease modifies the electrophoretic mobility of an unusual DNA conformation, present in blood cell, and to a lesser extent, in liver cell ribosomal chromatin. A possible function for these structures is discussed. The differences of the ribosomal chromatin structures in adult and embryonic tissues may reflect the potential of the genes to be expressed.

  6. Chromosomal diversification in ribosomal DNA sites in Ancistrus Kner, 1854 (Loricariidae, Ancistrini) from three hydrographic basins of Mato Grosso, Brazil.

    PubMed

    Mariotto, Sandra; Centofante, Liano; Vicari, Marcelo Ricardo; Artoni, Roberto Ferreira; Moreira-Filho, Orlando

    2011-01-01

    Populations of seven Ancistrus species were analyzed from streams and rivers of three hydrographic Brazilian basins. All populations showed different diploid numbers (2n), fundamental numbers (FNs), and karyotypes. Some representatives of Loricariidae have 2n = 54 chromosomes, which is very likely an ancestral cytotaxonomic characteristic, but many other representatives show extensive karyotype diversification. In the Ancistrus species studied, extensive karyotypic differentiation, which is generally associated with chromosome number reduction and rearrangement of the ribosomal RNA gene (rDNA) sites, was verified. Chromosomal locations of 18S and 5S rDNA were jointly detected using fluorescence in situ hybridization (FISH). In all the Ancistrus species analyzed, 18S rDNA sites were detected only on one chromosome pair, though this differed among species. 5S rDNA was located on 1-3 chromosome pairs either separately or in synteny with 18S rDNA in four of the seven species/populations. Hence the karyotype differentiation in Ancistrus species could be associated with a morphological speciation process, suggesting that chromosome fusions, inversions, deletions, duplications, and heterochromatination could contribute to the karyotype evolution of these neotropical armored catfishes. PMID:24260636

  7. Contrasting patterns of evolution of 45S and 5S rDNA families uncover new aspects in the genome constitution of the agronomically important grass Thinopyrum intermedium (Triticeae).

    PubMed

    Mahelka, Václav; Kopecky, David; Baum, Bernard R

    2013-09-01

    We employed sequencing of clones and in situ hybridization (genomic and fluorescent in situ hybridization [GISH and rDNA-FISH]) to characterize both the sequence variation and genomic organization of 45S (herein ITS1-5.8S-ITS2 region) and 5S (5S gene + nontranscribed spacer) ribosomal DNA (rDNA) families in the allohexaploid grass Thinopyrum intermedium. Both rDNA families are organized within several rDNA loci within all three subgenomes of the allohexaploid species. Both families have undergone different patterns of evolution. The 45S rDNA family has evolved in a concerted manner: internal transcribed spacer (ITS) sequences residing within the arrays of two subgenomes out of three got homogenized toward one major ribotype, whereas the third subgenome contained a minor proportion of distinct unhomogenized copies. Homogenization mechanisms such as unequal crossover and/or gene conversion were coupled with the loss of certain 45S rDNA loci. Unlike in the 45S family, the data suggest that neither interlocus homogenization among homeologous chromosomes nor locus loss occurred in 5S rDNA. Consistently with other Triticeae, the 5S rDNA family in intermediate wheatgrass comprised two distinct array types-the long- and short-spacer unit classes. Within the long and short units, we distinguished five and three different types, respectively, likely representing homeologous unit classes donated by putative parental species. Although the major ITS ribotype corresponds in our phylogenetic analysis to the E-genome species, the minor ribotype corresponds to Dasypyrum. 5S sequences suggested the contributions from Pseudoroegneria, Dasypyrum, and Aegilops. The contribution from Aegilops to the intermediate wheatgrass' genome is a new finding with implications in wheat improvement. We discuss rDNA evolution and potential origin of intermediate wheatgrass.

  8. Contrasting patterns of evolution of 45S and 5S rDNA families uncover new aspects in the genome constitution of the agronomically important grass Thinopyrum intermedium (Triticeae).

    PubMed

    Mahelka, Václav; Kopecky, David; Baum, Bernard R

    2013-09-01

    We employed sequencing of clones and in situ hybridization (genomic and fluorescent in situ hybridization [GISH and rDNA-FISH]) to characterize both the sequence variation and genomic organization of 45S (herein ITS1-5.8S-ITS2 region) and 5S (5S gene + nontranscribed spacer) ribosomal DNA (rDNA) families in the allohexaploid grass Thinopyrum intermedium. Both rDNA families are organized within several rDNA loci within all three subgenomes of the allohexaploid species. Both families have undergone different patterns of evolution. The 45S rDNA family has evolved in a concerted manner: internal transcribed spacer (ITS) sequences residing within the arrays of two subgenomes out of three got homogenized toward one major ribotype, whereas the third subgenome contained a minor proportion of distinct unhomogenized copies. Homogenization mechanisms such as unequal crossover and/or gene conversion were coupled with the loss of certain 45S rDNA loci. Unlike in the 45S family, the data suggest that neither interlocus homogenization among homeologous chromosomes nor locus loss occurred in 5S rDNA. Consistently with other Triticeae, the 5S rDNA family in intermediate wheatgrass comprised two distinct array types-the long- and short-spacer unit classes. Within the long and short units, we distinguished five and three different types, respectively, likely representing homeologous unit classes donated by putative parental species. Although the major ITS ribotype corresponds in our phylogenetic analysis to the E-genome species, the minor ribotype corresponds to Dasypyrum. 5S sequences suggested the contributions from Pseudoroegneria, Dasypyrum, and Aegilops. The contribution from Aegilops to the intermediate wheatgrass' genome is a new finding with implications in wheat improvement. We discuss rDNA evolution and potential origin of intermediate wheatgrass. PMID:23741054

  9. Chromosomal localization of rDNA genes and genomic organization of 5S rDNA in Oreochromis mossambicus, O. urolepis hornorum and their hybrid.

    PubMed

    Zhu, Hua Ping; Lu, Mai Xin; Gao, Feng Ying; Huang, Zhang Han; Yang, Li Ping; Gui, Jian Fang

    2010-08-01

    In this study, classical and molecular cytogenetic analyses were performed in tilapia fishes, Oreochromis mossambicus (XX/XY sex determination system), O. urolepis hornorum (WZ/ZZ sex determination system) and their hybrid by crossing O. mossambicus female x O. u. hornorum male. An identical karyotype ((2n = 44, NF (total number of chromosomal arms) = 50) was obtained from three examined tilapia samples. Genomic organization analysis of 5S rDNA revealed two different types of 5S rDNA sequences, 5S type I and 5S type II. Moreover, fluorescence in situ hybridization (FISH) with 5S rDNA probes showed six positive fluorescence signals on six chromosomes of all the analysed metaphases from the three tilapia samples. Subsequently, 45S rDNA probes were also prepared, and six positive fluorescence signals were observed on three chromosome pairs in all analysed metaphases of the three tilapia samples. The correlation between 45 rDNA localization and nucleolar organizer regions (NORs) was confirmed by silver nitrate staining in tilapia fishes. Further, different chromosomal localizations of 5S rDNA and 45S rDNA were verified by two different colour FISH probes. Briefly, the current data provide an insights for hybridization projects and breeding improvement of tilapias.

  10. Primary structure of the 5 S subunit of transcarboxylase as deduced from the genomic DNA sequence.

    PubMed

    Thornton, C G; Kumar, G K; Shenoy, B C; Haase, F C; Phillips, N F; Park, V M; Magner, W J; Hejlik, D P; Wood, H G; Samols, D

    1993-09-13

    Transcarboxylase from Propionibacterium shermanii is a complex biotin-containing enzyme composed of 30 polypeptides of three different types. It is composed of six dimeric outer subunits associated with a central cylindrical hexameric subunit through 12 biotinyl subunits; three outer subunits on each face of the central hexamer. Each outer dimer is termed a 5 S subunit which associates with two biotinyl subunits. The enzyme catalyzes a two-step reaction in which methylmalonyl-CoA and pyruvate form propionyl-CoA and oxalacetate, the 5 S subunit specifically catalyzing one of these reactions. We report here the cloning, sequencing and expression of the monomer of the 5 S subunit. The gene was identified by matching amino acid sequences derived from isolated authentic 5 S peptides with the deduced sequence of an open reading frame present on a cloned P. shermanii genomic fragment known to contain the gene encoding the 1.3 S biotinyl subunit. The cloned 5 S gene encodes a protein of 519 amino acids, M(r) 57,793. The deduced sequence shows regions of extensive homology with that of pyruvate carboxylase and oxalacetate decarboxylase, two enzymes which catalyze the same or reverse reaction. A fragment was subcloned into pUC19 in an orientation such that the 5 S open reading frame could be expressed from the lac promoter of the vector. Crude extracts prepared from these cells contained an immunoreactive band on Western blots which co-migrated with authentic 5 S and were fully active in catalyzing the 5 S partial reaction. We conclude that we have cloned, sequenced and expressed the monomer of the 5 S subunit and that the expressed product is catalytically active. PMID:8365490

  11. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus. PMID:26959315

  12. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  13. Evolutionary dynamics of 5S rDNA location in acridid grasshoppers and its relationship with H3 histone gene and 45S rDNA location.

    PubMed

    Cabral-de-Mello, Diogo C; Cabrero, Josefa; López-León, María Dolores; Camacho, Juan Pedro M

    2011-07-01

    We analyze the chromosomal location of 5S rDNA clusters in 29 species of grasshoppers belonging to the family Acrididae. There was extensive variation among species for the number and location of 5S rDNA sites. Out of 148 sites detected, 75% were proximally located, 21.6% were interstitial, and only 3.4% were distal. The number of 5S rDNA sites per species varied from a single chromosome pair (in six species) to all chromosome pairs (in five species), with a range of intermediate situations. Thirteen chromosomes from eight species carried two 5S rDNA clusters. At intraspecific level, differences among populations were detected in Eyprepocnemis plorans, and some heteromorphisms have also been observed in some species. Double FISH for 5S rDNA and H3 histone gene DNA, performed on 17 of these 29 species, revealed that both markers are sometimes placed in a same chromosome but at different location, whereas they appeared to co-localize in five species (Calliptamus barbarus, Heteracris adpersa, Aiolopus strepens, Oedipoda charpentieri and O. coerulescens). Double fiber-FISH in A. strepens and O. coerulescens showed that the two DNAs are closely interspersed with variable relative amounts of both classes of DNA. Finally, no correlation was observed between the number of 5S and 45S rDNA clusters in 23 species where this information was available. These results are discussed in the light of possible mechanisms of spread that led to the extensive variation in the number of clusters observed for both rDNA types in acridid grasshoppers.

  14. Evolutionary site-number changes of ribosomal DNA loci during speciation: complex scenarios of ancestral and more recent polyploid events

    PubMed Central

    Rosato, Marcela; Moreno-Saiz, Juan C.; Galián, José A.; Rosselló, Josep A.

    2015-01-01

    Several genome duplications have been identified in the evolution of seed plants, providing unique systems for studying karyological processes promoting diversification and speciation. Knowledge about the number of ribosomal DNA (rDNA) loci, together with their chromosomal distribution and structure, provides clues about organismal and molecular evolution at various phylogenetic levels. In this work, we aim to elucidate the evolutionary dynamics of karyological and rDNA site-number variation in all known taxa of subtribe Vellinae, showing a complex scenario of ancestral and more recent polyploid events. Specifically, we aim to infer the ancestral chromosome numbers and patterns of chromosome number variation, assess patterns of variation of both 45S and 5S rDNA families, trends in site-number change of rDNA loci within homoploid and polyploid series, and reconstruct the evolutionary history of rDNA site number using a phylogenetic hypothesis as a framework. The best-fitting model of chromosome number evolution with a high likelihood score suggests that the Vellinae core showing x = 17 chromosomes arose by duplication events from a recent x = 8 ancestor. Our survey suggests more complex patterns of polyploid evolution than previously noted for Vellinae. High polyploidization events (6x, 8x) arose independently in the basal clade Vella castrilensis–V. lucentina, where extant diploid species are unknown. Reconstruction of ancestral rDNA states in Vellinae supports the inference that the ancestral number of loci in the subtribe was two for each multigene family, suggesting that an overall tendency towards a net loss of 5S rDNA loci occurred during the splitting of Vellinae ancestors from the remaining Brassiceae lineages. A contrasting pattern for rDNA site change in both paleopolyploid and neopolyploid species was linked to diversification of Vellinae lineages. This suggests dynamic and independent changes in rDNA site number during speciation processes and a

  15. Ribosomal and Mitochondrial DNA Analyses of Xiphinema americanum-Group Populations.

    PubMed

    Lazarova, Stela S; Malloch, Gaynor; Oliveira, Claudio M G; Hübschen, Judith; Neilson, Roy

    2006-12-01

    The 18S ribosomal DNA (rDNA) and cytochrome oxidase I region of mitochondrial DNA (mtDNA) were sequenced for 24 Xiphinema americanum-group populations sourced from a number of geographically disparate locations. Sequences were subjected to phylogenetic analysis and compared. 18S rDNA strongly suggested that only X. pachtaicum, X. simile (two populations) and a X. americanum s.l. population from Portugal were different from the other 20 populations studied, whereas mtDNA indicated some heterogeneity between populations. Phylogenetically, based on mtDNA, an apparent dichotomy existed amongst X. americanum-group populations from North America and those from Asia, South America and Oceania. Analyses of 18S rDNA and mtDNA sequences underpin the classical taxonomic issues of the X. americanum-group and cast doubt on the degree of speciation within the X. americanum-group.

  16. Ribosomal and Mitochondrial DNA Analyses of Xiphinema americanum-Group Populations

    PubMed Central

    Lazarova, Stela S.; Malloch, Gaynor; Oliveira, Claudio M.G.; Hübschen, Judith; Neilson, Roy

    2006-01-01

    The 18S ribosomal DNA (rDNA) and cytochrome oxidase I region of mitochondrial DNA (mtDNA) were sequenced for 24 Xiphinema americanum-group populations sourced from a number of geographically disparate locations. Sequences were subjected to phylogenetic analysis and compared. 18S rDNA strongly suggested that only X. pachtaicum, X. simile (two populations) and a X. americanum s.l. population from Portugal were different from the other 20 populations studied, whereas mtDNA indicated some heterogeneity between populations. Phylogenetically, based on mtDNA, an apparent dichotomy existed amongst X. americanum-group populations from North America and those from Asia, South America and Oceania. Analyses of 18S rDNA and mtDNA sequences underpin the classical taxonomic issues of the X. americanum-group and cast doubt on the degree of speciation within the X. americanum-group. PMID:19259456

  17. cis-acting components in the replication origin from ribosomal DNA of Saccharomyces cerevisiae.

    PubMed Central

    Miller, C A; Kowalski, D

    1993-01-01

    The ribosomal DNA (rDNA) repeats of Saccharomyces cerevisiae contain an autonomously replicating sequence (ARS) that colocalizes with a chromosomal origin of replication. We show that a minimal sequence necessary for full ARS function corresponds to a 107-bp rDNA fragment which contains three 10-of-11-bp matches to the ARS consensus sequence. Point mutations in only one of the 10-of-11-bp matches, GTTTAT GTTTT, inactivate the rDNA ARS, indicating that this consensus sequence is essential. A perfect match to a revised ARS consensus is present but not essential. Sequences up to 9 bp 5' from the essential consensus are dispensable. A broad DNA region directly 3' to the essential consensus is required and is easily unwound as indicated by: (i) hypersensitivity to nicking of an approximately 100-bp region by mung bean nuclease in a negatively supercoiled plasmid and (ii) helical instability determined by thermodynamic analysis of the nucleotide sequence. A correlation between DNA helical instability and replication efficiency of wild-type and mutated ribosomal ARS derivatives suggests that a broad region 3' to the essential ARS consensus functions as a DNA unwinding element. Certain point mutations that do not stabilize the DNA helix in the 3' region but reduce ARS efficiency reveal an element distinct from, but overlapping, the DNA unwinding element. The nucleotide sequence of the functionally important constituents in the ARS appears to be conserved among the rDNA repeats in the chromosome. Images PMID:8355687

  18. Computational and Experimental Characterization of Ribosomal DNA and RNA G-Quadruplexes

    NASA Astrophysics Data System (ADS)

    Cho, Samuel

    DNA G-quadruplexes in human telomeres and gene promoters are being extensively studied for their role in controlling the growth of cancer cells. Recent studies strongly suggest that guanine (G)-rich genes encoding pre-ribosomal RNA (pre-rRNA) are a potential anticancer target through the inhibition of RNA polymerase I (Pol I) in ribosome biogenesis. However, the structures of ribosomal G-quadruplexes at atomic resolution are unknown, and very little biophysical characterization has been performed on them to date. Here, we have modeled two putative rDNA G-quadruplex structures, NUC 19P and NUC 23P, which we observe via circular dichroism (CD) spectroscopy to adopt a predominantly parallel topology, and their counterpart rRNA. To validate and refine the putative ribosomal G-quadruplex structures, we performed all-atom molecular dynamics (MD) simulations using the CHARMM36 force field in the presence and absence of stabilizing K + or Na + ions. We optimized the CHARMM36 force field K + parameters to be more consistent with quantum mechanical calculations (and the polarizable Drude model force field) so that the K + ion is predominantly in the G-quadruplex channel. Our MD simulations show that the rDNA G-quadruplex have more well-defined, predominantly parallel-topology structures than rRNA and NUC 19P is more structured than NUC 23P, which features extended loops. Our study demonstrates that they are both potential targets for the design of novel chemotherapeutics.

  19. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  20. Implication of mammalian ribosomal protein S3 in the processing of DNA damage.

    PubMed

    Kim, J; Chubatsu, L S; Admon, A; Stahl, J; Fellous, R; Linn, S

    1995-06-01

    A human apurinic/apyrimidinic endonuclease activity, called AP endonuclease I, is missing from or altered specifically in cells cultured from Xeroderma pigmentosum group-D individuals (XP-D cells) (Kuhnlein, U., Lee, B., Penhoet, E. E., and Linn, S. (1978) Nucleic Acids Res. 5,951-960). We have now observed that another nuclease activity, UV endonuclease III, is similarly not detected in XP-D cells and is inseparable from the AP endonuclease I activity. This activity preferentially cleaves the phosphodiester backbone of heavily ultraviolet-irradiated DNA at unknown lesions as well as at one of the phosphodiester bonds within a cyclobutane pyrimidine dimer. The nuclease activities have been purified from mouse cells to yield a peptide of M(r) = 32,000, whose sequence indicates identity with ribosomal protein S3. The nuclease activities all cross-react with immunopurified antibody directed against authentic rat ribosomal protein S3, and, upon expression in Escherichia coli of a cloned rat cDNA for ribosomal protein S3, each of the activities was recovered and was indistinguishable from those of the mammalian UV endonuclease III. Moreover, the protein expressed in E. coli and its activities cross-react with the rat protein antibody. Ribosomal protein S3 contains a potential nuclear localization signal, and the protein isolated as a nuclease also has a glycosylation pattern consistent with a nuclear localization as determined by lectin binding. The unexpected role of a ribosomal protein in DNA damage processing and the unexplained inability to detect the nuclease activities in extracts from XP-D cells are discussed. PMID:7775413

  1. Phylogenetic relationships in Nuphar (Nymphaeaceae): evidence from morphology, chloroplast DNA, and nuclear ribosomal DNA.

    PubMed

    Padgett, D J; Les, D H; Crow, G E

    1999-09-01

    The genus Nuphar consists of yellow-flowered waterlilies and is widely distributed in north-temperate bodies of water. Despite regular taxonomic evaluation of these plants, no explicit phylogenetic hypotheses have been proposed for the genus. We investigated phylogenetic relationships in Nuphar using morphology and sequences of the chloroplast gene matK and of the internal transcribed spacer (ITS) regions of nuclear ribosomal DNA. Two major lineages within Nuphar are consistently resolved with the morphological and molecular data sets. One lineage comprises New World taxa and the other represents a primarily Old World lineage. Relationships within the major lineages were poorly resolved by morphology and ITS, yet certain relationships were elucidated by all analyses. Most notable is the strong support for a monophyletic lineage of dwarf taxa and the alliance of the North American N. microphylla with the Eurasian taxa. Minor discordance between the independent cladograms is accounted for by hybridization. The common taxonomic practice of uniting all North American and Eurasian taxa under one species is not supported phylogenetically.

  2. Karyotypic Variability in Ribosomal DNA Subchromosome Size among Colpodid Ciliates, a Possible Tool To Differentiate Colpodid Species

    PubMed Central

    Martin, A.; Palacios, G.; Olmo, A.; Martin-Gonzalez, A.; Ruiz-Perez, L. M.; Gutierrez, J. C.

    1997-01-01

    Pulsed-field gel electrophoresis has been applied to analyze the karyotypic variability among colpodid ciliates. The 18S ribosomal gene was found at different locations in the electrophoretic pattern, and these size variations in the ribosomal DNA subchromosomal molecule seem to be species specific. This could potentially be a useful new tool with which to differentiate colpodid ciliates. PMID:16535582

  3. Amplification of bacterial 16S ribosomal DNA with polymerase chain reaction.

    PubMed

    Wilson, K H; Blitchington, R B; Greene, R C

    1990-09-01

    The sequence of small-subunit rRNA varies in an orderly manner across phylogenetic lines and contains segments that are conserved at the species, genus, or kingdom level. By directing oligonucleotide primers at sequences conserved throughout the eubacterial kingdom, we amplified bacterial 16S ribosomal DNA sequences with the polymerase chain reaction. Priming sites were located at the extreme 5' end, the extreme 3' end, and the center of 16S ribosomal DNA. The isolates tested with these primers included members of the genera Staphylococcus, Coxiella, Rickettsia, Clostridium, Neisseria, Mycobacterium, Bilophila, Eubacterium, Fusobacterium, and Lactobacillus and the family Enterobacteriaceae. Initially, the yields from the reactions were erratic because the primers were self-complementary at the 3' ends. Revised primers that were not self-complementary gave more reproducible results. With the latter primers, 0.4 pg of Escherichia coli DNA consistently gave a visible band after amplification. This method should be useful for increasing the amounts of bacterial 16S ribosomal DNA sequences for the purposes of sequencing and probing. It should have a broad range of applications, including the detection and identification of known pathogens that are difficult to culture. This approach may make it possible to identify new, nonculturable bacterial pathogens.

  4. Ribosomal protein genes are overexpressed in colorectal cancer: isolation of a cDNA clone encoding the human S3 ribosomal protein.

    PubMed

    Pogue-Geile, K; Geiser, J R; Shu, M; Miller, C; Wool, I G; Meisler, A I; Pipas, J M

    1991-08-01

    We have isolated a cDNA clone encoding the human S3 ribosomal protein from a normal human colon cDNA library. The clone was identified as one of many that detected genes whose level of expression was increased in adenocarcinoma of the colon relative to normal colonic mucosa. Increased levels of the S3 transcript were present in the tumors of all eight patients examined. Moreover, the S3 mRNA was also more abundant in 7 of 10 adenomatous polyps, the presumed precursor of carcinoma. Additional studies demonstrated that increased levels of mRNAs encoding several other ribosomal proteins, including S6, S8, S12, L5, and P0, were present in colorectal tumors and polyps. These results suggest that there is increased synthesis of ribosomes in colorectal tumors and that this increase is an early event in colon neoplasia.

  5. Non-Random Distribution of 5S rDNA Sites and Its Association with 45S rDNA in Plant Chromosomes.

    PubMed

    Roa, Fernando; Guerra, Marcelo

    2015-01-01

    5S and 45S rDNA sites are the best mapped chromosome regions in eukaryotic chromosomes. In this work, a database was built gathering information about the position and number of 5S rDNA sites in 784 plant species, aiming to identify patterns of distribution along the chromosomes and its correlation with the position of 45S rDNA sites. Data revealed that in most karyotypes (54.5%, including polyploids) two 5S rDNA sites (a single pair) are present, with 58.7% of all sites occurring in the short arm, mainly in the proximal region. In karyotypes of angiosperms with only 1 pair of sites (single sites) they are mostly found in the proximal region (52.0%), whereas in karyotypes with multiple sites the location varies according to the average chromosome size. Karyotypes with multiple sites and small chromosomes (<3 µm) often display proximal sites, while medium-sized (between 3 and 6 µm) and large chromosomes (>6 µm) more commonly show terminal or interstitial sites. In species with holokinetic chromosomes, the modal value of sites per karyotype was also 2, but they were found mainly in a terminal position. Adjacent 5S and 45S rDNA sites were often found in the short arm, reflecting the preferential distribution of both sites in this arm. The high frequency of genera with at least 1 species with adjacent 5S and 45S sites reveals that this association appeared several times during angiosperm evolution, but it has been maintained only rarely as the dominant array in plant genera.

  6. Differentiation of Mycoplasma Species by 16S Ribosomal DNA PCR and Denaturing Gradient Gel Electrophoresis Fingerprinting

    PubMed Central

    McAuliffe, Laura; Ellis, Richard J.; Ayling, Roger D.; Nicholas, Robin A. J.

    2003-01-01

    Denaturing gradient gel electrophoresis (DGGE) of a 16S ribosomal DNA PCR product was used to differentiate 32 mycoplasma species of veterinary significance. Twenty-seven (85%) species could be differentiated by DGGE. This method could enable the rapid identification of many mycoplasma species for which there is no specific PCR available and which are currently identified by using culture and serological tests. PMID:14532239

  7. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    PubMed Central

    Schoch, Conrad L.; Seifert, Keith A.; Huhndorf, Sabine; Robert, Vincent; Spouge, John L.; Levesque, C. André; Chen, Wen; Bolchacova, Elena; Voigt, Kerstin; Crous, Pedro W.; Miller, Andrew N.; Wingfield, Michael J.; Aime, M. Catherine; An, Kwang-Deuk; Bai, Feng-Yan; Barreto, Robert W.; Begerow, Dominik; Bergeron, Marie-Josée; Blackwell, Meredith; Boekhout, Teun; Bogale, Mesfin; Boonyuen, Nattawut; Burgaz, Ana R.; Buyck, Bart; Cai, Lei; Cai, Qing; Cardinali, G.; Chaverri, Priscila; Coppins, Brian J.; Crespo, Ana; Cubas, Paloma; Cummings, Craig; Damm, Ulrike; de Beer, Z. Wilhelm; de Hoog, G. Sybren; Del-Prado, Ruth; Dentinger, Bryn; Diéguez-Uribeondo, Javier; Divakar, Pradeep K.; Douglas, Brian; Dueñas, Margarita; Duong, Tuan A.; Eberhardt, Ursula; Edwards, Joan E.; Elshahed, Mostafa S.; Fliegerova, Katerina; Furtado, Manohar; García, Miguel A.; Ge, Zai-Wei; Griffith, Gareth W.; Griffiths, K.; Groenewald, Johannes Z.; Groenewald, Marizeth; Grube, Martin; Gryzenhout, Marieka; Guo, Liang-Dong; Hagen, Ferry; Hambleton, Sarah; Hamelin, Richard C.; Hansen, Karen; Harrold, Paul; Heller, Gregory; Herrera, Cesar; Hirayama, Kazuyuki; Hirooka, Yuuri; Ho, Hsiao-Man; Hoffmann, Kerstin; Hofstetter, Valérie; Högnabba, Filip; Hollingsworth, Peter M.; Hong, Seung-Beom; Hosaka, Kentaro; Houbraken, Jos; Hughes, Karen; Huhtinen, Seppo; Hyde, Kevin D.; James, Timothy; Johnson, Eric M.; Johnson, Joan E.; Johnston, Peter R.; Jones, E.B. Gareth; Kelly, Laura J.; Kirk, Paul M.; Knapp, Dániel G.; Kõljalg, Urmas; Kovács, Gábor M.; Kurtzman, Cletus P.; Landvik, Sara; Leavitt, Steven D.; Liggenstoffer, Audra S.; Liimatainen, Kare; Lombard, Lorenzo; Luangsa-ard, J. Jennifer; Lumbsch, H. Thorsten; Maganti, Harinad; Maharachchikumbura, Sajeewa S. N.; Martin, María P.; May, Tom W.; McTaggart, Alistair R.; Methven, Andrew S.; Meyer, Wieland; Moncalvo, Jean-Marc; Mongkolsamrit, Suchada; Nagy, László G.; Nilsson, R. Henrik; Niskanen, Tuula; Nyilasi, Ildikó; Okada, Gen; Okane, Izumi; Olariaga, Ibai; Otte, Jürgen; Papp, Tamás; Park, Duckchul; Petkovits, Tamás; Pino-Bodas, Raquel; Quaedvlieg, William; Raja, Huzefa A.; Redecker, Dirk; Rintoul, Tara L.; Ruibal, Constantino; Sarmiento-Ramírez, Jullie M.; Schmitt, Imke; Schüßler, Arthur; Shearer, Carol; Sotome, Kozue; Stefani, Franck O.P.; Stenroos, Soili; Stielow, Benjamin; Stockinger, Herbert; Suetrong, Satinee; Suh, Sung-Oui; Sung, Gi-Ho; Suzuki, Motofumi; Tanaka, Kazuaki; Tedersoo, Leho; Telleria, M. Teresa; Tretter, Eric; Untereiner, Wendy A.; Urbina, Hector; Vágvölgyi, Csaba; Vialle, Agathe; Vu, Thuy Duong; Walther, Grit; Wang, Qi-Ming; Wang, Yan; Weir, Bevan S.; Weiß, Michael; White, Merlin M.; Xu, Jianping; Yahr, Rebecca; Yang, Zhu L.; Yurkov, Andrey; Zamora, Juan-Carlos; Zhang, Ning; Zhuang, Wen-Ying; Schindel, David

    2012-01-01

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494

  8. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    NASA Astrophysics Data System (ADS)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  9. Intraspecific polymorphism of ribosomal DNA loci number and morphology in Brachypodium pinnatum and Brachypodium sylvaticum.

    PubMed

    Breda, Ewa; Wolny, Elzbieta; Hasterok, Robert

    2012-12-01

    The genus Brachypodium has become the target of extensive cytomolecular studies since one of its representatives, B. distachyon, has been accepted as a model plant for temperate cereals and forage grasses. Recent preliminary studies suggested that intraspecific rDNA polymorphism can occur in at least two members of the genus, B. sylvaticum and B. pinnatum, so the aim of this study was to further analyse this phenomenon. FISH with 25S rDNA and 5S rDNA probes was performed on somatic metaphase chromosomes, supplemented by the silver staining technique which distinguishes transcriptionally active from inactive 18S-5.8S-25S rDNA loci. The number, size and chromosomal distribution of 5S rDNA loci were very constant: two loci were invariably observed in all studied diploid accessions of both species, while four 5S rDNA loci were present in the tetraploid B. pinnatum. In contrast to 5S rDNA loci, those of the 35S rDNA were more variable. Two or three loci were observed in the diploid B. pinnatum and four in tetraploid accessions. In chromosome complements of B. sylvaticum accessions from two to six 35S rDNA sites were detected. Regardless of total rDNA locus number, only two were transcriptionally active in diploid accessions of both species, while two or four were active in the tetraploid B. pinnatum. Additionally, the fluorescent CMA/DAPI banding method was used to identify the relation between rDNA sites and CMA+ bands. It was revealed that the number and chromosomal distribution of CMA+ bands are in congruence only with 35S rDNA loci which gave strong FISH signals. PMID:22893263

  10. Development of a Ribosomal DNA ITS2 Marker for the Identification of the Thrips, Scirtothrips dorsalis

    PubMed Central

    Farris, R E; Ruiz-Arce, R; Ciomperlik, M; Vasquez, J D; DeLeón, R

    2010-01-01

    The thrips Scirtothrips dorsalis Hood (Thysanoptera: Thripidae) is an invasive pest that poses a significant economical threat to U.S. agriculture and trade. In this study, DNA sequence data and polymerase chain reaction (PCR) were utilized to develop a molecular diagnostic marker for S. dorsalis. The DNA sequence variation from the internal transcribed spacer 2 (ITS2) region of nuclear ribosomal DNA (rDNA) was analyzed from various thrips species, including S. dorsalis. A primer set and polymerase chain reaction cycling parameters were designed for the amplification of a single marker fragment of S. dorsalis ITS2 rDNA. Specificity tests performed on ten thrips species, efficacy tests performed on fifteen S. dorsalis populations, and tests on primer sensitivity and robustness all demonstrated the diagnostic utility of this marker. This diagnostic PCR assay provides a quick, simple, and reliable molecular technique to be used in the identification of S. dorsalis. PMID:20578948

  11. Phylogeny and PCR Identification of Clinically Important Zygomycetes Based on Nuclear Ribosomal-DNA Sequence Data

    PubMed Central

    Voigt, Kerstin; Cigelnik, Elizabeth; O'donnell, Kerry

    1999-01-01

    A molecular database for all clinically important Zygomycetes was constructed from nucleotide sequences from the nuclear small-subunit (18S) ribosomal DNA and domains D1 and D2 of the nuclear large-subunit (28S) ribosomal DNA. Parsimony analysis of the aligned 18S and 28S DNA sequences was used to investigate phylogenetic relationships among 42 isolates representing species of Zygomycetes reported to cause infections in humans and other animals, together with commonly cultured contaminants, with emphasis on members of the Mucorales. The molecular phylogeny provided strong support for the monophyly of the Mucorales, exclusive of Echinosporangium transversale and Mortierella spp., which are currently misclassified within the Mucorales. Micromucor ramannianus, traditionally classified within Mortierella, and Syncephalastrum racemosum represent the basal divergences within the Mucorales. Based on the 18S gene tree topology, Absidia corymbifera and Rhizomucor variabilis appear to be misplaced taxonomically. A. corymbifera is strongly supported as a sister group of the Rhizomucor miehei-Rhizomucor pusillus clade, while R. variabilis is nested within Mucor. The aligned 28S sequences were used to design 13 taxon-specific PCR primer pairs for those taxa most commonly implicated in infections. All of the primers specifically amplified DNA of the size predicted based on the DNA sequence data from the target taxa; however, they did not cross-react with phylogenetically related species. These primers have the potential to be used in a PCR assay for the rapid and accurate identification of the etiological agents of mucormycoses and entomophthoromycoses. PMID:10565914

  12. Mapping of replication initiation sites in human ribosomal DNA by nascent-strand abundance analysis.

    PubMed Central

    Yoon, Y; Sanchez, J A; Brun, C; Huberman, J A

    1995-01-01

    New techniques for mapping mammalian DNA replication origins are needed. We have modified the existing nascent-strand size analysis technique (L. Vassilev and E.M. Johnson, Nucleic Acids Res. 17:7693-7705, 1989) to provide an independent means of studying replication initiation sites. We call the new method nascent-strand abundance analysis. We confirmed the validity of this method with replicating simian virus 40 DNA as a model. We then applied nascent-strand abundance and nascent-strand size analyses to mapping of initiation sites in human (HeLa) ribosomal DNA (rDNA), a region previously examined exclusively by two-dimensional gel electrophoresis methods (R.D. Little, T.H.K. Platt, and C.L. Schildkraut, Mol. Cell. Biol. 13:6600-6613, 1993). Our results partly confirm those obtained by two-dimensional gel electrophoresis techniques. Both studies suggest that replication initiates at relatively high frequency a few kilobase pairs upstream of the transcribed region and that many additional low-frequency initiation sites are distributed through most of the remainder of the ribosomal DNA repeat unit. PMID:7739533

  13. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    PubMed Central

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  14. Organellar genome, nuclear ribosomal DNA repeat unit, and microsatellites isolated from a small-scale of 454 GS FLX sequencing on two mosses.

    PubMed

    Liu, Yang; Forrest, Laura L; Bainard, Jillian D; Budke, Jessica M; Goffinet, Bernard

    2013-03-01

    Recent innovations in high-throughput DNA sequencing methodology (next generation sequencing technologies [NGS]) allow for the generation of large amounts of high quality data that may be particularly critical for resolving ambiguous relationships such as those resulting from rapid radiations. Application of NGS technology to bryology is limited to assembling entire nuclear or organellar genomes of selected exemplars of major lineages (e.g., classes). Here we outline how organellar genomes and the entire nuclear ribosomal DNA repeat can be obtained from minimal amounts of moss tissue via small-scale 454 GS FLX sequencing. We sampled two Funariaceae species, Funaria hygrometrica and Entosthodon obtusus, and assembled nearly complete organellar genomes and the whole nuclear ribosomal DNA repeat unit (18S-ITS1-5.8S-ITS2-26S-IGS1-5S-IGS2) for both taxa. Sequence data from these species were compared to sequences from another Funariaceae species, Physcomitrella patens, revealing low overall degrees of divergence of the organellar genomes and nrDNA genes with substitutions spread rather evenly across their length, and high divergence within the external spacers of the nrDNA repeat. Furthermore, we detected numerous microsatellites among the 454 assemblies. This study demonstrates that NGS methodology can be applied to mosses to target large genomic regions and identify microsatellites.

  15. High-Density Microarray of Small-Subunit Ribosomal DNA Probes

    PubMed Central

    Wilson, Kenneth H.; Wilson, Wendy J.; Radosevich, Jennifer L.; DeSantis, Todd Z.; Viswanathan, Vijay S.; Kuczmarski, Thomas A.; Andersen, Gary L.

    2002-01-01

    Ribosomal DNA sequence analysis, originally conceived as a way to provide a universal phylogeny for life forms, has proven useful in many areas of biological research. Some of the most promising applications of this approach are presently limited by the rate at which sequences can be analyzed. As a step toward overcoming this limitation, we have investigated the use of photolithography chip technology to perform sequence analyses on amplified small-subunit rRNA genes. The GeneChip (Affymetrix Corporation) contained 31,179 20-mer oligonucleotides that were complementary to a subalignment of sequences in the Ribosomal Database Project (RDP) (B. L. Maidak et al., Nucleic Acids Res. 29:173-174, 2001). The chip and standard Affymetrix software were able to correctly match small-subunit ribosomal DNA amplicons with the corresponding sequences in the RDP database for 15 of 17 bacterial species grown in pure culture. When bacteria collected from an air sample were tested, the method compared favorably with cloning and sequencing amplicons in determining the presence of phylogenetic groups. However, the method could not resolve the individual sequences comprising a complex mixed sample. Given these results and the potential for future enhancement of this technology, it may become widely useful. PMID:11976131

  16. Variability of the 5S and 45S rDNA Sites in Passiflora L. Species with Distinct Base Chromosome Numbers

    PubMed Central

    DE MELO, NATONIEL FRANKLIN; GUERRA, MARCELO

    2003-01-01

    Cytologically, the species of Passiflora with known chromosome number can be divided into four groups: (1) 2n = 12, 24, 36; (2) 2n = 24; (3) 2n = 18, 72; and (4) 2n = 20. The base chromosome number proposed for the genus is x = 6, with x = 9, x = 10 and x = 12 being considered secondary base numbers. In the present study, variability of 5S and 45S rDNA sites was investigated in 20 species of these four groups to check the reliability of this hypothesis. In the group with x = 6, five diploid species (2n = 12) exhibit two 5S rDNA sites and two (P. capsularis, P. morifolia and P. rubra) or four (P. misera 2x and P. tricuspis) 45S rDNA sites. The hexaploid cytotype of P. misera had 12 45S rDNA sites and six 5S rDNA. A tetraploid species, P. suberosa, had ten 45S rDNA sites and four 5S rDNA sites, both in the same chromosomes as the 45S rDNA sites. In the group with x = 9, P. actinia, P. amethystina, P. edmundoi, P. elegans, P. galbana, P. glandulosa and P. mucronata displayed six 45S rDNA sites, whereas P. alata, P. cincinnata, P. edulis f. flavicarpa, P. edulis var. roxo and P. laurifolia had four sites. In this group, all species were diploid (2n = 18) and had only two 5S rDNA sites. Passiflora foetida, the only species with 2n = 20, had six 45S rDNA sites and four 5S rDNA sites. The species with x = 12 (2n = 24), P. haematostigma and P. pentagona, showed four 45S rDNA sites and two 5S rDNA. In general, the number and location of 5S and 45S rDNA sites were consistent with the hypothesis of x = 6 as the probable ancestral genome for the genus, while the groups of species with x = 9, x = 10 and x = 12 were considered to be of tetraploid origin with descending dysploidy and gene silencing of some redundant gene sites, mainly those of 5S rDNA. PMID:12876193

  17. Variability of the 5S and 45S rDNA sites in Passiflora L. species with distinct base chromosome numbers.

    PubMed

    de Melo, Natoniel Franklin; Guerra, Marcelo

    2003-08-01

    Cytologically, the species of Passiflora with known chromosome number can be divided into four groups: (1) 2n = 12, 24, 36; (2) 2n = 24; (3) 2n = 18, 72; and (4) 2n = 20. The base chromosome number proposed for the genus is x = 6, with x = 9, x = 10 and x = 12 being considered secondary base numbers. In the present study, variability of 5S and 45S rDNA sites was investigated in 20 species of these four groups to check the reliability of this hypothesis. In the group with x = 6, five diploid species (2n = 12) exhibit two 5S rDNA sites and two (P. capsularis, P. morifolia and P. rubra) or four (P. misera 2x and P. tricuspis) 45S rDNA sites. The hexaploid cytotype of P. misera had 12 45S rDNA sites and six 5S rDNA. A tetraploid species, P. suberosa, had ten 45S rDNA sites and four 5S rDNA sites, both in the same chromosomes as the 45S rDNA sites. In the group with x = 9, P. actinia, P. amethystina, P. edmundoi, P. elegans, P. galbana, P. glandulosa and P. mucronata displayed six 45S rDNA sites, whereas P. alata, P. cincinnata, P. edulis f. flavicarpa, P. edulis var. roxo and P. laurifolia had four sites. In this group, all species were diploid (2n = 18) and had only two 5S rDNA sites. Passiflora foetida, the only species with 2n = 20, had six 45S rDNA sites and four 5S rDNA sites. The species with x = 12 (2n = 24), P. haematostigma and P. pentagona, showed four 45S rDNA sites and two 5S rDNA. In general, the number and location of 5S and 45S rDNA sites were consistent with the hypothesis of x = 6 as the probable ancestral genome for the genus, while the groups of species with x = 9, x = 10 and x = 12 were considered to be of tetraploid origin with descending dysploidy and gene silencing of some redundant gene sites, mainly those of 5S rDNA. PMID:12876193

  18. Reversible Top1 cleavage complexes are stabilized strand-specifically at the ribosomal replication fork barrier and contribute to ribosomal DNA stability.

    PubMed

    Krawczyk, Claudia; Dion, Vincent; Schär, Primo; Fritsch, Olivier

    2014-04-01

    Various topological constraints at the ribosomal DNA (rDNA) locus impose an extra challenge for transcription and DNA replication, generating constant torsional DNA stress. The topoisomerase Top1 is known to release such torsion by single-strand nicking and re-ligation in a process involving transient covalent Top1 cleavage complexes (Top1cc) with the nicked DNA. Here we show that Top1ccs, despite their usually transient nature, are specifically targeted to and stabilized at the ribosomal replication fork barrier (rRFB) of budding yeast, establishing a link with previously reported Top1 controlled nicks. Using ectopically engineered rRFBs, we establish that the rRFB sequence itself is sufficient for induction of DNA strand-specific and replication-independent Top1ccs. These Top1ccs accumulate only in the presence of Fob1 and Tof2, they are reversible as they are not subject to repair by Tdp1- or Mus81-dependent processes, and their presence correlates with Top1 provided rDNA stability. Notably, the targeted formation of these Top1ccs accounts for the previously reported broken replication forks at the rRFB. These findings implicate a novel and physiologically regulated mode of Top1 action, suggesting a mechanism by which Top1 is recruited to the rRFB and stabilized in a reversible Top1cc configuration to preserve the integrity of the rDNA.

  19. Ribosomal DNA and Stellate gene copy number variation on the Y chromosome of Drosophila melanogaster.

    PubMed Central

    Lyckegaard, E M; Clark, A G

    1989-01-01

    Multigene families on the Y chromosome face an unusual array of evolutionary forces. Both ribosomal DNA and Stellate, the two families examined here, have multiple copies of similar sequences on the X and Y chromosomes. Although the rate of sequence divergence on the Y chromosome depends on rates of mutation, gene conversion and exchange with the X chromosome, as well as purifying selection, the regulation of gene copy number may also depend on other pleiotropic functions, such as maintenance of chromosome pairing. Gene copy numbers were estimated for a series of 34 Y chromosome replacement lines using densitometric measurements of slot blots of genomic DNA from adult Drosophila melanogaster. Scans of autoradiographs of the same blots probed with the cloned alcohol dehydrogenase gene, a single copy gene, served as internal standards. Copy numbers span a 6-fold range for ribosomal DNA and a 3-fold range for Stellate DNA. Despite this magnitude of variation, there was no association between copy number and segregation variation of the sex chromosomes. Images PMID:2494656

  20. Chromosomal mapping of repetitive DNAs in Gobionellus oceanicus and G. stomatus (Gobiidae; Perciformes): A shared XX/XY system and an unusual distribution of 5S rDNA sites on the Y chromosome.

    PubMed

    Lima-Filho, Paulo A; Amorim, Karlla D J; Cioffi, Marcelo B; Bertollo, Luiz A C; Molina, Wagner F

    2014-01-01

    With nearly 2,000 species, Gobiidae is the most specious family of the vertebrates. This high level of speciation is accompanied by conspicuous karyotypic modifications, where the role of repetitive sequences remains largely unknown. This study analyzed the karyotype of 2 species of the genus Gobionellus and mapped 18S and 5S ribosomal RNA genes and (CA)15 microsatellite sequences onto their chromosomes. G. oceanicus (2n = 56; ♂ 12 metacentrics (m) + 4 submetacentrics (sm) + 1 subtelocentric (st) + 39 acrocentrics (a); ♀ 12m + 4sm + 2st + 38a) and G. stomatus (2n = 56; ♂ 20m + 14sm + 1st + 21a; ♀ 20m + 14sm + 2st + 20a) possess the highest diploid chromosome number among the Gobiidae and have different karyotypes. Both species share an XX/XY sex chromosome system with a large subtelocentric X and a small acrocentric Y chromosome which is rich in (CA)15 sequences and bears 5S rRNA sites. Although coding and noncoding repetitive DNA sequences may be involved in the genesis or differentiation of the sex chromosomes, the exclusive presence of 5S rDNA sites on the Y, but not on the X chromosome of both species, represents a novelty in fishes. In summary, the karyotypic differences, as well as new data on the sex chromosome systems in these 2 Gobiidae species, confirm the high chromosomal dynamism observed in this family.

  1. Cytogenetic Analysis of Populus trichocarpa - Ribosomal DNA, Telomere Repeat Sequence, and Marker-selected BACs

    SciTech Connect

    Tuskan, Gerald A; Gunter, Lee E; DiFazio, Stephen P

    2009-01-01

    The 18S-28S rDNA and 5S rDNA loci in Populus trichocarpa were localized using fluorescent in situ hybridization (FISH). Two 18S-28S rDNA sites and one 5S rDNA site were identified and located at the ends of 3 different chromosomes. FISH signals from the Arabidopsis -type telomere repeat sequence were observed at the distal ends of each chromosome. Six BAC clones selected from 2 linkage groups based on genome sequence assembly (LG-I and LG-VI) were localized on 2 chromosomes, as expected. BACs from LG-I hybridized to the longest chromosome in the complement. All BAC positions were found to be concordant with sequence assembly positions. BAC-FISH will be useful for delineating each of the Populus trichocarpa chromosomes and improving the sequence assembly of this model angiosperm tree species.

  2. GC-biased gene conversion impacts ribosomal DNA evolution in vertebrates, angiosperms, and other eukaryotes.

    PubMed

    Escobar, Juan S; Glémin, Sylvain; Galtier, Nicolas

    2011-09-01

    Ribosomal DNA (rDNA) is one of the most conserved genes in eukaryotes. The multiples copies of rDNA in the genome evolve in a concerted manner, through unequal crossing over and/or gene conversion, two mechanisms related to homologous recombination. Recombination increases local GC content in several organisms through a process known as GC-biased gene conversion (gBGC). gBGC has been well characterized in mammals, birds, and grasses, but its phylogenetic distribution across the tree of life is poorly understood. Here, we test the hypothesis that recombination affects the evolution of base composition in 18S rDNA and examine the reliability of this thoroughly studied molecule as a marker of gBGC in eukaryotes. Phylogenetic analyses of 18S rDNA in vertebrates and angiosperms reveal significant heterogeneity in the evolution of base composition across both groups. Mammals, birds, and grasses experience increases in the GC content of the 18S rDNA, consistent with previous genome-wide analyses. In addition, we observe increased GC contents in Ostariophysi ray-finned fishes and commelinid monocots (i.e., the clade including grasses), suggesting that the genomes of these two groups have been affected by gBGC. Polymorphism analyses in rDNA confirm that gBGC, not mutation bias, is the most plausible explanation for these patterns. We also find that helix and loop sites of the secondary structure of ribosomal RNA do not evolve at the same pace: loops evolve faster than helices, whereas helices are GC richer than loops. We extend analyses to major lineages of eukaryotes and suggest that gBGC might have also affected base composition in Giardia (Diplomonadina), nudibranch gastropods (Mollusca), and Asterozoa (Echinodermata). PMID:21444650

  3. Organization and variation analysis of 5S rDNA in different ploidy-level hybrids of red crucian carp × topmouth culter.

    PubMed

    He, Weiguo; Qin, Qinbo; Liu, Shaojun; Li, Tangluo; Wang, Jing; Xiao, Jun; Xie, Lihua; Zhang, Chun; Liu, Yun

    2012-01-01

    Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp) in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC) and only class IV from their male parent (TC). Triploid hybrids inherited class II and class III from their female parent (RCC) and class IV from their male parent (TC). Tetraploid hybrids gained class II and class III from their female parent (RCC), and generated a new 5S rDNA sequence (designated class I-N). The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.

  4. Characterization of unrelated strains of Staphylococcus schleiferi by using ribosomal DNA fingerprinting, DNA restriction patterns, and plasmid profiles.

    PubMed Central

    Grattard, F; Etienne, J; Pozzetto, B; Tardy, F; Gaudin, O G; Fleurette, J

    1993-01-01

    The molecular characteristics of 31 unrelated strains of Staphylococcus schleiferi isolated from 13 hospitals between 1973 and 1991 were determined by ribosomal DNA fingerprinting by using a digoxigenin-labeled DNA probe, genomic DNA restriction patterns, and plasmid profiles. Only six strains harbored one or two plasmids. DNA restriction analysis, which was carried out with five endonucleases (EcoRI, HindIII, PstI, PvuII, and ClaI), did not allow us to discriminate between isolates. Ribotyping with HindIII, ClaI, or EcoRI enzymes generated six, seven, and nine distinct patterns, respectively. With the combination ClaI-EcoRI, 13 ribotypes were obtained among the 31 strains, suggesting a relative heterogeneity within the species. Moreover, all strains shared two or three common bands, according to the endonuclease used, which were relatively specific for S. schleiferi in comparison with the ribosomal banding patterns described for other coagulase-negative staphylococci. These results illustrate that ribotyping can be used for the epidemiological investigation of S. schleiferi isolates and possibly for taxonomic analysis in this species. Images PMID:8385149

  5. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH.

    PubMed

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.

  6. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    PubMed Central

    Meli, Marina L.; Novacco, Marilisa; Borel, Nicole

    2016-01-01

    The 18S ribosomal RNA (rRNA) gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal) DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR) analysis. We compared (i) samples from various animal species, tissues, and sample types, including swabs; (ii) multiple DNA extraction methods; and (iii) both fresh and formalin-fixed paraffin-embedded (FFPE) samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

  7. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    PubMed Central

    Meli, Marina L.; Novacco, Marilisa; Borel, Nicole

    2016-01-01

    The 18S ribosomal RNA (rRNA) gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal) DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR) analysis. We compared (i) samples from various animal species, tissues, and sample types, including swabs; (ii) multiple DNA extraction methods; and (iii) both fresh and formalin-fixed paraffin-embedded (FFPE) samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects. PMID:27672657

  8. Structure and variation of human ribosomal DNA: the external transcribed spacer and adjacent regions.

    PubMed Central

    Wilson, G N; Szura, L L; Rushford, C; Jackson, D; Erickson, J

    1982-01-01

    A group of human ribosomal DNA (rDNA) recombinants that include the probable site for initiation of transcription have been examined for sequence polymorphism. A detailed restriction map of one rDNA insert was constructed using plasmid subclones and end-labeled segments. Comparison of 16 similar rDNA inserts by restriction and heteroduplex analysis demonstrated striking conservation of the external transcribed spacer and 18S gene regions, but defined a region where restriction sites for the enzymes Sma I, Hpa II, and Hha I become frequent or variable. This region extends for about 400--800 base pairs (bp) at the left end of the rDNA insert and is postulated to contain nontranscribed spacer sequences. The use of cloned rDNA segments as probes for the restriction analysis of genomic rDNA has demonstrated certain fixed sites in the nontranscribed spacer that do not vary significantly among different individuals or tumor cell lines. In contrast, restriction with the enzyme Sal I reveals several variable fragments, one of which has been found only in a retinoblastoma cell line. Images Fig. 6 Fig. 1 Fig. 2 Fig. 4 Fig. 5 PMID:6282117

  9. Chaperoning 5S RNA assembly.

    PubMed

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit.

  10. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  11. Characterization of the Complete Nuclear Ribosomal DNA Sequences of Paramphistomum cervi

    PubMed Central

    Zheng, Xu; Chang, Qiao-Cheng; Zhang, Yan; Tian, Si-Qin; Lou, Yan; Duan, Hong; Guo, Dong-Hui; Wang, Chun-Ren; Zhu, Xing-Quan

    2014-01-01

    Sequences of the complete nuclear ribosomal DNA (rDNA) gene from five individual Paramphistomum cervi were determined for the first time. The five complete rDNA sequences, which included the 18S rDNA, the internal transcribed spacer 1 (ITS1), the 5.8S rDNA, the internal transcribed spacer 2 (ITS2), the 28S rDNA, and the intergenic spacer (IGS) regions, had a length range of 8,493–10,221 bp. The lengths of the investigated 18S, ITS1, 5.8S, ITS2, and 28S rDNA sequences, which were 1,994 bp, 1,293 bp, 157 bp, 286 bp, and 4,186 bp, respectively, did not vary. However, the IGS rDNA sequences had a length range of 577–2,305 bp. The 5.8S and ITS-2 rDNA sequences had 100% identity among the five investigated samples, while the identities among the IGS had a range of 53.7–99.8%. A comparative analysis revealed that different types and numbers of repeats were found within each ITS1 and IGS region, which may be related to the length polymorphism of IGS. The phylogenetic position of P. cervi in Paramphistomatidae was analyzed based on the 18S rDNA sequences. These results will aid in studying the intra- and interspecific variation of the Paramphistomatidae and the systematics and phylogenetics of Digenea. PMID:25140347

  12. Diversity and Recombination of Dispersed Ribosomal DNA and Protein Coding Genes in Microsporidia

    PubMed Central

    Ironside, Joseph Edward

    2013-01-01

    Microsporidian strains are usually classified on the basis of their ribosomal DNA (rDNA) sequences. Although rDNA occurs as multiple copies, in most non-microsporidian species copies within a genome occur as tandem arrays and are homogenised by concerted evolution. In contrast, microsporidian rDNA units are dispersed throughout the genome in some species, and on this basis are predicted to undergo reduced concerted evolution. Furthermore many microsporidian species appear to be asexual and should therefore exhibit reduced genetic diversity due to a lack of recombination. Here, DNA sequences are compared between microsporidia with different life cycles in order to determine the effects of concerted evolution and sexual reproduction upon the diversity of rDNA and protein coding genes. Comparisons of cloned rDNA sequences between microsporidia of the genus Nosema with different life cycles provide evidence of intragenomic variability coupled with strong purifying selection. This suggests a birth and death process of evolution. However, some concerted evolution is suggested by clustering of rDNA sequences within species. Variability of protein-coding sequences indicates that considerable intergenomic variation also occurs between microsporidian cells within a single host. Patterns of variation in microsporidian DNA sequences indicate that additional diversity is generated by intragenomic and/or intergenomic recombination between sequence variants. The discovery of intragenomic variability coupled with strong purifying selection in microsporidian rRNA sequences supports the hypothesis that concerted evolution is reduced when copies of a gene are dispersed rather than repeated tandemly. The presence of intragenomic variability also renders the use of rDNA sequences for barcoding microsporidia questionable. Evidence of recombination in the single-copy genes of putatively asexual microsporidia suggests that these species may undergo cryptic sexual reproduction, a

  13. Analysis of histone modifications at human ribosomal DNA in liver cancer cell

    PubMed Central

    Yu, Feng; Shen, Xingyong; Fan, Li; Yu, Zhaocai

    2015-01-01

    Human liver cancer is the cancer commonly seen clinically. The transcription of ribosomal DNA (rDNA) is a critical step for cells, and epigenetic marks such as post-translational histone modifications have been involved in the regulation of rDNA transcription. But less is known about the pathogenesis of the liver cancers concerning the rDNA transcription regulation. Here we aligned the ChIP-seq data of histone modification markers and CTCF to the human genome assembly which contains a single rDNA repeat in human liver cancer cell and validated their distribution with ChIP-QPCR. Human liver cancer cell possesses a higher enrichment of H3K4me1 and H3K27me3 at ~28 kb within the intergenic spacer (IGS) of rDNA and a higher enrichment of H3K4me3 and H3K27ac upstream of TSS. Furtherly, we studied whether UBF could affect histone modification markers and CTCF at rDNA in human liver cancer cell. UBF depletion leads to a decrease of gene activation mark H3K4me3 across the rDNA promoter. And other histone modification marks and CTCF were not altered after UBF depletion. Taken together, our data showed a high resolution map of histone modification marks at rDNA in human liver cancer cell and provide novel evidence to decipher chromatin-mediated regulation of rDNA in liver cancer. PMID:26657029

  14. RNA–DNA differences in human mitochondria restore ancestral form of 16S ribosomal RNA

    PubMed Central

    Bar-Yaacov, Dan; Avital, Gal; Levin, Liron; Richards, Allison L.; Hachen, Naomi; Rebolledo Jaramillo, Boris; Nekrutenko, Anton; Zarivach, Raz; Mishmar, Dan

    2013-01-01

    RNA transcripts are generally identical to the underlying DNA sequences. Nevertheless, RNA–DNA differences (RDDs) were found in the nuclear human genome and in plants and animals but not in human mitochondria. Here, by deep sequencing of human mitochondrial DNA (mtDNA) and RNA, we identified three RDD sites at mtDNA positions 295 (C-to-U), 13710 (A-to-U, A-to-G), and 2617 (A-to-U, A-to-G). Position 2617, within the 16S rRNA, harbored the most prevalent RDDs (>30% A-to-U and ∼15% A-to-G of the reads in all tested samples). The 2617 RDDs appeared already at the precursor polycistrone mitochondrial transcript. By using traditional Sanger sequencing, we identified the A-to-U RDD in six different cell lines and representative primates (Gorilla gorilla, Pongo pigmaeus, and Macaca mulatta), suggesting conservation of the mechanism generating such RDD. Phylogenetic analysis of more than 1700 vertebrate mtDNA sequences supported a thymine as the primate ancestral allele at position 2617, suggesting that the 2617 RDD recapitulates the ancestral 16S rRNA. Modeling U or G (the RDDs) at position 2617 stabilized the large ribosomal subunit structure in contrast to destabilization by an A (the pre-RDDs). Hence, these mitochondrial RDDs are likely functional. PMID:23913925

  15. Polymorphism and evolution of ribosomal DNA in tea (Camellia sinensis, Theaceae).

    PubMed

    Xu, Jing; Xu, Ying; Yonezawa, Takahiro; Li, Lijia; Hasegawa, Masami; Lu, Fan; Chen, Jiakuan; Zhang, Wenju

    2015-08-01

    Ribosomal DNA (rDNA) repeats often exhibit a high level of within-species homogeneity, but intra-individual polymorphism of rDNA has been found in Camellia species. In order to reveal the evolutionary pattern of rDNA repeats in tea [Camellia sinensis (L.) O. Kuntze], we identified the 45S rDNA loci, estimated their copy number, and cloned partial regions of them from different PCR products and from digested genomic DNA. The results show that there are 3 loci (6 sites) containing 45S rDNA in the tea genome; they are located at the ends of the short arms of 6 chromosomes and consist of a maximum of ∼6500 repeat units. On one hand, 164 sequences of the 26S rDNA cloned from PCR products contained 147 haplotypes, consisting of 62% pseudogenes, 24% putative functional genes, and 14% PCR-mediated recombinants, suggesting that the 45S rDNA of tea maintains an extremely high level of polymorphism and divergence; on the other hand, rDNA fragments cloned directly from genomic DNA exhibited a very high level of homogeneity: only one of 33 rDNA fragments was from a pseudogene. These results demonstrate that although over 60% of the 26S rDNA sequences identified in PCR products belong to pseudogenes, most 45S rDNA repeats are functional genes and have undergone concerted evolution. In this study, strong PCR bias and PCR-mediated recombination greatly increased the apparent proportion of pseudogenes in PCR products. Phylogenetic analysis and genetic divergence values for 26S rDNA sequences obtained in this study show that many pseudogenes have originated independently from functional genes at different times, and despite thus escaping from concerted evolution, they have failed to be eliminated from the tea genome over a long period, some of them having even produced addition copies by rapid expansion. Importantly, our study suggests that in order to determine the true pattern of evolution of rDNA it is necessary to combine data from more than one method rather than relying only

  16. Geographically localised bursts of ribosomal DNA mobility in the grasshopper Podisma pedestris.

    PubMed

    Veltsos, P; Keller, I; Nichols, R A

    2009-07-01

    We report extraordinary variation in the number and the chromosomal location of ribosomal DNA (rDNA) arrays within populations of the alpine grasshopper Podisma pedestris; even greater differences were found between populations. The sites were detected by in situ hybridisation of labelled rDNA to chromosomal preparations. The total number of rDNA sites in an individual varied from three to thirteen. In the most extreme case, individuals from populations only 10 km apart had no rDNA loci in common. A survey of the geographical distribution of this variation identified clusters of populations with relatively similar chromosomal distribution of rDNA loci. These clusters correspond to those identified earlier by analysis of rDNA sequences. To explain this geographical clustering, we reconstructed the post-glacial colonisation of the region by assuming that the species' distribution has ascended to its current altitudinal range as the climate warmed. The reconstruction suggests that each cluster is descended from a colonisation route up a different alpine valley. That history would imply rapid establishment of rDNA differences, conceivably during the last 10,000 years since the last glaciation. The proposal for rapid change is consistent with the extensive within-population variation, which indicates that the processes responsible for the change in rDNA's chromosomal location continue to occur at a higher rate. We discuss whether our reconstruction of colonisation routes implies movement of the hybrid zone, which would indicate that a neo-XY sex chromosome system has spread through extant populations.

  17. Correlation between ribosomal DNA polymorphism and electrophoretic enzyme polymorphism in Yersinia.

    PubMed

    Picard-Pasquier, N; Picard, B; Heeralal, S; Krishnamoorthy, R; Goullet, P

    1990-08-01

    Ribosomal DNA (rDNA) polymorphism was compared with electrophoretic enzyme polymorphism for the intra- and interspecies differentiation of Yersinia enterocolitica, Y. pseudotuberculosis, Y. intermedia, Y. aldovae, Y. frederiksenii and Y. kristensenii. DNA from 90 strains previously classified into six zymotypes (Y. enterocolitica and Y. frederiksenii) and into distinct enzyme electrophoretic patterns (the four other species) was digested with EcoRI or HindIII and analysed by Southern blotting. The six species were clearly differentiated from each other. In Y. enterocolitica, the subclassification of biotype 1 into zymotypes 1A and 1B was also reflected in the rDNA and the four other bio-zymotypes gave four different classes of restriction pattern. In Y. frederiksenii, both EcoRI and HindIII gave five distinct riboclasses which correlated with the zymotypes. In the four other species, the phenotype polymorphism appeared to be better correlated with the restriction fragment length polymorphism data in some enzymes than others. The data demonstrate that the inter- and intraspecies classification by rDNA polymorphism using two restriction enzymes is similar to that based on electrophoretic enzyme polymorphism. The analysis could be refined for taxonomic and epidemiological purposes by using other restriction enzymes.

  18. Wnt5a Signals through DVL1 to Repress Ribosomal DNA Transcription by RNA Polymerase I.

    PubMed

    Dass, Randall A; Sarshad, Aishe A; Carson, Brittany B; Feenstra, Jennifer M; Kaur, Amanpreet; Obrdlik, Ales; Parks, Matthew M; Prakash, Varsha; Love, Damon K; Pietras, Kristian; Serra, Rosa; Blanchard, Scott C; Percipalle, Piergiorgio; Brown, Anthony M C; Vincent, C Theresa

    2016-08-01

    Ribosome biogenesis is essential for cell growth and proliferation and is commonly elevated in cancer. Accordingly, numerous oncogene and tumor suppressor signaling pathways target rRNA synthesis. In breast cancer, non-canonical Wnt signaling by Wnt5a has been reported to antagonize tumor growth. Here, we show that Wnt5a rapidly represses rDNA gene transcription in breast cancer cells and generates a chromatin state with reduced transcription of rDNA by RNA polymerase I (Pol I). These effects were specifically dependent on Dishevelled1 (DVL1), which accumulates in nucleolar organizer regions (NORs) and binds to rDNA regions of the chromosome. Upon DVL1 binding, the Pol I transcription activator and deacetylase Sirtuin 7 (SIRT7) releases from rDNA loci, concomitant with disassembly of Pol I transcription machinery at the rDNA promoter. These findings reveal that Wnt5a signals through DVL1 to suppress rRNA transcription. This provides a novel mechanism for how Wnt5a exerts tumor suppressive effects and why disruption of Wnt5a signaling enhances mammary tumor growth in vivo. PMID:27500936

  19. Wnt5a Signals through DVL1 to Repress Ribosomal DNA Transcription by RNA Polymerase I

    PubMed Central

    Dass, Randall A.; Sarshad, Aishe A.; Feenstra, Jennifer M.; Kaur, Amanpreet; Pietras, Kristian; Serra, Rosa; Blanchard, Scott C.; Percipalle, Piergiorgio; Brown, Anthony M. C.; Vincent, C. Theresa

    2016-01-01

    Ribosome biogenesis is essential for cell growth and proliferation and is commonly elevated in cancer. Accordingly, numerous oncogene and tumor suppressor signaling pathways target rRNA synthesis. In breast cancer, non-canonical Wnt signaling by Wnt5a has been reported to antagonize tumor growth. Here, we show that Wnt5a rapidly represses rDNA gene transcription in breast cancer cells and generates a chromatin state with reduced transcription of rDNA by RNA polymerase I (Pol I). These effects were specifically dependent on Dishevelled1 (DVL1), which accumulates in nucleolar organizer regions (NORs) and binds to rDNA regions of the chromosome. Upon DVL1 binding, the Pol I transcription activator and deacetylase Sirtuin 7 (SIRT7) releases from rDNA loci, concomitant with disassembly of Pol I transcription machinery at the rDNA promoter. These findings reveal that Wnt5a signals through DVL1 to suppress rRNA transcription. This provides a novel mechanism for how Wnt5a exerts tumor suppressive effects and why disruption of Wnt5a signaling enhances mammary tumor growth in vivo. PMID:27500936

  20. Molecular detection of bacteria in plant tissues, using universal 16S ribosomal DNA degenerated primers

    PubMed Central

    Tsoktouridis, Georgios; Tsiamis, George; Koutinas, Nikolaos; Mantell, Sinclair

    2014-01-01

    Highly specific, sensitive and rapid tests are required for the detection and identification of covert bacterial contaminations in plant tissue cultures. Current methods available for this purpose are tedious, time consuming, highly error prone, expensive, require advanced technical expertise and are sometimes ineffective. We report here the development of a sensitive polymerase chain reaction (PCR) based method for the rapid detection and identification of bacteria occurring in plant tissue cultures. A total of 121 16S ribosomal DNA (rDNA) coding regions from 14 different groups of bacteria, algae and plants, available in the Gene Bank/European Molecular Biology Laboratory databases, were aligned and several conserved DNA sequences of bacterial origin were identified. From those, five degenerated primers were designed in order to amplify only the bacterial DNA present in mixed plant/bacteria genomic DNA extracts. A known amount of bacterial suspension of either covert Pseudomonas or covert Bacillus were added to in vitro plant leaves and total plant/bacterial DNA extracted using three different methods to determine the lowest number of bacteria required to be present in order to allow their detection. The highest sensitivity of the bacterial cell detection was 2.5 × 106 cells of both Bacillus and Pseudomonas inoculums, using template DNA prepared by the MiniPrep method. Generation of PCR amplification fragments was achieved only for the 16S rDNA bacterial gene by using four combinations of degenerated primers. Successive sequence analysis of these amplified fragments led to the rapid detection and molecular identification of bacteria covertly associated with plants. PMID:26019546

  1. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  2. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    PubMed

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  3. Molecular confirmation of the genomic constitution of Douglasdeweya (Triticeae: Poaceae): demonstration of the utility of the 5S rDNA sequence as a tool for haplome identification.

    PubMed

    Baum, Bernard R; Johnson, Douglas A

    2008-06-01

    A new genus Douglasdeweya containing the two species, Douglasdeweya deweyi and D. wangii was published in 2005 by Yen et al. based upon the results of cytogenetical and morphological findings. The genome constitution of Douglasdeweya-PPStSt-allowed its segregation from the genus Pseudoroegneria which contains the StSt or StStStSt genomes. Our previous work had demonstrated the utility of using 5S rDNA units, especially the non-transcribed spacer sequence variation, for the resolution of genomes (haplomes) previously established by cytology. Here, we show that sequence analysis of the 5S DNA units from these species strongly supports the proposed species relationships of Yen et al. (Can J Bot 83:413-419, 2005), i.e., the PP genome from Agropyron and the StSt genome from Pseudoroegneria. Analysis of the 5S rDNA units constitutes a powerful tool for genomic research especially in the Triticeae. PMID:18421479

  4. Single-step co-integration of multiple expressible heterologous genes into the ribosomal DNA of the methylotrophic yeast Hansenula polymorpha.

    PubMed

    Klabunde, J; Diesel, A; Waschk, D; Gellissen, G; Hollenberg, C P; Suckow, M

    2002-05-01

    We have investigated the methylotrophic yeast Hansenula polymorpha as a host for the co-integration and expression of multiple heterologous genes using an rDNA integration approach. The ribosomal DNA (rDNA) of H. polymorpha was found to consist of a single rDNA cluster of about 50-60 repeats of an 8-kb unit located on chromosome II. A 2.4-kb segment of H. polymorpha rDNA encompassing parts of the 25S, the complete 5S and the non-transcribed spacer region between 25S and 18S rDNA was isolated and inserted into conventional integrative H. polymorpha plasmids harboring the Saccharomyces- cerevisiae-derived URA3 gene for selection. These rDNA plasmids integrated homologously into the rDNA repeats of a H. polymorpha (odc1) host as several independent clusters. Anticipating that this mode of multiple-cluster integration could be used for the simultaneous integration of several distinct rDNA plasmids, the host strain was co-transformed with a mixture of up to three different plasmids, all bearing the same URA3 selection marker. Transformations indeed resulted in mitotically stable strains harboring one, two, or all three plasmids integrated into the rDNA. The overall copy number of the plasmids integrated did not exceed the number of rDNA repeats present in the untransformed host strain, irrespective of the number of different plasmids involved. Strains harboring different plasmids co-expressed the introduced genes, resulting in functional proteins. Thus, this approach provides a new and attractive tool for the rapid generation of recombinant strains that simultaneously co-produce several proteins in desired stoichiometric ratios. PMID:12021801

  5. An abundant nucleolar phosphoprotein is associated with ribosomal DNA in Tetrahymena macronuclei.

    PubMed Central

    McGrath, K E; Smothers, J F; Dadd, C A; Madireddi, M T; Gorovsky, M A; Allis, C D

    1997-01-01

    An abundant 52-kDa phosphoprotein was identified and characterized from macronuclei of the ciliated protozoan Tetrahymena thermophila. Immunoblot analyses combined with light and electron microscopic immunocytochemistry demonstrate that this polypeptide, termed Nopp52, is enriched in the nucleoli of transcriptionally active macronuclei and missing altogether from transcriptionally inert micronuclei. The cDNA sequence encoding Nopp52 predicts a polypeptide whose amino-terminal half consists of multiple acidic/serine-rich regions alternating with basic/proline-rich regions. Multiple serines located in these acidic stretches lie within casein kinase II consensus motifs, and Nopp52 is an excellent substrate for casein kinase II in vitro. The carboxyl-terminal half of Nopp52 contains two RNA recognition motifs and an extreme carboxyl-terminal domain rich in glycine, arginine, and phenylalanine, motifs common in many RNA processing proteins. A similar combination and order of motifs is found in vertebrate nucleolin and yeast NSR1, suggesting that Nopp52 is a member of a family of related nucleolar proteins. NSR1 and nucleolin have been implicated in transcriptional regulation of rDNA and rRNA processing. Consistent with a role in ribosomal gene metabolism, rDNA and Nopp52 colocalize in situ, as well as by cross-linking and immunoprecipitation experiments, demonstrating an association between Nopp52 and rDNA in vivo. Images PMID:9017598

  6. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    PubMed

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  7. [Identification of fish species based on ribosomal DNA ITS2 locus].

    PubMed

    Yuan, Wan-An

    2010-04-01

    To prevent illegal fishing and sale, the most difficult problem is identification of marketed fish species, especially the parts that are difficult to be differentiated with morphological method (e.g., larval, eggs, scales, meat, products etc. To assist conservation and management of fishery resources, this paper reported a molecular genetic approach based on ribosomal internal transcribed spacer 2 locus. The method includes two steps: (1) the order general primers were designed according to the conservative nature of 5.8SrRAN and 28SrRNA genes within an order, and the DNA ribosomal internal transcribed spacer 2 locus fragment were then amplified and sequenced. (2) The species-specific ladders and the species-specific primers for each species were designed according to the sequencing results. The map of molecular taxonomy was constructed. This approach employs multiplex PCR that is formatted for fish species identification. We tested 210 single-species samples and 40 mix-species samples from different regions of China. The approach distinguished accurately and sensitively samples from each of the five species. This genetic and molecular approach will be useful for fish conservation, assessment, management and exploitation, strengthen in law enforcement of fishery manager, combat rare and endangered fish smuggling, and prevent commercial fraud and biological invasion by harmful nonnative species.

  8. Homologous genes for mouse 4.5S hybRNA are found in all eukaryotes and their low molecular weight RNA transcripts intermolecularly hybridize with eukaryotic 18S ribosomal RNAs.

    PubMed

    Trinh-Rohlik, Q; Maxwell, E S

    1988-07-11

    Previous work has reported the isolation and sequencing of a mouse low molecular weight RNA species designated 4.5S hybridizing RNA or hybRNA because of its ability to intermolecularly hybridize with mouse mRNA and 18S rRNA sequences. Using synthetic DNA oligonucleotide probes we have examined the conservation of this gene sequence and its expression as a lmwRNA transcript across evolution. Southern blot analysis has shown that homologous genes of single or low copy number are found in all eukaryotes examined as well as in E. coli. Northern blot analysis has demonstrated 4.5S hybRNA transcription in all mouse tissues as well as expression in yeast and Xenopus laevis as lmwRNAs of approximately 130 and 100 nucleotides, respectively, as compared with mouse/rat/hamster species of approximately 87 nucleotides. Yeast and X. laevis 4.5S hybRNA homologs, isolated by hybrid-selection, were shown by Northern blot analysis to intermolecularly hybridize with homologous as well as heterologous 18S rRNA sequences. The conservation of 4.5S hybRNA homologous genes and their expression as lmwRNA transcripts with common intermolecular RNA:RNA hybridization capabilities in fungi, amphibians, and mammals argues for a common, conserved and required biological function for this lmwRNA in all eukaryotes and potential utilization of its intermolecular RNA:RNA hybridization capabilities to carry out this function.

  9. Are ribosomal DNA clusters rearrangement hotspots? A case study in the genus Mus (Rodentia, Muridae)

    PubMed Central

    2011-01-01

    Background Recent advances in comparative genomics have considerably improved our knowledge of the evolution of mammalian karyotype architecture. One of the breakthroughs was the preferential localization of evolutionary breakpoints in regions enriched in repetitive sequences (segmental duplications, telomeres and centromeres). In this context, we investigated the contribution of ribosomal genes to genome reshuffling since they are generally located in pericentromeric or subtelomeric regions, and form repeat clusters on different chromosomes. The target model was the genus Mus which exhibits a high rate of karyotypic change, a large fraction of which involves centromeres. Results The chromosomal distribution of rDNA clusters was determined by in situ hybridization of mouse probes in 19 species. Using a molecular-based reference tree, the phylogenetic distribution of clusters within the genus was reconstructed, and the temporal association between rDNA clusters, breakpoints and centromeres was tested by maximum likelihood analyses. Our results highlighted the following features of rDNA cluster dynamics in the genus Mus: i) rDNA clusters showed extensive diversity in number between species and an almost exclusive pericentromeric location, ii) a strong association between rDNA sites and centromeres was retrieved which may be related to their shared constraint of concerted evolution, iii) 24% of the observed breakpoints mapped near an rDNA cluster, and iv) a substantial rate of rDNA cluster change (insertion, deletion) also occurred in the absence of chromosomal rearrangements. Conclusions This study on the dynamics of rDNA clusters within the genus Mus has revealed a strong evolutionary relationship between rDNA clusters and centromeres. Both of these genomic structures coincide with breakpoints in the genus Mus, suggesting that the accumulation of a large number of repeats in the centromeric region may contribute to the high level of chromosome repatterning observed

  10. Metagenomic retrieval of a ribosomal DNA repeat array from an uncultured marine alveolate.

    PubMed

    Massana, Ramon; Karniol, Baruch; Pommier, Thomas; Bodaker, Idan; Béjà, Oded

    2008-05-01

    The aim of this study was to explore the use of large-scale sequencing to better describe the genome content of naturally occurring, uncultured protists. We constructed a metagenomic fosmid library from a picoplanktonic assemblage (0.2-3 mum size cells) collected at the Blanes Bay Microbial Observatory (Western Mediterranean). Seven clones contained a small-subunit ribosomal RNA gene (SSU rDNA) affiliating with prasinophytes and uncultured alveolates. One clone (FBB25; 35 kb in size) was completely sequenced and found to be a tandem repeat array (5.5 times) of the rDNA operon, including three rRNA genes (SSU, large-subunit and 5.8S rDNAs) and three spacer regions (internal transcribed spacers 1, 2 and intergenic spacer). The SSU rDNA of FBB25 affiliated with the marine alveolates group I, cluster 1, and was almost identical to sequences retrieved only in marine surveys from a wide geographic and ecological range. Phylogenetic trees using the different rRNA genes showed FBB25 as an independent branch among the main alveolate groups, but their closest affiliation varied between the SSU tree (dinoflagellates) and the large-subunit and 5.8S trees (perkinsids). The spacer regions of FBB25 were particularly short when compared with other eukaryotes, indicating a possible genome streamlining in this picoeukaryote. Finally, not a single polymorphism was found in the rDNA repeat array, suggesting that the high SSU rDNA variability typically found in molecular surveys derives from organismal and not intragenomic diversity. This first report on the rDNA genomic structure of an uncultured marine alveolate improves their phylogenetic position and helps interpreting data generated during picoeukaryotic molecular surveys.

  11. Sequence analysis and comparison of ribosomal DNA from bovine Neospora to similar coccidial parasites.

    PubMed

    Marsh, A E; Barr, B C; Sverlow, K; Ho, M; Dubey, J P; Conrad, P A

    1995-08-01

    The nuclear small subunit ribosomal RNA (nss-rRNA) gene sequence of Neospora spp. isolated from cattle was analyzed and compared to the sequences from several closely related cyst-forming coccidial parasites. Double-stranded DNA sequencing of 5 bovine Neospora spp. isolates (BPA1-4), 2 Neospora caninum isolates (NC-1 and NC-3), and 3 Toxoplasma gondii isolates (RH, GT-1, CT-1) were performed and compared to each other, as well as to other sequences available in GenBank for the NC-1 isolate, Sarcocystis muris, and Cryptosporidium parvum. There were no nucleotide differences detected between the Neospora spp. isolates from cattle and dogs. Four nucleotide differences were consistently detected when sequences of Neospora spp. isolates were compared to those of the T. gondii isolates. These results indicate that Neospora spp. and T. gondii are closely related, but distinct, species.

  12. Ribosomal DNA sequence of Nucleospora salmonis Hedrick, Groff and Baxa, 1991 (Microsporea:Enterocytozoonidae): implications for phylogeny and nomenclature.

    PubMed

    Docker, M F; Kent, M L; Hervio, D M; Khattra, J S; Weiss, L M; Cali, A; Devlin, R H

    1997-01-01

    Rules of zoological nomenclature, morphological data, and ribosomal DNA sequence data support the validity of the genus Nucleospora, and its placement in the family Enterocytozoonidae. Although Nucleospora exhibits most of the distinguishing morphological characteristics of the family Enterocytozoonidae Cali and Owen, 1990, the distinctively different hosts (fish and humans, respectively) and sites of development (the nuclei of immature blood cells and the cytoplasm of enterocytes) support the placement of Nucleospora and Enterocytozoon into separate genera. Ribosomal DNA sequence comparisons between Nucleospora salmonis and Enterocytozoon bieneusi showed 19.8% genetic divergence in the large and small subunit regions. Although more inter- and intrageneric comparisons are needed before percent homology of ribosomal DNA can be used as a criterion for the separation of genera, the genetic divergence between the two species is sufficiently large to deter suppression of the genus Nucleospora as a junior synonym of Enterocytozoon. A polymerase chain reaction test for the detection of N. salmonis in chinook salmon (Oncorhynchus tshawytscha), based on N. salmonis-specific ribosomal DNA sequence, is described.

  13. Ribosomal DNA in diploid and polyploid Setaria (Poaceae) species: number and distribution

    PubMed Central

    Nani, Thaís Furtado; Cenzi, Gisele; Pereira, Daniele Lais; Davide, Lisete Chamma; Techio, Vânia Helena

    2015-01-01

    Abstract Setaria Beauvois, 1812 is a genus of economically important forage species, including Setaria italica (Linnaeus, 1753) Beauvois, 1812 and Setaria viridis (Linnaeus, 1753) Beauvois, 1812, closely related species and considered as model systems for studies of C4 plants. However, complications and uncertainties related to taxonomy of other species of the genus are frequent due to the existence of numerous synonyms for the same species or multiple species with the same name, and overlapping of morphological characteristics. Cytogenetic studies in Setaria can be useful for taxonomic and evolutionary studies as well as for applications in breeding. Thus, this study is aimed at locating 45S and 5S rDNA sites through fluorescent in situ hybridization (FISH) in Setaria italica, Setaria viridis and Setaria sphacelata (Schumacher, 1827) Stapf, Hubbard, Moss, 1929 cultivars (cvs.) Narok and Nandi. Setaria italica and Setaria viridis have 18 chromosomes with karyotype formulas 6m + 3sm and 9m, respectively. The location of 45S and 5S rDNA for these species was in different chromosome pairs among the evaluated species. Setaria viridis presented a more symmetrical karyotype, strengthening the ancestral relationship with Setaria italica. Setaria sphacelata cvs. Narok and Nandi have 36 chromosomes, and karyotype formulas 11m+7sm and 16m+2sm, respectively. The 45S rDNA signals for both cultivars were also observed in distinct chromosome pairs; however chromosomes bearing 5S rDNA are conserved. Karyotypic variations found among the studied species are evidence of chromosomal rearrangements. PMID:26753080

  14. Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects.

    PubMed

    Elbrecht, Vasco; Taberlet, Pierre; Dejean, Tony; Valentini, Alice; Usseglio-Polatera, Philippe; Beisel, Jean-Nicolas; Coissac, Eric; Boyer, Frederic; Leese, Florian

    2016-01-01

    Cytochrome c oxidase I (COI) is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate. PMID:27114891

  15. Interspecific and intrapopulation variation in mitochondrial ribosomal DNA sequences of Mytilus spp. (Bivalvia: Mollusca).

    PubMed

    Geller, J B; Carlton, J T; Powers, D A

    1993-02-01

    A 560-base pair portion of the mitochondrial 16S ribosomal DNA (16S rDNA) from three morphologically similar mussels, Mytilus edulis, M. galloprovincialis, and M. trossulus, was amplified with the polymerase chain reaction, and 349 base pairs were sequenced. These data showed that this gene in M. edulis and M. galloprovincialis has not diverged; however, the north Pacific mussel, M. trossulus, showed fixed differences from M. edulis and M. galloprovincialis at 5 nucleotide positions. Furthermore, the population of M. trossulus at Tillamook Bay, Oregon, was found to contain two very divergent 16S rDNA genotypes that differ at 37 nucleotide positions. Thus, intraspecific variation in this gene in M. trossulus is greater than that seen interspecifically in M. edulis and M. galloprovincialis. Despite this large difference, in the absence of evidence of genetic isolation between these groups of M. trossulus, no taxonomic changes are proposed. These data are consistent with a north Pacific origin of the genus with subsequent dispersal to the Atlantic Ocean across the Artic Sea, giving rise to M. edulis in northern Europe and subsequently M. galloprovincialis in southern Europe and the Mediterranean Sea.

  16. Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA.

    PubMed

    Sun, Y; Skinner, D Z; Liang, G H; Hulbert, S H

    1994-09-01

    The phylogenetic relationships of the genus Sorghum and related genera were studied by sequencing the nuclear ribosomal DNA (rDNA) internal transcribed spacer region (ITS). DNA was extracted from 15 Sorghum accessions, including one accession from each of the sections Chaetosorghum and Heterosorghum, four accessions from Parasorghum, two accessions from Stiposorghum, and seven representatives from three species of the section Sorghum (one accession from each of S. propinquum and S. halepense, and five races of S. bicolor). The maize (Zea mays) line, H95, and an accession from Cleistachne sorghoides were also included in the study. Variable nucleotides were used to construct a strict consensus phylogenetic tree. The analyses indicate that S. propinquum, S. halepense and S. bicolor subsp. arundinaceum race aethiopicum may be the closest wild relatives of cultivated sorghum; Sorghum nitidum may be the closest 2n=10 relative to S. bicolor, the sections Chaetosorghum and Heterosorghum appear closely related to each other and more closely related to the section Sorghum than Parasorghum; and the section Parasorghum is not monophyletic. The results also indicate that the genus Sorghum is a very ancient and diverse group.

  17. Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects

    PubMed Central

    Elbrecht, Vasco; Taberlet, Pierre; Dejean, Tony; Valentini, Alice; Usseglio-Polatera, Philippe; Beisel, Jean-Nicolas; Coissac, Eric; Boyer, Frederic

    2016-01-01

    Cytochrome c oxidase I (COI) is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate. PMID:27114891

  18. SIRT1 regulates the ribosomal DNA locus: epigenetic candles twinkle longevity in the Christmas tree.

    PubMed

    Salminen, Antero; Kaarniranta, Kai

    2009-01-01

    Ribosomal RNA (rRNA) genes arrange themselves in a tandem pattern in nucleolus and during the transcription of rRNA genes, the elongating nascent rRNA transcripts create a structure called Christmas tree. rRNA genes in the rDNA locus can be either active or silent depending on the epigenetic regulation of the chromatin structure. Yeast Sir2 (silent information regulator 2) protein containing complexes can repress the recombination in the rDNA locus and subsequently extend the replicative lifespan of the budding yeast. The mammalian rDNA locus is also under the epigenetic regulation by protein complexes, such as NoRC (nucleolar remodeling complex) and eNoSC (energy-dependent nucleolar silencing complex), involving histone deacetylases and methyltransferases. SIRT1, a NAD(+)-dependent histone deacetylase, is the key component in the eNoSC complex and hence energetic changes can regulate the activation of eNoSC complex and in this way mediate the epigenetic silencing of rRNA gene expression. The eNoSC complex links SIRT1-induced longevity regulation to the metabolic rate theory of aging.

  19. Phylogeography of East Asian Lespedeza buergeri (Fabaceae) based on chloroplast and nuclear ribosomal DNA sequence variations.

    PubMed

    Jin, Dong-Pil; Lee, Jung-Hyun; Xu, Bo; Choi, Byoung-Hee

    2016-09-01

    The dynamic changes in land configuration during the Quaternary that were accompanied by climatic oscillations have significantly influenced the current distribution and genetic structure of warm-temperate forests in East Asia. Although recent surveys have been conducted, the historical migration of forest species via land bridges and, especially, the origins of Korean populations remains conjectural. Here, we reveal the genetic structure of Lespedeza buergeri, a warm-temperate shrub that is disjunctively distributed around the East China Sea (ECS) at China, Korea, and Japan. Two non-coding regions (rpl32-trnL, psbA-trnH) of chloroplast DNA (cpDNA) and the internal transcribed spacer of nuclear ribosomal DNA (nrITS) were analyzed for 188 individuals from 16 populations, which covered almost all of its distribution. The nrITS data demonstrated a genetic structure that followed geographic boundaries. This examination utilized AMOVA, comparisons of genetic differentiation based on haplotype frequency/genetic mutations among haplotypes, and Mantel tests. However, the cpDNA data showed contrasting genetic pattern, implying that this difference was due to a slower mutation rate in cpDNA than in nrITS. These results indicated frequent migration by this species via an ECS land bridge during the early Pleistocene that then tapered gradually toward the late Pleistocene. A genetic isolation between western and eastern Japan coincided with broad consensus that was suggested by the presence of other warm-temperate plants in that country. For Korean populations, high genetic diversity indicated the existence of refugia during the Last Glacial Maximum on the Korean Peninsula. However, their closeness with western Japanese populations at the level of haplotype clade implied that gene flow from western Japanese refugia was possible until post-glacial processing occurred through the Korea/Tsushima Strait land bridge. PMID:27206725

  20. The D1-D2 region of the large subunit ribosomal DNA as barcode for ciliates.

    PubMed

    Stoeck, T; Przybos, E; Dunthorn, M

    2014-05-01

    Ciliates are a major evolutionary lineage within the alveolates, which are distributed in nearly all habitats on our planet and are an essential component for ecosystem function, processes and stability. Accurate identification of these unicellular eukaryotes through, for example, microscopy or mating type reactions is reserved to few specialists. To satisfy the demand for a DNA barcode for ciliates, which meets the standard criteria for DNA barcodes defined by the Consortium for the Barcode of Life (CBOL), we here evaluated the D1-D2 region of the ribosomal DNA large subunit (LSU-rDNA). Primer universality for the phylum Ciliophora was tested in silico with available database sequences as well as in the laboratory with 73 ciliate species, which represented nine of 12 ciliate classes. Primers tested in this study were successful for all tested classes. To test the ability of the D1-D2 region to resolve conspecific and congeneric sequence divergence, 63 Paramecium strains were sampled from 24 mating species. The average conspecific D1-D2 variation was 0.18%, whereas congeneric sequence divergence averaged 4.83%. In pairwise genetic distance analyses, we identified a D1-D2 sequence divergence of <0.6% as an ideal threshold to discriminate Paramecium species. Using this definition, only 3.8% of all conspecific and 3.9% of all congeneric sequence comparisons had the potential of false assignments. Neighbour-joining analyses inferred monophyly for all taxa but for two Paramecium octaurelia strains. Here, we present a protocol for easy DNA amplification of single cells and voucher deposition. In conclusion, the presented data pinpoint the D1-D2 region as an excellent candidate for an official CBOL barcode for ciliated protists.

  1. Variation in Ribosomal DNA among Isolates of the Mycorrhizal Fungus Cenococcum Geophilum FR.

    NASA Astrophysics Data System (ADS)

    Lobuglio, Katherine Frances

    1990-01-01

    Cenococcum geophilum Fr., a cosmopolitan mycorrhizal fungus, is well-known for its extremely wide host and habitat range. The ecological diversity of C. geophilum sharply contrasts its present taxonomic status as a monotypic form -genus. Restriction fragment length polymorphisms (RFLPs) in nuclear ribosomal DNA (rDNA) was used to assess the degree of genetic variation among 72 isolates of C. geophilum. The probe used in this study was the rDNA repeat cloned from C. geophilum isolate A145 (pCG15). Length of the rDNA repeat was approximately 9 kb. The rDNA clone was mapped for 5 restriction endonucleases. Hybridization with cloned Saccharomyces cerevisiae rDNA (pSR118, and pSR125 containing the 18S, and 5.8-25S rRNA genes respectively), and alignment of restriction endonuclease sites conserved in the rDNA genes of other fungi, were used to position the corresponding rDNAs of C. geophilum. Southern hybridizations with EcoRI, HindIII, XhoI, and PstI digested DNAs indicated extensive variation among the C. geophilum isolates, greater than has been previously reported to occur within a fungal species. Most of the rDNA polymorphisms occurred in the IGS region. Restriction endonuclease site and length polymorphisms were also observed in the 5.8S-26S genic regions. Sixteen size categories of length mutations, 6 restriction endonuclease site additions, and 4 restriction endonuclease site deletions were determined using isolate A145 as a reference. The rDNA repeat length among the isolates varied from approximately 8.5 to 10.2 kb. RFLPs were also observed in the mitochondrial (mt) 24S rRNA gene and flanking regions of HindIII digested DNAs of C. geophilum isolates representing both geographically distinct and similar origins. Among the C. geophilum isolates analyzed there were fewer RFLPs in mt-DNA than in nuclear rDNA. EcoRI rDNA phenotypes between C. geophilum and Elaphomyces anthracinus, its proposed teleomorph or sexual state, did not correspond. In addition, the four

  2. Application of the Ribosomal DNA ITS2 Region of Physalis (Solanaceae): DNA Barcoding and Phylogenetic Study

    PubMed Central

    Feng, Shangguo; Jiang, Mengying; Shi, Yujun; Jiao, Kaili; Shen, Chenjia; Lu, Jiangjie; Ying, Qicai; Wang, Huizhong

    2016-01-01

    Recently, commercial interest in Physalis species has grown worldwide due to their high nutritional value, edible fruit, and potential medicinal properties. However, many Physalis species have similar shapes and are easily confused, and consequently the phylogenetic relationships between Physalis species are poorly understood. This hinders their safe utilization and genetic resource conservation. In this study, the nuclear ribosomal ITS2 region was used to identify species and phylogenetically examine Physalis. Eighty-six ITS2 regions from 45 Physalis species were analyzed. The ITS2 sequences were aligned using Clustal W and genetic distances were calculated using MEGA V6.0. The results showed that ITS2 regions have significant intra- and inter-specific divergences, obvious barcoding gaps, and higher species discrimination rates (82.2% for both the BLASTA1 and nearest distance methods). In addition, the secondary structure of ITS2 provided another way to differentiate species. Cluster analysis based on ITS2 regions largely concurred with the relationships among Physalis species established by many previous molecular analyses, and showed that most sections of Physalis appear to be polyphyletic. Our results demonstrated that ITS2 can be used as an efficient and powerful marker in the identification and phylogenetic study of Physalis species. The technique provides a scientific basis for the conservation of Physalis plants and for utilization of resources. PMID:27486467

  3. Application of the Ribosomal DNA ITS2 Region of Physalis (Solanaceae): DNA Barcoding and Phylogenetic Study.

    PubMed

    Feng, Shangguo; Jiang, Mengying; Shi, Yujun; Jiao, Kaili; Shen, Chenjia; Lu, Jiangjie; Ying, Qicai; Wang, Huizhong

    2016-01-01

    Recently, commercial interest in Physalis species has grown worldwide due to their high nutritional value, edible fruit, and potential medicinal properties. However, many Physalis species have similar shapes and are easily confused, and consequently the phylogenetic relationships between Physalis species are poorly understood. This hinders their safe utilization and genetic resource conservation. In this study, the nuclear ribosomal ITS2 region was used to identify species and phylogenetically examine Physalis. Eighty-six ITS2 regions from 45 Physalis species were analyzed. The ITS2 sequences were aligned using Clustal W and genetic distances were calculated using MEGA V6.0. The results showed that ITS2 regions have significant intra- and inter-specific divergences, obvious barcoding gaps, and higher species discrimination rates (82.2% for both the BLASTA1 and nearest distance methods). In addition, the secondary structure of ITS2 provided another way to differentiate species. Cluster analysis based on ITS2 regions largely concurred with the relationships among Physalis species established by many previous molecular analyses, and showed that most sections of Physalis appear to be polyphyletic. Our results demonstrated that ITS2 can be used as an efficient and powerful marker in the identification and phylogenetic study of Physalis species. The technique provides a scientific basis for the conservation of Physalis plants and for utilization of resources. PMID:27486467

  4. Molecular characterization of Fasciola gigantica from Mauritania based on mitochondrial and nuclear ribosomal DNA sequences.

    PubMed

    Amor, Nabil; Farjallah, Sarra; Salem, Mohamed; Lamine, Dia Mamadou; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine

    2011-10-01

    Fasciolosis caused by Fasciola hepatica and Fasciola gigantica (Platyhelminthes: Trematoda: Digenea) is considered the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. From Africa, F. gigantica has been previously characterized from Burkina Faso, Senegal, Kenya, Zambia and Mali, while F. hepatica has been reported from Morocco and Tunisia, and both species have been observed from Ethiopia and Egypt on the basis of morphometric differences, while the use of molecular markers is necessary to distinguish exactly between species. Samples identified morphologically as F. gigantica (n=60) from sheep and cattle from different geographical localities of Mauritania were genetically characterized by sequences of the first (ITS-1), the 5.8S, and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA) genes and the mitochondrial Cytochrome c Oxidase I (COI) gene. Comparison of the sequences of the Mauritanian samples with sequences of Fasciola spp. from GenBank confirmed that all samples belong to the species F. gigantica. The nucleotide sequencing of ITS rDNA of F. gigantica showed no nucleotide variation in the ITS-1, 5.8S, and ITS-2 rDNA sequences among all samples examined and those from Burkina Faso, Kenya, Egypt and Iran. The phylogenetic trees based on the ITS-1 and ITS-2 sequences showed a close relationship of the Mauritanian samples with isolates of F. gigantica from different localities of Africa and Asia. The COI genotypes of the Mauritanian specimens of F. gigantica had a high level of diversity, and they belonged to the F. gigantica phylogenically distinguishable clade. The present study is the first molecular characterization of F. gigantica in sheep and cattle from Mauritania, allowing a reliable approach for the genetic differentiation of Fasciola spp. and providing basis for further studies on liver flukes in the African countries.

  5. A phylogenetic analysis of Prunus and the Amygdaloideae (Rosaceae) using ITS sequences of nuclear ribosomal DNA.

    PubMed

    Lee, S; Wen, J

    2001-01-01

    The economically important plum or cherry genus (PRUNUS:) and the subfamily Amygdaloideae of the Rosaceae have a controversial taxonomic history due to the lack of a phylogenetic framework. Phylogenetic analysis using the ITS sequences of nuclear ribosomal DNA (nrDNA) was conducted to construct the evolutionary history and evaluate the historical classifications of PRUNUS: and the Amygdaloideae. The analyses suggest two major groups within the Amygdaloideae: (1) PRUNUS: s.l. (sensu lato) and MADDENIA:, and (2) EXOCHORDA:, Oemleria, and PRINSEPIA: The ITS phylogeny supports the recent treatment of including EXOCHORDA: (formerly in the Spiraeoideae) in the Amygdaloideae. MADDENIA: is found to be nested within PRUNUS: s.l. in the parsimony and distance analyses, but basal to PRUNUS: s.l. in the maximum likelihood analysis. Within PRUNUS:, two major groups are recognizable: (1) the AMYGDALUS:-PRUNUS: group, and (2) the CERASUS:-LAUROCERASUS:-PADUS: group. The clades in the ITS phylogeny are not congruent with most subgeneric groups in the widely used classification of PRUNUS: by Rehder. A broadly defined PRUNUS: is supported. PMID:11159135

  6. Hirudinella ventricosa (Pallas, 1774) Baird, 1853 represents a species complex based on ribosomal DNA.

    PubMed

    Calhoun, Dana M; Curran, Stephen S; Pulis, Eric E; Provaznik, Jennifer M; Franks, James S

    2013-10-01

    Digeneans in the genus Hirudinella de Blainville, 1828 (Hirudinellidae) from three species of pelagic fishes, Acanthocybium solandri (Cuvier), Makaira nigricans Lacépède and Thunnus albacares (Bonnaterre), and one benthic fish, Mulloidichthys martinicus (Cuvier), from the Gulf of Mexico are investigated using comparison of ribosomal DNA. Four species are identified based on molecular differences: Hirudinella ventricosa (Pallas, 1774) Baird, 1853 from A. solandri, Hirudinella ahi Yamaguti, 1970 from T. albacares, and two unidentified but distinct species of Hirudinella, herein referred to as Hirudinella sp. A (from both M. nigricans and M. martinicus) and Hirudinella sp. B from M. nigricans. Additionally, H. ahi, based tentatively on morphological identification, is reported from Thunnus thynnus (Linnaeus). This represents the first record of a hirudinellid from M. martinicus and the first record of H. ahi from T. thynnus. A phylogeny of some Hemiurata Skrjabin & Guschanskaja, 1954 using partial fragments of the 28S rDNA sequences is consistent with earlier phylogenies and the position of the Hirudinellidae Dollfus, 1932 is well-supported as a derived group most closely related to the Syncoeliidae Looss, 1899. PMID:24048751

  7. Variability of ribosomal DNA ITS-2 and its utility in detecting genetic relatedness of pearl oyster.

    PubMed

    He, Maoxian; Huang, Liangmin; Shi, Jianhua; Jiang, Yinping

    2005-01-01

    The objective of this study was to detect interspecific and intraspecific genetic variations of the second internal transcribed spacer of ribosomal DNA (ITS-2), and explore the feasibility of using it as a molecular marker phylogenetic analyses and species identification among pearl oysters. ITS-2 sequences of 6 pearl oysters were amplified via polymerase chain reaction. The amplified DNA fragments were about 500 bp, spanning the partial sequences of 5.8S and 28S rRNA genes. The GC contents of all species used in this study were higher than the AT contents. The variations of sequences involved substitutions as well as insertions/deletions and were mainly concentrated in spacer regions. Sequences of about 30-bp in spacer regions showed no variations among 5 Pincatda species. Intraindividual and intraspecific polymorphisms of ITS-2 sequences were detected in some species; the interspecific variability was significantly larger than the variability within species, and the variability at the genus level was higher than that at the species level. Both neighbor-joining and parsimony analyses of ITS-2 sequences revealed the distinguishable species boundary of 6 pearl oysters, and indicated that P. chemnitzi and P. nigra were the closely related species, as were P. maxima and P. margaritifera. The findings revealed that ITS-2 sequences could be an appropriate tool for phylogenetic study of pearl oysters.

  8. [Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

    PubMed

    Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

    2002-06-01

    Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

  9. Prevalence and Dynamics of Ribosomal DNA Micro-heterogeneity Are Linked to Population History in Two Contrasting Yeast Species

    PubMed Central

    James, Stephen A.; West, Claire; Davey, Robert P.; Dicks, Jo; Roberts, Ian N.

    2016-01-01

    Despite the considerable number and taxonomic breadth of past and current genome sequencing projects, many of which necessarily encompass the ribosomal DNA, detailed information on the prevalence and evolutionary significance of sequence variation in this ubiquitous genomic region are severely lacking. Here, we attempt to address this issue in two closely related yet contrasting yeast species, the baker’s yeast Saccharomyces cerevisiae and the wild yeast Saccharomyces paradoxus. By drawing on existing datasets from the Saccharomyces Genome Resequencing Project, we identify a rich seam of ribosomal DNA sequence variation, characterising 1,068 and 970 polymorphisms in 34 S. cerevisiae and 26 S. paradoxus strains respectively. We discover the two species sets exhibit distinct mutational profiles. Furthermore, we show for the first time that unresolved rDNA sequence variation resulting from imperfect concerted evolution of the ribosomal DNA region follows a U-shaped allele frequency distribution in each species, similar to loci that evolve under non-concerted mechanisms but arising through rather different evolutionary processes. Finally, we link differences between the shapes of these allele frequency distributions to the two species’ contrasting population histories. PMID:27345953

  10. Prevalence and Dynamics of Ribosomal DNA Micro-heterogeneity Are Linked to Population History in Two Contrasting Yeast Species.

    PubMed

    James, Stephen A; West, Claire; Davey, Robert P; Dicks, Jo; Roberts, Ian N

    2016-01-01

    Despite the considerable number and taxonomic breadth of past and current genome sequencing projects, many of which necessarily encompass the ribosomal DNA, detailed information on the prevalence and evolutionary significance of sequence variation in this ubiquitous genomic region are severely lacking. Here, we attempt to address this issue in two closely related yet contrasting yeast species, the baker's yeast Saccharomyces cerevisiae and the wild yeast Saccharomyces paradoxus. By drawing on existing datasets from the Saccharomyces Genome Resequencing Project, we identify a rich seam of ribosomal DNA sequence variation, characterising 1,068 and 970 polymorphisms in 34 S. cerevisiae and 26 S. paradoxus strains respectively. We discover the two species sets exhibit distinct mutational profiles. Furthermore, we show for the first time that unresolved rDNA sequence variation resulting from imperfect concerted evolution of the ribosomal DNA region follows a U-shaped allele frequency distribution in each species, similar to loci that evolve under non-concerted mechanisms but arising through rather different evolutionary processes. Finally, we link differences between the shapes of these allele frequency distributions to the two species' contrasting population histories. PMID:27345953

  11. Basic cytogenetics and physical mapping of 5S and 18S ribosomal genes in Hoplias malabaricus (Osteichthyes, Characiformes, Erythrinidae) from isolated natural lagoons: a conserved karyomorph along the Iguaçu river basin.

    PubMed

    Gemi, Gisele; Lui, Roberto Laridondo; Treco, Fernando Rodrigo; Paiz, Leonardo Marcel; Moresco, Rafaela Maria; Margarido, Vladimir Pavan

    2014-01-01

    Erythrinidae include Neotropical teleost fish that are widely distributed in South America. Hoplias Gill, 1903 include two large groups: H. malabaricus Bloch, 1794 and H. lacerdae Miranda Ribeiro, 1908. Hoplias malabaricus is characterized by remarkable karyotype diversity, with some karyomorphs widely distributed geographically while others are more restricted to certain river basins. Cytogenetic analyzes were performed in a population of Hoplias malabaricus from the Wildlife Refuge of Campos de Palmas, the Iguaçu River basin. The specimens showed diploid number of 42 chromosomes (24m+18sm) without differentiated sex chromosomes system. The impregnation by silver nitrate showed multiple AgNORs. Seven pairs (4, 7, 10, 13, 16, 20 and 21) carrying 18S rDNA were detected by FISH. Heterochromatin was verified in the centromeric and pericentromeric region of most chromosomes and the terminal region of some pairs. FISH with 5S rDNA probes showed two chromosome pairs carrying these sites in the interstitial region (8 and 14). The data obtained in this study are similar to those found for two other populations of H. malabaricus already studied in the basin of the Iguaçu River, confirming the hypothesis that this species is natural, not having been introduced, as well as having an intrinsic characteristic, such as the largest number of sites of 18S rDNA.

  12. Isolation of eukaryotic ribosomal proteins. Purification and characterization of the 40 S ribosomal subunit proteins Sa, Sc, S3a, S3b, S5', S9, S10, S11, S12, S14, S15, S15', S16, S17, S18, S19, S20, S21, S26, S27', and S29.

    PubMed

    Collatz, E; Ulbrich, N; Tsurugi, K; Lightfoot, H N; MacKinlay, W; Lin, A; Wool, I G

    1977-12-25

    The proteins of the small subunit of rat liver ribosomes were separated into five main groups by stepwise elution from carboxymethylcellulose with LiCl at pH 6.5. Twenty-one proteins (Sa, Sc, S3a, S3b, S5', S9, S10, S11, S12, S14, S15, S15', S16, S17, S18, S19, S20, S21, S26, S27', and S29) were isolated from three groups (A40, C40, and D40) by ion exchange chromatography on DEAE-cellulose, carboxymethylcellulose, and phosphocellulose and by filtration through Sephadex. The amount of protein obtained varied from 0.1 to 11 mg. Six of the proteins (S5', S10, S11, S18, S19, and S27') had no detectable contamination; the impurities in the others were no greater than 9%. The molecular weight of the proteins was estimated by polyacrylamide gel electrophoresis in sodium dodecyl sulfate; the amino acid composition was determined.

  13. Bile acid receptor TGR5, NADPH Oxidase NOX5-S and CREB Mediate Bile Acid-Induced DNA Damage In Barrett’s Esophageal Adenocarcinoma Cells

    PubMed Central

    Li, Dan; Cao, Weibiao

    2016-01-01

    The mechanisms whereby bile acid reflux may accelerate the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. In this study we found that bile acid taurodeoxycholic acid (TDCA) significantly increased the tail moment (TM) and histone H2AX phosphorylation in FLO-1 EA cells, an increase which was significantly decreased by knockdown of TGR5. Overexpression of TGR5 significantly increased TDCA-induced TM increase and H2AX phosphorylation. In addition, NADPH oxidase inhibitor diphenylene iodonium significantly inhibited the TDCA-induced increase in TM and H2AX phosphorylation. TDCA-induced increase in TM and H2AX phosphorylation was significantly decreased by knockdown of NOX5-S and overexpression of NOX5-S significantly increased TDCA-induced increase in the tail moment and H2AX phosphorylation. Furthermore, TDCA significantly increased cAMP response element binding protein (CREB) phosphorylation in FLO-1 cells. Knockdown of CREB significantly decreased TDCA-induced increase in NOX5-S mRNA and the tail moment. Conversely, overexpression of CREB significantly increased TDCA-induced TM increase. We conclude that TDCA-induced DNA damage may depend on the activation of TGR5, CREB and NOX5-S. It is possible that in Barrett’s patients bile acids may activate NOX5-S and increase reactive oxygen species (ROS) production via activation of TGR5 and CREB. NOX5-S-derived ROS may cause DNA damage, thereby contributing to the progression from BE to EA. PMID:27511066

  14. Bile acid receptor TGR5, NADPH Oxidase NOX5-S and CREB Mediate Bile Acid-Induced DNA Damage In Barrett's Esophageal Adenocarcinoma Cells.

    PubMed

    Li, Dan; Cao, Weibiao

    2016-01-01

    The mechanisms whereby bile acid reflux may accelerate the progression from Barrett's esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. In this study we found that bile acid taurodeoxycholic acid (TDCA) significantly increased the tail moment (TM) and histone H2AX phosphorylation in FLO-1 EA cells, an increase which was significantly decreased by knockdown of TGR5. Overexpression of TGR5 significantly increased TDCA-induced TM increase and H2AX phosphorylation. In addition, NADPH oxidase inhibitor diphenylene iodonium significantly inhibited the TDCA-induced increase in TM and H2AX phosphorylation. TDCA-induced increase in TM and H2AX phosphorylation was significantly decreased by knockdown of NOX5-S and overexpression of NOX5-S significantly increased TDCA-induced increase in the tail moment and H2AX phosphorylation. Furthermore, TDCA significantly increased cAMP response element binding protein (CREB) phosphorylation in FLO-1 cells. Knockdown of CREB significantly decreased TDCA-induced increase in NOX5-S mRNA and the tail moment. Conversely, overexpression of CREB significantly increased TDCA-induced TM increase. We conclude that TDCA-induced DNA damage may depend on the activation of TGR5, CREB and NOX5-S. It is possible that in Barrett's patients bile acids may activate NOX5-S and increase reactive oxygen species (ROS) production via activation of TGR5 and CREB. NOX5-S-derived ROS may cause DNA damage, thereby contributing to the progression from BE to EA. PMID:27511066

  15. Molecular characterization and physical mapping of two classes of 5S rDNA in the genomes of Gymnotus sylvius and G. inaequilabiatus (Gymnotiformes, Gymnotidae).

    PubMed

    Scacchetti, P C; Alves, J C P; Utsunomia, R; Claro, F L; de Almeida Toledo, L F; Oliveira, C; Foresti, F

    2012-01-01

    The nucleotide sequences of the 5S rRNA multigene family and their distribution across the karyotypes in 2 species of Gymnotiformes, genus Gymnotus (G. sylvius and G. inaequilabiatus) were investigated by means of fluorescence in situ hybridization (FISH). The results showed the existence of 2 distinct classes of 5S rDNA sequences in both species: class I and class II. A high conservative pattern of the codifying region of the 5S rRNA gene was identified, contrasting with significant alterations detected in the nontranscribed spacer (NTS). The presence of TATA-like sequences along the NTS of both species was an expected occurrence, since such sequences have been associated with the regulation of the gene expression. FISH using 5S rDNA class I and class II probes revealed that both gene classes were collocated in the same chromosome pair in the genome of G. sylvius, while in that of G. inaequilabiatus, class II appeared more disperse than class I.

  16. DNA damage stress induces the expression of ribosomal protein S27a gene in a p53-dependent manner.

    PubMed

    Nosrati, Nagisa; Kapoor, Neetu Rohit; Kumar, Vijay

    2015-03-15

    The small ribosomal protein RPS27a is known to play a role in the activation of cellular checkpoints via p53 which links ribosome biogenesis to cell cycle progression. Here, we show that RPS27a gene is a direct transcriptional target of p53 and is overexpressed in response to DNA damage. Elevated RPS27a level was associated with increased expression of p53 and its target p21(Waf1) gene. The RPS27a activity was specifically inhibited in the presence of a dominant negative mutant of p53. Down-regulation of ectopically expressed RPS27a by RNA interference blocked the activation of p21(waf1) in response to DNA damage. Thus, RPS27a appears to be a novel stress sensor in the cell which amplifies p53 response to arrest cell cycle.

  17. DNA damage stress induces the expression of ribosomal protein S27a gene in a p53-dependent manner.

    PubMed

    Nosrati, Nagisa; Kapoor, Neetu Rohit; Kumar, Vijay

    2015-03-15

    The small ribosomal protein RPS27a is known to play a role in the activation of cellular checkpoints via p53 which links ribosome biogenesis to cell cycle progression. Here, we show that RPS27a gene is a direct transcriptional target of p53 and is overexpressed in response to DNA damage. Elevated RPS27a level was associated with increased expression of p53 and its target p21(Waf1) gene. The RPS27a activity was specifically inhibited in the presence of a dominant negative mutant of p53. Down-regulation of ectopically expressed RPS27a by RNA interference blocked the activation of p21(waf1) in response to DNA damage. Thus, RPS27a appears to be a novel stress sensor in the cell which amplifies p53 response to arrest cell cycle. PMID:25592822

  18. Ribosomal DNA internal transcribed spacer analysis supports synonomy of Scedosporium inflatum and Lomentospora prolificans.

    PubMed Central

    Lennon, P A; Cooper, C R; Salkin, I F; Lee, S B

    1994-01-01

    Scedosporium inflatum is a dematiaceous opportunistic pathogen originally described by D. Malloch and I.F. Salkin (Mycotaxon 21:247-255, 1984). However, E. Gueho and G. S. De Hoog (J. Mycol. Med. 118:3-9, 1991) recently suggested reducing this mold to synonomy with Lomentospora prolificans on the basis of their similar morphological and molecular characteristics. We have investigated the ribosomal DNA internal transcribed spacers (ITS), i.e., ITS I and ITS II, of 18 isolates, including these two fungi and a closely related pathogen, Scedosporium apiospermum, and its telemorph, Pseudallescheria boydii. Identical ITS restriction fragment length polymorphisms were found in eight isolates of S. inflatum and L. prolificans. These results support Gueho and De Hoog's proposal to combine S. inflatum and L. prolificans into the binomial Scedosporium prolificans. However, the ITS I sequence of S. apiospermum and the ITS restriction fragment length polymorphisms of S. apiospermum and P. boydii were found to be significantly different from those of S. inflatum and L. prolificans. The ITS restriction pattern differences may be valuable in clinical settings for distinguishing these fungi. Images PMID:7814476

  19. Origin and relationships of Saintpaulia (Gesneriaceae) based on ribosomal DNA internal transcribed spacer (ITS) sequences.

    PubMed

    Moller, M; Cronk, Q

    1997-07-01

    Phylogenetic relationships of eight species of Saintpaulia H. Wendl., 19 species of Streptocarpus Lindl. (representing all major growth forms within the genus), and two outgroups (Haberlea rhodopensis Friv., Chirita spadiciformis W. T. Wang) were examined using comparative nucleotide sequences from the two internal transcribed spacers (ITS) of nuclear ribosomal DNA. The length of the ITS 1 region ranged from 228 to 249 base pairs (bp) and the ITS 2 region from 196 to 245 bp. Pairwise sequence divergence across both spacers for ingroup and outgroup species ranged from 0 to 29%. Streptocarpus is not monophyletic, and Saintpaulia is nested within Streptocarpus subgenus Streptocarpella. Streptocarpus subgenus Streptocarpus is monophyletic. The ITS sequence data demonstrate that the unifoliate Streptocarpus species form a clade, and are also characterized by a unique 47-bp deletion in ITS 2. The results strongly support the monophyly of (1) Saintpaulia, and (2) Saintpaulia plus the African members of the subgenus Streptocarpella of Streptocarpus. The data suggest the evolution of Saintpaulia from Streptocarpus subgenus Streptocarpella. The differences in flower and vegetative characters are probably due to ecological adaptation leading to a relatively rapid radiation of Saintpaulia. PMID:21708650

  20. Global functional analysis of nucleophosmin in Taxol response, cancer, chromatin regulation, and ribosomal DNA transcription

    SciTech Connect

    Bergstralh, Daniel T. . E-mail: dan.bergstralh@med.unc.edu; Conti, Brian J.; Moore, Chris B.; Brickey, W. June; Taxman, Debra J.; Ting, Jenny P.-Y.

    2007-01-01

    Analysis of lung cancer response to chemotherapeutic agents showed the accumulation of a Taxol-induced protein that reacted with an anti-phospho-MEK1/2 antibody. Mass spectroscopy identified the protein as nucleophosmin/B23 (NPM), a multifunctional protein with diverse roles: ribosome biosynthesis, p53 regulation, nuclear-cytoplasmic shuttling, and centrosome duplication. Our work demonstrates that following cellular exposure to mitosis-arresting agents, NPM is phosphorylated and its chromatographic property is altered, suggesting changes in function during mitosis. To determine the functional relevance of NPM, its expression in tumor cells was reduced by siRNA. Cells with reduced NPM were treated with Taxol followed by microarray profiling accompanied by gene/protein pathway analyses. These studies demonstrate several expected and unexpected consequences of NPM depletion. The predominant downstream effectors of NPM are genes involved in cell proliferation, cancer, and the cell cycle. In congruence with its role in cancer, NPM is over-expressed in primary malignant lung cancer tissues. We also demonstrate a role for NPM in the expression of genes encoding SET (TAF1{beta}) and the histone methylase SET8. Additionally, we show that NPM is required for a previously unobserved G2/M upregulation of TAF1A, which encodes the rDNA transcription factor TAF{sub I}48. These results demonstrate multi-faceted functions of NPM that can affect cancer cells.

  1. A cryptic intracellular green alga in Ginkgo biloba: ribosomal DNA markers reveal worldwide distribution.

    PubMed

    Trémouillaux-Guiller, Jocelyne; Huss, Volker A R

    2007-07-01

    Intracellular symbioses involving eukaryotic microalgae and a variety of heterotrophic protists and invertebrates are widespread, but are unknown in higher plants. Recently, we reported the isolation and molecular identification of a Coccomyxa-like green alga from in vitro cell cultures of Ginkgo biloba L. This alga resides intracellularly in an immature "precursor" form with a nonfunctional chloroplast, implying that algal photosynthetic activity has no role in this endosymbiosis. In necrotizing Ginkgo cells, precursors evolved into mature algae, proliferated, and were liberated into the culture medium after host cell bursting. In the present paper we demonstrate by molecular methods a worldwide distribution of the alga in planta. Endosymbiont-specific sequences of ribosomal DNA could be traced in Ginkgo tissues of each specimen examined from different geographic locations in Europe, North America, and Asia. The Ginkgo/Coccomyca association represents a new kind of intracellular, vertically inherited symbiosis. Storage bodies, probably of lipid nature, present in the cytoplasm of each partner suggest a possible involvement of the endosymbiont in metabolic pathways of its host.

  2. Phylogenetic position of Gromia oviformis Dujardin inferred from nuclear-encoded small subunit ribosomal DNA.

    PubMed

    Burki, Fabien; Berney, Cédric; Pawlowski, Jan

    2002-09-01

    Gromia oviformis Dujardin is a common marine protist characterised by a large, globular test and filose pseudopodia. First considered a foraminifer, Gromia was later placed within the Filosea and recently included among amoebae of uncertain affinities. In order to clarify the phylogenetic position of this genus, we sequenced the complete small-subunit ribosomal DNA gene of G. oviformis collected at five different geographic localities. The high divergence of obtained sequences suggests that G. oviformis is a species complex composed of several genetically distinct sibling species. Sequence analyses show Gromia to be a member of the Cercozoa, a heterogeneous assemblage which includes filose amoebae, the amoeboflagellate cercomonads, the chlorarachniophytes and the plasmodiophorid plant pathogens. Contrary to traditional classification, Gromia is not closely related to other testate filose amoebae (the Euglyphida), but seems to branch early among the Cercozoa. Our analyses also show a close relationship between the Cercozoa and the Acantharea. Because the Cercozoa are related to the Foraminifera based on other molecular data, we propose that most protists possessing filopodia, reticulopodia and axopodia have a common origin.

  3. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).

    PubMed

    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C

    2015-01-01

    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition. PMID:26634462

  4. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).

    PubMed

    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C

    2015-11-25

    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition.

  5. Pseudanoplocephala crawfordi is a member of genus Hymenolepis based on phylogenetic analysis using ribosomal and mitochondrial DNA sequences.

    PubMed

    Jia, Yan-Qing; Yan, Wen-Chao; Du, Shuai-Zhi; Song, Jun-Ke; Zhao, Wen; Zhao, Yu-Xin; Cheng, Wen-Yu; Zhao, Guang-Hui

    2016-05-01

    Pseudanoplocephala crawfordi is one of the important zoonotic cestodes causing economic significance and public health concern. In the present study, the phylogenetic position of P. crawfordi isolated from pigs was re-inferred using molecular markers of internal transcribed spacer ribosomal DNA (ITS rDNA) and partial NADH dehydrogenase subunit 1 (pnad1) mitochondrial DNA. The lengths of ITS1, ITS2 rDNA and pnad1 were 757 bp, 628 bp and 458 bp, respectively. Sequence differences in the ITS1, ITS2 rDNA and pnad1 between P. crawfordi and Hymenolepis species were smaller than that between cestodes within genus Hymenolepis. Phylogenetic analyses based on three gene fragments showed that P. crawfordi was grouped into cluster of Hymenolepis species. These results suggested that P. crawfordi would be one member of genus Hymenolepis but not in a new genus Pseudanoplocephala.

  6. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  7. 16S partial gene mitochondrial DNA and internal transcribed spacers ribosomal DNA as differential markers of Trichuris discolor populations.

    PubMed

    Callejón, R; Halajian, A; de Rojas, M; Marrugal, A; Guevara, D; Cutillas, C

    2012-05-25

    Comparative morphological, biometrical and molecular studies of Trichuris discolor isolated from Bos taurus from Spain and Iran was carried out. Furthermore, Trichuris ovis isolated from B. taurus and Capra hircus from Spain has been, molecularly, analyzed. Morphological studies revealed clear differences between T. ovis and T. discolor isolated from B. taurus but differences were not observed between populations of T. discolor isolated from different geographical regions. Nevertheless, the molecular studies based on the amplification and sequencing of the internal transcribed spacers 1 and 2 ribosomal DNA and 16S partial gene mitochondrial DNA showed clear differences between both populations of T. discolor from Spain and Iran suggesting two cryptic species. Phylogenetic studies corroborated these data. Thus, phylogenetic trees based on ITS1, ITS2 and 16S partial gene sequences showed that individuals of T. discolor from B. taurus from Iran clustered together and separated, with high bootstrap values, of T. discolor isolated from B. taurus from Spain, while populations of T. ovis from B. taurus and C. hircus from Spain clustered together but separated with high bootstrap values of both populations of T. discolor. Furthermore, a comparative phylogenetic study has been carried out with the ITS1and ITS2 sequences of Trichuris species from different hosts. Three clades were observed: the first clustered all the species of Trichuris parasitizing herbivores (T. discolor, T. ovis, Trichuris leporis and Trichuris skrjabini), the second clustered all the species of Trichuris parasitizing omnivores (Trichuris trichiura and Trichuris suis) and finally, the third clustered species of Trichuris parasitizing carnivores (Trichuris muris, Trichuris arvicolae and Trichuris vulpis).

  8. Measurement of (5'R)- and (5'S)-8,5'-cyclo-2'-deoxyadenosines in DNA in vivo by liquid chromatography/isotope-dilution tandem mass spectrometry

    SciTech Connect

    Jaruga, Pawel; Xiao, Yan; Nelson, Bryant C.; Dizdaroglu, Miral

    2009-09-04

    Oxidatively induced DNA lesions (5'R)- and (5'S)-8,5'-cyclo-2'-deoxyadenosines (R-cdA and S-cdA) are detectable and accumulate in vivo due to disease states and defects in DNA repair. They block transcription and inhibit gene expression, and may play a role in disease processes. Accurate measurement of these lesions in DNA in vivo is necessary to understand their biological effects. We report on a methodology using liquid chromatography/isotope-dilution tandem mass spectrometry to measure R-cdA and S-cdA in DNA. This methodology permitted the detection of these compounds at a level of 0.1 fmol on-column. Levels of R-cdA and S-cdA in mouse liver DNA amounted to 0.133 {+-} 0.024 and 0.498 {+-} 0.065 molecules/10{sup 7} DNA 2'-deoxynucleosides, respectively. The successful measurement of R-cdA and S-cdA in DNA in vivo suggests that this methodology will be used for understanding of their repair and biological consequences, and that these compounds may be used as putative biomarkers for disease states.

  9. Nucleotide sequence of cDNA coding for dianthin 30, a ribosome inactivating protein from Dianthus caryophyllus.

    PubMed

    Legname, G; Bellosta, P; Gromo, G; Modena, D; Keen, J N; Roberts, L M; Lord, J M

    1991-08-27

    Rabbit antibodies raised against dianthin 30, a ribosome inactivating protein from carnation (Dianthus caryophyllus) leaves, were used to identify a full length dianthin precursor cDNA clone from a lambda gt11 expression library. N-terminal amino acid sequencing of purified dianthin 30 and dianthin 32 confirmed that the clone encoded dianthin 30. The cDNA was 1153 basepairs in length and encoded a precursor protein of 293 amino acid residues. The first 23 N-terminal amino acids of the precursor represented the signal sequence. The protein contained a carboxy-terminal region which, by analogy with barley lectin, may contain a vacuolar targeting signal.

  10. Ribosomal DNA clusters and telomeric (TTAGG)n repeats in blue butterflies (Lepidoptera, Lycaenidae) with low and high chromosome numbers.

    PubMed

    Vershinina, Alisa O; Anokhin, Boris A; Lukhtanov, Vladimir A

    2015-01-01

    Ribosomal DNA clusters and telomeric repeats are important parts of eukaryotic genome. However, little is known about their organization and localization in karyotypes of organisms with holocentric chromosomes. Here we present first cytogenetic study of these molecular structures in seven blue butterflies of the genus Polyommatus Latreille, 1804 with low and high chromosome numbers (from n=10 to n=ca.108) using fluorescence in situ hybridization (FISH) with 18S rDNA and (TTAGG) n telomeric probes. FISH with the 18S rDNA probe showed the presence of two different variants of the location of major rDNA clusters in Polyommatus species: with one or two rDNA-carrying chromosomes in haploid karyotype. We discuss evolutionary trends and possible mechanisms of changes in the number of ribosomal clusters. We also demonstrate that Polyommatus species have the classical insect (TTAGG) n telomere organization. This chromosome end protection mechanism probably originated de novo in small chromosomes that evolved via fragmentations.

  11. Advantages and limitations of ribosomal RNA PCR and DNA sequencing for identification of bacteria in cardiac valves of danish patients.

    PubMed

    Kemp, Michael; Bangsborg, Jette; Kjerulf, Anne; Schmidt, Thomas Andersen; Christensen, John; Irmukhamedov, Akhmadjon 6; Bruun, Niels Eske; Dargis, Rimtas; Andresen, Keld; Christensen, Jens Jørgen

    2013-01-01

    Studies on the value of culture-independent molecular identification of bacteria in cardiac valves are mostly restricted to comparing agreement of identification to what is obtained by culture to the number of identified bacteria in culture-negative cases. However, evaluation of the usefulness of direct molecular identification should also address weaknesses, their relevance in the given setting, and possible improvements. In this study cardiac valves from 56 Danish patients referred for surgery for infective endocarditis were analysed by microscopy and culture as well as by PCR targeting part of the bacterial 16S rRNA gene followed by DNA sequencing of the PCR product. PCR and DNA sequencing identified significant bacteria in 49 samples from 43 patients, including five out of 13 culture-negative cases. No rare, exotic, or intracellular bacteria were identified. There was a general agreement between bacterial identity obtained by ribosomal PCR and DNA sequencing from the valves and bacterial isolates from blood culture. However, DNA sequencing of the 16S rRNA gene did not discriminate well among non-haemolytic streptococci, especially within the Streptococcus mitis group. Ribosomal PCR with subsequent DNA sequencing is an efficient and reliable method of identifying the cause of IE, but exact species identification of some of the most common causes, i.e. non-haemolytic streptococci, may be improved with other molecular methods. PMID:24403979

  12. Ribosomal DNA clusters and telomeric (TTAGG)n repeats in blue butterflies (Lepidoptera, Lycaenidae) with low and high chromosome numbers

    PubMed Central

    Vershinina, Alisa O.; Anokhin, Boris A.; Lukhtanov, Vladimir A.

    2015-01-01

    Abstract Ribosomal DNA clusters and telomeric repeats are important parts of eukaryotic genome. However, little is known about their organization and localization in karyotypes of organisms with holocentric chromosomes. Here we present first cytogenetic study of these molecular structures in seven blue butterflies of the genus Polyommatus Latreille, 1804 with low and high chromosome numbers (from n=10 to n=ca.108) using fluorescence in situ hybridization (FISH) with 18S rDNA and (TTAGG)n telomeric probes. FISH with the 18S rDNA probe showed the presence of two different variants of the location of major rDNA clusters in Polyommatus species: with one or two rDNA-carrying chromosomes in haploid karyotype. We discuss evolutionary trends and possible mechanisms of changes in the number of ribosomal clusters. We also demonstrate that Polyommatus species have the classical insect (TTAGG)n telomere organization. This chromosome end protection mechanism probably originated de novo in small chromosomes that evolved via fragmentations. PMID:26140159

  13. Chromosome mapping of 18S rDNA and 5S rDNA by dual-color fluorescence in situ hybridization in the half-smooth tongue sole (Cynoglossus semilaevis).

    PubMed

    Jiang, L; Jiang, J; Liu, J; Yuan, J; Chen, Y; Zhang, Q; Wang, X

    2014-12-18

    Half-smooth tongue sole (Cynoglossus semilaevis) is an important aquaculture flatfish in China. Cytogenetic analysis has revealed that its sex determination system is female heterogametic (ZZ/ZW). The W chromosome is morphologically larger and has been considered evolutionarily younger than any other chromosome in the set. However, the genetic origin and evolution process of this neo-chromosome remains unclear. In this study, 2 tandem arrays of rRNA genes were chosen to address this question. Both the major rDNA (18S rDNA) and the minor rDNA (5S rDNA) were located on the C. semilaevis chromosomes by fluorescence in situ hybridization (FISH). Six 18S rDNA signals were observed on the centromeric regions of 3 pairs of autosomes in both males and females. In females, there was an additional 18S rDNA signal mapping to the telomeric region of the W chromosome long arm. With respect to the 5S rDNA, 12 signals were mapped to the centromeric regions of six pairs of autosomes. Two-color FISH further confirmed that the two pairs of the 5S rDNA signals were correspondingly located at the same positions of the same autosomes as those of the 18S rDNA signals. These results allowed us to speculate about the evolution process of the W chromosome. Chromosome fusions and repetitive sequence accumulations might have occurred in C. semilaevis. The synteny and non-synteny of C. semilaevis 18S rDNA and 5S rDNA might imply the original and evolutionary characteristics of this species. These findings will facilitate studies on karyotype evolution of the order Pleuronectiformes.

  14. Phylogenetic Relationships in Bupleurum (Apiaceae) Based on Nuclear Ribosomal DNA ITS Sequence Data

    PubMed Central

    NEVES, SUSANA S.; WATSON, MARK F.

    2004-01-01

    • Backgroud and Aims The genus Bupleurum has long been recognized as a natural group, but its infrageneric classification is controversial and has not yet been studied in the light of sequence data. • Methods Phylogenetic relationships among 32 species (35 taxa) of the genus Bupleurum were investigated by comparative sequencing of the ITS region of the 18–26S nuclear ribosomal DNA repeat. Exemplar taxa from all currently accepted sections and subsections of the genus were included, along with outgroups from four other early branching Apioideae genera (Anginon, Heteromorpha, Physospermum and Pleurospermum). • Key Results Phylogenies generated by maximum parsimony, maximum likelihood, and neighbour‐joining methods show similar topologies, demonstrating monophyly of Bupleurum and the division of the genus into two major clades. This division is also supported by analysis of the 5.8S coding sequence alone. The first branching clade is formed by all the species of the genus with pinnate‐reticulate veined leaves and B. rigidum with a unique type of leaf venation. The other major clade includes the remaining species studied, all of which have more or less parallel‐veined leaves. • Conclusions These phylogenetic results do not agree with any previous classifications of the genus. Molecular data also suggest that the endemic Macaronesian species B. salicifolium is a neoendemic, as the sequence divergence between the populations in Madeira and Canary Islands, and closer mainland relatives in north‐west Africa is small. All endemic north‐west African taxa are included in a single unresolved but well‐supported clade, and the low nucleotide variation of ITS suggests a recent radiation within this group. The only southern hemisphere species, B. mundii (southern Africa), is shown to be a neoendemic, apparently closely related to B. falcatum, a Eurasian species. PMID:14980972

  15. A phylogenetic study on galactose-containing Candida species based on 18S ribosomal DNA sequences.

    PubMed

    Suzuki, Motofumi; Suh, Sung-Oui; Sugita, Takashi; Nakase, Takashi

    1999-10-01

    Phylogenetic relationships of 33 Candida species containing galactose in the cells were investigated by using 18S ribosomal DNA sequence analysis. Galactose-containing Candida species and galactose-containing species from nine ascomycetous genera were a heterogeneous assemblage. They were divided into three clusters (II, III, and IV) which were phylogenetically distant from cluster I, comprising 9 galactose-lacking Candida species, C. glabrata, C. holmii, C. krusei, C. tropicalis (the type species of Candida), C. albicans, C. viswanathii, C. maltosa, C. parapsilosis, C. guilliermondii, and C. lusitaniae, and 17 related ascomycetous yeasts. These three clusters were also phylogenetically distant from Schizosaccharomyces pombe, which contains galactomannan in its cell wall. Cluster II comprised C. magnoliae, C. vaccinii, C. apis, C. gropengiesseri, C. etchellsii, C. floricola, C. lactiscondensi, Wickerhamiella domercqiae, C. versatilis, C. azyma, C. vanderwaltii, C. pararugosa, C. sorbophila, C. spandovensis, C. galacta, C. ingens, C. incommunis, Yarrowia lipolytica, Galactomyces geotrichum, and Dipodascus albidus. Cluster III comprised C. tepae, C. antillancae and its synonym C. bondarzewiae, C. ancudensis, C. petrohuensis, C. santjacobensis, C. ciferrii (anamorph of Stephanoascus ciferrii), Arxula terrestris, C. castrensis, C. valdiviana, C. paludigena, C. blankii, C. salmanticensis, C. auringiensis, C. bertae, and its synonym C. bertae var. chiloensis, C. edax (anamorph of Stephanoascus smithiae), Arxula adeninivorans, and C. steatolytica (synonym of Zygoascus hellenicus). Cluster IV comprised C. cantarellii, C. vinaria, Dipodascopsis uninucleata, and Lipomyces lipofer. Two galactose-lacking and Q-8-forming species, C. stellata and Pichia pastoris, and 5 galactose-lacking and Q-9-forming species, C. apicola, C. bombi, C. bombicola, C. geochares, and C. insectalens, were included in Cluster II. Two galactose-lacking and Q-9-forming species, C. drimydis and C

  16. Seasonal Succession Leads to Habitat-Dependent Differentiation in Ribosomal RNA:DNA Ratios among Freshwater Lake Bacteria

    PubMed Central

    Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.; Schmidt, Marian L.

    2016-01-01

    Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA gene sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. However, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors. PMID:27199936

  17. Seasonal succession leads to habitat-dependent differentiation in ribosomal RNA:DNA ratios among freshwater lake bacteria

    DOE PAGES

    Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.; Schmidt, Marian L.

    2016-04-29

    Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA genemore » sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. Furthermore, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.« less

  18. Seasonal Succession Leads to Habitat-Dependent Differentiation in Ribosomal RNA:DNA Ratios among Freshwater Lake Bacteria.

    PubMed

    Denef, Vincent J; Fujimoto, Masanori; Berry, Michelle A; Schmidt, Marian L

    2016-01-01

    Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA gene sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. However, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors. PMID:27199936

  19. Detection and identification of the Candida species by 25S ribosomal DNA analysis in the urine of candidal cystitis.

    PubMed

    Kano, Rui; Hattori, Yousuke; Okuzumi, Katsuko; Miyazaki, Yoshio; Yamauchi, Rie; Koie, Hiroshi; Watari, Toshihiro; Hasegawa, Atsuhiko

    2002-02-01

    Candida species in clinical urine samples were identified directly by the newly developed method of PCR analysis on 25S ribosomal DNA (rDNA). Two dogs were referred to the Animal Medical Center, Nihon University School of Veterinary Medicine, Fujisawa, Kanagawa, Japan for the examination of chronic cystitis. Microscopic examination of urine samples from these dogs revealed yeast cells. Urine culture on Sabouraud's dextrose agar at 27 degrees C for 5 days produced white to cream colored colonies. The isolates were identifical to Candida albicans and C. parapsilosis by mycological examination, respectively. The nucleotide sequences of 25S ribosomal DNA from these urine isolates showed 99% similarity to those of a reference strain of Candida albicans or C. parapsilosis. The nucleotide sequences of 25S rDNA obtained directly from urine samples were also identical to C. albicans and C. parapsilosis, respectively. Confirming the results on the isolates cultured from the same urine samples. This PCR analysis method could be available for the direct identification of Candida species in urine samples within 2 days.

  20. Abundant 5S rRNA-like transcripts encoded by the mitochondrial genome in amoebozoa.

    PubMed

    Bullerwell, Charles E; Burger, Gertraud; Gott, Jonatha M; Kourennaia, Olga; Schnare, Murray N; Gray, Michael W

    2010-05-01

    5S rRNAs are ubiquitous components of prokaryotic, chloroplast, and eukaryotic cytosolic ribosomes but are apparently absent from mitochondrial ribosomes (mitoribosomes) of many eukaryotic groups including animals and fungi. Nevertheless, a clearly identifiable, mitochondrion-encoded 5S rRNA is present in Acanthamoeba castellanii, a member of Amoebozoa. During a search for additional mitochondrial 5S rRNAs, we detected small abundant RNAs in other members of Amoebozoa, namely, in the lobose amoeba Hartmannella vermiformis and in the myxomycete slime mold Physarum polycephalum. These RNAs are encoded by mitochondrial DNA (mtDNA), cosediment with mitoribosomes in glycerol gradients, and can be folded into a secondary structure similar to that of bona fide 5S rRNAs. Further, in the mtDNA of another slime mold, Didymium nigripes, we identified a region that in sequence, potential secondary structure, and genomic location is similar to the corresponding region encoding the Physarum small RNA. A mtDNA-encoded small RNA previously identified in Dictyostelium discoideum is here shown to share several characteristics with known 5S rRNAs. Again, we detected genes encoding potential homologs of this RNA in the mtDNA of three other species of the genus Dictyostelium as well as in a related genus, Polysphondylium. Taken together, our results indicate a widespread occurrence of small, abundant, mtDNA-encoded RNAs with 5S rRNA-like structures that are associated with the mitoribosome in various amoebozoan taxa. Our working hypothesis is that these novel small abundant RNAs represent radically divergent mitochondrial 5S rRNA homologs. We posit that currently unrecognized 5S-like RNAs may exist in other mitochondrial systems in which a conventional 5S rRNA cannot be identified.

  1. Cloning and sequencing of cDNA encoding the human ribosomal protein L11 mRNA

    SciTech Connect

    Mishin, V.P.; Filipenko, M.L.; Muravlev, A.I.

    1995-02-01

    To clone the RPL11 cDNA, we used a polymerase chain reaction (PCR) with the single-stranded cDNA synthesized on the total placentary poly(A){sup +}mRNA with the use of primer M245 containing a 3{prime}-terminal oligo(dT)-tract, the 5{prime}terminal hexadecanucleotide sequence of the M13 universal primer, and a NotiI restriction site between them. On the basis of the known sequence of the 5{prime}-end of the human ribosomal protein L11 mRNA, we chose two partially overlapping deoxyribooligonucleotides as 5{prime}-terminal primers in the amplification of the RPL11 cDNA. A pair of partially overlapping oligonucleotides complementary to the oligo(dT)-containing primer were used as 3{prime}-terminal primers.

  2. Phylogenetic position of Rhynchopus sp. and Diplonema ambulator as indicated by analyses of euglenozoan small subunit ribosomal DNA.

    PubMed

    Busse, I; Preisfeld, Angelika

    2002-02-01

    The taxa Rhynchopus Skuja and Diplonema Griessmann were first described as remarkable protists with euglenid affinities. Later on, the placement of Diplonema within the Euglenozoa was confirmed by molecular data. For this study two new sequences were added to the euglenozoan data set. The uncertainly placed Rhynchopus can be identified as a close relative to Diplonema by small subunit ribosomal DNA (SSU rDNA) analysis. The new sequence of Diplonema ambulator is in close relationship to two other Diplonema species. Our molecular analyses clearly support the monophyly of the diplonemids comprising Rhynchopus and Diplonema. Yet the topology at the base of the euglenozoan tree remains unresolved, and especially the monophyly of the euglenids is arguable. SSU rDNA sequence analyses suggest that significantly different GC contents, high mutational saturation in the euglenids, and different evolutionary rates in the euglenozoan clades make it difficult to identify any sister group to the diplonemids.

  3. Ribosomal DNA locus variation and REMAP analysis of the diploid and triploid complexes of Lilium lancifolium.

    PubMed

    Nguyen, Truong Xuan; Lee, Sung-Il; Rai, Rameshwar; Kim, Nam-Soo; Kim, Jong Hwa

    2016-08-01

    Lilium lancifolium Thunb. (2n = 2x = 24) is a cytologically conspicuous species with both diploids and triploids in nature. Cytological and molecular genetic analyses were carried out in both diploids and triploids that were collected from 55 geographical locations in Korea, Japan, and China. While the 5S rRNA gene loci were located at duplicated loci on the long arm of chromosome 2, the 45S rRNA gene loci were present in chromosomes 1, 2, 4, 6, 7, and 11. While the loci on chromosomes 1 and 7 were constant, the loci on chromosomes 2, 4, 6, 7, and 11 were variable in some plants so that the L. lancifolium accessions were grouped into 7 cytotypes in diploids and 12 cytotypes in triploids. REMAP marker analysis revealed that the diploids were classified into seven clusters, and the triploids were classified into a large cluster. Geographic, cytological, and genetic differentiations were not related in both the diploid and triploid accessions of L. lancifolium. Thus, current genetic variations occurred prior to the geographic differentiation in both diploids and triploids, and the 45S rDNA cytotype variations occurred after geographic differentiation in the current habitats of L. lancifolium. PMID:27458741

  4. New Primers for Discovering Fungal Diversity Using Nuclear Large Ribosomal DNA.

    PubMed

    Asemaninejad, Asma; Weerasuriya, Nimalka; Gloor, Gregory B; Lindo, Zoë; Thorn, R Greg

    2016-01-01

    Metabarcoding has become an important tool in the discovery of biodiversity, including fungi, which are the second most speciose group of eukaryotes, with diverse and important ecological roles in terrestrial ecosystems. We have designed and tested new PCR primers that target the D1 variable region of nuclear large subunit (LSU) ribosomal DNA; one set that targets the phylum Ascomycota and another that recovers all other fungal phyla. The primers yield amplicons compatible with the Illumina MiSeq platform, which is cost-effective and has a lower error rate than other high throughput sequencing platforms. The new primer set LSU200A-F/LSU476A-R (Ascomycota) yielded 95-98% of reads of target taxa from environmental samples, and primers LSU200-F/LSU481-R (all other fungi) yielded 72-80% of target reads. Both primer sets have fairly low rates of data loss, and together they cover a wide variety of fungal taxa. We compared our results with these primers by amplifying and sequencing a subset of samples using the previously described ITS3_KYO2/ITS4_KYO3 primers, which amplify the internal transcribed spacer 2 (ITS2) of Ascomycota and Basidiomycota. With approximately equivalent read depth, our LSU primers recovered a greater number and phylogenetic diversity of sequences than the ITS2 primers. For instance, ITS3_KYO2/ITS4_KYO3 primers failed to pick up any members of Eurotiales, Mytilinidiales, Pezizales, Saccharomycetales, or Venturiales within Ascomycota, or members of Exobasidiomycetes, Microbotryomycetes, Pucciniomycetes, or Tremellomycetes within Basidiomycota, which were retrieved in good numbers from the same samples by our LSU primers. Among the OTUs recovered using the LSU primers were 127 genera and 28 species that were not obtained using the ITS2 primers, although the ITS2 primers recovered 10 unique genera and 16 species that were not obtained using either of the LSU primers These features identify the new primer sets developed in this study as useful

  5. New Primers for Discovering Fungal Diversity Using Nuclear Large Ribosomal DNA

    PubMed Central

    Gloor, Gregory B.; Lindo, Zoë

    2016-01-01

    Metabarcoding has become an important tool in the discovery of biodiversity, including fungi, which are the second most speciose group of eukaryotes, with diverse and important ecological roles in terrestrial ecosystems. We have designed and tested new PCR primers that target the D1 variable region of nuclear large subunit (LSU) ribosomal DNA; one set that targets the phylum Ascomycota and another that recovers all other fungal phyla. The primers yield amplicons compatible with the Illumina MiSeq platform, which is cost-effective and has a lower error rate than other high throughput sequencing platforms. The new primer set LSU200A-F/LSU476A-R (Ascomycota) yielded 95–98% of reads of target taxa from environmental samples, and primers LSU200-F/LSU481-R (all other fungi) yielded 72–80% of target reads. Both primer sets have fairly low rates of data loss, and together they cover a wide variety of fungal taxa. We compared our results with these primers by amplifying and sequencing a subset of samples using the previously described ITS3_KYO2/ITS4_KYO3 primers, which amplify the internal transcribed spacer 2 (ITS2) of Ascomycota and Basidiomycota. With approximately equivalent read depth, our LSU primers recovered a greater number and phylogenetic diversity of sequences than the ITS2 primers. For instance, ITS3_KYO2/ITS4_KYO3 primers failed to pick up any members of Eurotiales, Mytilinidiales, Pezizales, Saccharomycetales, or Venturiales within Ascomycota, or members of Exobasidiomycetes, Microbotryomycetes, Pucciniomycetes, or Tremellomycetes within Basidiomycota, which were retrieved in good numbers from the same samples by our LSU primers. Among the OTUs recovered using the LSU primers were 127 genera and 28 species that were not obtained using the ITS2 primers, although the ITS2 primers recovered 10 unique genera and 16 species that were not obtained using either of the LSU primers These features identify the new primer sets developed in this study as useful

  6. Evolutionary relationships among members of the genus Chlamydia based on 16S ribosomal DNA analysis.

    PubMed Central

    Pettersson, B; Andersson, A; Leitner, T; Olsvik, O; Uhlén, M; Storey, C; Black, C M

    1997-01-01

    Nucleotide sequences from strains of the four species currently in the genus Chlamydia, C. pecorum, C. pneumoniae, C. psittaci, and C. trachomatis were investigated. In vitro-amplified RNA genes of the ribosomal small subunit from 30 strains of C. pneumoniae and C. pecorum were subjected to solid-phase DNA sequencing of both strands. The human isolates of C. pneumoniae differed in only one position in the 16S rRNA gene, indicating genetic homogeneity among these strains. Interestingly, horse isolate N16 of C. pneumoniae was found to be closely related to the human isolates of this species, with a 98.9% nucleotide similarity between their 16S rRNA sequences. The type strain and koala isolates of C. pecorum were also found to be very similar to each other, possessing two different 16S rRNA sequences with only one-nucleotide difference. Furthermore, the C. pecorum strains truncated the 16S rRNA molecule by one nucleotide compared to the molecules of the other chlamydial species. This truncation was found to result in loss of a unilaterally bulged nucleotide, an attribute present in all other eubacteria. The phylogenetic structure of the genus Chlamydia was determined by analysis of 16S rRNA sequences. All phylogenetic trees revealed a distinct line of descent of the family Chlamydiaceae built of two main clusters which we denote the C. pneumoniae cluster and the C. psittaci cluster. The clusters were verified by bootstrap analysis of the trees and signature nucleotide analysis. The former cluster contained the human isolates of C. pneumoniae and equine strain N16. The latter cluster consisted of C. psittaci, C. pecorum, and C. trachomatis. The members of the C. pneumoniae cluster showed tight clustering and strain N16 is likely to be a subspecies of C. pneumoniae since these strains also share some antigenic cross-reactivity and clustering of major outer membrane protein gene sequences. C. psittaci and strain N16 branched early out of the respective cluster, and

  7. Heterochromatin and rDNA 5S and 45S sites as reliable cytogenetic markers for castor bean (Ricinus communis, Euphorbiaceae).

    PubMed

    Vasconcelos, Santelmo; Souza, Analice Araújo de; Gusmão, Cássia Lima Silva; Milani, Máira; Benko-Iseppon, Ana M; Brasileiro-Vidal, Ana Christina

    2010-10-01

    The increasing need for renewable energy resources has led to higher demands for biofuel, a scenario where the castor bean (Ricinus communis L.) seed oil represents a promising source of raw material. Despite that, information regarding the genome organization of R. communis is still scarce, impairing the application of modern biotechnological and breeding procedures. The present work brings the first evaluation of the mitotic chromosomes of this species, including 10 potentially interesting accessions for cultivation in semi-arid environments aiming at the biofuel production. The approach included standard staining, fluorochrome staining (CMA/DAPI), fluorescent in situ hybridization (FISH) with rDNA 5S and 45S, as well as silver impregnation. All accessions were diploid with 2n=2x=20, displaying mainly metacentric chromosomes, with CMA-positive bands (GC-rich) in all pairs of the complement. After silver impregnation, one to 14 nucleoli were observed, while the FISH with rDNA 45S revealed two large sites and a variety of minor dots, and the DNAr 5S hybridized in a single pair. The observed features were discussed and compared with literature data regarding pachytene bivalents.

  8. Loss of Nucleolar Histone Chaperone NPM1 Triggers Rearrangement of Heterochromatin and Synergizes with a Deficiency in DNA Methyltransferase DNMT3A to Drive Ribosomal DNA Transcription*

    PubMed Central

    Holmberg Olausson, Karl; Nistér, Monica; Lindström, Mikael S.

    2014-01-01

    Nucleoli are prominent nuclear structures assembled and organized around actively transcribed ribosomal DNA (rDNA). The nucleolus has emerged as a platform for the organization of chromatin enriched for repressive histone modifications associated with repetitive DNA. NPM1 is a nucleolar protein required for the maintenance of genome stability. However, the role of NPM1 in nucleolar chromatin dynamics and ribosome biogenesis remains unclear. We found that normal fibroblasts and cancer cells depleted of NPM1 displayed deformed nucleoli and a striking rearrangement of perinucleolar heterochromatin, as identified by immunofluorescence staining of trimethylated H3K9, trimethylated H3K27, and heterochromatin protein 1γ (HP1γ/CBX3). By co-immunoprecipitation we found NPM1 associated with HP1γ and core and linker histones. Moreover, NPM1 was required for efficient tethering of HP1γ-enriched chromatin to the nucleolus. We next tested whether the alterations in perinucleolar heterochromatin architecture correlated with a difference in the regulation of rDNA. U1242MG glioma cells depleted of NPM1 presented with altered silver staining of nucleolar organizer regions, coupled to a modest decrease in H3K9 di- and trimethylation at the rDNA promoter. rDNA transcription and cell proliferation were sustained in these cells, indicating that altered organization of heterochromatin was not secondary to inhibition of rDNA transcription. Furthermore, knockdown of DNA methyltransferase DNMT3A markedly enhanced rDNA transcription in NPM1-depleted U1242MG cells. In summary, this study highlights a function of NPM1 in the spatial organization of nucleolus-associated heterochromatin. PMID:25349213

  9. Loss of nucleolar histone chaperone NPM1 triggers rearrangement of heterochromatin and synergizes with a deficiency in DNA methyltransferase DNMT3A to drive ribosomal DNA transcription.

    PubMed

    Holmberg Olausson, Karl; Nistér, Monica; Lindström, Mikael S

    2014-12-12

    Nucleoli are prominent nuclear structures assembled and organized around actively transcribed ribosomal DNA (rDNA). The nucleolus has emerged as a platform for the organization of chromatin enriched for repressive histone modifications associated with repetitive DNA. NPM1 is a nucleolar protein required for the maintenance of genome stability. However, the role of NPM1 in nucleolar chromatin dynamics and ribosome biogenesis remains unclear. We found that normal fibroblasts and cancer cells depleted of NPM1 displayed deformed nucleoli and a striking rearrangement of perinucleolar heterochromatin, as identified by immunofluorescence staining of trimethylated H3K9, trimethylated H3K27, and heterochromatin protein 1γ (HP1γ/CBX3). By co-immunoprecipitation we found NPM1 associated with HP1γ and core and linker histones. Moreover, NPM1 was required for efficient tethering of HP1γ-enriched chromatin to the nucleolus. We next tested whether the alterations in perinucleolar heterochromatin architecture correlated with a difference in the regulation of rDNA. U1242MG glioma cells depleted of NPM1 presented with altered silver staining of nucleolar organizer regions, coupled to a modest decrease in H3K9 di- and trimethylation at the rDNA promoter. rDNA transcription and cell proliferation were sustained in these cells, indicating that altered organization of heterochromatin was not secondary to inhibition of rDNA transcription. Furthermore, knockdown of DNA methyltransferase DNMT3A markedly enhanced rDNA transcription in NPM1-depleted U1242MG cells. In summary, this study highlights a function of NPM1 in the spatial organization of nucleolus-associated heterochromatin.

  10. Identification and detection of Trypanosoma cruzi by using a DNA amplification fingerprint obtained from the ribosomal intergenic spacer.

    PubMed Central

    González, N; Galindo, I; Guevara, P; Novak, E; Scorza, J V; Añez, N; Da Silveira, J F; Ramírez, J L

    1994-01-01

    We designed a PCR assay targeted on repeated elements of the ribosomal intergenic spacer which produces highly polymorphic DNA band patterns for different strains of Trypanosoma cruzi. By labeling the PCR products with digoxigenin and by chemiluminescence detection, we improved the assay sensitivity by three orders of magnitude to get T. cruzi strain fingerprints in feces of the trypanosome-infected triatomine bug vector. We also developed a capture assay for the digoxigenin-labeled PCR products that allowed us to detect T. cruzi in triatomine bug vector feces and in human serum samples with a solid support. Images PMID:8126172

  11. Genetic differentiation of strongyloides stercoralis from two different climate zones revealed by 18S ribosomal DNA sequence comparison.

    PubMed

    Pakdee, Wallop; Thaenkham, Urusa; Dekumyoy, Paron; Sa-Nguankiat, Surapol; Maipanich, Wanna; Pubampen, Somchit

    2012-11-01

    Over 70 countries in tropical and subtropical zones are endemic areas for Strongyloides stercoralis, with a higher prevalence of the parasite often occurring in tropical regions compared to subtropical ones. In order to explore genetic variations of S. stercoralis form different climate zones, 18S ribosomal DNA of parasite specimens obtained from Thailand were sequenced and compared with those from Japan. The maximum likelihood indicates that S. stercoralis populations from these two different climate zones have genetically diverged. The genetic relationship between S. stercoralis populations is not related to the host species, but rather to moisture and temperature. These factors may directly drive genetic differentiation among isolated populations of S. stercoralis.

  12. Overexpression of Ribosomal RNA in the Development of Human Cervical Cancer Is Associated with rDNA Promoter Hypomethylation

    PubMed Central

    Zhou, Hong; Wang, Yapei; Lv, Qiongying; Zhang, Juan; Wang, Qing; Gao, Fei; Hou, Haoli; Zhang, Hao; Zhang, Wei; Li, Lijia

    2016-01-01

    The ribosomal RNA (rRNA) gene encodes rRNA for protein synthesis. Aberrant expression of the rRNA gene has been generally observed in tumor cells and levels of its promoter methylation as an epigenetic regulator affect rRNA gene transcription. The possible relationship between expression and promoter methylation of rDNA has not been examined in human clinical cervical cancer. Here we investigate rRNA gene expression by quantitative real time PCR, and promoter methylation levels by HpaII/MspI digestion and sodium bisulfite sequencing in the development of human cervical cancer. We find that indeed rRNA levels are elevated in most of cervical intraepithelial neoplasia (CIN) specimens as compared with non-cancer tissues. The rDNA promoter region in cervical intraepithelial neoplasia (CIN) tissues reveals significant hypomethylation at cytosines in the context of CpG dinucleotides, accompanied with rDNA chromatin decondensation. Furthermore treatment of HeLa cells with the methylation inhibitor drug 5-aza-2’-deoxycytidine (DAC) demonstrates the negative correlation between the expression of 45S rDNA and the methylation level in the rDNA promoter region. These data suggest that a decrease in rDNA promoter methylation levels can result in an increase of rRNA synthesis in the development of human cervical cancer. PMID:27695092

  13. Intragenomic polymorphisms among high-copy loci: a genus-wide study of nuclear ribosomal DNA in Asclepias (Apocynaceae).

    PubMed

    Weitemier, Kevin; Straub, Shannon C K; Fishbein, Mark; Liston, Aaron

    2015-01-01

    Despite knowledge that concerted evolution of high-copy loci is often imperfect, studies that investigate the extent of intragenomic polymorphisms and comparisons across a large number of species are rarely made. We present a bioinformatic pipeline for characterizing polymorphisms within an individual among copies of a high-copy locus. Results are presented for nuclear ribosomal DNA (nrDNA) across the milkweed genus, Asclepias. The 18S-26S portion of the nrDNA cistron of Asclepias syriaca served as a reference for assembly of the region from 124 samples representing 90 species of Asclepias. Reads were mapped back to each individual's consensus and at each position reads differing from the consensus were tallied using a custom perl script. Low frequency polymorphisms existed in all individuals (mean = 5.8%). Most nrDNA positions (91%) were polymorphic in at least one individual, with polymorphic sites being less frequent in subunit regions and loops. Highly polymorphic sites existed in each individual, with highest abundance in the "noncoding" ITS regions. Phylogenetic signal was present in the distribution of intragenomic polymorphisms across the genus. Intragenomic polymorphisms in nrDNA are common in Asclepias, being found at higher frequency than any other study to date. The high and variable frequency of polymorphisms across species highlights concerns that phylogenetic applications of nrDNA may be error-prone. The new analytical approach provided here is applicable to other taxa and other high-copy regions characterized by low coverage genome sequencing (genome skimming). PMID:25653903

  14. Evaluation of DNA encoding acidic ribosomal protein P2 of Cryptosporidium parvum as a potential vaccine candidate for cryptosporidiosis.

    PubMed

    Benitez, Alvaro; Priest, Jeffrey W; Ehigiator, Humphrey N; McNair, Nina; Mead, Jan R

    2011-11-15

    The Cryptosporidium parvum acidic ribosomal protein P2 (CpP2) is an important immunodominant marker in C. parvum infection. In this study, the CpP2 antigen was evaluated as a vaccine candidate using a DNA vaccine model in adult C57BL/6 IL-12 knockout (KO) mice, which are susceptible to C. parvum infection. Our data show that subcutaneous immunization in the ear with DNA encoding CpP2 (CpP2-DNA) cloned into the pUMVC4b vector induced a significant anti-CpP2 IgG antibody response that was predominantly of the IgG1 isotype. Compared to control KO mice immunized with plasmid alone, CpP2-immunized mice demonstrated specific in vitro spleen cell proliferation as well as enhanced IFN-γ production to recombinant CpP2. Further, parasite loads in CpP2 DNA-immunized mice were compared to control mice challenged with C. parvum oocysts. Although a trend in reduction of infection was observed in the CpP2 DNA-immunized mice, differences between groups were not statistically significant. These results suggest that a DNA vaccine encoding the C. parvum P2 antigen is able to provide an effective means of eliciting humoral and cellular responses and has the potential to generate protective immunity against C. parvum infection but may require using alternative vectors or adjuvant to generate a more potent and balanced response.

  15. Study on sequences of ribosomal DNA internal transcribed spacers of clams belonging to the Veneridae family (Mollusca: Bivalvia).

    PubMed

    Cheng, Han-Liang; Xia, De-Quan; Wu, Ting-Ting; Meng, Xue-Ping; Ji, Hong-Ju; Dong, Zhi-Guo

    2006-08-01

    The first and second internal transcribed spacer (ITS1 and ITS2) regions of the ribosomal DNA from four species, Meretrix meretrix L., Cyclina sinensis G., Mercenaria mercenaria L., and Protothaca jedoensis L., belonging to the family Veneridae were amplified by PCR and sequenced. The size of the ITS1 PCR amplification product ranged from 663 bp to 978 bp, with GC contents ranging from 60.78% to 64.97%. The size of the ITS1 sequence ranged from 585 bp to 900 bp, which is the largest range reported thus far in bivalve species, with GC contents ranging from 61.03% to 65.62%. The size of the ITS2 PCR amplification product ranged from 513 bp to 644 bp, with GC contents ranging from 61.29% to 62.73%. The size of the ITS2 sequence ranged from 281 bp to 412 bp, with GC contents ranging from 65.21% to 67.87%. Extensive sequence variation and obvious length polymorphisms were noted for both regions in these species, and sequence similarity of ITS2 was higher than that of ITS1 across species. The complete sequences of 5.8S ribosomal RNA gene were obtained by assembling ITS1 and ITS2 sequences, and the sequence length in all species was 157 bp. The phylogenetic tree of Veneridae clams was reconstructed using ITS2-containing partial sequences of both 5.8S and 28S ribosomal DNA as markers and the corresponding sequence information in Arctica islandica as the outgroup. Tree topologies indicated that P. jedoensis shared a close relationship with M. mercenaria and C. sinensis, a distant relationship with other species.

  16. Organization of ribosomal genes in Paramecium tetraurelia

    PubMed Central

    1980-01-01

    The macronuclear ribosomal DNA (rDNA) of the ciliated protozoan Paramecium tetraurelia (stock 51) was analyzed by digestion with restriction endonucleases. The fragments which contained ribosomal RNA (rRNA) coding sequences and spacer sequences were identified. The spacer sequences exhibited some heterogeneity in size. The genes coding for 5.8S RNA, but not for 5S RNA, are linked to the 17S and 25S rRNA genes. Complementary RNA, synthesized from rDNA of stock 51, was hybridized with restriction digests of whole cell DNA from six other allopatric stocks of this species. The restriction patterns of the rDNA from these seven stocks were, in general, very similar, and the sizes of the coding sequences were identical in all seven stocks. Only the restriction pattern of rDNA from stock 127 differed significantly from that of stock 51. The rDNA from stock 127 was isolated and characterized, and with the exception of the restriction pattern of its spacer, it resembled the rDNA from stock 51. It is concluded that the rDNA repeat in Paramecium, including the spacer, has, in general, been conserved during the course of evolution. It is suggested that in some species, even in the absence of genetic exchange among geographically separated populations, selection pressure may act to conserve spacers of tandemly repeated rDNA. The conservation may be related to the number of rDNA copies in the germinal nucleus. PMID:6244317

  17. A ribosomal protein gene cluster is encoded in the mitochondrial DNA of Dictyostelium discoideum: UGA termination codons and similarity of gene order to Acanthamoeba castellanii.

    PubMed

    Iwamoto, M; Pi, M; Kurihara, M; Morio, T; Tanaka, Y

    1998-04-01

    We sequenced a region of about 14.5 kb downstream from the ribosomal protein L11 gene (rpl11) in the mitochondrial DNA (54+/-2 kb) of the cellular slime mold Dictyostelium discoideum. Sequence analysis revealed that eleven ribosomal protein genes and six open reading frames (ORFs) formed a cluster arranged in the order: rpl11-orf189-rps12-rps7-rpl2-rps19-+ ++orf425-orf1740-rpl16-rpl14-orf188- rps14-rps8-rpl6-rps13-orf127-orf796. This order was very similar to that of homologous genes in Acanthamoeba castellanii mitochondrial DNA. The N-terminal region of ORF425 and the C-terminal region of ORF1740 had partial similarities to the S3 ribosomal protein of other organisms. The termination codons of rpl16 and orf188 were UGA, which has not hitherto been found in genes encoded in D. discoideum mitochondrial DNA. PMID:9560439

  18. Physical mapping of the 5S and 18S rDNA in ten species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): evolutionary tendencies in the genus.

    PubMed

    Bueno, Vanessa; Venere, Paulo César; Thums Konerat, Jocicléia; Zawadzki, Cláudio Henrique; Vicari, Marcelo Ricardo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  19. Physical Mapping of the 5S and 18S rDNA in Ten Species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): Evolutionary Tendencies in the Genus

    PubMed Central

    César Venere, Paulo; Thums Konerat, Jocicléia; Henrique Zawadzki, Cláudio; Ricardo Vicari, Marcelo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus. PMID:25405240

  20. Phylogeny of the Sphaerotilus-Leptothrix group inferred from morphological comparisons, genomic fingerprinting, and 16S ribosomal DNA sequence analyses.

    PubMed

    Siering, P L; Ghiorse, W C

    1996-01-01

    Phase-contrast light microscopy revealed that only one of eight cultivated strains belonging to the Sphaerotilus-Leptothrix group of sheathed bacteria actually produced a sheath in standard growth media. Two Sphaerotilus natans strains produced branched cells, but other morphological characteristics that were used to identify these bacteria were consistent with previously published descriptions. Genomic fingerprints, which were obtained by performing PCR amplification with primers corresponding to enterobacterial repetitive intergenic consensus sequences, were useful for distinguishing between the genera Sphaerotilus and Leptothrix, as well as among individual strains. The complete 16S ribosomal DNA (rDNA) sequences of two strains of "Leptothrix discophora" (strains SP-6 and SS-1) were determined. In addition, partial sequences (approximately 300 nucleotides) of one strain of Leptothrix cholodnii (strain LMG 7171), an unidentified Leptothrix strain (strain NC-1), and four strains of Sphaerotilus natans (strains ATCC 13338T [T = type strain], ATCC 15291, ATCC 29329, and ATCC 29330) were determined. We found that two of the S. natans strains (ATCC 15291 and ATCC 13338T), which differed in morphology and in their genomic fingerprints, had identical sequences in the 300-nucleotide region sequenced. Both parsimony and distance matrix methods were used to infer the evolutionary relationships of the eight strains in a comparison of the 16S rDNA sequences of these organisms with 16S rDNA sequences obtained from ribosomal sequence databases. All of the strains clustered in the Rubrivivax subdivision of the beta subclass of the Proteobacteria, which confirmed previously published conclusions concerning selected individual strains. Additional analyses revealed that all of the S. natans strains clustered in one closely related group, while the Leptothrix strains clustered in two separate lineages that were approximately equidistant from the S. natans cluster. This finding

  1. Phylogeny of the Sphaerotilus-Leptothrix group inferred from morphological comparisons, genomic fingerprinting, and 16S ribosomal DNA sequence analyses.

    PubMed

    Siering, P L; Ghiorse, W C

    1996-01-01

    Phase-contrast light microscopy revealed that only one of eight cultivated strains belonging to the Sphaerotilus-Leptothrix group of sheathed bacteria actually produced a sheath in standard growth media. Two Sphaerotilus natans strains produced branched cells, but other morphological characteristics that were used to identify these bacteria were consistent with previously published descriptions. Genomic fingerprints, which were obtained by performing PCR amplification with primers corresponding to enterobacterial repetitive intergenic consensus sequences, were useful for distinguishing between the genera Sphaerotilus and Leptothrix, as well as among individual strains. The complete 16S ribosomal DNA (rDNA) sequences of two strains of "Leptothrix discophora" (strains SP-6 and SS-1) were determined. In addition, partial sequences (approximately 300 nucleotides) of one strain of Leptothrix cholodnii (strain LMG 7171), an unidentified Leptothrix strain (strain NC-1), and four strains of Sphaerotilus natans (strains ATCC 13338T [T = type strain], ATCC 15291, ATCC 29329, and ATCC 29330) were determined. We found that two of the S. natans strains (ATCC 15291 and ATCC 13338T), which differed in morphology and in their genomic fingerprints, had identical sequences in the 300-nucleotide region sequenced. Both parsimony and distance matrix methods were used to infer the evolutionary relationships of the eight strains in a comparison of the 16S rDNA sequences of these organisms with 16S rDNA sequences obtained from ribosomal sequence databases. All of the strains clustered in the Rubrivivax subdivision of the beta subclass of the Proteobacteria, which confirmed previously published conclusions concerning selected individual strains. Additional analyses revealed that all of the S. natans strains clustered in one closely related group, while the Leptothrix strains clustered in two separate lineages that were approximately equidistant from the S. natans cluster. This finding

  2. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.

    PubMed

    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto

    2015-01-01

    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group. PMID:26329975

  3. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.

    PubMed

    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto

    2015-01-01

    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group.

  4. Intraspecific differentiation of Paramecium novaurelia strains (Ciliophora, Protozoa) inferred from phylogenetic analysis of ribosomal and mitochondrial DNA variation.

    PubMed

    Tarcz, Sebastian

    2013-01-01

    Paramecium novaurelia Beale and Schneller, 1954, was first found in Scotland and is known to occur mainly in Europe, where it is the most common species of the P. aurelia complex. In recent years, two non-European localities have been described: Turkey and the United States of America. This article presents the analysis of intraspecific variability among 25 strains of P. novaurelia with the application of ribosomal and mitochondrial loci (ITS1-5.8S-ITS2, 5' large subunit rDNA (5'LSU rDNA) and cytochrome c oxidase subunit 1 (COI) mtDNA). The mean distance observed for all of the studied P. novaurelia sequence pairs was p=0.008/0.016/0.092 (ITS1-5.8S-ITS2/5'LSU rDNA/COI). Phylogenetic trees (NJ/MP/BI) based on a comparison of all of the analysed sequences show that the studied strains of P. novaurelia form a distinct clade, separate from the P. caudatum outgroup, and are divided into two clusters (A and B) and two branches (C and D). The occurrence of substantial genetic differentiation within P. novaurelia, confirmed by the analysed DNA fragments, indicates a rapid evolution of particular species within the Paramecium genus.

  5. Ribosomal DNA organization patterns within the dinoflagellate genus Alexandrium as revealed by FISH: life cycle and evolutionary implications.

    PubMed

    Figueroa, Rosa Isabel; Cuadrado, Angeles; Stüken, Anke; Rodríguez, Francisco; Fraga, Santiago

    2014-05-01

    Dinoflagellates are a group of protists whose genome differs from that of other eukaryotes in terms of size (contains up to 250pg per haploid cell), base composition, chromosomal organization, and gene expression. But rDNA gene mapping of the active nucleolus in this unusual eukaryotic genome has not been carried out thus far. Here we used FISH in dinoflagellate species belonging to the genus Alexandrium (genome sizes ranging from 21 to 170 pg of DNA per haploid genome) to localize the sequences encoding the 18S, 5.8S, and 28S rRNA genes. The results can be summarized as follows: 1) Each dinoflagellate cell contains only one active nucleolus, with no hybridization signals outside it. However, the rDNA organization varies among species, from repetitive clusters forming discrete nuclear organizer regions (NORs) in some to specialized "ribosomal chromosomes" in other species. The latter chromosomes, never reported before in other eukaryotes, are mainly formed by rDNA genes and appeared in the species with the highest DNA content. 2) Dinoflagellate chromosomes are first characterized by several eukaryotic features, such as structural differentiation (centromere-like constrictions), size differences (dot chromosomes), and SAT (satellite) chromosomes. 3) NOR patterns prove to be useful in discriminating between cryptic species and life cycle stages in protists.

  6. Nuclear Ribosomal DNA Variation and Pathogenic Specialization in Alternaria Fungi Known To Produce Host-Specific Toxins †

    PubMed Central

    Kusaba, Motoaki; Tsuge, Takashi

    1994-01-01

    A total of 99 strains of 11 Alternaria species, including 68 strains of seven fungi known to produce host-specific toxins, were subjected to analysis of restriction fragment length polymorphism (RFLP) in nuclear ribosomal DNA (rDNA). Total DNA was digested with XbaI, and the Southern blots were probed with a nuclear rDNA clone of Alternaria kikuchiana. The hybridization gave 17 different RFLPs from the 99 strains. On the basis of these RFLPs, populations of host-specific toxin-producing fungi could not be differentiated from one another nor from nonpathogenic A. alternata. Each population of the toxin-producing fungi carried rDNA variants. Nine different types, named A1 to A6 and B1 to B3, were detected among the toxin-producing fungi and nonpathogenic A. alternata. All of the populations contained the type A4 variant, and the other rDNA types were also shared by different toxin-producing fungi and A. alternata. In contrast, Alternaria species that are morphologically distinguishable from A. alternata could be differentiated from A. alternata on the basis of the rDNA RFLPs. Polymorphisms in rDNA digested with HaeIII and MspI were also evaluated in 61 Alternaria strains. These restriction enzymes produced 31 variations among all of the samples. The seven toxin-producing fungi and nonpathogenic A. alternata could not be resolved by phylogenetic analysis based on the RFLPs, although they could be differentiated from the other Alternaria species studied. These results provide support for the hypothesis that Alternaria fungi known to produce host-specific toxins are intraspecific variants of A. alternata specialized in pathogenicity. Images PMID:16349367

  7. Detection of a variable number of ribosomal DNA loci by fluorescent in situ hybridization in Populus species.

    PubMed

    Prado, E A; Faivre-Rampant, P; Schneider, C; Darmency, M A

    1996-10-01

    Fluorescent in situ hybridization (FISH) was applied to related Populus species (2n = 19) in order to detect rDNA loci. An interspecific variability in the number of hybridization sites was revealed using as probe an homologous 25S clone from Populus deltoides. The application of image analysis methods to measure fluorescence intensity of the hybridization signals has enabled us to characterize major and minor loci in the 18S-5.8S-25S rDNA. We identified one pair of such rDNA clusters in Populus alba; two pairs, one major and one minor, in both Populus nigra and P. deltoides; and three pairs in Populus balsamifera, (two major and one minor) and Populus euroamericana (one major and two minor). FISH results are in agreement with those based on RFLP analysis. The pBG13 probe containing 5S sequence from flax detected two separate clusters corresponding to the two size classes of units that coexist within 5S rDNA of most Populus species. Key words : Populus spp., fluorescent in situ hybridization, FISH, rDNA variability, image analysis.

  8. A putative precursor for the small ribosomal RNA from mitochondria of Saccharomyces cerevisiae.

    PubMed Central

    Osinga, K A; Evers, R F; Van der Laan, J C; Tabak, H F

    1981-01-01

    We have characterized a putative precursor RNA (15.5S) for the 15S ribosomal RNA in mitochondria of Saccharomyces cerevisiae. Hybrids were formed with mitochondrial RNA and mtDNA fragments terminally labelled at restriction sites located within the gene coding for 15S ribosomal RNA and treated with S1 nuclease (Berk, A.J. and Sharp, J.A. (1977) 12, 721-732). Sites of resistant hybrids were measured by agarose gel electrophoresis and end points of RNAs determined. The 15.5S RNA is approximately 80 nucleotides longer than the 15S ribosomal RNA, with the extra sequences being located at the 5'-end. Both 15S ribosomal RNA and 15.5S RNA are fully localised within a 2000 base pair HapII fragment. This putative precursor and the mature 15S ribosomal RNA are also found in petite mutants which retain the 15S ribosomal RNA gene. The petite mutant with the smallest genetic complexity has its end point of deletion (junction) just outside the HapII site located in the 5' flank of the 15S ribosomal RNA genes as determined by S1 nuclease analysis. This leaves a DNA stretch approximately 300 base pairs long where an initiation signal for mitochondrial transcription may be present. Images PMID:6262728

  9. cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).

    PubMed

    Abolhassani, Mohsen; Roux, Kenneth H

    2009-06-01

    Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

  10. Identification of the Bacterial Community of Maple Sap by Using Amplified Ribosomal DNA (rDNA) Restriction Analysis and rDNA Sequencing

    PubMed Central

    Lagacé, L.; Pitre, M.; Jacques, M.; Roy, D.

    2004-01-01

    The bacterial community of maple sap was characterized by analysis of samples obtained at the taphole of maple trees for the 2001 and 2002 seasons. Among the 190 bacterial isolates, 32 groups were formed according to the similarity of the banding patterns obtained by amplified ribosomal DNA restriction analysis (ARDRA). A subset of representative isolates for each ARDRA group was identified by 16S rRNA gene fragment sequencing. Results showed a wide variety of organisms, with 22 different genera encountered. Pseudomonas and Ralstonia, of the γ- and β-Proteobacteria, respectively, were the most frequently encountered genera. Gram-positive bacteria were also observed, and Staphylococcus, Plantibacter, and Bacillus were the most highly represented genera. The sampling period corresponding to 50% of the cumulative sap flow percentage presented the greatest bacterial diversity according to its Shannon diversity index value (1.1). γ-Proteobacteria were found to be dominant almost from the beginning of the season to the end. These results are providing interesting insights on maple sap microflora that will be useful for further investigation related to microbial contamination and quality of maple products and also for guiding new strategies on taphole contamination control. PMID:15066796

  11. Identification and quantification of (5'R)- and (5'S)-8,5'-cyclo-2'-deoxyadenosines in human urine as putative biomarkers of oxidatively induced damage to DNA

    SciTech Connect

    Jaruga, Pawel; Dizdaroglu, Miral

    2010-06-18

    Biomarkers of oxidatively induced DNA damage are of great interest and can potentially be used for the early detection of disease, monitoring the progression of disease and determining the efficacy of therapy. The present work deals with the measurement in human urine of (5'R)-8,5'-cyclo-2'-deoxyadenosine (R-cdA) and (5'S)-8,5'-cyclo-2'-deoxyadenosine (S-cdA). These modified nucleosides had hitherto not been considered or investigated to be present in urine as possible biomarkers of oxidatively induced DNA damage. Urine samples were collected from volunteers, purified and analyzed by LC-MS/MS with isotope-dilution. R-cdA and S-cdA were detected in urine and quantified. Creatinine levels were also measured. In addition, we measured 8-hydroxy-2'-deoxyguanosine that is commonly used as a biomarker. This study shows, for the first time, that R-cdA and S-cdA exist in human urine and can be identified and quantified by LC-MS/MS. We propose that R-cdA and S-cdA may be well-suited biomarkers for disease processes such as carcinogenesis.

  12. TALE nickase mediates high efficient targeted transgene integration at the human multi-copy ribosomal DNA locus.

    PubMed

    Wu, Yong; Gao, Tieli; Wang, Xiaolin; Hu, Youjin; Hu, Xuyun; Hu, Zhiqing; Pang, Jialun; Li, Zhuo; Xue, Jinfeng; Feng, Mai; Wu, Lingqian; Liang, Desheng

    2014-03-28

    Although targeted gene addition could be stimulated strikingly by a DNA double strand break (DSB) created by either zinc finger nucleases (ZFNs) or TALE nucleases (TALENs), the DSBs are really mutagenic and toxic to human cells. As a compromised solution, DNA single-strand break (SSB) or nick has been reported to mediate high efficient gene addition but with marked reduction of random mutagenesis. We previously demonstrated effective targeted gene addition at the human multicopy ribosomal DNA (rDNA) locus, a genomic safe harbor for the transgene with therapeutic potential. To improve the transgene integration efficiency by using TALENs while lowering the cytotoxicity of DSBs, we created both TALENs and TALE nickases (TALENickases) targeting this multicopy locus. A targeting vector which could integrate a GFP cassette at the rDNA locus was constructed and co-transfected with TALENs or TALENickases. Although the fraction of GFP positive cells using TALENs was greater than that using TALENickases during the first few days after transfection, it reduced to a level less than that using TALENickases after continuous culture. Our findings showed that the TALENickases were more effective than their TALEN counterparts at the multi-copy rDNA locus, though earlier studies using ZFNs and ZFNickases targeting the single-copy loci showed the reverse. Besides, TALENickases mediated the targeted integration of a 5.4 kb fragment at a frequency of up to 0.62% in HT1080 cells after drug selection, suggesting their potential application in targeted gene modification not being limited at the rDNA locus.

  13. Ribosomal DNA transcription in dorsal raphe nucleus neurons is increased in residual schizophrenia compared to depressed patients with affective disorders.

    PubMed

    Krzyżanowska, Marta; Steiner, Johann; Brisch, Ralf; Mawrin, Christian; Busse, Stefan; Braun, Katharina; Jankowski, Zbigniew; Bernstein, Hans-Gert; Bogerts, Bernhard; Gos, Tomasz

    2015-12-15

    The central serotonergic system is implicated differentially in the pathogenesis of depression and schizophrenia. The dorsal raphe nucleus (DRN) is the main source of serotonergic innervation of forebrain limbic structures disturbed in both disorders. The study was carried out on paraffin-embedded brains from 27 depressed (15 major depressive disorder, MDD and 12 bipolar disorder, BD) and 17 schizophrenia (9 residual and 8 paranoid) patients and 28 matched controls without mental disorders. The transcriptional activity of ribosomal DNA (rDNA) in DRN neurons was evaluated by the AgNOR silver staining method. A significant effect of diagnosis on rDNA activity was found in the cumulative analysis of all DRN subnuclei. Further analysis revealed an increase in this activity in residual (but not paranoid) schizophrenia compared to depressed (both MDD and BD) patients. The effect was most probably neither confounded by suicide nor related to antidepressant and antipsychotic medication. Our findings suggest that increased activity of rDNA in DRN neurons is a distinct phenomenon in residual schizophrenia, related presumably to differentially disturbed inputs to the DRN and/or their local transformation compared with depressive episodes in patients with affective disorders.

  14. A nuclear ribosomal DNA pseudogene in triatomines opens a new research field of fundamental and applied implications in Chagas disease

    PubMed Central

    Zuriaga, María Angeles; Mas-Coma, Santiago; Bargues, María Dolores

    2015-01-01

    A pseudogene, designated as "ps(5.8S+ITS-2)", paralogous to the 5.8S gene and internal transcribed spacer (ITS)-2 of the nuclear ribosomal DNA (rDNA), has been recently found in many triatomine species distributed throughout North America, Central America and northern South America. Among characteristics used as criteria for pseudogene verification, secondary structures and free energy are highlighted, showing a lower fit between minimum free energy, partition function and centroid structures, although in given cases the fit only appeared to be slightly lower. The unique characteristics of "ps(5.8S+ITS-2)" as a processed or retrotransposed pseudogenic unit of the ghost type are reviewed, with emphasis on its potential functionality compared to the functionality of genes and spacers of the normal rDNA operon. Besides the technical problem of the risk for erroneous sequence results, the usefulness of "ps(5.8S+ITS-2)" for specimen classification, phylogenetic analyses and systematic/taxonomic studies should be highlighted, based on consistence and retention index values, which in pseudogenic sequence trees were higher than in functional sequence trees. Additionally, intraindividual, interpopulational and interspecific differences in pseudogene amount and the fact that it is a pseudogene in the nuclear rDNA suggests a potential relationships with fitness, behaviour and adaptability of triatomine vectors and consequently its potential utility in Chagas disease epidemiology and control. PMID:25760450

  15. Variability and genetics of spacer DNA sequences between the ribosomal-RNA genes of hexaploid wheat (Triticum aestivum).

    PubMed

    May, C E; Appels, R

    1987-09-01

    Using restriction enzyme digests of genomic DNA extracted from the leaves of 25 hexaploid wheat (Triticum aestivum L. em. Thell.) cultivars and their hybrids, restriction fragment length polymorphisms of the spacer DNA which separates the ribosomal-RNA genes have been examined. (From one to three thousand of these genes are borne on chromosomes 1B and 6B of hexaploid wheat). The data show that there are three distinct alleles of the 1B locus, designated Nor-B1a, Nor-B1b, and Nor-B1c, and at least five allelic variants of the 6B locus, designated Nor-B2a, Nor-B2b, Nor-B2c, Nor-B2d, and Nor-B2e. A further, previously reported allele on 6B has been named Nor-B2f. Chromosome 5D has only one allelic variant, Nor-D3. Whereas the major spacer variants of the 1B alleles apparently differ by the loss or gain of one or two of the 133 bp sub-repeat units within the spacer DNA, the 6B allelic variants show major differences in their compositions and lengths. This may be related to the greater number of rDNA repeat units at this locus. The practical implications of these differences and their application to wheat breeding are discussed.

  16. A pathogenic non-coding RNA induces changes in dynamic DNA methylation of ribosomal RNA genes in host plants

    PubMed Central

    Martinez, German; Castellano, Mayte; Tortosa, Maria; Pallas, Vicente; Gomez, Gustavo

    2014-01-01

    Viroids are plant-pathogenic non-coding RNAs able to interfere with as yet poorly known host-regulatory pathways and to cause alterations recognized as diseases. The way in which these RNAs coerce the host to express symptoms remains to be totally deciphered. In recent years, diverse studies have proposed a close interplay between viroid-induced pathogenesis and RNA silencing, supporting the belief that viroid-derived small RNAs mediate the post-transcriptional cleavage of endogenous mRNAs by acting as elicitors of symptoms expression. Although the evidence supporting the role of viroid-derived small RNAs in pathogenesis is robust, the possibility that this phenomenon can be a more complex process, also involving viroid-induced alterations in plant gene expression at transcriptional levels, has been considered. Here we show that plants infected with the ‘Hop stunt viroid’ accumulate high levels of sRNAs derived from ribosomal transcripts. This effect was correlated with an increase in the transcription of ribosomal RNA (rRNA) precursors during infection. We observed that the transcriptional reactivation of rRNA genes correlates with a modification of DNA methylation in their promoter region and revealed that some rRNA genes are demethylated and transcriptionally reactivated during infection. This study reports a previously unknown mechanism associated with viroid (or any other pathogenic RNA) infection in plants providing new insights into aspects of host alterations induced by the viroid infectious cycle. PMID:24178032

  17. Intragenomic polymorphisms among high-copy loci: a genus-wide study of nuclear ribosomal DNA in Asclepias (Apocynaceae)

    PubMed Central

    Straub, Shannon C.K.; Fishbein, Mark; Liston, Aaron

    2015-01-01

    Despite knowledge that concerted evolution of high-copy loci is often imperfect, studies that investigate the extent of intragenomic polymorphisms and comparisons across a large number of species are rarely made. We present a bioinformatic pipeline for characterizing polymorphisms within an individual among copies of a high-copy locus. Results are presented for nuclear ribosomal DNA (nrDNA) across the milkweed genus, Asclepias. The 18S-26S portion of the nrDNA cistron of Asclepias syriaca served as a reference for assembly of the region from 124 samples representing 90 species of Asclepias. Reads were mapped back to each individual’s consensus and at each position reads differing from the consensus were tallied using a custom perl script. Low frequency polymorphisms existed in all individuals (mean = 5.8%). Most nrDNA positions (91%) were polymorphic in at least one individual, with polymorphic sites being less frequent in subunit regions and loops. Highly polymorphic sites existed in each individual, with highest abundance in the “noncoding” ITS regions. Phylogenetic signal was present in the distribution of intragenomic polymorphisms across the genus. Intragenomic polymorphisms in nrDNA are common in Asclepias, being found at higher frequency than any other study to date. The high and variable frequency of polymorphisms across species highlights concerns that phylogenetic applications of nrDNA may be error-prone. The new analytical approach provided here is applicable to other taxa and other high-copy regions characterized by low coverage genome sequencing (genome skimming). PMID:25653903

  18. Ribosomal DNA analysis of tsetse and non-tsetse transmitted Ethiopian Trypanosoma vivax strains in view of improved molecular diagnosis.

    PubMed

    Fikru, Regassa; Matetovici, Irina; Rogé, Stijn; Merga, Bekana; Goddeeris, Bruno Maria; Büscher, Philippe; Van Reet, Nick

    2016-04-15

    Animal trypanosomosis caused by Trypanosoma vivax (T. vivax) is a devastating disease causing serious economic losses. Most molecular diagnostics for T. vivax infection target the ribosomal DNA locus (rDNA) but are challenged by the heterogeneity among T. vivax strains. In this study, we investigated the rDNA heterogeneity of Ethiopian T. vivax strains in relation to their presence in tsetse-infested and tsetse-free areas and its effect on molecular diagnosis. We sequenced the rDNA loci of six Ethiopian (three from tsetse-infested and three from tsetse-free areas) and one Nigerian T. vivax strain. We analysed the obtained sequences in silico for primer-mismatches of some commonly used diagnostic PCR assays and for GC content. With these data, we selected some rDNA diagnostic PCR assays for evaluation of their diagnostic accuracy. Furthermore we constructed two phylogenetic networks based on sequences within the smaller subunit (SSU) of 18S and within the 5.8S and internal transcribed spacer 2 (ITS2) to assess the relatedness of Ethiopian T. vivax strains to strains from other African countries and from South America. In silico analysis of the rDNA sequence showed important mismatches of some published diagnostic PCR primers and high GC content of T. vivax rDNA. The evaluation of selected diagnostic PCR assays with specimens from cattle under natural T. vivax challenge showed that this high GC content interferes with the diagnostic accuracy of PCR, especially in cases of mixed infections with T. congolense. Adding betain to the PCR reaction mixture can enhance the amplification of T. vivax rDNA but decreases the sensitivity for T. congolense and Trypanozoon. The networks illustrated that Ethiopian T. vivax strains are considerably heterogeneous and two strains (one from tsetse-infested and one from tsetse-free area) are more related to the West African and South American strains than to the East African strains. The rDNA locus sequence of six Ethiopian T. vivax

  19. Ribosomal PCR and DNA sequencing for detection and identification of bacteria: experience from 6 years of routine analyses of patient samples.

    PubMed

    Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen; Kemp, Michael

    2014-03-01

    The use of broad range PCR and DNA sequencing of bacterial 16S ribosomal RNA genes for routine diagnostics of bacterial infections was evaluated. Here, the results from more than 2600 analyses during a 6-year period (2003-2009) are presented. Almost half of the samples were from joints and bones, and the second most frequent origin of samples was from the central nervous system. Overall, 26% of all samples were positive for bacterial DNA and bacterial identification was obtained in 80% of the PCR-positive samples by subsequent DNA sequencing. Ambiguous species identification was noticed among non-haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci, may not be precisely identified.

  20. Ribosomal DNA and Plastid Markers Used to Sample Fungal and Plant Communities from Wetland Soils Reveals Complementary Biotas.

    PubMed

    Porter, Teresita M; Shokralla, Shadi; Baird, Donald; Golding, G Brian; Hajibabaei, Mehrdad

    2016-01-01

    Though the use of metagenomic methods to sample below-ground fungal communities is common, the use of similar methods to sample plants from their underground structures is not. In this study we use high throughput sequencing of the ribulose-bisphosphate carboxylase large subunit (rbcL) plastid marker to study the plant community as well as the internal transcribed spacer and large subunit ribosomal DNA (rDNA) markers to investigate the fungal community from two wetland sites. Observed community richness and composition varied by marker. The two rDNA markers detected complementary sets of fungal taxa and total fungal composition clustered according to primer rather than by site. The composition of the most abundant plants, however, clustered according to sites as expected. We suggest that future studies consider using multiple genetic markers, ideally generated from different primer sets, to detect a more taxonomically diverse suite of taxa compared with what can be detected by any single marker alone. Conclusions drawn from the presence of even the most frequently observed taxa should be made with caution without corroborating lines of evidence.

  1. Ribosomal DNA and Plastid Markers Used to Sample Fungal and Plant Communities from Wetland Soils Reveals Complementary Biotas

    PubMed Central

    Porter, Teresita M.; Shokralla, Shadi; Baird, Donald; Golding, G. Brian; Hajibabaei, Mehrdad

    2016-01-01

    Though the use of metagenomic methods to sample below-ground fungal communities is common, the use of similar methods to sample plants from their underground structures is not. In this study we use high throughput sequencing of the ribulose-bisphosphate carboxylase large subunit (rbcL) plastid marker to study the plant community as well as the internal transcribed spacer and large subunit ribosomal DNA (rDNA) markers to investigate the fungal community from two wetland sites. Observed community richness and composition varied by marker. The two rDNA markers detected complementary sets of fungal taxa and total fungal composition clustered according to primer rather than by site. The composition of the most abundant plants, however, clustered according to sites as expected. We suggest that future studies consider using multiple genetic markers, ideally generated from different primer sets, to detect a more taxonomically diverse suite of taxa compared with what can be detected by any single marker alone. Conclusions drawn from the presence of even the most frequently observed taxa should be made with caution without corroborating lines of evidence. PMID:26731732

  2. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    PubMed

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA.

  3. Diversity within the genus Elymus (Poaceae: Triticeae) as investigated by the analysis of the nr5S rDNA variation in species with St and H haplomes.

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2015-02-01

    The genus Elymus ("Ryegrass") is a repository for a range of species with a variety of haplome contents; hence the pejorative name "dustbin" genus. We have analyzed 1,059 sequences from 128 accessions representing 24 species to investigate the relationships among the StH haplomes-containing species described by Yen and Yang (Genus Elymus Beijing 5:58-362, 2013). Sequences were assigned to "unit classes" of orthologous sequences and subjected to a suite of analyses including BLAST (Basic Local Alignment Search Tool) searches, phylogenetic analysis and population genetic analysis to estimate species diversity. Our results support the genome analyses in Yen and Yang (Genus Elymus Beijing 5:58-362, 2013), i.e., genomic constitution StStHH including variants restricted to Elymus. Population genetic analysis of the 5S nrDNA sequence data revealed that the within-species variance component is roughly ±89 %; thus, we were unable to identify molecular markers capable to separate the 24 species analyzed. Separate phylogenetic analyses of the two unit classes and of all the data exhibit a trend only of the species to cluster on the phylograms. Finally, the analysis provides evidence for the multiple origins of American and Eurasian species. PMID:25248636

  4. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Six DNA regions were evaluated in a multi-national, multi-laboratory consortium as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it...

  5. Effects of permissible maximum-contamination levels of VOC mixture in water on total DNA, antioxidant gene expression, and sequences of ribosomal DNA of Drosophila melanogaster.

    PubMed

    Doganlar, Oguzhan; Doganlar, Zeynep Banu; Tabakcioglu, Kiymet

    2015-10-01

    In this study, we aimed to investigate the mutagenic and carcinogenic potential of a volatile organic compound (VOC) mixture with references to the response of D.melanogaster using selected antioxidant gene expressions, RAPD assay and base-pair change of ribosomal 18S, and the internal transcribed spacer, ITS2 rDNA gene sequences. For this purpose, Drosophila melanogaster Oregon R, reared under controlled conditions on artificial diets, were treated with the mixture of thirteen VOCs, which are commonly found in water in concentrations of 10, 20, 50, and 75 ppb for 1 and 5 days. In the random amplified polymorphic DNA (RAPD) assay, band changes were clearly detected, especially at the 50 and 75 ppb exposure levels, for both treatment periods, and the band profiles exhibited clear differences between the treated and untreated flies with changes in band intensity and the loss/appearance of bands. Quantitative real-time PCR (qRT-PCR) analysis of Mn-superoxide dismutase (Mn-SOD), catalase (CAT) and glutathione-synthetase (GS) expressions demonstrated that these markers responded significantly to VOC-induced oxidative stress. Whilst CAT gene expressions increased linearly with increasing concentrations of VOCs and treatment times, the 50- and 75-ppb treatments caused decreases in GS expressions compared to the control at 5 days. Treatment with VOCs at both exposure times, especially in high doses, caused gene mutation of the 18S and the ITS2 ribosomal DNA. According to this research, we thought that the permissible maximum-contamination level of VOCs can cause genotoxic effect especially when mixed.

  6. Fine resolution mapping of double-strand break sites for human ribosomal DNA units.

    PubMed

    Pope, Bernard J; Mahmood, Khalid; Jung, Chol-Hee; Park, Daniel J

    2016-12-01

    DNA breakage arises during a variety of biological processes, including transcription, replication and genome rearrangements. In the context of disease, extensive fragmentation of DNA has been described in cancer cells and during early stages of neurodegeneration (Stephens et al., 2011 Stephens et al. (2011) [5]; Blondet et al., 2001 Blondet et al. (2001) [1]). Stults et al. (2009) Stults et al. (2009) [6] reported that human rDNA gene clusters are hotspots for recombination and that rDNA restructuring is among the most common chromosomal alterations in adult solid tumours. As such, analysis of rDNA regions is likely to have significant prognostic and predictive value, clinically. Tchurikov et al. (2015a, 2016) Tchurikov et al. (2015a, 2016) [7], [9] have made major advances in this direction, reporting that sites of human genome double-strand breaks (DSBs) occur frequently at sites in rDNA that are tightly linked with active transcription - the authors used a RAFT (rapid amplification of forum termini) protocol that selects for blunt-ended sites. They reported the relative frequency of these rDNA DSBs within defined co-ordinate 'windows' of varying size and made these data (as well as the relevant 'raw' sequencing information) available to the public (Tchurikov et al., 2015b). Assay designs targeting rDNA DSB hotspots will benefit greatly from the publication of break sites at greater resolution. Here, we re-analyse public RAFT data and make available rDNA DSB co-ordinates to the single-nucleotide level. PMID:27656414

  7. Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA.

    PubMed

    Bullerwell, Charles E; Schnare, Murray N; Gray, Michael W

    2003-03-01

    Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.

  8. Sequence variation in the ribosomal DNA internal transcribed spacer of Tridacna crocea.

    PubMed

    Yu, E T; Juinio-Meñez, M A; Monje, V D

    2000-11-01

    DNA-based genetic markers are needed to augment existing allozyme markers in the assessment of genetic diversity of wild giant clam populations. The dearth of polymorphic mitochondrial DNA regions amplified from known universal polymerase chain reaction (PCR) primers has led us to search other regions of the genome for viable sources of DNA polymorphism. We have designed tridacnid-specific PCR primers for the amplification of internal transcribed spacer regions. Sequences of the first internal transcribed spacer segment (ITS-1) revealed very high polymorphism, showing 29% variation arising from base substitutions alone. Preliminary restriction analysis of the ITS regions using 8 restriction enzymes revealed cryptic changes in the DNA sequence. These mutations are promising as marker tools for differentiating geographically separated populations. Such variation in the ITS region can possibly be used for population genetic analysis.

  9. Diversity and Inheritance of Intergenic Spacer Sequences of 45S Ribosomal DNA among Accessions of Brassica oleracea L. var. capitata

    PubMed Central

    Yang, Kiwoung; Robin, Arif Hasan Khan; Yi, Go-Eun; Lee, Jonghoon; Chung, Mi-Young; Yang, Tae-Jin; Nou, Ill-Sup

    2015-01-01

    Ribosomal DNA (rDNA) of plants is present in high copy number and shows variation between and within species in the length of the intergenic spacer (IGS). The 45S rDNA of flowering plants includes the 5.8S, 18S and 25S rDNA genes, the internal transcribed spacer (ITS1 and ITS2), and the intergenic spacer 45S-IGS (25S-18S). This study identified six different types of 45S-IGS, A to F, which at 363 bp, 1121 bp, 1717 bp, 1969 bp, 2036 bp and 2111 bp in length, respectively, were much shorter than the reported reference IGS sequences in B. oleracea var. alboglabra. The shortest two IGS types, A and B, lacked the transcription initiation site, non-transcribed spacer, and external transcribed spacer. Functional behavior of those two IGS types in relation to rRNA synthesis is a subject of further investigation. The other four IGSs had subtle variations in the transcription termination site, guanine-cytosine (GC) content, and number of tandem repeats, but the external transcribed spacers of these four IGSs were quite similar in length. The 45S IGSs were found to follow Mendelian inheritance in a population of 15 F1s and their 30 inbred parental lines, which suggests that these sequences could be useful for development of new breeding tools. In addition, this study represents the first report of intra-specific (within subspecies) variation of the 45S IGS in B. oleracea. PMID:26633391

  10. Phylogenetic Diversity of Lactic Acid Bacteria Associated with Paddy Rice Silage as Determined by 16S Ribosomal DNA Analysis

    PubMed Central

    Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito

    2003-01-01

    A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and Weissella. Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the predominant groups indicated by phenotypic analysis and to determine the phylogenetic affiliation of representative strains. The virtually complete 16S rRNA gene was PCR amplified and sequenced. The sequences from the various LAB isolates showed high degrees of similarity to those of the GenBank reference strains (between 98.7 and 99.8%). Phylogenetic trees based on the 16S rDNA sequence displayed high consistency, with nodes supported by high bootstrap values. With the exception of one species, the genetic data was in agreement with the phenotypic identification. The prevalent LAB, predominantly homofermentative (66%), consisted of Lactobacillus plantarum (24%), Lactococcus lactis (22%), Leuconostoc pseudomesenteroides (20%), Pediococcus acidilactici (11%), Lactobacillus brevis (11%), Enterococcus faecalis (7%), Weissella kimchii (3%), and Pediococcus pentosaceus (2%). The present study, the first to fully document rice-associated LAB, showed a very diverse community of LAB with a relatively high number of species involved in the fermentation process of paddy rice silage. The comprehensive 16S rDNA-based approach to describing LAB community structure was valuable in revealing the large diversity of bacteria inhabiting paddy rice silage and enabling the future design of appropriate inoculants aimed at improving its fermentation quality. PMID:12514026

  11. Extensive Pyrosequencing Reveals Frequent Intra-Genomic Variations of Internal Transcribed Spacer Regions of Nuclear Ribosomal DNA

    PubMed Central

    Li, Dezhu; Sun, Yongzhen; Niu, Yunyun; Chen, Zhiduan; Luo, Hongmei; Pang, Xiaohui; Sun, Zhiying; Liu, Chang; Lv, Aiping; Deng, Youping; Larson-Rabin, Zachary; Wilkinson, Mike; Chen, Shilin

    2012-01-01

    Background Internal transcribed spacer of nuclear ribosomal DNA (nrDNA) is already one of the most popular phylogenetic and DNA barcoding markers. However, the existence of its multiple copies has complicated such usage and a detailed characterization of intra-genomic variations is critical to address such concerns. Methodology/Principal Findings In this study, we used sequence-tagged pyrosequencing and genome-wide analyses to characterize intra-genomic variations of internal transcribed spacer 2 (ITS2) regions from 178 plant species. We discovered that mutation of ITS2 is frequent, with a mean of 35 variants per species. And on average, three of the most abundant variants make up 91% of all ITS2 copies. Moreover, we found different congeneric species share identical variants in 13 genera. Interestingly, different species across different genera also share identical variants. In particular, one minor variant of ITS2 in Eleutherococcus giraldii was found identical to the ITS2 major variant of Panax ginseng, both from Araliaceae family. In addition, DNA barcoding gap analysis showed that the intra-genomic distances were markedly smaller than those of the intra-specific or inter-specific variants. When each of 5543 variants were examined for its species discrimination efficiency, a 97% success rate was obtained at the species level. Conclusions Identification of identical ITS2 variants across intra-generic or inter-generic species revealed complex species evolutionary history, possibly, horizontal gene transfer and ancestral hybridization. Although intra-genomic multiple variants are frequently found within each genome, the usage of the major variants alone is sufficient for phylogeny construction and species determination in most cases. Furthermore, the inclusion of minor variants further improves the resolution of species identification. PMID:22952830

  12. Neurospora ribosomal DNA sequences are indistinguishable within cell types but distinguishable among heterothallic species

    SciTech Connect

    Chambers, C.; Dutta, S.K.

    1983-01-01

    High molecular nuclear DNAs were isolated from three developmental cell types of N. crassa: conidia, mycelia and germinated conidia, and from mycelial cells of two other heterothallic species, N. intermedia and N. sitophila. These nuclear DNAs were treated with several restriction enzymes: EcoR1, Bam H1, Hind III, Hinc II, Bgl II, Sma I and Pst 1. All seven restriction enzymes were tested on 0.7% agarose gels. EcoR1, Hind III, Pst 1, and Hinc II showed band differences among the species, but not among the cell types. Southern blot transfers of restricted DNA gels were then hybridized with TSP-labelled pMF2 rDNAs (probe). This later DNA was prepared from N. crassa rDNA cloned into pBR322 plasmid, obtained from Dr. Robert Metzenberg of the University of Wisconsin. Autoradiograms of these hybrids between southern blots and probe DNA revealed similar rDNA band patterns confirming the observations on restriction gels. In the case of EcoR1 restriction analysis there were differences in fragments on 0.7% agarose gel, but after hybridization of southern blots no differences in band patterns were seen in autoradiograms. This raises the question whether the background bands were all of rDNA sequences. These studies are being continued using ITS (internal transcribed spacer) sequences of N. crassa rDNAs cloned in pBR322 plasmid.

  13. Chromosome breakages associated with 45S ribosomal DNA sequences in spotted snakehead fish Channa punctatus.

    PubMed

    Singh, Mamta; Barman, Anindya Sundar

    2013-01-01

    It is well known that transcriptionally inactive rRNA genes are correlated with DNA hyper-methylation and histone hypo-methylation and there is clear evidence in humans that DNA and histone modification which alter chromatin structure are related to chromosome fragility. Very little is known about the biological cause of 45S rDNA fragility. In this report we characterized the chromosome breakage or gap associated with 45S rDNA in a fish species Channa punctatus. The rDNA mapping in C. punctatus, showed many chromosome breakages or gap formations, and all occurred exclusively in the 45S rDNA sites in anterior kidney cells. We observed that the number of chromosomes plus chromosome fragments was often more than the expected 32 in most cells. Total 67 % metaphase spread showed the expected or normal 32 chromosomes, while 33 % metaphase spread showed 33 and/or 34 chromosomes and/or chromosome fragments. The chromosome lesions observed in this study are very similar cytologically to that of fragile sites observed in human chromosomes. Possible causes for the spontaneous expression of fragile sites and their potential biological significance are also discussed in present report.

  14. Evaluation of amplified ribosomal DNA restriction analysis (ARDRA) and species-specific PCR for identification of Bifidobacterium species.

    PubMed

    Krízová, Jana; Spanová, Alena; Rittich, Bohuslav

    2006-01-01

    Molecular biological methods based on genus-specific PCR, species-specific PCR, and amplified ribosomal DNA restriction analysis (ARDRA) of two PCR amplicons (523 and 914bp) using six restriction enzymes were used to differentiate among species of Bifidobacterium. The techniques were established using DNA from 16 type and reference strains of bifidobacteria of 11 species. The discrimination power of 914bp amplicon digestion was higher than that of 523bp amplicon digestion. The 914bp amplicon digestion by six restrictases provided unique patterns for nine species; B. catenulatum and B. pseudocatenulatum were not differentiated yet. The NciI digestion of the 914bp PCR product enabled to discriminate between each of B. animalis, B. lactis, and B. gallicum. The reference strain B. adolescentis CCM 3761 was reclassified as a member of the B. catenulatum/B. pseudocatenulatum group. The above-mentioned methods were applied for the identification of seven strains of Bifidobacterium spp. collected in the Culture Collection of Dairy Microorganisms (CCDM). The strains collected in CCDM were differentiated to the species level. Six strains were identified as B. lactis, one strain as B. adolescentis.

  15. Analysis of Fungal Flora in Indoor Dust by Ribosomal DNA Sequence Analysis, Quantitative PCR, and Culture▿ †

    PubMed Central

    Pitkäranta, M.; Meklin, T.; Hyvärinen, A.; Paulin, L.; Auvinen, P.; Nevalainen, A.; Rintala, H.

    2008-01-01

    In recent years increasing attention has been given to the potential health effects of fungal exposure in indoor environments. We used large-scale sequencing of the fungal internal transcribed spacer region (ITS) of nuclear ribosomal DNA to describe the mycoflora of two office buildings over the four seasons. DNA sequencing was complemented by cultivation, ergosterol determination, and quantitative PCR analyses. Sequences of 1,339 clones were clustered into 394 nonredundant fungal operational taxonomical units containing sequences from 18 fungal subclasses. The observed flora differed markedly from that recovered by cultivation, the major differences being the near absence of several typical indoor mold genera such as Penicillium and Aspergillus spp. and a high prevalence of basidiomycetes in clone libraries. A total of 55% of the total diversity constituted of unidentifiable ITS sequences, some of which may represent novel fungal species. Dominant species were Cladosporium cladosporioides and C. herbarum, Cryptococcus victoriae, Leptosphaerulina americana and L. chartarum, Aureobasidium pullulans, Thekopsora areolata, Phaeococcomyces nigricans, Macrophoma sp., and several Malassezia species. Seasonal differences were observed for community composition, with ascomycetous molds and basidiomycetous yeasts predominating in the winter and spring and Agaricomycetidae basidiomycetes predominating in the fall. The comparison of methods suggested that the cloning, cultivation, and quantitative PCR methods complemented each other, generating a more comprehensive picture of fungal flora than any of the methods would give alone. The current restrictions of the methods are discussed. PMID:17981947

  16. Phylogenetic Relationships and Genetic Variation in Longidorus and Xiphinema Species (Nematoda: Longidoridae) Using ITS1 Sequences of Nuclear Ribosomal DNA.

    PubMed

    Ye, Weimin; Szalanski, Allen L; Robbins, R T

    2004-03-01

    Genetic analyses using DNA sequences of nuclear ribosomal DNA ITS1 were conducted to determine the extent of genetic variation within and among Longidorus and Xiphinema species. DNA sequences were obtained from samples collected from Arkansas, California and Australia as well as 4 Xiphinema DNA sequences from GenBank. The sequences of the ITS1 region including the 3' end of the 18S rDNA gene and the 5' end of the 5.8S rDNA gene ranged from 1020 bp to 1244 bp for the 9 Longidorus species, and from 870 bp to 1354 bp for the 7 Xiphinema species. Nucleotide frequencies were: A = 25.5%, C = 21.0%, G = 26.4%, and T = 27.1%. Genetic variation between the two genera had a maximum divergence of 38.6% between X. chambersi and L. crassus. Genetic variation among Xiphinema species ranged from 3.8% between X. diversicaudatum and X. bakeri to 29.9% between X. chambersi and X. italiae. Within Longidorus, genetic variation ranged from 8.9% between L. crassus and L. grandis to 32.4% between L. fragilis and L. diadecturus. Intraspecific genetic variation in X. americanum sensu lato ranged from 0.3% to 1.9%, while genetic variation in L. diadecturus had 0.8% and L. biformis ranged from 0.6% to 10.9%. Identical sequences were obtained between the two populations of L. grandis, and between the two populations of X. bakeri. Phylogenetic analyses based on the ITS1 DNA sequence data were conducted on each genus separately using both maximum parsimony and maximum likelihood analysis. Among the Longidorus taxa, 4 subgroups are supported: L. grandis, L. crassus, and L. elongatus are in one cluster; L. biformis and L. paralongicaudatus are in a second cluster; L. fragilis and L. breviannulatus are in a third cluster; and L. diadecturus is in a fourth cluster. Among the Xiphinema taxa, 3 subgroups are supported: X. americanum with X. chambersi, X. bakeri with X. diversicaudatum, and X. italiae and X. vuittenezi forming a sister group with X. index. The relationships observed in this study

  17. G-rich telomeric and ribosomal DNA sequences from the fission yeast genome form stable G-quadruplex DNA structures in vitro and are unwound by the Pfh1 DNA helicase.

    PubMed

    Wallgren, Marcus; Mohammad, Jani B; Yan, Kok-Phen; Pourbozorgi-Langroudi, Parham; Ebrahimi, Mahsa; Sabouri, Nasim

    2016-07-27

    Certain guanine-rich sequences have an inherent propensity to form G-quadruplex (G4) structures. G4 structures are e.g. involved in telomere protection and gene regulation. However, they also constitute obstacles during replication if they remain unresolved. To overcome these threats to genome integrity, organisms harbor specialized G4 unwinding helicases. In Schizosaccharomyces pombe, one such candidate helicase is Pfh1, an evolutionarily conserved Pif1 homolog. Here, we addressed whether putative G4 sequences in S. pombe can adopt G4 structures and, if so, whether Pfh1 can resolve them. We tested two G4 sequences, derived from S. pombe ribosomal and telomeric DNA regions, and demonstrated that they form inter- and intramolecular G4 structures, respectively. Also, Pfh1 was enriched in vivo at the ribosomal G4 DNA and telomeric sites. The nuclear isoform of Pfh1 (nPfh1) unwound both types of structure, and although the G4-stabilizing compound Phen-DC3 significantly enhanced their stability, nPfh1 still resolved them efficiently. However, stable G4 structures significantly inhibited adenosine triphosphate hydrolysis by nPfh1. Because ribosomal and telomeric DNA contain putative G4 regions conserved from yeasts to humans, our studies support the important role of G4 structure formation in these regions and provide further evidence for a conserved role for Pif1 helicases in resolving G4 structures.

  18. Comparative cytogenetic analysis of the genus symphysodon (discus fishes, cichlidae): chromosomal characteristics of retrotransposons and minor ribosomal DNA.

    PubMed

    Gross, M C; Schneider, C H; Valente, G T; Porto, J I R; Martins, C; Feldberg, E

    2009-01-01

    As part of a genetic screening program for wild Discus fishes, we analyzed karyotypes and cytogenetic characteristics of Symphysodon aequifasciatus, S. discus and S. haraldi using C-banding and fluorescent in situ hybridization (FISH) with the Rex3 retrotransposon and 5S rDNA probes in mitotic and meiotic chromosomes. In the 3 species, diploid chromosome number was 2n = 60 and karyotypes contained predominantly meta-submetacentric chromosomes. C-banding showed blocks of constitutive heterochromatin mainly in the pericentromeric region. Physical mapping of repetitive 5S rDNA sequences and Rex3 retrotransposons in mitotic and meiotic chromosomes showed partial colocalization of constitutive heterochromatin and repetitive elements. Correlations among the accumulation of repetitive elements, heterochromatinization and chromosome rearrangements have been hypothesized to explain the karyotype differentiation in the Symphysodon genus. The role of repetitive elements in adaptation to highly diverse habitats, as well as in the generation of the phenotypic and genetic variability found in wild Discus populations, needs to be further investigated.

  19. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    PubMed Central

    2008-01-01

    Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny. PMID:18366624

  20. Transcription factor IIIA induced bending of the Xenopus somatic 5S gene promoter.

    PubMed

    Schroth, G P; Cook, G R; Bradbury, E M; Gottesfeld, J M

    1989-08-10

    Transcription factor IIIA (TFIIIA), the canonical zinc-finger protein, is a protein of relative molecular mass 39,000 (39K) that is required for transcription of 5S-ribosomal subunit genes in Xenopus. It binds in a sequence-specific manner to the internal control region of the 5S gene (see Fig. 1) and facilitates transcription of the gene by RNA polymerase III. It also binds to the 5S gene product to form a 7S ribonucleoprotein particle. In oocytes the 7S particle acts as a storage form of the RNA to be utilized later in development. TFIIIA binds to DNA through its 30 K N-terminal domain, which contains nine zinc-fingers. TFIIIA was the first protein described to have this type of DNA binding motif, but numerous other proteins have now been shown to have zinc-finger domains. A structure for a single zinc-finger from the yeast protein ADR1, was recently proposed based on two-dimensional NMR data (ref. 8), and a similar structure was proposed based on comparison with crystal structures of other metalloproteins. Although models for the interaction of TFIIIA with the 5S-ribosomal gene DNA have been proposed, based on nuclease digestion and methylation interference data, little precise structural information is available for TFIIIA and the physical basis for the interaction of zinc-fingers with DNA is not understood. Using both circular permutation and circularization assays we provide convincing biochemical evidence that TFIIIA bends the DNA at the internal promoter of the 5S gene.

  1. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array.

  2. 18S ribosomal DNA sequences provide insight into the phylogeny of patellogastropod limpets (Mollusca: Gastropoda).

    PubMed

    Yoon, Sook Hee; Kim, Won

    2007-02-28

    To investigate the phylogeny of Patellogastropoda, the complete 18S rDNA sequences of nine patellogastropod limpets Cymbula canescens (Gmelin, 1791), Helcion dunkeri (Krauss, 1848), Patella rustica Linnaeus, 1758, Cellana toreuma (Reeve, 1855), Cellana nigrolineata (Reeve, 1854), Nacella magellanica Gmelin, 1791, Nipponacmea concinna (Lischke, 1870), Niveotectura pallida (Gould, 1859), and Lottia dorsuosa Gould, 1859 were determined. These sequences were then analyzed along with the published 18S rDNA sequences of 35 gastropods, one bivalve, and one chiton species. Phylogenetic trees were constructed by maximum parsimony, maximum likelihood, and Bayesian inference. The results of our 18S rDNA sequence analysis strongly support the monophyly of Patellogastropoda and the existence of three subgroups. Of these, two subgroups, the Patelloidea and Acmaeoidea, are closely related, with branching patterns that can be summarized as [(Cymbula + Helcion) + Patella] and [(Nipponacmea + Lottia) + Niveotectura]. The remaining subgroup, Nacelloidea, emerges as basal and paraphyletic, while its genus Cellana is monophyletic. Our analysis also indicates that the Patellogastropoda have a sister relationship with the order Cocculiniformia within the Gastropoda. PMID:17464213

  3. Phylogeny of the Macaronesian endemic Crambe section Dendrocrambe (Brassicaceae) based on internal transcribed spacer sequences of nuclear ribosomal DNA.

    PubMed

    Francisco-Ortega, Javier; Fuertes-Aguilar, Javier; Kim, Seung-Chul; Santos-Guerra, Arnoldo; Crawford, Daniel J; Jansen, Robert K

    2002-12-01

    The 14 species of Crambe L. sect. Dendrocrambe DC. (Brassicaceae) form a monophyletic group endemic to the Canary and Madeira archipelagos. Both parsimony and maximum likelihood analyses of sequence data from the two internal transcribed spacer regions of nuclear ribosomal DNA were used to estimate phylogenetic relationships within this section. These analyses support the monophyly of three major clades. No clade is restricted to a single island, and therefore it appears that inter-island colonization has been the main avenue for speciation in these two archipelagos. The two species endemic to Fuerteventura (C. sventenii) and Madeira (C. fruticosa) comprise a clade, providing the first evidence for a floristic link between the Eastern Canary Islands and the archipelago of Madeira. Both maximum likelihood and weighted parsimony analyses show that this clade is sister to the two other clades, although bootstrap support for this relationship is weak. Parsimony optimizations of ecological zones and island distribution suggest a colonization route from the low-altitude areas of the lowland scrub toward the high-elevation areas of the laurel and pine forests. In addition, Tenerife is likely the ancestral island for species endemic to the five westernmost islands of Gran Canaria, La Gomera, El Hierro, La Palma, and Tenerife.

  4. Rapid Diagnosis of Bacteremia by Universal Amplification of 23S Ribosomal DNA Followed by Hybridization to an Oligonucleotide Array

    PubMed Central

    Anthony, R. M.; Brown, T. J.; French, G. L.

    2000-01-01

    The rapid identification of bacteria in blood cultures and other clinical specimens is important for patient management and antimicrobial therapy. We describe a rapid (<4 h) detection and identification system that uses universal PCR primers to amplify a variable region of bacterial 23S ribosomal DNA, followed by reverse hybridization of the products to a panel of oligonucleotides. This procedure was successful in discriminating a range of bacteria in pure cultures. When this procedure was applied directly to 158 unselected positive blood culture broths on the day when growth was detected, 125 (79.7%) were correctly identified, including 4 with mixed cultures. Nine (7.2%) yielded bacteria for which no oligonucleotide targets were present in the oligonucleotide panel, and 16 culture-positive broths (10.3%) produced no PCR product. In seven of the remaining eight broths, streptococci were identified but not subsequently grown, and one isolate of Staphylococcus aureus was misidentified as a coagulase-negative staphylococcus. The accuracy, range, and discriminatory power of the assay can be continually extended by adding further oligonucleotides to the panel without significantly increasing complexity or cost. PMID:10655385

  5. Identification of Ustilago cynodontis as a new producer of glycolipid biosurfactants, mannosylerythritol lipids, based on ribosomal DNA sequences.

    PubMed

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2008-01-01

    Mannosylerythritol lipids (MELs) are one of the most promising glycolipid biosurfactants known because of their multifunctionality and biocompatibility. The search for novel producers of MELs was undertaken based on the analysis of ribosomal DNA sequences on basidiomycetous yeasts. The bermuda grass smut fungus Ustilago cynodontis NBRC 7530, which taxonomically relates to Pseudozyma shanxiensis known as a MEL-C producer, was found to accumulate glycolipids in the cultured medium. Under a shake flask culture with soybean oil, the amount of the glycolipids was 1.4 g/L for 7 days at 25 degrees C. As a result of the structural characterization, the main glycolipids was identified as 4-O-[(4'-O-acetyl-3'-O-alka(e)noyl-2'-O-butanoyl)-beta-D-mannopyranosyl]-D-erythritol, and the major fatty acids were C(14) and C(16) ones. The glycolipid was highly hydrophilic MEL-C, and very similar to those produced by P. shanxiensis. The fungi of the genus Ustilago are thus likely to be potential producers of MELs as well as the yeasts of the genus Pseudozyma. PMID:18781055

  6. Phenotypic variability confirmed by nuclear ribosomal DNA suggests a possible natural hybrid zone of Triatoma brasiliensis species complex.

    PubMed

    Costa, Jane; Bargues, Maria Dolores; Neiva, Vanessa Lima; Lawrence, Gena G; Gumiel, Marcia; Oliveira, Genova; Cabello, Pedro; Lima, Marli Maria; Dotson, Ellen; Provance, David William; Almeida, Carlos Eduardo; Mateo, Lucia; Mas-Coma, Santiago; Dujardin, Jean Pierre

    2016-01-01

    Triatoma brasiliensis macromelasoma occurs in Pernambuco state, Brazil, which is situated between the distribution areas of Triatoma brasiliensis brasiliensis (north) and Triatoma juazeirensis (south). T. b. macromelasoma displays greater variations in its chromatic phenotype than either T. b. brasiliensis or T. juazeirensis, and patterns reminiscent of one or the other. Experimental crosses from each of these members of the T. brasiliensis species complex generated fertile offspring suggesting that viable hybrids could be present in nature, despite their significant genetic distances. Considering the geographical position of occurrence of the T. b. macromelasoma (in Pernambuco) it was proposed to be an area capable of supporting natural hybridization between T. b. brasiliensis and T. juazeirensis. Since phenotypic variability is expected, this study investigated the existence of intermediate chromatic phenotypes for T. b. macromelasoma in various locations in areas between the T. b. brasiliensis and T. juazeirensis occurrences. Thirteen different color patterns were for the first time characterized and nine of those displayed intermediate phenotypes. Molecular analysis performed using ribosomal DNA intergenic region, grouped all within the T. brasiliensis complex. The intermediate chromatic phenotypes, molecular analysis and experimental crosses all support the distinction of a zone of hybridization that gave rise to the T. b. macromelasoma through homoploidal evolution. PMID:26520796

  7. Genetic heterogeneity and phylogeny of Trichuris spp. from captive non-human primates based on ribosomal DNA sequence data.

    PubMed

    Cavallero, Serena; De Liberato, Claudio; Friedrich, Klaus G; Di Cave, David; Masella, Valentina; D'Amelio, Stefano; Berrilli, Federica

    2015-08-01

    Nematodes of the genus Trichuris, known as whipworms, are recognized to infect numerous mammalian species including humans and non-human primates. Several Trichuris spp. have been described and species designation/identification is traditionally based on host-affiliation, although cross-infection and hybridization events may complicate species boundaries. The main aims of the present study were to genetically characterize adult Trichuris specimens from captive Japanese macaques (Macaca fuscata) and grivets (Chlorocebus aethiops), using the ribosomal DNA (ITS) as molecular marker and to investigate the phylogeny and the extent of genetic variation also by comparison with data on isolates from other humans, non-human primates and other hosts. The phylogenetic analysis of Trichuris sequences from M. fuscata and C. aethiops provided evidences of distinct clades and subclades thus advocating the existence of additional separated taxa. Neighbor Joining and Bayesian trees suggest that specimens from M. fuscata may be distinct from, but related to Trichuris trichiura, while a close relationship is suggested between the subclade formed by the specimens from C. aethiops and the subclade formed by T. suis. The tendency to associate Trichuris sp. to host species can lead to misleading taxonomic interpretations (i.e. whipworms found in primates are identified as T. trichiura). The results here obtained confirm previous evidences suggesting the existence of Trichuris spp. other than T. trichiura infecting non-human living primates.

  8. Phenotypic variability confirmed by nuclear ribosomal DNA suggests a possible natural hybrid zone of Triatoma brasiliensis species complex.

    PubMed

    Costa, Jane; Bargues, Maria Dolores; Neiva, Vanessa Lima; Lawrence, Gena G; Gumiel, Marcia; Oliveira, Genova; Cabello, Pedro; Lima, Marli Maria; Dotson, Ellen; Provance, David William; Almeida, Carlos Eduardo; Mateo, Lucia; Mas-Coma, Santiago; Dujardin, Jean Pierre

    2016-01-01

    Triatoma brasiliensis macromelasoma occurs in Pernambuco state, Brazil, which is situated between the distribution areas of Triatoma brasiliensis brasiliensis (north) and Triatoma juazeirensis (south). T. b. macromelasoma displays greater variations in its chromatic phenotype than either T. b. brasiliensis or T. juazeirensis, and patterns reminiscent of one or the other. Experimental crosses from each of these members of the T. brasiliensis species complex generated fertile offspring suggesting that viable hybrids could be present in nature, despite their significant genetic distances. Considering the geographical position of occurrence of the T. b. macromelasoma (in Pernambuco) it was proposed to be an area capable of supporting natural hybridization between T. b. brasiliensis and T. juazeirensis. Since phenotypic variability is expected, this study investigated the existence of intermediate chromatic phenotypes for T. b. macromelasoma in various locations in areas between the T. b. brasiliensis and T. juazeirensis occurrences. Thirteen different color patterns were for the first time characterized and nine of those displayed intermediate phenotypes. Molecular analysis performed using ribosomal DNA intergenic region, grouped all within the T. brasiliensis complex. The intermediate chromatic phenotypes, molecular analysis and experimental crosses all support the distinction of a zone of hybridization that gave rise to the T. b. macromelasoma through homoploidal evolution.

  9. Delimitation of Sauropus (Phyllanthaceae) Based on Plastid matK and Nuclear Ribosomal ITS DNA Sequence Data

    PubMed Central

    Pruesapan, Kanchana; Telford, Ian R. H.; Bruhl, Jeremy J.; Draisma, Stefano G. A.; Van Welzen, Peter C.

    2008-01-01

    Background and Aims A recent molecular phylogenetic study showed that Sauropus is deeply embedded within Phyllanthus together with its allies, Breynia and Glochidion. As relationships within Sauropus are still problematic and the relationship with Breynia has long been doubted, more molecular data are needed to test/corroborate such a broad definition of Phyllanthus. This study aims to clarify the status and delimitation of Sauropus and establish its position within Phyllanthaceae. Methods Plastid matK and nuclear ribosomal ITS DNA sequence data for Sauropus and its allies were used to construct phylogenetic trees using maximum parsimony and Bayesian methods. Key Results Within Phyllanthus, Sauropus can be split into the mainly south-east Asian Sauropus sensu stricto (s.s.) plus Breynia and the mainly Australian Sauropus (formerly Synostemon). Sauropus s.s. plus Breynia comprise two distinct clades; one is the combination of Sauropus sections Glochidioidei, Sauropus and Schizanthi and the other is the combination of Sauropus sections Cryptogynium and Hemisauropus and the monophyletic genus Breynia. Conclusions Molecular data indicate that Synostemon should be reinstated at the same level as Sauropus s.s. and that Sauropus s.s. should be united with Breynia under the latter, older name. The molecular data corroborate only two of the five infrageneric groups of Sauropus recognized on the basis of morphological data. PMID:18854375

  10. Ribosomal DNA is active in different B chromosome variants of the grasshopper Eyprepocnemis plorans.

    PubMed

    Ruíz-Estévez, Mercedes; López-León, M Dolores; Cabrero, Josefa; Camacho, Juan Pedro M

    2013-09-01

    B chromosomes are considered to be genetically inert elements. However, some of them are able to show nucleolus organizer region (NOR) activity, as detected by both cytological and molecular means. The grasshopper Eyprepocnemis plorans shows a B chromosome polymorphism characterized by the existence of many B variants. One of them, B24, shows NOR activity in about half of B-carrying males in the Torrox population. Molecular data have suggested the recent origin for B chromosomes in this species, and on this basis it would be expected that NOR activity was widespread among the different B variants. Here we test this hypothesis in four different B chromosome variants (B1, B2, B5, and B24) from 11 natural populations of the grasshopper E. plorans covering the south and east of the Iberian Peninsula plus the Balearic Islands. We used two different approaches: (1) the cytological observation of nucleoli attached to the distal region of the B chromosome (where the rDNA is located), and (2) the molecular detection of the rDNA transcripts carrying an adenine insertion characteristic of B chromosome ITS2 sequences. The results showed NOR expression not only for B24 but also for the B1 and B2 variants. However, the level of B-NOR expression in these latter variants, measured by the proportion of cells showing nucleoli attached to the B chromosomes, was much lower than that previously reported for B24. This suggests the possibility that structural or genetic background conditions are enhancing the expressivity of the rDNA in the B24 variant.

  11. Differentiation and identification of iron-oxidizing acidophilic bacteria using cultivation techniques and amplified ribosomal DNA restriction enzyme analysis.

    PubMed

    Johnson, D Barrie; Okibe, Naoko; Hallberg, Kevin B

    2005-03-01

    Acidophilic iron-oxidizing microorganisms are important both environmentally and in biotechnological applications. Although, as a group, they are readily detected by their ability to generate ferric iron (resulting in a distinctive color change in liquid media), these microbes highly diverse phylogenetically. Various other characteristics, such as optimum growth temperature, response to organic carbon sources, and cellular morphologies, facilitate, in some cases, identification of isolates to a genus or species level, although this approach has limitations and may give erroneous results. In this study, a combined approach of using physiological traits together with amplified ribosomal DNA restriction enzyme analysis (ARDREA) has been successful in identifying all known acidophilic iron-oxidizing bacteria to the species level. Computer-generated maps were used to identify restriction enzymes that allow the differentiation of the acidophiles, and these were confirmed experimentally using authentic bacterial strains. To test further the validity of this approach, six acidophilic moderately thermophilic iron-oxidizing bacteria isolated from Montserrat (West Indies) were analysed using the ARDREA protocol. Three of the isolates were identified as Sulfobacillus acidophilus-like, and one as Sulfobacillus thermosulfidooxidans-like bacteria. The fifth isolate gave DNA digest patterns that were distinct from all known strains of iron-oxidizing acidophiles. Subsequent sequencing of the 16S rRNA genes of these isolates confirmed the identity of the four Sulfobacillus isolates, and also that the fifth isolate was a novel species. Schematic diagrams showing how ARDREA may be used to rapidly identify all known acidophilic iron-oxidizing bacteria are presented.

  12. Global eukaryote phylogeny: Combined small- and large-subunit ribosomal DNA trees support monophyly of Rhizaria, Retaria and Excavata.

    PubMed

    Moreira, David; von der Heyden, Sophie; Bass, David; López-García, Purificación; Chao, Ema; Cavalier-Smith, Thomas

    2007-07-01

    Resolution of the phylogenetic relationships among the major eukaryotic groups is one of the most important problems in evolutionary biology that is still only partially solved. This task was initially addressed using a single marker, the small-subunit ribosomal DNA (SSU rDNA), although in recent years it has been shown that it does not contain enough phylogenetic information to robustly resolve global eukaryotic phylogeny. This has prompted the use of multi-gene analyses, especially in the form of long concatenations of numerous conserved protein sequences. However, this approach is severely limited by the small number of taxa for which such a large number of protein sequences is available today. We have explored the alternative approach of using only two markers but a large taxonomic sampling, by analysing a combination of SSU and large-subunit (LSU) rDNA sequences. This strategy allows also the incorporation of sequences from non-cultivated protists, e.g., Radiozoa (=radiolaria minus Phaeodarea). We provide the first LSU rRNA sequences for Heliozoa, Apusozoa (both Apusomonadida and Ancyromonadida), Cercozoa and Radiozoa. Our Bayesian and maximum likelihood analyses for 91 eukaryotic combined SSU+LSU sequences yielded much stronger support than hitherto for the supergroup Rhizaria (Cercozoa plus Radiozoa plus Foraminifera) and several well-recognised groups and also for other problematic clades, such as the Retaria (Radiozoa plus Foraminifera) and, with more moderate support, the Excavata. Within opisthokonts, the combined tree strongly confirms that the filose amoebae Nuclearia are sisters to Fungi whereas other Choanozoa are sisters to animals. The position of some bikont taxa, notably Heliozoa and Apusozoa, remains unresolved. However, our combined trees suggest a more deeply diverging position for Ancyromonas, and perhaps also Apusomonas, than for other bikonts, suggesting that apusozoan zooflagellates may be central for understanding the early evolution of

  13. Identification of airborne bacterial and fungal species in the clinical microbiology laboratory of a university teaching hospital employing ribosomal DNA (rDNA) PCR and gene sequencing techniques.

    PubMed

    Nagano, Yuriko; Walker, Jim; Loughrey, Anne; Millar, Cherie; Goldsmith, Colin; Rooney, Paul; Elborn, Stuart; Moore, John

    2009-06-01

    Universal or "broad-range" PCR-based ribosomal DNA (rDNA) was performed on a collection of 58 isolates (n = 30 bacteria + 28 fungi), originating from environmental air from several locations within a busy clinical microbiology laboratory, supporting a university teaching hospital. A total of 10 bacterial genera were identified including both Gram-positive and Gram-negative genera. Gram-positive organisms accounted for 27/30 (90%) of total bacterial species, consisting of seven genera and included (in descending order of frequency) Staphylococcus, Micrococcus, Corynebacterium, Paenibacillus, Arthrobacter, Janibacter and Rothia. Gram-negative organisms were less frequently isolated 3/30 (10%) and comprised three genera, including Moraxella, Psychrobacter and Haloanella. Eight fungal genera were identified among the 28 fungal organisms isolated, including (in descending order of frequency) Cladosporium, Penicillium, Aspergillus, Thanatephorus, Absidia, Eurotium, Paraphaeosphaeria and Tritirachium, with Cladosporium accounting for 10/28 (35.7%) of the total fungal isolates. In conclusion, this study identified the presence of 10 bacterial and eight fungal genera in the air within the laboratory sampled. Although this reflected diversity of the microorganisms present, none of these organisms have been described previously as having an inhalational route of laboratory-acquired infection. Therefore, we believe that the species of organisms identified and the concentration levels of these airborne contaminants determined, do not pose a significant health and safety threat for immunocompotent laboratory personnel and visitors. PMID:20183192

  14. Arabidopsis MAS2, an Essential Gene That Encodes a Homolog of Animal NF-κ B Activating Protein, Is Involved in 45S Ribosomal DNA Silencing

    PubMed Central

    Sánchez-García, Ana Belén; Aguilera, Verónica; Micol-Ponce, Rosa; Jover-Gil, Sara; Ponce, María Rosa

    2015-01-01

    Ribosome biogenesis requires stoichiometric amounts of ribosomal proteins and rRNAs. Synthesis of rRNAs consumes most of the transcriptional activity of eukaryotic cells, but its regulation remains largely unclear in plants. We conducted a screen for ethyl methanesulfonate-induced suppressors of Arabidopsis thaliana ago1-52, a hypomorphic allele of AGO1 (ARGONAUTE1), a key gene in microRNA pathways. We identified nine extragenic suppressors as alleles of MAS2 (MORPHOLOGY OF AGO1-52 SUPPRESSED2). Positional cloning showed that MAS2 encodes the putative ortholog of NKAP (NF-κ B activating protein), a conserved eukaryotic protein involved in transcriptional repression and splicing in animals. The mas2 point mutations behave as informational suppressors of ago1 alleles that cause missplicing. MAS2 is a single-copy gene whose insertional alleles are embryonic lethal. In yeast two-hybrid assays, MAS2 interacted with splicing and ribosome biogenesis proteins, and fluorescence in situ hybridization showed that MAS2 colocalizes with the 45S rDNA at the nucleolar organizer regions (NORs). The artificial microRNA amiR-MAS2 partially repressed MAS2 and caused hypomethylation of 45S rDNA promoters as well as partial NOR decondensation, indicating that MAS2 negatively regulates 45S rDNA expression. Our results thus reveal a key player in the regulation of rRNA synthesis in plants. PMID:26139346

  15. DNaseI-hypersensitive sites at promoter-like sequences in the spacer of Xenopus laevis and Xenopus borealis ribosomal DNA.

    PubMed Central

    La Volpe, A; Taggart, M; McStay, B; Bird, A

    1983-01-01

    We have detected a DNAseI hypersensitive site in the ribosomal DNA spacer of Xenopus laevis and Xenopus borealis. The site is present in blood and embryonic nuclei of each species. In interspecies hybrids, however, the site is absent in unexpressed borealis rDNA, but is present normally in expressed laevis rDNA. Hypersensitive sites are located well upstream (over lkb) of the pre-ribosomal RNA promoter. Sequencing of the hypersensitive region in borealis rDNA, however, shows extensive homology with the promoter sequence, and with the hypersensitive region in X. laevis. Of two promoter-like duplications in each spacer, only the most upstream copy is associated with hypersensitivity to DNAaseI. Unlike DNAaseI, Endo R. MspI digests the rDNA of laevis blood nuclei at a domain extending downstream from the hypersensitive site to near the 40S promoter. Since the organisation of conserved sequence elements within this "proximal domain" is similar in three Xenopus species whose spacers have otherwise evolved rapidly, we conclude that this domain plays an important role in rDNA function. Images PMID:6310495

  16. The phylogenetic position of Rhopalura ophiocomae (Orthonectida) based on 18S ribosomal DNA sequence analysis.

    PubMed

    Hanelt, B; Van Schyndel, D; Adema, C M; Lewis, L A; Loker, E S

    1996-11-01

    The Orthonectida is a small, poorly known phylum of parasites of marine invertebrates. Their phylogenetic placement is obscure; they have been considered to be multicellular protozoans, primitive animals at a "mesozoan" grade of organization, or secondarily simplified flatworm-like organisms. The best known species in the phylum, Rhopalura ophiocomae, was collected on San Juan Island, Wash. and a complete 18S rDNA sequence was obtained. Using the models of minimum evolution and parsimony, phylogenetic analyses were undertaken and the results lend support to the following hypotheses about orthonectids: (1) orthonectids are more closely aligned with triploblastic metazoan taxa than with the protist or diploblastic metazoan taxa considered in this analysis; (2) orthonectids are not derived members of the phylum Platyhelminthes; and (3) orthonectids and rhombozoans are not each other's closest relatives, thus casting further doubt on the validity of the phylum Mesozoa previously used to encompass both groups. PMID:8896370

  17. Small subunit ribosomal DNA suggests that the xenophyophorean Syringammina corbicula is a foraminiferan.

    PubMed

    Pawlowski, Jan; Holzmann, Maria; Fahrni, Jose; Richardson, Susan L

    2003-01-01

    Xenophyophorea are giant deep-sea rhizopodial protists of enigmatic origins. Although species were described as Foraminifera or sponges in the early literature, the xenophyophoreans are currently classified either as a class of Rhizopoda or an independent phylum. To establish the phylogenetic position of Xenophyophorea, we analysed the small subunit (SSU) rRNA gene sequence of Syringammina corbicula Richardson, a newly described xenophyophorean species from the Cape Verde Plateau. The SSUrDNA analyses showed that S. corbicula is closely related to Rhizammina algaeformis, a tubular deep-sea foraminiferan. Both species branch within a group of monothalamous (single-chambered) Foraminifera, which include also such agglutinated genera as Toxisarcon, Rhabdammina, and Saccammina, and the organic-walled genera Gloiogullmia and Cylindrogullmia. Our results are congruent with observations of similar cytoplasmic organisation in Rhizammina and Syringammina. Thus, the Xenophyophorea appear to be a highly specialised group of deep-sea Foraminifera.

  18. The phylogenetic position of Rhopalura ophiocomae (Orthonectida) based on 18S ribosomal DNA sequence analysis.

    PubMed

    Hanelt, B; Van Schyndel, D; Adema, C M; Lewis, L A; Loker, E S

    1996-11-01

    The Orthonectida is a small, poorly known phylum of parasites of marine invertebrates. Their phylogenetic placement is obscure; they have been considered to be multicellular protozoans, primitive animals at a "mesozoan" grade of organization, or secondarily simplified flatworm-like organisms. The best known species in the phylum, Rhopalura ophiocomae, was collected on San Juan Island, Wash. and a complete 18S rDNA sequence was obtained. Using the models of minimum evolution and parsimony, phylogenetic analyses were undertaken and the results lend support to the following hypotheses about orthonectids: (1) orthonectids are more closely aligned with triploblastic metazoan taxa than with the protist or diploblastic metazoan taxa considered in this analysis; (2) orthonectids are not derived members of the phylum Platyhelminthes; and (3) orthonectids and rhombozoans are not each other's closest relatives, thus casting further doubt on the validity of the phylum Mesozoa previously used to encompass both groups.

  19. 16S ribosomal DNA sequence analysis confirms the close relationship between the genera Xanthobacter, Azorhizobium, and Aquabacter and reveals a lack of phylogenetic coherence among Xanthobacter species

    SciTech Connect

    Rainey, F.A.; Wiegel, J.

    1996-04-01

    A comparative 16S ribosomal DNA (rDNA) sequence analysis was used to investigate the phylogenetic position of members of the genus Xanthobacter. We determined 16S rDNA sequence data for the type strains of the three Xanthobacter species and five additional Xanthobacter strains. The close relationship between the genera Xanthobacter, Azorhizobium, and Aquabacter previously demonstrated by DNA-rRNA hybridization studies was confirmed. The results of our phylogenetic analysis indicate that members of the genera Xanthobacter, Azorhizobium, and Aquabacter are intermixed and that there is no clear genetic cluster consisting of the Xanthobacter species. A comparison of the Xanthobacter sequences with the 16S rDNA sequences available from environmental clone studies indicated that members of this genus have not been detected by nonculturing approaches.

  20. Yeast ribosomal protein L7 and its homologue Rlp7 are simultaneously present at distinct sites on pre-60S ribosomal particles

    PubMed Central

    Babiano, Reyes; Badis, Gwenael; Saveanu, Cosmin; Namane, Abdelkader; Doyen, Antonia; Díaz-Quintana, Antonio; Jacquier, Alain; Fromont-Racine, Micheline; de la Cruz, Jesús

    2013-01-01

    Ribosome biogenesis requires >300 assembly factors in Saccharomyces cerevisiae. Ribosome assembly factors Imp3, Mrt4, Rlp7 and Rlp24 have sequence similarity to ribosomal proteins S9, P0, L7 and L24, suggesting that these pre-ribosomal factors could be placeholders that prevent premature assembly of the corresponding ribosomal proteins to nascent ribosomes. However, we found L7 to be a highly specific component of Rlp7-associated complexes, revealing that the two proteins can bind simultaneously to pre-ribosomal particles. Cross-linking and cDNA analysis experiments showed that Rlp7 binds to the ITS2 region of 27S pre-rRNAs, at two sites, in helix III and in a region adjacent to the pre-rRNA processing sites C1 and E. However, L7 binds to mature 25S and 5S rRNAs and cross-linked predominantly to helix ES7Lb within 25S rRNA. Thus, despite their predicted structural similarity, our data show that Rlp7 and L7 clearly bind at different positions on the same pre-60S particles. Our results also suggest that Rlp7 facilitates the formation of the hairpin structure of ITS2 during 60S ribosomal subunit maturation. PMID:23945946

  1. The evaluation for generic-level monophyly of Ancyrocephalinae (Monogenea, Dactylogyridae) using ribosomal DNA sequence data.

    PubMed

    Wu, Xiang-Yun; Zhu, Xing-Quan; Xie, Ming-Quan; Li, An-Xing

    2007-08-01

    To overcome the limited regional and taxonomic coverage in previous studies of the Ancyrocephalinae (Monogenea, Dactylogyridae), we present further findings on the molecular systematics and phylogeny of a broader selection of specimens, aiming to build a molecular phylogeny of the Ancyrocephalinae, and to assess the monophyly of each available genus, using D1-D2 domain of LSU rDNA and the combined LSU and partial sequence of SSU rDNA data sets. Our studies showed that 18 Haliotrema species were highly dispersive to form several clades with species from ten closely related genera. The host range of Euryhaliotrematoides species was not only restricted in butterfly fishes (Chaetodontidae), but widen to include the Lutjanidae. Euryhaliotrema was phylogenetically more closely related to Aliatrema than to Euryhaliotrematoides. Given that the species Haliotrema kurodai, Haliotrema spirotubiforum and Haliotrema anguiformis had a funnel-shaped base of the coiled male copulatory organ (MCO) lacking an accessory piece, and our molecular evidence, we proposed to transfer the three species to the Aliatrema as new combinations. We proposed to combine Bravohollisia and Caballeria into one genus, mainly based on molecular evidence and their similar MCO characters. Using SSU+ITS1 data set, Scutogyrus was robustly resolved as a polyphyletic group and its status should be questioned. Based on the present molecular evidence and their similar MCO characters, we proposed to combine Cichlidogyrus and Scutogyrus into one genus, Cichlidogyrus, by treating Scutogyrus as the synonym of Cichlidogyrus. Generally, the present study indicated that the vagina can make little contribution for understanding the generic-level monophyly, due to its high variability even among phylogenetically very closely related species, but it was useful for species determination. Given that phylogenetically closely related species from the same or closely related host species may have similar MCO characters but

  2. Role of DNA damage and repair in the function of eukaryotic genes: radiation-induced single-strand breaks and their rejoining in chromosomal and extrachromosomal ribosomal DNA of Tetrahymena

    SciTech Connect

    Chiu, S.M.; Oleinick, N.L.

    1980-04-01

    The production and rejoining of single-strand breaks (SSB) in chromosomal DNA and extrachromosomal ribosomal DNA (rDNA) were investigated after sublethal doses of ..gamma.. radiation to exponentially growing Tetrahymena. Hydrogen-3-labeled total nuclear DNA isolated from either control or irradiated cells was heat denatured and electrophoresed in agarose gels containing formaldehyde. Ribosomal DNA was identified by hybridization to (/sup 32/P)rRNA after transferring the DNA from the gels to nitrocellulose strips. It was found that (a) approximately 0.68 SSB is produced in each strand of rDNA exposed to 40 krad; (b) greater than 80% of SSB were rejoined within the first 20 min after irradiation in both chromosomal and rDNA; and (c) the rejoining process in both chromosomal and rDNA proceeded in the presence of inhibitors of protein synthesis, RNA synthesis, or oxidative metabolism. While the majority of SSB induced by 40 krad is rejoined within 20 min after irradiation, the resumption of rRNA synthesis does not occur until 30 min thereafter; it is concluded that the restoration of the normal size of the rDNA template is probably necessary but not sufficient for the resumption of rRNA synthesis.

  3. U-INSERTION/DELETION RNA EDITING MULTIPROTEIN COMPLEXES AND MITOCHONDRIAL RIBOSOMES IN LEISHMANIA TARENTOLAE ARE LOCATED IN ANTIPODAL NODES ADJACENT TO THE KINETOPLAST DNA

    PubMed Central

    Wong, Richard G; Kazane, Katelynn; Maslov, Dmitri A; Rogers, Kestrel; Aphasizhev, Ruslan; Simpson, Larry

    2015-01-01

    We studied the intramitochondrial localization of several multiprotein complexes involved in U-insertion/deletion RNA editing in trypanosome mitochondria. The editing complexes are located in one or two antipodal nodes adjacent to the kinetoplast DNA (kDNA) disk, which are distinct from but associated with the minicircle catenation nodes. In some cases the proteins are in a bilateral sheet configuration. We also found that mitoribosomes have a nodal configuration. This type of organization is consistent with evidence for protein and RNA interactions of multiple editing complexes to form a ~40S editosome and also an interaction of editosomes with mitochondrial ribosomes. PMID:26462764

  4. U-insertion/deletion RNA editing multiprotein complexes and mitochondrial ribosomes in Leishmania tarentolae are located in antipodal nodes adjacent to the kinetoplast DNA.

    PubMed

    Wong, Richard G; Kazane, Katelynn; Maslov, Dmitri A; Rogers, Kestrel; Aphasizhev, Ruslan; Simpson, Larry

    2015-11-01

    We studied the intramitochondrial localization of several multiprotein complexes involved in U-insertion/deletion RNA editing in trypanosome mitochondria. The editing complexes are located in one or two antipodal nodes adjacent to the kinetoplast DNA (kDNA) disk, which are distinct from but associated with the minicircle catenation nodes. In some cases the proteins are in a bilateral sheet configuration. We also found that mitoribosomes have a nodal configuration. This type of organization is consistent with evidence for protein and RNA interactions of multiple editing complexes to form an ~40S editosome and also an interaction of editosomes with mitochondrial ribosomes.

  5. Directed gene copy number amplification in Pichia pastoris by vector integration into the ribosomal DNA locus.

    PubMed

    Marx, Hans; Mecklenbräuker, Astrid; Gasser, Brigitte; Sauer, Michael; Mattanovich, Diethard

    2009-12-01

    The yeast Pichia pastoris is a widely used host organism for heterologous protein production. One of the basic steps for strain improvement is to ensure a sufficient level of transcription of the heterologous gene, based on promoter strength and gene copy number. To date, high-copy-number integrants of P. pastoris are achievable only by screening of random events or by cloning of gene concatemers. Methods for rapid and reliable multicopy integration of the expression cassette are therefore desirable. Here we present such a method based on vector integration into the rDNA locus and post-transformational vector amplification by repeated selection on increased antibiotic concentrations. Data are presented for two exemplary products: human serum albumin, which is secreted into the supernatant, and human superoxide dismutase, which is accumulated in the cytoplasm of the cells. The striking picture evolving is that intracellular protein production is tightly correlated with gene copy number, while use of the secretory pathway introduces a high clonal variability and the correlation with gene copy number is valid only for low gene copy numbers. PMID:19799640

  6. Practical identification of human originated Lactobacillus species by amplified ribosomal DNA restriction analysis (ARDRA) for probiotic use.

    PubMed

    Öztürk, Mehmet; Meterelliyöz, Merve

    2015-08-01

    Probiotics are gaining popularity and increasing the importance of their accurate speciation. Lactobacillus species are commonly used as probiotic strains mostly of clinical importance. Present knowledge indicates that at least 14 Lactobacillus species are associated with the human intestinal tract. Currently, researchers are interested in developing efficient techniques for screening and selecting probiotics bacteria, but unfortunately most of these methods are time-consuming, labor-intensive and costly. The aim of this study is to develop reliable, rapid and accurate method to identify 14 references Lactobacillus species that could have been found in the human alimentary tract by 16S ribosomal DNA restriction analysis. In this study, to develop an effective method for the genotype-based identification of the reference Lactobacillus species, 1.5 kb of 16S rRNA nucleotide sequences of 14 Lactobacillus were collected from the Gene Bank aligned, in silico restricted and analyzed in respect to their 16S-rRNA restriction fragment polymorphism. In silico restriction profiles of 16S-rRNA indicated that FspBI, HinfI and DraI restriction enzymes (RE) are convenient for differentiation of 14 Lactobacillus species in human intestinal tract except Lb. casei and Lb. paracasei. The patterns of our experimental findings obtained from 16S PCR-ARDRA completely confirmed our in silico patterns. The present work demonstrated that 16S PCR-ARDRA method with FspBI, HinfI and DraI RE is a rapid, accurate and reliable method for the identification of Lactobacillus species from human alimentary tract, especially during the identification of large numbers of isolates and any laboratory equipped with a thermo cycler for probiotic use.

  7. Human acidic ribosomal phosphoproteins P0, P1, and P2: Analysis of cDNA clones, in vitro synthesis, and assembly

    SciTech Connect

    Rich, B.E.; Steitz, J.A.

    1987-11-01

    cDNA clones encoding three antigenically related human ribosomal phosophoproteins (P-proteins) P0, P1, and P2 were isolated and sequenced. P1 and P2 are analogous to Escherichia coli ribosomal protein L7/L12, and P0 is likely to be an analog of L10. The three proteins have a nearly identical carboxy-terminal 17-amino-acid sequence (KEESEESD(D/E)DMGFGLFD-COOH) that is the basis of their immunological cross-reactivity. The identifies of the P1 and P2 cDNAs were confirmed by the strong similarities of their encoded amino acid sequences to published primary structures of the homologous rat, brine shrimp, and Saccharomyces cerevisiae proteins. The P0 cDNA was initially identified by translation of hybrid-selected mRNA and immunoprecipitation of the products. To demonstrate that the coding sequences are full length, the P0, P1, and P2 cDNAs were transcribed in vitro by bacteriophage T7 RNA polymerase and the resulting mRNAs were translated in vitro. The synthetic P0, P1, and P2 proteins were serologically and electrophoretically identical to P-proteins extracted from HeLa cells. These synthetic P-proteins were incorporated into 60S but not 40S ribosomes and also assembled into a complex similar to that described for E. coli L7/L12 and L10.

  8. The Ribosome Biogenesis Factor Nol11 Is Required for Optimal rDNA Transcription and Craniofacial Development in Xenopus

    PubMed Central

    Griffin, John N.; Sondalle, Samuel B.; del Viso, Florencia; Baserga, Susan J.; Khokha, Mustafa K.

    2015-01-01

    The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC) of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival. PMID:25756904

  9. The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus.

    PubMed

    Griffin, John N; Sondalle, Samuel B; Del Viso, Florencia; Baserga, Susan J; Khokha, Mustafa K

    2015-03-01

    The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC) of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival. PMID:25756904

  10. Assessment of phylogenetic relationship of rare plant species collected from Saudi Arabia using internal transcribed spacer sequences of nuclear ribosomal DNA.

    PubMed

    Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A

    2013-01-01

    The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.

  11. Molecular characterization of Fasciola spp. from the endemic area of northern Iran based on nuclear ribosomal DNA sequences.

    PubMed

    Amor, Nabil; Halajian, Ali; Farjallah, Sarra; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine

    2011-07-01

    Fasciolosis caused by Fasciola spp. (Platyhelminthes: Trematoda: Digenea) is considered as the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. In the endemic regions of the North of Iran, Fasciola hepatica and Fasciola gigantica have been previously characterized on the basis of morphometric differences, but the use of molecular markers is necessary to distinguish exactly between species and intermediate forms. Samples from buffaloes and goats from different localities of northern Iran were identified morphologically and then genetically characterized by sequences of the first (ITS-1) and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA). Comparison of the ITS of the northern Iranian samples with sequences of Fasciola spp. from GenBank showed that the examined specimens had sequences identical to those of the most frequent haplotypes of F. hepatica (n=25, 48.1%) and F. gigantica (n=20, 38.45%), which differed from each other in different variable nucleotide positions of ITS region sequences, and their intermediate forms (n=7, 13.45%), which had nucleotides overlapped between the two Fasciola species in all the positions. The ITS sequences from populations of Fasciola isolates in buffaloes and goats had experienced introgression/hybridization as previously reported in isolates from other ruminants and humans. Based on ITS-1 and ITS-2 sequences, flukes are scattered in pure F. hepatica, F. gigantica and intermediate Fasciola clades, revealing that multiple genotypes of Fasciola are able to infect goats and buffaloes in North of Iran. Furthermore, the phylogenetic trees based upon the ITS-1 and ITS-2 sequences showed a close relationship of the Iranian samples with isolates of F. hepatica and F. gigantica from different localities of Africa and Asia. In the present study, the intergenic transcribed spacers ITS-1 and ITS-2 showed to be reliable approaches for the genetic

  12. The site-specific ribosomal DNA insertion element R1Bm belongs to a class of non-long-terminal-repeat retrotransposons

    SciTech Connect

    Xiong, Y.; Eickbush, T.H.

    1988-01-01

    Two types of insertion elements, R1 and R2 (previously called type I and type II), are known to interrupt the 28S ribosomal genes of several insect species. In the silkmoth, Bombyx mori, each element occupies approximately 10% of the estimated 240 ribosomal DNA units, while at most only a few copies are located outside the ribosomal DNA units. The authors present here the complete nucleotide sequence of an R1 insertion from B. mori (R1Bm). This 5.1-kilobase element contains two overlapping open reading frames (ORFs) which together occupy 88% of its length. ORF1 is 461 amino acids in length and exhibits characteristics of retroviral gag genes. ORF2 is 1,051 amino acids in length and contains homology to reverse transcriptase-like enzymes. The analysis of 3' and 5' ends of independent isolates from the ribosomal locus supports the suggestion that R1 is still functioning as a transposable element. The precise location of the element within the genome implies that its transposition must occur with remarkable insertion sequence specificity. Comparison of the deduced amino acid sequences from six retrotransposons, R1 and R2 of B. mori, I factor and F element of Drosophila melanogaster, L1 of Mus domesticus, and Ingi of Trypanosoma brucei, reveals a relatively high level of sequence homology in the reverse transcriptase region. Like R1, these elements lack long terminal repeats. The authors therefore named this class of related elements the non-long-terminal-repeat (non-LTR) retrotransposons.

  13. Bacterial diversity in water samples from uranium wastes as demonstrated by 16S rDNA and ribosomal intergenic spacer amplification retrievals.

    PubMed

    Radeva, Galina; Selenska-Pobell, Sonja

    2005-11-01

    Bacterial diversity was assessed in water samples collected from several uranium mining wastes in Ger many and in the United States by using 16S rDNA and ribosomal intergenic spacer amplification retrievals. The results obtained using the 16S rDNA retrieval showed that the samples collected from the uranium mill tailings of Schlema/Alberoda, Germany, were predominated by Nitrospina-like bacteria, whereas those from the mill tailings of Shiprock, New Mexico, USA, were predominated by gamma-Pseudomonas and Frauteria spp. Additional smaller populations of the Cytophaga-Flavobacterium-Bacteroides group and alpha- and delta-Proteobacteria were identified in the Shiprock samples as well. Proteobacteria and Cytophaga-Flavobacterium-Bacteroides were also found in the third uranium mill tailings studied, Gittersee/Coschütz, Germany, but the groups of the predominant clones were rather small. Most of the clones of the Gittersee/Coschütz samples represented individual sequences, which indicates a high level of bacterial diversity. The samples from the fourth uranium waste studied, Steinsee Deponie B1, Germany, were predominantly occupied by Acinetobacter spp. The ribosomal intergenic spacer amplification retrieval provided results complementary to those obtained by the 16S rDNA analyses. For instance, in the Shiprock samples, an additional predominant bacterial group was identified and affiliated with Nitrosomonas sp., whereas in the Gittersee/Coschütz samples, anammox populations were identified that were not retrieved by the applied 16S rDNA approach.

  14. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location. PMID:27334092

  15. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

  16. Genome differentiation in a species pair of coregonine fishes: an extremely rapid speciation driven by stress-activated retrotransposons mediating extensive ribosomal DNA multiplications

    PubMed Central

    2013-01-01

    Background Sympatric species pairs are particularly common in freshwater fishes associated with postglacial lakes in northern temperate environments. The nature of divergences between co-occurring sympatric species, factors contributing to reproductive isolation and modes of genome evolution is a much debated topic in evolutionary biology addressed by various experimental tools. To the best of our knowledge, nobody approached this field using molecular cytogenetics. We examined chromosomes and genomes of one postglacial species pair, sympatric European winter-spawning Coregonus albula and the local endemic dwarf-sized spring-spawning C. fontanae, both originating in Lake Stechlin. We have employed molecular cytogenetic tools to identify the genomic differences between the two species of the sympatric pair on the sub-chromosomal level of resolution. Results Fluorescence in situ hybridization (FISH) experiments consistently revealed a distinct variation in the copy number of loci of the major ribosomal DNA (the 45S unit) between C. albula and C. fontanae genomes. In C. fontanae, up to 40 chromosomes were identified to bear a part of the major ribosomal DNA, while in C. albula only 8–10 chromosomes possessed these genes. To determine mechanisms how such extensive genome alternation might have arisen, a PCR screening for retrotransposons from genomic DNA of both species was performed. The amplified retrotransposon Rex1 was used as a probe for FISH mapping onto chromosomes of both species. These experiments showed a clear co-localization of the ribosomal DNA and the retrotransposon Rex1 in a pericentromeric region of one or two acrocentric chromosomes in both species. Conclusion We demonstrated genomic consequences of a rapid ecological speciation on the level undetectable by neither sequence nor karyotype analysis. We provide indirect evidence that ribosomal DNA probably utilized the spreading mechanism of retrotransposons subsequently affecting recombination rates

  17. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  18. Nuclear-encoded chloroplast ribosomal protein L12 of Nicotiana tabacum: characterization of mature protein and isolation and sequence analysis of cDNA clones encoding its cytoplasmic precursor.

    PubMed Central

    Elhag, G A; Thomas, F J; McCreery, T P; Bourque, D P

    1992-01-01

    Poly(A)+ mRNA isolated from Nicotiana tabacum (cv. Petite Havana) leaves was used to prepare a cDNA library in the expression vector lambda gt11. Recombinant phage containing cDNAs coding for chloroplast ribosomal protein L12 were identified and sequenced. Mature tobacco L12 protein has 44% amino acid identity with ribosomal protein L7/L12 of Escherichia coli. The longest L12 cDNA (733 nucleotides) codes for a 13,823 molecular weight polypeptide with a transit peptide of 53 amino acids and a mature protein of 133 amino acids. The transit peptide and mature protein share 43% and 79% amino acid identity, respectively, with corresponding regions of spinach chloroplast ribosomal protein L12. The predicted amino terminus of the mature protein was confirmed by partial sequence analysis of HPLC-purified tobacco chloroplast ribosomal protein L12. A single L12 mRNA of about 0.8 kb was detected by hybridization of L12 cDNA to poly(A)+ and total leaf RNA. Hybridization patterns of restriction fragments of tobacco genomic DNA probed with the L12 cDNA suggested the existence of more than one gene for ribosomal protein L12. Characterization of a second cDNA with an identical L12 coding sequence but a different 3'-noncoding sequence provided evidence that at least two L12 genes are expressed in tobacco. Images PMID:1542565

  19. Characterization of a wheat cDNA encoding mitochondrial ribosomal protein L11: qualitative and quantitative tissue-specific differences in its expression.

    PubMed

    Handa, H; Kobayashi-Uehara, A; Murayama, S

    2001-06-01

    We have cloned a cDNA for a ribosomal protein of wheat that is similar to the bacterial ribosomal protein L11 (RPL11). To determine the subcellular localization of the gene product, we fused the whole cDNA sequence to the coding sequence for Green Fluorescent Protein, and expressed the fusion product transiently in epidermal cells of pea hypocotyls or dayflower leaves. Localized fluorescence was detectable in mitochondria, indicating that this nuclear cDNA encodes a mitochondrial ribosomal protein L11 (MRPL11). In lower protists, mitochondrial RPL11 is encoded by the mitochondrial genome, but higher organisms, including animals, fungi and plants, do not have genes for RPL11 in their mitochondrial genomes, suggesting that transfer of the genetic information for RPL11 from the mitochondrial genome to the nucleus was a very early event in evolution. Transcripts of this wheat gene (TaMRPL11) for mitochondrial RPL11 were found in all tissues examined, although qualitative and quantitative differences in expression were noted. The transcript sizes were different in different plant tissues: 1.0 kb in flowers and roots, and 1.5 kb in shoots. Cold stress transiently increased the steady-state level of TaMRPL11 mRNA in shoots, but the transcription of TaMRPL11 was completely inhibited by cold treatment for longer periods. However, the transcript level in flowers decreased gradually on exposure to low temperature. On the other hand, the accumulation of TaMRPL11 transcripts in roots was not affected by low temperature. These results suggest that the expression of MRPL11 in wheat is regulated precisely, in a tissue-specific manner.

  20. Yeast linker histone Hho1p is required for efficient RNA polymerase I processivity and transcriptional silencing at the ribosomal DNA.

    PubMed

    Levy, Anat; Eyal, Miri; Hershkovits, Gitit; Salmon-Divon, Mali; Klutstein, Michael; Katcoff, Don Jay

    2008-08-19

    Nucleosome core particles in eukaryotes are linked by a stretch of DNA that is usually associated with a linker histone. Here, we show in yeast, that the presence of yeast linker histone Hho1p represses expression of a pol II transcribed gene (MET15) embedded in the rDNA. In vivo deletions of Hho1p sequences showed that the second globular domain is sufficient for that repression, whereas the presence of the N terminus is required for its derepression. In contrast, a run-on assay confirmed by a ChIP experiment showed that Hho1p is required for maximal pol I processivity during rDNA transcription. Psoralen accessibility experiments indicated that Hho1p is necessary for normal rDNA compaction. DNA array expression analysis comparing RNA transcripts in wild-type and hho1 strains before and after a heat-shock showed that Hho1p is necessary to achieve wild-type mRNA levels of transcripts that encode ribosomal components. Taken together, our results suggest that Hho1p is involved in rDNA compaction, and like core histones, is required for efficient rDNA transcription by pol I. PMID:18687885

  1. Molecular phylogeny of the butterfly tribe Satyrini (Nymphalidae: Satyrinae) with emphasis on the utility of ribosomal mitochondrial genes 16s rDNA and nuclear 28s rDNA.

    PubMed

    Yang, Mingsheng; Zhang, Yalin

    2015-07-09

    The tribe Satyrini is one of the most diverse groups of butterflies, but no robust phylogenetic hypothesis for this group has been achieved. Two rarely used 16s and 28s ribosomal and another seven protein-coding genes were used to reconstruct the phylogeny of the Satyrini, with further aim to evaluate the informativeness of the ribosomal genes. Our maximum parsimony (MP), maximum likelihood (ML) and Bayesian inference (BI) analyses consistently recovered three well-supported clades for the eleven sampled subtribes of Satyrini: clade I includes Eritina and Coenonymphina, being sister to the clade II + clade III; clade II contains Parargina, Mycalesina and Lethina, and the other six subtribes constitute clade III. The placements of the taxonomically unstable Davidina Oberthür and geographically restricted Paroeneis Moore in Satyrina are confirmed for the first time based on molecular evidence. The close relationships of Callerebia Butler, Loxerebia Watkins and Argestina Riley are well-supported. We suggest that Rhaphicera Butler belongs to Lethina. The partitioned Bremer support (PBS) values of MP analysis show that the 16s rDNA contributes well to the nodes representing all the taxa from subtribe to species levels, and the 28s rDNA is informative at the subtribe level. Furthermore, our ML analyses show that the ribosomal genes 16s rDNA and 28s rDNA are informative, because most node support values are lower in the ML tree after the removal of them than that in ML tree constructed based on the full nine-gene dataset. This indicates that some other ribosomal genes should be tentatively used through combining with traditionally used protein-coding genes in further analysis on phylogeny of Satyrini, providing that proper representatives are sampled.

  2. Role of DNA-Dependent RNA Polymerase III in the Transcription of the tRNA and 5S RNA Genes

    PubMed Central

    Weinmann, Roberto; Roeder, Robert G.

    1974-01-01

    Mouse myeloma cells have previously been shown (L. B. Schwartz, V. E. F. Sklar, J. A. Jaehning, R. Weinmann & R. G. Roeder, submitted for publication) to contain two chromatographically distinct forms of RNA polymerase III (designated IIIA and IIIB). The enzymes are unaffected by low α-amanitin concentrations which completely inhibit RNA polymerase II, but they exhibit characteristic inhibition curves (identical for IIIA and IIIB) at higher toxin concentrations. RNA polymerase I was unaffected at all α-amanitin concentrations tested. Myeloma RNA polymerases II, IIIA, and IIIB appear to be inhibited by the same mechanism, since the toxin rapidly blocks chain elongation by each enzyme. The characteristic α-amanitin sensitivity of RNA polymerase III has been employed in studies of the function(s) of the class III RNA polymerases. Isolated myeloma nuclei and nucleoli contińue to synthesize RNA via the endogenous RNA polymerases when incubated in vitro. With nuclei, newly synthesized 4S precursor (pre-4S) and 5S RNA species were detected by electrophoretic analysis either of the total nuclear RNA or of the RNA released into the supernatant during incubation. The synthesis of both pre-4S and 5S RNA species was inhibited by α-amanitin, but only at high concentrations; and the α-amanitin inhibition curves for these RNAs were identical to those obtained for solubilized RNA polymerases IIIA and IIIB. In control experiments it was shown that the endogenous RNA polymerase II activity of isolated nuclei was inhibited by α-amanitin concentrations similar to those required to inhibit purified enzyme II. However, 40-50% of the endogenous activity of nuclei and 100% of the endogenous activity of purified nucleoli was completely resistant to the high α-amanitin concentrations necessary to inhibit the RNA polymerase III activities. These experiments rule out nonspecific inhibitory effects in the endogenous systems. These results unequivocally demonstrate the role of RNA

  3. Double trouble for grasshopper molecular systematics: intra-individual heterogeneity of both mitochondrial 12S-valine-16S and nuclear internal transcribed spacer ribosomal DNA sequences in Hesperotettix viridis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Hesperotettix viridis grasshoppers (Orthoptera: Acrididae:Melanoplinae) exhibit intra-individual variation in both mitochondrial 12S-valine-16S and nuclear internal transcribed spacer (ITS) ribosomal DNA sequences. These findings violate core assumptions underlying DNA sequence data obtained via pol...

  4. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central

    2012-01-01

    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  5. Genetic investigations in immigration cases and frequencies of DNA fragments of the VNTR systems D2S44, D5S43, D7S21, D7S22, and D12S11 in Turks.

    PubMed

    Hansen, H E; Morling, N

    1993-06-01

    We have included investigations of the DNA polymorphism of variable numbers of tandem repeat (VNTR) regions with restriction fragment length polymorphism (RFLP) in the genetic evaluations in immigrant cases. HinfI-digested DNA was separated by electrophoresis in agarose gels and hybridized with radiolabelled probes detecting the VNTR systems D2S44 (YNH24), D5S43 (MS8), D7S21 (MS31), D7S22 (g3), and D12S11 (MS43a). We used the matching criterion for paternity testing for the parent/child comparisons, i.e. non-match if the intra gel difference exceeded 1.25 mm. A total of 43 immigration cases involving mainly Turks were investigated with DNA technique in parallel with investigations of 10-15 conventional systems. One man was excluded from paternity by both conventional and DNA investigations. Non-exclusion was observed with both conventional and DNA systems in 97 putative mother/child pairs and in 96 putative father/child pairs. In a putative father/child combination with non-exclusion in 18 genetic systems, a single genetic inconsistency ('exclusion') in D7S21 (MS31) was observed. The frequency distributions of HinfI digested DNA fragments of the five VNTR systems in 105 Turks are presented.

  6. Parasitic helminth fauna of the cutlass fish, Trichiurus lepturus L., and the differentiation of four anisakid nematode third-stage larvae by nuclear ribosomal DNA sequences.

    PubMed

    Shih, Hsiu-Hui

    2004-06-01

    The helminth fauna of the gastrointestinal tract and abdominal cavity of cutlass fish, Trichiurus lepturus L., off the Taiwanese coast of the north-western Pacific was investigated. The following helminths were found: (1) nematodes--Anisakis simplex, Hysterothylacium aduncum, Porrocaecum decipiens, Raphidascaris trichiuri; (2) digeneans--adult Lecithochirium trichiuri; and (3) cestodes-plerocercoids of Proteocephalus spp. The third-stage larvae of these four anisakid nematodes were characterized genetically using a molecular approach. The nuclear ribosomal DNA region spanning the first internal transcribed spacer (ITS-1), the 5.8S gene and the second internal transcribed spacer (ITS-2) was amplified and sequenced. Based on the sequence differences, a PCR-based restriction fragment length polymorphism method was established for the unequivocal delineation of the four species. Phylogenetic analysis showed that H. aduncum clustered with P. decipiens, whereas A. simplex was not closely related to these according to the nucleotide sequences of all rDNA. PMID:15133659

  7. Transcription Termination Factor reb1p Causes Two Replication Fork Barriers at Its Cognate Sites in Fission Yeast Ribosomal DNA In Vivo

    PubMed Central

    Sánchez-Gorostiaga, Alicia; López-Estraño, Carlos; Krimer, Dora B.; Schvartzman, Jorge B.; Hernández, Pablo

    2004-01-01

    Polar replication fork barriers (RFBs) near the 3′ end of the rRNA transcriptional unit are a conserved feature of ribosomal DNA (rDNA) replication in eukaryotes. In the mouse, in vivo studies indicate that the cis-acting Sal boxes required for rRNA transcription termination are also involved in replication fork blockage. On the contrary, in the budding yeast Saccharomyces cerevisiae, the rRNA transcription termination factors are not required for RFBs. Here we characterized the rDNA RFBs in the fission yeast Schizosaccharomyces pombe. S. pombe rDNA contains three closely spaced polar replication barriers named RFB1, RFB2, and RFB3 in the 3′ to 5′ order. The transcription termination protein reb1 and its two binding sites, present at the 3′ end of the coding region, were required for fork arrest at RFB2 and RFB3 in vivo. On the other hand, fork arrest at the strongest RFB1 barrier was independent of the above transcription termination factors. Therefore, RFB2 and RFB3 resemble the barriers present in the mouse rDNA, whereas RFB1 is similar to the budding yeast RFBs. These results suggest that during evolution, cis- and trans-acting factors required for rRNA transcription termination became involved in replication fork blockage also. S. pombe is suggested to be a transitional species in which both mechanisms coexist. PMID:14673172

  8. Detection and identification of fungal pathogens by PCR and by ITS2 and 5.8S ribosomal DNA typing in ocular infections.

    PubMed

    Ferrer, C; Colom, F; Frasés, S; Mulet, E; Abad, J L; Alió, J L

    2001-08-01

    The goal of this study was to determine whether sequence analysis of internal transcribed spacer/5.8S ribosomal DNA (rDNA) can be used to detect fungal pathogens in patients with ocular infections (endophthalmitis and keratitis). Internal transcribed spacer 1 (ITS1) and ITS2 and 5.8S rDNA were amplified by PCR and seminested PCR to detect fungal DNA. Fifty strains of 12 fungal species (yeasts and molds) were used to test the selected primers and conditions of the PCR. PCR and seminested PCR of this region were carried out to evaluate the sensitivity and specificity of the method. It proved possible to amplify the ITS2/5.8S region of all the fungal strains by this PCR method. All negative controls (human and bacterial DNA) were PCR negative. The sensitivity of the seminested PCR amplification reaction by DNA dilutions was 1 organism per PCR, and the sensitivity by cell dilutions was fewer than 10 organisms per PCR. Intraocular sampling or corneal scraping was undertaken for all patients with suspected infectious endophthalmitis or keratitis (nonherpetic), respectively, between November 1999 and February 2001. PCRs were subsequently performed with 11 ocular samples. The amplified DNA was sequenced, and aligned against sequences in GenBank at the National Institutes of Health. The results were PCR positive for fungal primers for three corneal scrapings, one aqueous sample, and one vitreous sample; one of them was negative by culture. Molecular fungal identification was successful in all cases. Bacterial detection by PCR was positive for three aqueous samples and one vitreous sample; one of these was negative by culture. Amplification of ITS2/5.8S rDNA and molecular typing shows potential as a rapid technique for identifying fungi in ocular samples.

  9. Detection and Identification of Fungal Pathogens by PCR and by ITS2 and 5.8S Ribosomal DNA Typing in Ocular Infections

    PubMed Central

    Ferrer, Consuelo; Colom, Francisca; Frasés, Susana; Mulet, Emilia; Abad, José L.; Alió, Jorge L.

    2001-01-01

    The goal of this study was to determine whether sequence analysis of internal transcribed spacer/5.8S ribosomal DNA (rDNA) can be used to detect fungal pathogens in patients with ocular infections (endophthalmitis and keratitis). Internal transcribed spacer 1 (ITS1) and ITS2 and 5.8S rDNA were amplified by PCR and seminested PCR to detect fungal DNA. Fifty strains of 12 fungal species (yeasts and molds) were used to test the selected primers and conditions of the PCR. PCR and seminested PCR of this region were carried out to evaluate the sensitivity and specificity of the method. It proved possible to amplify the ITS2/5.8S region of all the fungal strains by this PCR method. All negative controls (human and bacterial DNA) were PCR negative. The sensitivity of the seminested PCR amplification reaction by DNA dilutions was 1 organism per PCR, and the sensitivity by cell dilutions was fewer than 10 organisms per PCR. Intraocular sampling or corneal scraping was undertaken for all patients with suspected infectious endophthalmitis or keratitis (nonherpetic), respectively, between November 1999 and February 2001. PCRs were subsequently performed with 11 ocular samples. The amplified DNA was sequenced, and aligned against sequences in GenBank at the National Institutes of Health. The results were PCR positive for fungal primers for three corneal scrapings, one aqueous sample, and one vitreous sample; one of them was negative by culture. Molecular fungal identification was successful in all cases. Bacterial detection by PCR was positive for three aqueous samples and one vitreous sample; one of these was negative by culture. Amplification of ITS2/5.8S rDNA and molecular typing shows potential as a rapid technique for identifying fungi in ocular samples. PMID:11474006

  10. Combination of electron microscopic in situ hybridization and anti-DNA antibody labelling reveals a peculiar arrangement of ribosomal DNA in the fibrillar centres of the plant cell nucleolus.

    PubMed

    Yano, Hiroyuki; Sato, Seiichi

    2002-01-01

    The fibrillar centres (FCs) in the nucleoli of Allium cepa usually contained compact dense chromatin, which was always surrounded with light fibrous material (LFM). Distribution of 18S ribosomal DNA (rDNA) in the FCs was examined by in situ hybridization at the light and electron microscopic levels and the results were compared with those obtained by immunogold labelling with anti-DNA antibodies. Anti-DNA antibodies heavily labelled the dense chromatin of the FCs but scarcely labelled the LFM. However, electron microscopic in situ hybridization using the 18S rDNA probe showed that the label in the dense chromatin was extremely weak compared with that obtained by the anti-DNA antibody labelling: the specific label with anti-DNA antibodies of the dense chromatin was about 15 times as much as that of the LFM, whereas the specific label with in situ hybridization in the dense chromatin was only about 1.7 times higher than in the LFM. These results suggest that the rDNA encoding rRNA is preferentially released from the dense chromatin and that non-transcribed intergenic spacers remain in the dense chromatin as the anchoring sites of rDNA. PMID:12227553

  11. Ribosomal proteins: functions beyond the ribosome

    PubMed Central

    Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2015-01-01

    Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. PMID:25735597

  12. Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer)

    PubMed Central

    Chelomina, Galina N.; Rozhkovan, Konstantin V.; Voronova, Anastasia N.; Burundukova, Olga L.; Muzarok, Tamara I.; Zhuravlev, Yuri N.

    2015-01-01

    Background Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. Methods The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. Results In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440–640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. Conclusion This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine. PMID:27158239

  13. ATM-dependent E2F1 accumulation in the nucleolus is an indicator of ribosomal stress in early response to DNA damage.

    PubMed

    Jin, Ya-Qiong; An, Guo-Shun; Ni, Ju-Hua; Li, Shu-Yan; Jia, Hong-Ti

    2014-01-01

    The nucleolus plays a major role in ribosome biogenesis. Most genotoxic agents disrupt nucleolar structure and function, which results in the stabilization/activation of p53, inducing cell cycle arrest or apoptosis. Likewise, transcription factor E2F1 as a DNA damage responsive protein also plays roles in cell cycle arrest, DNA repair, or apoptosis in response to DNA damage through transcriptional response and protein-protein interaction. Furthermore, E2F1 is known to be involved in regulating rRNA transcription. However, how E2F1 displays in coordinating DNA damage and nucleolar stress is unclear. In this study, we demonstrate that ATM-dependent E2F1 accumulation in the nucleolus is a characteristic feature of nucleolar stress in early response to DNA damage. We found that at the early stage of DNA damage, E2F1 accumulation in the nucleolus was an ATM-dependent and a common event in p53-suficient and -deficient cells. Increased nucleolar E2F1 was sequestered by the nucleolar protein p14ARF, which repressed E2F1-dependent rRNA transcription initiation, and was coupled with S phase. Our data indicate that early accumulation of E2F1 in the nucleolus is an indicator for nucleolar stress and a component of ATM pathway, which presumably buffers elevation of E2F1 in the nucleoplasm and coordinates the diversifying mechanisms of E2F1 acts in cell cycle progression and apoptosis in early response to DNA damage.

  14. Evaluation of immunogenicity and protective efficacy of a plasmid DNA vaccine encoding ribosomal protein L9 of Brucella abortus in BALB/c mice.

    PubMed

    Jain, Shikha; Afley, Prachiti; Dohre, Sudhir K; Saxena, Nandita; Kumar, Subodh

    2014-07-31

    Brucellosis is a worldwide zoonotic disease. No Brucella vaccine is available for use in humans and existing animal vaccines have limitations. We have previously described the ribosomal protein L9 to have the vaccine potential. In this study, L9 based DNA vaccine (pVaxL9) was generated and evaluated in mouse model. Intramuscular immunisation of pVaxL9 was able to elicit the anti-L9 IgG antibody response of both IgG1 and IgG2a isotypes when compared with PBS and pVax immunised control animals. Heightened antibody response was observed in mice groups immunised with pVaxL9 priming and recombinant L9 boosting (PB) and where pDNA immunisation was carried out by in vivo electroporation (EP). The vaccine groups proliferated splenocytes and released Th1 type cytokines e.g. IFN-γ, TNF-α, IL-2. Further, flow cytometric analysis revealed that IFN-γ was released by both by CD4+ and CD8+ T cells particularly in PB and EP groups when compared with mice immunised with empty control vector. The L9 based pDNA vaccine was able to confer significant protection in mice against challenge with virulent B. abortus with PB and EP groups offering better protection. Taken together, it can be concluded that L9 based DNA vaccine is immunogenic and confer protection in mouse model.

  15. Sequencing of whole plastid genomes and nuclear ribosomal DNA of Diospyros species (Ebenaceae) endemic to New Caledonia: many species, little divergence

    PubMed Central

    Turner, Barbara; Paun, Ovidiu; Munzinger, Jérôme; Chase, Mark W.; Samuel, Rosabelle

    2016-01-01

    Background and Aims Some plant groups, especially on islands, have been shaped by strong ancestral bottlenecks and rapid, recent radiation of phenotypic characters. Single molecular markers are often not informative enough for phylogenetic reconstruction in such plant groups. Whole plastid genomes and nuclear ribosomal DNA (nrDNA) are viewed by many researchers as sources of information for phylogenetic reconstruction of groups in which expected levels of divergence in standard markers are low. Here we evaluate the usefulness of these data types to resolve phylogenetic relationships among closely related Diospyros species. Methods Twenty-two closely related Diospyros species from New Caledonia were investigated using whole plastid genomes and nrDNA data from low-coverage next-generation sequencing (NGS). Phylogenetic trees were inferred using maximum parsimony, maximum likelihood and Bayesian inference on separate plastid and nrDNA and combined matrices. Key Results The plastid and nrDNA sequences were, singly and together, unable to provide well supported phylogenetic relationships among the closely related New Caledonian Diospyros species. In the nrDNA, a 6-fold greater percentage of parsimony-informative characters compared with plastid DNA was found, but the total number of informative sites was greater for the much larger plastid DNA genomes. Combining the plastid and nuclear data improved resolution. Plastid results showed a trend towards geographical clustering of accessions rather than following taxonomic species. Conclusions In plant groups in which multiple plastid markers are not sufficiently informative, an investigation at the level of the entire plastid genome may also not be sufficient for detailed phylogenetic reconstruction. Sequencing of complete plastid genomes and nrDNA repeats seems to clarify some relationships among the New Caledonian Diospyros species, but the higher percentage of parsimony-informative characters in nrDNA compared with

  16. [Detection and analysis of Tetrahymena pyriformis 26S ribosomal DNA domain sequences, differing in degree of evolutionary conservation].

    PubMed

    Mukha, D V; Sidorenko, A P

    1995-01-01

    Domains of different evolutionary conservatism were defined in the 26S rDNA sequence of T. pyriformis. The fragment of studied DNA (1212 bp) showing high evolutionary conservatism was cloned. It was shown this fragment of DNA may be used to a probe for blot-hybridization analysis of the structure of rDNA from various taxa, protists to mammals. Superconservative and hypervariable domains were defined. The first are good for the primers for PCR analysis of rDNA from various taxa, the second--for species specific primers.

  17. The Leishmania infantum Acidic Ribosomal Protein P0 Administered as a DNA Vaccine Confers Protective Immunity to Leishmania major Infection in BALB/c Mice

    PubMed Central

    Iborra, Salvador; Soto, Manuel; Carrión, Javier; Nieto, Ana; Fernández, Edgar; Alonso, Carlos; Requena, Jose M.

    2003-01-01

    In this study, we examined the immunogenic properties of the Leishmania infantum acidic ribosomal protein P0 (LiP0) in the BALB/c mouse model. The humoral and cellular responses induced by the administration of the LiP0 antigen, either as soluble recombinant LiP0 (rLiP0) or as a plasmid DNA formulation (pcDNA3-LiP0), were determined. Also, the immunological response associated with a prime-boost strategy, consisting of immunization with pcDNA3-LiP0 followed by a boost with rLiP0, was assayed. Immunization with rLiP0 induced a predominant Th2-like humoral response, but no anti-LiP0 antibodies were induced after immunization with pcDNA3-LiP0, whereas a strong humoral response consisting of a mixed immunoglobulin G2a (IgG2a)-IgG1 isotype profile was induced in mice immunized with the prime-boost regime. For all three immunization protocols, rLiP0-stimulated production of gamma interferon (IFN-γ) in both splenocytes and lymph node cells from immunized mice was observed. However, it was only when mice were immunized with pcDNA3-LiP0 that noticeable protection against L. major infection was achieved, as determined by both lesion development and parasite burden. Immunization of mice with LiP0-DNA primes both CD4+ and CD8+ T cells, which, with the L. major challenge, were boosted to produce significant levels of IL-12-dependent, antigen-specific IFN-γ. Taken together, these data indicate that genetic vaccination with LiP0 induces protective immunological effector mechanisms, yet the immunological response elicited by LiP0 is not sufficient to keep the infection from progressing. PMID:14573678

  18. Effects of anti-C23 (nucleolin) antibody on transcription of ribosomal DNA in Chironomus salivary gland cells

    SciTech Connect

    Egyhazi, E.; Pigon, A. ); Chang, Jinhong; Ghaffari, S.H.; Dreesen, T.D.; Wellman, S.E.; Case, S.T.; Olson, M.O.J. )

    1988-10-01

    Protein C23 (also called nucleolin or 100-kDa nucleolar protein) is a major nucleolar phosphoprotein involved in ribosome biogenesis. To determine the effects of protein C23 on preribosomal RNA (pre-rRNA) synthesis anti-C23 antiserum was microinjected into nuclei of Chironomus tentans salivary glands. Transcription was measured by incubation of the glands with {sup 32}P-labeled RNA precursors followed by microdissection of nucleoli, RNA extraction, and electrophoretic analyses. Injection of the anti-C23 antibody caused a 2- to 3.5-fold stimulation of {sup 32}P incorporation into 38 S pre-rRNA. No stimulation was observed in salivary glands injected with preimmune serum or antiserum preabsorbed with protein C23. The stimulatory effect was selective for pre-rRNA as indicated by the lack of stimulation of {sup 32}P incorporation into extranucleolar RNA. Injection of the antiserum produced little or no effect on pre-RNA processing as measured by the relative amounts of {sup 32}P-labeled intermediate cleavage products of pre-rRNA in stimulated versus control glands. These results suggest that protein C23 not only is involved in ribosome assembly but also plays a role in regulating the transcription of the preribosomal RNA.

  19. Cytogenetic comparison between two allopatric populations of Astyanax altiparanae Garutti et Britski, 2000 (Teleostei, Characidae), with emphasis on the localization of 18S and 5S rDNA

    PubMed Central

    Pacheco, Rosiley Berton; da Rosa, Renata; Giuliano-Caetano, Lucia; Júlio Jr., Horácio Ferreira; Dias, Ana Lúcia

    2011-01-01

    Abstract Two populations of Astyanax altiparanae (Garutti & Britski, 2000) of the Água dos Patos stream/SP and lake Igapó/PR were analyzed. All individuals showed 2n = 50, however, different karyotypic formulae were observed. The population of the Água dos Patos stream showed 8m +24sm+6st+12a (NF=88) and the population of lake Igapó, 8m+28sm+4st+10a (NF=90). Nucleolus organizing regions (AgNORs) were observed in the terminal position on the short and long arm of different chromosomes of both populations, showing a variation from 3 to 4 chromosomes. Fluorescent in situ hybridization (FISH) using 18S rDNA probes revealed only one pair of chromosomes with fluorescent signals in the terminal site on the short arm in the Igapó lake population, while the population of Água dos Patos stream showed 4 fluorescence terminal signals, characterizing a system of simple and multiple NORs, respectively. 5S rDNA fluorescent signals were detected in the interstitial position of a pair of chromosomes in the two studied populations. Some AgNOR sites revealed to be GC-rich when stained with Chromomycin A3 (CMA3), however, AT positive regions were not observed. The data obtained show that, despite the conservation of the diploid number and location of 5S DNAr, differences in both the distribution of 18S rDNA and karyotypic formula among the populations were found, thus corroborating the existing data on chromosome variability in Astyanax altiparanae that can be significant for cytotaxonomy in this group. PMID:24260632

  20. Cytogenetic comparison between two allopatric populations of Astyanax altiparanae Garutti et Britski, 2000 (Teleostei, Characidae), with emphasis on the localization of 18S and 5S rDNA.

    PubMed

    Pacheco, Rosiley Berton; da Rosa, Renata; Giuliano-Caetano, Lucia; Júlio, Horácio Ferreira; Dias, Ana Lúcia

    2011-01-01

    Two populations of Astyanax altiparanae (Garutti & Britski, 2000) of the Água dos Patos stream/SP and lake Igapó/PR were analyzed. All individuals showed 2n = 50, however, different karyotypic formulae were observed. The population of the Água dos Patos stream showed 8m +24sm+6st+12a (NF=88) and the population of lake Igapó, 8m+28sm+4st+10a (NF=90). Nucleolus organizing regions (AgNORs) were observed in the terminal position on the short and long arm of different chromosomes of both populations, showing a variation from 3 to 4 chromosomes. Fluorescent in situ hybridization (FISH) using 18S rDNA probes revealed only one pair of chromosomes with fluorescent signals in the terminal site on the short arm in the Igapó lake population, while the population of Água dos Patos stream showed 4 fluorescence terminal signals, characterizing a system of simple and multiple NORs, respectively. 5S rDNA fluorescent signals were detected in the interstitial position of a pair of chromosomes in the two studied populations. Some AgNOR sites revealed to be GC-rich when stained with Chromomycin A3 (CMA3), however, AT positive regions were not observed. The data obtained show that, despite the conservation of the diploid number and location of 5S DNAr, differences in both the distribution of 18S rDNA and karyotypic formula among the populations were found, thus corroborating the existing data on chromosome variability in Astyanax altiparanae that can be significant for cytotaxonomy in this group.

  1. Non-monophyly of most supraspecific taxa of calcareous sponges (Porifera, Calcarea) revealed by increased taxon sampling and partitioned Bayesian analysis of ribosomal DNA.

    PubMed

    Dohrmann, Martin; Voigt, Oliver; Erpenbeck, Dirk; Wörheide, Gert

    2006-09-01

    Calcareous sponges (Porifera, Calcarea) play an important role for our understanding of early metazoan evolution, since several molecular studies suggested their closer relationship to Eumetazoa than to the other two sponge 'classes,' Demospongiae and Hexactinellida. The division of Calcarea into the subtaxa Calcinea and Calcaronea is well established by now, but their internal relationships remain largely unresolved. Here, we estimate phylogenetic relationships within Calcarea in a Bayesian framework, using full-length 18S and partial 28S ribosomal DNA sequences. Both genes were analyzed separately and in combination and were further partitioned by stem and loop regions, the former being modelled to take non-independence of paired sites into account. By substantially increasing taxon sampling, we show that most of the traditionally recognized supraspecific taxa within Calcinea and Calcaronea are not monophyletic, challenging the existing classification system, while monophyly of Calcinea and Calcaronea is again highly supported.

  2. Detection and discrimination of Loa loa, Mansonella perstans and Wuchereria bancrofti by PCR-RFLP and nested-PCR of ribosomal DNA ITS1 region.

    PubMed

    Jiménez, Maribel; González, Luis Miguel; Carranza, Cristina; Bailo, Begoña; Pérez-Ayala, Ana; Muro, Antonio; Pérez-Arellano, José Luis; Gárate, Teresa

    2011-01-01

    The ribosomal deoxyribonucleic acid (DNA) internal transcribed spacer region (ITS1) of two filarial nematodes, Loa loa and Mansonella perstans, was amplified and further sequenced to develop an species-specific polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) protocol for the differentiation of both species from Wuchereria bancrofti, three filarial nematodes with blood circulating microfilariae. The ITS1-PCR product digested with the restriction endonuclease Ase I generated an specific diagnostic pattern for each of the three species. Moreover, three new specific nested-PCRs, targeting the ITS1 region, for differential detection of L. loa, M. perstans and W. bancrofti were developed and used when the ITS1-PCR products were insufficient for the Ase I enzymatic digestion. These filarial species-specific molecular protocols were evaluated in forty blood samples from African adult immigrants attending in the Hospital Insular of Gran Canaria, Canarias, Spain. PMID:20599994

  3. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  4. cDNA cloning, overexpression, purification and pharmacologic evaluation for anticancer activity of ribosomal protein L23A gene (RPL23A) from the Giant Panda.

    PubMed

    Sun, Bing; Hou, Yi-Ling; Hou, Wan-Ru; Zhang, Si-Nan; Ding, Xiang; Su, Xiu-Lan

    2012-01-01

    RPL23A gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L23P family of ribosomal proteins, which is located in the cytoplasm. The purpose of this paper was to explore the structure and anti-cancer function of ribosomal protein L23A (RPL23A) gene of the Giant Panda (Ailuropoda melanoleuca). The cDNA of RPL23A was cloned successfully from the Giant Panda using RT-PCR technology. We constructed a recombinant expression vector containing RPL23A cDNA and over-expressed it in Escherichia coli using pET28a plasmids. The expression product obtained was purified by using Ni chelating affinity chromatography. Recombinant protein of RPL23A obtained from the experiment acted on Hep-2 cells and human HepG-2 cells, then the growth inhibitory effect of these cells was observed by MTT (3-[4,5-dimethyl-2-thiazolyl]-2,5-diphenyl-2H-tetrazolium bromide) assay. The result indicated that the length of the fragment cloned is 506 bp, and it contains an open-reading frame (ORF) of 471 bp encoding 156 amino acids. Primary structure analysis revealed that the molecular weight of the putative RPL23A protein is 17.719 kDa with a theoretical pI 11.16. The molecular weight of the recombinant protein RPL23A is 21.265 kDa with a theoretical pI 10.57. The RPL23A gene can be really expressed in E. coli and the RPL23A protein, fusioned with the N-terminally His-tagged protein, gave rise to the accumulation of an expected 22 KDa polypeptide. The data showed that the recombinant protein RPL23A had a time- and dose-dependency on the cell growth inhibition rate. The data also indicated that the effect at low concentrations was better than at high concentrations on Hep-2 cells, and that the concentration of 0.185 μg/mL had the best rate of growth inhibition of 36.31%. All results of the experiment revealed that the recombinant protein RPL23A exhibited anti-cancer function on the Hep-2 cells. The study provides a scientific basis and aids orientation for

  5. Phylogenetic Analysis of Rhinosporidium seeberi’s 18S Small-Subunit Ribosomal DNA Groups This Pathogen among Members of the Protoctistan Mesomycetozoa Clade

    PubMed Central

    Herr, Roger A.; Ajello, Libero; Taylor, John W.; Arseculeratne, Sarath N.; Mendoza, Leonel

    1999-01-01

    For the past 100 years the phylogenetic affinities of Rhinosporidium seeberi have been controversial. Based on its morphological features, it has been classified as a protozoan or as a member of the kingdom Fungi. We have amplified and sequenced nearly a full-length 18S small-subunit (SSU) ribosomal DNA (rDNA) sequence from R. seeberi. Using phylogenetic analysis, by parsimony and distance methods, of R. seeberi’s 18S SSU rDNA and that of other eukaryotes, we found that this enigmatic pathogen of humans and animals clusters with a novel group of fish parasites referred to as the DRIP clade (Dermocystidium, rossete agent, Ichthyophonus, and Psorospermium), near the animal-fungal divergence. Our phylogenetic analyses also indicate that R. seeberi is the sister taxon of the two Dermocystidium species used in this study. This molecular affinity is remarkable since members of the genus Dermocystidium form spherical structures in infected hosts, produce endospores, have not been cultured, and possess mitochondria with flat cristae. With the addition of R. seeberi to this clade, the acronym DRIP is no longer appropriate. We propose to name this monophyletic clade Mesomycetozoa to reflect the group’s phylogenetic association within the Eucarya. PMID:10449446

  6. Molecular characterization of Hysterothylacium aduncum (Nematoda: Raphidascaridae) from different fish caught off the Tunisian coast based on nuclear ribosomal DNA sequences.

    PubMed

    Amor, Nabil; Farjallah, Sarra; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine

    2011-11-01

    Larval forms of the genus Hysterothylacium have been previously reported in teleost fish from the North African coasts of central Mediterranean Sea by morphological analysis. In the present study, samples identified morphologically as Hysterothylacium aduncum (n = 62), from Merluccius merluccius, Trachurus mediterraneus and Pagellus erythrinus from different geographical locations of the Tunisian coasts, were genetically characterised by sequences of the first (ITS-1), the 5.8S and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA). Comparison of the sequences obtained with those available in public gene databases confirmed that all the samples from the Tunisian coasts belong to a single species, namely H. aduncum. All specimens from the Tunisian coasts showed one indel in position 787 in ITS-2 sequences not reported by any of the previously published sequences from the Atlantic and Pacific Oceans, Adriatic Sea (Mediterranean Sea) and the East Greenland Sea, suggesting the existence of a population-specific pattern exhibiting a low differentiation of this parasite in this area. This is the first molecular characterization of H. aduncum from the Tunisian coasts using ITS rDNA sequences which allows the definition of genetic markers for their unequivocal identification, and provides further biological data on these nematodes in marine fish off the Tunisian coasts, improving the picture of the occurrence of these taxa in the North African coasts of central Mediterranean Sea. PMID:21519865

  7. Stimulation of ribosomal RNA gene promoter by transcription factor Sp1 involves active DNA demethylation by Gadd45-NER pathway.

    PubMed

    Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay

    2016-08-01

    The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. PMID:27156884

  8. Numerical Analysis of Grassland Bacterial Community Structure under Different Land Management Regimens by Using 16S Ribosomal DNA Sequence Data and Denaturing Gradient Gel Electrophoresis Banding Patterns

    PubMed Central

    McCaig, Allison E.; Glover, L. Anne; Prosser, James I.

    2001-01-01

    Bacterial diversity in unimproved and improved grassland soils was assessed by PCR amplification of bacterial 16S ribosomal DNA (rDNA) from directly extracted soil DNA, followed by sequencing of ∼45 16S rDNA clones from each of three unimproved and three improved grassland samples (A. E. McCaig, L. A. Glover, and J. I. Prosser, Appl. Environ. Microbiol. 65:1721–1730, 1999) or by denaturing gradient gel electrophoresis (DGGE) of total amplification products. Semi-improved grassland soils were analyzed only by DGGE. No differences between communities were detected by calculation of diversity indices and similarity coefficients for clone data (possibly due to poor coverage). Differences were not observed between the diversities of individual unimproved and improved grassland DGGE profiles, although considerable spatial variation was observed among triplicate samples. Semi-improved grassland samples, however, were less diverse than the other grassland samples and had much lower within-group variation. DGGE banding profiles obtained from triplicate samples pooled prior to analysis indicated that there was less evenness in improved soils, suggesting that selection for specific bacterial groups occurred. Analysis of DGGE profiles by canonical variate analysis but not by principal-coordinate analysis, using unweighted data (considering only the presence and absence of bands) and weighted data (considering the relative intensity of each band), demonstrated that there were clear differences between grasslands, and the results were not affected by weighting of data. This study demonstrated that quantitative analysis of data obtained by community profiling methods, such as DGGE, can reveal differences between complex microbial communities. PMID:11571155

  9. SSCP-based identification of members within the Pseudoterranova decipiens complex (Nematoda: Ascaridoidea: Anisakidae) using genetic markers in the internal transcribed spacers of ribosomal DNA.

    PubMed

    Zhu, X Q; D'Amelio, S; Palm, H W; Paggi, L; George-Nascimento, M; Gasser, R B

    2002-06-01

    The anisakid nematodes morphologically corresponding with Pseudoterranova decipiens sensu lato (s.l.) (Krabbe, 1878) from different seal or sea lion hosts and geographical origins, previously identified as Pseudoterranova krabbei, P. decipiens (s.s.), P. bulbosa, P. azarasi and P. cattani by multilocus enzyme electrophoresis, were characterized using a DNA approach. Also a population of P. decipiens (s.l.) from Chaenocephalus aceratus, the blackfin icefish, from Antarctica and another from Osmerus eperlanus, the European smelt, from Germany were included in the study. The first (ITS-1) and second (ITS-2) internal transcribed spacers (ITS) of ribosomal DNA (rDNA) were amplified by PCR from individual nematodes and analysed by single-strand conformation polymorphism (SSCP), followed by selective sequencing. While no variation in single-stranded ITS-1 and ITS-2 profiles was detected among samples representing each of the species or populations (with the exception of slight microheterogeneity), SSCP analysis of the ITS-2 amplicons allowed the unequivocal differentiation of all of the 5 sibling species of P. decipiens (s.l.) examined, which was supported by sequence differences in ITS rDNA. Samples representing the P. decipiens (s.l.) population from O. eperlanus had the same SSCP profile as those of P. decipiens (s.s.), which was supported by a lack of nucleotide difference in the ITS between them, suggesting that the former represented P. decipiens (s.s.). Based on SSCP results and ITS sequence data, P. decipiens (s.l.) from C. aceratus was genetically most distinct with respect to all other members of Pseudoterranova examined, which indicated that it may represent P. decipiens E (based on geographical origin) or a distinct species. These findings and the molecular approach taken should have important implications for studying the life-cycles, transmission patterns, epidemiology and population genetics of these anisakid nematodes, and the diagnosis of their infections

  10. Combined Use of 16S Ribosomal DNA and 16S rRNA To Study the Bacterial Community of Polychlorinated Biphenyl-Polluted Soil

    PubMed Central

    Nogales, Balbina; Moore, Edward R. B.; Llobet-Brossa, Enrique; Rossello-Mora, Ramon; Amann, Rudolf; Timmis, Kenneth N.

    2001-01-01

    The bacterial diversity assessed from clone libraries prepared from rRNA (two libraries) and ribosomal DNA (rDNA) (one library) from polychlorinated biphenyl (PCB)-polluted soil has been analyzed. A good correspondence of the community composition found in the two types of library was observed. Nearly 29% of the cloned sequences in the rDNA library were identical to sequences in the rRNA libraries. More than 60% of the total cloned sequence types analyzed were grouped in phylogenetic groups (a clone group with sequence similarity higher than 97% [98% for Burkholderia and Pseudomonas-type clones]) represented in both types of libraries. Some of those phylogenetic groups, mostly represented by a single (or pair) of cloned sequence type(s), were observed in only one of the types of library. An important difference between the libraries was the lack of clones representative of the Actinobacteria in the rDNA library. The PCB-polluted soil exhibited a high bacterial diversity which included representatives of two novel lineages. The apparent abundance of bacteria affiliated to the beta-subclass of the Proteobacteria, and to the genus Burkholderia in particular, was confirmed by fluorescence in situ hybridization analysis. The possible influence on apparent diversity of low template concentrations was assessed by dilution of the RNA template prior to amplification by reverse transcription-PCR. Although differences in the composition of the two rRNA libraries obtained from high and low RNA concentrations were observed, the main components of the bacterial community were represented in both libraries, and therefore their detection was not compromised by the lower concentrations of template used in this study. PMID:11282645

  11. The DNA Virus White Spot Syndrome Virus Uses an Internal Ribosome Entry Site for Translation of the Highly Expressed Nonstructural Protein ICP35

    PubMed Central

    Kang, Shih-Ting; Wang, Han-Ching; Yang, Yi-Ting

    2013-01-01

    Although shrimp white spot syndrome virus (WSSV) is a large double-stranded DNA virus (∼300 kbp), it expresses many polycistronic mRNAs that are likely to use internal ribosome entry site (IRES) elements for translation. A polycistronic mRNA encodes the gene of the highly expressed nonstructural protein ICP35, and here we use a dual-luciferase assay to demonstrate that this protein is translated cap independently by an IRES element located in the 5′ untranslated region of icp35. A deletion analysis of this region showed that IRES activity was due to stem-loops VII and VIII. A promoterless assay, a reverse transcription-PCR together with quantitative real-time PCR analysis, and a stable stem-loop insertion upstream of the Renilla luciferase open reading frame were used, respectively, to rule out the possibility that cryptic promoter activity, abnormal splicing, or read-through was contributing to the IRES activity. In addition, a Northern blot analysis was used to confirm that only a single bicistronic mRNA was expressed. The importance of ICP35 to viral replication was demonstrated in a double-stranded RNA (dsRNA) interference knockdown experiment in which the mortality of the icp35 dsRNA group was significantly reduced. Tunicamycin was used to show that the α subunit of eukaryotic initiation factor 2 is required for icp35 IRES activity. We also found that the intercalating drug quinacrine significantly inhibited icp35 IRES activity in vitro and reduced the mortality rate and viral copy number in WSSV-challenged shrimp. Lastly, in Sf9 insect cells, we found that knockdown of the gene for the Spodoptera frugiperda 40S ribosomal protein RPS10 decreased icp35 IRES-regulated firefly luciferase activity but had no effect on cap-dependent translation. PMID:24089551

  12. Characterization of Trichuris trichiura from humans and T. suis from pigs in China using internal transcribed spacers of nuclear ribosomal DNA.

    PubMed

    Liu, G H; Zhou, W; Nisbet, A J; Xu, M J; Zhou, D H; Zhao, G H; Wang, S K; Song, H Q; Lin, R Q; Zhu, X Q

    2014-03-01

    Trichuris trichiura and Trichuris suis parasitize (at the adult stage) the caeca of humans and pigs, respectively, causing trichuriasis. Despite these parasites being of human and animal health significance, causing considerable socio-economic losses globally, little is known of the molecular characteristics of T. trichiura and T. suis from China. In the present study, the entire first and second internal transcribed spacer (ITS-1 and ITS-2) regions of nuclear ribosomal DNA (rDNA) of T. trichiura and T. suis from China were amplified by polymerase chain reaction (PCR), the representative amplicons were cloned and sequenced, and sequence variation in the ITS rDNA was examined. The ITS rDNA sequences for the T. trichiura and T. suis samples were 1222-1267 bp and 1339-1353 bp in length, respectively. Sequence analysis revealed that the ITS-1, 5.8S and ITS-2 rDNAs of both whipworms were 600-627 bp and 655-661 bp, 154 bp, and 468-486 bp and 530-538 bp in size, respectively. Sequence variation in ITS rDNA within and among T. trichiura and T. suis was examined. Excluding nucleotide variations in the simple sequence repeats, the intra-species sequence variation in the ITS-1 was 0.2-1.7% within T. trichiura, and 0-1.5% within T. suis. For ITS-2 rDNA, the intra-species sequence variation was 0-1.3% within T. trichiura and 0.2-1.7% within T. suis. The inter-species sequence differences between the two whipworms were 60.7-65.3% for ITS-1 and 59.3-61.5% for ITS-2. These results demonstrated that the ITS rDNA sequences provide additional genetic markers for the characterization and differentiation of the two whipworms. These data should be useful for studying the epidemiology and population genetics of T. trichiura and T. suis, as well as for the diagnosis of trichuriasis in humans and pigs.

  13. Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA.

    PubMed

    Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod

    2016-02-01

    Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili. PMID:26862481

  14. Evolution of the assassin’s arms: insights from a phylogeny of combined transcriptomic and ribosomal DNA data (Heteroptera: Reduvioidea)

    PubMed Central

    Zhang, Junxia; Gordon, Eric R. L.; Forthman, Michael; Hwang, Wei Song; Walden, Kim; Swanson, Daniel R.; Johnson, Kevin P.; Meier, Rudolf; Weirauch, Christiane

    2016-01-01

    Assassin bugs (Reduvioidea) are one of the most diverse (>7,000 spp.) lineages of predatory animals and have evolved an astounding diversity of raptorial leg modifications for handling prey. The evolution of these modifications is not well understood due to the lack of a robust phylogeny, especially at deeper nodes. We here utilize refined data from transcriptomes (370 loci) to stabilize the backbone phylogeny of Reduvioidea, revealing the position of major clades (e.g., the Chagas disease vectors Triatominae). Analyses combining transcriptomic and Sanger-sequencing datasets result in the first well-resolved phylogeny of Reduvioidea. Despite amounts of missing data, the transcriptomic loci resolve deeper nodes while the targeted ribosomal genes anchor taxa at shallower nodes, both with high support. This phylogeny reveals patterns of raptorial leg evolution across major leg types. Hairy attachment structures (fossula spongiosa), present in the ancestor of Reduvioidea, were lost multiple times within the clade. In contrast to prior hypotheses, this loss is not directly correlated with the evolution of alternative raptorial leg types. Our results suggest that prey type, predatory behavior, salivary toxicity, and morphological adaptations pose intricate and interrelated factors influencing the evolution of this diverse group of predators. PMID:26916580

  15. Evolution of the assassin's arms: insights from a phylogeny of combined transcriptomic and ribosomal DNA data (Heteroptera: Reduvioidea).

    PubMed

    Zhang, Junxia; Gordon, Eric R L; Forthman, Michael; Hwang, Wei Song; Walden, Kim; Swanson, Daniel R; Johnson, Kevin P; Meier, Rudolf; Weirauch, Christiane

    2016-01-01

    Assassin bugs (Reduvioidea) are one of the most diverse (>7,000 spp.) lineages of predatory animals and have evolved an astounding diversity of raptorial leg modifications for handling prey. The evolution of these modifications is not well understood due to the lack of a robust phylogeny, especially at deeper nodes. We here utilize refined data from transcriptomes (370 loci) to stabilize the backbone phylogeny of Reduvioidea, revealing the position of major clades (e.g., the Chagas disease vectors Triatominae). Analyses combining transcriptomic and Sanger-sequencing datasets result in the first well-resolved phylogeny of Reduvioidea. Despite amounts of missing data, the transcriptomic loci resolve deeper nodes while the targeted ribosomal genes anchor taxa at shallower nodes, both with high support. This phylogeny reveals patterns of raptorial leg evolution across major leg types. Hairy attachment structures (fossula spongiosa), present in the ancestor of Reduvioidea, were lost multiple times within the clade. In contrast to prior hypotheses, this loss is not directly correlated with the evolution of alternative raptorial leg types. Our results suggest that prey type, predatory behavior, salivary toxicity, and morphological adaptations pose intricate and interrelated factors influencing the evolution of this diverse group of predators. PMID:26916580

  16. Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA

    PubMed Central

    Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod

    2015-01-01

    Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift–mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicumchinense and Capsicumfrutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili. PMID:26862481

  17. Molecular Analysis of Dehalococcoides 16S Ribosomal DNA from Chloroethene-Contaminated Sites throughout North America and Europe

    PubMed Central

    Hendrickson, Edwin R.; Payne, Jo Ann; Young, Roslyn M.; Starr, Mark G.; Perry, Michael P.; Fahnestock, Stephen; Ellis, David E.; Ebersole, Richard C.

    2002-01-01

    The environmental distribution of Dehalococcoides group organisms and their association with chloroethene-contaminated sites were examined. Samples from 24 chloroethene-dechlorinating sites scattered throughout North America and Europe were tested for the presence of members of the Dehalococcoides group by using a PCR assay developed to detect Dehalococcoides 16S rRNA gene (rDNA) sequences. Sequences identified by sequence analysis as sequences of members of the Dehalococcoides group were detected at 21 sites. Full dechlorination of chloroethenes to ethene occurred at these sites. Dehalococcoides sequences were not detected in samples from three sites at which partial dechlorination of chloroethenes occurred, where dechlorination appeared to stop at 1,2-cis-dichloroethene. Phylogenetic analysis of the 16S rDNA amplicons confirmed that Dehalococcoides sequences formed a unique 16S rDNA group. These 16S rDNA sequences were divided into three subgroups based on specific base substitution patterns in variable regions 2 and 6 of the Dehalococcoides 16S rDNA sequence. Analyses also demonstrated that specific base substitution patterns were signature patterns. The specific base substitutions distinguished the three sequence subgroups phylogenetically. These results demonstrated that members of the Dehalococcoides group are widely distributed in nature and can be found in a variety of geological formations and in different climatic zones. Furthermore, the association of these organisms with full dechlorination of chloroethenes suggests that they are promising candidates for engineered bioremediation and may be important contributors to natural attenuation of chloroethenes. PMID:11823182

  18. Variation in ribosomal and mitochondrial DNA sequences demonstrates the existence of intraspecific groups in Paramecium multimicronucleatum (Ciliophora, Oligohymenophorea).

    PubMed

    Tarcz, Sebastian; Potekhin, Alexey; Rautian, Maria; Przyboś, Ewa

    2012-05-01

    This is the first phylogenetic study of the intraspecific variability within Paramecium multimicronucleatum with the application of two-loci analysis (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA) carried out on numerous strains originated from different continents. The species has been shown to have a complex structure of several sibling species within taxonomic species. Our analysis revealed the existence of 10 haplotypes for the rDNA fragment and 15 haplotypes for the COI fragment in the studied material. The mean distance for all of the studied P. multimicronucleatum sequence pairs was p=0.025/0.082 (rDNA/COI). Despite the greater variation of the COI fragment, the COI-derived tree topology is similar to the tree topology constructed on the basis of the rDNA fragment. P. multimicronucleatum strains are divided into three main clades. The tree based on COI fragment analysis presents a greater resolution of the studied P. multimicronucleatum strains. Our results indicate that the strains of P. multimicronucleatum that appear in different clades on the trees could belong to different syngens.

  19. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  20. Clade-Specific 16S Ribosomal DNA Oligonucleotides Reveal the Predominance of a Single Marine Synechococcus Clade throughout a Stratified Water Column in the Red Sea

    PubMed Central

    Fuller, Nicholas J.; Marie, Dominique; Partensky, Frédéric; Vaulot, Daniel; Post, Anton F.; Scanlan, David J.

    2003-01-01

    Phylogenetic relationships among members of the marine Synechococcus genus were determined following sequencing of the 16S ribosomal DNA (rDNA) from 31 novel cultured isolates from the Red Sea and several other oceanic environments. This revealed a large genetic diversity within the marine Synechococcus cluster consistent with earlier work but also identified three novel clades not previously recognized. Phylogenetic analyses showed one clade, containing halotolerant isolates lacking phycoerythrin (PE) and including strains capable, or not, of utilizing nitrate as the sole N source, which clustered within the MC-A (Synechococcus subcluster 5.1) lineage. Two copies of the 16S rRNA gene are present in marine Synechococcus genomes, and cloning and sequencing of these copies from Synechococcus sp. strain WH 7803 and genomic information from Synechococcus sp. strain WH 8102 reveal these to be identical. Based on the 16S rDNA sequence information, clade-specific oligonucleotides for the marine Synechococcus genus were designed and their specificity was optimized. Using dot blot hybridization technology, these probes were used to determine the in situ community structure of marine Synechococcus populations in the Red Sea at the time of a Synechococcus maximum during April 1999. A predominance of genotypes representative of a single clade was found, and these genotypes were common among strains isolated into culture. Conversely, strains lacking PE, which were also relatively easily isolated into culture, represented only a minor component of the Synechococcus population. Genotypes corresponding to well-studied laboratory strains also appeared to be poorly represented in this stratified water column in the Red Sea. PMID:12732508

  1. Development of molecular markers, based on chloroplast and ribosomal DNA regions, to discriminate three popular medicinal plant species, Cynanchum wilfordii, Cynanchum auriculatum, and Polygonum multiflorum.

    PubMed

    Han, Eun-Heui; Cho, KyeMan; Goo, YoungMin; Kim, ManBae; Shin, Young-Wook; Kim, Yun-Hee; Lee, Shin-Woo

    2016-04-01

    Identification of plant species is important for standardizing herbal medicine. Cynanchum wilfordii (Baekshuoh in Korean) and Polygonum multiflorum (Hashuoh in Korean) are important oriental medicinal herbs in Korea, Japan, and China. Cynanchum auriculatum is a faster growing and more productive plant than C. wilfordii; and, it is not recognized as a medicinal plant in the Korean Pharmacopoeia. C. wilfordii, P. multiflorum, and C. auriculatum are often misidentified in the Korean herbal medicine marketplace due to their morphological similarities and similar names. In this study, we investigated molecular authentication of these three medicinal plants using DNA sequences in the TrnL-F chloroplast intergenic region. Specific species identification was achieved by detecting allelic variations of single nucleotide polymorphisms (SNPs) using amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) and high resolution melting curve analysis. Our results demonstrate that the intraspecific genetic distance between C. wilfordii and C. auriculatum is relatively low. We also developed a quantitative PCR assay using species-specific TrnL-F primers, which allowed us to estimate the ratio of C. wilfordii and C. auriculatum using varying ratios of mixed genomic DNA template from the two species. Additionally, to identify species in hybrid plants produced by cross-fertilization, we analyzed nuclear ribosomal DNA internal transcribed spacer regions in C. wilfordii and C. auriculatum by ARMS-PCR. Our results indicate that SNP-based molecular markers, usable to barcode tools could provide efficient and rapid authentication of these closely related medicinal plant species, and will be useful for preventing the distribution of products contaminated with adulterants. PMID:26902862

  2. Use of Subgenic 18S Ribosomal DNA PCR and Sequencing for Genus and Genotype Identification of Acanthamoebae from Humans with Keratitis and from Sewage Sludge

    PubMed Central

    Schroeder, Jill M.; Booton, Gregory C.; Hay, John; Niszl, Ingrid A.; Seal, David V.; Markus, Miles B.; Fuerst, Paul A.; Byers, Thomas J.

    2001-01-01

    This study identified subgenic PCR amplimers from 18S rDNA that were (i) highly specific for the genus Acanthamoeba, (ii) obtainable from all known genotypes, and (iii) useful for identification of individual genotypes. A 423- to 551-bp Acanthamoeba-specific amplimer ASA.S1 obtained with primers JDP1 and JDP2 was the most reliable for purposes i and ii. A variable region within this amplimer also identified genotype clusters, but purpose iii was best achieved with sequencing of the genotype-specific amplimer GTSA.B1. Because this amplimer could be obtained from any eukaryote, axenic Acanthamoeba cultures were required for its study. GTSA.B1, produced with primers CRN5 and 1137, extended between reference bp 1 and 1475. Genotypic identification relied on three segments: bp 178 to 355, 705 to 926, and 1175 to 1379. ASA.S1 was obtained from single amoeba, from cultures of all known 18S rDNA genotypes, and from corneal scrapings of Scottish patients with suspected Acanthamoeba keratitis (AK). The AK PCR findings were consistent with culture results for 11 of 15 culture-positive specimens and detected Acanthamoeba in one of nine culture-negative specimens. ASA.S1 sequences were examined for 6 of the 11 culture-positive isolates and were most closely associated with genotypic cluster T3-T4-T11. A similar distance analysis using GTSA.B1 sequences identified nine South African AK-associated isolates as genotype T4 and three isolates from sewage sludge as genotype T5. Our results demonstrate the usefulness of 18S ribosomal DNA PCR amplimers ASA.S1 and GTSA.B1 for Acanthamoeba-specific detection and reliable genotyping, respectively, and provide further evidence that T4 is the predominant genotype in AK. PMID:11326011

  3. Identification of nucleosome assembly protein 1 (NAP1) as an interacting partner of plant ribosomal protein S6 (RPS6) and a positive regulator of rDNA transcription.

    PubMed

    Son, Ora; Kim, Sunghan; Shin, Yun-Jeong; Kim, Woo-Young; Koh, Hee-Jong; Cheon, Choong-Ill

    2015-09-18

    The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. PMID:26241676

  4. Differential use of multiple replication origins in the ribosomal DNA episome of the protozoan parasite Entamoeba histolytica.

    PubMed

    Ghosh, Soma; Satish, S; Tyagi, Sonika; Bhattacharya, Alok; Bhattacharya, Sudha

    2003-04-15

    The factors that control the initiation of eukaryotic DNA replication from defined origins (oris) on the chromosome remain incompletely resolved. Here we show that the circular rDNA episome of the human pathogen Entamoeba histolytica contains multiple potential oris, which are utilized in a differential manner. The primary ori in exponentially growing cells was mapped close to the promoter of rRNA genes in the upstream intergenic spacer (IGS) by two-dimensional gel electrophoresis. Replication initiated predominantly from the upstream IGS and terminated in the downstream IGS. However, when serum-starved cells were allowed to resume growth, the early oris which became activated were located in other parts of the molecule. Later the ori in the upstream IGS became activated, with concomitant silencing of the early oris. When the upstream IGS was located ectopically in an artificial plasmid, it again lost ori activity, while other parts of the rDNA episome could function as oris in this system. Therefore, the activation or silencing of the ori in this episome is context dependent, as is also the case with many eukaryotic replicons. This is the first replication origin to be mapped in this primitive protozoan and will provide an opportunity to define the factors involved in differential ori activity, and their comparison with metazoans. PMID:12682354

  5. Synthesis of ribosomes in Saccharomyces cerevisiae.

    PubMed Central

    Warner, J R

    1989-01-01

    The assembly of a eucaryotic ribosome requires the synthesis of four ribosomal ribonucleic acid (RNA) molecules and more than 75 ribosomal proteins. It utilizes all three RNA polymerases; it requires the cooperation of the nucleus and the cytoplasm, the processing of RNA, and the specific interaction of RNA and protein molecules. It is carried out efficiently and is exquisitely sensitive to the needs of the cell. Our current understanding of this process in the genetically tractable yeast Saccharomyces cerevisiae is reviewed. The ribosomal RNA genes are arranged in a tandem array of 100 to 200 copies. This tandem array has led to unique ways of carrying out a number of functions. Replication is asymmetric and does not initiate from every autonomously replicating sequence. Recombination is suppressed. Transcription of the major ribosomal RNA appears to involve coupling between adjacent transcription units, which are separated by the 5S RNA transcription unit. Genes for many ribosomal proteins have been cloned and sequenced. Few are linked; most are duplicated; most have an intron. There is extensive homology between yeast ribosomal proteins and those of other species. Most, but not all, of the ribosomal protein genes have one or two sites that are essential for their transcription and that bind a common transcription factor. This factor binds also to many other places in the genome, including the telomeres. There is coordinated transcription of the ribosomal protein genes under a variety of conditions. However, the cell seems to possess no mechanism for regulating the transcription of individual ribosomal protein genes in response either to a deficiency or an excess of a particular ribosomal protein. A deficiency causes slow growth. Any excess ribosomal protein is degraded very rapidly, with a half-life of 1 to 5 min. Unlike most types of cells, yeast cells appear not to regulate the translation of ribosomal proteins. However, in the case of ribosomal protein L32

  6. Characterization of the nuclear ribosomal DNA units and phylogeny of Beta L. wild forms and cultivated beets.

    PubMed

    Santoni, S; Bervillé, A

    1992-03-01

    The nuclear rDNA units of species belonging to the genus Beta were characterized using heterologous probes of flax (entire unit and 25S) and sunflower (6.1-kb Eco fragment containing the 18S, the entire intergenic spacer (IGS) and a small piece of the 25S). The physical maps of one species from each section of the genus was constructed by localization of the EcoRI, BamHI, HindIII, KpnI and SacI restriction sites. For each species a single individual was used to obtain total DNA. The major unit length is 11 kb, but variant length units at 10.4, 10.7 and 11.3 kb were found as minor forms. However, some individuals carried the 10.4-kb or the 10.7-kb variant length unit as the major form. For the variant length units of one species the restriction sites were conserved, so that the variation in length occurred in the IGS. The EcoRI fragment corresponding to the intergenic spacer appeared to be the best indicator of variation. The variable sequence in the IGS sometimes generated new restriction sites for the Corollinae and mainly, did so, for the Vulgares relative to the Procumbentes. The variable sites were able, to differentiate the three sections and species within the sections. Corollinae species belong to two different groups according to the absence or the presence of the BamHI (B4) site. The Vulgares species contain several unit types. We proposed that all the unit types derived from a unique unit, V-11-2.3, by unequal crossing-overs or conversion. We also supposed a homogenization mechanism because we found individuals homogeneous for every unit type. Among the cultivated beets, all the root beets contain only one rDNA unit type, V-11-2.9. Thus, we supposed that the common unit type of cultivated beets either brings a physiological advantage or is strictly linked to a favorable allele. It is likely that the rDNA unit of B. maritima were eliminated from sugar beet by the breeding process since they were not recovered. Whatever the process, we deduced that all the

  7. Genetic variability and geographical diversity of the main Chagas' disease vector Panstrongylus megistus (Hemiptera: Triatominae) in Brazil based on ribosomal DNA intergenic sequences.

    PubMed

    Cavassin, Francelisse Bridi; Kuehn, Christian Collins; Kopp, Rogério Luiz; Thomaz-Soccol, Vanette; Da Rosa, João Aristeu; Luz, Ennio; Mas-Coma, Santiago; Bargues, María Dolores

    2014-05-01

    Studies were made on the ribosomal DNA intergenic region, comprising complete internal transcribed spacer (ITS)-1, 5.8S, and ITS-2 sequences, of populations of the triatomine Panstrongylus megistus, the most important vector of Chagas' disease in Brazil since Triatoma infestans eradication. Specimens were from 26 localities of Rio Grande do Sul, Santa Catarina, Paraná, São Paulo, Minas Gerais, Bahia, and Sergipe states. In total, 21 ITS-1 and 12 ITS-2 haplotypes were found. Nucleotide differences were higher in ITS-1 (3.00%) than in ITS-2 (1.33%). The intergenic region was 1,513-1,522-bp-long (mean 1,516.9 bp), providing 26 combined haplotypes. The combination of microsatellites found in both ITSs may be of applied usefulness, to assess interpopulation specimen exchange and potential recolonizations after vector elimination by control implementation. Network results suggest that São Paulo may be considered one of the spreading centers of this species. Molecular clock datation suggests that P. megistus populations are diversifying at least since 4.54 million years ago, with diversification still ongoing today by geographical isolation of populations. Evidence is provided about the relationship of genetic diversity with geographical spread that characterizes a major vector and explains its ability to colonize distant areas and different ecotopes, including human habitats, and consequently its importance in Chagas' disease epidemiology.

  8. Molecular characterization by amplified ribosomal DNA restriction analysis and antimicrobial potential of endophytic fungi isolated from Luehea divaricata (Malvaceae) against plant pathogenic fungi and pathogenic bacteria.

    PubMed

    Bernardi-Wenzel, J; Garcia, A; Azevedo, J L; Pamphile, J A

    2013-01-01

    Luehea divaricata is an important plant in popular medicine; it is used for its depurative, anti-inflammatory, and other therapeutic activities. We evaluated the antimicrobial activity of endophytic fungi isolated from leaves of L. divaricata against phytopathogens and pathogenic bacteria, and characterized the isolates based on amplified ribosomal DNA restriction analysis (ARDRA). The in vitro antagonistic activity of these endophytes against the phytopathogen Alternaria alternata was assayed by dual culture technique. Based on this evaluation of antimicrobial activity, we extracted secondary metabolites from nine endophytic fungi by partitioning in ethyl acetate and methanol. These were tested against the phytopathogens A. alternata, Colletotrichum sp and Moniliophthora perniciosa, and against the human pathogenic bacteria Escherichia coli and Staphylococcus aureus. Molecular characterization by ARDRA technique was used for phylogenetic analysis, based on comparison with sequences in GenBank. The endophytes had varied effects on A. alternata. One isolate produced an inhibition halo against M. perniciosa and against E. coli. This antibiosis activity indicates a role in the protection of the plant against microbial pathogens in nature, with potential for pharmaceutical and agricultural applications. Based on ARDRA, the 13 isolates were grouped. We found three different haplotypes of Phomopsis sp, showing interspecific variability. It appears that examination of the microbial community associated with medicinal plants of tropical regions has potential as a useful strategy to look for species with biotechnological applications. PMID:24301768

  9. Genetic analysis of Fasciola isolates from cattle in Korea based on second internal transcribed spacer (ITS-2) sequence of nuclear ribosomal DNA.

    PubMed

    Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won

    2011-09-01

    Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence. PMID:21494845

  10. The first internal transcribed spacer (ITS-1) of ribosomal DNA as a molecular marker for phylogenetic and population analyses in crustacea.

    PubMed

    Chu, K H; Li, C P; Ho, H Y

    2001-07-01

    The objective of the present study is to explore the feasibility of using the first internal transcribed spacer (ITS-1) of ribosomal DNA as a molecular marker for studying the interspecific and intraspecific genetic variations among crustaceans. We designed primers that could amplify ITS-1 from a majority of taxonomic groups of crustaceans. The gene was found to exhibit a high degree of length polymorphism among different groups, ranging from 182 bp in the barnacle Balanus amphitrite to approximately 820 bp in the spiny lobster Panulirus japonicus. With respect to differences between congeneric species, it was found that the ITS-1 sequences of 3 mitten crabs, Eriocheir sinensis, Eriocheir leptognathus, and Eriocheir formosa, exhibit 5.4% to 16.3% nucleotide divergence, suggesting that ITS-1 is informative for phylogenetic analysis at the species level. Yet there are extensive (0.9%-2.3%) variations within individual E. formosa, so that phylogenetic analyses could be obscured. ITS-1 was found to vary between 2 geographical populations of the shrimp Penaeus japonicus. The variations involved substitutions as well as insertions/deletions between shrimp from Australia and South China Sea. These results show that ITS-1 is highly divergent among different crustaceans and could be an appropriate marker for molecular systematic studies at the species and population levels, although the presence of intragenomic variation needs to be taken into consideration.

  11. Replication initiates at multiple dispersed sites in the ribosomal DNA plasmid of the protozoan parasite Entamoeba histolytica.

    PubMed

    Dhar, S K; Choudhury, N R; Mittal, V; Bhattacharya, A; Bhattacharya, S

    1996-05-01

    In the protozoan parasite Entamoeba histolytica (which causes amoebiasis in humans), the rRNA genes (rDNA) in the nucleus are carried on an extrachromosomal circular plasmid. For strain HM-1:IMSS, the size of the rDNA plasmid is 24.5 kb, and 200 copies per genome are present. Each circle contains two rRNA transcription units as inverted repeats separated by upstream and downstream spacers. We have studied the replication of this molecule by neutral/neutral two-dimensional gel electrophoresis and by electron microscopy. All restriction fragments analyzed by two-dimensional gel electrophoresis gave signals corresponding to simple Y's and bubbles. This showed that replication initiated in this plasmid at multiple, dispersed locations spread throughout the plasmid. On the basis of the intensity of the bubble arcs, initiations from the rRNA transcription units seemed to occur more frequently than those from intergenic spacers. Multiple, dispersed initiation sites were also seen in the rDNA plasmid of strain HK-9 when it was analyzed by two-dimensional gel electrophoresis. Electron microscopic visualization of replicating plasmid molecules in strain HM-1:IMISS showed multiple replication bubbles in the same molecule. The location of bubbles on the rDNA circle was mapped by digesting with PvuI or BsaHI, which linearize the molecule, and with SacII, which cuts the circle twice. The distance of the bubbles from one end of the molecule was measured by electron microscopy. The data corroborated those from two-dimensional gels and showed that replication bubbles were distributed throughout the molecule and that they appeared more frequently in rRNA transcription units. The same interpretation was drawn from electron microscopic analysis of the HK-9 plasmid. Direct demonstration of more than one bubble in the same molecule is clear evidence that replication of this plasmid initiates at multiple sites. Potential replication origins are distributed throughout the plasmid. Such a

  12. The nuclear ribosomal DNA intergenic spacer as a target sequence to study intraspecific diversity of the ectomycorrhizal basidiomycete Hebeloma cylindrosporum directly on pinus root systems.

    PubMed

    Guidot, A; Lumini, E; Debaud, J C; Marmeisse, R

    1999-03-01

    Polymorphism of the nuclear ribosomal DNA intergenic spacer (IGS) of the ectomycorrhizal basidiomycete Hebeloma cylindrosporum was studied to evaluate whether this sequence could be used in field studies to estimate the diversity of strains forming mycorrhizas on individual Pinus pinaster root systems. This sequence was amplified by PCR from 125 haploid homokaryotic strains collected in 14 P. pinaster stands along the Atlantic coast of France by using conserved oligonucleotide primers. Restriction enzyme digestion of the amplified 3.4-kbp-long IGS allowed us to characterize 24 alleles whose frequencies differed. Nine of these alleles were found only once, whereas about 60% of the strains contained four of the alleles. Local populations could be almost as diverse as the entire population along a 150-km stretch of coastline that was examined; for example, 13 alleles were found in a single forest stand. The IGS from one strain was partially sequenced, and the sequence data were used to design oligonucleotides which allowed separate PCR amplification of three different segments of the IGS. Most polymorphisms observed among the full-length IGS regions resulted from polymorphisms in an internal ca. 1,500-bp-long sequence characterized by length variations that may have resulted from variable numbers of a T2AG3 motif. This internal polymorphic sequence could not be amplified from the genomes of nine other Hebeloma species. Analysis of this internal sequence amplified from the haploid progenies of 10 fruiting bodies collected in a 70-m2 area resulted in identification of six allelic forms and seven distinct diplotypes out of the 21 possible different combinations. Moreover, optimization of the PCR conditions resulted in amplification of this sequence from more than 80% of the DNA samples extracted from individual H. cylindrosporum infected P. pinaster mycorrhizal root tips, thus demonstrating the usefulness of this sequence for studying the below-ground diversity of

  13. PFR²: a curated database of planktonic foraminifera 18S ribosomal DNA as a resource for studies of plankton ecology, biogeography and evolution.

    PubMed

    Morard, Raphaël; Darling, Kate F; Mahé, Frédéric; Audic, Stéphane; Ujiié, Yurika; Weiner, Agnes K M; André, Aurore; Seears, Heidi A; Wade, Christopher M; Quillévéré, Frédéric; Douady, Christophe J; Escarguel, Gilles; de Garidel-Thoron, Thibault; Siccha, Michael; Kucera, Michal; de Vargas, Colomban

    2015-11-01

    Planktonic foraminifera (Rhizaria) are ubiquitous marine pelagic protists producing calcareous shells with conspicuous morphology. They play an important role in the marine carbon cycle, and their exceptional fossil record serves as the basis for biochronostratigraphy and past climate reconstructions. A major worldwide sampling effort over the last two decades has resulted in the establishment of multiple large collections of cryopreserved individual planktonic foraminifera samples. Thousands of 18S rDNA partial sequences have been generated, representing all major known morphological taxa across their worldwide oceanic range. This comprehensive data coverage provides an opportunity to assess patterns of molecular ecology and evolution in a holistic way for an entire group of planktonic protists. We combined all available published and unpublished genetic data to build PFR(2), the Planktonic foraminifera Ribosomal Reference database. The first version of the database includes 3322 reference 18S rDNA sequences belonging to 32 of the 47 known morphospecies of extant planktonic foraminifera, collected from 460 oceanic stations. All sequences have been rigorously taxonomically curated using a six-rank annotation system fully resolved to the morphological species level and linked to a series of metadata. The PFR(2) website, available at http://pfr2.sb-roscoff.fr, allows downloading the entire database or specific sections, as well as the identification of new planktonic foraminiferal sequences. Its novel, fully documented curation process integrates advances in morphological and molecular taxonomy. It allows for an increase in its taxonomic resolution and assures that integrity is maintained by including a complete contingency tracking of annotations and assuring that the annotations remain internally consistent. PMID:25828689

  14. PFR²: a curated database of planktonic foraminifera 18S ribosomal DNA as a resource for studies of plankton ecology, biogeography and evolution.

    PubMed

    Morard, Raphaël; Darling, Kate F; Mahé, Frédéric; Audic, Stéphane; Ujiié, Yurika; Weiner, Agnes K M; André, Aurore; Seears, Heidi A; Wade, Christopher M; Quillévéré, Frédéric; Douady, Christophe J; Escarguel, Gilles; de Garidel-Thoron, Thibault; Siccha, Michael; Kucera, Michal; de Vargas, Colomban

    2015-11-01

    Planktonic foraminifera (Rhizaria) are ubiquitous marine pelagic protists producing calcareous shells with conspicuous morphology. They play an important role in the marine carbon cycle, and their exceptional fossil record serves as the basis for biochronostratigraphy and past climate reconstructions. A major worldwide sampling effort over the last two decades has resulted in the establishment of multiple large collections of cryopreserved individual planktonic foraminifera samples. Thousands of 18S rDNA partial sequences have been generated, representing all major known morphological taxa across their worldwide oceanic range. This comprehensive data coverage provides an opportunity to assess patterns of molecular ecology and evolution in a holistic way for an entire group of planktonic protists. We combined all available published and unpublished genetic data to build PFR(2), the Planktonic foraminifera Ribosomal Reference database. The first version of the database includes 3322 reference 18S rDNA sequences belonging to 32 of the 47 known morphospecies of extant planktonic foraminifera, collected from 460 oceanic stations. All sequences have been rigorously taxonomically curated using a six-rank annotation system fully resolved to the morphological species level and linked to a series of metadata. The PFR(2) website, available at http://pfr2.sb-roscoff.fr, allows downloading the entire database or specific sections, as well as the identification of new planktonic foraminiferal sequences. Its novel, fully documented curation process integrates advances in morphological and molecular taxonomy. It allows for an increase in its taxonomic resolution and assures that integrity is maintained by including a complete contingency tracking of annotations and assuring that the annotations remain internally consistent.

  15. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  16. Identification of 16S Ribosomal DNA-Defined Bacterial Populations at a Shallow Submarine Hydrothermal Vent near Milos Island (Greece)

    PubMed Central

    Sievert, Stefan M.; Kuever, Jan; Muyzer, Gerard

    2000-01-01

    In a recent publication (S. M. Sievert, T. Brinkhoff, G. Muyzer, W. Ziebis, and J. Kuever, Appl. Environ. Microbiol. 65:3834–3842, 1999) we described spatiotemporal changes in the bacterial community structure at a shallow-water hydrothermal vent in the Aegean Sea near the isle of Milos (Greece). Here we describe identification and phylogenetic analysis of the predominant bacterial populations at the vent site and their distribution at the vent site as determined by sequencing of DNA molecules (bands) excised from denaturing gradient gels. A total of 36 bands could be sequenced, and there were representatives of eight major lineages of the domain Bacteria. Cytophaga-Flavobacterium and Acidobacterium were the most frequently retrieved bacterial groups. Less than 33% of the sequences exhibited 90% or more identity with cultivated organisms. The predominance of putative heterotrophic populations in the sequences retrieved is explained by the input of allochthonous organic matter at the vent site. PMID:10877814

  17. SSU ribosomal DNA-based monitoring of nematode assemblages reveals distinct seasonal fluctuations within evolutionary heterogeneous feeding guilds.

    PubMed

    Vervoort, Mariëtte T W; Vonk, J Arie; Mooijman, Paul J W; Van den Elsen, Sven J J; Van Megen, Hanny H B; Veenhuizen, Peter; Landeweert, Renske; Bakker, Jaap; Mulder, Christian; Helder, Johannes

    2012-01-01

    Soils are among the most complex, diverse and competitive habitats on Earth and soil biota are responsible for ecosystem services such as nutrient cycling, carbon sequestration and remediation of freshwater. The extreme biodiversity prohibits the making of a full inventory of soil life. Hence, an appropriate indicator group should be selected to determine the biological condition of soil systems. Due to their ubiquity and the diverse responses to abiotic and biotic changes, nematodes are suitable indicators for environmental monitoring. However, the time-consuming microscopic analysis of nematode communities has limited the scale at which this indicator group is used. In an attempt to circumvent this problem, a quantitative PCR-based tool for the detection of a consistent part of the soil nematofauna was developed based on a phylum-wide molecular framework consisting of 2,400 full-length SSU rDNA sequences. Taxon-specific primers were designed and tested for specificity. Furthermore, relationships were determined between the quantitative PCR output and numbers of target nematodes. As a first field test for this DNA sequence signature-based approach, seasonal fluctuations of nematode assemblages under open canopy (one field) and closed canopy (one forest) were monitored. Fifteen taxa from four feeding guilds (covering ∼ 65% of the free-living nematode biodiversity at higher taxonomical level) were detected at two trophic levels. These four feeding guilds are composed of taxa that developed independently by parallel evolution and we detected ecologically interpretable patterns for free-living nematodes belonging to the lower trophic level of soil food webs. Our results show temporal fluctuations, which can be even opposite within taxa belonging to the same guild. This research on nematode assemblages revealed ecological information about the soil food web that had been partly overlooked.

  18. Identification of nucleosome assembly protein 1 (NAP1) as an interacting partner of plant ribosomal protein S6 (RPS6) and a positive regulator of rDNA transcription

    SciTech Connect

    Son, Ora; Kim, Sunghan; Shin, Yun-jeong; Kim, Woo-Young; Koh, Hee-Jong; Cheon, Choong-Ill

    2015-09-18

    The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription.

  19. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  20. Phylogenetic utility of indels within ribosomal DNA and beta-tubulin sequences from fungi in the Rhizoctonia solani species complex.

    PubMed

    González, Dolores; Cubeta, Marc A; Vilgalys, Rytas

    2006-08-01

    The genus Rhizoctonia consists of a diverse assemblage of anamorphic fungi frequently associated with plants and soil throughout the world. Some anamorphs are related with teleomorphs (sexual stage) in different taxonomic classes, orders, and families. The fungus may exist as pathogen, saprophyte, or mycorrhizal symbiont and shows extensive variation in characteristics such as geographic location, morphology, host specificity, and pathogenicity. In this study, phylogenetic analyses were performed in the Rhizoctonia solani species complex with individual and combined data sets from three gene partitions (ITS, LSU rDNA, and beta-tubulin). To explore whether indels were a source of phylogenetically informative characters, single-site indels were treated as a new state, while indels greater than one contiguous nucleotide were analyzed by including them as ambiguous data (Coding A); excluding them from the analyses (Coding B), and with three distinct codes: multistate for different sequence (Coding C); multistate for different length (Coding D) and different characters for each distinct sequence (Coding E). Results suggest that indels in noncoding regions contain phylogenetic information and support the fact that the R. solani species complex is not monophyletic. Six clades within R. solani (teleomorph=Thanatephorus) representing distinct anastomosis groups and five clades within binucleate Rhizoctonia (teleomorph=Ceratobasidium) were well supported in all analyses. The data suggest that clades with representatives of R. solani fungi belonging to anastomosis groups 1, 4, 6, and 8 should be recognized as phylogenetic species.

  1. Phylogenetic Relationships of Tribes Within Harpalinae (Coleoptera: Carabidae) as Inferred from 28S Ribosomal DNA and the Wingless Gene

    PubMed Central

    Ober, Karen A.; Maddison, David R.

    2008-01-01

    Harpalinae is a large, monophyletic subfamily of carabid ground beetles containing more than 19,000 species in approximately 40 tribes. The higher level phylogenetic relationships within harpalines were investigated based on nucleotide data from two nuclear genes, wingless and 28S rDNA. Phylogenetic analyses of combined data indicate that many harpaline tribes are monophyletic, however the reconstructed trees showed little support for deeper nodes. In addition, our results suggest that the Lebiomorph Assemblage (tribes Lebiini, Cyclosomini, Graphipterini, Perigonini, Odacanthini, Lachnophorini, Pentagonicini, Catapiesini and Calophaenini), which is united by a morphological synapomorphy, is not monophyletic, and the tribe Lebiini is paraphyletic with respect to members of Cyclosomini. Two unexpected clades of tribes were supported: the Zuphiitae, comprised of Anthiini, Zuphiini, Helluonini, Dryptini, Galeritini, and Physocrotaphini; and a clade comprised of Orthogoniini, Pseudomorphini, and Graphipterini. The data presented in this study represent a dense sample of taxa to examine the molecular phylogeny of Harpalinae and provide a useful framework to examine the origin and evolution of morphological and ecological diversity in this group. PMID:20302528

  2. Ribosomal DNA as molecular markers and their applications in the identification of fish parasites (Platyhelminthes: Monogenea) from India

    PubMed Central

    Chaudhary, Anshu; Verma, Chandni; Singh, Hridaya Shanker

    2014-01-01

    The development of molecular techniques for taxonomic analysis of monogenean parasites has led to a great increase for proper identification and factualness. These molecular techniques, in particular the use of molecular markers, have been used to identify and validate the monogenean parasites. Although, improvements in marker detection systems particularly of elements of rDNA like 18S, ITS and 28S used in monogeneans parasites have enabled great advances to be made in recent years in India. However, the molecular sequence analysis and phylogenetic relationships among the parasitic helminthes is unconventional in India. Many workers have been always questioned the validity of Indian species of monogeneans and emphasized the need to ascertain the status of species from Indian fish. Here we would like to provide additional resolution for the interpretation of use of molecular markers in study of monogeneans in India. This review provides an overview of current stage of studies in India that have been used in applying molecular techniques to monogenean.

  3. Potential extra-ribosomal functions of ribosomal proteins in Saccharomyces cerevisiae.

    PubMed

    Lu, Hui; Zhu, Yi-Fei; Xiong, Juan; Wang, Rong; Jia, Zhengping

    2015-08-01

    Ribosomal proteins (RPs), are essential components of the ribosomes, the molecular machines that turn mRNA blueprints into proteins, as they serve to stabilize the structure of the rRNA, thus improving protein biosynthesis. In addition, growing evidence suggests that RPs can function in other cellular roles. In the present review, we summarize several potential extra-ribosomal functions of RPs in ribosomal biogenesis, transcription activity, translation process, DNA repair, replicative life span, adhesive growth, and morphological transformation in Saccharomyces cerevisiae. However, the future in-depth studies are needed to identify these novel secondary functions of RPs in S. cerevisiae.

  4. The Strepsiptera problem: phylogeny of the holometabolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology.

    PubMed

    Whiting, M F; Carpenter, J C; Wheeler, Q D; Wheeler, W C

    1997-03-01

    Phylogenetic relationships among the holometabolous insect orders were inferred from cladistic analysis of nucleotide sequences of 18S ribosomal DNA (rDNA) (85 exemplars) and 28S rDNA (52 exemplars) and morphological characters. Exemplar outgroup taxa were Collembola (1 sequence), Archaeognatha (1), Ephemerida (1), Odonata (2), Plecoptera (2), Blattodea (1), Mantodea (1), Dermaptera (1), Orthoptera (1), Phasmatodea (1), Embioptera (1), Psocoptera (1), Phthiraptera (1), Hemiptera (4), and Thysanoptera (1). Exemplar ingroup taxa were Coleoptera: Archostemata (1), Adephaga (2), and Polyphaga (7); Megaloptera (1); Raphidioptera (1); Neuroptera (sensu stricto = Planipennia): Mantispoidea (2), Hemerobioidea (2), and Myrmeleontoidea (2); Hymenoptera: Symphyta (4) and Apocrita (19); Trichoptera: Hydropsychoidea (1) and Limnephiloidea (2); Lepidoptera: Ditrysia (3); Siphonaptera: Pulicoidea (1) and Ceratophylloidea (2); Mecoptera: Meropeidae (1), Boreidae (1), Panorpidae (1), and Bittacidae (2); Diptera: Nematocera (1), Brachycera (2), and Cyclorrhapha (1); and Strepsiptera: Corioxenidae (1), Myrmecolacidae (1), Elenchidae (1), and Stylopidae (3). We analyzed approximately 1 kilobase of 18S rDNA, starting 398 nucleotides downstream of the 5' end, and approximately 400 bp of 28S rDNA in expansion segment D3. Multiple alignment of the 18S and 28S sequences resulted in 1,116 nucleotide positions with 24 insert regions and 398 positions with 14 insert regions, respectively. All Strepsiptera and Neuroptera have large insert regions in 18S and 28S. The secondary structure of 18S insert 23 is composed of long stems that are GC rich in the basal Strepsiptera and AT rich in the more derived Strepsiptera. A matrix of 176 morphological characters was analyzed for holometabolous orders. Incongruence length difference tests indicate that the 28S + morphological data sets are incongruent but that 28S + 18S, 18S + morphology, and 28S + 18S + morphology fail to reject the hypothesis of

  5. Molecular characterisation of three regions of the nuclear ribosomal DNA unit and the mitochondrial cox1 gene of Sarcocystis fusiformis from water buffaloes (Bubalus bubalis) in Egypt.

    PubMed

    Gjerde, Bjørn; Hilali, Mosaad; Mawgood, Sahar Abdel

    2015-09-01

    A total of 33 macroscopically visible (3-11 × 1-5 mm) sarcocysts of Sarcocystis fusiformis were excised from the oesophagus of 12 freshly slaughtered water buffalos in Giza, Egypt. Genomic DNA was extracted from the sarcocysts, and all isolates were characterised at the mitochondrial cytochrome c oxidase subunit I (cox1) gene through PCR amplification and direct sequencing, whereas a few selected isolates were characterised at the 18S and 28S ribosomal (r) RNA genes and the internal transcribed spacer 1 (ITS1) region of the nuclear rDNA unit following cloning. Among the 33 cox1 sequences (1,038-bp long), there was a total of 13 haplotypes, differing from each other by one to seven substitutions and sharing an identity of 99.3-99.9 %. In comparison, the sequence identity was 98.8-99.0 % among eight complete 18S rRNA gene sequences (1,873-1,879-bp long), 98.1-100 % among 28 complete ITS1 sequences (853-864-bp long) and 97.4-99.6 % among five partial 28S rRNA gene sequences (1,607-1,622 bp). At the three nuclear loci, the intraspecific (and intra-isolate) sequence variation was due to both substitutions and indels, which necessitated cloning of the PCR products before sequencing. Some additional clones of the 18S and 28S rRNA genes were highly divergent from the more typical clones, but the true nature of these aberrant clones could not be determined. Sequence comparisons and phylogenetic analyses based on either 18S rRNA gene or cox1 nucleotide sequences, placed S. fusiformis closest to Sarcocystis cafferi from the African buffalo, but only the analyses based on cox1 data separated the two taxa clearly from each other and showed that they were separate species (monophyletic clusters and 93 % sequence identity at cox1 versus interleaved sequences and 98.7-99.1 % sequence identity at the 18S rRNA gene). Two cats experimentally infected with sarcocysts of S. fusiformis started shedding small numbers of sporocysts 8-10 days post-infection (dpi) and were euthanized 15

  6. Short communication: Evaluation of the microbiota of kefir samples using metagenetic analysis targeting the 16S and 26S ribosomal DNA fragments.

    PubMed

    Korsak, N; Taminiau, B; Leclercq, M; Nezer, C; Crevecoeur, S; Ferauche, C; Detry, E; Delcenserie, V; Daube, G

    2015-06-01

    Milk kefir is produced by fermenting milk in the presence of kefir grains. This beverage has several benefits for human health. The aim of this experiment was to analyze 5 kefir grains (and their products) using a targeted metagenetic approach. Of the 5 kefir grains analyzed, 1 was purchased in a supermarket, 2 were provided by the Ministry of Agriculture (Namur, Belgium), and 2 were provided by individuals. The metagenetic approach targeted the V1-V3 fragment of the 16S ribosomal (r)DNA for the grains and the resulting beverages at 2 levels of grain incorporation (5 and 10%) to identify the bacterial species population. In contrast, the 26S rDNA pyrosequencing was performed only on kefir grains with the aim of assessing the yeast populations. In parallel, pH measurements were performed on the kefir obtained from the kefir grains using 2 incorporation rates. Regarding the bacterial population, 16S pyrosequencing revealed the presence of 20 main bacterial species, with a dominance of the following: Lactobacillus kefiranofaciens, Lactococcus lactis ssp. cremoris, Gluconobacter frateurii, Lactobacillus kefiri, Acetobacter orientalis, and Acetobacter lovaniensis. An important difference was noticed between the kefir samples: kefir grain purchased from a supermarket (sample E) harbored a much higher proportion of several operational taxonomic units of Lactococcus lactis and Leuconostoc mesenteroides. This sample of grain was macroscopically different from the others in terms of size, apparent cohesion of the grains, structure, and texture, probably associated with a lower level of Lactobacillus kefiranofaciens. The kefir (at an incorporation rate of 5%) produced from this sample of grain was characterized by a lower pH value (4.5) than the others. The other 4 samples of kefir (5%) had pH values above 5. Comparing the kefir grain and the kefir, an increase in the population of Gluconobacter in grain sample B was observed. This was also the case for Acetobacter orientalis

  7. [Study of the surface of Escherichia coli ribosomes and ribosomal particles by the tritium bombardment method].

    PubMed

    Iusupov, M M; Spirin, A S

    1986-11-01

    A new technique of atomic tritium bombardment has been used to study the surface topography of Escherichia coli ribosomes and ribosomal subunits. The technique provides for the labeling of proteins exposed on the surface of ribosomal particles, the extent of protein labeling being proportional to the degree of exposure. The following proteins were considerably tritiated in the 70S ribosomes: S1, S4, S7, S9 and/or S11, S12 and/or L20, S13, S18, S20, S21, L1, L5, L6, L7/L12, L10, L11, L16, L17, L24, L26 and L27. A conclusion is drawn that these proteins are exposed on the ribosome surface to an essentially greater extent than the others. Dissociation of 70S ribosomes into the ribosomal subunits by decreasing Mg2+ concentration does not lead to the exposure of additional ribosomal proteins. This implies that there are no proteins on the contacting surfaces of the subunits. However, if a mixture of subunits has been subjected to centrifugation in a low Mg2+ concentration at high concentrations of a monovalent cation, proteins S3, S5, S7, S14, S18 and L16 are more exposed on the surface of the isolated 30S and 50S subunits than in the subunit mixture or in the 70S ribosomes. The exposure of additional proteins is explained by distortion of the native quaternary structure of ribosomal subunits as a result of the separation procedure. Reassociation of isolated subunits at high Mg2+ concentration results in shielding of proteins S3, S5, S7 and S18 and can be explained by reconstitution of the intact 30S subunit structure. PMID:3542056

  8. Characterization of strains of Leuconostoc mesenteroides by analysis of soluble whole-cell protein pattern, DNA fingerprinting and restriction of ribosomal DNA.

    PubMed

    Villani, F; Moschetti, G; Blaiotta, G; Coppola, S

    1997-05-01

    Of 215 leuconostocs isolated from field grass, natural whey cultures and water-buffalo milk, 178 were identified as Leuconostoc mesenteroides ssp. mesenteroides while 37 strains could not be identified. Biochemical characterization allowed seven groups to be defined. Representative strains of each group and different habitat and nine reference strains were selected for further analyses. Protein profiles appeared suitable for species discrimination, but did not differentiate between the three subspecies of Leuc. mesenteroides. The technique also showed some differences among equivocal strains. DNA fingerprinting for most strains of Leuc. mesenteroides ssp. mesenteroides examined showed a different restriction pattern from that of the type strain. Ribotyping was not useful for discriminating species and subspecies of the genus Leuconostoc: Leuc. mesenteroides ssp. mesenteroides and ssp. dextranicum showed the same ribopattern as Leuc. lactis while Leuc. mesenteroides ssp. cremoris exhibited a pattern distinct from all the other species examined. On the basis of ARDRA-PCR, two main groups could be distinguished: the larger group included Leuc. mesenteroides, Leuc. lactis, Leuc. pseudomesenteroides and some unidentifiable strains; the second one included Leuc. citreum, Leuc. fallax, Weissella paramesenteroides and some unidentified strains.

  9. Microheterogeneity in 16S Ribosomal DNA-Defined Bacterial Populations from a Stratified Planktonic Environment Is Related to Temporal Changes and to Ecological Adaptations

    PubMed Central

    Casamayor, Emilio O.; Pedrós-Alió, Carlos; Muyzer, Gerard; Amann, Rudolf

    2002-01-01

    Temporal changes of the bacterioplankton from a meromictic lake (Lake Vilar, Banyoles, Spain) were analyzed with four culture-independent techniques: epifluorescence microscopy, PCR-denaturing gradient gel electrophoresis (DGGE) fingerprinting, fluorescence in situ whole-cell hybridization and flow cytometry sorting. Microscopically, blooms of one cyanobacterium (Synechococcus sp.-like), one green sulfur bacterium (Chlorobium phaeobacteroides-like), and one purple sulfur bacterium (Thiocystis minor-like) were observed at different depths and times. DGGE retrieved these populations and, additionally, populations related to the Cytophaga-Flavobacterium-Bacteroides phylum as predominant community members. The analyses of partial 16S ribosomal DNA sequences from the DGGE fingerprints (550 bp analyzed) revealed higher genetic diversity than expected from microscopic observation for most of these groups. Thus, the sequences of two Synechococcus spp. (both had a similarity of 97% to Synechococcus sp. strain PCC6307 in 16S rRNA), two Thiocystis spp. (similarities to Thiocystis minor of 93 and 94%, respectively), and three Cytophaga spp. (similarities to Cytophaga fermentans of 88 and 89% and to Cytophaga sp. of 93%, respectively) were obtained. The two populations of Synechococcus exhibited different pigment compositions and temporal distributions and their 16S rRNA sequences were 97.3% similar. The two Thiocystis populations differed neither in pigment composition nor in morphology, but their 16S rRNA sequences were only 92.3% similar and they also showed different distributions over time. Finally, two of the Cytophaga spp. showed 96.2% similarity between the 16S rRNA sequences, but one of them was found to be mostly attached to particles and only in winter. Thus, the identity of the main populations changed over time, but the function of the microbial guilds was maintained. Our data showed that temporal shifts in the identity of the predominant population is a new

  10. Ribosomal cistrons in higher plant cells. II. Sequence homology between the two mature rRNAs of sycamore cells and intracistronic reiteration. A DNA - rRNA hybridization study.

    PubMed

    Miassod, R; Cecchini, J P

    1976-01-01

    1. Uniformly labelled rRNA of sycamore cells has been annealed with homologous DNA. The fractions of DNA complementary to the 17S, or 26S, or 17S + 26S rRNAs are found to be 0.19%, 0.15% and 0.23%. They are not in the ratio of the molecular weight values (0.8, 1.2 and 2 - 10(6), respectively for the 17S, 26S and 17S + 26S rRNAs). This result is compatible with the large hybridization competition observed between the two rRNAs (53 and 72%) and with the shift-down of saturation curves when DNA is presaturated with unlabelled rRNA before the incubation with the other labelled rRNA. 2. Under the selected experimental procedure, the DNA - rRNA hybrids formed appear to be specific. Since there is an equal number of structural genes for the 17S and 26S rRNAs, these results mean the occurrence of a great sequence homology, strictly restricted to the two rRNAs. Homologous and specific sequences have been estimated to 0.1 and 0.7, or 0.85 and 0.35 million daltons, respectively in the 17S or 26S structural genes. 3. From the calculated lengths of homologous sequences, an intracistronic reiteration of some ribosomal sequences can be deduced. This internal reiteration is directly evidenced by the complex pattern of DNA - rRNA annealing curves. As demonstrated by base-composition analysis, the internal reiteration is heterogeneous and concerns both the homologous and specific sequences. In addition, the DNA saturation values allow the calculation of 4000 copies for the ribosomal cistron in the whole sycamore genome.

  11. [Comparative analysis of rDNA distribution in metaphase chromosomes of Cucurbitaceae species].

    PubMed

    Xu, Yan-Hao; Yang, Fei; Cheng, You-Lin; Ma, Lu; Wang, Jian-Bo; Li, Li-Jia

    2007-05-01

    Fluorescence in situ hybridization (FISH) and double FISH experiments were carried out to ascertain the chromosomal distribution patterns of the 45S and 5S ribosomal DNAs in the three species of Cucurbitaceae. Five pairs of 45S rDNA loci and two pairs of 5S rDNA signals were detected on chromosomes of Cucurbita moschata Duch. Luffa cylindrical Roem. contained five pairs of 45S rDNA loci and one pair of 5S rDNA loci. In Benincasa hispida Cogn., two pairs of 45S rDNA sites and one pair of 5S rDNA site were detected. In this species, 5S rDNA and one pair of the 45S loci were collocated closely in chromosome 7S. 45S rDNA chromosomal distribution patterns were highly conserved among the three species, althoufh their number varied markedly. The 5S rDNA sites on chromosomes among the three species were highly polymorphic. We further discussed differentially evolutionary processes of 45S and 5S rDNA in plant genomes.

  12. ESTIMATION OF BACTERIAL CELL NUMBERS IN HUMIC ACID-RICH SALT MARSH SEDIMENTS WITH PROBES DIRECTED TO 16S RIBOSOMAL DNA

    EPA Science Inventory

    The feasibility of using probes directed towards ribosomal DNAs (rDNAs) as a quantitative approach to estimating cell numbers was examined and applied to study the structure of a bacterial community in humic acid-rich salt marsh sediments. Hybridizations were performed with membr...

  13. [Ribosomal RNA Evolution

    NASA Technical Reports Server (NTRS)

    1997-01-01

    It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

  14. Phylogenetic study of Baylisascaris schroederi isolated from Qinling subspecies of giant panda in China based on combined nuclear 5.8S and the second internal transcribed spacer (ITS-2) ribosomal DNA sequences.

    PubMed

    Zhao, Guang-Hui; Li, Hong-Mei; Ryan, Una M; Cong, Mei-Mei; Hu, Bing; Gao, Man; Ren, Wan-Xin; Wang, Xing-Ye; Zhang, Shui-Ping; Lin, Qing; Zhu, Xing-Quan; Yu, San-Ke

    2012-09-01

    The nuclear ribosomal DNA (rDNA) region spanning 5.8S rDNA and the second internal transcribed spacer (ITS-2) of Baylisascaris schroederi isolated from the Qinling subspecies of giant panda in Shaanxi Province, China were amplified and sequenced. Sequence variations in the two rDNA regions within B. schroederi and among species in the family Ascarididae were examined. The lengths of B. schroederi 5.8S and ITS-2 rDNA sequences were 156 bp and 327 bp, respectively, and no nucleotide variation was found in these two rDNA regions among the 20 B. schroederi samples examined, and these ITS-2 sequences were identical to that of B. schroederi isolated from giant panda in Sichuan province, China. The inter-species differences in 5.8S and ITS-2 rDNA sequences among members of the family Ascarididae were 0-1.3% and 0-17.7%, respectively. Phylogenetic relationships among species in the Ascarididae were re-constructed by Bayesian inference (Bayes), maximum parsimony (MP), and maximum likelihood (ML) analyses, based on combined sequences of 5.8S and ITS-2 rDNA. All B. schroederi samples clustered together and sistered to B. transfuga with high posterior probabilities/bootstrap values, which further confirmed that nematodes isolated from the Qinling subspecies of giant panda in Shaanxi Province, China represent B. schroederi. Because of the large number of ambiguously aligned sequence positions (difficulty of inferring homology by positions), ITS-2 sequence alone is likely unsuitable for phylogenetic analyses at the family level, but the combined 5.8S and ITS-2 rDNA sequences provide alternative genetic markers for the identification of B. schroederi and for phylogenetic analysis of parasites in the family Ascarididae.

  15. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    SciTech Connect

    Lindstroem, Mikael S.

    2009-02-06

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-{kappa}B, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  16. The Ribosomal Database Project.

    PubMed Central

    Maidak, B L; Larsen, N; McCaughey, M J; Overbeek, R; Olsen, G J; Fogel, K; Blandy, J; Woese, C R

    1994-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services, and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server/rdp.life.uiuc.edu) and gopher (rdpgopher.life.uiuc.edu). The electronic mail server also provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for chimeric nature of newly sequenced rRNAs, and automated alignment. PMID:7524021

  17. Comparative cytogenetics of giant trahiras Hoplias aimara and H. intermedius (Characiformes, Erythrinidae): chromosomal characteristics of minor and major ribosomal DNA and cross-species repetitive centromeric sequences mapping differ among morphologically identical karyotypes.

    PubMed

    Blanco, D R; Lui, R L; Vicari, M R; Bertollo, L A C; Moreira-Filho, O

    2011-01-01

    Karyotype and cytogenetic characteristics of 2 species of giant trahiras, Hopliasintermedius, São Francisco river basin, and Hopliasaimara, Arinos river (Amazon basin), were examined by conventional (C-banding, Ag-NOR, DAPI/CMA(3) double-staining) and fluorescent in situ hybridization (FISH) with 5S, 18S rDNA probes and cross-species Cot-1 DNA probing. Both species invariably had diploid chromosome number 2n = 50 and identical karyotypes composed of 10 pairs of metacentric and 15 pairs of submetacentric chromosomes. On the other hand, staining with base-specific fluorochromes (CMA(3), DAPI) and FISH mapping of repetitive DNA sequences showed extensive interspecific differences: while the genome of H. aimara had one submetacentric pair bearing CMA(3)-positive (DAPI-negative) sites, that of H. intermedius had 4 such pairs; while FISH with a 5S rDNA probe showed one (likely homologous) signal-bearing pair, that with 18S rDNA displayed one signal-bearing pair in H. intermedius and 2 such pairs in H. aimara. Cross-species FISH probing with Cot-1 DNA prepared from total DNA of both species showed no signals of Cot-1 DNA from H. aimara on chromosomes of H. intermedius but reciprocally (Cot-1 DNA from H. intermedius on chromosomes of H. aimara) displayed signals on at least 4 chromosome pairs. Present findings indicate (i) different composition of repetitive sequences around centromeres, (ii) different NOR phenotypes and (iii) distinct taxonomic status of both giant trahira species. PMID:20924165

  18. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

    2001-01-01

    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  19. Chromosome mapping of ribosomal genes and histone H4 in the genus Radacridium (Romaleidae)

    PubMed Central

    Anjos, Allison; Loreto, Vilma; de Souza, Maria José

    2013-01-01

    In this study, two species of Romaleidae grasshoppers, Radacridium mariajoseae and R.nordestinum, were analyzed after CMA3/DA/DAPI sequential staining and fluorescence in situ hybridization (FISH) to determine the location of the 18S and 5S rDNA and histone H4 genes. Both species presented karyotypes composed of 2n = 23, X0 with exclusively acrocentric chromosomes. CMA3+ blocks were detected after CMA3/DA/DAPI staining in only one medium size autosome bivalent and in the X chromosome in R. mariajoseae. On the other hand, all chromosomes, except the L1 bivalent, of R. nordestinum presented CMA3+ blocks. FISH analysis showed that the 18S genes are restricted to the X chromosome in R. mariajoseae, whereas these genes were located in the L2, S9 and S10 autosomes in R. nordestinum. In R. mariajoseae, the 5S rDNA sites were localized in the in L1 and L2 bivalents and in the X chromosome. In R. nordestinum, the 5S genes were located in the L2, L3, M4 and M5 pairs. In both species the histone H4 genes were present in a medium size bivalent. Together, these data evidence a great variability of chromosome markers and show that the 18S and 5S ribosomal genes are dispersed in the Radacridium genome without a significant correlation. PMID:24130439

  20. Intragenomic sequence variation at the ITS1 - ITS2 region and at the 18S and 28S nuclear ribosomal DNA genes of the New Zealand mud snail, Potamopyrgus antipodarum (Hydrobiidae: mollusca)

    USGS Publications Warehouse

    Hoy, Marshal S.; Rodriguez, Rusty J.

    2013-01-01

    Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.                   

  1. The Ribosomal Database Project

    NASA Technical Reports Server (NTRS)

    Olsen, G. J.; Overbeek, R.; Larsen, N.; Marsh, T. L.; McCaughey, M. J.; Maciukenas, M. A.; Kuan, W. M.; Macke, T. J.; Xing, Y.; Woese, C. R.

    1992-01-01

    The Ribosomal Database Project (RDP) complies ribosomal sequences and related data, and redistributes them in aligned and phylogenetically ordered form to its user community. It also offers various software packages for handling, analyzing and displaying sequences. In addition, the RDP offers (or will offer) certain analytic services. At present the project is in an intermediate stage of development.

  2. Compact structure of ribosomal chromatin in Xenopus laevis.

    PubMed Central

    Spadafora, C; Crippa, M

    1984-01-01

    Micrococcal nuclease digestion was used as a tool to study the organization of the ribosomal chromatin in liver, blood and embryo cells of X. laevis. It was found that in liver and blood cells, ribosomal DNA is efficiently protected from nuclease attack in comparison to bulk chromatin. Although ribosomal chromatin is fragmented in a typical nucleosomal pattern, a considerable portion of ribosomal DNA retains a high molecular weight even after extensive digestion. A greater accessibility of the coding region in comparison to the non-coding spacer was found. In embryos, when ribosomal DNA is fully transcribed, these genes are even more highly protected than in adult tissues: in fact, the nucleosomal ladder can hardly be detected and rDNA is preserved in high molecular weight. Treatment of chromatin with 0.8 M NaCl abolishes the specific resistance of the ribosomal chromatin to digestion. The ribosomal chromatin, particularly in its active state, seems to be therefore tightly complexed with chromosomal proteins which protect its DNA from nuclease degradation. Images PMID:6709502

  3. Transcription and processing of ribosomal RNAs from maize mitochondria

    SciTech Connect

    Maloney, A.P.

    1986-01-01

    In order to gain insight into the expression of genes in higher plant mitochondria, the transcription of the three ribosomal-RNA genes of the maize mitochondria was investigated. The 5' and 3' ends of the 5S and 18S rRNAs, whose genes are 113 bp apart on the mitochondrial DNA, were defined using S/sub 1/ analysis. S/sub 1/ analysis and extensive hybridizational experiments demonstrated that the 18S and 5 S share several large transcripts. Nearly all of these rare cotranscripts include flanking sequence from both ends of the 18S + 5S complex. A model is proposed for the processing of the large transcripts into the mature rRNAs. Transcription of 26S rRNA was shown to occur from the strand opposite the transcribed strand of the 18S and 5S genes. Northern and S/sub 1/ nuclease analysis demonstrated the existence of 2 precursors of 26S rRNA. All the mature and precursor RNAs identified by S/sub 1/ analysis begin primarily with A residues, and exhibit 5' terminal heterogeneity of several nucleotides; all but one possess the sequence AAUC in their first few 5' nucleotides. Mitochondrial RNA, treated either with (alpha-/sup 32/P)GTP and guanylyl transferase to construct a radioactive methylated-GTP cap at the 5' ends of unprocessed RNAs, or with polynucleotide kinase and (gamma-/sup 32/P)ATP to label the 5' ends of processed RNAs, was hybridized to different fragments of mitochondrial genes. These experiments showed that the mature and precursor rRNAs detected in S/sub 1/ analysis are processed, not primary transcripts, suggesting that the 5' end similarity of all these RNAs is functionally significant in recognition of processing sites in vivo.

  4. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  5. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    PubMed

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level.

  6. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  7. DNA sequence analysis of a 10 624 bp fragment of the left arm of chromosome XV from Saccharomyces cerevisiae reveals a RNA binding protein, a mitochondrial protein, two ribosomal proteins and two new open reading frames.

    PubMed

    Lafuente, M J; Gamo, F J; Gancedo, C

    1996-09-01

    We have determined the sequence of a 10624 bp DNA segment located in the left arm of chromosome XV of Saccharomyces cerevisiae. The sequence contains eight open reading frames (ORFs) longer than 100 amino acids. Two of them do not present significant homology with sequences found in the databases. The product of ORF o0553 is identical to the protein encoded by the gene SMF1. Internal to it there is another ORF, o0555 that is apparently expressed. The proteins encoded by ORFs o0559 and o0565 are identical to ribosomal proteins S19.e and L18 respectively. ORF o0550 encodes a protein with an RNA binding signature including RNP motifs and stretches rich in asparagine, glutamine and arginine.

  8. Structural variation of the ribosomal gene cluster within the class Insecta

    SciTech Connect

    Mukha, D.V.; Sidorenko, A.P.; Lazebnaya, I.V.

    1995-09-01

    General estimation of ribosomal DNA variation within the class Insecta is presented. It is shown that, using blot-hybridization, one can detect differences in the structure of the ribosomal gene cluster not only between genera within an order, but also between species within a genera, including sibling species. Structure of the ribosomal gene cluster of the Coccinellidae family (ladybirds) is analyzed. It is shown that cloned highly conservative regions of ribosomal DNA of Tetrahymena pyriformis can be used as probes for analyzing ribosomal genes in insects. 24 refs., 4 figs.

  9. The ribosomal subunit assembly line

    PubMed Central

    Dlakić, Mensur

    2005-01-01

    Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363

  10. Monoterpene synthases from grand fir (Abies grandis). cDNA isolation, characterization, and functional expression of myrcene synthase, (-)-(4S)-limonene synthase, and (-)-(1S,5S)-pinene synthase.

    PubMed

    Bohlmann, J; Steele, C L; Croteau, R

    1997-08-29

    Grand fir (Abies grandis) has been developed as a model system for studying defensive oleoresin formation in conifers in response to insect attack or other injury. The turpentine fraction of the oleoresin is a complex mixture of monoterpene (C10) olefins in which (-)-limonene and (-)-alpha- and (-)-beta-pinene are prominent components; (-)-limonene and (-)-pinene synthase activities are also induced upon stem wounding. A similarity based cloning strategy yielded three new cDNA species from a wounded stem cDNA library that appeared to encode three distinct monoterpene synthases. After expression in Escherichia coli and enzyme assay with geranyl diphosphate as substrate, subsequent analysis of the terpene products by chiral phase gas chromatography and mass spectrometry showed that these sequences encoded a (-)-limonene synthase, a myrcene synthase, and a (-)-pinene synthase that produces both alpha-pinene and beta-pinene. In properties and reaction stereochemistry, the recombinant enzymes resemble the corresponding native monoterpene synthases of wound-induced grand fir stem. The deduced amino acid sequences indicated the limonene synthase to be 637 residues in length (73.5 kDa), the myrcene synthase to be 627 residues in length (72.5 kDa), and the pinene synthase to be 628 residues in length (71.5 kDa); all of these monoterpene synthases appear to be translated as preproteins bearing an amino-terminal plastid targeting sequence. Sequence comparison revealed that these monoterpene synthases from grand fir resemble sesquiterpene (C15) synthases and diterpene (C20) synthases from conifers more closely than other monoterpene synthases from angiosperm species. This similarity between extant monoterpene, sesquiterpene, and diterpene synthases of gymnosperms is surprising since functional diversification of this enzyme class is assumed to have occurred over 300 million years ago. Wound-induced accumulation of transcripts for monoterpene synthases was demonstrated by RNA

  11. Unusual dispersion of histone repeats on the whole chromosomal complement and their colocalization with ribosomal genes in Rachycentron canadum (Rachycentridae, Perciformes).

    PubMed

    Costa, Gideão W W F; Cioffi, Marcelo B; Bertollo, Luiz A C; Molina, Wagner F

    2014-01-01

    Rachycentron canadum, the only representative of the family Rachycentridae, has been the focus of biotechnological interest due to its significant potential in marine fish farming. The chromosome set of this species has been widely investigated with respect to the location of genes and multigene families. A FISH analysis was performed using 4 multigene families as probes, represented by 5S and 18S ribosomal genes and histones H2B-H2A and H3. Earlier data suggested that differential replication of heterochromatin could be partially associated with functional genes. Indeed, our results showed that the DNA contained in heterochromatic regions of R. canadum contains 5S and 18S ribosomal genes as well as the gene sequences of histones H2B-H2A and H3, which were colocalized. The distribution of H3 sequences in all heterochromatic regions, except in 13q, could indicate an important evolutionary role for this class of repetitive sequences. Besides, the presence of chromosome regions bearing multifunctional repetitive sequences formed by H2B-H2A/H3/18S rDNA and H2B-H2A/H3/5S rDNA clusters was demonstrated for the first time in fishes. The implications of differential histone gene extension and its functionality in the karyotype of R. canadum remain unknown. PMID:25341625

  12. Structural and functional exchangeability of 5 S RNA species from the eubacterium E.coli and the thermoacidophilic archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Teixidò, J; Altamura, S; Londei, P; Amils, R

    1989-01-01

    The role of 5 S RNA within the large ribosomal subunit of the extremely thermophilic archaebacterium Sulfolobus solfataricus has been analysed by means of in vitro reconstitution procedures. It is shown that Sulfolobus 50 S subunits reconstituted in the absence of 5 S RNA are inactive in protein synthesis and lack 2-3 ribosomal proteins. Furthermore, it has been determined that in the course of the in vitro assembly process Sulfolobus 5 S RNA can be replaced by the correspondent RNA species of E.coli; Sulfolobus reconstituted particles containing the eubacterial 5 S molecule are stable and active in polypeptide synthesis at high temperatures. Images PMID:2493632

  13. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).

    PubMed

    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F

    2014-11-14

    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera.

  14. Paradigms of ribosome synthesis: Lessons learned from ribosomal proteins

    PubMed Central

    Gamalinda, Michael; Woolford, John L

    2015-01-01

    The proteome in all cells is manufactured via the intricate process of translation by multimolecular factories called ribosomes. Nevertheless, these ribonucleoprotein particles, the largest of their kind, also have an elaborate assembly line of their own. Groundbreaking discoveries that bacterial ribosomal subunits can be self-assembled in vitro jumpstarted studies on how ribosomes are constructed. Until recently, ribosome assembly has been investigated almost entirely in vitro with bacterial small subunits under equilibrium conditions. In light of high-resolution ribosome structures and a more sophisticated toolkit, the past decade has been defined by a burst of kinetic studies in vitro and, importantly, also a shift to examining ribosome maturation in living cells, especially in eukaryotes. In this review, we summarize the principles governing ribosome assembly that emerged from studies focusing on ribosomal proteins and their interactions with rRNA. Understanding these paradigms has taken center stage, given the linkage between anomalous ribosome biogenesis and proliferative disorders. PMID:26779413

  15. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  16. Functional domains of the Xenopus laevis 5S gene promoter.

    PubMed Central

    Pieler, T; Oei, S L; Hamm, J; Engelke, U; Erdmann, V A

    1985-01-01

    To study the fine structure of the Xenopus laevis somatic 5S gene internal control region, we have created 15 different transversions using mutagenic oligonucleotide primers. The effects of these mutations on 5S DNA transcription in vitro as well as on stable complex formation with transcription factor TF III A and TF III C in crude nuclear extracts were analyzed. Mutations in the common class III 5' promoter element (nucleotides 50-61 in the 5S gene) interfere with transcription activity and stable complex formation whenever they contradict the tDNA box A consensus sequence. The second promoter element is defined by a major sequence block (nucleotides 80-89, box C) and two additional internal residues (70 and 71) at a distance of roughly one helical turn from both the major 3' and 5' control sequences; these two 3' elements contain the primary TF III A binding domain. The remaining nucleotides (62-69 and 71-79) when mutated do not interfere with transcription activity or factor binding and thus they constitute two spacer elements within a symmetrically structured 5S gene promoter. An increase in the relative spacing of box A and box C by insertion of 3 bp between nucleotides 66 and 67 leads to a drastic reduction in transcription activity and the ability to form a stable complex with TF III A and/or TF III C. Thus, accurate spacing is essential for the proper orientation of TF III A on 5S DNA and/or TF III C binding. Images Fig. 1. Fig. 3. Fig. 4. PMID:3004969

  17. Small subunit ribosomal RNA gene sequence of Minchinia teredinis (Haplosporidia: Haplosporidiidae) and a specific DNA probe and PCR primers for its detection.

    PubMed

    Stokes, N A; Siddall, M E; Burreson, E M

    1995-05-01

    Minchinia teredinis is a pathogen of wood-boring molluscs (shipworms), Teredo spp., along the middle Atlantic coast of the U.S. Genomic DNA was extracted from M. teredinis spores and small subunit (SSU) rDNA was amplified by PCR, cloned, and sequenced. The sequence of M. teredinis SSU rDNA was aligned with that of Haplosporidium nelsoni and various protists in GenBank. A 22-base oligonucleotide probe unique to M. teredinis, designated MIN702, was commercially synthesized and tested for sensitivity and specificity. In dot-blot hybridizations the probe detected 500 pg of cloned M. teredinis rDNA. The probe did not hybridize with cloned SSU rDNA of Teredo spp. or H. nelsoni. The probe was further tested for specificity with in situ hybridizations on AFA-fixed, paraffin-embedded tissue sections. The probe hybridized well with M. teredinis plasmodia and immature spores, but poorly with mature spores. The probe did not hybridize with shipworm tissue or with the haplosporidians Haplosporidium louisiana from mud crabs (Panopeus spp.) or H. nelsoni and H. costale from Crassostrea virginica. The probe and a second 18-base oligonucleotide, when used as PCR primers, amplified a 536-bp fragment of the M. teredinis SSU rRNA gene. The PCR assay was able to detect 10 fg of the cloned gene and also detected the presence of M. teredinis DNA in shipworms in which infections were observed microscopically. The 536-bp amplification product was not obtained in one Teredo sp. or in one Bankia gouldi, both categorized as uninfected after microscopic inspection. The DNA probe and PCR primers appear to be specific for M. teredinis and should be useful as diagnostic tools and for life cycle investigations.

  18. Diversity of Salmonella Strains Isolated from the Aquatic Environment as Determined by Serotyping and Amplification of the Ribosomal DNA Spacer Regions

    PubMed Central

    Baudart, Julia; Lemarchand, Karine; Brisabois, Anne; Lebaron, Philippe

    2000-01-01

    Salmonella species are pathogenic bacteria often detected in sewage, freshwater, marine coastal water, and groundwater. Salmonella spp. can survive for long periods in natural waters, and the persistence of specific and epidemic strains is of great concern in public health. However, the diversity of species found in the natural environment remains unknown. The aim of this study was to investigate the diversity of Salmonella strains isolated from different natural aquatic systems within a Mediterranean coastal watershed (river, wastewater, and marine coastal areas). A total of 574 strains isolated from these natural environments were identified by both conventional serotyping and the ribosomal spacer-heteroduplex polymorphism (RS-HP) method (M. A. Jensen and N. Straus, PCR Methods Appl. 3:186–194, 1993). More than 40 different serotypes were found, and some serotypes probably mobilized from widespread animal-rearing activities were detected only during storm events. These serotypes may be good indicators of specific contamination sources. Furthermore, the RS-HP method based on the PCR amplification of the intergenic spacer region between the 16S and 23S rRNA genes can produce amplicon profiles allowing the discrimination of species at both serotype and intraserotype levels. This method represents a powerful tool that could be used for rapid typing of Salmonella isolates. PMID:10742240

  19. Mitochondrial and nuclear ribosomal DNA evidence supports the existence of a new Trichuris species in the endangered françois' leaf-monkey.

    PubMed

    Liu, Guo-Hua; Gasser, Robin B; Nejsum, Peter; Wang, Yan; Chen, Qiang; Song, Hui-Qun; Zhu, Xing-Quan

    2013-01-01

    The whipworm of humans, Trichuris trichiura, is responsible for a neglected tropical disease (NTD) of major importance in tropical and subtropical countries of the world. Whipworms also infect animal hosts, including pigs, dogs and non-human primates, cause clinical disease (trichuriasis) similar to that of humans. Although Trichuris species are usually considered to be host specific, it is not clear whether non-human primates are infected with T. trichiura or other species. In the present study, we sequenced the complete mitochondrial (mt) genome as well as the first and second internal transcribed spacers (ITS-1 and ITS-2) of Trichuris from the François' leaf-monkey (langur), and compared them with homologous sequences from human- and pig-derived Trichuris. In addition, sequence comparison of a conserved mt ribosomal gene among multiple individual whipworms revealed substantial nucleotide differences among these three host species but limited sequence variation within each of them. The molecular data indicate that the monkey-derived whipworm is a separate species from that of humans. Future work should focus on detailed population genetic and morphological studies (by electron microscopy) of whipworms from various non-humans primates and humans.

  20. Diversity of Salmonella strains isolated from the aquatic environment as determined by serotyping and amplification of the ribosomal DNA spacer regions.

    PubMed

    Baudart, J; Lemarchand, K; Brisabois, A; Lebaron, P

    2000-04-01

    Salmonella species are pathogenic bacteria often detected in sewage, freshwater, marine coastal water, and groundwater. Salmonella spp. can survive for long periods in natural waters, and the persistence of specific and epidemic strains is of great concern in public health. However, the diversity of species found in the natural environment remains unknown. The aim of this study was to investigate the diversity of Salmonella strains isolated from different natural aquatic systems within a Mediterranean coastal watershed (river, wastewater, and marine coastal areas). A total of 574 strains isolated from these natural environments were identified by both conventional serotyping and the ribosomal spacer-heteroduplex polymorphism (RS-HP) method (M. A. Jensen and N. Straus, PCR Methods Appl. 3:186-194, 1993). More than 40 different serotypes were found, and some serotypes probably mobilized from widespread animal-rearing activities were detected only during storm events. These serotypes may be good indicators of specific contamination sources. Furthermore, the RS-HP method based on the PCR amplification of the intergenic spacer region between the 16S and 23S rRNA genes can produce amplicon profiles allowing the discrimination of species at both serotype and intraserotype levels. This method represents a powerful tool that could be used for rapid typing of Salmonella isolates.

  1. Molecular phylogeny of acantharian and polycystine radiolarians based on ribosomal DNA sequences, and some comparisons with data from the fossil record.

    PubMed

    Kunitomo, Yoshiki; Sarashina, Isao; Iijima, Minoru; Endo, Kazuyoshi; Sashida, Katsuo

    2006-07-01

    Polycystines (spumellarians, nassellarians, and collodarians), phaeodarians, and acantharians are marine planktonic protists that have been conventionally and collectively called "radiolaria". Recent molecular phylogenetic studies revealed radiolarian polyphyly with phaeodarians being a separate offshoot. Collodarians and nassellarians are also shown to form a monophyletic group, but other aspects of radiolarian phylogeny, such as interrelations among polycystines and acantharians, remained uncertain. Here, we present molecular phylogenetic analyses including new ribosomal RNA sequences from ten spumellarians and nine nassellarians, based on Bayesian and maximum-likelihood methods. Results indicate that the Polycystinea is a paraphyletic group, with Bayesian analysis suggesting that spumellarians form a clade with acantharians. The heliozoan-like protist Sticholonche appears as a sister to the spumellarian clade. The nassellarian Eucyrtidium is located outside the clade including the other nassellarians and collodarians. The mineralogy of the test of extant radiolarians and the tree topology obtained in this work suggest that acantharians and spumellarians evolved from an ancestor with a siliceous skeleton. Collodarians and nassellarians form a well-supported clade and one might infer from the fossil record that they may have diverged between the Jurassic and the Eocene.

  2. Fungal community analysis in the deep-sea sediments of the Pacific Ocean assessed by comparison of ITS, 18S and 28S ribosomal DNA regions

    NASA Astrophysics Data System (ADS)

    Xu, Wei; Luo, Zhu-Hua; Guo, Shuangshuang; Pang, Ka-Lai

    2016-03-01

    We investigated the diversity of fungal communities in 6 different deep-sea sediment samples of the Pacific Ocean based on three different types of clone libraries, including internal transcribed spacer (ITS), 18S rDNA, and 28S rDNA regions. A total of 1978 clones were generated from 18 environmental clone libraries, resulting in 140 fungal operational taxonomic units (OTUs), including 18 OTUs from ITS, 44 OTUs from 18S rDNA, and 78 OTUs from 28S rDNA gene primer sets. The majority of the recovered sequences belonged to diverse phylotypes of the Ascomycota and Basidiomycota. Additionally, our study revealed a total of 46 novel fungal phylotypes, which showed low similarities (<97%) with available fungal sequences in the GenBank, including a novel Zygomycete lineage, suggesting possible new fungal taxa occurring in the deep-sea sediments. The results suggested that 28S rDNA is an efficient target gene to describe fungal community in deep-sea environment.

  3. Characterization of Dicrocoelium dendriticum isolates from small ruminants in Shaanxi Province, north-western China, using internal transcribed spacers of nuclear ribosomal DNA.

    PubMed

    Bian, Q Q; Zhao, G H; Jia, Y Q; Fang, Y Q; Cheng, W Y; Du, S Z; Ma, X T; Lin, Q

    2015-01-01

    The genetic variations in internal transcribed spacers (ITS) spanning ITS-1, 5.8S and ITS-2 rDNA of Dicrocoelium dendriticum, isolated from sheep and goats in four geographical regions in Shaanxi province, were examined. The lengths of ITS-1, 5.8S and ITS-2 rDNA sequences for D. dendriticum were 749 bp, 161 bp and 234 bp, respectively. Intra-specific sequence variations of D. dendriticum were 0-0.5% for ITS-1 and 0-1.3% for ITS-2 rDNA, while the inter-specific variations among species in genus Dicrocoelium in ITS-2 rDNA were 3.4-12.3%. Phylogenetic analysis based on sequences of ITS-2 rDNA showed that all D. dendriticum isolates in the present study were grouped with reference D. dendriticum isolates from sheep and goats, and D. dendriticum isolates from cattle and Japanese serow were clustered in a sister clade. However, the phylogenetic tree could not reveal geographically genetic relationships of D. dendriticum isolates in different origins and hosts. These findings provided basic information for further study of molecular epidemiology and control of D. dendriticum infection in Shaanxi province as well as in the world.

  4. Patterns and regulation of ribosomal RNA transcription in Borrelia burgdorferi

    PubMed Central

    2011-01-01

    Background Borrelia burgdorferi contains one 16S and two tandem sets of 23S-5S ribosomal (r) RNA genes whose patterns of transcription and regulation are unknown but are likely to be critical for survival and persistence in its hosts. Results RT-PCR of B. burgdorferi N40 and B31 revealed three rRNA region transcripts: 16S rRNA-alanine transfer RNA (tRNAAla); tRNAIle; and both sets of 23S-5S rRNA. At 34°C, there were no differences in growth rate or in accumulation of total protein, DNA and RNA in B31 cultured in Barbour-Stoenner-Kelly (BSK)-H whether rabbit serum was present or not. At 23°C, B31 grew more slowly in serum-containing BSK-H than at 34°C. DNA per cell was higher in cells in exponential as compared to stationary phase at either temperature; protein per cell was similar at both temperatures in both phases. Similar amounts of rRNA were produced in exponential phase at both temperatures, and rRNA was down-regulated in stationary phase at either temperature. Interestingly, a relBbu deletion mutant unable to generate (p)ppGpp did not down-regulate rRNA at transition to stationary phase in serum-containing BSK-H at 34°C, similar to the relaxed phenotype of E. coli relA mutants. Conclusions We conclude that rRNA transcription in B. burgdorferi is complex and regulated both by growth phase and by the stringent response but not by temperature-modulated growth rate. PMID:21251259

  5. Ribosomal DNA identification of Nosema/Vairimorpha in freshwater polychaete, Manayunkia speciosa, from Oregon/California and the Laurentian Great Lakes

    USGS Publications Warehouse

    Malakauskas, David M.; Altman, Emory C.; Malakauskas, Sarah J.; Thiem, Suzanne M.; Schloesser, Donald W.

    2015-01-01

    We examined Manayunkia speciosa individuals from the Klamath River, Oregon/California and Lake Erie, Michigan, USA for the presence of Microsporidia. We identified microsporidian spores and sequenced their SSU, ITS, and part of the LSU rDNA. Phylogenetic analysis of SSU rDNA indicated spores from both populations belonged to the Nosema/Vairimorpha clade. PCR showed an infection prevalence in Lake Erie M. speciosa of 0.6% (95% CI = 0.5%, 0.7%). This represents the first known example of molecularly characterized Nosema/Vairimorpha isolates infecting a non-arthropod host.

  6. Purification of 70S ribosomes.

    PubMed

    Rivera, Maria C; Maguire, Bruce; Lake, James A

    2015-03-01

    Here we describe the further purification of prokaryotic ribosomal particles obtained after the centrifugation of a crude cell lysate through a sucrose cushion. In this final purification step, a fraction containing ribosomes, ribosomal subunits, and polysomes is centrifuged through a 7%-30% (w/w) linear sucrose gradient to isolate tight couple 70S ribosomes, as well as dissociated 30S and 50S subunits. The tight couples fraction, or translationally active ribosome fraction, is composed of intact vacant ribosomes that can be used in cell-free translation systems.

  7. The small subunit of the mammalian mitochondrial ribosome. Identification of the full complement of ribosomal proteins present.

    PubMed

    Cavdar Koc, E; Burkhart, W; Blackburn, K; Moseley, A; Spremulli, L L

    2001-06-01

    Identification of all the protein components of the small subunit (28 S) of the mammalian mitochondrial ribosome has been achieved by carrying out proteolytic digestions of whole 28 S subunits followed by analysis of the resultant peptides by liquid chromatography and tandem mass spectrometry (LC/MS/MS). Peptide sequence information was used to search the human EST data bases and complete coding sequences of the proteins were assembled. The human mitochondrial ribosome has 29 distinct proteins in the small subunit. Fourteen of this group of proteins are homologs of the Escherichia coli 30 S ribosomal proteins S2, S5, S6, S7, S9, S10, S11, S12, S14, S15, S16, S17, S18, and S21. All of these proteins have homologs in Drosophila melanogaster, Caenorhabditis elegans, and Saccharomyces cerevisiae mitochondrial ribosomes. Surprisingly, three variants of ribosomal protein S18 are found in the mammalian and D. melanogaster mitochondrial ribosomes while C. elegans has two S18 homologs. The S18 homologs tend to be more closely related to chloroplast S18s than to prokaryotic S18s. No mitochondrial homologs to prokaryotic ribosomal proteins S1, S3, S4, S8, S13, S19, and S20 could be found in the peptides obtained from the whole 28 S subunit digests or by analysis of the available data bases. The remaining 15 proteins present in mammalian mitochondrial 28 S subunits (MRP-S22 through MRP-S36) are specific to mitochondrial ribosomes. Proteins in this group have no apparent homologs in bacterial, chloroplast, archaebacterial, or cytosolic ribosomes. All but two of these proteins have a clear homolog in D. melanogaster while all but three can be found in the genome of C. elegans. Five of the mitochondrial specific ribosomal proteins have homologs in S. cerevisiae.

  8. Crystallography of ribosomal particles

    NASA Astrophysics Data System (ADS)

    Yonath, A.; Frolow, F.; Shoham, M.; Müssig, J.; Makowski, I.; Glotz, C.; Jahn, W.; Weinstein, S.; Wittmann, H. G.

    1988-07-01

    Several forms of three-dimensional crystals and two-dimensional sheets of intact ribosomes and their subunits have been obtained as a result of: (a) an extensive systematic investigation of the parameters involved in crystallization, (b) a development of an experimental procedure for controlling the volumes of the crystallization droplets, (c) a study of the nucleation process, and (d) introducing a delicate seeding procedure coupled with variations in the ratios of mono- and divalent ions in the crystallization medium. In all cases only biologically active particles could be crystallized, and the crystalline material retains its integrity and activity. Crystallographic data have been collected from crystals of 50S ribosomal subunits, using synchrotron radiation at temperatures between + 19 and - 180°C. Although at 4°C the higher resolution reflections decay within minutes in the synchrotron beam, at cryo-temperature there was hardly any radiation damage, and a complete set of data to about 6Åresolution could be collected from a single crystal. Heavy-atom clusters were used for soaking as well as for specific binding to the surface of the ribosomal subunits prior to crystallization. The 50S ribosomal subunits from a mutant of B. stearothermophilus which lacks the ribosomal protein BL11 crystallize isomorphously with in the native ones. Models, aimed to be used for low resolution phasing, have been reconstructed from two-dimensional sheets of 70S ribosomes and 50S subunits at 47 and 30Å, respectively. These models show the overall structure of these particles, the contact areas between the large and small subunits, the space where protein synthesis might take place and a tunnel which may provide the path for the nascent protein chain.

  9. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  10. Characterization of primary biogenic aerosol particles in urban, rural, and high-alpine air by DNA sequence and restriction fragment analysis of ribosomal RNA genes

    NASA Astrophysics Data System (ADS)

    Després, V. R.; Nowoisky, J. F.; Klose, M.; Conrad, R.; Andreae, M. O.; Pöschl, U.

    2007-12-01

    This study explores the applicability of DNA analyses for the characterization of primary biogenic aerosol (PBA) particles in the atmosphere. Samples of fine particulate matter (PM2.5) and total suspended particulates (TSP) have been collected on different types of filter materials at urban, rural, and high-alpine locations along an altitude transect in the south of Germany (Munich, Hohenpeissenberg, Mt. Zugspitze). From filter segments loaded with about one milligram of air particulate matter, DNA could be extracted and DNA sequences could be determined for bacteria, fungi, plants and animals. Sequence analyses were used to determine the identity of biological organisms, and terminal restriction fragment length polymorphism analyses (T-RFLP) were applied to estimate diversities and relative abundances of bacteria. Investigations of blank and background samples showed that filter materials have to be decontaminated prior to use, and that the sampling and handling procedures have to be carefully controlled to avoid artifacts in the analyses. Mass fractions of DNA in PM2.5 were found to be around 0.05% in urban, rural, and high-alpine aerosols. The average concentration of DNA determined for urban air was on the order of ~7 ng m-3, indicating that human adults may inhale about one microgram of DNA per day (corresponding to ~108 haploid bacterial genomes or ~105 haploid human genomes, respectively). Most of the bacterial sequences found in PM2.5 were from Proteobacteria (42) and some from Actinobacteria (10) and Firmicutes (1). The fungal sequences were characteristic for Ascomycota (3) and Basidiomycota (1), which are known to actively discharge spores into the atmosphere. The plant sequences could be attributed to green plants (2) and moss spores (2), while animal DNA was found only for one unicellular eukaryote (protist). Over 80% of the 53 bacterial sequences could be matched to one of the 19 T-RF peaks found in the PM2.5 samples, but only 40% of the T-RF peaks

  11. Molecular characterization of Gastrothylax crumenifer (Platyhelminthes: Gastrothylacidae) from goats in the western part of India by LSU of nuclear ribosomal DNA.

    PubMed

    Kumar, Ashwani; Chaudhary, Anshu; Verma, Chandni; Singh, Hridaya Shanker

    2014-12-01

    The rumen parasite, Gastrothylax crumenifer (Platyhelminthes: Gastrothylacidae), is a highly pathogenic trematode parasite of goat (Capra hircus). It sucks blood that causes acute disease like anemia, and severe economic losses occur due to morbidity and mortality of the ruminant infected by these worms. The study of these rumen paramphistomes, their infection, and public health importance remains unclear in India especially in the western part of state Uttar Pradesh (U.P.), Meerut, India, where the goat meat consumption is very high. This paper provides the molecular characterization of G. crumenifer recovered from the rumen of Capra hircus from Meerut, U.P., India by the partial sequence of 28S rDNA. Nucleotide sequence similarity searching on BLAST of 28S rDNA from parasites showed the highest identity with those of G. crumenifer from the same host Capra hircus. This is the first report of molecular identification of G. crumenifer from this part of India.

  12. Patterns of variation in the intergenic spacers of ribosomal DNA in Drosophila melanogaster support a model for genetic exchanges during X-Y pairing.

    PubMed

    Polanco, C; González, A I; Dover, G A

    2000-07-01

    Detailed analysis of variation in intergenic spacer (IGS) and internal transcribed spacer (ITS) regions of rDNA drawn from natural populations of Drosophila melanogaster has revealed contrasting patterns of homogenization although both spacers are located in the same rDNA unit. On the basis of the role of IGS regions in X-Y chromosome pairing, we proposed a mechanism of single-strand exchanges at the IGS regions, which can explain the different evolutionary trajectories followed by the IGS and the ITS regions. Here, we provide data from the chromosomal distribution of selected IGS length variants, as well as the detailed internal structure of a large number of IGS regions obtained from specific X and Y chromosomes. The variability found in the different internal subrepeat regions of IGS regions isolated from X and Y chromosomes supports the proposed mechanism of genetic exchanges and suggests that only the "240" subrepeats are involved. The presence of a putative site for topoisomerase I at the 5' end of the 18S rRNA gene would allow for the exchange between X and Y chromosomes of some 240 subrepeats, the promoter, and the ETS region, leaving the rest of the rDNA unit to evolve along separate chromosomal lineages. The phenomenon of localized units (modules) of homogenization has implications for multigene family evolution in general.

  13. Chapter 2: Genetic Variability in Nuclear Ribosomal and Chloroplast DNA in Utah (Juniperus Osteosperma) and Western (J. Occidentalis) Juniper (Cupressaceae): Evidence for Interspecific Gene Flow1

    SciTech Connect

    Terry, Randall G.; Tausch, Robin J.; Nowak, Robert S.

    1998-02-14

    Early studies of evolutionary change in chloroplast DNA indicated limited variability within species. This finding has been attributed to relatively low rates of sequence evolution and has been maintained as justification for the lack of intraspecific sampling in studies examining, relationships at the species level and above. However, documentation of intraspecific variation in cpDNA has become increasingly common and has been attributed in many cases to ''chloroplast capture'' following genetic exchange across species boundaries. Rleseberg and Wendel (1993) list 37 cases of proposed hybridization in plants that include intraspecific variation in cpDNA, 24 (65%) of which they considered to be probable instances of introgression. Rieseberg (1995) suspected that a review of the literature at that time would reveal over 100 cases of intraspecific variation in CPDNA that could be attributed to hybridization and introgression. That intraspecific variation in cpDNA is potentially indicative of hybridization is founded on the expectation that slowly evolving loci or genomes will produce greater molecular variation between than within species. In cases where a species is polymorphic for CPDNA and at least one of the molecular variants is diagnostic for a second species, interspecific hybridization is a plausible explanation. Incongruence between relationships suggested by cpDNA variation and those supported by other types of data (e.g., morphology or molecular data from an additional locus) provides additional support for introgression. One aspect of hybridization in both animals and plants that has become increasingly evident is incongruence in the phylogenetic and geographic distribution of cytoplasmic and nuclear markers. In most cases cytoplasmic introgression appears to be more pervasive than nuclear exchange. This discordance appears attributable to several factors including differences in the mutation rate, number of effective alleles, and modes of inheritance of

  14. Expanding the ribosomal universe.

    PubMed

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-01

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  15. Ribosomal Antibiotics: Contemporary Challenges.

    PubMed

    Auerbach-Nevo, Tamar; Baram, David; Bashan, Anat; Belousoff, Matthew; Breiner, Elinor; Davidovich, Chen; Cimicata, Giuseppe; Eyal, Zohar; Halfon, Yehuda; Krupkin, Miri; Matzov, Donna; Metz, Markus; Rufayda, Mruwat; Peretz, Moshe; Pick, Ophir; Pyetan, Erez; Rozenberg, Haim; Shalev-Benami, Moran; Wekselman, Itai; Zarivach, Raz; Zimmerman, Ella; Assis, Nofar; Bloch, Joel; Israeli, Hadar; Kalaora, Rinat; Lim, Lisha; Sade-Falk, Ofir; Shapira, Tal; Taha-Salaime, Leena; Tang, Hua; Yonath, Ada

    2016-06-29

    Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of "pathogen-specific antibiotics," in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  16. Ribosome-inactivating proteins

    PubMed Central

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

  17. Ribosomal Antibiotics: Contemporary Challenges.

    PubMed

    Auerbach-Nevo, Tamar; Baram, David; Bashan, Anat; Belousoff, Matthew; Breiner, Elinor; Davidovich, Chen; Cimicata, Giuseppe; Eyal, Zohar; Halfon, Yehuda; Krupkin, Miri; Matzov, Donna; Metz, Markus; Rufayda, Mruwat; Peretz, Moshe; Pick, Ophir; Pyetan, Erez; Rozenberg, Haim; Shalev-Benami, Moran; Wekselman, Itai; Zarivach, Raz; Zimmerman, Ella; Assis, Nofar; Bloch, Joel; Israeli, Hadar; Kalaora, Rinat; Lim, Lisha; Sade-Falk, Ofir; Shapira, Tal; Taha-Salaime, Leena; Tang, Hua; Yonath, Ada

    2016-01-01

    Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of "pathogen-specific antibiotics," in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification. PMID:27367739

  18. Ribosomal Antibiotics: Contemporary Challenges

    PubMed Central

    Auerbach-Nevo, Tamar; Baram, David; Bashan, Anat; Belousoff, Matthew; Breiner, Elinor; Davidovich, Chen; Cimicata, Giuseppe; Eyal, Zohar; Halfon, Yehuda; Krupkin, Miri; Matzov, Donna; Metz, Markus; Rufayda, Mruwat; Peretz, Moshe; Pick, Ophir; Pyetan, Erez; Rozenberg, Haim; Shalev-Benami, Moran; Wekselman, Itai; Zarivach, Raz; Zimmerman, Ella; Assis, Nofar; Bloch, Joel; Israeli, Hadar; Kalaora, Rinat; Lim, Lisha; Sade-Falk, Ofir; Shapira, Tal; Taha-Salaime, Leena; Tang, Hua; Yonath, Ada

    2016-01-01

    Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification. PMID:27367739

  19. Constructing ribosomes along the Danube

    PubMed Central

    Warner, Jonathan R.

    2010-01-01

    The EMBO Conference on Ribosome Synthesis held last summer explored the latest breakthroughs in ribosome assembly and how it affects disease. Both of these topics have recently seen important advances that enlighten how almost 200 proteins cooperate to produce a ribosome and how the cell responds to a malfunction in this process. PMID:20010797

  20. The spc ribosomal protein operon of Escherichia coli: sequence and cotranscription of the ribosomal protein genes and a protein export gene.

    PubMed

    Cerretti, D P; Dean, D; Davis, G R; Bedwell, D M; Nomura, M

    1983-05-11

    The genes encoding the 52 ribosomal proteins (r-proteins) of Escherichia coli are organized into approximately 19 operons scattered throughout the chromosome. One of these, the spc operon, contains the genes for ten ribosomal proteins: L14, L24, L5, S14, S8, L6, L18, S5, L30 and L15 (rp1N, rp1X, rp1E, rpsN, rpsH, rp1F, rp1R, rpsE, rpmD, and rp1O). We now report the entire 5.9 kb nucleotide sequence of the spc operon. DNA sequence analysis has confirmed the genetic organization and refined the amino acid sequence of the ten r-proteins in this operon. It has also revealed the presence of two open reading frames past the last known gene (L15) of the spc operon. One of these corresponds to a gene (pr1A or secY) which recently has been shown by others to be involved in protein export. In addition, S1 mapping experiments indicate that a significant proportion of transcription initiated from the spc operon continues not only into the two putative genes, but also without termination into the downstream alpha r-protein operon.

  1. Cytomolecular Analysis of Ribosomal DNA Evolution in a Natural Allotetraploid Brachypodium hybridum and Its Putative Ancestors—Dissecting Complex Repetitive Structure of Intergenic Spacers

    PubMed Central

    Borowska-Zuchowska, Natalia; Kwasniewski, Miroslaw; Hasterok, Robert

    2016-01-01

    Nucleolar dominance is an epigenetic phenomenon associated with nuclear 35S rRNA genes and consists in selective suppression of gene loci inherited from one of the progenitors in the allopolyploid. Our understanding of the exact mechanisms that determine this process is still fragmentary, especially in case of the grass species. This study aimed to shed some light on the molecular basis of this genome-specific inactivation of 35S rDNA loci in an allotetraploid Brachypodium hybridum (2n = 30), which arose from the interspecific hybridization between two diploid ancestors that were very similar to modern B. distachyon (2n = 10) and B. stacei (2n = 20). Using fluorescence in situ hybridization with 25S rDNA and chromosome-specific BAC clones as probes we revealed that the nucleolar dominance is present not only in meristematic root-tip cells but also in differentiated cell fraction of B. hybridum. Additionally, the intergenic spacers (IGSs) from both of the putative ancestors and the allotetraploid were sequenced and analyzed. The presumptive transcription initiation sites, spacer promoters and repeated elements were identified within the IGSs. Two different length variants, 2.3 and 3.5 kb, of IGSs were identified in B. distachyon and B. stacei, respectively, however only the IGS that had originated from B. distachyon-like ancestor was present in the allotetraploid. The amplification pattern of B. hybridum IGSs suggests that some genetic changes occurred in inactive B. stacei-like rDNA loci during the evolution of the allotetraploid. We hypothesize that their preferential silencing is an effect of structural changes in the sequence rather than just the result of the sole inactivation at the epigenetic level. PMID:27790225

  2. Description of a new planktonic mixotrophic dinoflagellate Paragymnodinium shiwhaense n. gen., n. sp. from the coastal waters off Western Korea: morphology, pigments, and ribosomal DNA gene sequence.

    PubMed

    Kang, Nam Seon; Jeong, Hae Jin; Moestrup, Øjvind; Shin, Woongghi; Nam, Seung Won; Park, Jae Yeon; De Salas, Miguel F; Kim, Ki Woo; Noh, Jae Hoon

    2010-01-01

    The mixotrophic dinoflagellate Paragymnodinium shiwhaense n. gen., n. sp. is described from living cells and from cells prepared by light, scanning electron, and transmission electron microscopy. In addition, sequences of the small subunit (SSU) and large subunit (LSU) rDNA and photosynthetic pigments are reported. The episome is conical, while the hyposome is hemispherical. Cells are covered with polygonal amphiesmal vesicles arranged in 16 rows and containing a very thin plate-like component. There is neither an apical groove nor apical line of narrow plates. Instead, there is a sulcal extension-like furrow. The cingulum is as wide as 0.2-0.3 x cell length and displaced by 0.2-0.3 x cell length. Cell length and width of live cells fed Amphidinium carterae were 8.4-19.3 and 6.1-16.0 microm, respectively. Paragymnodinium shiwhaense does not have a nuclear envelope chamber nor a nuclear fibrous connective (NFC). Cells contain chloroplasts, nematocysts, trichocysts, and peduncle, though eyespots, pyrenoids, and pusules are absent. The main accessory pigment is peridinin. The sequence of the SSU rDNA of this dinoflagellate (GenBank AM408889) is 4% different from that of Gymnodinium aureolum, Lepidodinium viride, and Gymnodinium catenatum, the three closest species, while the LSU rDNA was 17-18% different from that of G. catenatum, Lepidodinium chlorophorum, and Gymnodinium nolleri. The phylogenetic trees show that this dinoflagellate belongs within the Gymnodinium sensu stricto clade. However, in contrast to Gymnodinium spp., cells lack nuclear envelope chambers, NFC, and an apical groove. Unlike Polykrikos spp., which have a taeniocyst-nematocyst complex, P. shiwhaense has nematocysts without taeniocysts. In addition, P. shiwhaense does not have ocelloids in contrast to Warnowia spp. and Nematodinium spp. Therefore, based on morphological and molecular analyses, we suggest that this taxon is a new species, also within a new genus. PMID:20487128

  3. A 'garbage can' for ribosomes: how eukaryotes degrade their ribosomes.

    PubMed

    Lafontaine, Denis L J

    2010-05-01

    Ribosome synthesis is a major metabolic activity that involves hundreds of individual reactions, each of which is error-prone. Ribosomal insults occur in cis (alteration in rRNA sequences) and in trans (failure to bind to, or loss of, an assembly factor or ribosomal protein). In addition, specific growth conditions, such as starvation, require that excess ribosomes are turned over efficiently. Recent work indicates that cells evolved multiple strategies to recognize specifically, and target for clearance, ribosomes that are structurally and/or functionally deficient, as well as in excess. This surveillance is active at every step of the ribosome synthesis pathway and on mature ribosomes, involves nearly entirely different mechanisms for the small and large subunits, and requires specialized subcellular organelles. PMID:20097077

  4. Restriction Analysis of PCR-Amplified Internal Transcribed Spacers of Ribosomal DNA as a Tool for Species Identification in Different Genera of the Order Glomales

    PubMed Central

    Redecker, D.; Thierfelder, H.; Walker, C.; Werner, D.

    1997-01-01

    A technique combining PCR and restriction fragment length polymorphism analysis was used to generate specific DNA fragment patterns from spore extracts of arbuscular mycorrhizal fungi. With the universal primers ITS1 and ITS4, DNA fragments were amplified from species of Scutellospora and Gigaspora that were approximately 500 bp long. The apparent lengths of the corresponding fragments from Glomus spp. varied between 580 and 600 bp. Within the genus Glomus, the restriction enzymes MboI, HinfI, and TaqI were useful for distinguishing species. Depending on the restriction enzyme used, groups of species with common fragment patterns could be found. Five tropical and subtropical isolates identified as Glomus manihotis and G. clarum could not be distinguished by their restriction patterns, corresponding to the morphological similarity of the spores. The variation of internal transcribed spacer sequences among the Gigaspora species under study was low. Fragment patterns of Scutellospora spp. showed their phylogenetic relationship with Gigaspora and revealed only a slightly higher degree of variation. PMID:16535592

  5. Phylogenetics and systematics of Angiostrongylus lungworms and related taxa (Nematoda: Metastrongyloidea) inferred from the nuclear small subunit (SSU) ribosomal DNA sequences.

    PubMed

    Eamsobhana, P; Lim, P E; Yong, H S

    2015-05-01

    The Angiostrongylus lungworms are of public health and veterinary concern in many countries. At the family level, the Angiostrongylus lungworms have been included in the family Angiostrongylidae or the family Metastrongylidae. The present study was undertaken to determine the usefulness and suitability of the nuclear 18S (small subunit, SSU) rDNA sequences for differentiating various taxa of the genus Angiostrongylus, as well as to determine the systematics and phylogenetic relationship of Angiostrongylus species and other metastrongyloid taxa. This study revealed six 18S (SSU) haplotypes in A. cantonensis, indicating considerable genetic diversity. The uncorrected pairwise 'p' distances among A. cantonensis ranged from 0 to 0.86%. The 18S (SSU) rDNA sequences unequivocally distinguished the five Angiostrongylus species, confirmed the close relationship of A. cantonensis and A. malaysiensis and that of A. costaricensis and A. dujardini, and were consistent with the family status of Angiostrongylidae and Metastrongylidae. In all cases, the congeneric metastrongyloid species clustered together. There was no supporting evidence to include the genus Skrjabingylus as a member of Metastrongylidae. The genera Aelurostrongylus and Didelphostrongylus were not recovered with Angiostrongylus, indicating polyphyly of the Angiostrongylidae. Of the currently recognized families of Metastrongyloidea, only Crenosomatidae appeared to be monophyletic. In view of the unsettled questions regarding the phylogenetic relationships of various taxa of the metastrongyloid worms, further analyses using more markers and more taxa are warranted.

  6. Isolation of ribosomes and polysomes.

    PubMed

    Rivera, Maria C; Maguire, Bruce; Lake, James A

    2015-03-01

    Here we describe a preparative differential centrifugation protocol for the isolation of ribosomes from a crude cell homogenate. The subcellular fraction obtained is enriched in ribosome monomers and polysomes. The protocol has been optimized for the homogenization and collection of the ribosomal fraction from prokaryotic cells, mammalian and plant tissues, reticulocytes, and chloroplasts. The quality of the ribosomal preparation is enhanced by the removal of the remaining cellular components and adsorbed proteins by pelleting through a sucrose cushion with a high concentration of monovalent salts, NH4Cl or KCl. The different components of the ribosomal fraction isolated using this protocol can be further purified by sucrose gradient centrifugation.

  7. Ribosome Assembly as Antimicrobial Target.

    PubMed

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  8. Ribosome Assembly as Antimicrobial Target

    PubMed Central

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H.

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  9. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules

    PubMed Central

    Valach, Matus; Burger, Gertraud; Gray, Michael W.; Lang, B. Franz

    2014-01-01

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. PMID:25429974

  10. The 5-S RNA . protein complex from an extreme halophile, Halobacterium cutirubrum. Purification and characterization.

    PubMed

    Smith, N; Matheson, A T; Yaguchi, M; Willick, G E; Nazar, R N

    1978-09-01

    A 5-S RNA . protein complex has been isolated from the 50-S ribosomal subunit of an extreme halophile, Halobacterium cutirubrum. The 50-S ribosomal subunit from the extreme halophile requires 3.4 M K+ and 100 mM Mg2+ for stability. However, if the high K+ concentration is maintained but the Mg2+ concentration lowered to 0.3 mM, the 5-S RNA . protein complex is selectively extracted from the subunit. After being purified on an Agarose 0.5-m column the complex had a molecular weight of about 80000 and contained 5-S RNA and two proteins, HL13 and HL19, with molec