Science.gov

Sample records for 5s rna genes

  1. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  2. TFIIIA binds to different domains of 5S RNA and the Xenopus borealis 5S RNA gene.

    PubMed Central

    Sands, M S; Bogenhagen, D F

    1987-01-01

    We have established the conditions for the reassociation of 5S RNA and TFIIIA to form 7S particles. We tested the ability of altered 5S RNAs to bind TFIIIA, taking advantage of the slower mobility of 7S particles compared with free 5S RNA in native polyacrylamide gels. Linker substitution mutants were constructed encompassing the entire gene, including the intragenic control region. In vitro transcripts of the linker substitution mutants were tested for their ability to bind TFIIIA to form 7S ribonucleoprotein particles. Altered 5S RNAs with base changes in or around helices IV and V, which would interfere with the normal base pairing of that region, showed decreased ability to bind TFIIIA. The transcripts of some mutant genes that were efficiently transcribed (greater than 50% of wild-type efficiency) failed to bind TFIIIA in this gel assay. In contrast, the RNA synthesized from a poorly transcribed mutant, LS 86/97, in which residues 87 to 96 of the RNA were replaced in the single-stranded loop at the base of helix V, bound TFIIIA well. The data indicate that TFIIIA binds to different domains in the 5S RNA gene and 5S RNA. Images PMID:3431548

  3. Two sequence classes of kinetoplastid 5S ribosomal RNA gene revealed among bodonid spliced leader RNA gene arrays.

    PubMed

    Santana, D M; Lukes, J; Sturm, N R; Campbell, D A

    2001-11-13

    The spliced leader RNA genes of Bodo saltans, Cryptobia helicis and Dimastigella trypaniformis were analyzed as molecular markers for additional taxa within the suborder Bodonina. The non-transcribed spacer regions were distinctive for each organism, and 5S rRNA genes were present in Bodo and Dimastigella but not in C. helicis. Two sequence classes of 5S rRNA were evident from analysis of the bodonid genes. The two classes of 5S rRNA genes were found in other Kinetoplastids independent of co-localization with the spliced leader RNA gene.

  4. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  5. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  6. Interaction of Xenopus TFIIIC with the TFIIIA.5 S RNA gene complex.

    PubMed

    Keller, H J; Romaniuk, P J; Gottesfeld, J M

    1992-09-01

    The general transcription factor TFIIIC is necessary for transcription initiation by RNA polymerase III. TFIIIC binds predominantly to the B-Block promoter element, which is present in tRNA genes, several viral RNA genes and repetitive DNA elements, and to the TFIIIA.DNA complex on 5 S RNA genes. Here we report a characterization of Xenopus laevis TFIIIC and its interaction with the TFIIIA.5 S RNA gene complex. A polypeptide with apparent molecular mass of 85 kDa was specifically cross-linked to a B-Block oligonucleotide by UV light. This polypeptide was present in the partially purified TFIIIC fraction and in a complex with a B-Block double-stranded oligonucleotide isolated by nondenaturing gel electrophoresis. TFIIIC.TFIIIA.DNA gel mobility shift complexes were obtained using B-Block DNA affinity-purified TFIIIC and buffer conditions employing low Mg2+ (1 mM) and high dithiothreitol (7 mM) concentrations. Three TFIIIC.TFIIIA.5 S RNA gene complexes were observed by gel mobility shift analysis. One of these complexes was resistant to dissociation by the addition of competing DNA, but the formation of all three complexes was prevented by the inclusion of excess specific competitor DNA in the initial binding reactions. The apparent affinity of TFIIIC for the TFIIIA.5 S DNA complex was 5-fold higher for the somatic-type 5 S RNA gene than for the oocyte-type 5 S RNA gene. Mutations near the 5' boundary of the TFIIIA binding site alter the DNase I footprint of the TFIIIA.DNA complex and reduce the affinity of TFIIIA-mutant 5 S gene complexes for TFIIIC. Differences in TFIIIC affinity for the two classes of 5 S RNA genes may play a role in the developmental regulation of these gene families. PMID:1517247

  7. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    PubMed

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  8. A tandem array of 5S ribosomal RNA genes in Pythium irregulare.

    PubMed

    Belkhiri, A; Intengan, H; Klassen, G R

    1997-02-28

    The 5S ribosomal RNA genes of the oomycete Pythium irregulare exist in tandem arrays unlinked to the rDNA repeat unit. A clone with a 9.2-kb insert containing an array of 5S genes was identified in a lambda genomic library and was characterized by restriction mapping and partial sequencing. The array consisted of 9 apparently identical 5S genes and their spacers in tandem, followed by a diverged 5S-like sequence that is likely to be a pseudogene. This gene arrangement, although almost universal in plants and animals, is rare in fungi and protists.

  9. Identification of the gene encoding the 5S ribosomal RNA maturase in Bacillus subtilis: mature 5S rRNA is dispensable for ribosome function.

    PubMed Central

    Condon, C; Brechemier-Baey, D; Beltchev, B; Grunberg-Manago, M; Putzer, H

    2001-01-01

    Over 25 years ago, Pace and coworkers described an activity called RNase M5 in Bacillus subtilis cell extracts responsible for 5S ribosomal RNA maturation (Sogin & Pace, Nature, 1974, 252:598-600). Here we show that RNase M5 is encoded by a gene of previously unknown function that is highly conserved among the low G + C gram-positive bacteria. We propose that the gene be named rnmV. The rnmV gene is nonessential. B. subtilis strains lacking RNase M5 do not make mature 5S rRNA, indicating that this process is not necessary for ribosome function. 5S rRNA precursors can, however, be found in both free and translating ribosomes. In contrast to RNase E, which cleaves the Escherichia coli 5S precursor in a single-stranded region, which is then trimmed to yield mature 5S RNA, RNase M5 cleaves the B. subtilis equivalent in a double-stranded region to yield mature 5S rRNA in one step. For the most part, eubacteria contain one or the other system for 5S rRNA production, with an imperfect division along gram-negative and gram-positive lines. A potential correlation between the presence of RNase E or RNase M5 and the single- or double-stranded nature of the predicted cleavage sites is explored. PMID:11233981

  10. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    PubMed

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level.

  11. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  12. Ultraviolet damage and nucleosome folding of the 5S ribosomal RNA gene.

    SciTech Connect

    Liu, X; Mann, David B.; Suquet, C; Springer, David L. ); Smerdon, Michael J.

    2000-01-25

    The Xenopus borealis somatic 5S ribosomal RNA gene was used as a model system to determine the mutual effects of nucleosome folding and formation of ultraviolet (UV) photoproducts (primarily cis-syn cyclobutane pyrimidine dimers, or CPDs) in chromatin. We analyzed the preferred rotational and translational settings of 5S rDNA on the histone octamer surface after induction of up to 0.8 CPD/nucleosome core (2.5 kJ/m(2) UV dose). DNase I and hydroxyl radical footprints indicate that UV damage at these levels does not affect the average rotational setting of the 5S rDNA molecules. Moreover, a combination of nuclease trimming and restriction enzyme digestion indicates the preferred translational positions of the histone octamer are not affected by this level of UV damage. We also did not observe differences in the UV damage patterns of irradiated 5S rDNA before or after nucleosome formation, indicating there is little difference in the inhibition of nucleosome folding by specific CPD sites in the 5S rRNA gene. Conversely, nucleosome folding significantly restricts CPD formation at all sites in the three helical turns of the nontranscribed strand located in the dyad axis region of the nucleosome, where DNA is bound exclusively by the histone H3-H4 tetramer. Finally, modulation of the CPD distribution in a 14 nt long pyrimidine tract correlates with its rotational setting on the histone surface, when the strong sequence bias for CPD formation in this tract is minimized by normalization. These results help establish the mutual roles of histone binding and UV photoproducts on their formation in chromatin.

  13. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  14. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  15. Chaperoning 5S RNA assembly.

    PubMed

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit.

  16. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  17. Chromosomal localization of 5S rRNA gene loci and the implications for relationships within the Allium complex.

    PubMed

    Lee, S H; Do, G S; Seo, B B

    1999-01-01

    Chromosomal localizations and distribution patterns of the 5S rRNA genes by means of fluorescence in-situ hybridization in diploid Allium species could help to classify species into chromosome types and aid in determining relationships among genomes. All eleven diploid species were classified into five types, A to E. Species of type A showed a pair of 5S rRNA signals on the short arm of chromosome 5 and two pairs of signals on both arms of chromosome 7. Species of types B and C showed one pair and two pairs of signals on the short arm of chromosome 7, respectively. Type D species showed two pairs of signals on the satellite region of the short arm and a pair of signals on the long arm of chromosome 7. Type E species showed three distinct 5S rRNA gene loci signals on the short arm of chromosome 7. Information on chromosomal localization of 5S rRNA gene loci and distribution patterns within chromosomes in diploid Allium species could help to infer the pathway of origin of the three kinds of alloploid species. Data indicate that A. wakegi is an allopolyploid with genomes of types B and C, and A. deltoide-fistulosum is an allotetraploid derived from a natural hybridization between different species within chromosome type A. Results indicate that A. senescens is an allopolyploid with type B chromosomes and an unidentified chromosomal type. PMID:10328620

  18. snoU6 and 5S RNAs are not reliable miRNA reference genes in neuronal differentiation.

    PubMed

    Lim, Q E; Zhou, L; Ho, Y K; Wan, G; Too, H P

    2011-12-29

    Accurate profiling of microRNAs (miRNAs) is an essential step for understanding the functional significance of these small RNAs in both physiological and pathological processes. Quantitative real-time PCR (qPCR) has gained acceptance as a robust and reliable transcriptomic method to profile subtle changes in miRNA levels and requires reference genes for accurate normalization of gene expression. 5S and snoU6 RNAs are commonly used as reference genes in microRNA quantification. It is currently unknown if these small RNAs are stably expressed during neuronal differentiation. Panels of miRNAs have been suggested as alternative reference genes to 5S and snoU6 in various physiological contexts. To test the hypothesis that miRNAs may serve as stable references during neuronal differentiation, the expressions of eight miRNAs, 5S and snoU6 RNAs in five differentiating neuronal cell types were analyzed using qPCR. The stabilities of the expressions were evaluated using two complementary statistical approaches (geNorm and Normfinder). Expressions of 5S and snoU6 RNAs were stable under some but not all conditions of neuronal differentiation and thus are not suitable reference genes. In contrast, a combination of three miRNAs (miR-103, miR-106b and miR-26b) allowed accurate expression normalization across different models of neuronal differentiation.

  19. Transcription of the Drosophila melanogaster 5S RNA gene requires an upstream promoter and four intragenic sequence elements

    SciTech Connect

    Sharp, S.J.; Garcia, A.D.

    1988-03-01

    Linker-scanning (LS) mutations were constructed spanning the length of the Drosophila melanogaster 5S RNA gene. In vitro transcription analysis of the LS 5S DNAs revealed five transcription control regions. One control region essential for the transcription initiation was identified in the 5'-flanking sequence. The major sequence determinants of this upstream promoter region were located between coordinates -39 and -26 (-30 region), but important sequences extended to the transcription start site at position 1. Since mutations in the upstream promoter did not alter the ability of 5S DNA to sequester transcription factors into a stable transcription complex, it appears that this control region involved the interaction of RNA polymerase III. Active 5S DNA transcription additionally required the four intragenic control regions (ICRs) located between coordinates 3 and 18 (ICR I), 37 and 44 (ICR II), 48 and 61 (ICR III), and 78 and 98 (ICR IV). LS mutations in each ICR decreased the ability of 5S DNA to sequester transcription factors. ICR III, ICR IV, and the spacer sequence between were similar in sequence and position to the determinant elements of the multipartite ICR of Xenopus 5S DNA. The importance of ICR III and ICR IV in transcription initiation and in sequestering transcription factors suggests the presence of an activity in D. melanogaster similar to transcription factor TFIIIA of Xenopus laevis and HeLa cells. Transcription initiation of Drosophila 5S DNA was not eliminated by LS mutations in the spacer region even though these mutations reduced the ability of the TFIIIA-like activity to bind.

  20. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  1. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    PubMed

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  2. A 5 S rRNA gene is present in the mitochondrial genome of the protist Reclinomonas americana but is absent from red algal mitochondrial DNA.

    PubMed

    Lang, B F; Goff, L J; Gray, M W

    1996-09-01

    Except in the case of land plants, mitochondrial ribosomes apparently lack a 5 S rRNA species, even though this small RNA is a component of all prokaryotic, chloroplast and eukaryotic cytosol ribosomes. In plants, the mitochondrial 5 S rRNA is encoded by mtDNA and differs in sequence from the 5 S rRNA specified by plant nuclear and chloroplast genomes. A distinctive 5 S rRNA component has not been found in the mitochondrial ribosomes of non-plant eukaryotes and, with the notable exception of the chlorophycean alga, Prototheca wickerhamii, a 5 S rRNA gene has not been identified in those non-plant mtDNAs characterized to date. Here, we report the presence of a 5 S rRNA gene in the mtDNA of the heterotrophic flagellate Reclinomonas americana. This unicellular eukaryote is a member of the jakobid flagellates, an early-diverging group of protists that share ultrastructural characteristics with the retortamonads, primitive protists that lack mitochondria. We report sequence data from the mtDNAs of the red algae Porphyra purpurea and Gracilariopsis lemaneiformis, which we use to evaluate a recent claim that a 5 S rRNA gene exists in the mtDNA of a third rhodophyte alga, Chondrus crispus. Our results lead us to the opposite conclusion: that a 5 S rRNA gene is not encoded by red algal mtDNA. In view of the accumulating evidence favoring a monophyletic origin of the mitochondrial genome, it is likely that a 5 S rRNA gene was present in an ancestral proto-mitochondrial genome, and that contemporary mtDNA-encoded 5 S rRNA genes have all descended from this ancestral gene. Considering the highly restricted phylogenetic distribution of identified mtDNA-encoded 5 S rRNA genes, it follows that the mitochondrial 5 S rRNA gene must have been lost multiple times during evolutionary diversification of the eukaryotic lineage.

  3. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  4. Role of DNA-Dependent RNA Polymerase III in the Transcription of the tRNA and 5S RNA Genes

    PubMed Central

    Weinmann, Roberto; Roeder, Robert G.

    1974-01-01

    Mouse myeloma cells have previously been shown (L. B. Schwartz, V. E. F. Sklar, J. A. Jaehning, R. Weinmann & R. G. Roeder, submitted for publication) to contain two chromatographically distinct forms of RNA polymerase III (designated IIIA and IIIB). The enzymes are unaffected by low α-amanitin concentrations which completely inhibit RNA polymerase II, but they exhibit characteristic inhibition curves (identical for IIIA and IIIB) at higher toxin concentrations. RNA polymerase I was unaffected at all α-amanitin concentrations tested. Myeloma RNA polymerases II, IIIA, and IIIB appear to be inhibited by the same mechanism, since the toxin rapidly blocks chain elongation by each enzyme. The characteristic α-amanitin sensitivity of RNA polymerase III has been employed in studies of the function(s) of the class III RNA polymerases. Isolated myeloma nuclei and nucleoli contińue to synthesize RNA via the endogenous RNA polymerases when incubated in vitro. With nuclei, newly synthesized 4S precursor (pre-4S) and 5S RNA species were detected by electrophoretic analysis either of the total nuclear RNA or of the RNA released into the supernatant during incubation. The synthesis of both pre-4S and 5S RNA species was inhibited by α-amanitin, but only at high concentrations; and the α-amanitin inhibition curves for these RNAs were identical to those obtained for solubilized RNA polymerases IIIA and IIIB. In control experiments it was shown that the endogenous RNA polymerase II activity of isolated nuclei was inhibited by α-amanitin concentrations similar to those required to inhibit purified enzyme II. However, 40-50% of the endogenous activity of nuclei and 100% of the endogenous activity of purified nucleoli was completely resistant to the high α-amanitin concentrations necessary to inhibit the RNA polymerase III activities. These experiments rule out nonspecific inhibitory effects in the endogenous systems. These results unequivocally demonstrate the role of RNA

  5. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  6. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    PubMed

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  7. Homologous genes for mouse 4.5S hybRNA are found in all eukaryotes and their low molecular weight RNA transcripts intermolecularly hybridize with eukaryotic 18S ribosomal RNAs.

    PubMed

    Trinh-Rohlik, Q; Maxwell, E S

    1988-07-11

    Previous work has reported the isolation and sequencing of a mouse low molecular weight RNA species designated 4.5S hybridizing RNA or hybRNA because of its ability to intermolecularly hybridize with mouse mRNA and 18S rRNA sequences. Using synthetic DNA oligonucleotide probes we have examined the conservation of this gene sequence and its expression as a lmwRNA transcript across evolution. Southern blot analysis has shown that homologous genes of single or low copy number are found in all eukaryotes examined as well as in E. coli. Northern blot analysis has demonstrated 4.5S hybRNA transcription in all mouse tissues as well as expression in yeast and Xenopus laevis as lmwRNAs of approximately 130 and 100 nucleotides, respectively, as compared with mouse/rat/hamster species of approximately 87 nucleotides. Yeast and X. laevis 4.5S hybRNA homologs, isolated by hybrid-selection, were shown by Northern blot analysis to intermolecularly hybridize with homologous as well as heterologous 18S rRNA sequences. The conservation of 4.5S hybRNA homologous genes and their expression as lmwRNA transcripts with common intermolecular RNA:RNA hybridization capabilities in fungi, amphibians, and mammals argues for a common, conserved and required biological function for this lmwRNA in all eukaryotes and potential utilization of its intermolecular RNA:RNA hybridization capabilities to carry out this function.

  8. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  9. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  10. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    PubMed Central

    2010-01-01

    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  11. Molecular characterization and chromosomal mapping of the 5S rRNA gene in Solea senegalensis: a new linkage to the U1, U2, and U5 small nuclear RNA genes.

    PubMed

    Manchado, Manuel; Zuasti, Eugenia; Cross, Ismael; Merlo, Alejandro; Infante, Carlos; Rebordinos, Laureana

    2006-01-01

    Some units of the 5S rDNA of Solea senegalensis were amplified by PCR and sequenced. Three main PCR products (227, 441, and 2166 bp) were identified. The 227- and 441-bp fragments were characterized by highly divergent nontranscribed spacer sequences (referred to as NTS-I and NTS-II) that were 109 and 324 bp long, respectively, yet their coding sequences were nearly identical. The 2166-bp 5S rDNA unit was composed of two 5S rRNA genes separated by NTS-I and followed by a 1721-bp spacer containing the U2, U5, and U1 small nuclear RNA genes (snRNAs). They were inverted and arranged in the transcriptional direction opposite that of the 5S rRNA gene. This simultaneous linkage of 3 different snRNAs had never been observed before. The PCR products were used as probes in fluorescence in situ hybridization experiments to locate the corresponding loci on the chromosomes of S. senegalensis. A major 5S rDNA chromosomal site was located along most of the short arm of a submetacentric pair, while a minor site was detected near the centromeric region of an acrocentric pair.

  12. Regulation of the rplY gene encoding 5S rRNA binding protein L25 in Escherichia coli and related bacteria.

    PubMed

    Aseev, Leonid V; Bylinkina, Natalia S; Boni, Irina V

    2015-05-01

    Ribosomal protein (r-protein) L25 is one of the three r-proteins (L25, L5, L18) that interact with 5S rRNA in eubacteria. Specific binding of L25 with a certain domain of 5S r-RNA, a so-called loop E, has been studied in detail, but information about regulation of L25 synthesis has remained totally lacking. In contrast to the rplE (L5) and rplR (L18) genes that belong to the polycistronic spc-operon and are regulated at the translation level by r-protein S8, the rplY (L25) gene forms an independent transcription unit. The main goal of this work was to study the regulation of the rplY expression in vivo. We show that the rplY promoter is down-regulated by ppGpp and its cofactor DksA in response to amino acid starvation. At the level of translation, the rplY expression is subjected to the negative feedback control. The 5'-untranslated region of the rplY mRNA comprises specific sequence/structure features, including an atypical SD-like sequence, which are highly conserved in a subset of gamma-proteobacterial families. Despite the lack of a canonical SD element, the rplY'-'lacZ single-copy reporter showed unusually high translation efficiency. Expression of the rplY gene in trans decreased the translation yield, indicating the mechanism of autogenous repression. Site-directed mutagenesis of the rplY 5' UTR revealed an important role of the conserved elements in the translation control. Thus, the rplY expression regulation represents one more example of regulatory pathways that control ribosome biogenesis in Escherichia coli and related bacteria.

  13. Regulation of the rplY gene encoding 5S rRNA binding protein L25 in Escherichia coli and related bacteria

    PubMed Central

    Aseev, Leonid V.; Bylinkina, Natalia S.; Boni, Irina V.

    2015-01-01

    Ribosomal protein (r-protein) L25 is one of the three r-proteins (L25, L5, L18) that interact with 5S rRNA in eubacteria. Specific binding of L25 with a certain domain of 5S r-RNA, a so-called loop E, has been studied in detail, but information about regulation of L25 synthesis has remained totally lacking. In contrast to the rplE (L5) and rplR (L18) genes that belong to the polycistronic spc-operon and are regulated at the translation level by r-protein S8, the rplY (L25) gene forms an independent transcription unit. The main goal of this work was to study the regulation of the rplY expression in vivo. We show that the rplY promoter is down-regulated by ppGpp and its cofactor DksA in response to amino acid starvation. At the level of translation, the rplY expression is subjected to the negative feedback control. The 5′-untranslated region of the rplY mRNA comprises specific sequence/structure features, including an atypical SD-like sequence, which are highly conserved in a subset of gamma-proteobacterial families. Despite the lack of a canonical SD element, the rplY’-‘lacZ single-copy reporter showed unusually high translation efficiency. Expression of the rplY gene in trans decreased the translation yield, indicating the mechanism of autogenous repression. Site-directed mutagenesis of the rplY 5′ UTR revealed an important role of the conserved elements in the translation control. Thus, the rplY expression regulation represents one more example of regulatory pathways that control ribosome biogenesis in Escherichia coli and related bacteria. PMID:25749694

  14. Species identification of Crassostrea and Ostrea oysters by polymerase chain reaction amplification of the 5S rRNA gene.

    PubMed

    Cross, Ismael; Rebordinos, Laureana; Diaz, Edgardo

    2006-01-01

    A specific multiplex polymerase chain reaction (PCR) was developed for the identification of Crassostrea angulata, C. gigas, Ostrea edulis, and O. stentina oyster species. Universal primers were used for the amplification of complete repetition units of 5S rDNA in each of the 4 species. The alignment of the obtained sequences was the basis for the specific design of species-specific primers (ED1, ED2, ST1, ST2, CR1, and CR2) located in the nontranscribed spacer regions. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed identification of Crassostrea and Ostrea species. A multiplex PCR with a set of the 6 designed primers showed that they did not interfere with each other and bound specifically to the DNA target. This genetic marker can be very useful for traceability of the species, application in the management of oyster cultures, and conservation of the genetic resources of the species. PMID:16512239

  15. Mutations in TFIIIA that increase stability of the TFIIIA-5 S rRNA gene complex: unusual effects on the kinetics of complex assembly and dissociation.

    PubMed

    Brady, Kristina L; Ponnampalam, Stephen N; Bumbulis, Michael J; Setzer, David R

    2005-07-22

    We have identified four mutations in Xenopus TFIIIA that increase the stability of TFIIIA-5 S rRNA gene complexes. In each case, the mutation has a relatively modest effect on equilibrium binding affinity. In three cases, these equilibrium binding effects can be ascribed primarily to decreases in the rate constant for protein-DNA complex dissociation. In the fourth case, however, a substitution of phenylalanine for the wild-type leucine at position 148 in TFIIIA results in much larger compensating changes in the kinetics of complex assembly and dissociation. The data support a model in which a relatively unstable population of complexes with multi-component dissociation kinetics forms rapidly; complexes then undergo a slow conformational change that results in very stable, kinetically homogeneous TFIIIA-DNA complexes. The L148F mutant protein acts as a particularly potent transcriptional activator when it is fused to the VP16 activation domain and expressed in yeast cells. Substitution of L148 to tyrosine or tryptophan produces an equally strong transcriptional activator. Substitution to histidine results in genetic and biochemical effects that are more modest than, but similar to, those observed with the L148F mutation. We propose that an amino acid with a planar side chain at position 148 can intercalate between adjacent base pairs in the intermediate element of the 5 S rRNA gene. Intercalation occurs slowly but results in a very stable DNA-protein complex. These results suggest that transcriptional activation by a cis-acting sequence element is largely dependent on the kinetic, rather than the thermodynamic, stability of the complex formed with an activator protein. Thus, transcriptional activation is dependent in large part on the lifetime of the activator-DNA complex rather than on binding site occupancy at steady state. Introduction of intercalating amino acids into zinc finger proteins may be a useful tool for producing artificial transcription factors with

  16. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  17. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

  18. Cytogenetic characterization by in situ hybridization techniques and molecular analysis of 5S rRNA genes of the European hazelnut (Corylus avellana).

    PubMed

    Falistocco, E; Marconi, G

    2013-03-01

    The European hazelnut (Corylus avellana L.) is widespread in Europe, where it has been cultivated for centuries. Despite progress in genetics, most of the cytogenetic aspects of this species have been overlooked. The aim of this study was to fill in this gap and obtain basic information on the chromosome structure of this species. Karyomorphological analysis confirmed the chromosome number 2n = 22 and showed that, despite their apparent uniformity, the chromosomes could be separated into three groups of different size: large (L), medium (M), and small (S). As a first step towards the physical mapping of the hazelnut chromosomes, we applied FISH to localize the position of rRNA genes (rDNA). The sites of 45S and 5S rDNA enabled us to identify two chromosome pairs belonging, respectively, to the L and S groups. The self-GISH procedure revealed that repetitive DNA is concentrated in the pericentromeric regions of the chromosomes, as with other species with rather small genomes. The analysis of 5S rDNA repeats offered additional information on the hazelnut genome by obtaining the whole sequence of the transcribed region so far unpublished. The overall results constitute a substantial advance in hazelnut cytogenetics. Further investigation of other species of Corylus could be an effective approach to understanding the phylogenesis of the genus and resolving taxonomic problems.

  19. Structural polymorphism in the major groove of a 5S RNA gene complements the zinc finger domains of transcription factor IIIA.

    PubMed Central

    Huber, P W; Morii, T; Mei, H Y; Barton, J K

    1991-01-01

    Metal complexes that bind to DNA on the basis of shape-selection have been used to map the conformational features of the DNA binding site for transcription factor IIIA. Conformationally distinct segments are detected on the 5S rRNA gene that correspond closely to the binding sites identified for the individual zinc finger domains of the protein. The local conformations are characterized by a major groove opened because of a change in base pair inclination and/or displacement at a central 5'-pyrimidine-purine-3' step, flanked by a widened minor groove, as would arise at the junctions between alternating B- and A-like DNA segments. Docking experiments with a consensus structure of a zinc finger reveal that the mixed A-B binding site accommodates the peptide domain better than either canonical B- or A-DNA helices. The close structural matching of the conformational variations in the 5S rDNA both to the proposed sites of zinc finger binding and to the shape of an individual zinc finger domain points to DNA structural polymorphism as providing an important determinant in recognition. In particular, shape selection in the 5' half of the internal control region may orient the multiple finger domains. Images PMID:1961749

  20. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array.

  1. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  2. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    PubMed

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes.

  3. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    PubMed

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes. PMID:26835745

  4. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  5. Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA.

    PubMed

    Bullerwell, Charles E; Schnare, Murray N; Gray, Michael W

    2003-03-01

    Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.

  6. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  7. Chromosomal localization of the 18S-28S and 5S rRNA genes and (TTAGGG)n sequences of butterfly lizards (Leiolepis belliana belliana and Leiolepis boehmei, Agamidae, Squamata).

    PubMed

    Srikulnath, Kornsorn; Uno, Yoshinobu; Matsubara, Kazumi; Thongpan, Amara; Suputtitada, Saowanee; Apisitwanich, Somsak; Nishida, Chizuko; Matsuda, Yoichi

    2011-10-01

    Chromosomal mapping of the butterfly lizards Leiolepis belliana belliana and L. boehmei was done using the 18S-28S and 5S rRNA genes and telomeric (TTAGGG)n sequences. The karyotype of L. b. belliana was 2n = 36, whereas that of L. boehmei was 2n = 34. The 18S-28S rRNA genes were located at the secondary constriction of the long arm of chromosome 1, while the 5S rRNA genes were found in the pericentromeric region of chromosome 6 in both species. Hybridization signals for the (TTAGGG)n sequence were observed at the telomeric ends of all chromosomes, as well as interstitially at the same position as the 18S-28S rRNA genes in L. boehmei. This finding suggests that in L. boehmei telomere-to-telomere fusion probably occurred between chromosome 1 and a microchromosome where the 18S-28S rRNA genes were located or, alternatively, at the secondary constriction of chromosome 1. The absence of telomeric sequence signals in chromosome 1 of L. b. belliana suggested that its chromosomes may have only a few copies of the (TTAGGG)n sequence or that there may have been a gradual loss of the repeat sequences during chromosomal evolution.

  8. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central

    2012-01-01

    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  9. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  10. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    PubMed

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  11. Abundant 5S rRNA-like transcripts encoded by the mitochondrial genome in amoebozoa.

    PubMed

    Bullerwell, Charles E; Burger, Gertraud; Gott, Jonatha M; Kourennaia, Olga; Schnare, Murray N; Gray, Michael W

    2010-05-01

    5S rRNAs are ubiquitous components of prokaryotic, chloroplast, and eukaryotic cytosolic ribosomes but are apparently absent from mitochondrial ribosomes (mitoribosomes) of many eukaryotic groups including animals and fungi. Nevertheless, a clearly identifiable, mitochondrion-encoded 5S rRNA is present in Acanthamoeba castellanii, a member of Amoebozoa. During a search for additional mitochondrial 5S rRNAs, we detected small abundant RNAs in other members of Amoebozoa, namely, in the lobose amoeba Hartmannella vermiformis and in the myxomycete slime mold Physarum polycephalum. These RNAs are encoded by mitochondrial DNA (mtDNA), cosediment with mitoribosomes in glycerol gradients, and can be folded into a secondary structure similar to that of bona fide 5S rRNAs. Further, in the mtDNA of another slime mold, Didymium nigripes, we identified a region that in sequence, potential secondary structure, and genomic location is similar to the corresponding region encoding the Physarum small RNA. A mtDNA-encoded small RNA previously identified in Dictyostelium discoideum is here shown to share several characteristics with known 5S rRNAs. Again, we detected genes encoding potential homologs of this RNA in the mtDNA of three other species of the genus Dictyostelium as well as in a related genus, Polysphondylium. Taken together, our results indicate a widespread occurrence of small, abundant, mtDNA-encoded RNAs with 5S rRNA-like structures that are associated with the mitoribosome in various amoebozoan taxa. Our working hypothesis is that these novel small abundant RNAs represent radically divergent mitochondrial 5S rRNA homologs. We posit that currently unrecognized 5S-like RNAs may exist in other mitochondrial systems in which a conventional 5S rRNA cannot be identified.

  12. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    PubMed

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  13. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

    2001-01-01

    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  14. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  15. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    PubMed

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA.

  16. Localized frustration and binding-induced conformational change in recognition of 5S RNA by TFIIIA zinc finger.

    PubMed

    Tan, Cheng; Li, Wenfei; Wang, Wei

    2013-12-19

    Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.

  17. Functional domains of the Xenopus laevis 5S gene promoter.

    PubMed Central

    Pieler, T; Oei, S L; Hamm, J; Engelke, U; Erdmann, V A

    1985-01-01

    To study the fine structure of the Xenopus laevis somatic 5S gene internal control region, we have created 15 different transversions using mutagenic oligonucleotide primers. The effects of these mutations on 5S DNA transcription in vitro as well as on stable complex formation with transcription factor TF III A and TF III C in crude nuclear extracts were analyzed. Mutations in the common class III 5' promoter element (nucleotides 50-61 in the 5S gene) interfere with transcription activity and stable complex formation whenever they contradict the tDNA box A consensus sequence. The second promoter element is defined by a major sequence block (nucleotides 80-89, box C) and two additional internal residues (70 and 71) at a distance of roughly one helical turn from both the major 3' and 5' control sequences; these two 3' elements contain the primary TF III A binding domain. The remaining nucleotides (62-69 and 71-79) when mutated do not interfere with transcription activity or factor binding and thus they constitute two spacer elements within a symmetrically structured 5S gene promoter. An increase in the relative spacing of box A and box C by insertion of 3 bp between nucleotides 66 and 67 leads to a drastic reduction in transcription activity and the ability to form a stable complex with TF III A and/or TF III C. Thus, accurate spacing is essential for the proper orientation of TF III A on 5S DNA and/or TF III C binding. Images Fig. 1. Fig. 3. Fig. 4. PMID:3004969

  18. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  19. Triphosphate residues at the 5' ends of rRNA precursor and 5S RNA from Dictyostelium discoideum.

    PubMed Central

    Batts-Young, B; Lodish, H F

    1978-01-01

    We present here direct evidence for the preservation of a transcriptional initiation sequence in a eukaryotic rRNA precursor: the 5'-end group for precursor to 17S rRNA (p17S RNA) from Dictyostelium discoideum is identified as the triphosphate residue pppA-. We also show that mature 5S RNA form Dictyostelium bears a different triphosphate residue, pppG-. In contrast, we find no evidence for more than one phosphate at the 5' end of the 25S rRNA precursor (p25S RNA). These observations indicate that synthesis of the large ribosomal RNAs of Dictyostelium begins with the 5'-terminal sequence of the p17S RNA, and that 5S RNA transcription must be initiated independently, despite the close association of the 5S and rRNA coding segments. Images PMID:204930

  20. Molecular organization of the 5S rDNA gene type II in elasmobranchs

    PubMed Central

    Castro, Sergio I.; Hleap, Jose S.; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    ABSTRACT The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  1. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  2. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  3. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  4. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  5. Transcription factor IIIA induced bending of the Xenopus somatic 5S gene promoter.

    PubMed

    Schroth, G P; Cook, G R; Bradbury, E M; Gottesfeld, J M

    1989-08-10

    Transcription factor IIIA (TFIIIA), the canonical zinc-finger protein, is a protein of relative molecular mass 39,000 (39K) that is required for transcription of 5S-ribosomal subunit genes in Xenopus. It binds in a sequence-specific manner to the internal control region of the 5S gene (see Fig. 1) and facilitates transcription of the gene by RNA polymerase III. It also binds to the 5S gene product to form a 7S ribonucleoprotein particle. In oocytes the 7S particle acts as a storage form of the RNA to be utilized later in development. TFIIIA binds to DNA through its 30 K N-terminal domain, which contains nine zinc-fingers. TFIIIA was the first protein described to have this type of DNA binding motif, but numerous other proteins have now been shown to have zinc-finger domains. A structure for a single zinc-finger from the yeast protein ADR1, was recently proposed based on two-dimensional NMR data (ref. 8), and a similar structure was proposed based on comparison with crystal structures of other metalloproteins. Although models for the interaction of TFIIIA with the 5S-ribosomal gene DNA have been proposed, based on nuclease digestion and methylation interference data, little precise structural information is available for TFIIIA and the physical basis for the interaction of zinc-fingers with DNA is not understood. Using both circular permutation and circularization assays we provide convincing biochemical evidence that TFIIIA bends the DNA at the internal promoter of the 5S gene.

  6. Chemical accessibility of the 4.5S RNA in spinach chloroplast ribosomes.

    PubMed Central

    Kumagai, I; Bartsch, M; Subramanian, A R; Erdmann, V A

    1983-01-01

    We have examined the accessibility to diethylpyrocarbonate of spinach chloroplast 4.5S ribosomal RNA when free and when it is part of the ribosomal structure. The modifications in free 4.5S RNA were found mostly in single-stranded regions of the secondary structure model proposed in our previous paper (Kumagai, I. et al. (1982) J.B.C. 257, 12924-28): adenines at positions 17, 19, 33, 36, 54, 55, 60, 64, 68, 72, 77, 86 and 87 were identified as the reactive residues. On the other hand, in 4.5S RNA in 70S ribosomes or 50S subunits, adenine 33 was exclusively modified, and its reactivity was much higher than in free 4.5S RNA. This highly accessible A33 of spinach 4.5S RNA is located within a characteristic seven nucleotide sequence, which is found in the 4.5S rRNAs from spinach, tobacco and a fern but deleted in 4.5S RNAs from maize and wheat. Images PMID:6828382

  7. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  8. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio

    2008-01-04

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  9. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  10. Direct 5S rRNA assay for monitoring mixed-culture bioprocesses

    SciTech Connect

    Stoner, D.L.; Bulmer, D.K.; Ward, T.E.

    1996-06-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis in denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the general Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. 40 refs., 12 figs., 1 tab.

  11. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  12. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    PubMed

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis.

  13. Characterization of Ffh of Mycobacterium tuberculosis and its interaction with 4.5S RNA.

    PubMed

    Palaniyandi, Kannan; Veerasamy, Malini; Narayanan, Sujatha

    2012-10-12

    Signal recognition particle (SRP) mediates targeting of proteins to appropriate cellular compartments, which is an important process in all living organisms. In prokaryotes, SRP consists of Ffh, a protein, and 4.5S RNA that recognizes signal peptide emerging from ribosomes. The SRP (Ffh) of one the most successful intracellular pathogen, Mycobacterium tuberculosis, has been investigated with respect to biochemical properties. In the present study, Ffh of M. tuberculosis was overexpressed and was confirmed to be a GTPase using thin layer chromatography and malachite green assay. The GTP binding ability was confirmed by GTP overlay assay. The 4.5S RNA sequence of M. tuberculosis was synthesized by in vitro transcription assay. The interaction between Ffh and 4.5S RNA was confirmed by overlay assay and RNA gel shift assay. The results show that the biochemical properties of M. tuberculosis Ffh have been conserved, and this is the first report that shows the interaction of components of SRP in M. tuberculosis, namely Ffh protein and 4.5S RNA.

  14. The 5-S RNA . protein complex from an extreme halophile, Halobacterium cutirubrum. Purification and characterization.

    PubMed

    Smith, N; Matheson, A T; Yaguchi, M; Willick, G E; Nazar, R N

    1978-09-01

    A 5-S RNA . protein complex has been isolated from the 50-S ribosomal subunit of an extreme halophile, Halobacterium cutirubrum. The 50-S ribosomal subunit from the extreme halophile requires 3.4 M K+ and 100 mM Mg2+ for stability. However, if the high K+ concentration is maintained but the Mg2+ concentration lowered to 0.3 mM, the 5-S RNA . protein complex is selectively extracted from the subunit. After being purified on an Agarose 0.5-m column the complex had a molecular weight of about 80000 and contained 5-S RNA and two proteins, HL13 and HL19, with molecular weights (by sedimentation equilibrium) of 18700 and 18000, respectively. No ATPase or GTPase activity could be detected in the 5-S RNA . protein complex. The amino acid composition and electrophoretic mobility on polyacrylamide gels indicated both proteins were much more acidic than the equivalent from Escherichia coli or Bacillus stearothermophilus. Partial amino acid sequence data suggest HL13 is homologous to EL18 and HL19 to EL5.

  15. 5 S and 5.8 S ribosomal RNA sequences and protist phylogenetics.

    PubMed

    Walker, W F

    1985-01-01

    More than 100 5 S 5.8 S rRNA sequences from protists, including fungi, are known. Through a combination of quantitative treeing and special consideration of "signature' nucleotide combinations, the most significant phylogenetic implications of these data are emphasized. Also, limitations of the data for phylogenetic inferences are discussed and other significant data are brought to bear on the inferences obtained. 5 S sequences from red algae are seen as the most isolated among eukaryotics. A 5 S sequence lineage consisting of oomycetes, euglenoids, most protozoa, most slime molds and perhaps dinoflagellates and mesozoa is defined. Such a lineage is not evident from 5.8 S rRNA or cytochrome c sequence data. 5 S sequences from Ascomycota and Basidiomycota are consistent with the proposal that each is derived from a mycelial form with a haploid yeast phase and simple septal pores, probably most resembling present Taphrinales. 5 S sequences from Chytridiomycota and Zygomycota are not clearly distinct from each other and suggest that a major lineage radiation occurred in the early history of each. Qualitative biochemical data clearly supports a dichotomy between an Ascomycota-Basidiomycota lineage and a Zygomycota-Chytridiomycota lineage.

  16. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  17. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria.

    PubMed

    Smirnov, Alexandre; Tarassov, Ivan; Mager-Heckel, Anne-Marie; Letzelter, Michel; Martin, Robert P; Krasheninnikov, Igor A; Entelis, Nina

    2008-04-01

    RNA import into mitochondria is a widespread phenomenon. Studied in details for yeast, protists, and plants, it still awaits thorough investigation for human cells, in which the nuclear DNA-encoded 5S rRNA is imported. Only the general requirements for this pathway have been described, whereas specific protein factors needed for 5S rRNA delivery into mitochondria and its structural determinants of import remain unknown. In this study, a systematic analysis of the possible role of human 5S rRNA structural elements in import was performed. Our experiments in vitro and in vivo show that two distinct regions of the human 5S rRNA molecule are needed for its mitochondrial targeting. One of them is located in the proximal part of the helix I and contains a conserved uncompensated G:U pair. The second and most important one is associated with the loop E-helix IV region with several noncanonical structural features. Destruction or even destabilization of these sites leads to a significant decrease of the 5S rRNA import efficiency. On the contrary, the beta-domain of the 5S rRNA was proven to be dispensable for import, and thus it can be deleted or substituted without affecting the 5S rRNA importability. This finding was used to demonstrate that the 5S rRNA can function as a vector for delivering heterologous RNA sequences into human mitochondria. 5S rRNA-based vectors containing a substitution of a part of the beta-domain by a foreign RNA sequence were shown to be much more efficiently imported in vivo than the wild-type 5S rRNA.

  18. The nuclear 5S RNAs from chicken, rat and man. U5 RNAs are encoded by multiple genes.

    PubMed

    Krol, A; Gallinaro, H; Lazar, E; Jacob, M; Branlant, C

    1981-02-25

    Preparations of chicken, rat and human nuclear 5S RNA contain two sets of molecules. The set with the lowest electrophoretic mobility (5Sa) contains RNAs identical or closely related to ribosomal 5S RNA from the corresponding animal species. In HeLa cells and rat brain, we only detected an RNA identical to the ribosomal 5S RNA. In hen brain and liver, we found other species differing by a limited number of substitutions. The results suggest that mutated 5S genes may be expressed differently according to the cell type. The set with the highest mobility corresponds to U5 RNA. In both rat brain and HeLa cells, U5 RNA was found to be composed of 4 and 5 different molecules respectively (U5A, U5B1-4) differing by a small number of substitutions or insertions. In hen brain, no U5B was detected but U5A' differing from U5A by the absence of the 3'-terminal adenosine. All the U5 RNAs contain the same set of modified nucleotides. They also have the same secondary structure which consists of two hairpins joined together by a 17 nucleotide long single-stranded region. The 3' half of the molecule has a compact conformation. Together, the results suggest that U5 RNAs are transcribed from a multigene family and that mutated genes may be expressed as far as secondary structure is conserved. The conformation of U5 RNA is likely to be related to its function and it is of interest to mention that several similarities of structure are found between U5 and U1A RNA.

  19. Evolutionary dynamics of the 5S rDNA gene family in the mussel Mytilus: mixed effects of birth-and-death and concerted evolution.

    PubMed

    Freire, Ruth; Arias, Alberto; Insua, Ana M; Méndez, Josefina; Eirín-López, José M

    2010-05-01

    In higher eukaryotes, the gene family encoding the 5S ribosomal RNA (5S rRNA) has been used (together with histones) to showcase the archetypal example of a gene family subject to concerted evolution. However, recent studies have revealed conspicuous features challenging the predictions of this model, including heterogeneity of repeat units, the presence of functional 5S gene variants as well as the existence of 5S rDNA divergent pseudogenes lacking traces of homogenization. In the present work, we have broadened the scope in the evolutionary study of ribosomal gene families by studying the 5S rRNA family in mussels, a model organism which stands out among other animals due to the heterogeneity it displays regarding sequence and organization. To this end, 48 previously unknown 5S rDNA units (coding and spacer regions) were sequenced in five mussel species, leading to the characterization of two new types of units (referred to here as small-beta 5S rDNA and gamma-5S rDNA) coexisting in the genome with alpha and beta rDNA units. The intense genetic dynamics of this family is further supported by the first description of an association between gamma-5S rDNA units and tRNA genes. Molecular evolutionary and phylogenetic analyses revealed an extensive lack of homology among spacer sequences belonging to different rDNA types, suggesting the presence of independent evolutionary pathways leading to their differentiation. Overall, our results suggest that the long-term evolution of the 5S rRNA gene family in mussels is most likely mediated by a mixed mechanism involving the generation of genetic diversity through birth-and-death, followed by a process of local homogenization resulting from concerted evolution in order to maintain the genetic identities of the different 5S units, probably after their transposition to independent chromosomal locations.

  20. Characterization of a novel association between two trypanosome-specific proteins and 5S rRNA.

    PubMed

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC.

  1. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  2. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    NASA Astrophysics Data System (ADS)

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  3. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    PubMed

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  4. Taxonomy of 5 S ribosomal RNA by the linguistic technique: probing with mitochondrial and mammalian sequences.

    PubMed

    Guimarães, R C; Trifonov, E N; Lagunez-Otero, J

    1997-09-01

    Linguistic similarities and dissimilarities between 5 S rRNA sequences allowed taxonomical separation of species and classes. Comparisons with the molecule from mammals distinguished fungi and plants from protists and animals. Similarities to mammalians progressively increased from protists to invertebrates and to somatic-type molecules of the vertebrates lineage. In this, deviations were detected in avian, oocyte type, and pseudogene sequences. Among bacteria, actinobacteria were most similar to the mammalians, which could be related to the high frequency of associations among members of these groups. Some archaebacterial species most similar to the mammalians belonged to the Thermoproteales and Halobacteria groups. Comparisons with the soybean mitochondrial molecule revealed high internal homogeneity among plant mitochondria. The eubacterial groups most similar to it were Thermus and Rhodobacteria gamma-1 and alpha-2. Other procedures have already indicated similarities of Rhodobacteria alpha to mitochondria but the linguistic similarities were on the average higher with the first two groups.

  5. Release of ribosome-bound 5S rRNA upon cleavage of the phosphodiester bond between nucleotides A54 and A55 in 5S rRNA.

    PubMed

    Holmberg, L; Nygård, O

    2000-11-01

    Reticulocyte lysates contain ribosome-bound and free populations of 5S RNA. The free population is sensitive to nuclease cleavage in the internal loop B, at the phosphodiester bond connecting nucleotides A54 and A55. Similar cleavage sites were detected in 5S rRNA in 60S subunits and 80S ribosomes. However, 5S rRNA in reticulocyte polysomes is insensitive to cleavage unless ribosomes are salt-washed. This suggests that a translational factor protects the backbone surrounding A54 from cleavage in polysomes. Upon nuclease treatment of mouse 60S subunits or reticulocyte lysates a small population of ribosomes released its 5S rRNA together with ribosomal protein L5. Furthermore, rRNA sequences from 5.8S, 28S and 18S rRNA were released. In 18S rRNA the sequences mainly originate from the 630 loop and stem (helix 18) in the 5' domain, whereas in 28S rRNA a majority of fragments is derived from helices 47 and 81 in domains III and V, respectively. We speculate that this type of rRNA-fragmentation may mimic a ribosome degradation pathway.

  6. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    PubMed

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  7. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  8. Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

    NASA Technical Reports Server (NTRS)

    Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

    1985-01-01

    The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

  9. Seasonal dynamics of bacterioplankton community structure in a eutrophic lake as determined by 5S rRNA analysis.

    PubMed

    Höfle, M G; Haas, H; Dominik, K

    1999-07-01

    Community structure of bacterioplankton was studied during the major growth season for phytoplankton (April to October) in the epilimnion of a temperate eutrophic lake (Lake Plusssee, northern Germany) by using comparative 5S rRNA analysis. Estimates of the relative abundances of single taxonomic groups were made on the basis of the amounts of single 5S rRNA bands obtained after high-resolution electrophoresis of RNA directly from the bacterioplankton. Full-sequence analysis of single environmental 5S rRNAs enabled the identification of single taxonomic groups of bacteria. Comparison of partial 5S rRNA sequences allowed the detection of changes of single taxa over time. Overall, the whole bacterioplankton community showed two to eight abundant (>4% of the total 5S rRNA) taxa. A distinctive seasonal succession was observed in the taxonomic structure of this pelagic community. A rather-stable community structure, with seven to eight different taxonomic units, was observed beginning in April during the spring phytoplankton bloom. A strong reduction in this diversity occurred at the beginning of the clear-water phase (early May), when only two to four abundant taxa were observed, with one taxon dominating (up to 72% of the total 5S rRNA). The community structure during summer stagnation (June and July) was characterized by frequent changes of different dominating taxa. During late summer, a dinoflagellate bloom (Ceratium hirudinella) occurred, with Comamonas acidovorans (beta-subclass of the class Proteobacteria) becoming the dominant bacterial species (average abundance of 43% of the total 5S rRNA). Finally, the seasonal dynamics of the community structure of bacterioplankton were compared with the abundances of other major groups of the aquatic food web, such as phyto- and zooplankton, revealing that strong grazing pressure by zooplankton can reduce microbial diversity substantially in pelagic environments.

  10. Species-genomic relationships among the tribasic diploid and polyploid Carthamus taxa based on physical mapping of active and inactive 18S-5.8S-26S and 5S ribosomal RNA gene families, and the two tandemly repeated DNA sequences.

    PubMed

    Agrawal, Renuka; Tsujimoto, Hisashi; Tandon, Rajesh; Rao, Satyawada Rama; Raina, Soom Nath

    2013-05-25

    In the genus Carthamus (2n=20, 22, 24, 44, 64; x=10, 11, 12), most of the homologues within and between the chromosome complements are difficult to be identified. In the present work, we used fluorescent in situ hybridisation (FISH) to determine the chromosome distribution of the two rRNA gene families, and the two isolated repeated DNA sequences in the 14 Carthamus taxa. The distinctive variability in the distribution, number and signal intensity of hybridisation sites for 18S-26S and 5S rDNA loci could generally distinguish the 14 Carthamus taxa. Active 18S-26S rDNA sites were generally associated with NOR loci on the nucleolar chromosomes. The two A genome taxa, C. glaucus ssp. anatolicus and C. boissieri with 2n=20, and the two botanical varieties of B genome C. tinctorius (2n=24) had diagnostic FISH patterns. The present results support the origin of C. tinctorius from C. palaestinus. FISH patterns of C. arborescens vis-à-vis the other taxa indicate a clear division of Carthamus taxa into two distinct lineages. Comparative distribution and intensity pattern of 18S-26S rDNA sites could distinguish each of the tetraploid and hexaploid taxa. The present results indicate that C. boissieri (2n=20) is one of the genome donors for C. lanatus and C. lanatus ssp. lanatus (2n=44), and C. lanatus is one of the progenitors for the hexaploid (2n=64) taxa. The association of pCtKpnI-2 repeated sequence with rRNA gene cluster (orphon) in 2-10 nucleolar and non-nucleolar chromosomes and the consistent occurrence of pCtKpnI-1 repeated sequence at the subtelomeric region in all the taxa analysed indicate some functional role of these sequences.

  11. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  12. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  13. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  14. Eukaryotic origins: string analysis of 5S ribosomal RNA sequences from some relevant organisms.

    PubMed

    Nanney, D L; Mobley, D O; Preparata, R M; Meyer, E B; Simon, E M

    1991-04-01

    Using the PHYLOGEN tree-forming programs, we evaluate the published 5S rRNA sequences in certain of the files in the Berlin DataBank in an attempt to identify the connection between archaebacteria and the eukaryotic protists. These programs are based on methods of string analysis developed by Sankoff and others. Their discriminatory power is derived from their continuous realignment of sequences through repeated assessment of insertions and deletions as well as substitutions. The programs demonstrate that even these small molecules (ca. 120 bases) retain substantial records of evolutionary events that occurred over a billion years ago. The eukaryotes seem to have been derived from ancestors near the common origins of the halobacterial and Methanococcales groups. Identifying what might have been a primordial eukaryote is more difficult because several of the species considered as early derivatives from the common root are isolated species with large genetic differences from each other and from all other extant forms that have been sequenced. The ameboid, flagellated, and ciliated protists seem to have emerged nearly simultaneously from an ancient cluster, but the sarcodinid protozoa have preference as the group of most ancient origin. The euglenozoa and the ciliates are of later derivation. Our ability to tease plausible trees from such small molecules suggests that the mode of analysis rather than the size of the molecule is often a major limitation in the reconstruction of acceptable ancient phylogenics.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. RNA splicing and genes

    SciTech Connect

    Sharp, P.A.

    1988-11-25

    The splicing of long transcripts RNA (copied from DNA in the cell nucleus) into smaller specific mRNA is an important event in the regulation of gene expression in eukaryotic cells. The splicing reaction occurs as a late step in the nuclear pathway for synthesis of mRNAs. This pathway commences with initiation of transcription by RNA polymerase II and probably involves an integrated series of steps each dependent on previous events. Splicing of precursors to mRNAs involves the formation of a spliceosome complex containing 5' and 3' splice sites. This complex contains the evolutionary highly conserved small nuclear RNAs (snRNAs) Us, U4, U5, and U6. The most abundant snRNA, U1, is required to form the spliceosome and may be a part of the spliceosome. Analogues of these snRNAs have been identified in yeast. Assembly of the spliceosome probably involves the binding of a multi-snRNA complex containing U4, U5, and U6 snRNAs. Several observations suggest that the association of snRNAs in such complexes is quite dynamic. It is argued that the snRANs in the spliceosome form a catalytic RNA structure that is responsible for the cleavage and ligation steps during splicing.

  16. In Vivo Production of Small Recombinant RNAs Embedded in a 5S rRNA-Derived Protective Scaffold.

    PubMed

    Stepanov, Victor G; Fox, George E

    2015-01-01

    Preparative synthesis of RNA is a challenging task that is usually accomplished using either chemical or enzymatic polymerization of ribonucleotides in vitro. Herein, we describe an alternative approach in which RNAs of interest are expressed as a fusion with a 5S rRNA-derived scaffold. The scaffold provides protection against cellular ribonucleases resulting in cellular accumulations comparable to those of regular ribosomal RNAs. After isolation of the chimeric RNA from the cells, the scaffold can be removed if necessary by deoxyribozyme-catalyzed cleavage followed by preparative electrophoretic separation of the cleavage reaction products. The protocol is designed for sustained production of high quality RNA on the milligram scale.

  17. Restriction fragment length polymorphism of the 5S-rRNA-NTS region: a rapid and precise method for plant identification.

    PubMed

    Bertea, Cinzia Margherita; Gnavi, Giorgio

    2012-01-01

    Molecular genetic methods have several advantages over classical morphological and chemical analyses. The genetic method requires genotype instead than phenotype, therefore PCR-based techniques have been widely used for a rapid identification of plant species, varieties and chemotypes. Recently, the molecular discrimination of some higher plant species has been evaluated using sequences of a 5S-rRNA gene spacer region. The variation in the nontranscribed sequence (NTS) region has been used in a number of plant species for studying intraspecific variation, genome evolution, and phylogenetic reconstruction. Here, we describe a rapid method based on the use of the 5S-rRNA-NTS region as a tool for plant DNA fingerprinting, which combines PCR, sequencing and restriction fragment length polymorphism analyses. PMID:22419491

  18. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.

    PubMed

    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto

    2015-01-01

    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group. PMID:26329975

  19. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.

    PubMed

    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto

    2015-01-01

    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group.

  20. What does the 5S rRNA multigene family tell us about the origin of the annual Triticeae (Poaceae)?

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2013-05-01

    We have investigated the complex relationships among the annual genera within the tribe Triticeae through phylogenetic analyses of the 5S rRNA multigene family. Cloned sequences were assigned to groups of orthologous sequences, called unit classes, that were subjected to several analyses including BLAST (Basic Local Alignment Search Tool) searches to assess possible ancestral relationships with perennial genera; phylogenetic analyses using parsimony (Pars), maximum likelihood (ML), and Bayesian methods; and minimum reticulation networks from the Pars, ML, and Bayesian trees. In this study, we included genera with both annual and perennial species, such as Dasypyrum, Hordeum, and Secale. BLAST pointed to Pseudoroegneria (carrier of the St genome) and possibly Thinopyrum (carrier of the J genome) as the potential next of kin. However, Thinopyrum and Pseudoroegneria have never fallen together on the individual trees with the former generally associated with Crithopsis, Aegilops, Triticum, and Dasypyrum, while the latter is usually associated with the rest of the genera within Triticeae. The "long" unit classes placed Dasypyrum breviaristatum together with Dasypyrum villosum, whereas the "short" unit classes put them far apart on the trees. None of the gene trees alone was able to summarize the complex relationships among the genera, in line with previous results in the Triticeae. However, the application of tools designed to display phylogenetic networks was able to depict the complex links among the genera based on the short and the long gene trees, including the close link between Thinopyrum and Pseudoroegneria suggested by the phylogenetic analyses. In addition, our analyses provide support for the hypothesis that at least some annual Triticeae taxa are derived from their perennial relatives. PMID:23789993

  1. Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

    PubMed Central

    Carol, P; Rozier, C; Lazaro, E; Ballesta, J P; Mache, R

    1993-01-01

    The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain. Images PMID:8441674

  2. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed Central

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-01-01

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  3. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period.

  4. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  5. Characterization and physical mapping of 18S and 5S ribosomal genes in Indian major carps (Pisces, Cyprinidae).

    PubMed

    Ravindra Kumar; Kushwaha, Basdeo; Nagpure, Naresh S

    2013-06-01

    Characterization of the major (18S) and minor (5S) ribosomal RNA genes were carried out in three commercially important Indian major carp (IMC) species, viz. Catla catla, Labeo rohita and Cirrhinus mrigala along with their physical localizations using dual colour fluorescence in situ hybridization. The diploid chromosome number in the above carps was confirmed to be 50 with inter-species karyo-morphological variations. The 18S rDNA signals were observed on 3 pair of chromosomes in C. catla and L. rohita, and two pairs in C. mrigala. The 5S rDNA signal was found on single pair of chromosome in all the species with variation in their position on chromosomes. The sequencing of 18S rDNA generated 1804, 1805 and 1805 bp long fragments, respectively, in C. catla, L. rohita and C. mrigala with more than 98% sequence identity among them. Similarly, sequencing of 5S rDNA generated 191 bp long fragments in the three species with 100% identity in coding region and 23.2% overall variability in non-transcribed spacer region. Thus, these molecular markers could be used as species-specific markers for taxonomic identification and might help in understanding the genetic diversity, genome organization and karyotype evolution of these species.

  6. Structural and functional exchangeability of 5 S RNA species from the eubacterium E.coli and the thermoacidophilic archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Teixidò, J; Altamura, S; Londei, P; Amils, R

    1989-01-01

    The role of 5 S RNA within the large ribosomal subunit of the extremely thermophilic archaebacterium Sulfolobus solfataricus has been analysed by means of in vitro reconstitution procedures. It is shown that Sulfolobus 50 S subunits reconstituted in the absence of 5 S RNA are inactive in protein synthesis and lack 2-3 ribosomal proteins. Furthermore, it has been determined that in the course of the in vitro assembly process Sulfolobus 5 S RNA can be replaced by the correspondent RNA species of E.coli; Sulfolobus reconstituted particles containing the eubacterial 5 S molecule are stable and active in polypeptide synthesis at high temperatures. Images PMID:2493632

  7. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  8. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides

    PubMed Central

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S.; McBee, Megan E.; Dedon, Peter C.

    2015-01-01

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. PMID:25539917

  9. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    PubMed

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria.

  10. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

    PubMed

    Galián, J A; Rosato, M; Rosselló, J A

    2012-06-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  11. Cocrystallizing natural RNA with its unnatural mirror image: biochemical and preliminary X-ray diffraction analysis of a 5S rRNA A-helix racemate

    SciTech Connect

    Förster, Charlotte; Brauer, Arnd B. E.; Lehmann, Daniel; Borowski, Tordis; Brode, Svenja; Fürste, Jens P.; Perbandt, Markus; Betzel, Christian

    2007-10-01

    A 5S rRNA A-helix 7-mer oligonucleotide was chemically synthesized both as d-RNA and as l-RNA, biochemically investigated, crystallized as a stochiometric racemate and examined by X-ray diffraction. Chemically synthesized RNAs with the unnatural l-configuration possess enhanced in vivo stability and nuclease resistance, which is a highly desirable property for pharmacological applications. For a structural comparison, both l- and d-RNA oligonucleotides of a shortened Thermus flavus 5S rRNA A-helix were chemically synthesized. The enantiomeric RNA duplexes were stochiometrically cocrystallized as a racemate, which enabled analysis of the d- and l-RNA enantiomers in the same crystals. In addition to a biochemical investigation, diffraction data were collected to 3.0 Å resolution using synchrotron radiation. The crystals belonged to space group P3{sub 1}21, with unit-cell parameters a = b = 35.59, c = 135.30 Å, γ = 120° and two molecules per asymmetric unit.

  12. Cytogenetic mapping of 5S and 18S rRNAs and H3 histone genes in 4 ancient Proscopiidae grasshopper species: contribution to understanding the evolutionary dynamics of multigene families.

    PubMed

    Cabral-de-Mello, D C; Martins, C; Souza, M J; Moura, R C

    2011-01-01

    This paper reports on the chromosomal location of 18S rRNA, 5S rRNA and H3 histone multigene families in 4 species of a relatively ancient and diversified group of grasshoppers belonging to the family Proscopiidae. The 5S rRNA and H3 histone genes were highly conserved in the number of sites and chromosomal position in the 4th chromosome pair in all species analyzed, whereas the 18S rRNA genes showed slightly more variation because they were present on one or 2 chromosome pairs, depending on the species. The 5S and 18S rRNA gene families occurred in different chromosomes; in contrast, H3 histone and 5S rRNA genes co-localized in the same chromosomal position, with an apparently interspersed organization. Considering that the Proscopiidae family is a relatively ancient group compared with the Acrididae family, the association of the H3 histone and 5S rRNA multigene families can represent a basal condition for grasshoppers, although more research is needed on other representatives of this insect group to confirm this statement. The presence of such an association of 5S rDNA and H3 histone in mussels and arthropods (beetles, grasshoppers and crustaceans) suggests that this linked configuration could represent an ancestral pattern for invertebrates. These results provide new insights into the understanding of the genome organization and the evolution of multigene families in grasshoppers and in insects as a whole.

  13. RNA-mediated gene activation

    PubMed Central

    Jiao, Alan L; Slack, Frank J

    2014-01-01

    The regulation of gene expression by non-coding RNAs (ncRNAs) has become a new paradigm in biology. RNA-mediated gene silencing pathways have been studied extensively, revealing diverse epigenetic and posttranscriptional mechanisms. In contrast, the roles of ncRNAs in activating gene expression remains poorly understood. In this review, we summarize the current knowledge of gene activation by small RNAs, long non-coding RNAs, and enhancer-derived RNAs, with an emphasis on epigenetic mechanisms. PMID:24185374

  14. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    PubMed

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  15. Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells.

    PubMed

    Wang, Xinyu; Ren, Yanli; Wang, Zhiqiong; Xiong, Xiangyu; Han, Sichong; Pan, Wenting; Chen, Hongwei; Zhou, Liqing; Zhou, Changchun; Yuan, Qipeng; Yang, Ming

    2015-12-21

    5S rRNA plays an important part in ribosome biology and is over-expression in multiple cancers. In this study, we found that 5S rRNA is a direct target of miR-150 and miR-383 in esophageal squamous cell carcinoma (ESCC). Overexpression of miR-150 and miR-383 inhibited ESCC cell proliferation in vitro and in vivo. Moreover, 5S rRNA silencing by miR-150 and miR-383 might intensify rpL11-c-Myc interaction, which attenuated role of c-Myc as an oncogenic transcriptional factor and dysregulation of multiple c-Myc target genes. Taken together, our results highlight the involvement of miRNAs in ribosomal regulation during tumorigenesis.

  16. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    PubMed

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  17. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment. PMID:22724546

  18. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

  19. A novel association between two trypanosome-specific factors and the conserved L5-5S rRNA complex.

    PubMed

    Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis.

  20. Natural Microbial Community Compositions Compared by a Back-Propagating Neural Network and Cluster Analysis of 5S rRNA

    PubMed Central

    Noble, P. A.; Bidle, K. D.; Fletcher, M.

    1997-01-01

    The community compositions of free-living and particle-associated bacteria in the Chesapeake Bay estuary were analyzed by comparing banding patterns of stable low-molecular-weight RNA (SLMW RNA) which include 5S rRNA and tRNA molecules. By analyzing images of autoradiographs of SLMW RNAs on polyacrylamide gels, band intensities of 5S rRNA were converted to binary format for transmission to a back-propagating neural network (NN). The NN was trained to relate binary input to sample stations, collection times, positions in the water column, and sample types (e.g., particle-associated versus free-living communities). Dendrograms produced by using Euclidean distance and average and Ward's linkage methods on data of three independently trained NNs yielded the following results. (i) Community compositions of Chesapeake Bay water samples varied both seasonally and spatially. (ii) Although there was no difference in the compositions of free-living and particle-associated bacteria in the summer, these community types differed significantly in the winter. (iii) In the summer, most bay samples had a common 121-nucleotide 5S rRNA molecule. Although this band occurred in the top water of midbay samples, it did not occur in particle-associated communities of bottom-water samples. (iv) Regardless of the season, midbay samples had the greatest variety of 5S rRNA sizes. The utility of NNs for interpreting complex banding patterns in electrophoresis gels was demonstrated. PMID:16535593

  1. Comparative calorimetric studies on the dynamic conformation of plant 5S rRNA. I. Thermal unfolding pattern of lupin seeds and wheat germ 5S rRNAs, also in the presence of magnesium and sperminium cations.

    PubMed Central

    Barciszewski, J; Bratek-Wiewiórowska, M D; Górnicki, P; Naskret-Barciszewska, M; Wiewiórowski, M; Zielenkiewicz, A; Zielenkiewicz, W

    1988-01-01

    An attempt has been made to correlate differential scanning calorimetry melting profiles of 5S rRNAs from lupin seeds (L.s.) and wheat germ (W.g.) with their structure. It is suggested that the observed differences in thermal unfolding are due to differences in RNA nucleotide sequence and as a consequence in higher order structures. Interesting effects induced by magnesium cation, perprotonated and permethylated sperminium tetracations are discussed. It is suggested that the difference in the stabilizing effect of the three cations results from different mode of their interactions with RNA. "Pure" electrostatic interactions expected for permethylated tetracations are rather weak due to the steric hindrance around each positively charged nitrogen atom. Electrostatic interactions of the other two cations are significantly enhanced by coordination bonding for magnesium and by hydrogen bonding for protonated sperminium cation. PMID:3340550

  2. Molecular dissection of the rDNA array and of the 5S rDNA gene in Meloidogyne artiellia: phylogenetic and diagnostic implications.

    PubMed

    Veronico, Pasqua; De Luca, Francesca; De Giorgi, Carla

    2004-06-01

    The sequence of a 13.423 nucleotide genomic fragment has been determined for the plant parasitic nematode Meloidogyne artiellia. It contains an entire rDNA cluster, the bordering intergenic regions and portions of the flanking coding regions. The sequence analysis of the rDNA repeats suggests homogeneity in M. artiellia, thus providing a further indication of the usefulness of these genes for the diagnostic identification of this species. The comparison of the secondary structures of the internal transcribed spacer 2 region in several Meloidogyne species indicates that RNA folding predictions can be used as a tool of potential diagnostic relevance. The other ribosomal gene, 5S rDNA, has been demonstrated to be functional and located near the trans-spliced leader sequences, in the same arrangement found in the distantly related nematode Caenorhabditis elegans but never in other Meloidogyne thus providing species-specific markers for the identification of several Thylenchida parasitic nematodes. PMID:15135452

  3. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.

    2016-01-01

    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  4. Mitochondrial RNA granules: Compartmentalizing mitochondrial gene expression

    PubMed Central

    Jourdain, Alexis A.; Boehm, Erik; Maundrell, Kinsey

    2016-01-01

    In mitochondria, DNA replication, gene expression, and RNA degradation machineries coexist within a common nondelimited space, raising the question of how functional compartmentalization of gene expression is achieved. Here, we discuss the recently characterized “mitochondrial RNA granules,” mitochondrial subdomains with an emerging role in the regulation of gene expression. PMID:26953349

  5. Ultraviolet light-induced crosslinking reveals a unique region of local tertiary structure in potato spindle tuber viroid and HeLa 5S RNA

    SciTech Connect

    Branch, A.D.; Benenfeld, B.J.; Robertson, H.D.

    1985-10-01

    The positions of intramolecular crosslinks induced by irradiation with ultraviolet light were mapped into potato spindle tuber viroid RNA and HeLa 5S rRNA. Crosslinking in each of these molecules occurred at a single major site, which was located by RNA fingerprinting and secondary analysis. Various lines of evidence suggest that these crosslinks identify a previously undescribed element of local tertiary structure common to these two widely divergent RNA molecules: (i) both crosslinks occur in an identical eight-base context, with the sequence 5 GGGAA 3 on one side and the sequence 5 UAC 3 on the other; (ii) both crosslinks connect bases that are not thought to be involved in conventional hydrogen bonding, within regions usually depicted as single-stranded loops flanked by short helical segments; and (iii) both crosslinks connect a purine and a pyrimidine residue, and both may generate the same G-U dimer. Furthermore, it is likely that the crosslinking site is of functional significance because it is located within the most highly conserved region of the viroid sequence and involves bases that are essentially invariant among eukaryotic 5S rRNA molecules.

  6. The RNA gene information: retroelement-microRNA entangling as the RNA quantum code.

    PubMed

    Fujii, Yoichi Robertus

    2013-01-01

    MicroRNA (miRNA) and retroelements may be a master of regulator in our life, which are evolutionally involved in the origin of species. To support the Darwinism from the aspect of molecular evolution process, it has tremendously been interested in the molecular information of naive RNA. The RNA wave model 2000 consists of four concepts that have altered from original idea of the miRNA genes for crosstalk among embryonic stem cells, their niche cells, and retroelements as a carrier vesicle of the RNA genes. (1) the miRNA gene as a mobile genetic element induces transcriptional and posttranscriptional silencing via networking-processes (no hierarchical architecture); (2) the RNA information supplied by the miRNA genes expands to intracellular, intercellular, intraorgan, interorgan, intraspecies, and interspecies under the cycle of life into the global environment; (3) the mobile miRNAs can self-proliferate; and (4) cells contain two types information as resident and genomic miRNAs. Based on RNA wave, we have developed an interest in investigation of the transformation from RNA information to quantum bits as physicochemical characters of RNA with the measurement of RNA electron spin. When it would have been given that the fundamental bases for the acquired characters in genetics can be controlled by RNA gene information, it may be available to apply for challenging against RNA gene diseases, such as stress-induced diseases.

  7. rrnDB: documenting the number of rRNA and tRNA genes in bacteria and archaea.

    PubMed

    Lee, Zarraz May-Ping; Bussema, Carl; Schmidt, Thomas M

    2009-01-01

    A dramatic exception to the general pattern of single-copy genes in bacterial and archaeal genomes is the presence of 1-15 copies of each ribosomal RNA encoding gene. The original version of the Ribosomal RNA Database (rrnDB) cataloged estimates of the number of 16S rRNA-encoding genes; the database now includes the number of genes encoding each of the rRNAs (5S, 16S and 23S), an internally transcribed spacer region, and the number of tRNA genes. The rrnDB has been used largely by microbiologists to predict the relative rate at which microbial populations respond to favorable growth conditions, and to interpret 16S rRNA-based surveys of microbial communities. To expand the functionality of the rrnDB (http://ribosome.mmg.msu.edu/rrndb/index.php), the search engine has been redesigned to allow database searches based on 16S rRNA gene copy number, specific organisms or taxonomic subsets of organisms. The revamped database also computes average gene copy numbers for any collection of entries selected. Curation tools now permit rapid updates, resulting in an expansion of the database to include data for 785 bacterial and 69 archaeal strains. The rrnDB continues to serve as the authoritative, curated source that documents the phylogenetic distribution of rRNA and tRNA genes in microbial genomes.

  8. Interaction of ribosomal proteins S5, S6, S11, S12, S18 and S21 with 16 S rRNA.

    PubMed

    Stern, S; Powers, T; Changchien, L M; Noller, H F

    1988-06-20

    We have examined the effects of assembly of ribosomal proteins S5, S6, S11, S12, S18 and S21 on the reactivities of residues in 16 S rRNA towards chemical probes. The results show that S6, S18 and S11 interact with the 690-720 and 790 loop regions of 16 S rRNA in a highly co-operative manner, that is consistent with the previously defined assembly map relationships among these proteins. The results also indicate that these proteins, one of which (S18) has previously been implicated as a component of the ribosomal P-site, interact with residues near some of the recently defined P-site (class II tRNA protection) nucleotides in 16 S rRNA. In addition, assembly of protein S12 has been found to result in the protection of residues in both the 530 stem/loop and the 900 stem regions; the latter group is closely juxtaposed to a segment of 16 S rRNA recently shown to be protected from chemical probes by streptomycin. Interestingly, both S5 and S12 appear to protect, to differing degrees, a well-defined set of residues in the 900 stem/loop and 5'-terminal regions. These observations are discussed in terms of the effects of S5 and S12 on streptomycin binding, and in terms of the class III tRNA protection found in the 900 stem of 16 S rRNA. Altogether these results show that many of the small subunit proteins, which have previously been shown to be functionally important, appear to be associated with functionally implicated segments of 16 S rRNA.

  9. Gene expression: RNA interference in adult mice

    NASA Astrophysics Data System (ADS)

    McCaffrey, Anton P.; Meuse, Leonard; Pham, Thu-Thao T.; Conklin, Douglas S.; Hannon, Gregory J.; Kay, Mark A.

    2002-07-01

    RNA interference is an evolutionarily conserved surveillance mechanism that responds to double-stranded RNA by sequence-specific silencing of homologous genes. Here we show that transgene expression can be suppressed in adult mice by synthetic small interfering RNAs and by small-hairpin RNAs transcribed in vivo from DNA templates. We also show the therapeutic potential of this technique by demonstrating effective targeting of a sequence from hepatitis C virus by RNA interference in vivo.

  10. Computational prediction of microRNA genes.

    PubMed

    Hertel, Jana; Langenberger, David; Stadler, Peter F

    2014-01-01

    The computational identification of novel microRNA (miRNA) genes is a challenging task in bioinformatics. Massive amounts of data describing unknown functional RNA transcripts have to be analyzed for putative miRNA candidates with automated computational pipelines. Beyond those miRNAs that meet the classical definition, high-throughput sequencing techniques have revealed additional miRNA-like molecules that are derived by alternative biogenesis pathways. Exhaustive bioinformatics analyses on such data involve statistical issues as well as precise sequence and structure inspection not only of the functional mature part but also of the whole precursor sequence of the putative miRNA. Apart from a considerable amount of species-specific miRNAs, the majority of all those genes are conserved at least among closely related organisms. Some miRNAs, however, can be traced back to very early points in the evolution of eukaryotic species. Thus, the investigation of the conservation of newly found miRNA candidates comprises an important step in the computational annotation of miRNAs.Topics covered in this chapter include a review on the obvious problem of miRNA annotation and family definition, recommended pipelines of computational miRNA annotation or detection, and an overview of current computer tools for the prediction of miRNAs and their limitations. The chapter closes discussing how those bioinformatic approaches address the problem of faithful miRNA prediction and correct annotation. PMID:24639171

  11. A multiplicity of factors contributes to selective RNA polymerase III occupancy of a subset of RNA polymerase III genes in mouse liver.

    PubMed

    Canella, Donatella; Bernasconi, David; Gilardi, Federica; LeMartelot, Gwendal; Migliavacca, Eugenia; Praz, Viviane; Cousin, Pascal; Delorenzi, Mauro; Hernandez, Nouria

    2012-04-01

    The genomic loci occupied by RNA polymerase (RNAP) III have been characterized in human culture cells by genome-wide chromatin immunoprecipitations, followed by deep sequencing (ChIP-seq). These studies have shown that only ∼40% of the annotated 622 human tRNA genes and pseudogenes are occupied by RNAP-III, and that these genes are often in open chromatin regions rich in active RNAP-II transcription units. We have used ChIP-seq to characterize RNAP-III-occupied loci in a differentiated tissue, the mouse liver. Our studies define the mouse liver RNAP-III-occupied loci including a conserved mammalian interspersed repeat (MIR) as a potential regulator of an RNAP-III subunit-encoding gene. They reveal that synteny relationships can be established between a number of human and mouse RNAP-III genes, and that the expression levels of these genes are significantly linked. They establish that variations within the A and B promoter boxes, as well as the strength of the terminator sequence, can strongly affect RNAP-III occupancy of tRNA genes. They reveal correlations with various genomic features that explain the observed variation of 81% of tRNA scores. In mouse liver, loci represented in the NCBI37/mm9 genome assembly that are clearly occupied by RNAP-III comprise 50 Rn5s (5S RNA) genes, 14 known non-tRNA RNAP-III genes, nine Rn4.5s (4.5S RNA) genes, and 29 SINEs. Moreover, out of the 433 annotated tRNA genes, half are occupied by RNAP-III. Transfer RNA gene expression levels reflect both an underlying genomic organization conserved in dividing human culture cells and resting mouse liver cells, and the particular promoter and terminator strengths of individual genes.

  12. MIGS: miRNA-induced gene silencing.

    PubMed

    Felippes, Felipe Fenselau de; Wang, Jia-wei; Weigel, Detlef

    2012-05-01

    Gene silencing is an important tool in the study of gene function. Virus-induced gene silencing (VIGS) and hairpin RNA interference (hpRNAi), both of which rely on small interfering RNAs, together with artificial microRNAs (amiRNA), are amongst the most popular methods for reduction of gene activity in plants. However, all three approaches have limitations. Here, we introduce miRNA-induced gene silencing (MIGS). This method exploits a special 22-nucleotide miRNA of Arabidopsis thaliana, miR173, which can trigger production of another class of small RNAs called trans-acting small interfering RNAs (tasiRNAs). We show that fusion of gene fragments to an upstream miR173 target site is sufficient for effective silencing of the corresponding endogenous gene. MIGS can be reliably used for the knockdown of a single gene or of multiple unrelated genes. In addition, we show that MIGS can be applied to other species by co-expression of miR173.

  13. Traffic at the tmRNA Gene

    PubMed Central

    Williams, Kelly P.

    2003-01-01

    A partial screen for genetic elements integrated into completely sequenced bacterial genomes shows more significant bias in specificity for the tmRNA gene (ssrA) than for any type of tRNA gene. Horizontal gene transfer, a major avenue of bacterial evolution, was assessed by focusing on elements using this single attachment locus. Diverse elements use ssrA; among enterobacteria alone, at least four different integrase subfamilies have independently evolved specificity for ssrA, and almost every strain analyzed presents a unique set of integrated elements. Even elements using essentially the same integrase can be very diverse, as is a group with an ssrA-specific integrase of the P4 subfamily. This same integrase appears to promote damage routinely at attachment sites, which may be adaptive. Elements in arrays can recombine; one such event mediated by invertible DNA segments within neighboring elements likely explains the monophasic nature of Salmonella enterica serovar Typhi. One of a limited set of conserved sequences occurs at the attachment site of each enterobacterial element, apparently serving as a transcriptional terminator for ssrA. Elements were usually found integrated into tRNA-like sequence at the 3′ end of ssrA, at subsites corresponding to those used in tRNA genes; an exception was found at the non-tRNA-like 3′ end produced by ssrA gene permutation in cyanobacteria, suggesting that, during the evolution of new site specificity by integrases, tropism toward a conserved 3′ end of an RNA gene may be as strong as toward a tRNA-like sequence. The proximity of ssrA and smpB, which act in concert, was also surveyed. PMID:12533482

  14. RNA polymerase gene, microorganism having said gene and the production of RNA polymerase by the use of said microorganism

    DOEpatents

    Kotani, Hirokazu; Hiraoka, Nobutsugu; Obayashi, Akira

    1991-01-01

    SP6 bacteriophage RNA polymerase is produced by cultivating a new microorganism (particularly new strains of Escherichia coli) harboring a plasmid that carries SP6 bacteriophage RNA polymerase gene and recovering SP6 bacteriophage RNA polymerase from the culture broth. SP6 bacteriophage RNA polymerase gene is provided as are new microorganisms harboring a plasmid that carries SP6 bacteriophage RNA polymerase gene.

  15. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. PMID:25261903

  16. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps.

  17. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    PubMed

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends.

  18. Chromosomal organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the evolutionary dynamics of multigene families and heterochromatin

    PubMed Central

    2011-01-01

    Background Scarabaeinae beetles show a high level of macro-chromosomal variability, although the karyotypic organization of heterochromatin and multigene families (rDNAs and histone genes) is poorly understood in this group. To better understand the chromosomal organization and evolution in this group, we analyzed the karyotypes, heterochromatin distribution and chromosomal locations of the rRNAs and histone H3 genes in beetles belonging to eight tribes from the Scarabaeinae subfamily (Coleoptera, Scarabaeidae). Results The number of 18S rRNA gene (a member of the 45S rDNA unit) sites varied from one to 16 and were located on the autosomes, sex chromosomes or both, although two clusters were most common. Comparison of the 45S rDNA cluster number and the diploid numbers revealed a low correlation value. However, a comparison between the number of 45S rDNA sites per genome and the quantity of heterochromatin revealed (i) species presenting heterochromatin restricted to the centromeric/pericentromeric region that contained few rDNA sites and (ii) species with a high quantity of heterochromatin and a higher number of rDNA sites. In contrast to the high variability for heterochromatin and 45S rDNA cluster, the presence of two clusters (one bivalent cluster) co-located on autosomal chromosomes with the 5S rRNA and histone H3 genes was highly conserved. Conclusions Our results indicate that the variability of the 45S rDNA chromosomal clusters is not associated with macro-chromosomal rearrangements but are instead related to the spread of heterochromatin. The data obtained also indicate that both heterochromatin and the 45S rDNA loci could be constrained by similar evolutionary forces regulating spreading in the distinct Scarabaeinae subfamily lineages. For the 5S rRNA and the histone H3 genes, a similar chromosomal organization could be attributed to their association/co-localization in the Scarabaeinae karyotypes. These data provide evidence that different evolutionary

  19. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  20. Molecular and cytological characterization of ribosomal RNA genes in Chenopodium quinoa and Chenopodium berlandieri.

    PubMed

    Maughan, P J; Kolano, B A; Maluszynska, J; Coles, N D; Bonifacio, A; Rojas, J; Coleman, C E; Stevens, M R; Fairbanks, D J; Parkinson, S E; Jellen, E N

    2006-07-01

    The nucleolus organizer region (NOR) and 5S ribosomal RNA (rRNA) genes are valuable as chromosome landmarks and in evolutionary studies. The NOR intergenic spacers (IGS) and 5S rRNA nontranscribed spacers (NTS) were PCR-amplified and sequenced from 5 cultivars of the Andean grain crop quinoa (Chenopodium quinoa Willd., 2n = 4x = 36) and a related wild ancestor (C. berlandieri Moq. subsp. zschackei (Murr) A. Zobel, 2n = 4x = 36). Length heterogeneity observed in the IGS resulted from copy number difference in subrepeat elements, small re arrangements, and species-specific indels, though the general sequence composition of the 2 species was highly similar. Fifteen of the 41 sequence polymorphisms identified among the C. quinoa lines were synapomorphic and clearly differentiated the highland and lowland ecotypes. Analysis of the NTS sequences revealed 2 basic NTS sequence classes that likely originated from the 2 allopolyploid subgenomes of C. quinoa. Fluorescence in situ hybridization (FISH) analysis showed that C. quinoa possesses an interstitial and a terminal pair of 5S rRNA loci and only 1 pair of NOR, suggesting a reduction in the number of rRNA loci during the evolution of this species. C. berlandieri exhibited variation in both NOR and 5S rRNA loci without changes in ploidy.

  1. Identification of goose (Anser anser) and mule duck (Anasplatyrhynchos x Cairina moschata) foie gras by multiplex polymerase chain reaction amplification of the 5S RDNA gene.

    PubMed

    Rodríguez, M A; García, T; González, I; Asensio, L; Fernández, A; Lobo, E; Hernández, P E; Martín, R

    2001-06-01

    Polymerase chain reaction (PCR) amplification of the nuclear 5S rDNA gene has been used for the identification of goose and mule duck foie gras. Two species-specific reverse primers were designed and used in a multiplex reaction, together with a forward universal primer, to amplify specific fragments of the 5S rDNA in each species. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed clear identification of goose and mule duck foie gras samples. This genetic marker can be useful for detecting fraudulent substitution of the duck liver for the more expensive goose liver.

  2. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).

    PubMed

    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F

    2014-11-14

    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera.

  3. Evolutionary dynamics of 5S rDNA location in acridid grasshoppers and its relationship with H3 histone gene and 45S rDNA location.

    PubMed

    Cabral-de-Mello, Diogo C; Cabrero, Josefa; López-León, María Dolores; Camacho, Juan Pedro M

    2011-07-01

    We analyze the chromosomal location of 5S rDNA clusters in 29 species of grasshoppers belonging to the family Acrididae. There was extensive variation among species for the number and location of 5S rDNA sites. Out of 148 sites detected, 75% were proximally located, 21.6% were interstitial, and only 3.4% were distal. The number of 5S rDNA sites per species varied from a single chromosome pair (in six species) to all chromosome pairs (in five species), with a range of intermediate situations. Thirteen chromosomes from eight species carried two 5S rDNA clusters. At intraspecific level, differences among populations were detected in Eyprepocnemis plorans, and some heteromorphisms have also been observed in some species. Double FISH for 5S rDNA and H3 histone gene DNA, performed on 17 of these 29 species, revealed that both markers are sometimes placed in a same chromosome but at different location, whereas they appeared to co-localize in five species (Calliptamus barbarus, Heteracris adpersa, Aiolopus strepens, Oedipoda charpentieri and O. coerulescens). Double fiber-FISH in A. strepens and O. coerulescens showed that the two DNAs are closely interspersed with variable relative amounts of both classes of DNA. Finally, no correlation was observed between the number of 5S and 45S rDNA clusters in 23 species where this information was available. These results are discussed in the light of possible mechanisms of spread that led to the extensive variation in the number of clusters observed for both rDNA types in acridid grasshoppers.

  4. Methylation of miRNA genes and oncogenesis.

    PubMed

    Loginov, V I; Rykov, S V; Fridman, M V; Braga, E A

    2015-02-01

    Interaction between microRNA (miRNA) and messenger RNA of target genes at the posttranscriptional level provides fine-tuned dynamic regulation of cell signaling pathways. Each miRNA can be involved in regulating hundreds of protein-coding genes, and, conversely, a number of different miRNAs usually target a structural gene. Epigenetic gene inactivation associated with methylation of promoter CpG-islands is common to both protein-coding genes and miRNA genes. Here, data on functions of miRNAs in development of tumor-cell phenotype are reviewed. Genomic organization of promoter CpG-islands of the miRNA genes located in inter- and intragenic areas is discussed. The literature and our own results on frequency of CpG-island methylation in miRNA genes from tumors are summarized, and data regarding a link between such modification and changed activity of miRNA genes and, consequently, protein-coding target genes are presented. Moreover, the impact of miRNA gene methylation on key oncogenetic processes as well as affected signaling pathways is discussed.

  5. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product.

  6. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. PMID:26789074

  7. Gene silencing in Caenorhabditis elegans by transitive RNA interference

    PubMed Central

    ALDER, MATTHEW N.; DAMES, SHALE; GAUDET, JEFFREY; MANGO, SUSAN E.

    2003-01-01

    When a cell is exposed to double-stranded RNA (dsRNA), mRNA from the homologous gene is selectively degraded by a process called RNA interference (RNAi). Here, we provide evidence that dsRNA is amplified in Caenorhabditis elegans to ensure a robust RNAi response. Our data suggest a model in which mRNA targeted by RNAi functions as a template for 5′ to 3′ synthesis of new dsRNA (termed transitive RNAi). Strikingly, the effect is nonautonomous: dsRNA targeted to a gene expressed in one cell type can lead to transitive RNAi-mediated silencing of a second gene expressed in a distinct cell type. These data suggest dsRNA synthesized in vivo can mediate systemic RNAi. PMID:12554873

  8. Inhibitory effect of modified 5'-capped short RNA fragments on influenza virus RNA polymerase gene expression.

    PubMed

    Tado, M; Abe, T; Hatta, T; Ishikawa, M; Nakada, S; Yokota, T; Takaku, H

    2001-11-01

    We have shown previously that the 5'-capped short phosphodiester RNA fragments, Cap decoy, (Gm 12 nt) are potent inhibitors of influenza virus RNA polymerase gene expression. Here we investigate the modified capped RNA derivative containing phosphorothioate oligonucleotides (Cap decoy) as a potential influenza virus RNA polymerase inhibitor. The modified 5'-capped short phosphorothioate RNA fragments (Gms 12-15 nt) with the 5'-capped structure (m7GpppGm) were synthesized by T7 RNA polymerase. The 5'-capped short RNA fragments (Gms 12-15 nt) were encapsulated in liposome particulates and tested for their inhibitory effects on influenza virus RNA polymerase gene expression in the clone 76 cells. The 12-15 nt long Gms RNA fragments showed highly inhibitory effects. By contrast, the inhibitory effects of the 13 nt long short RNA fragments (Gm 13 nt) were considerably less in comparison with the 5'-capped short phosphorothioate RNA fragments (Gms 12-15 nt). In particular, the various Gms RNA chain lengths showed no significant differences in the inhibition of influenza virus RNA polymerase gene expression. Furthermore, the capped RNA with a phosphorothioate backbone was resistant to nuclease activity. These phosphorothioate RNA fragments exhibited higher inhibitory activity than the 5'-capped short RNA fragments (Gm 12 nt). These decoys may prove to be useful in anti-influenza virus therapeutics. PMID:12018680

  9. Evolution of small guide RNA genes in hyperthermophilic archaea.

    PubMed

    Randau, Lennart

    2015-04-01

    Profiling the RNA production in hyperthermophilic archaea revealed an abundance of small RNA-guided processes near the upper temperature limit of life. Archaea utilize the base-pairing ability of RNA guide sequences to target ribosomal RNAs, transfer RNAs, messenger RNAs, and viral genomes. Cellular processes that are guided by small RNAs include the modification of RNA molecules, trans-splicing, gene regulation, and RNA and DNA degradation. Here, a brief overview of our knowledge on small guide RNA genes in archaeal genomes is provided and examples of their putative roles in genome evolution are described.

  10. The Euglena gracilis chloroplast rpoB gene. Novel gene organization and transcription of the RNA polymerase subunit operon.

    PubMed Central

    Yepiz-Plascencia, G M; Radebaugh, C A; Hallick, R B

    1990-01-01

    The rpoB gene coding for a beta-like subunit of the chloroplast DNA-dependent RNA polymerase has been located on the chloroplast genome of Euglena gracilis distal to the rrnC ribosomal RNA operon. We have determined 5760 base-pairs of DNA sequence, including 97 bp of the 5S rRNA gene, an intergenic spacer of 1264 bp, the rpoB gene of 4249 bp, 84 bp spacer and 67 bp of the rpoC1 gene. The rpoB gene is of the same polarity as the rRNA operons. The organization of the rpoB and rpoC genes resembles the E. coli rpoB-rpoC and higher plant chloroplast rpoB-rpoC1-rpoC2 operons. The Euglena rpoB gene (1082 codons) encodes a polypeptide with a predicted molecular weight of 124,288. The rpoB gene is interrupted by seven Group III introns of 93, 95, 94, 99, 101, 110 and 99 bp respectively and a Group II intron of 309 bp. All other known rpoB genes lack introns. All the exon-exon junctions were experimentally determined by cDNA cloning and sequencing or direct primer extension RNA sequencing. Transcripts from the rpoB locus were characterized by Northern hybridization. Fully-spliced, monocistronic rpoB mRNA, as well as rpoB-rpoC1 and rpoB1-rpoC1-rpoC2 mRNAs were identified. Images PMID:2110656

  11. Unmasking Upstream Gene Expression Regulators with miRNA-corrected mRNA Data.

    PubMed

    Bollmann, Stephanie; Bu, Dengpan; Wang, Jiaqi; Bionaz, Massimo

    2015-01-01

    Expressed micro-RNA (miRNA) affects messenger RNA (mRNA) abundance, hindering the accuracy of upstream regulator analysis. Our objective was to provide an algorithm to correct such bias. Large mRNA and miRNA analyses were performed on RNA extracted from bovine liver and mammary tissue. Using four levels of target scores from TargetScan (all miRNA:mRNA target gene pairs or only the top 25%, 50%, or 75%). Using four levels of target scores from TargetScan (all miRNA:mRNA target gene pairs or only the top 25%, 50%, or 75%) and four levels of the magnitude of miRNA effect (ME) on mRNA expression (30%, 50%, 75%, and 83% mRNA reduction), we generated 17 different datasets (including the original dataset). For each dataset, we performed upstream regulator analysis using two bioinformatics tools. We detected an increased effect on the upstream regulator analysis with larger miRNA:mRNA pair bins and higher ME. The miRNA correction allowed identification of several upstream regulators not present in the analysis of the original dataset. Thus, the proposed algorithm improved the prediction of upstream regulators.

  12. Unmasking Upstream Gene Expression Regulators with miRNA-corrected mRNA Data

    PubMed Central

    Bollmann, Stephanie; Bu, Dengpan; Wang, Jiaqi; Bionaz, Massimo

    2015-01-01

    Expressed micro-RNA (miRNA) affects messenger RNA (mRNA) abundance, hindering the accuracy of upstream regulator analysis. Our objective was to provide an algorithm to correct such bias. Large mRNA and miRNA analyses were performed on RNA extracted from bovine liver and mammary tissue. Using four levels of target scores from TargetScan (all miRNA:mRNA target gene pairs or only the top 25%, 50%, or 75%). Using four levels of target scores from TargetScan (all miRNA:mRNA target gene pairs or only the top 25%, 50%, or 75%) and four levels of the magnitude of miRNA effect (ME) on mRNA expression (30%, 50%, 75%, and 83% mRNA reduction), we generated 17 different datasets (including the original dataset). For each dataset, we performed upstream regulator analysis using two bioinformatics tools. We detected an increased effect on the upstream regulator analysis with larger miRNA:mRNA pair bins and higher ME. The miRNA correction allowed identification of several upstream regulators not present in the analysis of the original dataset. Thus, the proposed algorithm improved the prediction of upstream regulators. PMID:27279737

  13. Multisubunit RNA Polymerases IV and V: Purveyors of Non-Coding RNA for Plant Gene Silencing

    SciTech Connect

    Haag, Jeremy R.; Pikaard, Craig S.

    2011-08-01

    In all eukaryotes, nuclear DNA-dependent RNA polymerases I, II and III synthesize the myriad RNAs that are essential for life. Remarkably, plants have evolved two additional multisubunit RNA polymerases, RNA polymerases IV and V, which orchestrate non-coding RNA-mediated gene silencing processes affecting development, transposon taming, antiviral defence and allelic crosstalk. Biochemical details concerning the templates and products of RNA polymerases IV and V are lacking. However, their subunit compositions reveal that they evolved as specialized forms of RNA polymerase II, which provides the unique opportunity to study the functional diversification of a eukaryotic RNA polymerase family.

  14. Extensive tRNA gene changes in synthetic Brassica napus.

    PubMed

    Wei, Lijuan; An, Zeshan; Mason, Annaliese S; Xiao, Meili; Guo, Ying; Yin, Jiaming; Li, Jiana; Fu, Donghui

    2014-01-01

    Allopolyploidization, where two species come together to form a new species, plays a major role in speciation and genome evolution. Transfer RNAs (abbreviated tRNA) are typically 73-94 nucleotides in length, and are indispensable in protein synthesis, transferring amino acids to the cell protein synthesis machinery (ribosome). To date, the regularity and function of tRNA gene sequence variation during the process of allopolyploidization have not been well understood. In this study, the inter-tRNA gene corresponding to tRNA amplification polymorphism method was used to detect changes in tRNA gene sequences in the progeny of interspecific hybrids between Brassica rapa and B. oleracea, mimicking the original B. napus (canola) species formation event. Cluster analysis showed that tRNA gene variation during allopolyploidization did not appear to have a genotypic basis. Significant variation occurred in the early generations of synthetic B. napus (F1 and F2 generations), but fewer alterations were observed in the later generation (F3). The variation-prone tRNA genes tended to be located in AT-rich regions. BlastN analysis of novel tRNA gene variants against a Brassica genome sequence database showed that the variation of these tRNA-gene-associated sequences in allopolyploidization might result in variation of gene structure and function, e.g., metabolic process and transport.

  15. Nucleotide sequence of a human tRNA gene heterocluster

    SciTech Connect

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-05-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both (3'-/sup 32/P)-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these ..gamma..-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues.

  16. Highly repetitive tRNA(Pro)-tRNA(His) gene cluster from Photobacterium phosphoreum.

    PubMed Central

    Giroux, S; Beaudet, J; Cedergren, R

    1988-01-01

    A DNA fragment comprising the four tRNA gene sequences of the Escherichia coli argT locus hybridized with two Sau3A-generated DNA fragments from the vibrio Photobacterium phosphoreum (ATCC 11040). Detailed sequence analysis of the longer fragment shows the following gene organization: 5'-promoter-tRNA(Pro)-tRNAPro-tRNA(Pro)-tRNA(His)-tRNA(Pro)-tRNA(Pro)- tRNA(His)-tRNA(Pro)-five pseudogenes derived from the upstream tRNAPro interspersed by putative Rho-independent terminators. This sequence demonstrates the presence of highly repetitive, tandem tRNA genes in a bacterial genome. Furthermore, a stretch of 304 nucleotides from this cluster was found virtually unchanged in the other (shorter) fragment which was previously sequenced. The two clusters together contain eight tRNA(Pro) pseudogenes and eight fully intact tRNA(Pro) genes, an unusually high number for a single eubacterial isoacceptor tRNA. These results show that the organization of some tRNA operons is highly variable in eubacteria. Images PMID:3056906

  17. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).

    PubMed

    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C

    2015-01-01

    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition. PMID:26634462

  18. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).

    PubMed

    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C

    2015-11-25

    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition.

  19. Studies on ribosomal RNA genes of mycobacteria including M. leprae.

    PubMed

    Katoch, V M; Shivannavar, C T; Datta, A K

    1989-01-01

    Information about specific genes specially of pathogenic mycobacteria could be used to unequivocally identify isolates of mycobacteria which are of clinical interest. Both eukaryotic and prokaryotic ribosomal RNA (rRNA) genes have been shown to comprise sequences which are conserved and others which are divergent. In the present study, rRNA genes from several cultivable mycobacteria including M. tuberculosis and armadillo derived M. leprae have been investigated. rRNA was isolated, made radioactive in vitro and then used to identify restriction fragments of DNA containing rRNA gene sequences. It was observed that restriction endonuclease patterns of rRNA genes are characteristic. By probing with homologous and heterologous rRNA probes, fragments hybridizing maximum with homologous probes could be identified and it appears that sequences flanking the rRNA genes are not identical. These fragments need to be further sequenced to identify the nucleotide sequences specific to rRNA gene cluster. It would also be necessary to analyse several isolates of each species including armadillo derived M. leprae before reaching any conclusions.

  20. Transcriptional regulation of mammalian miRNA genes

    PubMed Central

    Schanen, Brian C.; Li, Xiaoman

    2010-01-01

    MicroRNAs (miRNAs) are members of a growing family of non-coding transcripts, 21-23 nucleotides long, which regulate a diverse collection of biological processes and various diseases by RNA-mediated gene-silencing mechanisms. While currently many studies focus on defining the regulatory functions of miRNAs, few are directed towards how miRNA genes are themselves transcriptionally regulated. Recent studies of miRNA transcription have elucidated RNA polymerase II as the major polymerase of miRNAs, however, little is known of the structural features of miRNA promoters, especially those of mammalian miRNAs. Here, we review the current literature regarding features conserved among miRNA promoters useful for their detection and the current novel methodologies available to enable researchers to advance our understanding of the transcriptional regulation of miRNA genes. PMID:20977933

  1. The role of RNA structure at 5' untranslated region in microRNA-mediated gene regulation.

    PubMed

    Gu, Wanjun; Xu, Yuming; Xie, Xueying; Wang, Ting; Ko, Jae-Hong; Zhou, Tong

    2014-09-01

    Recent studies have suggested that the secondary structure of the 5' untranslated region (5' UTR) of messenger RNA (mRNA) is important for microRNA (miRNA)-mediated gene regulation in humans. mRNAs that are targeted by miRNA tend to have a higher degree of local secondary structure in their 5' UTR; however, the general role of the 5' UTR in miRNA-mediated gene regulation remains unknown. We systematically surveyed the secondary structure of 5' UTRs in both plant and animal species and found a universal trend of increased mRNA stability near the 5' cap in mRNAs that are regulated by miRNA in animals, but not in plants. Intra-genome comparison showed that gene expression level, GC content of the 5' UTR, number of miRNA target sites, and 5' UTR length may influence mRNA structure near the 5' cap. Our results suggest that the 5' UTR secondary structure performs multiple functions in regulating post-transcriptional processes. Although the local structure immediately upstream of the start codon is involved in translation initiation, RNA structure near the 5' cap site, rather than the structure of the full-length 5' UTR sequences, plays an important role in miRNA-mediated gene regulation.

  2. Transcription factor trapping by RNA in gene regulatory elements.

    PubMed

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs.

  3. RNA-Mediated Gene Silencing in Hematopoietic Cells

    PubMed Central

    Venturini, Letizia; Eder, Matthias; Scherr, Michaela

    2006-01-01

    In the past few years, the discovery of RNA-mediated gene silencing mechanisms, like RNA interference (RNAi), has revolutionized our understanding of eukaryotic gene expression. These mechanisms are activated by double-stranded RNA (dsRNA) and mediate gene silencing either by inducing the sequence-specific degradation of complementary mRNA or by inhibiting mRNA translation. RNAi now provides a powerful experimental tool to elucidate gene function in vitro and in vivo, thereby opening new exciting perspectives in the fields of molecular analysis and eventually therapy of several diseases such as infections and cancer. In hematology, numerous studies have described the successful application of RNAi to better define the role of oncogenic fusion proteins in leukemogenesis and to explore therapeutic approaches in hematological malignancies. In this review, we highlight recent advances and caveats relating to the application of this powerful new methodology to hematopoiesis. PMID:17057372

  4. A model for the topology of active ribosomal RNA genes.

    PubMed

    Denissov, Serguei; Lessard, Frédéric; Mayer, Christine; Stefanovsky, Victor; van Driel, Marc; Grummt, Ingrid; Moss, Tom; Stunnenberg, Hendrik G

    2011-03-01

    The Christmas tree view of active ribosomal RNA (rRNA) genes suggests a gene topology in which a large number of nascent rRNA transcripts are prevented from intertwining. The way in which this is achieved has remained unclear. By using a combination of chromatin immunoprecipitation and chromosome conformation capture techniques, we show that the promoter, upstream region and terminator R3 of active rRNA genes are held together spatially throughout the cell cycle, forming a stable core around which the transcribed region is organized. We suggest a new core-helix model for the topology of rRNA genes, that provides a structural basis for the productive synthesis or rRNA.

  5. A Neurospora crassa ribosomal protein gene, homologous to yeast CRY1, contains sequences potentially coordinating its transcription with rRNA genes.

    PubMed Central

    Tyler, B M; Harrison, K

    1990-01-01

    We have isolated and sequenced a Neurospora crassa ribosomal protein gene (designated crp-2) strongly homologous to the rp59 gene (CRY1) of yeast and the S14 ribosomal protein gene of mammals. The inferred sequence of the crp-2 protein is more homologous (83%) to the mammalian S14 sequence than to the yeast rp59 sequence (69%). The gene has three intervening sequences (IVSs) two of which are offset 7 bp from the position of IVSs in the mammalian genes. None correspond to the position of the IVS in the yeast gene. Crp-2 was mapped by RFLP analysis to the right arm of linkage group III. The 5' region of the gene contains three copies of a sequence, the Ribo box, previously shown to be required for transcription of both 5S and 40S rRNA genes. We speculate that the Ribo box may coordinate ribosomal protein and rRNA gene transcription. Images PMID:1977135

  6. Self-assembled Messenger RNA Nanoparticles (mRNA-NPs) for Efficient Gene Expression

    PubMed Central

    Kim, Hyejin; Park, Yongkuk; Lee, Jong Bum

    2015-01-01

    Although mRNA has several advantages over plasmid DNA when delivered into cells for gene expression, mRNA transfection is a very rare occurrence in gene delivery. This is mainly because of the labile nature of RNA, resulting in a low expression level of the desired protein. In this study, self-assembled mRNA nanoparticles (mRNA-NPs) packed with multiple repeats of mRNA were synthesized to achieve efficient gene expression. This approach required only a one-step process to synthesize particles with a minimal amount of plasmid DNA to produce the RNA transcripts via rolling circle transcription. Moreover, there are no concerns for cytotoxicity which can be caused by chemical condensates because mRNA-NPs are made entirely of mRNA. An examination of the cells transfected with the mRNA-NPs encoding the green fluorescence protein (GFP) confirmed that the mRNA-NPs can be used as a novel platform for effective gene delivery. PMID:26235529

  7. A New Class of SINEs with snRNA Gene-Derived Heads.

    PubMed

    Kojima, Kenji K

    2015-05-27

    Eukaryotic genomes are colonized by various transposons including short interspersed elements (SINEs). The 5' region (head) of the majority of SINEs is derived from one of the three types of RNA genes--7SL RNA, transfer RNA (tRNA), or 5S ribosomal RNA (rRNA)--and the internal promoter inside the head promotes the transcription of the entire SINEs. Here I report a new group of SINEs whose heads originate from either the U1 or U2 small nuclear RNA gene. These SINEs, named SINEU, are distributed among crocodilians and classified into three families. The structures of the SINEU-1 subfamilies indicate the recurrent addition of a U1- or U2-derived sequence onto the 5' end of SINEU-1 elements. SINEU-1 and SINEU-3 are ancient and shared among alligators, crocodiles, and gharials, while SINEU-2 is absent in the alligator genome. SINEU-2 is the only SINE family that was active after the split of crocodiles and gharials. All SINEU families, especially SINEU-3, are preferentially inserted into a family of Mariner DNA transposon, Mariner-N4_AMi. A group of Tx1 non-long terminal repeat retrotransposons designated Tx1-Mar also show target preference for Mariner-N4_AMi, indicating that SINEU was mobilized by Tx1-Mar.

  8. A New Class of SINEs with snRNA Gene-Derived Heads.

    PubMed

    Kojima, Kenji K

    2015-06-01

    Eukaryotic genomes are colonized by various transposons including short interspersed elements (SINEs). The 5' region (head) of the majority of SINEs is derived from one of the three types of RNA genes--7SL RNA, transfer RNA (tRNA), or 5S ribosomal RNA (rRNA)--and the internal promoter inside the head promotes the transcription of the entire SINEs. Here I report a new group of SINEs whose heads originate from either the U1 or U2 small nuclear RNA gene. These SINEs, named SINEU, are distributed among crocodilians and classified into three families. The structures of the SINEU-1 subfamilies indicate the recurrent addition of a U1- or U2-derived sequence onto the 5' end of SINEU-1 elements. SINEU-1 and SINEU-3 are ancient and shared among alligators, crocodiles, and gharials, while SINEU-2 is absent in the alligator genome. SINEU-2 is the only SINE family that was active after the split of crocodiles and gharials. All SINEU families, especially SINEU-3, are preferentially inserted into a family of Mariner DNA transposon, Mariner-N4_AMi. A group of Tx1 non-long terminal repeat retrotransposons designated Tx1-Mar also show target preference for Mariner-N4_AMi, indicating that SINEU was mobilized by Tx1-Mar. PMID:26019167

  9. Methylated MicroRNA Genes of the Developing Murine Palate

    PubMed Central

    Seelan, Ratnam S.; Mukhopadhyay, Partha; Warner, Dennis R.; Appana, Savitri N.; Brock, Guy N.; Pisano, M. Michele; Greene, Robert M.

    2016-01-01

    Environmental factors contribute to the etiology of cleft palate (CP). Environmental factors can also affect gene expression via alterations in DNA methylation suggesting a possible mechanism for the induction of CP. Identification of genes methylated during development of the secondary palate provides the basis for examination of the means by which environmental factors may adversely influence palatal ontogeny. We previously characterized the methylome of the developing murine secondary palate focusing primarily on protein-encoding genes. We now extend this study to include methylated microRNA (miRNA) genes. A total of 42 miRNA genes were found to be stably methylated in developing murine palatal tissue. Twenty eight of these were localized within host genes. Gene methylation was confirmed by pyrosequencing of selected miRNA genes. Integration of methylated miRNA gene and expression datasets identified 62 miRNAs, 69% of which were non-expressed. For a majority of genes (83%), upstream CpG islands (CGIs) were highly methylated suggesting down-regulation of CGI-associated promoters. DAVID and IPA analyses indicated that both expressed and non-expressed miRNAs target identical signaling pathways and biological processes associated with palatogenesis. Furthermore, these analyses also identified novel signaling pathways whose roles in palatogenesis remain to be elucidated. In summary, we identify methylated miRNA genes in the developing murine secondary palate, correlate miRNA gene methylation with expression of their cognate miRNA transcripts, and identify pathways and biological processes potentially mediated by these miRNAs. PMID:25642850

  10. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    PubMed

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  11. Non-functional genes repaired at the RNA level.

    PubMed

    Burger, Gertraud

    2016-01-01

    Genomes and genes continuously evolve. Gene sequences undergo substitutions, deletions or nucleotide insertions; mobile genetic elements invade genomes and interleave in genes; chromosomes break, even within genes, and pieces reseal in reshuffled order. To maintain functional gene products and assure an organism's survival, two principal strategies are used - either repair of the gene itself or of its product. I will introduce common types of gene aberrations and how gene function is restored secondarily, and then focus on systematically fragmented genes found in a poorly studied protist group, the diplonemids. Expression of their broken genes involves restitching of pieces at the RNA-level, and substantial RNA editing, to compensate for point mutations. I will conclude with thoughts on how such a grotesquely unorthodox system may have evolved, and why this group of organisms persists and thrives since tens of millions of years.

  12. The Selenocysteine tRNA Gene in Leishmania major Is Transcribed by both RNA Polymerase II and RNA Polymerase III

    PubMed Central

    Padilla-Mejía, Norma E.; Florencio-Martínez, Luis E.; Moreno-Campos, Rodrigo; Vizuet-de-Rueda, Juan C.; Cevallos, Ana M.; Hernández-Rivas, Rosaura; Manning-Cela, Rebeca

    2014-01-01

    Eukaryotic tRNAs, transcribed by RNA polymerase III (Pol III), contain boxes A and B as internal promoter elements. One exception is the selenocysteine (Sec) tRNA (tRNA-Sec), whose transcription is directed by an internal box B and three extragenic sequences in vertebrates. Here we report on the transcriptional analysis of the tRNA-Sec gene in the protozoan parasite Leishmania major. This organism has unusual mechanisms of gene expression, including Pol II polycistronic transcription and maturation of mRNAs by trans splicing, a process that attaches a 39-nucleotide miniexon to the 5′ end of all the mRNAs. In L. major, tRNA-Sec is encoded by a single gene inserted into a Pol II polycistronic unit, in contrast to most tRNAs, which are clustered at the boundaries of polycistronic units. 5′ rapid amplification of cDNA ends and reverse transcription-PCR experiments showed that some tRNA-Sec transcripts contain the miniexon at the 5′ end and a poly(A) tail at the 3′ end, indicating that the tRNA-Sec gene is polycistronically transcribed by Pol II and processed by trans splicing and polyadenylation, as was recently reported for the tRNA-Sec genes in the related parasite Trypanosoma brucei. However, nuclear run-on assays with RNA polymerase inhibitors and with cells that were previously UV irradiated showed that the tRNA-Sec gene in L. major is also transcribed by Pol III. Thus, our results indicate that RNA polymerase specificity in Leishmania is not absolute in vivo, as has recently been found in other eukaryotes. PMID:25548151

  13. Silencing structural and nonstructural genes in baculovirus by RNA interference.

    PubMed

    Flores-Jasso, C Fabian; Valdes, Victor Julian; Sampieri, Alicia; Valadez-Graham, Viviana; Recillas-Targa, Felix; Vaca, Luis

    2004-06-01

    We review several aspects of RNAi and gene silencing with baculovirus. We show that the potency of RNAi in Spodoptera frugiperda (Sf21) insect cells correlates well with the efficiency of transfection of the siRNA. Using a fluorescein-labeled siRNA we found that the siRNA localized in areas surrounding the endoplasmic reticulum (ER). Both long (700 nucleotides long) and small ( approximately 25 nucleotides long) interfering RNAs were equally effective in initiating RNA interference (RNAi), and the duration of the interfering effect was indistinguishable. Even though RNAi in Sf21 cells is very effective, in vitro experiments show that these cells fragment the long dsRNA into siRNA poorly, when compared to HEK cells. Finally, we show that in vivo inhibition of baculovirus infection with dsRNA homologous to genes that are essential for baculovirus infectivity depends strongly on the amount of dsRNA used in the assays. Five hundred nanogram of dsRNA directly injected into the haemolymph of insects prevent animal death to over 95%. In control experiments, over 96% of insects not injected with dsRNA or injected with an irrelevant dsRNA died within a week. These results demonstrate the efficiency of dsRNA for in vivo prevention of a viral infection by virus that is very cytotoxic and lytic in animals.

  14. Karyotypic diversification in Mytilus mussels (Bivalvia: Mytilidae) inferred from chromosomal mapping of rRNA and histone gene clusters

    PubMed Central

    2014-01-01

    Background Mussels of the genus Mytilus present morphologically similar karyotypes that are presumably conserved. The absence of chromosome painting probes in bivalves makes difficult verifying this hypothesis. In this context, we comparatively mapped ribosomal RNA and histone gene families on the chromosomes of Mytilus edulis, M. galloprovincialis, M. trossulus and M. californianus by fluorescent in situ hybridization (FISH). Results Major rRNA, core and linker histone gene clusters mapped to different chromosome pairs in the four taxa. In contrast, minor rRNA gene clusters showed a different behavior. In all Mytilus two of the 5S rDNA clusters mapped to the same chromosome pair and one of them showed overlapping signals with those corresponding to one of the histone H1 gene clusters. The overlapping signals on mitotic chromosomes became a pattern of alternate 5S rRNA and linker histone gene signals on extended chromatin fibers. Additionally, M. trossulus showed minor and major rDNA clusters on the same chromosome pair. Conclusion The results obtained suggest that at least some of the chromosomes bearing these sequences are orthologous and that chromosomal mapping of rRNA and histone gene clusters could be a good tool to help deciphering some of the many unsolved questions in the systematic classification of Mytilidae. PMID:25023072

  15. An alanine tRNA gene cluster from Nephila clavipes.

    PubMed

    Luciano, E; Candelas, G C

    1996-06-01

    We report the sequence of a 2.3-kb genomic DNA fragment from the orb-web spider, Nephila clavipes (Nc). The fragment contains four regions of high homology to tRNA(Ala). The members of this irregularly spaced cluster of genes are oriented in the same direction and have the same anticodon (GCA), but their sequence differs at several positions. Initiation and termination signals, as well as consensus intragenic promoter sequences characteristic of tRNA genes, have been identified in all genes. tRNA(Ala) are involved in the regulation of the fibroin synthesis in the large ampullate Nc glands.

  16. Computational Design of Artificial RNA Molecules for Gene Regulation

    PubMed Central

    Laganà, Alessandro; Veneziano, Dario; Russo, Francesco; Pulvirenti, Alfredo; Giugno, Rosalba; Croce, Carlo Maria; Ferro, Alfredo

    2015-01-01

    RNA interference (RNAi) is a powerful tool for the regulation of gene expression. Small exogenous noncoding RNAs (ncRNAs) such as siRNA and shRNA are the active silencing agents, intended to target and cleave complementary mRNAs in a specific way. They are widely and successfully employed in functional studies, and several ongoing and already completed siRNA-based clinical trials suggest encouraging results in the regulation of overexpressed genes in disease. siRNAs share many aspects of their biogenesis and function with miRNAs, small ncRNA molecules transcribed from endogenous genes which are able to repress the expression of target mRNAs by either inhibiting their translation or promoting their degradation. Although siRNA and artificial miRNA molecules can significantly reduce the expression of overexpressed target genes, cancer and other diseases can also be triggered or sustained by upregulated miRNAs. Thus, in the past recent years, molecular tools for miRNA silencing, such as antagomiRs and miRNA sponges, have been developed. These molecules have shown their efficacy in the derepression of genes downregulated by overexpressed miRNAs. In particular, while a single antagomiR is able to inhibit a single complementary miRNA, an artificial sponge construct usually contains one or more binding sites for one or more miRNAs and functions by competing with the natural targets of these miRNAs. As a consequence, natural miRNA targets are reexpressed at their physiological level. In this chapter we review the most successful methods for the computational design of siRNAs, antagomiRs, and miRNA sponges and describe the most popular tools that implement them. PMID:25577393

  17. Spliced synthetic genes as internal controls in RNA sequencing experiments.

    PubMed

    Hardwick, Simon A; Chen, Wendy Y; Wong, Ted; Deveson, Ira W; Blackburn, James; Andersen, Stacey B; Nielsen, Lars K; Mattick, John S; Mercer, Tim R

    2016-09-01

    RNA sequencing (RNA-seq) can be used to assemble spliced isoforms, quantify expressed genes and provide a global profile of the transcriptome. However, the size and diversity of the transcriptome, the wide dynamic range in gene expression and inherent technical biases confound RNA-seq analysis. We have developed a set of spike-in RNA standards, termed 'sequins' (sequencing spike-ins), that represent full-length spliced mRNA isoforms. Sequins have an entirely artificial sequence with no homology to natural reference genomes, but they align to gene loci encoded on an artificial in silico chromosome. The combination of multiple sequins across a range of concentrations emulates alternative splicing and differential gene expression, and it provides scaling factors for normalization between samples. We demonstrate the use of sequins in RNA-seq experiments to measure sample-specific biases and determine the limits of reliable transcript assembly and quantification in accompanying human RNA samples. In addition, we have designed a complementary set of sequins that represent fusion genes arising from rearrangements of the in silico chromosome to aid in cancer diagnosis. RNA sequins provide a qualitative and quantitative reference with which to navigate the complexity of the human transcriptome. PMID:27502218

  18. Regulation of miRNA Processing and miRNA Mediated Gene Repression in Cancer

    PubMed Central

    Bajan, Sarah; Hutvagner, Gyorgy

    2014-01-01

    The majority of human protein-coding genes are predicted to be targets of miRNA-mediated post-transcriptional regulation. The widespread influence of miRNAs is illustrated by their essential roles in all biological processes. Regulated miRNA expression is essential for maintaining cellular differentiation; therefore alterations in miRNA expression patterns are associated with several diseases, including various cancers. High-throughput sequencing technologies revealed low level expressing miRNA isoforms, termed isomiRs. IsomiRs may differ in sequence, length, target preference and expression patterns from their parental miRNA and can arise from differences in miRNA biosynthesis, RNA editing, or SNPs inherent to the miRNA gene. The association between isomiR expression and disease progression is largely unknown. Misregulated miRNA expression is thought to contribute to the formation and/or progression of cancer. However, due to the diversity of targeted transcripts, miRNAs can function as both tumor-suppressor genes and oncogenes as defined by cellular context. Despite this, miRNA profiling studies concluded that the differential expression of particular miRNAs in diseased tissue could aid the diagnosis and treatment of some cancers. PMID:25069508

  19. The theory of RNA-mediated gene evolution

    PubMed Central

    Morris, Kevin V

    2015-01-01

    Observations over the last decade suggest that some RNA transcripts, such as non-coding RNAs, function in regulating the transcriptional and epigenetic state of gene expression. DNA methylation appears to be operative in non-coding RNA regulation of gene expression. Interestingly, methylated cytosines undergo deamination to remove the methylation, which if not properly repaired results in the methylated cytosine being recognized by the cell as a thymine. This observation suggests that the process of non-coding RNA-directed epigenetic targeting also has the potential to alter the genomic landscape of the cell by changing cytosines to thymines and ultimately influence the evolution of the cell. This proposed theory of “RNA-mediated gene evolution” might be one possible mechanism of action whereby RNA participates in the natural selective process to drive cellular and possibly organismal evolution. PMID:25581873

  20. Upregulating endogenous genes by an RNA-programmable artificial transactivator

    PubMed Central

    Fimiani, Cristina; Goina, Elisa; Mallamaci, Antonello

    2015-01-01

    To promote expression of endogenous genes ad libitum, we developed a novel, programmable transcription factor prototype. Kept together via an MS2 coat protein/RNA interface, it includes a fixed, polypeptidic transactivating domain and a variable RNA domain that recognizes the desired gene. Thanks to this device, we specifically upregulated five genes, in cell lines and primary cultures of murine pallial precursors. Gene upregulation was small, however sufficient to robustly inhibit neuronal differentiation. The transactivator interacted with target gene chromatin via its RNA cofactor. Its activity was restricted to cells in which the target gene is normally transcribed. Our device might be useful for specific applications. However for this purpose, it will require an improvement of its transactivation power as well as a better characterization of its target specificity and mechanism of action. PMID:26152305

  1. Amber, ochre and opal suppressor tRNA genes derived from a human serine tRNA gene.

    PubMed Central

    Capone, J P; Sharp, P A; RajBhandary, U L

    1985-01-01

    Amber, ochre and opal suppressor tRNA genes have been generated by using oligonucleotide directed site-specific mutagenesis to change one or two nucleotides in a human serine tRNA gene. The amber and ochre suppressor (Su+) tRNA genes are efficiently expressed in CV-1 cells when introduced as part of a SV40 recombinant. The expressed amber and ochre Su+ tRNAs are functional as suppressors as demonstrated by readthrough of the amber codon which terminates the NS1 gene of an influenza virus or the ochre codon which terminates the hexon gene of adenovirus, respectively. Interestingly, several attempts to obtain the equivalent virus stock of an SV40 recombinant containing the opal suppressor tRNA gene yielded virus lacking the opal suppressor tRNA gene. This suggests that expression of an efficient opal suppressor derived from a human serine tRNA gene is highly detrimental to either cellular or viral processes. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:2990894

  2. A New Class of SINEs with snRNA Gene-Derived Heads

    PubMed Central

    Kojima, Kenji K.

    2015-01-01

    Eukaryotic genomes are colonized by various transposons including short interspersed elements (SINEs). The 5′ region (head) of the majority of SINEs is derived from one of the three types of RNA genes—7SL RNA, transfer RNA (tRNA), or 5S ribosomal RNA (rRNA)—and the internal promoter inside the head promotes the transcription of the entire SINEs. Here I report a new group of SINEs whose heads originate from either the U1 or U2 small nuclear RNA gene. These SINEs, named SINEU, are distributed among crocodilians and classified into three families. The structures of the SINEU-1 subfamilies indicate the recurrent addition of a U1- or U2-derived sequence onto the 5′ end of SINEU-1 elements. SINEU-1 and SINEU-3 are ancient and shared among alligators, crocodiles, and gharials, while SINEU-2 is absent in the alligator genome. SINEU-2 is the only SINE family that was active after the split of crocodiles and gharials. All SINEU families, especially SINEU-3, are preferentially inserted into a family of Mariner DNA transposon, Mariner-N4_AMi. A group of Tx1 non-long terminal repeat retrotransposons designated Tx1-Mar also show target preference for Mariner-N4_AMi, indicating that SINEU was mobilized by Tx1-Mar. PMID:26019167

  3. RNA.

    ERIC Educational Resources Information Center

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  4. Integrated gene set analysis for microRNA studies

    PubMed Central

    Garcia-Garcia, Francisco; Panadero, Joaquin; Dopazo, Joaquin; Montaner, David

    2016-01-01

    Motivation: Functional interpretation of miRNA expression data is currently done in a three step procedure: select differentially expressed miRNAs, find their target genes, and carry out gene set overrepresentation analysis. Nevertheless, major limitations of this approach have already been described at the gene level, while some newer arise in the miRNA scenario. Here, we propose an enhanced methodology that builds on the well-established gene set analysis paradigm. Evidence for differential expression at the miRNA level is transferred to a gene differential inhibition score which is easily interpretable in terms of gene sets or pathways. Such transferred indexes account for the additive effect of several miRNAs targeting the same gene, and also incorporate cancellation effects between cases and controls. Together, these two desirable characteristics allow for more accurate modeling of regulatory processes. Results: We analyze high-throughput sequencing data from 20 different cancer types and provide exhaustive reports of gene and Gene Ontology-term deregulation by miRNA action. Availability and Implementation: The proposed methodology was implemented in the Bioconductor library mdgsa. http://bioconductor.org/packages/mdgsa. For the purpose of reproducibility all of the scripts are available at https://github.com/dmontaner-papers/gsa4mirna Contact: david.montaner@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27324197

  5. Antisense RNA suppression of peroxidase gene expression

    SciTech Connect

    Lagrimini, L.M.; Bradford, S.; De Leon, F.D. )

    1989-04-01

    The 5{prime} half the anionic peroxidase cDNA of tobacco was inserted into a CaMV 35S promoter/terminator expression cassette in the antisense configuration. This was inserted into the Agrobacterium-mediated plant transformation vector pCIBIO which includes kanamycin selection, transformed into two species of tobacco (N. tabacum and M. sylvestris), and plants were subsequently regenerated on kanamycin. Transgenic plants were analyzed for peroxidase expression and found to have 3-5 fold lower levels of peroxidase than wild-type plants. Isoelectric focusing demonstrated that the antisense RNA only suppressed the anionic peroxidase. Wound-induced peroxidase expression was found not to be affected by the antisense RNA. Northern blots show a greater than 5 fold suppression of anionic peroxidase mRNA in leaf tissue, and the antisense RNA was expressed at a level 2 fold over the endogenous mRNA. Plants were self-pollinated and F1 plants showed normal segregation. N. sylvestris transgenic plants with the lowest level of peroxidase are epinastic, and preliminary results indicate elevated auxin levels. Excised pith tissue from both species of transgenic plants rapidly collapse when exposed to air, while pith tissue from wild-type plants showed little change when exposed to air. Further characterization of these phenotypes is currently being made.

  6. The 5S rDNA gene family in mollusks: characterization of transcriptional regulatory regions, prediction of secondary structures, and long-term evolution, with special attention to Mytilidae mussels.

    PubMed

    Vizoso, Miguel; Vierna, Joaquín; González-Tizón, Ana M; Martínez-Lage, Andrés

    2011-01-01

    Several reports on the characterization of 5S ribosomal DNA (5S rDNA) in various animal groups have been published to date, but there is a lack of studies analyzing this gene family in a much broader context. Here, we have studied 5S rDNA variation in several molluskan species, including bivalves, gastropods, and cephalopods. The degree of conservation of transcriptional regulatory regions was analyzed in these lineages, revealing a conserved TATA-like box in the upstream region. The evolution of the 120 bp coding region (5S) was also studied, suggesting the occurrence of paralogue groups in razor clams, clams, and cockles. In addition, 5S rDNA sequences from 11 species and 7 genus of Mytilidae Rafinesque, 1815 mussels were sampled and studied in detail. Four different 5S rDNA types, based on the nontranscribed spacer region were identified. The phylogenetic analyses performed within each type showed a between-species gene clustering pattern, suggesting ancestral polymorphism. Moreover, some putative pseudogenized 5S copies were also identified. Our report, together with previous studies that found high degree of intragenomic divergence in bivalve species, suggests that birth-and-death evolution may be the main force driving the evolution of 5S rDNA in these animals, even at the genus level.

  7. Comparative analysis of dinoflagellate chloroplast genomes reveals rRNA and tRNA genes

    PubMed Central

    Barbrook, Adrian C; Santucci, Nicole; Plenderleith, Lindsey J; Hiller, Roger G; Howe, Christopher J

    2006-01-01

    Background Peridinin-containing dinoflagellates have a highly reduced chloroplast genome, which is unlike that found in other chloroplast containing organisms. Genome reduction appears to be the result of extensive transfer of genes to the nuclear genome. Unusually the genes believed to be remaining in the chloroplast genome are found on small DNA 'minicircles'. In this study we present a comparison of sets of minicircle sequences from three dinoflagellate species. Results PCR was used to amplify several minicircles from Amphidinium carterae so that a homologous set of gene-containing minicircles was available for Amphidinium carterae and Amphidinium operculatum, two apparently closely related peridinin-containing dinoflagellates. We compared the sequences of these minicircles to determine the content and characteristics of their chloroplast genomes. We also made comparisons with minicircles which had been obtained from Heterocapsa triquetra, another peridinin-containing dinoflagellate. These in silico comparisons have revealed several genetic features which were not apparent in single species analyses. The features include further protein coding genes, unusual rRNA genes, which we show are transcribed, and the first examples of tRNA genes from peridinin-containing dinoflagellate chloroplast genomes. Conclusion Comparative analysis of minicircle sequences has allowed us to identify previously unrecognised features of dinoflagellate chloroplast genomes, including additional protein and RNA genes. The chloroplast rRNA gene sequences are radically different from those in other organisms, and in many ways resemble the rRNA genes found in some highly reduced mitochondrial genomes. The retention of certain tRNA genes in the dinoflagellate chloroplast genome has important implications for models of chloroplast-mitochondrion interaction. PMID:17123435

  8. mRNA modifications: Dynamic regulators of gene expression?

    PubMed Central

    Hoernes, Thomas Philipp; Hüttenhofer, Alexander; Erlacher, Matthias David

    2016-01-01

    ABSTRACT The expression of a gene is a tightly regulated process and is exerted by a myriad of different mechanisms. Recently, RNA modifications located in coding sequences of mRNAs, have been identified as potential regulators of gene expression. N6-methyladenosine (m6A), 5-methylcytosine (m5C), pseudouridine (Ψ) and N1-methyladenosine (m1A) have been found within open reading frames of mRNAs. The presence of these mRNA modifications has been implicated to modulate the fate of an mRNA, ranging from maturation to its translation and even degradation. However, many aspects concerning the biological functions of mRNA modifications remain elusive. Recently, systematic in vitro studies allowed a first glimpse of the direct interplay of mRNA modifications and the efficiency and fidelity of ribosomal translation. It thereby became evident that the effects of mRNA modifications were, astonishingly versatile, depending on the type, position or sequence context. The incorporation of a single modification could either prematurely terminate protein synthesis, reduce the peptide yield or alter the amino acid sequence identity. These results implicate that mRNA modifications are a powerful mechanism to post-transcriptionally regulate gene expression. PMID:27351916

  9. Molecular mechanisms of RNA-triggered gene silencing machineries.

    PubMed

    Li, Zhonghan; Rana, Tariq M

    2012-07-17

    Gene silencing by RNA triggers is an ancient, evolutionarily conserved, and widespread phenomenon. This process, known as RNA interference (RNAi), occurs when double-stranded RNA helices induce cleavage of their complementary mRNAs. Because these RNA molecules can be introduced exogenously as small interfering RNAs (siRNAs), RNAi has become an everyday experimental tool in laboratory research. In addition, the number of RNA-based therapeutics that are currently in clinical trials for a variety of human diseases demonstrate the therapeutic potential of RNAi. In this Account, we focus on our current understanding of the structure and function of various classes of RNAi triggers and how this knowledge has contributed to our understanding of the biogenesis and catalytic functions of siRNA and microRNA in mammalian cells. Mechanistic studies to understand the structure and function of small RNAs that induce RNAi have illuminated broad functions of the ancient RNAi machinery in animals and plants. In addition, such studies have provided insight to identify endogenous physiological gene silencing RNA triggers that engage functional machineries similar to siRNAs. Several endogenous small RNA species have been identified: small noncoding RNAs (microRNAs), piwi-interacting RNAs (piRNAs), and endogenous siRNAs (endo-siRNAs). microRNAs are the most widespread class of small RNAs in mammalian cells. Despite their importance in biology and medicine, the molecular and cellular mechanisms of microRNA biogenesis and function are not fully understood. We provide an overview of the current understanding of how these molecules are synthesized within cells and how they act on gene targets. Interesting questions remain both for understanding the effects of modifications and editing on microRNAs and the interactions between microRNAs and other cellular RNAs such as long noncoding RNAs. PMID:22304792

  10. Temperature-driven differential gene expression by RNA thermosensors.

    PubMed

    Krajewski, Stefanie Sandra; Narberhaus, Franz

    2014-10-01

    Many prokaryotic genes are organized in operons. Genes organized in such transcription units are co-transcribed into a polycistronic mRNA. Despite being clustered in a single mRNA, individual genes can be subjected to differential regulation, which is mainly achieved at the level of translation depending on initiation and elongation. Efficiency of translation initiation is primarily determined by the structural accessibility of the ribosome binding site (RBS). Structured cis-regulatory elements like RNA thermometers (RNATs) can contribute to differential regulation of individual genes within a polycistronic mRNA. RNATs are riboregulators that mediate temperature-responsive regulation of a downstream gene by modulating the accessibility of its RBS. At low temperature, the RBS is trapped by intra-molecular base pairing prohibiting translation initiation. The secondary structure melts with increasing temperature thus liberating the RBS. Here, we present an overview of different RNAT types and specifically highlight recently discovered RNATs. The main focus of this review is on RNAT-based differential control of polycistronic operons. Finally, we discuss the influence of temperature on other riboregulators and the potential of RNATs in synthetic RNA biology. This article is part of a Special Issue entitled: Riboswitches.

  11. Methylation of microRNA genes regulates gene expression in bisexual flower development in andromonoecious poplar.

    PubMed

    Song, Yuepeng; Tian, Min; Ci, Dong; Zhang, Deqiang

    2015-04-01

    Previous studies showed sex-specific DNA methylation and expression of candidate genes in bisexual flowers of andromonoecious poplar, but the regulatory relationship between methylation and microRNAs (miRNAs) remains unclear. To investigate whether the methylation of miRNA genes regulates gene expression in bisexual flower development, the methylome, microRNA, and transcriptome were examined in female and male flowers of andromonoecious poplar. 27 636 methylated coding genes and 113 methylated miRNA genes were identified. In the coding genes, 64.5% of the methylated reads mapped to the gene body region; by contrast, 60.7% of methylated reads in miRNA genes mainly mapped in the 5' and 3' flanking regions. CHH methylation showed the highest methylation levels and CHG showed the lowest methylation levels. Correlation analysis showed a significant, negative, strand-specific correlation of methylation and miRNA gene expression (r=0.79, P <0.05). The methylated miRNA genes included eight long miRNAs (lmiRNAs) of 24 nucleotides and 11 miRNAs related to flower development. miRNA172b might play an important role in the regulation of bisexual flower development-related gene expression in andromonoecious poplar, via modification of methylation. Gynomonoecious, female, and male poplars were used to validate the methylation patterns of the miRNA172b gene, implying that hyper-methylation in andromonoecious and gynomonoecious poplar might function as an important regulator in bisexual flower development. Our data provide a useful resource for the study of flower development in poplar and improve our understanding of the effect of epigenetic regulation on genes other than protein-coding genes.

  12. Methylation of microRNA genes regulates gene expression in bisexual flower development in andromonoecious poplar

    PubMed Central

    Song, Yuepeng; Tian, Min; Ci, Dong; Zhang, Deqiang

    2015-01-01

    Previous studies showed sex-specific DNA methylation and expression of candidate genes in bisexual flowers of andromonoecious poplar, but the regulatory relationship between methylation and microRNAs (miRNAs) remains unclear. To investigate whether the methylation of miRNA genes regulates gene expression in bisexual flower development, the methylome, microRNA, and transcriptome were examined in female and male flowers of andromonoecious poplar. 27 636 methylated coding genes and 113 methylated miRNA genes were identified. In the coding genes, 64.5% of the methylated reads mapped to the gene body region; by contrast, 60.7% of methylated reads in miRNA genes mainly mapped in the 5′ and 3′ flanking regions. CHH methylation showed the highest methylation levels and CHG showed the lowest methylation levels. Correlation analysis showed a significant, negative, strand-specific correlation of methylation and miRNA gene expression (r=0.79, P <0.05). The methylated miRNA genes included eight long miRNAs (lmiRNAs) of 24 nucleotides and 11 miRNAs related to flower development. miRNA172b might play an important role in the regulation of bisexual flower development-related gene expression in andromonoecious poplar, via modification of methylation. Gynomonoecious, female, and male poplars were used to validate the methylation patterns of the miRNA172b gene, implying that hyper-methylation in andromonoecious and gynomonoecious poplar might function as an important regulator in bisexual flower development. Our data provide a useful resource for the study of flower development in poplar and improve our understanding of the effect of epigenetic regulation on genes other than protein-coding genes. PMID:25617468

  13. Accumulation of (5'S)-8,5'-cyclo-2'-deoxyadenosine in organs of Cockayne syndrome complementation group B gene knockout mice.

    PubMed

    Kirkali, Güldal; de Souza-Pinto, Nadja C; Jaruga, Pawel; Bohr, Vilhelm A; Dizdaroglu, Miral

    2009-02-01

    Cockayne syndrome (CS) is a human genetic disorder characterized by sensitivity to UV radiation, neurodegeneration, premature aging among other phenotypes. CS complementation group B (CS-B) gene (csb) encodes the CSB protein (CSB) that is involved in base excision repair of a number of oxidatively induced lesions in genomic DNA in vivo. We hypothesized that CSB may also play a role in cellular repair of the DNA helix-distorting tandem lesion (5'S)-8,5'-cyclo-2'-deoxyadenosine (S-cdA). Among many DNA lesions, S-cdA is unique in that it represents a concomitant damage to both the sugar and base moieties of the same nucleoside. Because of the presence of the C8-C5' covalent bond, S-cdA is repaired by nucleotide excision repair unlike most of other oxidatively induced lesions in DNA, which are subject to base excision repair. To test our hypothesis, we isolated genomic DNA from brain, kidney and liver of wild type and csb knockout (csb(-/-)) mice. Animals were not exposed to any exogenous oxidative stress before the experiment. DNA samples were analysed by liquid chromatography/mass spectrometry with isotope-dilution. Statistically greater background levels of S-cdA were observed in all three organs of csb(-/-) mice than in those of wild type mice. These results suggest the in vivo accumulation of S-cdA in genomic DNA due to lack of its repair in csb(-/-) mice. Thus, this study provides, for the first time, the evidence that CSB plays a role in the repair of the DNA helix-distorting tandem lesion S-cdA. Accumulation of unrepaired S-cdA in vivo may contribute to the pathology associated with CS. PMID:18992371

  14. In silico analysis of miRNA-mediated gene regulation in OCA and OA genes.

    PubMed

    Kamaraj, Balu; Gopalakrishnan, Chandrasekhar; Purohit, Rituraj

    2014-12-01

    Albinism is an autosomal recessive genetic disorder due to low secretion of melanin. The oculocutaneous albinism (OCA) and ocular albinism (OA) genes are responsible for melanin production and also act as a potential targets for miRNAs. The role of miRNA is to inhibit the protein synthesis partially or completely by binding with the 3'UTR of the mRNA thus regulating gene expression. In this analysis, we predicted the genetic variation that occurred in 3'UTR of the transcript which can be a reason for low melanin production thus causing albinism. The single nucleotide polymorphisms (SNPs) in 3'UTR cause more new binding sites for miRNA which binds with mRNA which leads to inhibit the translation process either partially or completely. The SNPs in the mRNA of OCA and OA genes can create new binding sites for miRNA which may control the gene expression and lead to hypopigmentation. We have developed a computational procedure to determine the SNPs in the 3'UTR region of mRNA of OCA (TYR, OCA2, TYRP1 and SLC45A2) and OA (GPR143) genes which will be a potential cause for albinism. We identified 37 SNPs in five genes that are predicted to create 87 new binding sites on mRNA, which may lead to abrogation of the translation process. Expression analysis confirms that these genes are highly expressed in skin and eye regions. It is well supported by enrichment analysis that these genes are mainly involved in eye pigmentation and melanin biosynthesis process. The network analysis also shows how the genes are interacting and expressing in a complex network. This insight provides clue to wet-lab researches to understand the expression pattern of OCA and OA genes and binding phenomenon of mRNA and miRNA upon mutation, which is responsible for inhibition of translation process at genomic levels. PMID:25060099

  15. Chromosomal localization of rDNA genes and genomic organization of 5S rDNA in Oreochromis mossambicus, O. urolepis hornorum and their hybrid.

    PubMed

    Zhu, Hua Ping; Lu, Mai Xin; Gao, Feng Ying; Huang, Zhang Han; Yang, Li Ping; Gui, Jian Fang

    2010-08-01

    In this study, classical and molecular cytogenetic analyses were performed in tilapia fishes, Oreochromis mossambicus (XX/XY sex determination system), O. urolepis hornorum (WZ/ZZ sex determination system) and their hybrid by crossing O. mossambicus female x O. u. hornorum male. An identical karyotype ((2n = 44, NF (total number of chromosomal arms) = 50) was obtained from three examined tilapia samples. Genomic organization analysis of 5S rDNA revealed two different types of 5S rDNA sequences, 5S type I and 5S type II. Moreover, fluorescence in situ hybridization (FISH) with 5S rDNA probes showed six positive fluorescence signals on six chromosomes of all the analysed metaphases from the three tilapia samples. Subsequently, 45S rDNA probes were also prepared, and six positive fluorescence signals were observed on three chromosome pairs in all analysed metaphases of the three tilapia samples. The correlation between 45 rDNA localization and nucleolar organizer regions (NORs) was confirmed by silver nitrate staining in tilapia fishes. Further, different chromosomal localizations of 5S rDNA and 45S rDNA were verified by two different colour FISH probes. Briefly, the current data provide an insights for hybridization projects and breeding improvement of tilapias.

  16. TAP1, a yeast gene that activates the expression of a tRNA gene with a defective internal promoter.

    PubMed Central

    Di Segni, G; McConaughy, B L; Shapiro, R A; Aldrich, T L; Hall, B D

    1993-01-01

    We developed a genetic selection system based on nonsense suppression in Saccharomyces cerevisiae to identify mutations in proteins involved in transcription initiation by RNA polymerase III. A SUP4 tRNA(Tyr) internal promoter mutation (A53T61) that was unable to suppress ochre mutations in vivo and was incapable of binding TFIIIC in vitro was used as the target for selection of trans-acting compensatory mutations. We identified two such mutations in the same gene, which we named TAP1 (for transcription activation protein). The level of the SUP4A53T61 transcript was threefold higher in the tap1-1 mutant than in the wild type. The tap1-1 mutant strain was also temperature sensitive for growth. The thermosensitive character cosegregated with the restorer of suppression activity, as shown by meiotic linkage analysis and coreversion of the two traits. At 1 to 2 h after a shift to the restrictive temperature, RNA synthesis was strongly inhibited in the tap1-1 mutant, preceding any effect upon protein synthesis or growth. A marked decrease in tRNA and 5S rRNA synthesis was seen, and shortly after that, rRNA synthesis was inhibited. By complementation of the ts- growth defect, we cloned the wild-type TAP1 gene. It is essential for yeast growth. We show in the accompanying report (T. L. Aldrich, G. Di Segni, B. L. McConaughy, N. J. Keen, S. Whelen, and B. D. Hall, Mol. Cell. Biol. 13:3434-3444, 1993) that TAP1 is identical to RAT1, a yeast gene implicated in poly(A)+ RNA export and that the TAP1/RAT1 gene product has extensive sequence similarity to the protein encoded by another yeast gene (variously named DST2, KEM1, RAR5, SEP1, or XRN1) having exonuclease and DNA strand transfer activity (reviewed by Kearsey and Kipling [Trends Cell Biol. 1:110-112, 1991]). Images PMID:8497259

  17. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules

    PubMed Central

    Valach, Matus; Burger, Gertraud; Gray, Michael W.; Lang, B. Franz

    2014-01-01

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. PMID:25429974

  18. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    PubMed

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator.

  19. Ultrasensitive DNA chip: gene expression profile analysis without RNA amplification.

    PubMed

    Nagino, Kunihisa; Nomura, Osamu; Takii, Yuki; Myomoto, Akira; Ichikawa, Makiko; Nakamura, Fumio; Higasa, Masashi; Akiyama, Hideo; Nobumasa, Hitoshi; Shiojima, Satoshi; Tsujimoto, Gozoh

    2006-04-01

    We have developed a new DNA chip whose substrate has a unique minute columnar array structure made of plastic. The DNA chip exhibits ultrahigh sensitivity, up to 100-fold higher than that of reference DNA chips, which makes it possible to monitor gene expression profiles even with very small amounts of RNA (0.1-0.01 microg of total RNA) without amplification. Differential expression ratios obtained with the new DNA chip were validated against those obtained with quantitative real-time PCR assays. This novel microarray technology would be a powerful tool for monitoring gene expression profiles, especially for clinical diagnosis.

  20. siRNA Versus miRNA as Therapeutics for Gene Silencing.

    PubMed

    Lam, Jenny K W; Chow, Michael Y T; Zhang, Yu; Leung, Susan W S

    2015-09-15

    Discovered a little over two decades ago, small interfering RNAs (siRNAs) and microRNAs (miRNAs) are noncoding RNAs with important roles in gene regulation. They have recently been investigated as novel classes of therapeutic agents for the treatment of a wide range of disorders including cancers and infections. Clinical trials of siRNA- and miRNA-based drugs have already been initiated. siRNAs and miRNAs share many similarities, both are short duplex RNA molecules that exert gene silencing effects at the post-transcriptional level by targeting messenger RNA (mRNA), yet their mechanisms of action and clinical applications are distinct. The major difference between siRNAs and miRNAs is that the former are highly specific with only one mRNA target, whereas the latter have multiple targets. The therapeutic approaches of siRNAs and miRNAs are therefore very different. Hence, this review provides a comparison between therapeutic siRNAs and miRNAs in terms of their mechanisms of action, physicochemical properties, delivery, and clinical applications. Moreover, the challenges in developing both classes of RNA as therapeutics are also discussed.

  1. siRNA Versus miRNA as Therapeutics for Gene Silencing

    PubMed Central

    Lam, Jenny K W; Chow, Michael Y T; Zhang, Yu; Leung, Susan W S

    2015-01-01

    Discovered a little over two decades ago, small interfering RNAs (siRNAs) and microRNAs (miRNAs) are noncoding RNAs with important roles in gene regulation. They have recently been investigated as novel classes of therapeutic agents for the treatment of a wide range of disorders including cancers and infections. Clinical trials of siRNA- and miRNA-based drugs have already been initiated. siRNAs and miRNAs share many similarities, both are short duplex RNA molecules that exert gene silencing effects at the post-transcriptional level by targeting messenger RNA (mRNA), yet their mechanisms of action and clinical applications are distinct. The major difference between siRNAs and miRNAs is that the former are highly specific with only one mRNA target, whereas the latter have multiple targets. The therapeutic approaches of siRNAs and miRNAs are therefore very different. Hence, this review provides a comparison between therapeutic siRNAs and miRNAs in terms of their mechanisms of action, physicochemical properties, delivery, and clinical applications. Moreover, the challenges in developing both classes of RNA as therapeutics are also discussed. PMID:26372022

  2. MicroRNA-Offset RNA Alters Gene Expression and Cell Proliferation

    PubMed Central

    Zhao, Jin; Schnitzler, Gavin R.; Iyer, Lakshmanan K.; Aronovitz, Mark J.; Baur, Wendy E.; Karas, Richard H.

    2016-01-01

    MicroRNA-offset RNAs (moRs) were first identified in simple chordates and subsequently in mouse and human cells by deep sequencing of short RNAs. MoRs are derived from sequences located immediately adjacent to microRNAs (miRs) in the primary miR (pri-miR). Currently moRs are considered to be simply a by-product of miR biosynthesis that lack biological activity. Here we show for the first time that a moR is biologically active. We demonstrate that endogenous or over-expressed moR-21 significantly alters gene expression and inhibits the proliferation of vascular smooth muscle cells (VSMC). In addition, we find that miR-21 and moR-21 may regulate different genes in a given pathway and can oppose each other in regulating certain genes. We report that there is a “seed region” of moR-21 as well as a “seed match region” in the target gene 3’UTR that are indispensable for moR-21-mediated gene down-regulation. We further demonstrate that moR-21-mediated gene repression is Argonaute 2 (Ago2) dependent. Taken together, these findings provide the first evidence that microRNA offset RNA alters gene expression and is biologically active. PMID:27276022

  3. Posttranscriptional regulation of retroviral gene expression: primary RNA transcripts play three roles as pre-mRNA, mRNA, and genomic RNA

    PubMed Central

    LeBlanc, Jason; Weil, Jason; Beemon, Karen

    2013-01-01

    After reverse transcription of the retroviral RNA genome and integration of the DNA provirus into the host genome, host machinery is used for viral gene expression along with viral proteins and RNA regulatory elements. Here, we discuss co-transcriptional and posttranscriptional regulation of retroviral gene expression, comparing simple and complex retroviruses. Cellular RNA polymerase II synthesizes full-length viral primary RNA transcripts that are capped and polyadenylated. All retroviruses generate a singly spliced env mRNA from this primary transcript, which encodes the viral glycoproteins. In addition, complex viral RNAs are alternatively spliced to generate accessory proteins, such as Rev, which is involved in posttranscriptional regulation of HIV-1 RNA. Importantly, the splicing of all retroviruses is incomplete; they must maintain and export a fraction of their primary RNA transcripts. This unspliced RNA functions both as the major mRNA for Gag and Pol proteins and as the packaged genomic RNA. Different retroviruses export their unspliced viral RNA from the nucleus to the cytoplasm by either Tap-dependent or Rev/CRM1-dependent routes. Translation of the unspliced mRNA involves frame-shifting or termination codon suppression so that the Gag proteins, which make up the capsid, are expressed more abundantly than the Pol proteins, which are the viral enzymes. After the viral polyproteins assemble into viral particles and bud from the cell membrane, a viral encoded protease cleaves them. Some retroviruses have evolved mechanisms to protect their unspliced RNA from decay by nonsense-mediated RNA decay and to prevent genome editing by the cellular APOBEC deaminases. PMID:23754689

  4. Characterization of recombinant bacteriophages containing mosquito ribosomal RNA genes

    SciTech Connect

    Park, Y.J.

    1988-01-01

    A family of nine recombinant bacteriophages containing rRNA genes from cultured cells of the mosquito, Aedes albopictus, has been isolated by screening two different genomic DNA libraries - Charon 30 and EMBL 3 using {sup 32}P-labeled 18S and 28S rRNA as probes. These nine recombinant bacteriophages were characterized by restriction mapping, Southern blotting, and S1 nuclease analysis. The 18S rRNA coding region contains an evolutionarily conserved EcoRI site near the 3{prime}-end, and measures 1800 bp. The 28S rRNA genes were divided into {alpha} and {beta} coding regions measuring 1750 bp and 2000 bp, respectively. The gap between these two regions measures about 340 bp. No insertion sequences were found in the rRNA coding regions. The entire rDNA repeat unit had a minimum length of 15.6 kb, including a nontranscribed spacer region. The non-transcribed spacer region of cloned A. albopictus rDNA contained a common series of seven PvuI sites within a 1250 bp region upstream of the 18S rRNA coding region, and a proportion of this region also showed heterogeneity both in the length and in the restriction sites.

  5. Modification of Globin Gene Expression by RNA Targeting Strategies

    PubMed Central

    Shen, Tong-Jian; Rogers, Heather; Yu, Xiaobing; Lin, Felix; Noguchi, Constance T.; Ho, Chien

    2007-01-01

    Objective Sickle cell anemia is a genetic blood disease resulting from production of mutant β-globin (βS) and has severe clinical consequences. It is known that a higher cellular γ-globin level, e.g., higher ratio of cellular γ-globin to βS-globin (γ/βS ratio), inhibits sickle hemoglobin (HbS) polymerization tendency. Hence, therapeutic treatment of sickle cell anemia has been focused on introducing γ-globin gene into red blood cells to increase the cellular γ/βS ratio. Here, we have introduced ribozymes and small interfering RNAs (siRNAs) against βS-globin mRNA into blood cells as a means to increase the γ/βS ratio. Methods Single and multi-ribozymes against βS-globin mRNA have been tested in vitro and in human erythroleukemia K562βS cells that stably express exogenous βS-globin gene. Primary human hematopoietic progenitor cells were also transfected with multi-ribozyme and the γ/(γ+β) ratio determined and compared with cells transfected with long hairpin β-globin cDNA and synthetic siRNA genes. Results We have found that the multi-ribozyme zb21A containing two ribozyme units effectively reduces βS-globin mRNA both in vitro and in K562βS cells. The γ-globin mRNA to βS-globin mRNA ratio in the multi-ribozyme transfected cells is about a factor of 2 more than that in the control cells. We have also found that the γ/(γ+β) ratio in the transfected hematopoietic progenitor cells is increased by more than 2-fold in cells treated with multi-ribozyme zb21A or siRNA ib5. Conclusion Our results suggest that introducing multi-ribozymes or siRNAs into red blood cells are comparable in their effectiveness to increase the ratio of cellular γ-globin mRNA to β- or βS-globin mRNA, providing possible strategies to increase the effectiveness of γ-globin gene transfer as gene therapy for treatment of patients with sickle cell anemia. PMID:17662889

  6. Serum stress responsive gene EhslncRNA of Entamoeba histolytica is a novel long noncoding RNA.

    PubMed

    Saha, Arpita; Bhattacharya, Sudha; Bhattacharya, Alok

    2016-01-01

    Non coding RNAs are known to play important roles in regulating gene expression at the transcriptional and posttranscriptional levels in metazoans. There is very little information available about non coding RNAs in protists such as Entamoeba histolytica. Antisense and micro RNAs have been reported in E. histolytica, however no long non coding RNAs has been reported yet. Here, we report our findings on an in vitro serum stress-inducible gene EhslncRNA, a member of B1 transmembrane kinase family of E. histolytica. EhslncRNA encodes a transcript of 2.6 kb and sequence analysis revealed that there is no ORF >150 bp within this transcript. The transcript was found to be polyadenylated and mainly associated with monosomes in the cytoplasm under serum starvation. In normal proliferating cells this RNA is mainly present in the nucleus. The promoter element was mapped between 437 to 346 nucleotides upstream of transcriptional start site and has both positive and negative regulatory elements. Deletion of the negative element converted the promoter to serum inducible type. Oxygen and heat stress also increased expression levels of EhslncRNA. These observations suggest that EhslncRNA may be a long non coding RNA and likely to help cells withstand stressful conditions in the host. PMID:27273618

  7. Serum stress responsive gene EhslncRNA of Entamoeba histolytica is a novel long noncoding RNA

    PubMed Central

    Saha, Arpita; Bhattacharya, Sudha; Bhattacharya, Alok

    2016-01-01

    Non coding RNAs are known to play important roles in regulating gene expression at the transcriptional and posttranscriptional levels in metazoans. There is very little information available about non coding RNAs in protists such as Entamoeba histolytica. Antisense and micro RNAs have been reported in E. histolytica, however no long non coding RNAs has been reported yet. Here, we report our findings on an in vitro serum stress-inducible gene EhslncRNA, a member of B1 transmembrane kinase family of E. histolytica. EhslncRNA encodes a transcript of 2.6 kb and sequence analysis revealed that there is no ORF >150 bp within this transcript. The transcript was found to be polyadenylated and mainly associated with monosomes in the cytoplasm under serum starvation. In normal proliferating cells this RNA is mainly present in the nucleus. The promoter element was mapped between 437 to 346 nucleotides upstream of transcriptional start site and has both positive and negative regulatory elements. Deletion of the negative element converted the promoter to serum inducible type. Oxygen and heat stress also increased expression levels of EhslncRNA. These observations suggest that EhslncRNA may be a long non coding RNA and likely to help cells withstand stressful conditions in the host. PMID:27273618

  8. Serum stress responsive gene EhslncRNA of Entamoeba histolytica is a novel long noncoding RNA.

    PubMed

    Saha, Arpita; Bhattacharya, Sudha; Bhattacharya, Alok

    2016-01-01

    Non coding RNAs are known to play important roles in regulating gene expression at the transcriptional and posttranscriptional levels in metazoans. There is very little information available about non coding RNAs in protists such as Entamoeba histolytica. Antisense and micro RNAs have been reported in E. histolytica, however no long non coding RNAs has been reported yet. Here, we report our findings on an in vitro serum stress-inducible gene EhslncRNA, a member of B1 transmembrane kinase family of E. histolytica. EhslncRNA encodes a transcript of 2.6 kb and sequence analysis revealed that there is no ORF >150 bp within this transcript. The transcript was found to be polyadenylated and mainly associated with monosomes in the cytoplasm under serum starvation. In normal proliferating cells this RNA is mainly present in the nucleus. The promoter element was mapped between 437 to 346 nucleotides upstream of transcriptional start site and has both positive and negative regulatory elements. Deletion of the negative element converted the promoter to serum inducible type. Oxygen and heat stress also increased expression levels of EhslncRNA. These observations suggest that EhslncRNA may be a long non coding RNA and likely to help cells withstand stressful conditions in the host.

  9. Impact of Host Genes and Strand Selection on miRNA and miRNA* Expression

    PubMed Central

    Biasiolo, Marta; Sales, Gabriele; Lionetti, Marta; Agnelli, Luca; Todoerti, Katia; Bisognin, Andrea; Coppe, Alessandro; Romualdi, Chiara; Neri, Antonino; Bortoluzzi, Stefania

    2011-01-01

    Dysregulation of miRNAs expression plays a critical role in the pathogenesis of genetic, multifactorial disorders and in human cancers. We exploited sequence, genomic and expression information to investigate two main aspects of post-transcriptional regulation in miRNA biogenesis, namely strand selection regulation and expression relationships between intragenic miRNAs and host genes. We considered miRNAs expression profiles, measured in five sizeable microarray datasets, including samples from different normal cell types and tissues, as well as different tumours and disease states. First, the study of expression profiles of “sister” miRNA pairs (miRNA/miRNA*, 5′ and 3′ strands of the same hairpin precursor) showed that the strand selection is highly regulated since it shows tissue-/cell-/condition-specific modulation. We used information about the direction and the strength of the strand selection bias to perform an unsupervised cluster analysis for the sample classification evidencing that is able to distinguish among different tissues, and sometimes between normal and malignant cells. Then, considering a minimum expression threshold, in few miRNA pairs only one mature miRNA is always present in all considered cell types, whereas the majority of pairs were concurrently expressed in some cell types and alternatively in others. In a significant fraction of concurrently expressed pairs, the major and the minor forms found at comparable levels may contribute to post-transcriptional gene silencing, possibly in a coordinate way. In the second part of the study, the behaved tendency to co-expression of intragenic miRNAs and their “host” mRNA genes was confuted by expression profiles examination, suggesting that the expression profile of a given host gene can hardly be a good estimator of co-transcribed miRNA(s) for post-transcriptional regulatory networks inference. Our results point out the regulatory importance of post-transcriptional phases of mi

  10. MicroRNA-regulated viral vectors for gene therapy.

    PubMed

    Geisler, Anja; Fechner, Henry

    2016-05-20

    Safe and effective gene therapy approaches require targeted tissue-specific transfer of a therapeutic transgene. Besides traditional approaches, such as transcriptional and transductional targeting, microRNA-dependent post-transcriptional suppression of transgene expression has been emerging as powerful new technology to increase the specificity of vector-mediated transgene expression. MicroRNAs are small non-coding RNAs and often expressed in a tissue-, lineage-, activation- or differentiation-specific pattern. They typically regulate gene expression by binding to imperfectly complementary sequences in the 3' untranslated region (UTR) of the mRNA. To control exogenous transgene expression, tandem repeats of artificial microRNA target sites are usually incorporated into the 3' UTR of the transgene expression cassette, leading to subsequent degradation of transgene mRNA in cells expressing the corresponding microRNA. This targeting strategy, first shown for lentiviral vectors in antigen presenting cells, has now been used for tissue-specific expression of vector-encoded therapeutic transgenes, to reduce immune response against the transgene, to control virus tropism for oncolytic virotherapy, to increase safety of live attenuated virus vaccines and to identify and select cell subsets for pluripotent stem cell therapies, respectively. This review provides an introduction into the technical mechanism underlying microRNA-regulation, highlights new developments in this field and gives an overview of applications of microRNA-regulated viral vectors for cardiac, suicide gene cancer and hematopoietic stem cell therapy, as well as for treatment of neurological and eye diseases. PMID:27226955

  11. MicroRNA-regulated viral vectors for gene therapy

    PubMed Central

    Geisler, Anja; Fechner, Henry

    2016-01-01

    Safe and effective gene therapy approaches require targeted tissue-specific transfer of a therapeutic transgene. Besides traditional approaches, such as transcriptional and transductional targeting, microRNA-dependent post-transcriptional suppression of transgene expression has been emerging as powerful new technology to increase the specificity of vector-mediated transgene expression. MicroRNAs are small non-coding RNAs and often expressed in a tissue-, lineage-, activation- or differentiation-specific pattern. They typically regulate gene expression by binding to imperfectly complementary sequences in the 3’ untranslated region (UTR) of the mRNA. To control exogenous transgene expression, tandem repeats of artificial microRNA target sites are usually incorporated into the 3’ UTR of the transgene expression cassette, leading to subsequent degradation of transgene mRNA in cells expressing the corresponding microRNA. This targeting strategy, first shown for lentiviral vectors in antigen presenting cells, has now been used for tissue-specific expression of vector-encoded therapeutic transgenes, to reduce immune response against the transgene, to control virus tropism for oncolytic virotherapy, to increase safety of live attenuated virus vaccines and to identify and select cell subsets for pluripotent stem cell therapies, respectively. This review provides an introduction into the technical mechanism underlying microRNA-regulation, highlights new developments in this field and gives an overview of applications of microRNA-regulated viral vectors for cardiac, suicide gene cancer and hematopoietic stem cell therapy, as well as for treatment of neurological and eye diseases. PMID:27226955

  12. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  13. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces.

  14. Riboswitch-Mediated Gene Regulation: Novel RNA Architectures Dictate Gene Expression Responses.

    PubMed

    Sherwood, Anna V; Henkin, Tina M

    2016-09-01

    Riboswitches are RNA elements that act on the mRNA with which they are cotranscribed to modulate expression of that mRNA. These elements are widely found in bacteria, where they have a broad impact on gene expression. The defining feature of riboswitches is that they directly recognize a physiological signal, and the resulting shift in RNA structure affects gene regulation. The majority of riboswitches respond to cellular metabolites, often in a feedback loop to repress synthesis of the enzymes used to produce the metabolite. Related elements respond to the aminoacylation status of a specific tRNA or to a physical parameter, such as temperature or pH. Recent studies have identified new classes of riboswitches and have revealed new insights into the molecular mechanisms of signal recognition and gene regulation. Application of structural and biophysical approaches has complemented previous genetic and biochemical studies, yielding new information about how different riboswitches operate. PMID:27607554

  15. Development of a universal RNA beacon for exogenous gene detection.

    PubMed

    Guo, Yuanjian; Lu, Zhongju; Cohen, Ira Stephen; Scarlata, Suzanne

    2015-05-01

    Stem cell therapy requires a nontoxic and high-throughput method to achieve a pure cell population to prevent teratomas that can occur if even one cell in the implant has not been transformed. A promising method to detect and separate cells expressing a particular gene is RNA beacon technology. However, developing a successful, specific beacon to a particular transfected gene can take months to develop and in some cases is impossible. Here, we report on an off-the-shelf universal beacon that decreases the time and cost of applying beacon technology to select any living cell population transfected with an exogenous gene.

  16. Development of a Universal RNA Beacon for Exogenous Gene Detection

    PubMed Central

    Guo, Yuanjian; Lu, Zhongju; Cohen, Ira Stephen

    2015-01-01

    Stem cell therapy requires a nontoxic and high-throughput method to achieve a pure cell population to prevent teratomas that can occur if even one cell in the implant has not been transformed. A promising method to detect and separate cells expressing a particular gene is RNA beacon technology. However, developing a successful, specific beacon to a particular transfected gene can take months to develop and in some cases is impossible. Here, we report on an off-the-shelf universal beacon that decreases the time and cost of applying beacon technology to select any living cell population transfected with an exogenous gene. PMID:25769653

  17. Reproducible, Scalable Fusion Gene Detection from RNA-Seq.

    PubMed

    Arsenijevic, Vladan; Davis-Dusenbery, Brandi N

    2016-01-01

    Chromosomal rearrangements resulting in the creation of novel gene products, termed fusion genes, have been identified as driving events in the development of multiple types of cancer. As these gene products typically do not exist in normal cells, they represent valuable prognostic and therapeutic targets. Advances in next-generation sequencing and computational approaches have greatly improved our ability to detect and identify fusion genes. Nevertheless, these approaches require significant computational resources. Here we describe an approach which leverages cloud computing technologies to perform fusion gene detection from RNA sequencing data at any scale. We additionally highlight methods to enhance reproducibility of bioinformatics analyses which may be applied to any next-generation sequencing experiment. PMID:26667464

  18. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  19. GeneTack database: genes with frameshifts in prokaryotic genomes and eukaryotic mRNA sequences.

    PubMed

    Antonov, Ivan; Baranov, Pavel; Borodovsky, Mark

    2013-01-01

    Database annotations of prokaryotic genomes and eukaryotic mRNA sequences pay relatively low attention to frame transitions that disrupt protein-coding genes. Frame transitions (frameshifts) could be caused by sequencing errors or indel mutations inside protein-coding regions. Other observed frameshifts are related to recoding events (that evolved to control expression of some genes). Earlier, we have developed an algorithm and software program GeneTack for ab initio frameshift finding in intronless genes. Here, we describe a database (freely available at http://topaz.gatech.edu/GeneTack/db.html) containing genes with frameshifts (fs-genes) predicted by GeneTack. The database includes 206 991 fs-genes from 1106 complete prokaryotic genomes and 45 295 frameshifts predicted in mRNA sequences from 100 eukaryotic genomes. The whole set of fs-genes was grouped into clusters based on sequence similarity between fs-proteins (conceptually translated fs-genes), conservation of the frameshift position and frameshift direction (-1, +1). The fs-genes can be retrieved by similarity search to a given query sequence via a web interface, by fs-gene cluster browsing, etc. Clusters of fs-genes are characterized with respect to their likely origin, such as pseudogenization, phase variation, etc. The largest clusters contain fs-genes with programed frameshifts (related to recoding events).

  20. Conditional Mutants of Rpc160, the Gene Encoding the Largest Subunit of RNA Polymerase C in Saccharomyces Cerevisiae

    PubMed Central

    Gudenus, R.; Mariotte, S.; Moenne, A.; Ruet, A.; Memet, S.; Buhler, J. M.; Sentenac, A.; Thuriaux, P.

    1988-01-01

    A 18.4-kb fragment of the yeast genome containing the gene of the largest subunit of RNA polymerase C (RPC160) was cloned by hybridization to a previously isolated fragment of that gene. RPC160 maps on chromosome XV, tightly linked but not allelic to the essential gene TSM8740. Temperature sensitive (ts) mutant alleles were constructed by in vitro mutagenesis with NaHSO(3) and substituted for the wild-type allele on the chromosome. Four of them were unambiguously identified as rpc160 mutants by failure to complement a fully defective mutation rpc160::URA3. The faithful transcription of a yeast tRNA gene by mutant cell-free extracts is strongly reduced as compared to wild-type. In vivo, the rpc160 mutations specifically affect the synthesis of tRNA in a temperature sensitive way, with comparatively little effect on the synthesis of 5S rRNA and no effect on 5.8S rRNA. An unlinked mutation (pci1-3) suppresses the temperature sensitive phenotype of the rpc160-41 mutation. PMID:2841184

  1. Alteration of BRCA1 expression affects alcohol-induced transcription of RNA Pol III-dependent genes.

    PubMed

    Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Lu, Lei; Levy, Daniel; Zhong, Shuping

    2015-02-01

    Emerging evidence has indicated that alcohol consumption is an established risk factor for breast cancer. Deregulation of RNA polymerase III (Pol III) transcription enhances cellular Pol III gene production, leading to an increase in translational capacity to promote cell transformation and tumor formation. We have reported that alcohol intake increases Pol III gene transcription to promote cell transformation and tumor formation in vitro and in vivo. Studies revealed that tumor suppressors, pRb, p53, PTEN and Maf1 repress the transcription of Pol III genes. BRCA1 is a tumor suppressor and its mutation is tightly related to breast cancer development. However, it is not clear whether BRCA1 expression affects alcohol-induced transcription of Pol III genes. At the present studies, we report that restoring BRCA1 in HCC 1937 cells, which is a BRCA1 deficient cell line, represses Pol III gene transcription. Expressing mutant or truncated BRCA1 in these cells does not affect the ability of repression on Pol III genes. Our analysis has demonstrated that alcohol induces Pol III gene transcription. More importantly, overexpression of BRCA1 in estrogen receptor positive (ER+) breast cancer cells (MCF-7) decreases the induction of tRNA(Leu) and 5S rRNA genes by alcohol, whereas reduction of BRCA1 by its siRNA slightly increases the transcription of the class of genes. This suggests that BRCA1 is associated with alcohol-induced deregulation of Pol III genes. These studies for the first time demonstrate the role of BRCA1 in induction of Pol III genes by alcohol and uncover a novel mechanism of alcohol-associated breast cancer.

  2. The role of RNA structure at 5′ untranslated region in microRNA-mediated gene regulation

    PubMed Central

    Xu, Yuming; Xie, Xueying; Wang, Ting; Ko, Jae-Hong; Zhou, Tong

    2014-01-01

    Recent studies have suggested that the secondary structure of the 5′ untranslated region (5′ UTR) of messenger RNA (mRNA) is important for microRNA (miRNA)-mediated gene regulation in humans. mRNAs that are targeted by miRNA tend to have a higher degree of local secondary structure in their 5′ UTR; however, the general role of the 5′ UTR in miRNA-mediated gene regulation remains unknown. We systematically surveyed the secondary structure of 5′ UTRs in both plant and animal species and found a universal trend of increased mRNA stability near the 5′ cap in mRNAs that are regulated by miRNA in animals, but not in plants. Intra-genome comparison showed that gene expression level, GC content of the 5′ UTR, number of miRNA target sites, and 5′ UTR length may influence mRNA structure near the 5′ cap. Our results suggest that the 5′ UTR secondary structure performs multiple functions in regulating post-transcriptional processes. Although the local structure immediately upstream of the start codon is involved in translation initiation, RNA structure near the 5′ cap site, rather than the structure of the full-length 5′ UTR sequences, plays an important role in miRNA-mediated gene regulation. PMID:25002673

  3. Cloning of the RNA8 gene of Saccharomyces cerevisiae, detection of the RNA8 protein, and demonstration that it is essential for nuclear pre-mRNA splicing.

    PubMed Central

    Jackson, S P; Lossky, M; Beggs, J D

    1988-01-01

    Strains of Saccharomyces cerevisiae that bear the temperature-sensitive mutation rna8-1 are defective in nuclear pre-mRNA splicing at the restrictive temperature (36 degrees C), suggesting that the RNA8 gene encodes a component of the splicing machinery. The RNA8 gene was cloned by complementation of the temperature-sensitive growth defect of an rna8-1 mutant strain. Integrative transformation and gene disruption experiments confirmed the identity of the cloned DNA and demonstrated that the RNA8 gene encodes an essential function. The RNA8 gene was shown to be represented once per S. cerevisiae haploid genome and to encode a low-abundance transcript of approximately 7.4 kilobases. By using antisera raised against beta-galactosidase-RNA8 fusion proteins, the RNA8 gene product was identified in S. cerevisiae cell extracts as a low-abundance protein of approximately 260 kilodaltons. Immunodepletion of the RNA8 protein specifically abolished the activity of S. cerevisiae in vitro splicing extracts, confirming that RNA8 plays an essential role in splicing. Images PMID:2835658

  4. RNA-Seq Gene Profiling - A Systematic Empirical Comparison

    PubMed Central

    Fonseca, Nuno A.; Marioni, John; Brazma, Alvis

    2014-01-01

    Accurately quantifying gene expression levels is a key goal of experiments using RNA-sequencing to assay the transcriptome. This typically requires aligning the short reads generated to the genome or transcriptome before quantifying expression of pre-defined sets of genes. Differences in the alignment/quantification tools can have a major effect upon the expression levels found with important consequences for biological interpretation. Here we address two main issues: do different analysis pipelines affect the gene expression levels inferred from RNA-seq data? And, how close are the expression levels inferred to the “true” expression levels? We evaluate fifty gene profiling pipelines in experimental and simulated data sets with different characteristics (e.g, read length and sequencing depth). In the absence of knowledge of the ‘ground truth’ in real RNAseq data sets, we used simulated data to assess the differences between the “true” expression and those reconstructed by the analysis pipelines. Even though this approach does not take into account all known biases present in RNAseq data, it still allows to estimate the accuracy of the gene expression values inferred by different analysis pipelines. The results show that i) overall there is a high correlation between the expression levels inferred by the best pipelines and the true quantification values; ii) the error in the estimated gene expression values can vary considerably across genes; and iii) a small set of genes have expression estimates with consistently high error (across data sets and methods). Finally, although the mapping software is important, the quantification method makes a greater difference to the results. PMID:25268973

  5. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing

    PubMed Central

    Nishina, Kazutaka; Piao, Wenying; Yoshida-Tanaka, Kie; Sujino, Yumiko; Nishina, Tomoko; Yamamoto, Tsuyoshi; Nitta, Keiko; Yoshioka, Kotaro; Kuwahara, Hiroya; Yasuhara, Hidenori; Baba, Takeshi; Ono, Fumiko; Miyata, Kanjiro; Miyake, Koichi; Seth, Punit P.; Low, Audrey; Yoshida, Masayuki; Bennett, C. Frank; Kataoka, Kazunori; Mizusawa, Hidehiro; Obika, Satoshi; Yokota, Takanori

    2015-01-01

    Antisense oligonucleotides (ASOs) are recognized therapeutic agents for the modulation of specific genes at the post-transcriptional level. Similar to any medical drugs, there are opportunities to improve their efficacy and safety. Here we develop a short DNA/RNA heteroduplex oligonucleotide (HDO) with a structure different from double-stranded RNA used for short interfering RNA and single-stranded DNA used for ASO. A DNA/locked nucleotide acid gapmer duplex with an α-tocopherol-conjugated complementary RNA (Toc-HDO) is significantly more potent at reducing the expression of the targeted mRNA in liver compared with the parent single-stranded gapmer ASO. Toc-HDO also improves the phenotype in disease models more effectively. In addition, the high potency of Toc-HDO results in a reduction of liver dysfunction observed in the parent ASO at a similar silencing effect. HDO technology offers a novel concept of therapeutic oligonucleotides, and the development of this molecular design opens a new therapeutic field. PMID:26258894

  6. Understanding mechanisms underlying human gene expression variation with RNA sequencing

    PubMed Central

    Pickrell, Joseph K.; Marioni, John C.; Pai, Athma A.; Degner, Jacob F.; Engelhardt, Barbara E.; Nkadori, Everlyne; Veyrieras, Jean-Baptiste; Stephens, Matthew; Gilad, Yoav; Pritchard, Jonathan K.

    2011-01-01

    Understanding the genetic mechanisms underlying natural variation in gene expression is a central goal of both medical and evolutionary genetics, and studies of expression quantitative trait loci (eQTLs) have become an important tool for achieving this goal1. Although all eQTL studies so far have assayed messenger RNA levels using expression microarrays, recent advances in RNA sequencing enable the analysis of transcript variation at unprecedented resolution. We sequenced RNA from 69 lymphoblastoid cell lines derived from unrelated Nigerian individuals that have been extensively genotyped by the International HapMap Project2. By pooling data from all individuals, we generated a map of the transcriptional landscape of these cells, identifying extensive use of unannotated untranslated regions and more than 100 new putative protein-coding exons. Using the genotypes from the HapMap project, we identified more than a thousand genes at which genetic variation influences overall expression levels or splicing. We demonstrate that eQTLs near genes generally act by a mechanism involving allele-specific expression, and that variation that influences the inclusion of an exon is enriched within and near the consensus splice sites. Our results illustrate the power of high-throughput sequencing for the joint analysis of variation in transcription, splicing and allele-specific expression across individuals. PMID:20220758

  7. Integrated microRNA-gene analysis of coronary artery disease based on miRNA and gene expression profiles

    PubMed Central

    XU, XIANGDONG; LI, HONGSONG

    2016-01-01

    The present study aimed to investigate the key genes and microRNAs (miRNA/miRs) associated with coronary artery disease (CAD) progression. The gene expression profile of GSE20680 and GSE12288, and the miRNA expression profile of GSE28858 were downloaded from the gene expression omnibus database. The differentially expressed genes (DEGs) in GSE20680 and GSE12288, and the differentially expressed miRNAs in GSE28858 were screened using the limma package in R software. Common DEGs between GSE20680 and GSE12288 were selected. Functions and pathways of DEGs and miRNAs were enriched using the DAVID tool from the GO and KEGG databases. The regulatory network of miRNA and selected CAD-associated DEGs was constructed. A total of 270 DEGs (167 upregulated and 103 downregulated) based on the GSE20680 dataset, and 2,268 DEGs (534 upregulated and 1,734 downregulated) based on the GSE12288 dataset, were screened. For the differentially expressed miRNAs, 214 were identified (102 upregulated and 112 downregulated) in CAD samples and were screened. Interferon regulatory factor 2 (IRF2) and cell death-inducing DFFA-like effector b (CIDEB), which are regulated by signal transducer and activator of transcription 3 and myc-associated factor X, were identified as common DEGs for CAD. miR-455-5p, miR-455-3p and miR-1257, which are involved in the major histocompatibility complex (MHC)protein assembly pathway and peptide antigen assembly with MHC class I protein complex pathway, may regulate various miRNAs and target genes, including pro-opiomelancortin (POMC), toll-like receptor 4 (TLR4), interleukin 10 (IL10), activating transcription factor 6 (ATF6) and calreticulin (CALR). The current study identified IRF2 and CIDEB as crucial genes, and miRNA-455-5p, miRNA-455-3p and miR-1257 along with their target genes POMC, TLR4 and CALR, as miRNAs involved in CAD progression. Thus, the present study may provide a basis for future research into the progression mechanism of CAD. PMID:26936111

  8. Rapid intraspecific evolution of miRNA and siRNA genes in the mosquito Aedes aegypti.

    PubMed

    Bernhardt, Scott A; Simmons, Mark P; Olson, Ken E; Beaty, Barry J; Blair, Carol D; Black, William C

    2012-01-01

    RNA silencing, or RNA interference (RNAi) in metazoans mediates development, reduces viral infection and limits transposon mobility. RNA silencing involves 21-30 nucleotide RNAs classified into microRNA (miRNA), exogenous and endogenous small interfering RNAs (siRNA), and Piwi-interacting RNA (piRNA). Knock-out, silencing and mutagenesis of genes in the exogenous siRNA (exo-siRNA) regulatory network demonstrate the importance of this RNAi pathway in antiviral immunity in Drosophila and mosquitoes. In Drosophila, genes encoding components for processing exo-siRNAs are among the fastest evolving 3% of all genes, suggesting that infection with pathogenic RNA viruses may drive diversifying selection in their host. In contrast, paralogous miRNA pathway genes do not evolve more rapidly than the genome average. Silencing of exo-siRNA pathway genes in mosquitoes orally infected with arboviruses leads to increased viral replication, but little is known about the comparative patterns of molecular evolution among the exo-siRNA and miRNA pathways genes in mosquitoes. We generated nearly complete sequences of all exons of major miRNA and siRNA pathway genes dicer-1 and dicer-2, argonaute-1 and argonaute-2, and r3d1 and r2d2 in 104 Aedes aegypti mosquitoes collected from six distinct geographic populations and analyzed their genetic diversity. The ratio of replacement to silent amino acid substitutions was 1.4 fold higher in dicer-2 than in dicer-1, 27.4 fold higher in argonaute-2 than in argonaute-1 and similar in r2d2 and r3d1. Positive selection was supported in 32% of non-synonymous sites in dicer-1, in 47% of sites in dicer-2, in 30% of sites in argonaute-1, in all sites in argonaute-2, in 22% of sites in r3d1 and in 55% of sites in r2d2. Unlike Drosophila, in Ae. aegypti, both exo-siRNA and miRNA pathway genes appear to be undergoing rapid, positive, diversifying selection. Furthermore, refractoriness of mosquitoes to infection with dengue virus was significantly

  9. Multiple Yeast Genes, Including Paf1 Complex Genes, Affect Telomere Length via Telomerase RNA Abundance▿ †

    PubMed Central

    Mozdy, Amy D.; Podell, Elaine R.; Cech, Thomas R.

    2008-01-01

    Twofold reductions in telomerase RNA levels cause telomere shortening in both humans and the yeast Saccharomyces cerevisiae. To test whether multiple genes that affect telomere length act by modulating telomerase RNA abundance, we used real-time reverse transcription-PCR to screen S. cerevisiae deletion strains reported to maintain shorter or longer telomeres to determine the levels of their telomerase RNA (TLC1) abundance. Of 290 strains screened, 5 had increased TLC1 levels; 4 of these maintained longer telomeres. Twenty strains had decreased TLC1 levels; 18 of these are known to maintain shorter telomeres. Four strains with decreased TLC1 RNA levels contained deletions of subunits of Paf1C (polymerase II-associated factor complex). While Paf1C had been implicated in the transcription of both polyadenylated and nonpolyadenylated RNAs, Paf1C had not been associated previously with the noncoding telomerase RNA. In Paf1C mutant strains, TLC1 overexpression partially rescues telomere length and cell growth defects, suggesting that telomerase RNA is a critical direct or indirect Paf1C target. Other factors newly identified as affecting TLC1 RNA levels include cyclin-dependent kinase, the mediator complex, protein phosphatase 2A, and ribosomal proteins L13B and S16A. This report establishes that a subset of telomere length genes act by modulating telomerase RNA abundance. PMID:18411302

  10. The structure of the yeast ribosomal RNA genes. I. The complete nucleotide sequence of the 18S ribosomal RNA gene from Saccharomyces cerevisiae.

    PubMed

    Rubtsov, P M; Musakhanov, M M; Zakharyev, V M; Krayev, A S; Skryabin, K G; Bayev, A A

    1980-12-11

    The cloned 18 S ribosomal RNA gene from Saccharomyces cerevisiae have been sequenced, using the Maxam-Gilbert procedure. From this data the complete sequence of 1789 nucleotides of the 18 S RNA was deduced. Extensive homology with many eucaryotic as well as E. coli ribosomal small subunit rRNA (S-rRNA) has been observed in the 3'-end region of the rRNA molecule. Comparison of the yeast 18 S rRNA sequences with partial sequence data, available for rRNAs of the other eucaryotes provides strong evidence that a substantial portion of the 18 S RNA sequence has been conserved in evolution.

  11. Downregulation of plant genes with miRNA-induced gene silencing.

    PubMed

    de Felippes, Felipe Fenselau

    2013-01-01

    In plants, some microRNAs (miRNAs) can trigger the production of secondary small interfering RNAs (siRNAs) from their targets. miRNA-induced gene silencing (MIGS) exploits this unique feature to efficiently downregulate gene expression. The simple flanking of a sequence of interest with the target site for the miR173 (an miRNA able to trigger transitivity) is sufficient to start the production of secondary siRNAs and, consequently, silencing of the target gene. This technique can be easily adapted to promote gene silencing of more than one gene, even with those that share no sequence similarities. This chapter describes the necessary steps for designing and implementing the use of MIGS in plants.

  12. The Trypanosoma brucei protein phosphatase gene: polycistronic transcription with the RNA polymerase II largest subunit gene.

    PubMed Central

    Evers, R; Cornelissen, A W

    1990-01-01

    We have previously described the trypanosomal gene encoding the largest subunit of RNA polymerase II (RNAP II) and found that two almost identical genes are encoded within the Trypanosoma brucei genome. Here we show by Southern analyses that the 5' breakpoint between both loci is located approximately 7.5 kb upstream of the RNAP II genes. Northern analyses revealed that the 5' duplicated segment contains at least four other genes, which are transcribed in both bloodstream and procyclic trypanosomes. The gene located immediately upstream of the RNAP II gene in both loci was characterized by sequence analyses. The deduced amino acid sequences show a high degree of similarity to the catalytic subunit of protein phosphatase class 1 (PP1) genes. S1 mapping provided strong evidence in support of the fact that the PP1 and RNAP II genes belong to a single transcription unit. Images PMID:2169604

  13. An RNA-dependent RNA polymerase gene in bat genomes derived from an ancient negative-strand RNA virus.

    PubMed

    Horie, Masayuki; Kobayashi, Yuki; Honda, Tomoyuki; Fujino, Kan; Akasaka, Takumi; Kohl, Claudia; Wibbelt, Gudrun; Mühldorfer, Kristin; Kurth, Andreas; Müller, Marcel A; Corman, Victor M; Gillich, Nadine; Suzuki, Yoshiyuki; Schwemmle, Martin; Tomonaga, Keizo

    2016-01-01

    Endogenous bornavirus-like L (EBLL) elements are inheritable sequences derived from ancient bornavirus L genes that encode a viral RNA-dependent RNA polymerase (RdRp) in many eukaryotic genomes. Here, we demonstrate that bats of the genus Eptesicus have preserved for more than 11.8 million years an EBLL element named eEBLL-1, which has an intact open reading frame of 1,718 codons. The eEBLL-1 coding sequence revealed that functional motifs essential for mononegaviral RdRp activity are well conserved in the EBLL-1 genes. Genetic analyses showed that natural selection operated on eEBLL-1 during the evolution of Eptesicus. Notably, we detected efficient transcription of eEBLL-1 in tissues from Eptesicus bats. To the best of our knowledge, this study is the first report showing that the eukaryotic genome has gained a riboviral polymerase gene from an ancient virus that has the potential to encode a functional RdRp. PMID:27174689

  14. An RNA-dependent RNA polymerase gene in bat genomes derived from an ancient negative-strand RNA virus

    PubMed Central

    Horie, Masayuki; Kobayashi, Yuki; Honda, Tomoyuki; Fujino, Kan; Akasaka, Takumi; Kohl, Claudia; Wibbelt, Gudrun; Mühldorfer, Kristin; Kurth, Andreas; Müller, Marcel A.; Corman, Victor M.; Gillich, Nadine; Suzuki, Yoshiyuki; Schwemmle, Martin; Tomonaga, Keizo

    2016-01-01

    Endogenous bornavirus-like L (EBLL) elements are inheritable sequences derived from ancient bornavirus L genes that encode a viral RNA-dependent RNA polymerase (RdRp) in many eukaryotic genomes. Here, we demonstrate that bats of the genus Eptesicus have preserved for more than 11.8 million years an EBLL element named eEBLL-1, which has an intact open reading frame of 1,718 codons. The eEBLL-1 coding sequence revealed that functional motifs essential for mononegaviral RdRp activity are well conserved in the EBLL-1 genes. Genetic analyses showed that natural selection operated on eEBLL-1 during the evolution of Eptesicus. Notably, we detected efficient transcription of eEBLL-1 in tissues from Eptesicus bats. To the best of our knowledge, this study is the first report showing that the eukaryotic genome has gained a riboviral polymerase gene from an ancient virus that has the potential to encode a functional RdRp. PMID:27174689

  15. Identification of miRNA-Mediated Core Gene Module for Glioma Patient Prediction by Integrating High-Throughput miRNA, mRNA Expression and Pathway Structure

    PubMed Central

    Han, Junwei; Shang, Desi; Zhang, Yunpeng; Zhang, Wei; Yao, Qianlan; Han, Lei; Xu, Yanjun; Yan, Wei; Bao, Zhaoshi; You, Gan; Jiang, Tao; Kang, Chunsheng; Li, Xia

    2014-01-01

    The prognosis of glioma patients is usually poor, especially in patients with glioblastoma (World Health Organization (WHO) grade IV). The regulatory functions of microRNA (miRNA) on genes have important implications in glioma cell survival. However, there are not many studies that have investigated glioma survival by integrating miRNAs and genes while also considering pathway structure. In this study, we performed sample-matched miRNA and mRNA expression profilings to systematically analyze glioma patient survival. During this analytical process, we developed pathway-based random walk to identify a glioma core miRNA-gene module, simultaneously considering pathway structure information and multi-level involvement of miRNAs and genes. The core miRNA-gene module we identified was comprised of four apparent sub-modules; all four sub-modules displayed a significant correlation with patient survival in the testing set (P-values≤0.001). Notably, one sub-module that consisted of 6 miRNAs and 26 genes also correlated with survival time in the high-grade subgroup (WHO grade III and IV), P-value = 0.0062. Furthermore, the 26-gene expression signature from this sub-module had robust predictive power in four independent, publicly available glioma datasets. Our findings suggested that the expression signatures, which were identified by integration of miRNA and gene level, were closely associated with overall survival among the glioma patients with various grades. PMID:24809850

  16. The gene for human E2 small nucleolar RNA resides in an intron of a laminin-binding protein gene

    SciTech Connect

    Selvamurugan, N.; Eliceiri, G.L.

    1995-11-20

    Several of the known small nucleolar RNA (snoRNA) species have been shown to be required for processing of ribosomal RNA precursors (pre-rRNA). The genes of most of the known vertebrate snoRNA species are located in introns of genes for messenger RNA precursors. E2 RNA is a nucleolar species that is 154 nucleotides long in human; it belongs to a new family of snoRNAs because it does not have the sequences named box C, C{prime} or D that are present in most vertebrate snoRNA species, and it does not bind fibrillarin, the nucleolar protein associated with most snoRNAs. E2 snoRNA is found in all tissues tested and in all vertebrates analyzed. E2 snoRNA is expected to have a unique function in ribosome formation, because it psoralen-photocrosslinks in vivo to a unique internal segment of the 28S rRNA sequence of pre-rRNA. Two observations are compatible with the possibility that the human E2 RNA gene may be intronic. First, the human E2 RNA gene lacks the intragenic or flanking sequences that are functional in other genes. Second, the 5{prime} end of E2 RNA is monophosphorylated, suggesting that is formed by RNA processing. Intron-encoded snoRNAs have monophosphorylated 5{prime}termini. Until now, it was not known whether the E2 RNA gene resides in an intron. This information is important for studying the biosynthesis of E2 RNA. 13 refs., 1 fig.

  17. Ribosomal RNA genes of Trypanosoma brucei. Cloning of a rRNA gene containing a mobile element.

    PubMed Central

    Hasan, G; Turner, M J; Cordingley, J S

    1982-01-01

    An ordered restriction map of the ribosomal RNA genes of Trypanosoma brucei brucei is presented. Bgl II fragments of T.b.brucei genomic DNA were cloned into pAT 153, and the clones containing rDNA identified. Restriction maps were established and the sense strands identified. One clone was shown by heteroduplex mapping to contain a 1.1 kb inserted sequence which was demonstrated to be widely distributed throughout the genomes of members of the subgenus Trypanozoon. However, in two other subgenera of Trypanosoma, Nannomonas and Schizotrypanum, the sequence is far less abundant. Analysis of the genomic DNA from two serodemes of T.b.brucei showed that the sequence was present in the rRNA of only one of them, implying that the sequence is a mobile element and that its appearance in rDNA is a comparitively recent occurrence. Images PMID:6294613

  18. Chromosomal localization of human RNA polymerase II subunit genes

    SciTech Connect

    Acker, J.; Wintzerith, M.; Vigneron, M.; Kedinger, C. ); Mattei, M.G.; Roeckel, N.; Depetris, D. )

    1994-04-01

    The eukaryotic DNA-dependent RNA polymerase II (or B) is composed of 10 to 14 polypeptides ranging from 220 to 10 kDa. To gain further insight into the molecular structure and function of these subunits, the authors have undertaken the molecular cloning of nucleotide sequences corresponding to the human enzyme. The cDNAs of five subunits (hRPB220, hRPB140, hRPB33, hRPB25, and hRPB14.5) have been isolated. Using in situ hybridization, they show that the genes of these subunits have distinct chromosomal locations (17p13, 4q12, 16q13-q21, 19p13.3, and 19q12, respectively). Thus, if assembly of active polymerase molecules requires coordinated expression from these independent genes, mechanisms that ensure tight coregulation of the corresponding promoters must exist. 20 refs., 2 figs., 1 tab.

  19. Horizontal gene transfer of chlamydial-like tRNA genes into early vascular plant mitochondria.

    PubMed

    Knie, Nils; Polsakiewicz, Monika; Knoop, Volker

    2015-03-01

    Mitochondrial genomes of lycophytes are surprisingly diverse, including strikingly different transfer RNA (tRNA) gene complements: No mitochondrial tRNA genes are present in the spikemoss Selaginella moellendorffii, whereas 26 tRNAs are encoded in the chondrome of the clubmoss Huperzia squarrosa. Reinvestigating the latter we found that trnL(gag) and trnS(gga) had never before been identified in any other land plant mitochondrial DNA. Sensitive sequence comparisons showed these two tRNAs as well as trnN(guu) and trnS(gcu) to be very similar to their respective counterparts in chlamydial bacteria. We identified homologs of these chlamydial-type tRNAs also in other lycophyte, fern, and gymnosperm DNAs, suggesting horizontal gene transfer (HGT) into mitochondria in the early vascular plant stem lineages. These findings extend plant mitochondrial HGT to affect individual tRNA genes, to include bacterial donors, and suggest that Chlamydiae on top of their recently proposed key role in primary chloroplast establishment may also have participated in early tracheophyte genome evolution.

  20. Human tRNA genes function as chromatin insulators.

    PubMed

    Raab, Jesse R; Chiu, Jonathan; Zhu, Jingchun; Katzman, Sol; Kurukuti, Sreenivasulu; Wade, Paul A; Haussler, David; Kamakaka, Rohinton T

    2012-01-18

    Insulators help separate active chromatin domains from silenced ones. In yeast, gene promoters act as insulators to block the spread of Sir and HP1 mediated silencing while in metazoans most insulators are multipartite autonomous entities. tDNAs are repetitive sequences dispersed throughout the human genome and we now show that some of these tDNAs can function as insulators in human cells. Using computational methods, we identified putative human tDNA insulators. Using silencer blocking, transgene protection and repressor blocking assays we show that some of these tDNA-containing fragments can function as barrier insulators in human cells. We find that these elements also have the ability to block enhancers from activating RNA pol II transcribed promoters. Characterization of a putative tDNA insulator in human cells reveals that the site possesses chromatin signatures similar to those observed at other better-characterized eukaryotic insulators. Enhanced 4C analysis demonstrates that the tDNA insulator makes long-range chromatin contacts with other tDNAs and ETC sites but not with intervening or flanking RNA pol II transcribed genes.

  1. Bacterial control of host gene expression through RNA polymerase II

    PubMed Central

    Lutay, Nataliya; Ambite, Ines; Hernandez, Jenny Grönberg; Rydström, Gustav; Ragnarsdóttir, Bryndís; Puthia, Manoj; Nadeem, Aftab; Zhang, Jingyao; Storm, Petter; Dobrindt, Ulrich; Wullt, Björn; Svanborg, Catharina

    2013-01-01

    The normal flora furnishes the host with ecological barriers that prevent pathogen attack while maintaining tissue homeostasis. Urinary tract infections (UTIs) constitute a highly relevant model of microbial adaptation in which some patients infected with Escherichia coli develop acute pyelonephritis, while other patients with bacteriuria exhibit an asymptomatic carrier state similar to bacterial commensalism. It remains unclear if the lack of destructive inflammation merely reflects low virulence or if carrier strains actively inhibit disease-associated responses in the host. Here, we identify a new mechanism of bacterial adaptation through broad suppression of RNA polymerase II–dependent (Pol II–dependent) host gene expression. Over 60% of all genes were suppressed 24 hours after human inoculation with the prototype asymptomatic bacteriuria (ABU) strain E. coli 83972, and inhibition was verified by infection of human cells. Specific repressors and activators of Pol II–dependent transcription were modified, Pol II phosphorylation was inhibited, and pathogen-specific signaling was suppressed in cell lines and inoculated patients. An increased frequency of strains inhibiting Pol II was epidemiologically verified in ABU and fecal strains compared with acute pyelonephritis, and a Pol II antagonist suppressed the disease-associated host response. These results suggest that by manipulating host gene expression, ABU strains promote tissue integrity while inhibiting pathology. Such bacterial modulation of host gene expression may be essential to sustain asymptomatic bacterial carriage by ensuring that potentially destructive immune activation will not occur. PMID:23728172

  2. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    PubMed

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  3. Peptides from aminoacyl-tRNA synthetases can cure the defects due to mutations in mt tRNA genes.

    PubMed

    Francisci, Silvia; Montanari, Arianna; De Luca, Cristina; Frontali, Laura

    2011-11-01

    Recent results from several laboratories have confirmed that human and yeast leucyl- and valyl-tRNA synthetases can rescue the respiratory defects due to mutations in mitochondrial tRNA genes. In this report we show that this effect cannot be ascribed to the catalytic activity per se and that isolated domains of aminoacyl-tRNA synthetases and even short peptides thereof have suppressing effects.

  4. Hypoxic stress suppresses RNA polymerase III recruitment and tRNA gene transcription in cardiomyocytes

    PubMed Central

    Ernens, Isabelle; Goodfellow, Sarah J.; Innes, Fiona; Kenneth, Niall S.; Derblay, Louise E.; White, Robert J.; Scott, Pamela H.

    2006-01-01

    RNA polymerase (pol) III transcription decreases when primary cultures of rat neonatal cardiomyocytes are exposed to low oxygen tension. Previous studies in fibroblasts have shown that the pol III-specific transcription factor IIIB (TFIIIB) is bound and regulated by the proto-oncogene product c-Myc, the mitogen-activated protein kinase ERK and the retinoblastoma tumour suppressor protein, RB. The principal function of TFIIIB is to recruit pol III to its cognate gene template, an activity that is known to be inhibited by RB and stimulated by ERK. We demonstrate by chromatin immunoprecipitation (ChIP) that c-Myc also stimulates pol III recruitment by TFIIIB. However, hypoxic conditions cause TFIIIB dissociation from c-Myc and ERK, at the same time as increasing its interaction with RB. Consistent with this, ChIP assays indicate that the occupancy of tRNA genes by pol III is significantly reduced, whereas promoter binding by TFIIIB is undiminished. The data suggest that hypoxia can inhibit pol III transcription by altering the interactions between TFIIIB and its regulators and thus compromising its ability to recruit the polymerase. These effects are independent of cell cycle changes. PMID:16407335

  5. Selection and Verification of Candidate Reference Genes for Mature MicroRNA Expression by Quantitative RT-PCR in the Tea Plant (Camellia sinensis).

    PubMed

    Song, Hui; Zhang, Xiao; Shi, Cong; Wang, Shuangshuang; Wu, Ailin; Wei, Chaoling

    2016-05-28

    Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) is a rapid and sensitive method for analyzing microRNA (miRNA) expression. However, accurate qRT-PCR results depend on the selection of reliable reference genes as internal positive controls. To date, few studies have identified reliable reference genes for differential expression analysis of miRNAs among tissues, and among experimental conditions in plants. In this study, three miRNAs and four non-coding small RNAs (ncRNA) were selected as reference candidates, and the stability of their expression was evaluated among different tissues and under different experimental conditions in the tea plant (Camellia sinensis) using the geNorm and NormFinder programs. It was shown that miR159a was the best single reference gene in the bud to the fifth leaf, 5S rRNA was the most suitable gene in different organs, miR6149 was the most stable gene when the leaves were attacked by Ectropis oblique and U4, miR5368n and miR159a were the best genes when the leaves were treated by methyl jasmonate (MeJA), salicylic acid (SA) and abscisic acid (ABA), respectively. Our results provide suitable reference genes for future investigations on miRNA functions in tea plants.

  6. Selection and Verification of Candidate Reference Genes for Mature MicroRNA Expression by Quantitative RT-PCR in the Tea Plant (Camellia sinensis)

    PubMed Central

    Song, Hui; Zhang, Xiao; Shi, Cong; Wang, Shuangshuang; Wu, Ailin; Wei, Chaoling

    2016-01-01

    Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) is a rapid and sensitive method for analyzing microRNA (miRNA) expression. However, accurate qRT-PCR results depend on the selection of reliable reference genes as internal positive controls. To date, few studies have identified reliable reference genes for differential expression analysis of miRNAs among tissues, and among experimental conditions in plants. In this study, three miRNAs and four non-coding small RNAs (ncRNA) were selected as reference candidates, and the stability of their expression was evaluated among different tissues and under different experimental conditions in the tea plant (Camellia sinensis) using the geNorm and NormFinder programs. It was shown that miR159a was the best single reference gene in the bud to the fifth leaf, 5S rRNA was the most suitable gene in different organs, miR6149 was the most stable gene when the leaves were attacked by Ectropis oblique and U4, miR5368n and miR159a were the best genes when the leaves were treated by methyl jasmonate (MeJA), salicylic acid (SA) and abscisic acid (ABA), respectively. Our results provide suitable reference genes for future investigations on miRNA functions in tea plants. PMID:27240406

  7. Intervening sequences in ribosomal RNA genes and bobbed phenotype in Drosophila hydei.

    PubMed

    Franz, G; Kunz, W

    1981-08-13

    The "bobbed' (bb) mutation in Drosophila is represented phenotypically by shortened and abnormally thin scutellar bristles and by delayed development. There is a direct correlation between bristle size and ribosomal RNA (rRNA) synthesis, and the bb mutation was at first explained as a deficiency of rRNA genes (rDNA). However, the bb phenotype can occur in Drosophila melanogaster and Drosophila hydei with high rDNA content, while phenotypically wild-type flies are known with few rRNA genes, suggesting that what matters is not the number of rRNA genes but their transcriptional activity. In D. melanogaster, it has recently emerged that rRNA genes interrupted by an intervening sequence are not transcribed. We now report that in D. hydei, the length of the scutellar bristle is directly proportional to the number of rRNA genes without this intervening sequence.

  8. Brain Gene Expression Signatures From Cerebrospinal Fluid Exosome RNA Profiling

    NASA Technical Reports Server (NTRS)

    Zanello, S. B.; Stevens, B.; Calvillo, E.; Tang, R.; Gutierrez Flores, B.; Hu, L.; Skog, J.; Bershad, E.

    2016-01-01

    While the Visual Impairment and Intracranial Pressure (VIIP) syndrome observations have focused on ocular symptoms, spaceflight has been also associated with a number of other performance and neurologic signs, such as headaches, cognitive changes, vertigo, nausea, sleep/circadian disruption and mood alterations, which, albeit likely multifactorial, can also result from elevation of intracranial pressure (ICP). We therefore hypothesize that these various symptoms are caused by disturbances in the neurophysiology of the brain structures and are correlated with molecular markers in the cerebrospinal fluid (CSF) as indicators of neurophysiological changes. Exosomes are 30-200 nm microvesicles shed into all biofluids, including blood, urine, and CSF, carrying a highly rich source of intact protein and RNA cargo. Exosomes have been identified in human CSF, and their proteome and RNA pool is a potential new reservoir for biomarker discovery in neurological disorders. The purpose of this study is to investigate changes in brain gene expression via exosome analysis in patients suffering from ICP elevation of varied severity (idiopathic intracranial hypertension -IIH), a condition which shares some of the neuroophthalmological features of VIIP, as a first step toward obtaining evidence suggesting that cognitive function and ICP levels can be correlated with biomarkers in the CSF. Our preliminary work, reported last year, validated the exosomal technology applicable to CSF analysis and demonstrated that it was possible to obtain gene expression evidence of inflammation processes in traumatic brain injury patients. We are now recruiting patients with suspected IIH requiring lumbar puncture at Baylor College of Medicine. Both CSF (5 ml) and human plasma (10 ml) are being collected in order to compare the pattern of differentially expressed genes observed in CSF and in blood. Since blood is much more accessible than CSF, we would like to determine whether plasma biomarkers for

  9. The expression of prokaryotic tRNA genes in frog oocytes.

    PubMed Central

    Bossi, L; Ciampi, M S

    1983-01-01

    A tRNA gene cluster in Salmonella typhimurium includes the genes for tRNAArg, tRNAHis, tRNA1Leu and tRNAPro. DNA clones were constructed with different portions of this tRNA gene cluster. These clones were microinjected into the nuclei of Xenopus laevis oocytes and assayed for expression. Two of the bacterial tRNA genes (tRNAArg and tRNAPro) are transcribed at high rates and the primary transcripts are processed into mature tRNAs. Transcription and processing are largely independent of whether the two genes are injected individually or as part of a tRNA gene cluster. A third tRNA gene (tRNA1Leu) is expressed less efficiently. Synthesis of this tRNA is totally abolished by a deletion removing 22 bp in the first half of the tRNA1Leu coding sequence. The expression of the fourth tRNA gene (tRNAHis) is very inefficient and dependent upon the gene organization within the injected DNA. No significant tRNA synthesis is detected upon injection of a clone containing only the tRNAHis gene. Evidence is presented suggesting that the impaired expression of the tRNAHis gene is not caused by inefficient transcription, but rather by defective processing of the primary transcript. The prokaryotic tRNAs synthesized in the oocytes show a modification pattern that is specific of eukaryotic tRNAs. Overall, our results are consistent with the hypothesis that the intragenic signals for eukaryotic tRNA gene transcription have appeared early in evolution for reasons other than gene expression. Images PMID:6304627

  10. Analysis of hairpin RNA transgene-induced gene silencing in Fusarium oxysporum

    PubMed Central

    2013-01-01

    Background Hairpin RNA (hpRNA) transgenes can be effective at inducing RNA silencing and have been exploited as a powerful tool for gene function analysis in many organisms. However, in fungi, expression of hairpin RNA transcripts can induce post-transcriptional gene silencing, but in some species can also lead to transcriptional gene silencing, suggesting a more complex interplay of the two pathways at least in some fungi. Because many fungal species are important pathogens, RNA silencing is a powerful technique to understand gene function, particularly when gene knockouts are difficult to obtain. We investigated whether the plant pathogenic fungus Fusarium oxysporum possesses a functional gene silencing machinery and whether hairpin RNA transcripts can be employed to effectively induce gene silencing. Results Here we show that, in the phytopathogenic fungus F. oxysporum, hpRNA transgenes targeting either a β-glucuronidase (Gus) reporter transgene (hpGus) or the endogenous gene Frp1 (hpFrp) did not induce significant silencing of the target genes. Expression analysis suggested that the hpRNA transgenes are prone to transcriptional inactivation, resulting in low levels of hpRNA and siRNA production. However, the hpGus RNA can be efficiently transcribed by promoters acquired either by recombination with a pre-existing, actively transcribed Gus transgene or by fortuitous integration near an endogenous gene promoter allowing siRNA production. These siRNAs effectively induced silencing of a target Gus transgene, which in turn appeared to also induce secondary siRNA production. Furthermore, our results suggested that hpRNA transcripts without poly(A) tails are efficiently processed into siRNAs to induce gene silencing. A convergent promoter transgene, designed to express poly(A)-minus sense and antisense Gus RNAs, without an inverted-repeat DNA structure, induced consistent Gus silencing in F. oxysporum. Conclusions These results indicate that F. oxysporum possesses

  11. Initiation of transcription in yeast mitochondria: analysis of origins of replication and of genes coding for a messenger RNA and a transfer RNA.

    PubMed Central

    Osinga, K A; De Vries, E; Van der Horst, G T; Tabak, H F

    1984-01-01

    The initiation of transcription of the yeast mitochondrial genes coding for subunit I of cytochrome c oxidase (COX1) and for tRNA1Thr has been examined. COX1 messenger RNA synthesis is initiated in a conserved nonanucleotide sequence (ATATAAGTA) which we have previously found immediately upstream of ribosomal RNA genes at positions at which RNA synthesis starts. The 5'-end of the precursor of tRNA1Thr is located in a variant nonanucleotide motif (TTATAAGTA), which may be characteristic for tRNA genes. Using a partially purified fraction of mtRNA polymerase, we demonstrate that RNA synthesis is precisely initiated in vitro in nonanucleotide sequences preceding both ribosomal RNA-, tRNA- and messenger RNA-encoding genes and origins of replication. Images PMID:6322126

  12. Identification of microRNA-regulated gene networks by expression analysis of target genes

    PubMed Central

    Gennarino, Vincenzo Alessandro; D'Angelo, Giovanni; Dharmalingam, Gopuraja; Fernandez, Serena; Russolillo, Giorgio; Sanges, Remo; Mutarelli, Margherita; Belcastro, Vincenzo; Ballabio, Andrea; Verde, Pasquale; Sardiello, Marco; Banfi, Sandro

    2012-01-01

    MicroRNAs (miRNAs) and transcription factors control eukaryotic cell proliferation, differentiation, and metabolism through their specific gene regulatory networks. However, differently from transcription factors, our understanding of the processes regulated by miRNAs is currently limited. Here, we introduce gene network analysis as a new means for gaining insight into miRNA biology. A systematic analysis of all human miRNAs based on Co-expression Meta-analysis of miRNA Targets (CoMeTa) assigns high-resolution biological functions to miRNAs and provides a comprehensive, genome-scale analysis of human miRNA regulatory networks. Moreover, gene cotargeting analyses show that miRNAs synergistically regulate cohorts of genes that participate in similar processes. We experimentally validate the CoMeTa procedure through focusing on three poorly characterized miRNAs, miR-519d/190/340, which CoMeTa predicts to be associated with the TGFβ pathway. Using lung adenocarcinoma A549 cells as a model system, we show that miR-519d and miR-190 inhibit, while miR-340 enhances TGFβ signaling and its effects on cell proliferation, morphology, and scattering. Based on these findings, we formalize and propose co-expression analysis as a general paradigm for second-generation procedures to recognize bona fide targets and infer biological roles and network communities of miRNAs. PMID:22345618

  13. Transformation of tetrahymena thermophila with hypermethylated rRNA genes

    SciTech Connect

    Karrer, K.M.; Yao, M.C.

    1988-04-01

    The extrachromosomal rRNA genes (rDNA) of Tetrahymena thermophila contain 0.4% N/sup 6/-methyladenine. C3 strain rDNA was isolated, hypermethylated in vitro, and microinjected into B strain host cells. Clonal cell lines were established, and transformants were selected on the basis of resistance to paromomycin, conferred by the injected rDNA. The effects of methylation by three enzymes which methylate the sequence 5'-NAT-3'', the dam, EcoRI, and ClaI methylases, were tested. Hypermethylation of the injected rDNA had no effect on transformation efficiency relative to mock-methylated controls. The injected C3 strain rDNA efficiently replaced host rDNA as the major constituent of the population of rDNA molecules. Hypermethylation of the injected DNA was not maintained through 20 to 25 cell generations.

  14. [Study on the effect of Klotho gene interferred by plasmid-mediated short hairpin RNA (shRNA) on sinoatrial node pacing channel gene].

    PubMed

    Cai, Yingying; Wang, Han; Hou, Yanbin; Fang, Chenli; Tian, Peng; Wang, Guihua; Li, Lu; Deng, Juelin

    2013-06-01

    The study was aimed to assess the effect of Klotho gene and sinoatrial node pacing channel gene (HCN4 and HCN2) for studying sick sinus syndrome, with Klotho gene under the interference of Plasmid-mediated short hairpin RNA. Twenty-five C57BL/6J mice were divided into four groups, i. e, plasmid shRNA 24h group, plasmid shRNA 12h group, sodium chloride 24h group and sodium chloride 12h group. Plasmid shRNA 50microL (1microg/microL) and sodium chloride 50microl were respectively injected according to mice vena caudalis into those in plasmid shRNA group and sodium chloride group. After 12h or 24h respectively, all mice were executed and their sinoatrial node tissues were cut. The mRNA of Klotho, HCN4 and HCN2 gene were detected by RT-PCR. The results of RT-PCR showed that Klotho, HCN4 and HCN2 mRNA levels were lower compared with those in sodium chloride 12h group after 12h interference interval. The results indicated that there might be the a certain relationship between Klotho gene and sinoatrial node pacing channel gene.

  15. DNA homologies of ribosomal RNA genes of Neurospora species

    SciTech Connect

    Mukhopadhyay, D.K.; Mimiko, R.; Dutta, S.K.

    1980-01-01

    Ribosomal RNA genes (rDNAs) of Neurospora crassa contain DNA sequences which code for 17S, 5.8S, and 26S rRNAs, in addition to internal and external spacers. As has been reported for many eukaryotes, the DNA sequences which code for 17S, 5.8S, and 26S rRNAs in Neurospora species are probably conserved while the internal and external spacer regions are probably variable sequences. Extensive electron microscopic studies of 45S precursor rRNA of several cold and warm blooded animals confirm that spacer regions vary extensively from species to species. It was desirable to know whether such differences in rDNA sequences exist between Neurospora species. Any such difference should be detectable using standard procedures for DNA homology studies rDNA sequences were isolated from N. crassa mycelial cells using the procedure described previously. The purified rDNA was /sup 3/H-labeled (by nick translation) and reassociated with total DNA isolated from the heterothallic species N. crassa and from three homothalliospecies: N. dodgei, N. lineolata, and N. africana. In addition, /sup 32/P-labeled total DNA of N. crassa was reannealed with unlabeled bulk DNA from N. crassa, N. dodgei, and N. lineolata.

  16. Altered Gene Expression Associated with microRNA Binding Site Polymorphisms

    PubMed Central

    Võsa, Urmo; Esko, Tõnu; Kasela, Silva; Annilo, Tarmo

    2015-01-01

    Allele-specific gene expression associated with genetic variation in regulatory regions can play an important role in the development of complex traits. We hypothesized that polymorphisms in microRNA (miRNA) response elements (MRE-SNPs) that either disrupt a miRNA binding site or create a new miRNA binding site can affect the allele-specific expression of target genes. By integrating public expression quantitative trait locus (eQTL) data, miRNA binding site predictions, small RNA sequencing, and Argonaute crosslinking immunoprecipitation (AGO-CLIP) datasets, we identified genetic variants that can affect gene expression by modulating miRNA binding efficiency. We also identified MRE-SNPs located in regions associated with complex traits, indicating possible causative mechanisms associated with these loci. The results of this study expand the current understanding of gene expression regulation and help to interpret the mechanisms underlying eQTL effects. PMID:26496489

  17. Identification of microRNA Genes in Three Opisthorchiids

    PubMed Central

    Ovchinnikov, Vladimir Y.; Afonnikov, Dmitry A.; Vasiliev, Gennady V.; Kashina, Elena V.; Sripa, Banchob; Mordvinov, Viacheslav A.; Katokhin, Alexey V.

    2015-01-01

    Background Opisthorchis felineus, O. viverrini, and Clonorchis sinensis (family Opisthorchiidae) are parasitic flatworms that pose a serious threat to humans in some countries and cause opisthorchiasis/clonorchiasis. Chronic disease may lead to a risk of carcinogenesis in the biliary ducts. MicroRNAs (miRNAs) are small noncoding RNAs that control gene expression at post-transcriptional level and are implicated in the regulation of various cellular processes during the parasite- host interplay. However, to date, the miRNAs of opisthorchiid flukes, in particular those essential for maintaining their complex biology and parasitic mode of existence, have not been satisfactorily described. Methodology/Principal Findings Using a SOLiD deep sequencing-bioinformatic approach, we identified 43 novel and 18 conserved miRNAs for O. felineus (miracidia, metacercariae and adult worms), 20 novel and 16 conserved miRNAs for O. viverrini (adult worms), and 33 novel and 18 conserved miRNAs for C. sinensis (adult worms). The analysis of the data revealed differences in the expression level of conserved miRNAs among the three species and among three the developmental stages of O. felineus. Analysis of miRNA genes revealed two gene clusters, one cluster-like region and one intronic miRNA in the genome. The presence and structure of the two gene clusters were validated using a PCR-based approach in the three flukes. Conclusions This study represents a comprehensive description of miRNAs in three members of the family Opistorchiidae, significantly expands our knowledge of miRNAs in multicellular parasites and provides a basis for understanding the structural and functional evolution of miRNAs in these metazoan parasites. Results of this study also provides novel resources for deeper understanding the complex parasite biology, for further research on the pathogenesis and molecular events of disease induced by the liver flukes. The present data may also facilitate the development of novel

  18. Cloning and expression of the gene for bacteriophage T7 RNA polymerase

    DOEpatents

    Studier, F. William; Davanloo, Parichehre; Rosenberg, Alan H.; Moffatt, Barbara A.; Dunn, John J.

    1997-12-02

    This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells.

  19. Cloning and expression of the gene for bacteriophage T7 RNA polymerase

    DOEpatents

    Studier, F.W.; Davanloo, P.; Rosenberg, A.H.; Moffatt, B.A.; Dunn, J.J.

    1997-12-02

    This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells. 10 figs.

  20. Cloning and expression of the gene for bacteriophage T7 RNA polymerase

    DOEpatents

    Studier, F.W.; Davanloo, P.; Rosenberg, A.H.; Moffatt, B.A.; Dunn, J.J.

    1999-02-09

    This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells. 10 figs.

  1. Cloning and expression of the gene for bacteriophage T7 RNA polymerase

    DOEpatents

    Studier, F. William; Davanloo, Parichehre; Rosenberg, Alan H.; Moffatt, Barbara A.; Dunn, John J.

    1999-02-09

    This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells.

  2. Cloning and expression of the gene for bacteriophage T7 RNA polymerase

    DOEpatents

    Studier, F. William; Davanloo, Parichehre; Rosenberg, Alan H.; Moffatt, Barbara A.; Dunn, John J.

    1990-01-01

    This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the T7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells.

  3. Intraspecific 16S rRNA gene diversity among clinical isolates of Neisseria species.

    PubMed

    Mechergui, Arij; Achour, Wafa; Hassen, Assia Ben

    2014-05-01

    In the present work, nearly the entire 16S rRNA gene sequences of 46 clinical samples of Neisseria spp. were determined, and the aligned sequences were analyzed to investigate the diversity of 16S rRNA genes in each commensal Neisseria species. Two 16S rRNA types were identified in two Neisseria sicca strains, three 16S rRNA types in five Neisseria macacae strains, fourteen 16S rRNA types in twenty Neisseria flavescens isolates, and fourteen 16S rRNA types in nineteen Neisseria mucosa isolates. The number of nucleotides that were different between 16S rRNA sequences within specie ranged from 1 to 15. We found high intraspecific sequence variation in 16S rRNA genes of Neisseria spp. strains.

  4. Regulation of Gene Expression in Plants through miRNA Inactivation

    PubMed Central

    Zhang, Yuanji; Ziegler, Todd E.; Roberts, James K.; Heck, Gregory R.

    2011-01-01

    Eukaryotic organisms possess a complex RNA-directed gene expression regulatory network allowing the production of unique gene expression patterns. A recent addition to the repertoire of RNA-based gene regulation is miRNA target decoys, endogenous RNA that can negatively regulate miRNA activity. miRNA decoys have been shown to be a valuable tool for understanding the function of several miRNA families in plants and invertebrates. Engineering and precise manipulation of an endogenous RNA regulatory network through modification of miRNA activity also affords a significant opportunity to achieve a desired outcome of enhanced plant development or response to environmental stresses. Here we report that expression of miRNA decoys as single or heteromeric non-cleavable microRNA (miRNA) sites embedded in either non-protein-coding or within the 3′ untranslated region of protein-coding transcripts can regulate the expression of one or more miRNA targets. By altering the sequence of the miRNA decoy sites, we were able to attenuate miRNA inactivation, which allowed for fine regulation of native miRNA targets and the production of a desirable range of plant phenotypes. Thus, our results demonstrate miRNA decoys are a flexible and robust tool, not only for studying miRNA function, but also for targeted engineering of gene expression in plants. Computational analysis of the Arabidopsis transcriptome revealed a number of potential miRNA decoys, suggesting that endogenous decoys may have an important role in natural modulation of expression in plants. PMID:21731706

  5. Lateral transfer of eukaryotic ribosomal RNA genes: an emerging concern for molecular ecology of microbial eukaryotes.

    PubMed

    Yabuki, Akinori; Toyofuku, Takashi; Takishita, Kiyotaka

    2014-07-01

    Ribosomal RNA (rRNA) genes are widely utilized in depicting organismal diversity and distribution in a wide range of environments. Although a few cases of lateral transfer of rRNA genes between closely related prokaryotes have been reported, it remains to be reported from eukaryotes. Here, we report the first case of lateral transfer of eukaryotic rRNA genes. Two distinct sequences of the 18S rRNA gene were detected from a clonal culture of the stramenopile, Ciliophrys infusionum. One was clearly derived from Ciliophrys, but the other gene originated from a perkinsid alveolate. Genome-walking analyses revealed that this alveolate-type rRNA gene is immediately adjacent to two protein-coding genes (ubc12 and usp39), and the origin of both genes was shown to be a stramenopile (that is, Ciliophrys) in our phylogenetic analyses. These findings indicate that the alveolate-type rRNA gene is encoded on the Ciliophrys genome and that eukaryotic rRNA genes can be transferred laterally.

  6. On the Evolution and Expression of Chlamydomonas reinhardtii Nucleus-Encoded Transfer RNA Genes

    PubMed Central

    Cognat, Valérie; Deragon, Jean-Marc; Vinogradova, Elizaveta; Salinas, Thalia; Remacle, Claire; Maréchal-Drouard, Laurence

    2008-01-01

    In Chlamydomonas reinhardtii, 259 tRNA genes were identified and classified into 49 tRNA isoaccepting families. By constructing phylogenetic trees, we determined the evolutionary history for each tRNA gene family. The majority of the tRNA sequences are more closely related to their plant counterparts than to animals ones. Northern experiments also permitted us to show that at least one member of each tRNA isoacceptor family is transcribed and correctly processed in vivo. A short stretch of T residues known to be a signal for termination of polymerase III transcription was found downstream of most tRNA genes. It allowed us to propose that the vast majority of the tRNA genes are expressed and to confirm that numerous tRNA genes separated by short spacers are indeed cotranscribed. Interestingly, in silico analyses and hybridization experiments show that the cellular tRNA abundance is correlated with the number of tRNA genes and is adjusted to the codon usage to optimize translation efficiency. Finally, we studied the origin of SINEs, short interspersed elements related to tRNAs, whose presence in Chlamydomonas is exceptional. Phylogenetic analysis strongly suggests that tRNAAsp-related SINEs originate from a prokaryotic-type tRNA either horizontally transferred from a bacterium or originally present in mitochondria or chloroplasts. PMID:18493044

  7. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    PubMed Central

    2010-01-01

    Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s) occurring in 39.6% of the analyzed individuals (both male and female) were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH) was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs) enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement. PMID:20051104

  8. Combining Spinach-tagged RNA and gene localization to image gene expression in live yeast

    PubMed Central

    Guet, David; Burns, Laura T.; Maji, Suman; Boulanger, Jérôme; Hersen, Pascal; Wente, Susan R.; Salamero, Jean; Dargemont, Catherine

    2015-01-01

    Although many factors required for the formation of export-competent mRNPs have been described, an integrative view of the spatiotemporal coordinated cascade leading mRNPs from their site of transcription to their site of nuclear exit, at a single cell level, is still partially missing due to technological limitations. Here we report that the RNA Spinach aptamer is a powerful tool for mRNA imaging in live S. cerevisiae with high spatial-temporal resolution and no perturbation of the mRNA biogenesis properties. Dedicated image processing workflows are developed to allow detection of very low abundance of transcripts, accurate quantitative dynamic studies, as well as to provide a localization precision close to 100 nm at consistent time scales. Combining these approaches has provided a state-of-the-art analysis of the osmotic shock response in live yeast by localizing induced transcription factors, target gene loci and corresponding transcripts. PMID:26582123

  9. RNAi Pathway Genes Are Resistant to Small RNA Mediated Gene Silencing in the Protozoan Parasite Entamoeba histolytica

    PubMed Central

    Pompey, Justine M.; Morf, Laura; Singh, Upinder

    2014-01-01

    The RNA interference pathway in the protist Entamoeba histolytica plays important roles in permanent gene silencing as well as in the regulation of virulence determinants. Recently, a novel RNA interference (RNAi)-based silencing technique was developed in this parasite that uses a gene endogenously silenced by small RNAs as a “trigger” to induce silencing of other genes that are fused to it. Fusion to a trigger gene induces the production of gene-specific antisense small RNAs, resulting in robust and permanent silencing of the cognate gene. This approach has silenced multiple genes including those involved in virulence and transcriptional regulation. We now demonstrate that all tested genes of the amebic RNAi pathway are unable to be silenced using the trigger approach, including Argonaute genes (Ago2-1, Ago2-2, and Ago2-3), RNaseIII, and RNA-dependent RNA polymerase (RdRP). In all situations (except for RdRP), fusion to a trigger successfully induces production of gene-specific antisense small RNAs to the cognate gene. These small RNAs are capable of silencing a target gene in trans, indicating that they are functional; despite this, however, they cannot silence the RNAi pathway genes. Interestingly, when a trigger is fused to RdRP, small RNA induction to RdRP does not occur, a unique phenotype hinting that either RdRP is highly resistant to being a target of small RNAs or that small RNA generation may be controlled by RdRP. The inability of the small RNA pathway to silence RNAi genes in E. histolytica, despite the generation of functional small RNAs to these loci suggest that epigenetic factors may protect certain genomic loci and thus determine susceptibility to small RNA mediated silencing. PMID:25198343

  10. RNAi pathway genes are resistant to small RNA mediated gene silencing in the protozoan parasite Entamoeba histolytica.

    PubMed

    Pompey, Justine M; Morf, Laura; Singh, Upinder

    2014-01-01

    The RNA interference pathway in the protist Entamoeba histolytica plays important roles in permanent gene silencing as well as in the regulation of virulence determinants. Recently, a novel RNA interference (RNAi)-based silencing technique was developed in this parasite that uses a gene endogenously silenced by small RNAs as a "trigger" to induce silencing of other genes that are fused to it. Fusion to a trigger gene induces the production of gene-specific antisense small RNAs, resulting in robust and permanent silencing of the cognate gene. This approach has silenced multiple genes including those involved in virulence and transcriptional regulation. We now demonstrate that all tested genes of the amebic RNAi pathway are unable to be silenced using the trigger approach, including Argonaute genes (Ago2-1, Ago2-2, and Ago2-3), RNaseIII, and RNA-dependent RNA polymerase (RdRP). In all situations (except for RdRP), fusion to a trigger successfully induces production of gene-specific antisense small RNAs to the cognate gene. These small RNAs are capable of silencing a target gene in trans, indicating that they are functional; despite this, however, they cannot silence the RNAi pathway genes. Interestingly, when a trigger is fused to RdRP, small RNA induction to RdRP does not occur, a unique phenotype hinting that either RdRP is highly resistant to being a target of small RNAs or that small RNA generation may be controlled by RdRP. The inability of the small RNA pathway to silence RNAi genes in E. histolytica, despite the generation of functional small RNAs to these loci suggest that epigenetic factors may protect certain genomic loci and thus determine susceptibility to small RNA mediated silencing.

  11. Targeted RNA Sequencing Assay to Characterize Gene Expression and Genomic Alterations.

    PubMed

    Martin, Dorrelyn P; Miya, Jharna; Reeser, Julie W; Roychowdhury, Sameek

    2016-01-01

    RNA sequencing (RNAseq) is a versatile method that can be utilized to detect and characterize gene expression, mutations, gene fusions, and noncoding RNAs. Standard RNAseq requires 30 - 100 million sequencing reads and can include multiple RNA products such as mRNA and noncoding RNAs. We demonstrate how targeted RNAseq (capture) permits a focused study on selected RNA products using a desktop sequencer. RNAseq capture can characterize unannotated, low, or transiently expressed transcripts that may otherwise be missed using traditional RNAseq methods. Here we describe the extraction of RNA from cell lines, ribosomal RNA depletion, cDNA synthesis, preparation of barcoded libraries, hybridization and capture of targeted transcripts and multiplex sequencing on a desktop sequencer. We also outline the computational analysis pipeline, which includes quality control assessment, alignment, fusion detection, gene expression quantification and identification of single nucleotide variants. This assay allows for targeted transcript sequencing to characterize gene expression, gene fusions, and mutations. PMID:27585245

  12. Diversity of human tRNA genes from the 1000-genomes project

    PubMed Central

    Parisien, Marc; Wang, Xiaoyun; Pan, Tao

    2013-01-01

    The sequence diversity of individual human genomes has been extensively analyzed for variations and phenotypic implications for mRNA, miRNA, and long non-coding RNA genes. TRNA (tRNA) also exhibits large sequence diversity in the human genome, but tRNA gene sequence variation and potential functional implications in individual human genomes have not been investigated. Here we capitalize on the sequencing data from the 1000-genomes project to examine the diversity of tRNA genes in the human population. Previous analysis of the reference human genome indicated an unexpected large number of diverse tRNA genes beyond the necessity of translation, suggesting that some tRNA transcripts may perform non-canonical functions. We found 24 new tRNA sequences in > 1% and 76 new tRNA sequences in > 0.2% of all individuals, indicating that tRNA genes are also subject to evolutionary changes in the human population. Unexpectedly, two abundant new tRNA genes contain base-pair mismatches in the anticodon stem. We experimentally determined that these two new tRNAs have altered structures in vitro; however, one new tRNA is not aminoacylated but extremely stable in HeLa cells, suggesting that this new tRNA can be used for non-canonical function. Our results show that at the scale of human population, tRNA genes are more diverse than conventionally understood, and some new tRNAs may perform non-canonical, extra-translational functions that may be linked to human health and disease. PMID:24448271

  13. Diversity of human tRNA genes from the 1000-genomes project.

    PubMed

    Parisien, Marc; Wang, Xiaoyun; Pan, Tao

    2013-12-01

    The sequence diversity of individual human genomes has been extensively analyzed for variations and phenotypic implications for mRNA, miRNA, and long non-coding RNA genes. TRNA (tRNA) also exhibits large sequence diversity in the human genome, but tRNA gene sequence variation and potential functional implications in individual human genomes have not been investigated. Here we capitalize on the sequencing data from the 1000-genomes project to examine the diversity of tRNA genes in the human population. Previous analysis of the reference human genome indicated an unexpected large number of diverse tRNA genes beyond the necessity of translation, suggesting that some tRNA transcripts may perform non-canonical functions. We found 24 new tRNA sequences in>1% and 76 new tRNA sequences in>0.2% of all individuals, indicating that tRNA genes are also subject to evolutionary changes in the human population. Unexpectedly, two abundant new tRNA genes contain base-pair mismatches in the anticodon stem. We experimentally determined that these two new tRNAs have altered structures in vitro; however, one new tRNA is not aminoacylated but extremely stable in HeLa cells, suggesting that this new tRNA can be used for non-canonical function. Our results show that at the scale of human population, tRNA genes are more diverse than conventionally understood, and some new tRNAs may perform non-canonical, extra-translational functions that may be linked to human health and disease.

  14. BayMiR: inferring evidence for endogenous miRNA-induced gene repression from mRNA expression profiles

    PubMed Central

    2013-01-01

    Background Popular miRNA target prediction techniques use sequence features to determine the functional miRNA target sites. These techniques commonly ignore the cellular conditions in which miRNAs interact with their targets in vivo. Gene expression data are rich resources that can complement sequence features to take into account the context dependency of miRNAs. Results We introduce BayMiR, a new computational method, that predicts the functionality of potential miRNA target sites using the activity level of the miRNAs inferred from genome-wide mRNA expression profiles. We also found that mRNA expression variation can be used as another predictor of functional miRNA targets. We benchmarked BayMiR, the expression variation, Cometa, and the TargetScan “context scores” on two tasks: predicting independently validated miRNA targets and predicting the decrease in mRNA abundance in miRNA overexpression assays. BayMiR performed better than all other methods in both benchmarks and, surprisingly, the variation index performed better than Cometa and some individual determinants of the TargetScan context scores. Furthermore, BayMiR predicted miRNA target sets are more consistently annotated with GO and KEGG terms than similar sized random subsets of genes with conserved miRNA seed regions. BayMiR gives higher scores to target sites residing near the poly(A) tail which strongly favors mRNA degradation using poly(A) shortening. Our work also suggests that modeling multiplicative interactions among miRNAs is important to predict endogenous mRNA targets. Conclusions We develop a new computational method for predicting the target mRNAs of miRNAs. BayMiR applies a large number of mRNA expression profiles and successfully identifies the mRNA targets and miRNA activities without using miRNA expression data. The BayMiR package is publicly available and can be readily applied to any mRNA expression data sets. PMID:24001276

  15. The Xist RNA gene evolved in eutherians by pseudogenization of a protein-coding gene.

    PubMed

    Duret, Laurent; Chureau, Corinne; Samain, Sylvie; Weissenbach, Jean; Avner, Philip

    2006-06-16

    The Xist noncoding RNA is the key initiator of the process of X chromosome inactivation in eutherian mammals, but its precise function and origin remain unknown. Although Xist is well conserved among eutherians, until now, no homolog has been identified in other mammals. We show here that Xist evolved, at least partly, from a protein-coding gene and that the loss of protein-coding function of the proto-Xist coincides with the four flanking protein genes becoming pseudogenes. This event occurred after the divergence between eutherians and marsupials, which suggests that mechanisms of dosage compensation have evolved independently in both lineages.

  16. Virus-induced gene silencing of the RPC5-like subunit of RNA polymerase III caused pleiotropic effects in Nicotiana benthamiana

    PubMed Central

    Nemchinov, Lev G.; Boutanaev, Alexander M.; Postnikova, Olga A.

    2016-01-01

    In eukaryotic cells, RNA polymerase III is highly conserved and transcribes housekeeping genes such as ribosomal 5S rRNA, tRNA and other small RNAs. The RPC5-like subunit is one of the 17 subunits forming RNAPIII and its exact functional roles in the transcription are poorly understood. In this work, we report that virus-induced gene silencing of transcripts encoding a putative RPC5-like subunit of the RNA Polymerase III in a model species Nicotiana benthamiana had pleiotropic effects, including but not limited to severe dwarfing appearance, chlorosis, nearly complete reduction of internodes and abnormal leaf shape. Using transcriptomic analysis, we identified genes and pathways affected by RPC5 silencing and thus presumably related to the cellular roles of the subunit as well as to the downstream cascade of reactions in response to partial loss of RNA Polymerase III function. Our results suggest that silencing of the RPC5L in N. benthamiana disrupted not only functions commonly associated with the core RNA Polymerase III transcripts, but also more diverse cellular processes, including responses to stress. We believe this is the first demonstration that activity of the RPC5 subunit is critical for proper functionality of RNA Polymerase III and normal plant development. PMID:27282827

  17. A dynamic intron retention program enriched in RNA processing genes regulates gene expression during terminal erythropoiesis.

    PubMed

    Pimentel, Harold; Parra, Marilyn; Gee, Sherry L; Mohandas, Narla; Pachter, Lior; Conboy, John G

    2016-01-29

    Differentiating erythroblasts execute a dynamic alternative splicing program shown here to include extensive and diverse intron retention (IR) events. Cluster analysis revealed hundreds of developmentally-dynamic introns that exhibit increased IR in mature erythroblasts, and are enriched in functions related to RNA processing such as SF3B1 spliceosomal factor. Distinct, developmentally-stable IR clusters are enriched in metal-ion binding functions and include mitoferrin genes SLC25A37 and SLC25A28 that are critical for iron homeostasis. Some IR transcripts are abundant, e.g. comprising ∼50% of highly-expressed SLC25A37 and SF3B1 transcripts in late erythroblasts, and thereby limiting functional mRNA levels. IR transcripts tested were predominantly nuclear-localized. Splice site strength correlated with IR among stable but not dynamic intron clusters, indicating distinct regulation of dynamically-increased IR in late erythroblasts. Retained introns were preferentially associated with alternative exons with premature termination codons (PTCs). High IR was observed in disease-causing genes including SF3B1 and the RNA binding protein FUS. Comparative studies demonstrated that the intron retention program in erythroblasts shares features with other tissues but ultimately is unique to erythropoiesis. We conclude that IR is a multi-dimensional set of processes that post-transcriptionally regulate diverse gene groups during normal erythropoiesis, misregulation of which could be responsible for human disease.

  18. A dynamic intron retention program enriched in RNA processing genes regulates gene expression during terminal erythropoiesis

    SciTech Connect

    Pimentel, Harold; Parra, Marilyn; Gee, Sherry L.; Mohandas, Narla; Pachter, Lior; Conboy, John G.

    2015-11-03

    Differentiating erythroblasts execute a dynamic alternative splicing program shown here to include extensive and diverse intron retention (IR) events. Cluster analysis revealed hundreds of developmentallydynamic introns that exhibit increased IR in mature erythroblasts, and are enriched in functions related to RNA processing such as SF3B1 spliceosomal factor. Distinct, developmentally-stable IR clusters are enriched in metal-ion binding functions and include mitoferrin genes SLC25A37 and SLC25A28 that are critical for iron homeostasis. Some IR transcripts are abundant, e.g. comprising ~50% of highly-expressed SLC25A37 and SF3B1 transcripts in late erythroblasts, and thereby limiting functional mRNA levels. IR transcripts tested were predominantly nuclearlocalized. Splice site strength correlated with IR among stable but not dynamic intron clusters, indicating distinct regulation of dynamically-increased IR in late erythroblasts. Retained introns were preferentially associated with alternative exons with premature termination codons (PTCs). High IR was observed in disease-causing genes including SF3B1 and the RNA binding protein FUS. Comparative studies demonstrated that the intron retention program in erythroblasts shares features with other tissues but ultimately is unique to erythropoiesis. Finally, we conclude that IR is a multi-dimensional set of processes that post-transcriptionally regulate diverse gene groups during normal erythropoiesis, misregulation of which could be responsible for human disease.

  19. A dynamic intron retention program enriched in RNA processing genes regulates gene expression during terminal erythropoiesis

    PubMed Central

    Pimentel, Harold; Parra, Marilyn; Gee, Sherry L.; Mohandas, Narla; Pachter, Lior; Conboy, John G.

    2016-01-01

    Differentiating erythroblasts execute a dynamic alternative splicing program shown here to include extensive and diverse intron retention (IR) events. Cluster analysis revealed hundreds of developmentally-dynamic introns that exhibit increased IR in mature erythroblasts, and are enriched in functions related to RNA processing such as SF3B1 spliceosomal factor. Distinct, developmentally-stable IR clusters are enriched in metal-ion binding functions and include mitoferrin genes SLC25A37 and SLC25A28 that are critical for iron homeostasis. Some IR transcripts are abundant, e.g. comprising ∼50% of highly-expressed SLC25A37 and SF3B1 transcripts in late erythroblasts, and thereby limiting functional mRNA levels. IR transcripts tested were predominantly nuclear-localized. Splice site strength correlated with IR among stable but not dynamic intron clusters, indicating distinct regulation of dynamically-increased IR in late erythroblasts. Retained introns were preferentially associated with alternative exons with premature termination codons (PTCs). High IR was observed in disease-causing genes including SF3B1 and the RNA binding protein FUS. Comparative studies demonstrated that the intron retention program in erythroblasts shares features with other tissues but ultimately is unique to erythropoiesis. We conclude that IR is a multi-dimensional set of processes that post-transcriptionally regulate diverse gene groups during normal erythropoiesis, misregulation of which could be responsible for human disease. PMID:26531823

  20. A dynamic intron retention program enriched in RNA processing genes regulates gene expression during terminal erythropoiesis

    DOE PAGES

    Pimentel, Harold; Parra, Marilyn; Gee, Sherry L.; Mohandas, Narla; Pachter, Lior; Conboy, John G.

    2015-11-03

    Differentiating erythroblasts execute a dynamic alternative splicing program shown here to include extensive and diverse intron retention (IR) events. Cluster analysis revealed hundreds of developmentallydynamic introns that exhibit increased IR in mature erythroblasts, and are enriched in functions related to RNA processing such as SF3B1 spliceosomal factor. Distinct, developmentally-stable IR clusters are enriched in metal-ion binding functions and include mitoferrin genes SLC25A37 and SLC25A28 that are critical for iron homeostasis. Some IR transcripts are abundant, e.g. comprising ~50% of highly-expressed SLC25A37 and SF3B1 transcripts in late erythroblasts, and thereby limiting functional mRNA levels. IR transcripts tested were predominantly nuclearlocalized. Splicemore » site strength correlated with IR among stable but not dynamic intron clusters, indicating distinct regulation of dynamically-increased IR in late erythroblasts. Retained introns were preferentially associated with alternative exons with premature termination codons (PTCs). High IR was observed in disease-causing genes including SF3B1 and the RNA binding protein FUS. Comparative studies demonstrated that the intron retention program in erythroblasts shares features with other tissues but ultimately is unique to erythropoiesis. Finally, we conclude that IR is a multi-dimensional set of processes that post-transcriptionally regulate diverse gene groups during normal erythropoiesis, misregulation of which could be responsible for human disease.« less

  1. Duplicate gene divergence by changes in microRNA binding sites in Arabidopsis and Brassica.

    PubMed

    Wang, Sishuo; Adams, Keith L

    2015-03-01

    Gene duplication provides large numbers of new genes that can lead to the evolution of new functions. Duplicated genes can diverge by changes in sequences, expression patterns, and functions. MicroRNAs play an important role in the regulation of gene expression in many eukaryotes. After duplication, two paralogs may diverge in their microRNA binding sites, which might impact their expression and function. Little is known about conservation and divergence of microRNA binding sites in duplicated genes in plants. We analyzed microRNA binding sites in duplicated genes in Arabidopsis thaliana and Brassica rapa. We found that duplicates are more often targeted by microRNAs than singletons. The vast majority of duplicated genes in A. thaliana with microRNA binding sites show divergence in those sites between paralogs. Analysis of microRNA binding sites in genes derived from the ancient whole-genome triplication in B. rapa also revealed extensive divergence. Paralog pairs with divergent microRNA binding sites show more divergence in expression patterns compared with paralog pairs with the same microRNA binding sites in Arabidopsis. Close to half of the cases of binding site divergence are caused by microRNAs that are specific to the Arabidopsis genus, indicating evolutionarily recent gain of binding sites after target gene duplication. We also show rapid evolution of microRNA binding sites in a jacalin gene family. Our analyses reveal a dynamic process of changes in microRNA binding sites after gene duplication in Arabidopsis and highlight the role of microRNA regulation in the divergence and contrasting evolutionary fates of duplicated genes.

  2. Duplicate gene divergence by changes in microRNA binding sites in Arabidopsis and Brassica.

    PubMed

    Wang, Sishuo; Adams, Keith L

    2015-03-01

    Gene duplication provides large numbers of new genes that can lead to the evolution of new functions. Duplicated genes can diverge by changes in sequences, expression patterns, and functions. MicroRNAs play an important role in the regulation of gene expression in many eukaryotes. After duplication, two paralogs may diverge in their microRNA binding sites, which might impact their expression and function. Little is known about conservation and divergence of microRNA binding sites in duplicated genes in plants. We analyzed microRNA binding sites in duplicated genes in Arabidopsis thaliana and Brassica rapa. We found that duplicates are more often targeted by microRNAs than singletons. The vast majority of duplicated genes in A. thaliana with microRNA binding sites show divergence in those sites between paralogs. Analysis of microRNA binding sites in genes derived from the ancient whole-genome triplication in B. rapa also revealed extensive divergence. Paralog pairs with divergent microRNA binding sites show more divergence in expression patterns compared with paralog pairs with the same microRNA binding sites in Arabidopsis. Close to half of the cases of binding site divergence are caused by microRNAs that are specific to the Arabidopsis genus, indicating evolutionarily recent gain of binding sites after target gene duplication. We also show rapid evolution of microRNA binding sites in a jacalin gene family. Our analyses reveal a dynamic process of changes in microRNA binding sites after gene duplication in Arabidopsis and highlight the role of microRNA regulation in the divergence and contrasting evolutionary fates of duplicated genes. PMID:25644246

  3. Effect of ribonucleic acid (RNA) isolation methods on putative reference genes messenger RNA abundance in human spermatozoa.

    PubMed

    Barragán, M; Martínez, A; Llonch, S; Pujol, A; Vernaeve, V; Vassena, R

    2015-07-01

    Although the male gamete participates in a significant proportion of infertility cases, there are currently no proven molecular markers of sperm quality. The search for significant gene expression markers is partially hindered by the lack of a recognized set of reference genes (RGs) to normalize reverse transcription quantitative PCR (RT-qPCR) data across studies. The aim of this study is to define a set of RGs in assisted reproduction patients undergoing different sample collection and RNA isolation methods. Twenty-two normozoospermic men were included in the study. From each man, semen was either cryopreserved by slow freezing or analyzed fresh, and, for each, RNA was extracted with either phenol-free or phenol-based methods. In two cases, both methods were used to isolate RNA. Twenty putative RGs were analyzed and their mRNA abundance across samples was estimated by RT-qPCR. To determine the genes whose steady-state mRNA abundance remains unchanged, three different algorithms (geNorm, BestKeeper and NormFinder) were applied to the qPCR data. We found that RGs such as GAPDH or ACTB, useful in other biological contexts, cannot be used as reference for human spermatozoa. It is possible to compare gene expression from fresh and cryopreserved sperm samples using the same isolation method, while the mRNA abundance of expressed genes becomes different depending on the RNA isolation technique employed. In our conditions, the most appropriate RGs for RT-qPCR analysis were RPLP1, RPL13A, and RPLP2. Published discrepancies in gene expression studies in human spermatozoa may be due in part to inappropriate RGs selection, suggesting a possible different interpretation of PCR data in several reports, which were normalized using unstable RGs.

  4. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.

    PubMed

    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A

    2008-01-01

    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  5. Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus

    PubMed Central

    Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie

    2016-01-01

    Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21–24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species. PMID:27187354

  6. Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus.

    PubMed

    Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie

    2016-01-01

    Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species. PMID:27187354

  7. Cloning and expression of the gene for bacteriophage T7 RNA polymerase

    DOEpatents

    Studier, F.W.; Davanloo, P.; Rosenberg, A.H.

    1984-03-30

    This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the T7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties.

  8. Dynamic signal processing by ribozyme-mediated RNA circuits to control gene expression.

    PubMed

    Shen, Shensi; Rodrigo, Guillermo; Prakash, Satya; Majer, Eszter; Landrain, Thomas E; Kirov, Boris; Daròs, José-Antonio; Jaramillo, Alfonso

    2015-05-26

    Organisms have different circuitries that allow converting signal molecule levels to changes in gene expression. An important challenge in synthetic biology involves the de novo design of RNA modules enabling dynamic signal processing in live cells. This requires a scalable methodology for sensing, transmission, and actuation, which could be assembled into larger signaling networks. Here, we present a biochemical strategy to design RNA-mediated signal transduction cascades able to sense small molecules and small RNAs. We design switchable functional RNA domains by using strand-displacement techniques. We experimentally characterize the molecular mechanism underlying our synthetic RNA signaling cascades, show the ability to regulate gene expression with transduced RNA signals, and describe the signal processing response of our systems to periodic forcing in single live cells. The engineered systems integrate RNA-RNA interaction with available ribozyme and aptamer elements, providing new ways to engineer arbitrary complex gene circuits.

  9. miR2Gene: pattern discovery of single gene, multiple genes, and pathways by enrichment analysis of their microRNA regulators

    PubMed Central

    2011-01-01

    Background In recent years, a number of tools have been developed to explore microRNAs (miRNAs) by analyzing their target genes. However, a reverse problem, that is, inferring patterns of protein-coding genes through their miRNA regulators, has not been explored. As various miRNA annotation data become available, exploring gene patterns by analyzing the prior knowledge of their miRNA regulators is becoming more feasible. Results In this study, we developed a tool, miR2Gene, for this purpose. Various sets of miRNAs, according to prior rules such as function, associated disease, tissue specificity, family, and cluster, were integrated with miR2Gene. For given genes, miR2Gene evaluates the enrichment of the predicted miRNAs that regulate them in each miRNA set. This tool can be used for single genes, multiple genes, and KEGG pathways. For the KEGG pathway, genes with enriched miRNA sets are highlighted according to various rules. We confirmed the usefulness of miR2Gene through case studies. Conclusions miR2Gene represents a novel and useful tool that integrates miRNA knowledge for protein-coding gene analysis. miR2Gene is freely available at http://cmbi.hsc.pku.edu.cn/mir2gene. PMID:22784580

  10. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  11. Exploration of RNA structure spaces

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1991-01-01

    In order to understand the structure of real structure spaces, we are studying the 5S rRNA structure space experimentally. A plasmid containing a synthetic 5S rRNA gene, two rRNA promoters, and transcription terminators has been assembled. Assays are conducted to determine if the foreign 5S rRNA is expressed, and to see whether or not it is incorporated into ribosomes. Evolutionary competition is used to determine the relative fitness of strains containing the foreign 5S rRNA and a control 5S rRNA. By using site directed mutagenesis, a number of mutants can be made in order to study the boundaries of the structure space and how sharply defined they are. By making similar studies in the vicinity of structure space, it will be possible to determine how homogeneous the 5S rRNA structure space is. Useable experimental protocols have been developed, and a number of mutants have already been studied. Initial results suggest an explanation of why single stranded regions of the RNA are less subject to mutation than double stranded regions.

  12. The Effect of Gene Overlapping on the Rate of RNA Virus Evolution

    PubMed Central

    Simon-Loriere, Etienne; Holmes, Edward C.; Pagán, Israel

    2013-01-01

    Gene overlapping is widely employed by RNA viruses to generate genetic novelty while retaining a small genome size. However, gene overlapping also increases the deleterious effect of mutations as they affect more than one gene, thereby reducing the evolutionary rate of RNA viruses and hence their adaptive capacity. Although there is general agreement on the benefits of gene overlapping as a mechanism of genomic compression for rapidly evolving organisms, its effect on the pace of RNA virus evolution remains a source of debate. To address this issue, we collected sequence data from 117 instances of gene overlapping across 19 families, 30 genera, and 55 species of RNA viruses. On these data, we analyzed how genetic distances, selective pressures, and the distribution of RNA secondary structures and conserved protein functional domains vary between overlapping (OV) and nonoverlapping (NOV) regions. We show that gene overlapping generally results in a decrease in the rate of RNA virus evolution through a reduction in the frequency of synonymous mutations. However, this effect is less pronounced in genes with a terminal rather than an internal gene overlap, which might result from a greater proportion of protein functional conserved domains in NOV than in OV regions, in turn reducing the number of nonsynonymous mutations in the former. Overall, our analyses clarify the role of gene overlapping as a modulator of the evolutionary rates exhibited by RNA viruses and shed light on the factors that shape the genetic diversity of this important group of pathogens. PMID:23686658

  13. Simple gene silencing using the trans-acting siRNA pathway.

    PubMed

    Jacobs, Thomas B; Lawler, Noah J; LaFayette, Peter R; Vodkin, Lila O; Parrott, Wayne A

    2016-01-01

    In plants, particular micro-RNAs (miRNAs) induce the production of a class of small interfering RNAs (siRNA) called trans-acting siRNA (ta-siRNA) that lead to gene silencing. A single miRNA target is sufficient for the production of ta-siRNAs, which target can be incorporated into a vector to induce the production of siRNAs, and ultimately gene silencing. The term miRNA-induced gene silencing (MIGS) has been used to describe such vector systems in Arabidopsis. Several ta-siRNA loci have been identified in soybean, but, prior to this work, few of the inducing miRNAs have been experimentally validated, much less used to silence genes. Nine ta-siRNA loci and their respective miRNA targets were identified, and the abundance of the inducing miRNAs varies dramatically in different tissues. The miRNA targets were experimentally verified by silencing a transgenic GFP gene and two endogenous genes in hairy roots and transgenic plants. Small RNAs were produced in patterns consistent with the utilization of the ta-siRNA pathway. A side-by-side experiment demonstrated that MIGS is as effective at inducing gene silencing as traditional hairpin vectors in soybean hairy roots. Soybean plants transformed with MIGS vectors produced siRNAs and silencing was observed in the T1 generation. These results complement previous reports in Arabidopsis by demonstrating that MIGS is an efficient way to produce siRNAs and induce gene silencing in other species, as shown with soybean. The miRNA targets identified here are simple to incorporate into silencing vectors and offer an effective and efficient alternative to other gene silencing strategies.

  14. Oscillatory kinetics of gene expression: Protein conversion and slow mRNA transport

    SciTech Connect

    Zhdanov, V. P.

    2009-06-15

    The negative feedback between mRNA and regulatory-protein production may result in oscillations in the kinetics of gene expression if the mRNA-protein interplay includes protein conversion. Using a mean-field kinetic model, we show that such oscillations can be amplified due to limitations of the mRNA transport between the nucleus and cytoplasm. This effect may be dramatic for the mRNA population in the nucleus.

  15. A pathogenic non-coding RNA induces changes in dynamic DNA methylation of ribosomal RNA genes in host plants

    PubMed Central

    Martinez, German; Castellano, Mayte; Tortosa, Maria; Pallas, Vicente; Gomez, Gustavo

    2014-01-01

    Viroids are plant-pathogenic non-coding RNAs able to interfere with as yet poorly known host-regulatory pathways and to cause alterations recognized as diseases. The way in which these RNAs coerce the host to express symptoms remains to be totally deciphered. In recent years, diverse studies have proposed a close interplay between viroid-induced pathogenesis and RNA silencing, supporting the belief that viroid-derived small RNAs mediate the post-transcriptional cleavage of endogenous mRNAs by acting as elicitors of symptoms expression. Although the evidence supporting the role of viroid-derived small RNAs in pathogenesis is robust, the possibility that this phenomenon can be a more complex process, also involving viroid-induced alterations in plant gene expression at transcriptional levels, has been considered. Here we show that plants infected with the ‘Hop stunt viroid’ accumulate high levels of sRNAs derived from ribosomal transcripts. This effect was correlated with an increase in the transcription of ribosomal RNA (rRNA) precursors during infection. We observed that the transcriptional reactivation of rRNA genes correlates with a modification of DNA methylation in their promoter region and revealed that some rRNA genes are demethylated and transcriptionally reactivated during infection. This study reports a previously unknown mechanism associated with viroid (or any other pathogenic RNA) infection in plants providing new insights into aspects of host alterations induced by the viroid infectious cycle. PMID:24178032

  16. RNA-Seq defines novel genes, RNA processing patterns and enhancer maps for the early stages of nephrogenesis: Hox supergenes.

    PubMed

    Brunskill, Eric W; Potter, S Steven

    2012-08-01

    During kidney development the cap mesenchyme progenitor cells both self renew and differentiate into nephrons. The balance between renewal and differentiation determines the final nephron count, which is of considerable medical importance. An important goal is to create a precise genetic definition of the early differentiation of cap mesenchyme progenitors. We used RNA-Seq to transcriptional profile the cap mesenchyme progenitors and their first epithelial derivative, the renal vesicles. The results provide a global view of the changing gene expression program during this key period, defining expression levels for all transcription factors, growth factors, and receptors. The RNA-Seq was performed using two different biochemistries, with one examining only polyadenylated RNA and the other total RNA. This allowed the analysis of noncanonical transcripts, which for many genes were more abundant than standard exonic RNAs. Since a large fraction of enhancers are now known to be transcribed the results also provide global maps of potential enhancers. Further, the RNA-Seq data defined hundreds of novel splice patterns and large numbers of new genes. Particularly striking was the extensive sense/antisense transcription and changing RNA processing complexities of the Hox clusters. PMID:22664176

  17. RNA-Seq defines novel genes, RNA processing patterns and enhancer maps for the early stages of nephrogenesis: Hox supergenes

    PubMed Central

    Brunskill, Eric W; Potter, S. Steven

    2012-01-01

    During kidney development the cap mesenchyme progenitor cells both self renew and differentiate into nephrons. The balance between renewal and differentiation determines the final nephron count, which is of considerable medical importance. An important goal is to create a precise genetic definition of the early differentiation of cap mesenchyme progenitors. We used RNA-Seq to transcriptional profile the cap mesenchyme progenitors and their first epithelial derivative, the renal vesicles. The results provide a global view of the changing gene expression program during this key period, defining expression levels for all transcription factors, growth factors, and receptors. The RNA-Seq was performed using two different biochemistries, with one examining only polyadenylated RNA and the other total RNA. This allowed the analysis of noncanonical transcripts, which for many genes were more abundant than standard exonic RNAs. Since a large fraction of enhancers are now known to be transcribed the results also provide global maps of potential enhancers. Further, the RNA-Seq data defined hundreds of novel splice patterns and large numbers of new genes. Particularly striking was the extensive sense/antisense transcription and changing RNA processing complexities of the Hox clusters. PMID:22664176

  18. Integrative analyses of RNA editing, alternative splicing, and expression of young genes in human brain transcriptome by deep RNA sequencing.

    PubMed

    Wu, Dong-Dong; Ye, Ling-Qun; Li, Yan; Sun, Yan-Bo; Shao, Yi; Chen, Chunyan; Zhu, Zhu; Zhong, Li; Wang, Lu; Irwin, David M; Zhang, Yong E; Zhang, Ya-Ping

    2015-08-01

    Next-generation RNA sequencing has been successfully used for identification of transcript assembly, evaluation of gene expression levels, and detection of post-transcriptional modifications. Despite these large-scale studies, additional comprehensive RNA-seq data from different subregions of the human brain are required to fully evaluate the evolutionary patterns experienced by the human brain transcriptome. Here, we provide a total of 6.5 billion RNA-seq reads from different subregions of the human brain. A significant correlation was observed between the levels of alternative splicing and RNA editing, which might be explained by a competition between the molecular machineries responsible for the splicing and editing of RNA. Young human protein-coding genes demonstrate biased expression to the neocortical and non-neocortical regions during evolution on the lineage leading to humans. We also found that a significantly greater number of young human protein-coding genes are expressed in the putamen, a tissue that was also observed to have the highest level of RNA-editing activity. The putamen, which previously received little attention, plays an important role in cognitive ability, and our data suggest a potential contribution of the putamen to human evolution.

  19. Programmable control of bacterial gene expression with the combined CRISPR and antisense RNA system.

    PubMed

    Lee, Young Je; Hoynes-O'Connor, Allison; Leong, Matthew C; Moon, Tae Seok

    2016-03-18

    A central goal of synthetic biology is to implement diverse cellular functions by predictably controlling gene expression. Though research has focused more on protein regulators than RNA regulators, recent advances in our understanding of RNA folding and functions have motivated the use of RNA regulators. RNA regulators provide an advantage because they are easier to design and engineer than protein regulators, potentially have a lower burden on the cell and are highly orthogonal. Here, we combine the CRISPR system from Streptococcus pyogenes and synthetic antisense RNAs (asRNAs) in Escherichia coli strains to repress or derepress a target gene in a programmable manner. Specifically, we demonstrate for the first time that the gene target repressed by the CRISPR system can be derepressed by expressing an asRNA that sequesters a small guide RNA (sgRNA). Furthermore, we demonstrate that tunable levels of derepression can be achieved (up to 95%) by designing asRNAs that target different regions of a sgRNA and by altering the hybridization free energy of the sgRNA-asRNA complex. This new system, which we call the combined CRISPR and asRNA system, can be used to reversibly repress or derepress multiple target genes simultaneously, allowing for rational reprogramming of cellular functions.

  20. A Novel Tryptophanyl-tRNA Synthetase Gene Confers High-Level Resistance to Indolmycin▿ †

    PubMed Central

    Vecchione, James J.; Sello, Jason K.

    2009-01-01

    Indolmycin, a potential antibacterial drug, competitively inhibits bacterial tryptophanyl-tRNA synthetases. An effort to identify indolmycin resistance genes led to the discovery of a gene encoding an indolmycin-resistant isoform of tryptophanyl-tRNA synthetase. Overexpression of this gene in an indolmycin-sensitive strain increased the indolmycin MIC 60-fold. Its transcription and distribution in various bacterial genera were assessed. The level of resistance conferred by this gene was compared to that of a known indolmycin resistance gene and to those of genes with resistance-conferring point mutations. PMID:19546369

  1. miRNA and miRNA target genes in copy number variations occurring in individuals with intellectual disability

    PubMed Central

    2013-01-01

    Background MicroRNAs (miRNAs) are a family of short, non-coding RNAs modulating expression of human protein coding genes (miRNA target genes). Their dysfunction is associated with many human diseases, including neurodevelopmental disorders. It has been recently shown that genomic copy number variations (CNVs) can cause aberrant expression of integral miRNAs and their target genes, and contribute to intellectual disability (ID). Results To better understand the CNV-miRNA relationship in ID, we investigated the prevalence and function of miRNAs and miRNA target genes in five groups of CNVs. Three groups of CNVs were from 213 probands with ID (24 de novo CNVs, 46 familial and 216 common CNVs), one group of CNVs was from a cohort of 32 cognitively normal subjects (67 CNVs) and one group of CNVs represented 40 ID related syndromic regions listed in DECIPHER (30 CNVs) which served as positive controls for CNVs causing or predisposing to ID. Our results show that 1). The number of miRNAs is significantly higher in de novo or DECIPHER CNVs than in familial or common CNV subgroups (P < 0.01). 2). miRNAs with brain related functions are more prevalent in de novo CNV groups compared to common CNV groups. 3). More miRNA target genes are found in de novo, familial and DECIPHER CNVs than in the common CNV subgroup (P < 0.05). 4). The MAPK signaling cascade is found to be enriched among the miRNA target genes from de novo and DECIPHER CNV subgroups. Conclusions Our findings reveal an increase in miRNA and miRNA target gene content in de novo versus common CNVs in subjects with ID. Their expression profile and participation in pathways support a possible role of miRNA copy number change in cognition and/or CNV-mediated developmental delay. Systematic analysis of expression/function of miRNAs in addition to coding genes integral to CNVs could uncover new causes of ID. PMID:23937676

  2. Gene silencing in tick cell lines using small interfering or long double-stranded RNA.

    PubMed

    Barry, Gerald; Alberdi, Pilar; Schnettler, Esther; Weisheit, Sabine; Kohl, Alain; Fazakerley, John K; Bell-Sakyi, Lesley

    2013-03-01

    Gene silencing by RNA interference (RNAi) is an important research tool in many areas of biology. To effectively harness the power of this technique in order to explore tick functional genomics and tick-microorganism interactions, optimised parameters for RNAi-mediated gene silencing in tick cells need to be established. Ten cell lines from four economically important ixodid tick genera (Amblyomma, Hyalomma, Ixodes and Rhipicephalus including the sub-species Boophilus) were used to examine key parameters including small interfering RNA (siRNA), double stranded RNA (dsRNA), transfection reagent and incubation time for silencing virus reporter and endogenous tick genes. Transfection reagents were essential for the uptake of siRNA whereas long dsRNA alone was taken up by most tick cell lines. Significant virus reporter protein knockdown was achieved using either siRNA or dsRNA in all the cell lines tested. Optimum conditions varied according to the cell line. Consistency between replicates and duration of incubation with dsRNA were addressed for two Ixodes scapularis cell lines; IDE8 supported more consistent and effective silencing of the endogenous gene subolesin than ISE6, and highly significant knockdown of the endogenous gene 2I1F6 in IDE8 cells was achieved within 48 h incubation with dsRNA. In summary, this study shows that gene silencing by RNAi in tick cell lines is generally more efficient with dsRNA than with siRNA but results vary between cell lines and optimal parameters need to be determined for each experimental system.

  3. RNA silencing as a tool to uncover gene function and engineer novel traits in soybean

    PubMed Central

    Kasai, Megumi; Kanazawa, Akira

    2012-01-01

    RNA silencing refers collectively to diverse RNA-mediated pathways of nucleotide-sequence-specific inhibition of gene expression. It has been used to analyze gene function and engineer novel traits in various organisms. Here, we review the application of RNA silencing in soybean. To produce soybean lines, in which a particular gene is stably silenced, researchers have frequently used a transgene that transcribes inverted repeats of a target gene segment. Suppression of gene expression in developing soybean embryos has been one of the main focuses of metabolic engineering using transgene-induced silencing. Plants that have enhanced resistance against diseases caused by viruses or cyst nematode have also been produced. Meanwhile, Agrobacterium rhizogenes-mediated transformation has been used to induce RNA silencing in roots, which enabled analysis of the roles of gene products in nodulation or disease resistance. RNA silencing has also been induced using viral vectors, which is particularly useful for gene function analysis. So far, three viral vectors for virus-induced gene silencing have been developed for soybean. One of the features of the soybean genome is the presence of a large number of duplicated genes. Potential use of RNA silencing technology in combination with forward genetic approaches for analyzing duplicated genes is discussed. PMID:23136487

  4. Polyion complex stability and gene silencing efficiency with a siRNA-grafted polymer delivery system.

    PubMed

    Takemoto, Hiroyasu; Ishii, Atsushi; Miyata, Kanjiro; Nakanishi, Masataka; Oba, Makoto; Ishii, Takehiko; Yamasaki, Yuichi; Nishiyama, Nobuhiro; Kataoka, Kazunori

    2010-11-01

    An siRNA-grafted polymer through disulfide linkage was prepared to improve the physicochemical properties and transfection efficacies of the polyion complexes (PICs) as a nanocarrier of siRNA. The siRNA-grafted polymer formed stable PICs due to its larger numbers and higher density of anionic charges compared with monomeric siRNA, leading to effective internalization by cultured cells. Following the endosomal escape of the PIC, the disulfide linkage of the siRNA-grafted polymer allowed efficient siRNA release from the PIC under intracellular reductive conditions. Consequently, the PIC from the siRNA-grafted polymer showed a potent gene silencing effect without cytotoxicity or immunogenicity, demonstrating a promising feature of the siRNA-grafted polymer to construct the PIC-based nanocarrier for in vivo siRNA delivery.

  5. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  6. Chromosomal mapping of rRNA genes, core histone genes and telomeric sequences in Brachidontes puniceus and Brachidontes rodriguezi (Bivalvia, Mytilidae)

    PubMed Central

    2010-01-01

    Background Chromosome rearrangements are an important part of the speciation process in many taxa. The study of chromosome evolution in bivalves is hampered by the absence of clear chromosomal banding patterns and the similarity in both chromosome size and morphology. For this reason, obtaining good chromosome markers is essential for reliable karyotypic comparisons. To begin this task, the chromosomes of the mussels Brachidontes puniceus and B. rodriguezi were studied by means of fluorochrome staining and fluorescent in situ hybridization (FISH). Results Brachidontes puniceus and B. rodriguezi both have 2n = 32 chromosomes but differing karyotype composition. Vertebrate-type telomeric sequences appear at both ends of every single chromosome. B. puniceus presents a single terminal major rRNA gene cluster on a chromosome pair while B. rodriguezi shows two. Both mussels present two 5S rDNA and two core histone gene clusters intercalary located on the long arms of two chromosome pairs. Double and triple-FISH experiments demonstrated that one of the 5S rDNA and one of the major rDNA clusters appear on the same chromosome pair in B. rodriguezi but not in B. puniceus. On the other hand, the second 5S rDNA cluster is located in one of the chromosome pairs also bearing one of the core histone gene clusters in the two mussel species. Conclusion Knowledge of the chromosomal distribution of these sequences in the two species of Brachidontes is a first step in the understanding of the role of chromosome changes on bivalve evolution. PMID:21143946

  7. Bioinformatics-Based Identification of MicroRNA-Regulated and Rheumatoid Arthritis-Associated Genes.

    PubMed

    Song, Yi-Jiang; Li, Guiling; He, Jian-Hua; Guo, Yao; Yang, Li

    2015-01-01

    MicroRNAs (miRNAs) act as epigenetic markers and regulate the expression of their target genes, including those characterized as regulators in autoimmune diseases. Rheumatoid arthritis (RA) is one of the most common autoimmune diseases. The potential roles of miRNA-regulated genes in RA pathogenesis have greatly aroused the interest of clinicians and researchers in recent years. In the current study, RA-related miRNAs records were obtained from PubMed through conditional literature retrieval. After analyzing the selected records, miRNA targeted genes were predicted. We identified 14 RA-associated miRNAs, and their sub-analysis in 5 microarray or RNA sequencing (RNA-seq) datasets was performed. The microarray and RNA-seq data of RA were also downloaded from NCBI Gene Expression Omnibus (GEO) and Sequence Read Archive (SRA), analyzed, and annotated. Using a bioinformatics approach, we identified a series of differentially expressed genes (DEGs) by comparing studies on RA and the controls. The RA-related gene expression profile was thus obtained and the expression of miRNA-regulated genes was analyzed. After functional annotation analysis, we found GO molecular function (MF) terms significantly enriched in calcium ion binding (GO: 0005509). Moreover, some novel dysregulated target genes were identified in RA through integrated analysis of miRNA/mRNA expression. The result revealed that the expression of a number of genes, including ROR2, ABI3BP, SMOC2, etc., was not only affected by dysregulated miRNAs, but also altered in RA. Our findings indicate that there is a close association between negatively correlated mRNA/miRNA pairs and RA. These findings may be applied to identify genetic markers for RA diagnosis and treatment in the future.

  8. Dynamic signal processing by ribozyme-mediated RNA circuits to control gene expression

    PubMed Central

    Shen, Shensi; Rodrigo, Guillermo; Prakash, Satya; Majer, Eszter; Landrain, Thomas E.; Kirov, Boris; Daròs, José-Antonio; Jaramillo, Alfonso

    2015-01-01

    Organisms have different circuitries that allow converting signal molecule levels to changes in gene expression. An important challenge in synthetic biology involves the de novo design of RNA modules enabling dynamic signal processing in live cells. This requires a scalable methodology for sensing, transmission, and actuation, which could be assembled into larger signaling networks. Here, we present a biochemical strategy to design RNA-mediated signal transduction cascades able to sense small molecules and small RNAs. We design switchable functional RNA domains by using strand-displacement techniques. We experimentally characterize the molecular mechanism underlying our synthetic RNA signaling cascades, show the ability to regulate gene expression with transduced RNA signals, and describe the signal processing response of our systems to periodic forcing in single live cells. The engineered systems integrate RNA–RNA interaction with available ribozyme and aptamer elements, providing new ways to engineer arbitrary complex gene circuits. PMID:25916845

  9. Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.

    PubMed

    Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun

    2013-10-01

    Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.

  10. Transfer RNA gene arrangement and codon usage in vertebrate mitochondrial genomes: a new insight into gene order conservation

    PubMed Central

    2010-01-01

    Background Mitochondrial (mt) gene arrangement has been highly conserved among vertebrates from jawless fishes to mammals for more than 500 million years. It remains unclear, however, whether such long-term persistence is a consequence of some constraints on the gene order. Results Based on the analysis of codon usage and tRNA gene positions, we suggest that tRNA gene order of the typical vertebrate mt-genomes may be important for their translational efficiency. The vertebrate mt-genome encodes 2 rRNA, 22 tRNA, and 13 transmembrane proteins consisting mainly of hydrophobic domains. We found that the tRNA genes specifying the hydrophobic residues were positioned close to the control region (CR), where the transcription efficiency is estimated to be relatively high. Using 47 vertebrate mt-genome sequences representing jawless fishes to mammals, we further found a correlation between codon usage and tRNA gene positions, implying that highly-used tRNA genes are located close to the CR. In addition, an analysis considering the asymmetric nature of mtDNA replication suggested that the tRNA loci that remain in single-strand for a longer time tend to have more guanine and thymine not suffering deamination mutations in their anticodon sites. Conclusions Our analyses imply the existence of translational constraint acting on the vertebrate mt-gene arrangement. Such translational constraint, together with the deamination-related constraint, may have contributed to long-term maintenance of gene order. PMID:20723209

  11. Computer identification of snoRNA genes using a Mammalian Orthologous Intron Database

    PubMed Central

    Fedorov, Alexei; Stombaugh, Jesse; Harr, Michael W.; Yu, Saihua; Nasalean, Lorena; Shepelev, Valery

    2005-01-01

    Based on comparative genomics, we created a bioinformatic package for computer prediction of small nucleolar RNA (snoRNA) genes in mammalian introns. The core of our approach was the use of the Mammalian Orthologous Intron Database (MOID), which contains all known introns within the human, mouse and rat genomes. Introns from orthologous genes from these three species, that have the same position relative to the reading frame, are grouped in a special orthologous intron table. Our program SNO.pl searches for conserved snoRNA motifs within MOID and reports all cases when characteristic snoRNA-like structures are present in all three orthologous introns of human, mouse and rat sequences. Here we report an example of the SNO.pl usage for searching a particular pattern of conserved C/D-box snoRNA motifs (canonical C- and D-boxes and the 6 nt long terminal stem). In this computer analysis, we detected 57 triplets of snoRNA-like structures in three mammals. Among them were 15 triplets that represented known C/D-box snoRNA genes. Six triplets represented snoRNA genes that had only been partially characterized in the mouse genome. One case represented a novel snoRNA gene, and another three cases, putative snoRNAs. Our programs are publicly available and can be easily adapted and/or modified for searching any conserved motifs within mammalian introns. PMID:16093549

  12. Comprehensive protein-based artificial microRNA screens for effective gene silencing in plants.

    PubMed

    Li, Jian-Feng; Chung, Hoo Sun; Niu, Yajie; Bush, Jenifer; McCormack, Matthew; Sheen, Jen

    2013-05-01

    Artificial microRNA (amiRNA) approaches offer a powerful strategy for targeted gene manipulation in any plant species. However, the current unpredictability of amiRNA efficacy has limited broad application of this promising technology. To address this, we developed epitope-tagged protein-based amiRNA (ETPamir) screens, in which target mRNAs encoding epitope-tagged proteins were constitutively or inducibly coexpressed in protoplasts with amiRNA candidates targeting single or multiple genes. This design allowed parallel quantification of target proteins and mRNAs to define amiRNA efficacy and mechanism of action, circumventing unpredictable amiRNA expression/processing and antibody unavailability. Systematic evaluation of 63 amiRNAs in 79 ETPamir screens for 16 target genes revealed a simple, effective solution for selecting optimal amiRNAs from hundreds of computational predictions, reaching ∼100% gene silencing in plant cells and null phenotypes in transgenic plants. Optimal amiRNAs predominantly mediated highly specific translational repression at 5' coding regions with limited mRNA decay or cleavage. Our screens were easily applied to diverse plant species, including Arabidopsis thaliana, tobacco (Nicotiana benthamiana), tomato (Solanum lycopersicum), sunflower (Helianthus annuus), Catharanthus roseus, maize (Zea mays) and rice (Oryza sativa), and effectively validated predicted natural miRNA targets. These screens could improve plant research and crop engineering by making amiRNA a more predictable and manageable genetic and functional genomic technology.

  13. Programmable control of bacterial gene expression with the combined CRISPR and antisense RNA system

    PubMed Central

    Lee, Young Je; Hoynes-O'Connor, Allison; Leong, Matthew C.; Moon, Tae Seok

    2016-01-01

    A central goal of synthetic biology is to implement diverse cellular functions by predictably controlling gene expression. Though research has focused more on protein regulators than RNA regulators, recent advances in our understanding of RNA folding and functions have motivated the use of RNA regulators. RNA regulators provide an advantage because they are easier to design and engineer than protein regulators, potentially have a lower burden on the cell and are highly orthogonal. Here, we combine the CRISPR system from Streptococcus pyogenes and synthetic antisense RNAs (asRNAs) in Escherichia coli strains to repress or derepress a target gene in a programmable manner. Specifically, we demonstrate for the first time that the gene target repressed by the CRISPR system can be derepressed by expressing an asRNA that sequesters a small guide RNA (sgRNA). Furthermore, we demonstrate that tunable levels of derepression can be achieved (up to 95%) by designing asRNAs that target different regions of a sgRNA and by altering the hybridization free energy of the sgRNA–asRNA complex. This new system, which we call the combined CRISPR and asRNA system, can be used to reversibly repress or derepress multiple target genes simultaneously, allowing for rational reprogramming of cellular functions. PMID:26837577

  14. Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes.

    PubMed

    Barvkar, Vitthal T; Pardeshi, Varsha C; Kale, Sandip M; Qiu, Shuqing; Rollins, Meaghen; Datla, Raju; Gupta, Vidya S; Kadoo, Narendra Y

    2013-04-01

    MicroRNAs (miRNAs) are small (20-24 nucleotide long) endogenous regulatory RNAs that play important roles in plant growth and development. They regulate gene expression at the post-transcriptional level by translational repression or target degradation and gene silencing. In this study, we identified 116 conserved miRNAs belonging to 23 families from the flax (Linum usitatissimum L.) genome using a computational approach. The precursor miRNAs varied in length; while most of the mature miRNAs were 21 nucleotide long, intergenic and showed conserved signatures of RNA polymerase II transcripts in their upstream regions. Promoter region analysis of the flax miRNA genes indicated prevalence of MYB transcription factor binding sites. Four miRNA gene clusters containing members of three phylogenetic groups were identified. Further, 142 target genes were predicted for these miRNAs and most of these represent transcriptional regulators. The miRNA encoding genes were expressed in diverse tissues as determined by digital expression analysis as well as real-time PCR. The expression of fourteen miRNAs and nine target genes was independently validated using the quantitative reverse transcription PCR (qRT-PCR). This study suggests that a large number of conserved plant miRNAs are also found in flax and these may play important roles in growth and development of flax.

  15. eIF4AII is dispensable for miRNA-mediated gene silencing

    PubMed Central

    Galicia-Vázquez, Gabriela; Chu, Jennifer; Pelletier, Jerry

    2015-01-01

    MicroRNAs (miRNAs) are short noncoding RNAs that regulate gene expression through partial complementary base-pairing to the 3′ untranslated region (UTR) of target mRNAs. Inhibition of translation initiation has been identified as an early event of miRNA-mediated gene repression, but the underlying mechanistic details of this process are not well understood. Recently, eukaryotic initiation factor (eIF) 4AII was identified as a critical modulator of miRNA activity with depletion of this factor alleviating miRNA-mediated gene repression. Using the CRISPR/Cas9-editing system, we generated a novel cell line in which expression of eIF4AII was eliminated. The absence of eIF4AII does not affect cell viability, proliferation, or global mRNA translation. Importantly, we show that eIF4AII is dispensable for miRNA-mediated gene silencing. PMID:26286746

  16. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

    NASA Technical Reports Server (NTRS)

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

    1993-01-01

    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  17. Structure and sequence of the gene for the largest subunit of trypanosomal RNA polymerase III.

    PubMed Central

    Köck, J; Evers, R; Cornelissen, A W

    1988-01-01

    As the first step in the analysis of the transcription process in the African trypanosome, Trypanosoma brucei, we have started to characterise the trypanosomal RNA polymerases. We have previously described the gene encoding the largest subunit of RNA polymerase II and found that two almost identical RNA polymerase II genes are encoded within the genome of T. brucei. Here we present the identification, cloning and sequence analysis of the gene encoding the largest subunit of RNA polymerase III. This gene contains a single open reading frame encoding a polypeptide with a Mr of 170 kD. In total, eight encoding a polypeptide with a Mr of 170 kD. In total, eight highly conserved regions with significant homology to those previously reported in other eukaryotic RNA polymerase largest subunits were identified. Some of these domains contain functional sites, which are conserved among all eukaryotic largest subunit genes analysed thus far. Since these domains make up a large part of each polypeptide, independent of the RNA polymerase class, these data strongly support the hypothesis that these domains provide a major part of the transcription machinery of the RNA polymerase complex. The additional domains which are uniquely present in the largest subunit of RNA polymerase I and II, respectively, two large hydrophylic insertions and a C-terminal extension, might be a determining factor in specific transcription of the gene classes. Images PMID:3174432

  18. EBV noncoding RNA EBER2 interacts with host RNA-binding proteins to regulate viral gene expression.

    PubMed

    Lee, Nara; Yario, Therese A; Gao, Jessica S; Steitz, Joan A

    2016-03-22

    Epstein-Barr virus (EBV) produces a highly abundant noncoding RNA called EBV-encoded RNA 2 (EBER2) that interacts indirectly with the host transcription factor paired box protein 5 (PAX5) to regulate viral latent membrane protein 1/2 (LMP1/2) gene expression as well as EBV lytic replication. To identify intermediary proteins, we isolated EBER2-PAX5-containing complexes and analyzed the protein components by mass spectrometry. The top candidates include three host proteins splicing factor proline and glutamine rich (SFPQ), non-POU domain-containing octamer-binding protein (NONO), and RNA binding motif protein 14 (RBM14), all reported to be components of nuclear bodies called paraspeckles. In vivo RNA-protein crosslinking indicates that SFPQ and RBM14 contact EBER2 directly. Binding studies using recombinant proteins demonstrate that SFPQ and NONO associate with PAX5, potentially bridging its interaction with EBER2. Similar to EBER2 or PAX5 depletion, knockdown of any of the three host RNA-binding proteins results in the up-regulation of viral LMP2A mRNA levels, supporting a physiologically relevant interaction of these newly identified factors with EBER2 and PAX5. Identification of these EBER2-interacting proteins enables the search for cellular noncoding RNAs that regulate host gene expression in a manner similar to EBER2. PMID:26951683

  19. The embryonic RNA helicase gene (ERH): a new member of the DEAD box family of RNA helicases.

    PubMed Central

    Sowden, J; Putt, W; Morrison, K; Beddington, R; Edwards, Y

    1995-01-01

    DEAD box proteins share several highly conserved motifs including the characteristic Asp-Glu-Ala-Asp (D-E-A-D in the amino acid single-letter code) motif and have established or putative ATP-dependent RNA helicase activity. These proteins are implicated in a range of cellular processes that involve regulation of RNA function, including translation initiation, RNA splicing and ribosome assembly. Here we describe the isolation and characterization of an embryonic RNA helicase gene, ERH, which maps to mouse chromosome 1 and encodes a new member of the DEAD box family of proteins. The predicted ERH protein shows high sequence similarity to the testes-specific mouse PL10 and to the maternally acting Xenopus An3 helicase proteins. The ERH expression profile is similar, to that of An3, which localizes to the animal hemisphere of oocytes and is abundantly expressed in the embryo. ERH is expressed in oocytes and is a ubiquitous mRNA in the 9 days-post-conception embryo, and at later stages of development shows a more restricted pattern of expression in brain and kidney. The similarities in sequence and in expression profile suggest that ERH is the murine equivalent of the Xenopus An3 gene, and we propose that ERH plays a role in translational activation of mRNA in the oocyte and early embryo. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:8948440

  20. EBV noncoding RNA EBER2 interacts with host RNA-binding proteins to regulate viral gene expression.

    PubMed

    Lee, Nara; Yario, Therese A; Gao, Jessica S; Steitz, Joan A

    2016-03-22

    Epstein-Barr virus (EBV) produces a highly abundant noncoding RNA called EBV-encoded RNA 2 (EBER2) that interacts indirectly with the host transcription factor paired box protein 5 (PAX5) to regulate viral latent membrane protein 1/2 (LMP1/2) gene expression as well as EBV lytic replication. To identify intermediary proteins, we isolated EBER2-PAX5-containing complexes and analyzed the protein components by mass spectrometry. The top candidates include three host proteins splicing factor proline and glutamine rich (SFPQ), non-POU domain-containing octamer-binding protein (NONO), and RNA binding motif protein 14 (RBM14), all reported to be components of nuclear bodies called paraspeckles. In vivo RNA-protein crosslinking indicates that SFPQ and RBM14 contact EBER2 directly. Binding studies using recombinant proteins demonstrate that SFPQ and NONO associate with PAX5, potentially bridging its interaction with EBER2. Similar to EBER2 or PAX5 depletion, knockdown of any of the three host RNA-binding proteins results in the up-regulation of viral LMP2A mRNA levels, supporting a physiologically relevant interaction of these newly identified factors with EBER2 and PAX5. Identification of these EBER2-interacting proteins enables the search for cellular noncoding RNAs that regulate host gene expression in a manner similar to EBER2.

  1. Controlling mesenchymal stem cell gene expression using polymer-mediated delivery of siRNA

    PubMed Central

    Benoit, Danielle S.W.; Boutin, Molly E.

    2012-01-01

    siRNA treatment has great promise to specifically control gene expression and select cell behaviors but have delivery challenges limiting their use. Particularly for applications in regenerative medicine, uniform and consistent delivery of siRNA to control gene expression and subsequent stem cell functions, such as differentiation, is paramount. Therefore, a diblock copolymer was examined for its ability to effective delivery siRNA to mesenchymal stem cells (MSCs). The diblock copolymers, which are composed of cationic blocks for siRNA complexation, protection, and uptake and pH-responsive blocks for endosomal escape, were shown to facilitate nearly 100% MSC uptake of siRNA, which is vastly superior to a commercially-available control, DharmaFECT, which resulted in only ~60% siRNA positive MSCs. Moreover, the diblock copolymer, at conditions that result in excellent knockdown (down to ~10% of control gene expression), is cytocompatible, causing no negative effects on MSC survivability. In contrast, DharmaFECT:siRNA treatment results in only ~60% survivability of MSCs. Longitudinal knockdown after siRNA treatment was examined and protein knockdown persists for ~6 days regardless of delivery system (diblock copolymer or DharmaFECT). Finally, MSC phenotype and differentiation capacity was examined after treatment with control siRNA. There is no statistically significant differences on cell surface markers of diblock copolymer:siRNA or DharmaFECT:siRNA treated or cells measured 2 weeks after siRNA delivery compared to untreated cells. Upon differentiation with typical media/culture conditions to adipogenic, chondrogenic, and osteogenic lineages and examination of histological staining markers, there is no discernable differences between treated and untreated cells, regardless of delivery mechanism. Thus, diblock copolymers examined herein facilitate uniform siRNA treatment of MSCs, inducing siRNA-specific gene and protein knockdown without adversely affecting MSC

  2. Multifunctional nanocarrier based on clay nanotubes for efficient intracellular siRNA delivery and gene silencing.

    PubMed

    Wu, Hui; Shi, Yinfeng; Huang, Chusen; Zhang, Yang; Wu, Jiahui; Shen, Hebai; Jia, Nengqin

    2014-04-01

    RNA interference-mediated gene silencing relating to disease has recently emerged as a powerful method in gene therapy. Despite the promises, effective transport of siRNA with minimal side effects remains a challenge. Halloysites are cheap and naturally available aluminosilicate clay nanotubes with high mechanical strength and biocompatibility. In this study, a novel multifunctional nanocarrier based on functionalized halloysite nanotubes (f-HNTs) has been developed via electrostatic layer-by-layer assembling approach for loading and intracellular delivery of therapeutic antisurvivin siRNA and simultaneously tracking their intracellular transport, in which PEI-modified HNTs are used as gene vector, antisurvivin siRNA as gene therapeutic agent, and mercaptoacetic acid-capped CdSe quantum dots as fluorescent labeling probes. The successful assembly of the f-HNTs-siRNA complexes was systematically characterized by transmission electron microscopy (TEM), UV-visible spectrophotometry, Zeta potential measurement, fluorescence spectrophotometry, and electrochemical impedance spectroscopy. Confocal microscopy, biological TEM, and flow cytometry studies revealed that the complexes enabled the efficient intracellular delivery of siRNA for cell-specific gene silencing. MTT assays exhibited that the complexes can enhance antitumor activity. Furthermore, Western blot analysis showed that f-HNTs-mediated siRNA delivery effectively knocked down gene expression of survivin and thereby decreased the levels of target proteins of PANC-1 cells. Therefore, this study suggested that the synthesized f-HNTs were a new effective drug delivery system for potential application in cancer gene therapy.

  3. shRNA-Induced Gene Knockdown In Vivo to Investigate Neutrophil Function.

    PubMed

    Basit, Abdul; Tang, Wenwen; Wu, Dianqing

    2016-01-01

    To silence genes in neutrophils efficiently, we exploited the RNA interference and developed an shRNA-based gene knockdown technique. This method involves transfection of mouse bone marrow-derived hematopoietic stem cells with retroviral vector carrying shRNA directed at a specific gene. Transfected stem cells are then transplanted into irradiated wild-type mice. After engraftment of stem cells, the transplanted mice have two sets of circulating neutrophils. One set has a gene of interest knocked down while the other set has full complement of expressed genes. This efficient technique provides a unique way to directly compare the response of neutrophils with a knocked-down gene to that of neutrophils with the full complement of expressed genes in the same environment. PMID:27271902

  4. SoMART, a web server for miRNA, tasiRNA and target gene analysis in Solanaceae plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plant micro(mi)RNAs and trans-acting small interfering (tasi)RNAs mediate posttranscriptional silencing of genes and play important roles in a variety of biological processes. Although bioinformatics prediction and small (s)RNA cloning are the key approaches used for identification of miRNAs, tasiRN...

  5. Knockdown of actin and caspase gene expression by RNA interference in the symbiotic anemone Aiptasia pallida.

    PubMed

    Dunn, Simon R; Phillips, Wendy S; Green, Douglas R; Weis, Virginia M

    2007-06-01

    Since the discovery of the ancient eukaryotic process of RNA-mediated gene silencing, the reverse-genetics technique RNA interference (RNAi) has increasingly been used to examine gene function in vertebrate and invertebrate systems. In this study, we report on the use of RNAi, adapted from studies on animal model systems, to manipulate gene expression in a symbiotic marine cnidarian. We describe gene knockdown of actin and of acasp--a cysteine protease, or caspase--in the symbiotic sea anemone Aiptasia pallida. Knockdown was assessed qualitatively with in situ hybridizations for both genes. Quantitative PCR and caspase activity assays were used as a quantitative measure of knockdown for acasp. PMID:17565114

  6. Rare Events of Intragenus and Intraspecies Horizontal Transfer of the 16S rRNA Gene.

    PubMed

    Tian, Ren-Mao; Cai, Lin; Zhang, Wei-Peng; Cao, Hui-Luo; Qian, Pei-Yuan

    2015-07-27

    Horizontal gene transfer (HGT) of operational genes has been widely reported in prokaryotic organisms. However, informational genes such as those involved in transcription and translation processes are very difficult to be horizontally transferred, as described by Woese's complexity hypothesis. Here, we analyzed all of the completed prokaryotic genome sequences (2,143 genomes) in the NCBI (National Center for Biotechnology Information) database, scanned for genomes with high intragenomic heterogeneity of 16S rRNA gene copies, and explored potential HGT events of ribosomal RNA genes based on the phylogeny, genomic organization, and secondary structures of the ribosomal RNA genes. Our results revealed 28 genomes with relatively high intragenomic heterogeneity of multiple 16S rRNA gene copies (lowest pairwise identity <98.0%), and further analysis revealed HGT events and potential donors of the heterogeneous copies (such as HGT from Chlamydia suis to Chlamydia trachomatis) and mutation events of some heterogeneous copies (such as Streptococcus suis JS14). Interestingly, HGT of the 16S rRNA gene only occurred at intragenus or intraspecies levels, which is quite different from the HGT of operational genes. Our results improve our understanding regarding the exchange of informational genes.

  7. A subset of conserved tRNA genes in plastid DNA of nongreen plants.

    PubMed Central

    Lohan, A J; Wolfe, K H

    1998-01-01

    The plastid genome of the nonphotosynthetic parasitic plant Epifagus virginiana contains only 17 of the 30 tRNA genes normally found in angiosperm plastid DNA. Although this is insufficient for translation, the genome is functional, so import of cytosolic tRNAs into plastids has been suggested. This raises the question of whether the tRNA genes that remain in E. virginiana plastid DNA are active or have just fortuitously escaped deletion. We report the sequences of 20 plastid tRNA loci from Orobanche minor, which shares a nonphotosynthetic ancestor with E. virginiana. The two species have 9 intact tRNA genes in common, the others being defunct in one or both species. The intron-containing trnLUAA gene is absent from E. virginiana, but it is intact, transcribed, and spliced in O. minor. The shared intact genes are better conserved than intergenic sequences, which indicates that these genes are being maintained by natural selection and, therefore, must be functional. For the most part, the tRNA species conserved in nonphotosynthetic plastids are also those that have never been found to be imported in plant mitochondria, which suggests that the same rules may govern tRNA import in the two organelles. A small photosynthesis gene, psbI, is still intact in O. minor, and computer simulations show that some small nonessential genes have an appreciable chance of escaping deletion. PMID:9725858

  8. Human Nopp140, Which Interacts with RNA Polymerase I: Implications for rRNA Gene Transcription and Nucleolar Structural Organization

    PubMed Central

    Chen, Hung-Kai; Pai, Chi-Yun; Huang, Jing-Yi; Yeh, Ning-Hsing

    1999-01-01

    Nopp140 is thought to shuttle between nucleolus and cytoplasm. However, the predominant nucleolar localization of Nopp140 homologues from different species suggests that Nopp140 is also involved in events occurring within the nucleolus. In this study, we demonstrated that the largest subunit of RNA polymerase I, RPA194, was coimmunoprecipitated with the human Nopp140 (hNopp140). Such an interaction is mediated through amino acids 204 to 382 of hNopp140. By double immunofluorescence, hNopp140 was colocalized with RNA polymerase I at the rDNA (rRNA genes) transcription active foci in the nucleolus. These results suggest that Nopp140 can interact with RNA polymerase I in vivo. Transfected cells expressing the amino-terminal half of hNopp140, hNopp140N382 (amino acids 1 to 382), displayed altered nucleoli with crescent-shaped structures. This phenotype is reminiscent of the segregated nucleoli induced by actinomycin D treatment, which is known to inhibit rRNA synthesis. Consistently, the hNopp140N382 protein mislocalized the endogenous RNA polymerase I and shut off cellular rRNA gene transcription as revealed by an in situ run-on assay. These dominant negative effects of the mutant hNopp140N382 suggest that Nopp140 plays an essential role in rDNA transcription. Interestingly, ectopic expression of hNopp140 to a very high level caused the formation of a transcriptionally inactive spherical structure occupying the entire nucleolar area which trapped the RNA polymerase I, fibrillarin, and hNopp140 but excluded the nucleolin. The mislocalizations of these nucleolar proteins after hNopp140 overexpression imply that Nopp140 may also play roles in maintenance of nucleolar integrity. PMID:10567578

  9. MR VIGS: microRNA-based virus-induced gene silencing in plants.

    PubMed

    Chen, Weiwei; Zhang, Qi; Kong, Junhua; Hu, Feng; Li, Bin; Wu, Chaoqun; Qin, Cheng; Zhang, Pengcheng; Shi, Nongnong; Hong, Yiguo

    2015-01-01

    In plants, microRNA (miRNA)-based virus-induced gene silencing, dubbed MR VIGS, is a powerful technique to delineate the biological functions of genes. By targeting to a specific sequence, miRNAs can knock down expression of genes with fewer off-target effects. Here, using a modified Cabbage leaf curling virus (CaLCuV) and Tobacco rattle virus (TRV) as vectors, we describe two virus-based miRNA expression systems to perform MR VIGS for plant functional genomics assays. PMID:25740363

  10. RNA silencing of genes involved in Alzheimer's disease enhances mitochondrial function and synaptic activity.

    PubMed

    Manczak, Maria; Reddy, P Hemachandra

    2013-12-01

    An age-dependent increase in mRNA levels of the amyloid precursor protein (APP), the microtubule-associated protein Tau, and voltage-dependent anion channel 1 (VDAC1) genes are reported to be toxic to neurons affected by Alzheimer's disease (AD). However, the underlying toxic nature of these genes is not completely understood. The purpose of our study was to determine the effects of RNA silencing of APP, Tau, and VDAC1 genes in AD pathogenesis. Using human neuroblastoma (SHSY5Y) cells, we first silenced RNA for APP, Tau, and VDAC1 genes, and then performed real-time RT-PCR analysis to measure mRNA levels of 34 genes that are involved in AD pathogenesis. Using biochemical assays, we also assessed mitochondrial function by measuring levels of H2O2 production, lipid peroxidation, cytochrome c oxidase activity, ATP production, and GTPase enzymatic activity. We found that increased mRNA expression of synaptic function and mitochondrial fission genes, and reduced levels of mitochondrial fusion genes in RNA silenced the SHSY5Y cells for APP, Tau and VDAC1 genes relative to the control SHSY5Y cells. In addition, RNA-silenced APP, Tau, and VDAC1 genes in SHSY5Y cells showed reduced levels of H2O2 production, lipid peroxidation, fission-linked GTPase activity, and increased cytochrome oxidase activity and ATP production. These findings suggest that a reduction of human APP, Tau, and VDAC1 may enhance synaptic activity, may improve mitochondrial maintenance and function, and may protect against toxicities of AD-related genes. Thus, these findings also suggest that the reduction of APP, Tau, and VDAC1 mRNA expressions may have therapeutic value for patients with AD.

  11. Repertoire and evolution of miRNA genes in four divergent nematode species

    PubMed Central

    de Wit, Elzo; Linsen, Sam E.V.; Cuppen, Edwin; Berezikov, Eugene

    2009-01-01

    miRNAs are ∼22-nt RNA molecules that play important roles in post-transcriptional regulation. We have performed small RNA sequencing in the nematodes Caenorhabditis elegans, C. briggsae, C. remanei, and Pristionchus pacificus, which have diverged up to 400 million years ago, to establish the repertoire and evolutionary dynamics of miRNAs in these species. In addition to previously known miRNA genes from C. elegans and C. briggsae we demonstrate expression of many of their homologs in C. remanei and P. pacificus, and identified in total more than 100 novel expressed miRNA genes, the majority of which belong to P. pacificus. Interestingly, more than half of all identified miRNA genes are conserved at the seed level in all four nematode species, whereas only a few miRNAs appear to be species specific. In our compendium of miRNAs we observed evidence for known mechanisms of miRNA evolution including antisense transcription and arm switching, as well as miRNA family expansion through gene duplication. In addition, we identified a novel mode of miRNA evolution, termed “hairpin shifting,” in which an alternative hairpin is formed with up- or downstream sequences, leading to shifting of the hairpin and creation of novel miRNA* species. Finally, we identified 21U-RNAs in all four nematodes, including P. pacificus, where the upstream 21U-RNA motif is more diverged. The identification and systematic analysis of small RNA repertoire in four nematode species described here provides a valuable resource for understanding the evolutionary dynamics of miRNA-mediated gene regulation. PMID:19755563

  12. Disruption of Spodoptera exigua larval development by silencing chitin synthase gene A with RNA interference.

    PubMed

    Chen, X; Tian, H; Zou, L; Tang, B; Hu, J; Zhang, W

    2008-12-01

    RNA interference (RNAi) is a powerful tool for rapidly analyzing gene functions. However, little is known about the possible use of dsRNA/siRNA as a pest control method. Here, we demonstrate that dsRNA/siRNA can induce the silence of chitin synthase gene A (CHSA), which is an important gene for the growth and development of cuticles and trachea in beet armyworm, Spodoptera exigua. Based on the in vitro RNAi experiments in an insect cell line (Trichoplusia ni High 5), in vivo RNAi was performed by injecting synthesized dsRNA/siRNA into the 4th instar larvae of S. exigua. Significantly lower levels of CHSA transcripts were detected. In addition, the cuticle of these insects was disordered and the epithelial walls of larval trachea did not expand uniformly in injected individuals. Moreover, Injections significantly increased abnormalities relative to control larvae. These results highlighted the possibility of dsRNA/siRNA for gene function studies in lepidopteran insects and future pest control. PMID:18662430

  13. Sequence arrangement of the rRNA genes of the dipteran Sarcophaga bullata.

    PubMed

    French, C K; Fouts, D L; Manning, J E

    1981-06-11

    Velocity sedimentation studies of RNA of Sarcophaga bullata show that the major rRNA species have sedimentation values of 26S and 18S. Analysis of the rRNA under denaturing conditions indicates that there is a hidden break centrally located in the 26S rRNA species. Saturation hybridization studies using total genomic DNA and rRNA show that 0.08% of the nuclear DNA is occupied by rRNA coding sequences and that the average repetition frequency of these coding sequences is approximately 144. The arrangement of the rRNA genes and their spacer sequences on long strands of purified rDNA was determined by the examination of the structure of rRNa:DNA hybrids in the electron microscope. Long DNA strands contain several gene sets (18S + 26S) with one repeat unit containing the following sequences in order given: (a) An 18S gene of length 2.12 kb, (b) an internal transcribed spacer of length 2.01 kb, which contains a short sequence that may code for a 5.8S rRNA, (c) A 26S gene of length 4.06 kb which, in 20% of the cases, contains an intron with an average length of 5.62 kb, and (d) an external spacer of average length of 9.23 kb.

  14. Colorado potato beetle (Coleoptera) gut transcriptome analysis: expression of RNA interference-related genes.

    PubMed

    Swevers, L; Huvenne, H; Menschaert, G; Kontogiannatos, D; Kourti, A; Pauchet, Y; ffrench-Constant, R; Smagghe, G

    2013-12-01

    In the search for new methods of pest control, the potential of RNA interference (RNAi) is being explored. Because the gut is the first barrier for the uptake of double-stranded (ds)RNA, pyrosequencing of the gut transcriptome is a powerful tool for obtaining the necessary sequences for specific dsRNA-mediated pest control. In the present study, a dataset representing the gut transcriptome of the Colorado potato beetle (CPB; Leptinotarsa decemlineata) was generated and analysed for the presence of RNAi-related genes. Almost all selected genes that were implicated in silencing efficiency at different levels in the RNAi pathway (core machinery, associated intracellular factors, dsRNA uptake, antiviral RNAi, nucleases), which uses different types of small RNA (small interfering RNA, microRNA and piwi-RNA), were expressed in the CPB gut. Although the database is of lower quality, the majority of the RNAi genes are also found to be present in the gut transcriptome of the tobacco hornworm [TH; Manduca sexta (19 out of 35 genes analysed)]. The high quality of the CPB transcriptome database will lay the foundation for future gene expression and functional studies regarding the gut and RNAi. PMID:24580832

  15. MicroRNA-mediated gene silencing modulates the UV-induced DNA-damage response

    PubMed Central

    Pothof, Joris; Verkaik, Nicole S; van IJcken, Wilfred; Wiemer, Erik A C; Ta, Van T B; van der Horst, Gijsbertus T J; Jaspers, Nicolaas G J; van Gent, Dik C; Hoeijmakers, Jan H J; Persengiev, Stephan P

    2009-01-01

    DNA damage provokes DNA repair, cell-cycle regulation and apoptosis. This DNA-damage response encompasses gene-expression regulation at the transcriptional and post-translational levels. We show that cellular responses to UV-induced DNA damage are also regulated at the post-transcriptional level by microRNAs. Survival and checkpoint response after UV damage was severely reduced on microRNA-mediated gene-silencing inhibition by knocking down essential components of the microRNA-processing pathway (Dicer and Ago2). UV damage triggered a cell-cycle-dependent relocalization of Ago2 into stress granules and various microRNA-expression changes. Ago2 relocalization required CDK activity, but was independent of ATM/ATR checkpoint signalling, whereas UV-responsive microRNA expression was only partially ATM/ATR independent. Both microRNA-expression changes and stress-granule formation were most pronounced within the first hours after genotoxic stress, suggesting that microRNA-mediated gene regulation operates earlier than most transcriptional responses. The functionality of the microRNA response is illustrated by the UV-inducible miR-16 that downregulates checkpoint-gene CDC25a and regulates cell proliferation. We conclude that microRNA-mediated gene regulation adds a new dimension to the DNA-damage response. PMID:19536137

  16. Colorado potato beetle (Coleoptera) gut transcriptome analysis: expression of RNA interference-related genes.

    PubMed

    Swevers, L; Huvenne, H; Menschaert, G; Kontogiannatos, D; Kourti, A; Pauchet, Y; ffrench-Constant, R; Smagghe, G

    2013-12-01

    In the search for new methods of pest control, the potential of RNA interference (RNAi) is being explored. Because the gut is the first barrier for the uptake of double-stranded (ds)RNA, pyrosequencing of the gut transcriptome is a powerful tool for obtaining the necessary sequences for specific dsRNA-mediated pest control. In the present study, a dataset representing the gut transcriptome of the Colorado potato beetle (CPB; Leptinotarsa decemlineata) was generated and analysed for the presence of RNAi-related genes. Almost all selected genes that were implicated in silencing efficiency at different levels in the RNAi pathway (core machinery, associated intracellular factors, dsRNA uptake, antiviral RNAi, nucleases), which uses different types of small RNA (small interfering RNA, microRNA and piwi-RNA), were expressed in the CPB gut. Although the database is of lower quality, the majority of the RNAi genes are also found to be present in the gut transcriptome of the tobacco hornworm [TH; Manduca sexta (19 out of 35 genes analysed)]. The high quality of the CPB transcriptome database will lay the foundation for future gene expression and functional studies regarding the gut and RNAi.

  17. Cooperative gene regulation by microRNA pairs and their identification using a computational workflow

    PubMed Central

    Schmitz, Ulf; Lai, Xin; Winter, Felix; Wolkenhauer, Olaf; Vera, Julio; Gupta, Shailendra K.

    2014-01-01

    MicroRNAs (miRNAs) are an integral part of gene regulation at the post-transcriptional level. Recently, it has been shown that pairs of miRNAs can repress the translation of a target mRNA in a cooperative manner, which leads to an enhanced effectiveness and specificity in target repression. However, it remains unclear which miRNA pairs can synergize and which genes are target of cooperative miRNA regulation. In this paper, we present a computational workflow for the prediction and analysis of cooperating miRNAs and their mutual target genes, which we refer to as RNA triplexes. The workflow integrates methods of miRNA target prediction; triplex structure analysis; molecular dynamics simulations and mathematical modeling for a reliable prediction of functional RNA triplexes and target repression efficiency. In a case study we analyzed the human genome and identified several thousand targets of cooperative gene regulation. Our results suggest that miRNA cooperativity is a frequent mechanism for an enhanced target repression by pairs of miRNAs facilitating distinctive and fine-tuned target gene expression patterns. Human RNA triplexes predicted and characterized in this study are organized in a web resource at www.sbi.uni-rostock.de/triplexrna/. PMID:24875477

  18. Development of hybrid baculovirus vectors for artificial MicroRNA delivery and prolonged gene suppression.

    PubMed

    Chen, Chiu-Ling; Luo, Wen-Yi; Lo, Wen-Hsin; Lin, Kun-Ju; Sung, Li-Yu; Shih, Yung-Shen; Chang, Yu-Han; Hu, Yu-Chen

    2011-12-01

    MicroRNA (miRNA) plays essential roles in regulating gene expression, but miRNA delivery remains a hurdle, thus entailing a vector system for efficient transfer. Baculovirus emerges as a promising gene delivery vector but its inherent transient expression restricts its applications in some scenarios. Therefore, this study primarily aimed to develop baculovirus as a miRNA expression vector for prolonged gene suppression. We constructed recombinant baculoviruses carrying artificial egfp-targeting miRNA sequences within the miR155 backbone, which after expression by the cytomegalovirus promoter could knockdown the enhanced green fluorescent protein (EGFP) expression in a sequence- and dose-dependent manner. By swapping the mature miRNA sequences, the baculovirus miRNA shuttle effectively repressed the overexpression of endogenous TNF-α in arthritic synoviocytes without inducing apoptosis. To prolong the baculovirus-mediated expression, we further developed a hybrid baculovirus vector that exploited the Sleeping Beauty (SB) transposon for gene integration and sustained miRNA expression. The hybrid baculovirus vector that combined the miR155 scaffold and SB transposon effectively repressed the transgene expression for a prolonged period of time, hence diversifying the applications of baculovirus to indications necessitating prolonged gene regulation such as arthritis. PMID:21732325

  19. Successful transient expression of Cas9 and single guide RNA genes in Chlamydomonas reinhardtii.

    PubMed

    Jiang, Wenzhi; Brueggeman, Andrew J; Horken, Kempton M; Plucinak, Thomas M; Weeks, Donald P

    2014-11-01

    The clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 system has become a powerful and precise tool for targeted gene modification (e.g., gene knockout and gene replacement) in numerous eukaryotic organisms. Initial attempts to apply this technology to a model, the single-cell alga, Chlamydomonas reinhardtii, failed to yield cells containing edited genes. To determine if the Cas9 and single guide RNA (sgRNA) genes were functional in C. reinhardtii, we tested the ability of a codon-optimized Cas9 gene along with one of four different sgRNAs to cause targeted gene disruption during a 24-h period immediately following transformation. All three exogenously supplied gene targets as well as the endogenous FKB12 (rapamycin sensitivity) gene of C. reinhardtii displayed distinct Cas9/sgRNA-mediated target site modifications as determined by DNA sequencing of cloned PCR amplicons of the target site region. Success in transient expression of Cas9 and sgRNA genes contrasted with the recovery of only a single rapamycin-resistant colony bearing an appropriately modified FKB12 target site in 16 independent transformation experiments involving >10(9) cells. Failure to recover transformants with intact or expressed Cas9 genes following transformation with the Cas9 gene alone (or even with a gene encoding a Cas9 lacking nuclease activity) provided strong suggestive evidence for Cas9 toxicity when Cas9 is produced constitutively in C. reinhardtii. The present results provide compelling evidence that Cas9 and sgRNA genes function properly in C. reinhardtii to cause targeted gene modifications and point to the need for a focus on development of methods to properly stem Cas9 production and/or activity following gene editing.

  20. Functional genomics tool: Gene silencing in Ixodes scapularis eggs and nymphs by electroporated dsRNA

    PubMed Central

    2010-01-01

    Background Ticks are blood-sucking arthropods responsible for transmitting a wide variety of disease-causing agents, and constitute important public health threats globally. Ixodes scapularis is the primary vector of the Lyme disease agent in the eastern and central U.S. RNAi is a mechanism by which gene-specific double-stranded RNA (dsRNA) triggers degradation of homologous mRNA transcripts. Here, we describe an optimized protocol for effectively suppressing gene expression in the egg and nymphal stages of I. scapularis by electroporation. Results The genes encoding the putative Phospholipase A2 (PLA2), cytoplasmic Cystatin, Syntaxin-5, β-Actin and Calreticulin were targeted by delivering the dsRNA encoding the specific gene coding regions in the unfed nymphs. Silencing was measured using real time qRT-PCR. Electroporation as a mode of dsRNA delivery appears to be substantially efficient and less traumatic to the tick than dsRNA microinjection in the unfed nymphs. Using Cy3-labeled dsRNA to monitor the movement, electroporated dsRNA entered the nymphs and spread to salivary glands and other tissues. The significant disruption of β-actin and cytoplasmic Cystatin transcripts in tick eggs demonstrate the applicability of this technique. The PLA2, cytoplasmic Cystatin, Syntaxin-5, β-Actin and Calreticulin genes were also significantly silenced, suggesting that this method has the potential to introduce dsRNA in eggs and unfed nymphs. Conclusions Our study demonstrates that electroporation can be used as a simple dsRNA delivery tool in assessing the functional role of tick genes in the vector-host interactions. This technique represents a novel approach for specific gene suppression in immature stages of ticks. PMID:20074328

  1. Agitation during lipoplex formation improves the gene knockdown effect of siRNA.

    PubMed

    Barichello, Jose Mario; Kizuki, Shinji; Tagami, Tatsuaki; Asai, Tomohiro; Ishida, Tatsuhiro; Kikuchi, Hiroshi; Oku, Naoto; Kiwada, Hiroshi

    2011-05-30

    The successful delivery of therapeutic siRNA to the designated target cells and their availability at the intracellular site of action are crucial requirements for successful RNAi therapy. In the present study, we focused on the siRNA-lipoplex preparation procedure and its effect on the gene-knockdown efficiency of siRNA in vitro. Agitation (vortex-mixing) during siRNA-lipoplex (vor-LTsiR) preparation and its effect on the gene-knockdown efficiency of stably expressed cell GFP was investigated, and their efficiency was compared with that of spontaneously formed lipoplex (spo-LTsiR). A dramatic difference in size between lipoplexes was observed at the N/P ratio of 7.62 (siRNA dose of 30 nM), even though both lipoplexes were positively charged. With the siRNA dose of 30 nM, vor-LTsiR accomplished a 50% gene-knockdown, while spo-LTsiR managed a similar knockdown effect at the 120 nM level, suggesting that the preparation procedure remarkably affects the gene-knockdown efficacy of siRNA. The uptake of vor-LTsiR was mainly via clathrin-mediated endocytosis, whereas that of spo-LTsiR was via membrane fusion. In addition, by inhibiting clathrin-mediated endocytosis, the gene-knockdown efficiency was significantly lowered. The size of the lipoplex, promoted by the preparation procedure, is likely to define the entry pathway, resulting in an increased amount of siRNA internalized in cells and an enhanced gene-knockdown efficacy. The results of the present study definitively show that a proper siRNA-lipoplex preparation procedure makes a significant contribution to the efficiency of cellular uptake, and thereby, to the gene-knockdown efficiency of siRNA. PMID:21392562

  2. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  3. Chromosome-specific NOR inactivation explains selective rRNA gene silencing and dosage control in Arabidopsis

    PubMed Central

    Chandrasekhara, Chinmayi; Mohannath, Gireesha; Blevins, Todd; Pontvianne, Frederic; Pikaard, Craig S.

    2016-01-01

    In eukaryotes, scores of excess ribosomal RNA (rRNA) genes are silenced by repressive chromatin modifications. Given the near sequence identity of rRNA genes within a species, it is unclear how specific rRNA genes are reproducibly chosen for silencing. Using Arabidopsis thaliana ecotype (strain) Col-0, a systematic search identified sequence polymorphisms that differ between active and developmentally silenced rRNA gene subtypes. Recombinant inbred mapping populations derived from three different ecotype crosses were then used to map the chromosomal locations of silenced and active RNA gene subtypes. Importantly, silenced and active rRNA gene subtypes are not intermingled. All silenced rRNA gene subtypes mapped to the nucleolus organizer region (NOR) on chromosome 2 (NOR2). All active rRNA gene subtypes mapped to NOR4. Using an engineered A. thaliana line in which a portion of Col-0 chromosome 4 was replaced by sequences of another ecotype, we show that a major rRNA gene subtype silenced at NOR2 is active when introgressed into the genome at NOR4. Collectively, these results reveal that selective rRNA gene silencing is not regulated gene by gene based on mechanisms dependent on subtle gene sequence variation. Instead, we propose that a subchromosomal silencing mechanism operates on a multimegabase scale to inactivate NOR2. PMID:26744421

  4. RNA polymerase II pauses and associates with pre-mRNA processing factors at both ends of genes

    PubMed Central

    Glover-Cutter, Kira; Kim, Soojin; Espinosa, Joaquin; Bentley, David L.

    2010-01-01

    We investigated co-transcriptional recruitment of pre-mRNA processing factors to human genes. Capping factors associate with paused RNA pol II at the 5′ ends of quiescent genes. They also track throughout actively transcribed genes, and accumulate with paused polymerase in the 3′ flanking region. 3′ processing factors CstF and CPSF are maximally recruited 0.5-1.5 kb downstream of poly(A) sites where they coincide with capping factors, Spt5, and Ser2 hyperphosphorylated, paused pol II. 3′ end processing factors also localize at transcription start sites, and this early recruitment is enhanced after polymerase arrest with DRB. These results suggest that promoters may help specify recruitment of 3′ end processing factors. We propose a dual pausing model where elongation arrests near the transcription start site and in the 3′ flank to allow co-transcriptional processing by factors recruited to the pol II ternary complex. PMID:18157150

  5. Small RNA pathway genes identified by patterns of phylogenetic conservation and divergence

    PubMed Central

    Tabach, Yuval; Billi, Allison C.; Hayes, Gabriel D.; Newman, Martin A.; Zuk, Or; Gabel, Harrison; Kamath, Ravi; Yacoby, Keren; Chapman, Brad; Garcia, Susana M.; Borowsky, Mark; Kim, John K.; Ruvkun, Gary

    2013-01-01

    Genetic and biochemical analyses of RNA interference (RNAi) and microRNA (miRNA) pathways have revealed proteins such as Argonaute/PIWI and Dicer that process and present small RNAs to their targets. Well validated small RNA pathway cofactors, such as the Argonaute/PIWI proteins show distinctive patterns of conservation or divergence in particular animal, plant, fungal, and protist species. We compared 86 divergent eukaryotic genome sequences to discern sets of proteins that show similar phylogenetic profiles with known small RNA cofactors. A large set of additional candidate small RNA cofactors have emerged from functional genomic screens for defects in miRNA- or siRNA-mediated repression in C. elegans and D. melanogaster1,2 and from proteomic analyses of proteins co-purifying with validated small RNA pathway proteins3,4. The phylogenetic profiles of many of these candidate small RNA pathway proteins are similar to those of known small RNA cofactor proteins. We used a Bayesian approach to integrate the phylogenetic profile analysis with predictions from diverse transcriptional coregulation and proteome interaction datasets to assign a probability for each protein for a role in a small RNA pathway. Testing high-confidence candidates from this analysis for defects in RNAi silencing, we found that about half of the predicted small RNA cofactors are required for RNAi silencing. Many of the newly identified small RNA pathway proteins are orthologues of proteins implicated in RNA splicing. In support of a deep connection between the mechanism of RNA splicing and small RNA-mediated gene silencing, the presence of the Argonaute proteins and other small RNA components in the many species analysed strongly correlates with the number of introns in that species. PMID:23364702

  6. Systematic identification of novel, essential host genes affecting bromovirus RNA replication.

    PubMed

    Gancarz, Brandi L; Hao, Linhui; He, Qiuling; Newton, Michael A; Ahlquist, Paul

    2011-01-01

    Positive-strand RNA virus replication involves viral proteins and cellular proteins at nearly every replication step. Brome mosaic virus (BMV) is a well-established model for dissecting virus-host interactions and is one of very few viruses whose RNA replication, gene expression and encapsidation have been reproduced in the yeast Saccharomyces cerevisiae. Previously, our laboratory identified ∼100 non-essential host genes whose loss inhibited or enhanced BMV replication at least 3-fold. However, our isolation of additional BMV-modulating host genes by classical genetics and other results underscore that genes essential for cell growth also contribute to BMV RNA replication at a frequency that may be greater than that of non-essential genes. To systematically identify novel, essential host genes affecting BMV RNA replication, we tested a collection of ∼900 yeast strains, each with a single essential gene promoter replaced by a doxycycline-repressible promoter, allowing repression of gene expression by adding doxycycline to the growth medium. Using this strain array of ∼81% of essential yeast genes, we identified 24 essential host genes whose depleted expression reproducibly inhibited or enhanced BMV RNA replication. Relevant host genes are involved in ribosome biosynthesis, cell cycle regulation and protein homeostasis, among other cellular processes. BMV 2a(Pol) levels were significantly increased in strains depleted for a heat shock protein (HSF1) or proteasome components (PRE1 and RPT6), suggesting these genes may affect BMV RNA replication by directly or indirectly modulating 2a(Pol) localization, post-translational modification or interacting partners. Investigating the diverse functions of these newly identified essential host genes should advance our understanding of BMV-host interactions and normal cellular pathways, and suggest new modes of virus control.

  7. A Caenorhabditis Elegans RNA Polymerase II Gene, Ama-1 Iv, and Nearby Essential Genes

    PubMed Central

    Rogalski, T. M.; Riddle, D. L.

    1988-01-01

    The amanitin-binding subunit of RNA polymerase II in Caenorhabditis elegans is encoded by the ama-1 gene, located approximately 0.05 map unit to the right of dpy-13 IV. Using the amanitin-resistant ama-1(m118) strain as a parent, we have isolated amanitin-sensitive mutants that carry recessive-lethal ama-1 alleles. Of the six ethyl methanesulfonate-induced mutants examined, two are arrested late in embryogenesis. One of these is a large deficiency, mDf9, but the second may be a novel point mutation. The four other mutants are hypomorphs, and presumably produce altered RNA polymerase II enzymes with some residual function. Two of these mutants develop into sterile adults at 20° but are arrested as larvae at 25°, and two others are fertile at 20° and sterile at 25°. Temperature-shift experiments performed with the adult sterile mutant, ama-1(m118m238ts), have revealed a temperature-sensitive period that begins late in gonadogenesis and is centered around the initiation of egg-laying. Postembryonic development at 25° is slowed by 30%. By contrast, the amanitin-resistant allele of ama-1 has very little effect on developmental rate or fertility. We have identified 15 essential genes in an interval of 4.5 map units surrounding ama-1, as well as four γ-ray-induced deficiencies and two duplications that include the ama-1 gene. The larger duplication, mDp1, may include the entire left arm of chromosome IV, and it recombines with the normal homologue at a low frequency. The smallest deficiency, mDf10, complements all but three identified genes: let-278, dpy-13 and ama-1, which define an interval of only 0.1 map unit. The terminal phenotype of mDf10 homozygotes is developmental arrest during the first larval stage, suggesting that there is sufficient maternal RNA polymerase II to complete embryonic development. PMID:8608933

  8. GENE SILENCING BY PARENTAL RNA INTERFERENCE IN THE GREEN RICE LEAFHOPPER, Nephotettix cincticeps (HEMIPTERA: CICADELLIDAE).

    PubMed

    Matsumoto, Yukiko; Hattori, Makoto

    2016-03-01

    RNA interference (RNAi) has been widely used for investigating gene function in many nonmodel insect species. Parental RNAi causes gene knockdown in the next generation through the administration of double-strand RNA (dsRNA) to the mother generation. In this study, we demonstrate that parental RNAi mediated gene silencing is effective in determining the gene function of the cuticle and the salivary glands in green rice leafhopper (GRH), Nephotettix cincticeps (Uhler). Injection of dsRNA of NcLac2 (9 ng/female) to female parents caused a strong knockdown of laccase-2 gene of first instar nymphs, which eventually led to high mortality rates and depigmentation of side lines on the body. The effects of parental RNAi on the mortality of the nymphs were maintained through 12-14 days after the injections. We also confirmed the effectiveness of parental RNAi induced silencing on the gene expressed in the salivary gland, the gene product of which is passed from instar to instar. The parental RNAi method can be used to examine gene function by phenotyping many offspring nymphs with injection of dsRNA into a small number of parent females, and may be applicable to high-efficiency determination of gene functions in this species. PMID:26728387

  9. GENE SILENCING BY PARENTAL RNA INTERFERENCE IN THE GREEN RICE LEAFHOPPER, Nephotettix cincticeps (HEMIPTERA: CICADELLIDAE).

    PubMed

    Matsumoto, Yukiko; Hattori, Makoto

    2016-03-01

    RNA interference (RNAi) has been widely used for investigating gene function in many nonmodel insect species. Parental RNAi causes gene knockdown in the next generation through the administration of double-strand RNA (dsRNA) to the mother generation. In this study, we demonstrate that parental RNAi mediated gene silencing is effective in determining the gene function of the cuticle and the salivary glands in green rice leafhopper (GRH), Nephotettix cincticeps (Uhler). Injection of dsRNA of NcLac2 (9 ng/female) to female parents caused a strong knockdown of laccase-2 gene of first instar nymphs, which eventually led to high mortality rates and depigmentation of side lines on the body. The effects of parental RNAi on the mortality of the nymphs were maintained through 12-14 days after the injections. We also confirmed the effectiveness of parental RNAi induced silencing on the gene expressed in the salivary gland, the gene product of which is passed from instar to instar. The parental RNAi method can be used to examine gene function by phenotyping many offspring nymphs with injection of dsRNA into a small number of parent females, and may be applicable to high-efficiency determination of gene functions in this species.

  10. Salicylic acid and gentisic acid induce RNA silencing-related genes and plant resistance to RNA pathogens.

    PubMed

    Campos, Laura; Granell, Pablo; Tárraga, Susana; López-Gresa, Pilar; Conejero, Vicente; Bellés, José María; Rodrigo, Ismael; Lisón, Purificación

    2014-04-01

    We have observed that treatments with salicylic acid (SA) or gentisic acid (GA) induced resistance to RNA pathogens such as ToMV and CEVd in tomato and Gynura auriantiaca, respectively. Accumulation of SA and GA has been found to occur in plants infected by these pathogens, thus pointing out a possible defence role of both molecules. To study the molecular basis of the observed induced resistance to RNA pathogens the induction of silencing-related genes by SA and GA was considered. For that purpose, we searched for tomato genes which were orthologous to those described in Arabidopsis thaliana, such as AtDCL1, AtDCL2, AtDCL4, AtRDR1, AtRDR2 and AtRDR6, and we tracked their induction in tomato along virus and viroid infections. We observed that CEVd significantly induced all these genes in tomato, with the exception of ToRDR6, being the induction of ToDCL4 the most outstanding. Regarding the ToMV asymptomatic infection, with the exception of ToRDR2, we observed a significant induction of all the indicated silencing-related genes, being ToDCL2 the most induced gene. Subsequently, we analyzed their transcriptional activation by SA and at the time when ToMV was inoculated on plants. ToDCL2, ToRDR1 and ToRDR2 were significantly induced by both SA and GA, whereas ToDCL1 was only induced by SA. Such an induction resulted more effective by SA treatment, which is in agreement with the stronger SA-induced resistance observed. Our results suggest that the observed delay in the RNA pathogen accumulation could be due to the pre-induction of RNA silencing-related genes by SA or GA.

  11. Chemical Targeting of a G-Quadruplex RNA in the Ebola Virus L Gene.

    PubMed

    Wang, Shao-Ru; Zhang, Qiu-Yan; Wang, Jia-Qi; Ge, Xing-Yi; Song, Yan-Yan; Wang, Ya-Fen; Li, Xiao-Dan; Fu, Bo-Shi; Xu, Guo-Hua; Shu, Bo; Gong, Peng; Zhang, Bo; Tian, Tian; Zhou, Xiang

    2016-09-22

    In the present study, our bioinformatics analysis first reveals the existence of a conserved guanine-rich sequence within the Zaire ebolavirus L gene. Using various methods, we show that this sequence tends to fold into G-quadruplex RNA. TMPyP4 treatment evidently inhibits L gene expression at the RNA level. Moreover, the mini-replicon assay demonstrates that TMPyP4 effectively inhibits the artificial Zaire ebolavirus mini-genome and is a more potent inhibitor than ribavirin. Although TMPyP4 treatment reduced the replication of the mutant mini-genome when G-quadruplex formation was abolished in the L gene, its inhibitory effect was significantly alleviated compared with wild-type. Our findings thus provide the first evidence that G-quadruplex RNA is present in a negative-sense RNA virus. Finally, G-quadruplex RNA stabilization may represent a new therapeutic strategy against Ebola virus disease. PMID:27617851

  12. Methylation of miRNA genes in the response to temperature stress in Populus simonii.

    PubMed

    Ci, Dong; Song, Yuepeng; Tian, Min; Zhang, Deqiang

    2015-01-01

    DNA methylation and miRNAs provide crucial regulation of the transcriptional and post-transcriptional responses to abiotic stress. In this study, we used methylation-sensitive amplification polymorphisms to identify 1066 sites that were differentially methylated in response to temperature stress in Populus simonii. Among these loci, BLAST searches of miRBase identified seven miRNA genes. Expression analysis by quantitative real-time PCR suggested that the methylation pattern of these miRNA genes probably influences their expression. Annotation of these miRNA genes in the sequenced genome of Populus trichocarpa found three target genes (Potri.007G090400, Potri.014G042200, and Potri.010G176000) for the miRNAs produced from five genes (Ptc-MIR396e and g, Ptc-MIR156i and j, and Ptc-MIR390c) respectively. The products of these target genes function in lipid metabolism to deplete lipid peroxide. We also constructed a network based on the interactions between DNA methylation and miRNAs, miRNAs and target genes, and the products of target genes and the metabolic factors that they affect, including H2O2, malondialdehyde, catalase (CAT), and superoxide dismutase. Our results suggested that DNA methylation probably regulates the expression of miRNA genes, thus affecting expression of their target genes, likely through the gene-silencing function of miRNAs, to maintain cell survival under abiotic stress conditions. PMID:26579167

  13. Methylation of miRNA genes in the response to temperature stress in Populus simonii

    PubMed Central

    Ci, Dong; Song, Yuepeng; Tian, Min; Zhang, Deqiang

    2015-01-01

    DNA methylation and miRNAs provide crucial regulation of the transcriptional and post-transcriptional responses to abiotic stress. In this study, we used methylation-sensitive amplification polymorphisms to identify 1066 sites that were differentially methylated in response to temperature stress in Populus simonii. Among these loci, BLAST searches of miRBase identified seven miRNA genes. Expression analysis by quantitative real-time PCR suggested that the methylation pattern of these miRNA genes probably influences their expression. Annotation of these miRNA genes in the sequenced genome of Populus trichocarpa found three target genes (Potri.007G090400, Potri.014G042200, and Potri.010G176000) for the miRNAs produced from five genes (Ptc-MIR396e and g, Ptc-MIR156i and j, and Ptc-MIR390c) respectively. The products of these target genes function in lipid metabolism to deplete lipid peroxide. We also constructed a network based on the interactions between DNA methylation and miRNAs, miRNAs and target genes, and the products of target genes and the metabolic factors that they affect, including H2O2, malondialdehyde, catalase (CAT), and superoxide dismutase. Our results suggested that DNA methylation probably regulates the expression of miRNA genes, thus affecting expression of their target genes, likely through the gene-silencing function of miRNAs, to maintain cell survival under abiotic stress conditions. PMID:26579167

  14. Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli.

    PubMed Central

    Brosius, J; Palmer, M L; Kennedy, P J; Noller, H F

    1978-01-01

    The complete nucleotide sequence of the 16S RNA gene from the rrnB cistron of Escherichia coli has been determined by using three rapid DNA sequencing methods. Nearly all of the structure has been confirmed by two to six independent sequence determinations on both DNA strands. The length of the 16S rRNA chain inferred from the DNA sequence is 1541 nucleotides, in close agreement with previous estimates. We note discrepancies between this sequence and the most recent version of it reported from direct RNA sequencing [Ehresmann, C., Stiegler, P., Carbon, P. & Ebel, J.P. (1977) FEBS Lett. 84, 337-341]. A few of these may be explained by heterogeneity among 16S rRNA sequences from different cistrons. No nucleotide sequences were found in the 16S rRNA gene that cannot be reconciled with RNase digestion products of mature 16S rRNA. Images PMID:368799

  15. Genetic Variability of MicroRNA Genes in 15 Animal Species.

    PubMed

    Zorc, Minja; Obsteter, Jana; Dovc, Peter; Kunej, Tanja

    2015-01-01

    MicroRNAs (miRNA) are a class of non-coding RNAs important in posttranscriptional regulation of target genes. Previous studies have proven that genetic variability of miRNA genes (miR-SNP) has an impact on phenotypic variation and disease susceptibility in human, mice and some livestock species. MicroRNA gene polymorphisms could therefore represent biomarkers for phenotypic traits also in other animal species. We upgraded our previously developed tool miRNA SNiPer to the version 4.0 which enables the search of miRNA genetic variability in 15 animal genomes: http://www.integratomics-time.com/miRNA-SNiPer. Genome-wide in silico screening (GWISS) of 15 genomes revealed that based on the current database releases, miRNA genes are most polymorphic in cattle, followed by human, fruitfly, mouse, chicken, pig, horse, and sheep. The difference in the number of miRNA gene polymorphisms between species is most probably not due to a biological reason and lack of genetic variability in some species, but to different stage of sequencing projects and differences in development of genomic resource databases in different species. Genome screening revealed several interesting genomic hotspots. For instance, several multiple nucleotide polymorphisms (MNPs) are present within mature seed region in cattle. Among miR-SNPs 46 are present on commercial whole-genome SNP chips: 16 in cattle, 26 in chicken, two in sheep and two in pig. The update of the miRNA SNiPer tool and the generated catalogs will serve researchers as a starting point in designing projects dealing with the effects of genetic variability of miRNA genes.

  16. Regulation of gene expression by the RNA-binding protein Sam68 in cancer.

    PubMed

    Rajan, Prabhakar; Gaughan, Luke; Dalgliesh, Caroline; El-Sherif, Amira; Robson, Craig N; Leung, Hing Y; Elliott, David J

    2008-06-01

    Sam68 (Src-associated in mitosis 68 kDa) is the prototypical member of the STAR (signal transducer and activator of RNA) family of RNA-binding proteins. Sam68 is implicated in a number of cellular processes including signal transduction, transcription, RNA metabolism, cell cycle regulation and apoptosis. In the present review, we summarize the functions of Sam68 as a transcriptional and post-transcriptional regulator of gene expression, with particular relevance to cancer. PMID:18481990

  17. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    PubMed

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  18. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    PubMed

    Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

    2015-01-01

    In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  19. Applications of RNA interference in cancer therapeutics as a powerful tool for suppressing gene expression.

    PubMed

    He, Song; Zhang, Dechun; Cheng, Fang; Gong, Fanghong; Guo, Yanan

    2009-11-01

    Cancer poses a tremendous therapeutic challenge worldwide, highlighting the critical need for developing novel therapeutics. A promising cancer treatment modality is gene therapy, which is a form of molecular medicine designed to introduce into target cells genetic material with therapeutic intent. The history of RNA interference (RNAi) has only a dozen years, however, further studies have revealed that it is a potent method of gene silencing that has developed rapidly over the past few years as a result of its extensive importance in the study of genetics, molecular biology and physiology. RNAi is a natural process by which small interfering RNA (siRNA) duplex directs sequence specific post-transcriptional silencing of homologous genes by binding to its complementary mRNA and triggering its elimination. RNAi has been extensively used as a novel and effective gene silencing tool for the fundamental research of cancer therapeutics, and has displayed great potential in clinical treatment.

  20. Prolonged gene knockdown in the tsetse fly Glossina by feeding double stranded RNA.

    PubMed

    Walshe, D P; Lehane, S M; Lehane, M J; Haines, L R

    2009-02-01

    Reverse genetic studies based on RNA interference (RNAi) have revolutionized analysis of gene function in most insects. However the necessity of injecting double stranded RNA (dsRNA) inevitably compromises many investigations particularly those on immunity. Additionally, injection of tsetse flies often causes significant mortality. We demonstrate, at transcript and protein level, that delivering dsRNA in the bloodmeal to Glossina morsitans morsitans is as effective as injection in knockdown of the immunoresponsive midgut-expressed gene TsetseEP. However, feeding dsRNA fails to knockdown the fat body expressed transferrin gene, 2A192, previously shown to be silenced by dsRNA injection. Mortality rates of the dsRNA fed flies were significantly reduced compared to injected flies 14 days after treatment (Fed: 10.1%+/- 1.8%; injected: 37.9% +/- 3.6% (Mean +/- SEM)). This is the first demonstration in Diptera of gene knockdown by feeding and the first example of knockdown in a blood-sucking insect by including dsRNA in the bloodmeal. PMID:19016913

  1. Diverse evolutionary trajectories for small RNA biogenesis genes in the oomycete genus Phytophthora

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gene regulation by small RNA pathways is ubiquitous among eukaryotes, but little is known about small RNA pathways in the Stramenopile kingdom. Phytophthora, a genus of filamentous oomycetes, contains many devastating plant pathogens, causing multibillion-dollar damage to crops, ornamental plants, ...

  2. In Vivo Gene-Silencing in Fibrotic Liver by siRNA-Loaded Cationic Nanohydrogel Particles.

    PubMed

    Kaps, Leonard; Nuhn, Lutz; Aslam, Misbah; Brose, Alexander; Foerster, Friedrich; Rosigkeit, Sebastian; Renz, Patricia; Heck, Rosario; Kim, Yong Ook; Lieberwirth, Ingo; Schuppan, Detlef; Zentel, Rudolf

    2015-12-30

    Cationic nanohydrogel particles loaded with anti-Col1α1 siRNA suppress collagen synthesis and deposition in fibrotic mice: Systemically administered 40 nm sized nanogel particles accumulate in collagen-expressing cells in the liver. Their siRNA payload induces a sequence specific in vivo gene knockdown affording an efficient antifibrotic effect in mice with liver fibrosis.

  3. Differential accumulation of nif structural gene mRNA in Azotobacter vinelandii.

    PubMed

    Hamilton, Trinity L; Jacobson, Marty; Ludwig, Marcus; Boyd, Eric S; Bryant, Donald A; Dean, Dennis R; Peters, John W

    2011-09-01

    Northern analysis was employed to investigate mRNA produced by mutant strains of Azotobacter vinelandii with defined deletions in the nif structural genes and in the intergenic noncoding regions. The results indicate that intergenic RNA secondary structures effect the differential accumulation of transcripts, supporting the high Fe protein-to-MoFe protein ratio required for optimal diazotrophic growth.

  4. [Selection of microRNA for providing tumor specificity of transgene expression in cancer gene therapy].

    PubMed

    Shepelev, M V; Kalinichenko, S V; Vikhreva, P N; Korobko, I V

    2016-01-01

    The use of tumor-specific microRNA loss to inhibit transgene expression in normal cells is considered as a way to increase the specificity of gene-therapeutic antitumor drugs. This method assumes the introduction of recognition sites of suppressed in tumor cells microRNAs into transgene transcipt. In the presented work, the efficiency of the strategy for providing the tumor specificity of transgene expression depending on parameters of microRNA expression in normal and tumor cells was studied. It was established that microRNA suppression in tumor cells and the determination of absolute microRNA levels in tumor and normal cells are not sufficient for the adequate estimation of the possibility of specific microRNA usage in the scheme of cancer gene therapy, and particularly do not allow to exclude a significant decrease in the efficiency of the gene-therapeutic drug upon the introduction of microRNA recognition sites. These parameters are only suitable for the preliminary selection of microRNA. The effect of introduction of microRNA recognition sites on transgene expression level in target tumor cells should be validated experimentally. It is suggested that this should be done directly in the cancer gene therapy scheme with monitoring of the therapeutic transgene activity. PMID:27239854

  5. Polyethyleneimine (PEI) Mediated siRNA Gene Silencing in the Schistosoma mansoni Snail Host, Biomphalaria glabrata

    PubMed Central

    Knight, Matty; Miller, Andre; Liu, Yijia; Scaria, Puthupparampil; Woodle, Martin; Ittiprasert, Wannaporn

    2011-01-01

    An in vivo, non-invasive technique for gene silencing by RNA interference (RNAi) in the snail, Biomphalaria glabrata, has been developed using cationic polymer polyethyleneimine (PEI) mediated delivery of long double-stranded (ds) and small interfering (si) RNA. Cellular delivery was evaluated and optimized by using a ‘mock’ fluorescent siRNA. Subsequently, we used the method to suppress expression of Cathepsin B (CathB) with either the corresponding siRNA or dsRNA of this transcript. In addition, the knockdown of peroxiredoxin (Prx) at both RNA and protein levels was achieved with the PEI-mediated soaking method. B. glabrata is an important snail host for the transmission of the parasitic digenean platyhelminth, Schistosoma mansoni that causes schistosomiasis in the neotropics. Progress is being made to realize the genome sequence of the snail and to uncover gene expression profiles and cellular pathways that enable the snail to either prevent or sustain an infection. Using PEI complexes, a convenient soaking method has been developed, enabling functional gene knockdown studies with either dsRNA or siRNA. The protocol developed offers a first whole organism method for host-parasite gene function studies needed to identify key mechanisms required for parasite development in the snail host, which ultimately are needed as points for disrupting this parasite mediated disease. PMID:21765961

  6. Widespread inference of weighted microRNA-mediated gene regulation in cancer transcriptome analysis

    PubMed Central

    Suzuki, Hiroshi I.; Mihira, Hajime; Watabe, Tetsuro; Sugimoto, Koichi; Miyazono, Kohei

    2013-01-01

    MicroRNAs (miRNAs) comprise a gene-regulatory network through sequence complementarity with target mRNAs. Previous studies have shown that mammalian miRNAs decrease many target mRNA levels and reduce protein production predominantly by target mRNA destabilization. However, it has not yet been fully assessed whether this scheme is widely applicable to more realistic conditions with multiple miRNA fluctuations. By combining two analytical frameworks for detecting the enrichment of gene sets, Gene Set Enrichment Analysis (GSEA) and Functional Assignment of miRNAs via Enrichment (FAME), we developed GSEA–FAME analysis (GFA), which enables the prediction of miRNA activities from mRNA expression data using rank-based enrichment analysis and weighted evaluation of miRNA–mRNA interactions. This cooperative approach delineated a better widespread correlation between miRNA expression levels and predicted miRNA activities in cancer transcriptomes, thereby providing proof-of-concept of the mRNA-destabilization scenario. In an integrative analysis of The Cancer Genome Atlas (TCGA) multidimensional data including profiles of both mRNA and miRNA, we also showed that GFA-based inference of miRNA activity could be used for the selection of prognostic miRNAs in the development of cancer survival prediction models. This approach proposes a next-generation strategy for the interpretation of miRNA function and identification of target miRNAs as biomarkers and therapeutic targets. PMID:23275554

  7. Gene-gene interaction and RNA splicing profiles of MAP2K4 gene in rheumatoid arthritis.

    PubMed

    Shchetynsky, Klementy; Protsyuk, Darya; Ronninger, Marcus; Diaz-Gallo, Lina-Marcela; Klareskog, Lars; Padyukov, Leonid

    2015-05-01

    We performed gene-gene interaction analysis, with HLA-DRB1 shared epitope (SE) alleles for 195 SNPs within immunologically important MAP2K, MAP3K and MAP4K gene families, in 2010 rheumatoid arthritis (RA) patients and 2280 healthy controls. We found a significant statistical interaction for rs10468473 with SE alleles in autoantibody-positive RA. Individuals heterozygous for rs10468473 demonstrated higher expression of total MAP2K4 mRNA in blood, compared to A-allele homozygous. We discovered a novel, putatively translated, "cassette exon" RNA splice form of MAP2K4, differentially expressed in peripheral blood mononuclear cells from 88 RA cases and controls. Within the group of RA patients, we observed a correlation of MAP2K4 isoform expression with carried SE alleles, autoantibody, and rheumatoid factor profiles. TNF-dependent modulation of isoform expression pattern was detected in the Jurkat cell line. Our data suggest a genetic interaction between MAP2K4 and HLA-DRB1, and the importance of rs10468473 and MAP2K4 splice variants in the development of autoantibody-positive RA.

  8. RNA splicing regulates the temporal order of TNF-induced gene expression.

    PubMed

    Hao, Shengli; Baltimore, David

    2013-07-16

    When cells are induced to express inflammatory genes by treatment with TNF, the mRNAs for the induced genes appear in three distinct waves, defining gene groups I, II, and III, or early, intermediate, and late genes. To examine the basis for these different kinetic classes, we have developed a PCR-based procedure to distinguish pre-mRNAs from mRNAs. It shows that the three groups initiate transcription virtually simultaneously but that delays in splicing characterize groups II and III. We also examined the elongation times, concluding that pre-mRNA synthesis is coordinate but splicing differences directly regulate the timing of mRNA production.

  9. Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.

    PubMed

    Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

    2008-09-15

    Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

  10. Efficient Gene Knockdown in Mouse Oocytes through Peptide Nanoparticle-Mediated SiRNA Transfection.

    PubMed

    Jin, Zhen; Li, Ruichao; Zhou, Chunxiang; Shi, Liya; Zhang, Xiaolan; Yang, Zhixia; Zhang, Dong

    2016-01-01

    The use of mouse oocytes as a model for studying female meiosis is very important in reproductive medicine. Gene knockdown by specific small interfering RNA (siRNA) is usually the first step in the study of the function of a target gene in mouse oocytes during in vitro maturation. Traditionally, the only way to introduce siRNA into mouse oocytes is through microinjection, which is certainly less efficient and strenuous than siRNA transfection in somatic cells. Recently, in research using somatic cells, peptide nanoparticle-mediated siRNA transfection has been gaining popularity over liposome nanoparticle-mediated methods because of its high efficiency, low toxicity, good stability, and strong serum compatibility. However, no researchers have yet tried transfecting siRNA into mouse oocytes because of the existence of the protective zona pellucida surrounding the oocyte membrane (vitelline membrane). We therefore tested whether peptide nanoparticles can introduce siRNA into mouse oocytes. In the present study, we showed for the first time that our optimized program can efficiently knock down a target gene with high specificity. Furthermore, we achieved the expected meiotic phenotypes after we knocked down a test unknown target gene TRIM75. We propose that peptide nanoparticles may be superior for preliminary functional studies of unknown genes in mouse oocytes. PMID:26974323

  11. Argonaute 2-dependent Regulation of Gene Expression by Single-stranded miRNA Mimics.

    PubMed

    Matsui, Masayuki; Prakash, Thazha P; Corey, David R

    2016-05-01

    MicroRNAs (miRNAs) are small noncoding transcripts that regulate gene expression. Aberrant expression of miRNAs can affect development of cancer and other diseases. Synthetic miRNA mimics can modulate gene expression and offer an approach to therapy. Inside cells, mature miRNAs are produced as double-stranded RNAs and miRNA mimics typically retain both strands. This need for two strands has the potential to complicate drug development. Recently, synthetic chemically modified single-stranded silencing RNAs (ss-siRNA) have been shown to function through the RNAi pathway to induce gene silencing in cell culture and animals. Here, we test the hypothesis that single-stranded miRNA (ss-miRNA) can also mimic the function of miRNAs. We show that ss-miRNAs can act as miRNA mimics to silence the expression of target genes. Gene silencing requires expression of argonaute 2 (AGO2) protein and involves recruitment of AGO2 to the target transcripts. Chemically modified ss-miRNAs function effectively inside cells through endogenous RNAi pathways and broaden the options for miRNA-based oligonucleotide drug development.

  12. Efficient Gene Knockdown in Mouse Oocytes through Peptide Nanoparticle-Mediated SiRNA Transfection

    PubMed Central

    Jin, Zhen; Li, Ruichao; Zhou, Chunxiang; Shi, Liya; Zhang, Xiaolan; Yang, Zhixia; Zhang, Dong

    2016-01-01

    The use of mouse oocytes as a model for studying female meiosis is very important in reproductive medicine. Gene knockdown by specific small interfering RNA (siRNA) is usually the first step in the study of the function of a target gene in mouse oocytes during in vitro maturation. Traditionally, the only way to introduce siRNA into mouse oocytes is through microinjection, which is certainly less efficient and strenuous than siRNA transfection in somatic cells. Recently, in research using somatic cells, peptide nanoparticle-mediated siRNA transfection has been gaining popularity over liposome nanoparticle-mediated methods because of its high efficiency, low toxicity, good stability, and strong serum compatibility. However, no researchers have yet tried transfecting siRNA into mouse oocytes because of the existence of the protective zona pellucida surrounding the oocyte membrane (vitelline membrane). We therefore tested whether peptide nanoparticles can introduce siRNA into mouse oocytes. In the present study, we showed for the first time that our optimized program can efficiently knock down a target gene with high specificity. Furthermore, we achieved the expected meiotic phenotypes after we knocked down a test unknown target gene TRIM75. We propose that peptide nanoparticles may be superior for preliminary functional studies of unknown genes in mouse oocytes. PMID:26974323

  13. Gene Profiling of Bone around Orthodontic Mini-Implants by RNA-Sequencing Analysis

    PubMed Central

    Nahm, Kyung-Yen; Heo, Jung Sun; Lee, Jae-Hyung; Lee, Dong-Yeol; Chung, Kyu-Rhim; Ahn, Hyo-Won; Kim, Seong-Hun

    2015-01-01

    This study aimed to evaluate the genes that were expressed in the healing bones around SLA-treated titanium orthodontic mini-implants in a beagle at early (1-week) and late (4-week) stages with RNA-sequencing (RNA-Seq). Samples from sites of surgical defects were used as controls. Total RNA was extracted from the tissue around the implants, and an RNA-Seq analysis was performed with Illumina TruSeq. In the 1-week group, genes in the gene ontology (GO) categories of cell growth and the extracellular matrix (ECM) were upregulated, while genes in the categories of the oxidation-reduction process, intermediate filaments, and structural molecule activity were downregulated. In the 4-week group, the genes upregulated included ECM binding, stem cell fate specification, and intramembranous ossification, while genes in the oxidation-reduction process category were downregulated. GO analysis revealed an upregulation of genes that were related to significant mechanisms, including those with roles in cell proliferation, the ECM, growth factors, and osteogenic-related pathways, which are associated with bone formation. From these results, implant-induced bone formation progressed considerably during the times examined in this study. The upregulation or downregulation of selected genes was confirmed with real-time reverse transcription polymerase chain reaction. The RNA-Seq strategy was useful for defining the biological responses to orthodontic mini-implants and identifying the specific genetic networks for targeted evaluations of successful peri-implant bone remodeling. PMID:25759820

  14. Mutational analysis of the mitochondrial 12S rRNA and tRNA{sup Ser(UCN)} genes in Tunisian patients with nonsyndromic hearing loss

    SciTech Connect

    Mkaouar-Rebai, Emna . E-mail: emna_mkaouar@mail2world.com; Tlili, Abdelaziz; Masmoudi, Saber; Louhichi, Nacim; Charfeddine, Ilhem; Amor, Mohamed Ben; Lahmar, Imed; Driss, Nabil; Drira, Mohamed; Ayadi, Hammadi; Fakhfakh, Faiza

    2006-02-24

    We explored the mitochondrial 12S rRNA and the tRNA{sup Ser(UCN)} genes in 100 Tunisian families affected with NSHL and in 100 control individuals. We identified the mitochondrial A1555G mutation in one out of these 100 families and not in the 100 control individuals. Members of this family harbouring the A1555G mutation showed phenotypic heterogeneity which could be explained by an eventual nuclear-mitochondrial interaction. So, we have screened three nuclear genes: GJB2, GJB3, and GJB6 but we have not found correlation between the phenotypic heterogeneity and variants detected in these genes. We explored also the entire mitochondrial 12S rRNA and the tRNA{sup Ser(UCN)} genes. We detected five novel polymorphisms: T742C, T794A, A813G, C868T, and C954T, and 12 known polymorphisms in the mitochondrial 12S rRNA gene. None of the 100 families or the 100 controls were found to carry mutations in the tRNA{sup Ser(UCN)} gene. We report here First mutational screening of the mitochondrial 12S rRNA and the tRNA{sup Ser(UCN)} genes in the Tunisian population which describes the second family harbouring the A1555G mutation in Africa and reveals novel polymorphisms in the mitochondrial 12S rRNA gene.

  15. Long noncoding RNA #32 contributes to antiviral responses by controlling interferon-stimulated gene expression.

    PubMed

    Nishitsuji, Hironori; Ujino, Saneyuki; Yoshio, Sachiyo; Sugiyama, Masaya; Mizokami, Masashi; Kanto, Tatsuya; Shimotohno, Kunitada

    2016-09-13

    Despite the breadth of knowledge that exists regarding the function of long noncoding RNAs (lncRNAs) in biological phenomena, the role of lncRNAs in host antiviral responses is poorly understood. Here, we report that lncRNA#32 is associated with type I IFN signaling. The silencing of lncRNA#32 dramatically reduced the level of IFN-stimulated gene (ISG) expression, resulting in sensitivity to encephalomyocarditis virus (EMCV) infection. In contrast, the ectopic expression of lncRNA#32 significantly suppressed EMCV replication, suggesting that lncRNA#32 positively regulates the host antiviral response. We further demonstrated the suppressive function of lncRNA#32 in hepatitis B virus and hepatitis C virus infection. lncRNA#32 bound to activating transcription factor 2 (ATF2) and regulated ISG expression. Our results reveal a role for lncRNA#32 in host antiviral responses. PMID:27582466

  16. Delivery of cationic polymer-siRNA nanoparticles for gene therapies in neural regeneration

    SciTech Connect

    Liang, Yanran; Liu, Zhonglin; Shuai, Xintao; Wang, Weiwei; Liu, Jun; Bi, Wei; Wang, Chuanming; Jing, Xiuna; Liu, Yunyun; Tao, Enxiang

    2012-05-18

    Highlights: Black-Right-Pointing-Pointer Nogo receptor can inhibit growth of injured axons, thus affecting neural regeneration. Black-Right-Pointing-Pointer The delivery of siRNA is crucial to inhibit NgR expression in NSCs. Black-Right-Pointing-Pointer Non-viral vector PEG-PEI condensed siRNA targeting NgR into nanoscale particles. Black-Right-Pointing-Pointer PEG-PEI/siRNA at N/P = 15 displayed high transfection efficiency and low cytotoxicity. Black-Right-Pointing-Pointer PEG-PEI has great potential in carrying siRNA to diminish the gene expression in NSCs. -- Abstract: The therapeutic applications of neural stem cells (NSCs) have potential to promote recovery in many obstinate diseases in central nervous system. Regulation of certain gene expressions using siRNA may have significant influence on the fate of NSC. To achieve the optimum gene silencing effect of siRNA, non-viral vector polyethylene glycol-polyethyleneimine (PEG-PEI) was investigated in the delivery of siRNA to NSCs. The characteristics of PEG-PEI/siRNA polyplexes were detected by scanning electron microscopy (SEM). The effects of nanoparticles on cell viability were measured via CCK-8 assay. In addition, the transfection efficiency was evaluated by fluorescence microscope and flow cytometry, and real-time PCR and Western Blot were employed to detect the gene inhibition effect of siRNA delivered by PEG-PEI. The SEM micrographs showed that PEG-PEI could condense siRNA to form diffuse and spherical nanoparticles. The cytotoxicity of PEG-PEI/siRNA nanocomplexes (N/P = 15) was significantly lower when compared with that of Lipofectamine 2000/siRNA (P < 0.05). Moreover, the highest transfection efficiency of PEG-PEI/siRNA nanoparticles was obtained at an N/P ratio of 15, which was better than that achieved in the transfection using Lipofectamine 2000 (P < 0.05). Finally, the gene knockdown effect of PEG-PEI/siRNA nanoparticles was verified at the levels of mRNA and protein. These results suggest that

  17. Evaluation of tRNA Gene PCR for Identification of Mollicutes

    PubMed Central

    Stakenborg, Tim; Vicca, Jo; Verhelst, Rita; Butaye, Patrick; Maes, Dominiek; Naessens, Anne; Claeys, Geert; De Ganck, Catharine; Haesebrouck, Freddy; Vaneechoutte, Mario

    2005-01-01

    We evaluated the applicability of tRNA gene PCR in combination with fluorescent capillary electrophoresis with an ABI310 genetic analyzer (Applied Biosystems, Calif.) for the identification of different mollicute species. A total of 103 strains and DNA extracts of 30 different species belonging to the genera Acholeplasma, Mycoplasma, and Ureaplasma were studied. Reproducible peak profiles were generated for all samples, except for one M. genitalium isolate, the three M. gallisepticum isolates, and 8 of the 24 Ureaplasma cultures, where no amplification could be obtained. Clustering revealed numerous discrepancies compared to the identifications that had been previously obtained by means of biochemical and serological tests. Final identification was obtained by 16S rRNA gene amplification followed by sequence analysis and/or restriction digestion. This confirmed the identification obtained by tRNA gene PCR in all cases. Seven samples yielded an unexpected tRNA gene PCR profile. Sequence analysis of the 16S rRNA genes showed that six of these samples were mixed and that one had a unique sequence that did not match any of the published sequences, pointing to the existence of a not-yet-described species. In conclusion, we found tRNA gene PCR to be a rapid and discriminatory method to correctly identify a large collection of different species of the class of Mollicutes and to recognize not-yet-described groups. PMID:16145107

  18. A possible mechanism for the inhibition of ribosomal RNA gene transcription during mitosis.

    PubMed

    Weisenberger, D; Scheer, U

    1995-05-01

    When cells enter mitosis, RNA synthesis ceases. Yet the RNA polymerase I (pol I) transcription machinery involved in the production of pre-rRNA remains bound to the nucleolus organizing region (NOR), the chromosome site harboring the tandemly repeated rRNA genes. Here we examine whether rDNA transcription units are transiently blocked or "frozen" during mitosis. By using fluorescent in situ hybridization we were unable to detect nascent pre-rRNA chains on the NORs of mouse 3T3 and rat kangaroo PtK2 cells. Appropriate controls showed that our approach was sensitive enough to visualize, at the light microscopic level, individual transcriptionally active rRNA genes both in situ after experimental unfolding of nucleoli and in chromatin spreads ("Miller spreads"). Analysis of the cell cycle-dependent redistribution of transcript-associated components also revealed that most transcripts are released from the rDNA at mitosis. Upon disintegration of the nucleolus during mitosis, U3 small nucleolar RNA (snoRNA) and the nucleolar proteins fibrillarin and nucleolin became dispersed throughout the cytoplasm and were excluded from the NORs. Together, our data rule out the presence of "frozen Christmas-trees" at the mitotic NORs but are compatible with the view that inactive pol I remains on the rDNA. We propose that expression of the rRNA genes is regulated during mitosis at the level of transcription elongation, similarly to what is known for a number of genes transcribed by pol II. Such a mechanism may explain the decondensed state of the NOR chromatin and the immediate transcriptional reactivation of the rRNA genes following mitosis.

  19. Circularly permuted tRNA genes: their expression and implications for their physiological relevance and development

    PubMed Central

    Soma, Akiko

    2014-01-01

    A number of genome analyses and searches using programs that focus on the RNA-specific bulge-helix-bulge (BHB) motif have uncovered a wide variety of disrupted tRNA genes. The results of these analyses have shown that genetic information encoding functional RNAs is described in the genome cryptically and is retrieved using various strategies. One such strategy is represented by circularly permuted tRNA genes, in which the sequences encoding the 5′-half and 3′-half of the specific tRNA are separated and inverted on the genome. Biochemical analyses have defined a processing pathway in which the termini of tRNA precursors (pre-tRNAs) are ligated to form a characteristic circular RNA intermediate, which is then cleaved at the acceptor-stem to generate the typical cloverleaf structure with functional termini. The sequences adjacent to the processing site located between the 3′-half and the 5′-half of pre-tRNAs potentially form a BHB motif, which is the dominant recognition site for the tRNA-intron splicing endonuclease, suggesting that circularization of pre-tRNAs depends on the splicing machinery. Some permuted tRNAs contain a BHB-mediated intron in their 5′- or 3′-half, meaning that removal of an intron, as well as swapping of the 5′- and 3′-halves, are required during maturation of their pre-tRNAs. To date, 34 permuted tRNA genes have been identified from six species of unicellular algae and one archaeon. Although their physiological significance and mechanism of development remain unclear, the splicing system of BHB motifs seems to have played a key role in the formation of permuted tRNA genes. In this review, current knowledge of circularly permuted tRNA genes is presented and some unanswered questions regarding these species are discussed. PMID:24744771

  20. Involvement of an intracellular vesicular transport process in naked-sgRNA-mediated TRUE gene silencing.

    PubMed

    Tamura, Masato; Kawano, Mitsuoki; Sato, Mari; Nashimoto, Masayuki

    2015-10-01

    tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing) is an RNA-mediated gene expression control technology with therapeutic potential. Recently, our group demonstrated that a heptamer, mh1 (Bcl‑2), targeting human Bcl-2 mRNA, can be taken up by cells without the use of any transfection reagents and can induce the apoptosis of leukemia cells. However, little is known regarding the mechanism of naked small guide (sg)RNA uptake by cultured cells. Therefore, in the present study the effects of various inhibitors on the induction of apoptosis by naked sgRNA treatment were investigated in order to identify the uptake pathway required for sgRNA function in cultured cells. Addition of the endocytosis inhibitors chlorpromazine, nystatin or methyl‑β‑cyclodextrin together with naked effective sgRNA was unable to diminish the apoptosis‑inducing effects of naked sgRNA or the reduction in target mRNA, suggesting that functional uptake of sgRNA by cells is clathrin‑, caveolae‑ and raft‑independent. Next, chloroquine, an inhibitor of lysosome acidification, and brefeldin A, an inhibitor that blocks protein transport from the Golgi apparatus to the endoplasmic reticulum were administered. In the presence of these compounds, the apoptosis‑inducing effects of naked sgRNA were reduced. These results suggest that a vesicular transport process is involved in sgRNA‑mediated TRUE gene silencing. A greater understanding of how naked sgRNAs enter cells and how they reach their target RNAs may aid in the design of more specifically‑targeted and potent sgRNA drugs.

  1. NONCODEv4: exploring the world of long non-coding RNA genes

    PubMed Central

    Xie, Chaoyong; Yuan, Jiao; Li, Hui; Li, Ming; Zhao, Guoguang; Bu, Dechao; Zhu, Weimin; Wu, Wei; Chen, Runsheng; Zhao, Yi

    2014-01-01

    NONCODE (http://www.bioinfo.org/noncode/) is an integrated knowledge database dedicated to non-coding RNAs (excluding tRNAs and rRNAs). Non-coding RNAs (ncRNAs) have been implied in diseases and identified to play important roles in various biological processes. Since NONCODE version 3.0 was released 2 years ago, discovery of novel ncRNAs has been promoted by high-throughput RNA sequencing (RNA-Seq). In this update of NONCODE, we expand the ncRNA data set by collection of newly identified ncRNAs from literature published in the last 2 years and integration of the latest version of RefSeq and Ensembl. Particularly, the number of long non-coding RNA (lncRNA) has increased sharply from 73 327 to 210 831. Owing to similar alternative splicing pattern to mRNAs, the concept of lncRNA genes was put forward to help systematic understanding of lncRNAs. The 56 018 and 46 475 lncRNA genes were generated from 95 135 and 67 628 lncRNAs for human and mouse, respectively. Additionally, we present expression profile of lncRNA genes by graphs based on public RNA-seq data for human and mouse, as well as predict functions of these lncRNA genes. The improvements brought to the database also include an incorporation of an ID conversion tool from RefSeq or Ensembl ID to NONCODE ID and a service of lncRNA identification. NONCODE is also accessible through http://www.noncode.org/. PMID:24285305

  2. MicroRNA-373 induces expression of genes with complementary promoter sequences.

    PubMed

    Place, Robert F; Li, Long-Cheng; Pookot, Deepa; Noonan, Emily J; Dahiya, Rajvir

    2008-02-01

    Recent studies have shown that microRNA (miRNA) regulates gene expression by repressing translation or directing sequence-specific degradation of complementary mRNA. Here, we report new evidence in which miRNA may also function to induce gene expression. By scanning gene promoters in silico for sequences complementary to known miRNAs, we identified a putative miR-373 target site in the promoter of E-cadherin. Transfection of miR-373 and its precursor hairpin RNA (pre-miR-373) into PC-3 cells readily induced E-cadherin expression. Knockdown experiments confirmed that induction of E-cadherin by pre-miR-373 required the miRNA maturation protein Dicer. Further analysis revealed that cold-shock domain-containing protein C2 (CSDC2), which possesses a putative miR-373 target site within its promoter, was also readily induced in response to miR-373 and pre-miR-373. Furthermore, enrichment of RNA polymerase II was detected at both E-cadherin and CSDC2 promoters after miR-373 transfection. Mismatch mutations to miR-373 indicated that gene induction was specific to the miR-373 sequence. Transfection of promoter-specific dsRNAs revealed that the concurrent induction of E-cadherin and CSDC2 by miR-373 required the miRNA target sites in both promoters. In conclusion, we have identified a miRNA that targets promoter sequences and induces gene expression. These findings reveal a new mode by which miRNAs may regulate gene expression.

  3. De novo computational prediction of non-coding RNA genes in prokaryotic genomes

    PubMed Central

    Tran, Thao T.; Zhou, Fengfeng; Marshburn, Sarah; Stead, Mark; Kushner, Sidney R.; Xu, Ying

    2009-01-01

    Motivation: The computational identification of non-coding RNA (ncRNA) genes represents one of the most important and challenging problems in computational biology. Existing methods for ncRNA gene prediction rely mostly on homology information, thus limiting their applications to ncRNA genes with known homologues. Results: We present a novel de novo prediction algorithm for ncRNA genes using features derived from the sequences and structures of known ncRNA genes in comparison to decoys. Using these features, we have trained a neural network-based classifier and have applied it to Escherichia coli and Sulfolobus solfataricus for genome-wide prediction of ncRNAs. Our method has an average prediction sensitivity and specificity of 68% and 70%, respectively, for identifying windows with potential for ncRNA genes in E.coli. By combining windows of different sizes and using positional filtering strategies, we predicted 601 candidate ncRNAs and recovered 41% of known ncRNAs in E.coli. We experimentally investigated six novel candidates using Northern blot analysis and found expression of three candidates: one represents a potential new ncRNA, one is associated with stable mRNA decay intermediates and one is a case of either a potential riboswitch or transcription attenuator involved in the regulation of cell division. In general, our approach enables the identification of both cis- and trans-acting ncRNAs in partially or completely sequenced microbial genomes without requiring homology or structural conservation. Availability: The source code and results are available at http://csbl.bmb.uga.edu/publications/materials/tran/. Contact: xyn@bmb.uga.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:19744996

  4. Identification of recurrence-related genes by integrating microRNA and gene expression profiling of gastric cancer.

    PubMed

    Yan, Zhi; Xiong, Yimin; Xu, Weitian; Li, Min; Cheng, Yi; Chen, Fang; Ding, Shifang; Xu, Hualin; Zheng, Guorong

    2012-12-01

    We previously analyzed the microRNA (miRNA) expression pattern in gastric cancer with and without recurrence and obtained 17 differentially expressed miRNAs with potential to predict recurrence risk for GC patients. In the present study, we aimed to investigate recurrence-related genes which may be regulated by the differentially expressed miRNAs identified in our prior research. Three different miRNA target gene databases (miRanda, TargetScan and PicTar) were used for searching the potential genes regulated by miRNAs. A combination was performed between miRNA target genes and recurrence-related gene expression profiling. Three bioinformatics algorithms (PAM, SVM and RF) were used to feature recurrence-related gene selection. In addition, we validated the expression levels of the genes in GC patients using real-time PCR. A total of 3,263 genes were identified as potential targets of 17 miRNAs. We identified 2,736 differential expressed genes using the SAM method based on 22K oligo microarray data which included 7 recurrence and 4 without recurrence GC samples. Combining the target genes regulated by miRNAs and the differentially expressed genes between recurrence and non-recurrence groups, we identified 228 differential genes for further study. Finally, we identified HNRPA0 and PRDM4 as risk biomarkers of GC patients, which were regulated by hsa-miR‑194 and hsa-miR-373, respectively. Our data indicated that HNRPA0 and PRDM4 may be involved in the recurrence process of GC and have potential to act as new prognostic biomarkers in predicting recurrence risk for gastric cancer patients.

  5. Structure Tuning of Cationic Oligospermine-siRNA Conjugates for Carrier-Free Gene Silencing.

    PubMed

    Nothisen, Marc; Bagilet, Jérémy; Behr, Jean-Paul; Remy, Jean-Serge; Kotera, Mitsuharu

    2016-08-01

    Oligospermine-siRNA conjugates are able to induce efficient luciferase gene silencing upon carrier-free transfection. These conjugates are readily accessible by a versatile automated chemistry that we developed using a DMT-spermine phosphoramidite reagent. In this article, we used this chemistry to study a wide range of structural modifications of the oligospermine-siRNA conjugates, i.e., variation of conjugate positions and introduction of chemical modifications to increase nuclease resistance. At first we examined gene silencing activity of a series of siRNA-tris(spermine) conjugates with and without chemical modifications in standard carrier assisted conditions. The three spermine units attached at one of the two ends of the sense strand or at the 3'-end of the antisense strand are compatible with gene silencing activity whereas attachment of spermine units at the 5'-end of the antisense strand abolished the activity. 2'-O-Methylated nucleotides introduced in the sense strand are compatible while not in the antisense strand. Thiophosphate links could be used without activity loss at the 3'-end of both strands and at the 5'-end of the sense strand to conjugate oligospermine. Consequently a series of oligospermine-siRNA conjugates containing 15 to 45 spermines units in various configurations were chosen, prepared, and examined in carrier-free conditions. Attachment of 30 spermine units singly at the 5'-end of the sense strand provides the most potent carrier-free siRNA. Longevity of luciferase gene silencing was studied using oligospermine-siRNA conjugates. Five day long efficiency with more than 80% gene expression knockdown was observed upon transfection without vector. Oligospermine-siRNA conjugates targeting cell-constitutive natural lamin A/C gene were prepared. Efficient gene silencing was observed upon carrier-free transfection of siRNA conjugates containing 20 or 30 spermine residues grafted at the 5'-end of the sense strand. PMID:27398779

  6. Gene Rearrangement Attenuates Expression and Lethality of a Nonsegmented Negative Strand RNA Virus

    NASA Astrophysics Data System (ADS)

    Williams Wertz, Gail; Perepelitsa, Victoria P.; Ball, L. Andrew

    1998-03-01

    The nonsegmented negative strand RNA viruses comprise hundreds of human, animal, insect, and plant pathogens. Gene expression of these viruses is controlled by the highly conserved order of genes relative to the single transcriptional promoter. We utilized this regulatory mechanism to alter gene expression levels of vesicular stomatitis virus by rearranging the gene order. This report documents that gene expression levels and the viral phenotype can be manipulated in a predictable manner. Translocation of the promoter-proximal nucleocapsid protein gene N, whose product is required stoichiometrically for genome replication, to successive positions down the genome reduced N mRNA and protein expression in a stepwise manner. The reduction in N gene expression resulted in a stepwise decrease in genomic RNA replication. Translocation of the N gene also attenuated the viruses to increasing extents for replication in cultured cells and for lethality in mice, without compromising their ability to elicit protective immunity. Because monopartite negative strand RNA viruses have not been reported to undergo homologous recombination, gene rearrangement should be irreversible and may provide a rational strategy for developing stably attenuated live vaccines against this type of virus.

  7. Mutation of genes controlling mRNA metabolism and protein synthesis predisposes to neurodevelopmental disorders.

    PubMed

    Sartor, Francesca; Anderson, Jihan; McCaig, Colin; Miedzybrodzka, Zosia; Müller, Berndt

    2015-12-01

    Brain development is a tightly controlled process that depends upon differentiation and function of neurons to allow for the formation of functional neural networks. Mutation of genes encoding structural proteins is well recognized as causal for neurodevelopmental disorders (NDDs). Recent studies have shown that aberrant gene expression can also lead to disorders of neural development. Here we summarize recent evidence implicating in the aetiology of NDDs mutation of factors acting at the level of mRNA splicing, mRNA nuclear export, translation and mRNA degradation. This highlights the importance of these fundamental processes for human health and affords new strategies and targets for therapeutic intervention.

  8. Sequence of the PV2 gene of rice hoja blanca tenuivirus RNA-2.

    PubMed

    De Miranda, J R; Hull, R; Espinoza, A M

    1995-01-01

    Comparison of a partial sequence of rice hoja blanca tenuivirus RNA-2 with 40% similarity to rice stripe tenuivirus RNA-2 revealed regions of high local sequence homology at the 5' terminus, within the coding region (the pv2 gene), and in the intergenic region separating this gene from the other protein (pc2) encoded by this ambisense RNA. Analysis of the conserved regions of the pv2 protein identified two motifs found principally in viral membrane glycoproteins and six motifs found each in a wide variety of proteins. The possible significance of these results is discussed. PMID:8560781

  9. Sequences more than 500 base pairs upstream of the human U3 small nuclear RNA gene stimulate the synthesis of U3 RNA in frog oocytes

    SciTech Connect

    Suh, D.; Reddy, R. ); Wright, D. )

    1991-06-04

    Small nuclear RNA (snRNA) genes contain strong promoters capable of initiating transcription once every 4 s. Studies on the human U1 snRNA gene, carried out in other laboratories, showed that sequences within 400 bp of the 5' flanking region are sufficient for maximal levels of transcription both in vivo and in frog oocytes (reviewed in Dahlberg and Lund (1988)). The authors studied the expression of a human U3 snRNA gene by injecting 5' deletion mutants into frog oocytes. The results show that sequences more than 500 bp upstream of the U3 snRNA gene have a 2-3-fold stimulatory effect on the U3 snRNA synthesis. These results indicate that the human U3 snRNA gene is different from human U1 snRNA gene in containing regulatory elements more than 500 bp upstream. The U3 snRNA gene upstream sequences contain an AluI homologous sequence in the {minus}1,200 region; these AluI sequences were transcribed in vitro and in frog oocytes but were not detectable in Hela cells.

  10. Delta sequences in the 5' non-coding region of yeast tRNA genes

    PubMed Central

    Gafner, Jürg; Robertis, Eddy M.De; Philippsen, Peter

    1983-01-01

    Two so far undetected tRNA genes were found close to delta (δ) sequences at the sup4 locus on chromosome X in the genome of Saccharomyces cerevisiae. The two genes were identified from their abundant transcription products in frog oocytes. Hybridisation experiments allowed the mapping of the transcripts in cloned DNA and DNA sequence analysis revealed the presence of one AGGtRNAArg and one GACtRNAAsp gene. tRNAAsp genes with sequences similar or identical to GACtRNAAsp exist in 14-16 copies per haploid yeast genome, whereas only one copy was detected for AGGtRNAArg. In vivo labelling of total yeast tRNA with 32P followed by hybridisation revealed that the unique AGGtRNAArg gene is transcribed in S. cerevisiae. δ sequences are present 120 bp upstream from the first coding nucleotide in the case of AGGtRNAArg, 80 bp in the case of GACtRNAAsp and 405 bp in the case of the known UACtRNATyr (sup4) gene. δ sequences, as part of Ty elements or alone, were also found by other investigators at similar distances upstream of the mRNA start in mutant alleles of protein-coding yeast genes. Although protein-coding genes are transcribed by RNA polymerase II and tRNA genes by RNA polymerase III, the 5' non-coding region of both types of genes could conceivably have a peculiar DNA or chromatin structure used as preferred landing sites by transposable elements. ImagesFig. 1.Fig. 2.Fig. 5.Fig. 6. PMID:16453444

  11. An Lnc RNA (GAS5)/SnoRNA-derived piRNA induces activation of TRAIL gene by site-specifically recruiting MLL/COMPASS-like complexes

    PubMed Central

    He, Xin; Chen, Xinxin; Zhang, Xue; Duan, Xiaobing; Pan, Ting; Hu, Qifei; Zhang, Yijun; Zhong, Fudi; Liu, Jun; Zhang, Hong; Luo, Juan; Wu, Kang; Peng, Gao; Luo, Haihua; Zhang, Lehong; Li, Xiaoxi; Zhang, Hui

    2015-01-01

    PIWI-interacting RNA (piRNA) silences the transposons in germlines or induces epigenetic modifications in the invertebrates. However, its function in the mammalian somatic cells remains unknown. Here we demonstrate that a piRNA derived from Growth Arrest Specific 5, a tumor-suppressive long non-coding RNA, potently upregulates the transcription of tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL), a proapoptotic protein, by inducing H3K4 methylation/H3K27 demethylation. Interestingly, the PIWIL1/4 proteins, which bind with this piRNA, directly interact with WDR5, resulting in a site-specific recruitment of the hCOMPASS-like complexes containing at least MLL3 and UTX (KDM6A). We have indicated a novel pathway for piRNAs to specially activate gene expression. Given that MLL3 or UTX are frequently mutated in various tumors, the piRNA/MLL3/UTX complex mediates the induction of TRAIL, and consequently leads to the inhibition of tumor growth. PMID:25779046

  12. Eukaryotic mRNA decay: methodologies, pathways, and links to other stages of gene expression.

    PubMed

    Pérez-Ortín, José E; Alepuz, Paula; Chávez, Sebastián; Choder, Mordechai

    2013-10-23

    mRNA concentration depends on the balance between transcription and degradation rates. On both sides of the equilibrium, synthesis and degradation show, however, interesting differences that have conditioned the evolution of gene regulatory mechanisms. Here, we discuss recent genome-wide methods for determining mRNA half-lives in eukaryotes. We also review pre- and posttranscriptional regulons that coordinate the fate of functionally related mRNAs by using protein- or RNA-based trans factors. Some of these factors can regulate both transcription and decay rates, thereby maintaining proper mRNA homeostasis during eukaryotic cell life.

  13. In Vitro Gene Silencing of the Fish Microsporidian Heterosporis saurida by RNA Interference

    PubMed Central

    Kumar, Gokhlesh; Abdel-Baki, Abdel-Azeem; Dkhil, Mohamed A.; El-Matbouli, Mansour; Al-Quraishy, Saleh

    2016-01-01

    Heterosporis saurida, a microsporidian parasite of lizardfish, Saurida undosquamis, causes severe economic losses in marine aquaculture. Among the novel approaches being explored for treatment of parasitic infections in aquaculture is small interfering RNA molecules. The aim of the present study was to investigate the efficiency of using siRNA to knock down expression of specific genes of H. saurida in vitro. For this purpose, siRNAs specific for ATP/ADP antiporter 1 and methionine aminopeptidase II genes were designed and tested using a previously developed in vitro cultivation model. Silencing of H. saurida target genes was assessed and the efficacy of using siRNA for inhibition of gene expression was measured by quantitative real-time polymerase chain reaction (PCR). Silencing of ATP/ADP antiporter 1 or methionine aminopeptidase II by siRNA reduced H. saurida infection levels in EK-1 cells 40% and 60%, respectively, as measured by qRT-PCR and spore counts. Combined siRNA treatment of both ATP/ADP antiporter 1 and methionine aminopeptidase II siRNAs was more effective against H. saurida infection as seen by the 16S rRNA level and spore counts. Our study concluded that siRNA could be used to advance development of novel approaches to inhibit H. saurida and provide an alternative approach to combat microsporidia. PMID:27228357

  14. Depletion of REF/Aly alters gene expression and reduces RNA polymerase II occupancy

    PubMed Central

    Stubbs, Sarah H.; Conrad, Nicholas K.

    2015-01-01

    Pre-mRNA processing is mechanistically linked to transcription with RNA pol II serving as a platform to recruit RNA processing factors to nascent transcripts. The TREX complex member, REF/Aly, has been suggested to play roles in transcription and nuclear RNA stability in addition to its more broadly characterized role in mRNA export. We employed RNA-seq to identify a subset of transcripts with decreased expression in both nuclear and cytoplasmic fractions upon REF/Aly knockdown, which implies that REF/Aly affects their expression upstream of its role in mRNA export. Transcription inhibition experiments and metabolic labeling assays argue that REF/Aly does not affect stability of selected candidate transcripts. Instead, ChIP assays and nuclear run-on analysis reveal that REF/Aly depletion diminishes the transcription of these candidate genes. Furthermore, we determined that REF/Aly binds directly to candidate transcripts, supporting a direct effect of REF/Aly on candidate gene transcription. Taken together, our data suggest that the importance of REF/Aly is not limited to RNA export, but that REF/Aly is also critical for gene expression at the level of transcription. Our data are consistent with the model that REF/Aly is involved in linking splicing with transcription efficiency. PMID:25477387

  15. Depletion of REF/Aly alters gene expression and reduces RNA polymerase II occupancy.

    PubMed

    Stubbs, Sarah H; Conrad, Nicholas K

    2015-01-01

    Pre-mRNA processing is mechanistically linked to transcription with RNA pol II serving as a platform to recruit RNA processing factors to nascent transcripts. The TREX complex member, REF/Aly, has been suggested to play roles in transcription and nuclear RNA stability in addition to its more broadly characterized role in mRNA export. We employed RNA-seq to identify a subset of transcripts with decreased expression in both nuclear and cytoplasmic fractions upon REF/Aly knockdown, which implies that REF/Aly affects their expression upstream of its role in mRNA export. Transcription inhibition experiments and metabolic labeling assays argue that REF/Aly does not affect stability of selected candidate transcripts. Instead, ChIP assays and nuclear run-on analysis reveal that REF/Aly depletion diminishes the transcription of these candidate genes. Furthermore, we determined that REF/Aly binds directly to candidate transcripts, supporting a direct effect of REF/Aly on candidate gene transcription. Taken together, our data suggest that the importance of REF/Aly is not limited to RNA export, but that REF/Aly is also critical for gene expression at the level of transcription. Our data are consistent with the model that REF/Aly is involved in linking splicing with transcription efficiency.

  16. A new gene in E. coli RNA synthesis.

    PubMed

    Liebke, H H; Speyer, J F

    1983-01-01

    A novel spontaneous temperature sensitive mutant of Escherichia coli, which stops synthesizing stable RNA and some proteins immediately upon temperature shift from 30 degrees C to 42 degrees C, is described. Stable RNA species are not preferentially degraded in the mutant at the nonpermissive temperature. The guanine polyphosphate compounds, ppGpp (MS1) and pppGpp (MS2), are not produced at 42 degrees C. The mutant strain does not grow at 42 degrees C in either broth or defined minimal medium supplemented with any of a variety of carbon sources. The temperature sensitive mutation in this strain maps between dap A, E and pts I and defines a new locus affecting RNA synthesis in E. coli.

  17. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage.

  18. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  19. Identification and annotation of small RNA genes using ShortStack

    PubMed Central

    Shahid, Saima; Axtell, Michael J.

    2013-01-01

    Highly parallel sequencing of cDNA derived from endogenous small RNAs (small RNA-seq) is a key method that has accelerated understanding of regulatory small RNAs in eukaryotes. Eukaryotic regulatory small RNAs, which include microRNAs (miRNAs), short interfering RNAs (siRNAs), and Piwi-associated RNAs (piRNAs), typically derive from the processing of longer precursor RNAs. Alignment of small RNA-seq data to a reference genome allows the inference of the longer precursor and thus the annotation of small RNA producing genes. ShortStack is a program that was developed to comprehensively analyze reference-aligned small RNA-seq data, and output detailed and useful annotations of the causal small RNA-producing genes. Here, we provide a step- by-step tutorial of ShortStack usage with the goal of introducing new users to the software and pointing out some common pitfalls. PMID:24139974

  20. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  1. RNA Polymerase Backtracking in Gene Regulation and Genome Instability

    PubMed Central

    Nudler, Evgeny

    2013-01-01

    RNA polymerase is a ratchet machine that oscillates between productive and backtracked states at numerous DNA positions. The amount of backtracking (reversible sliding of the enzyme along DNA and RNA) varies from one to many nucleotides. Since its first description 15 years ago, backtracking has been implicated in a plethora of critical processes in bacteria and eukaryotic cells. Here we review the most fundamental roles of this phenomenon in controlling transcription elongation, pausing, termination, fidelity, and genome instability. We also discuss recent progress in understanding the structural and mechanistic properties of the backtracking process. PMID:22726433

  2. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools.

    PubMed

    Quast, Christian; Pruesse, Elmar; Yilmaz, Pelin; Gerken, Jan; Schweer, Timmy; Yarza, Pablo; Peplies, Jörg; Glöckner, Frank Oliver

    2013-01-01

    SILVA (from Latin silva, forest, http://www.arb-silva.de) is a comprehensive web resource for up to date, quality-controlled databases of aligned ribosomal RNA (rRNA) gene sequences from the Bacteria, Archaea and Eukaryota domains and supplementary online services. The referred database release 111 (July 2012) contains 3 194 778 small subunit and 288 717 large subunit rRNA gene sequences. Since the initial description of the project, substantial new features have been introduced, including advanced quality control procedures, an improved rRNA gene aligner, online tools for probe and primer evaluation and optimized browsing, searching and downloading on the website. Furthermore, the extensively curated SILVA taxonomy and the new non-redundant SILVA datasets provide an ideal reference for high-throughput classification of data from next-generation sequencing approaches.

  3. Gene dosage and stochastic effects determine the severity and direction of uniparental ribosomal RNA gene silencing (nucleolar dominance) in Arabidopsis allopolyploids.

    PubMed

    Chen, Z J; Comai, L; Pikaard, C S

    1998-12-01

    Nucleolar dominance is an epigenetic phenomenon in which one parental set of ribosomal RNA (rRNA) genes is silenced in an interspecific hybrid. In natural Arabidopsis suecica, an allotetraploid (amphidiploid) hybrid of Arabidopsis thaliana and Cardaminopsis arenosa, the A. thaliana rRNA genes are repressed. Interestingly, A. thaliana rRNA gene silencing is variable in synthetic Arabidopsis suecica F1 hybrids. Two generations are needed for A. thaliana rRNA genes to be silenced in all lines, revealing a species-biased direction but stochastic onset to nucleolar dominance. Backcrossing synthetic A. suecica to tetraploid A. thaliana yielded progeny with active A. thaliana rRNA genes and, in some cases, silenced C. arenosa rRNA genes, showing that the direction of dominance can be switched. The hypothesis that naturally dominant rRNA genes have a superior binding affinity for a limiting transcription factor is inconsistent with dominance switching. Inactivation of a species-specific transcription factor is argued against by showing that A. thaliana and C. arenosa rRNA genes can be expressed transiently in the other species. Transfected A. thaliana genes are also active in A. suecica protoplasts in which chromosomal A. thaliana genes are repressed. Collectively, these data suggest that nucleolar dominance is a chromosomal phenomenon that results in coordinate or cooperative silencing of rRNA genes.

  4. Transformation of Chloroplast Ribosomal RNA Genes in Chlamydomonas: Molecular and Genetic Characterization of Integration Events

    PubMed Central

    Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.

    1990-01-01

    Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764

  5. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    PubMed

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  6. DSIR: assessing the design of highly potent siRNA by testing a set of cancer-relevant target genes.

    PubMed

    Filhol, Odile; Ciais, Delphine; Lajaunie, Christian; Charbonnier, Peggy; Foveau, Nicolas; Vert, Jean-Philippe; Vandenbrouck, Yves

    2012-01-01

    Chemically synthesized small interfering RNA (siRNA) is a widespread molecular tool used to knock down genes in mammalian cells. However, designing potent siRNA remains challenging. Among tools predicting siRNA efficacy, very few have been validated on endogenous targets in realistic experimental conditions. We previously described a tool to assist efficient siRNA design (DSIR, Designer of siRNA), which focuses on intrinsic features of the siRNA sequence. Here, we evaluated DSIR's performance by systematically investigating the potency of the siRNA it designs to target ten cancer-related genes. mRNA knockdown was measured by quantitative RT-PCR in cell-based assays, revealing that over 60% of siRNA sequences designed by DSIR silenced their target genes by at least 70%. Silencing efficacy was sustained even when low siRNA concentrations were used. This systematic analysis revealed in particular that, for a subset of genes, the efficiency of siRNA constructs significantly increases when the sequence is located closer to the 5'-end of the target gene coding sequence, suggesting the distance to the 5'-end as a new feature for siRNA potency prediction. A new version of DSIR incorporating these new findings, as well as the list of validated siRNA against the tested cancer genes, has been made available on the web (http://biodev.extra.cea.fr/DSIR).

  7. Efficient expression of protein coding genes from the murine U1 small nuclear RNA promoters.

    PubMed Central

    Bartlett, J S; Sethna, M; Ramamurthy, L; Gowen, S A; Samulski, R J; Marzluff, W F

    1996-01-01

    Few promoters are active at high levels in all cells. Of these, the majority encode structural RNAs transcribed by RNA polymerases I or III and are not accessible for the expression of proteins. An exception are the small nuclear RNAs (snRNAs) transcribed by RNA polymerase II. Although snRNA biosynthesis is unique and thought not to be compatible with synthesis of functional mRNA, we have tested these promoters for their ability to express functional mRNAs. We have used the murine U1a and U1b snRNA gene promoters to express the Escherichia coli lacZ gene and the human alpha-globin gene from either episomal or integrated templates by transfection, or infection into a variety of mammalian cell types. Equivalent expression of beta-galactosidase was obtained from < 250 nucleotides of 5'-flanking sequence containing the complete promoter of either U1 snRNA gene or from the 750-nt cytomegalovirus promoter and enhancer regions. The mRNA was accurately initiated at the U1 start site, efficiently spliced and polyadenylylated, and localized to polyribosomes. Recombinant adenovirus containing the U1b-lacZ chimeric gene transduced and expressed beta-galactosidase efficiently in human 293 cells and airway epithelial cells in culture. Viral vectors containing U1 snRNA promoters may be an attractive alternative to vectors containing viral promoters for persistent high-level expression of therapeutic genes or proteins. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8799116

  8. RNA interference can be used to disrupt gene function in tardigrades

    PubMed Central

    Tenlen, Jennifer R.; McCaskill, Shaina; Goldstein, Bob

    2012-01-01

    How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We show that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions, and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800

  9. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples. PMID:25343859

  10. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples.

  11. RNA interference can be used to disrupt gene function in tardigrades.

    PubMed

    Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob

    2013-05-01

    How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments.

  12. Rearrangement of mitochondrial tRNA genes in flat bugs (Hemiptera: Aradidae)

    PubMed Central

    Song, Fan; Li, Hu; Shao, Renfu; Shi, Aimin; Bai, Xiaoshuan; Zheng, Xiaorong; Heiss, Ernst; Cai, Wanzhi

    2016-01-01

    The typical insect mitochondrial (mt) genome organization, which contains a single chromosome with 37 genes, was found in the infraorder Pentatomomorpha (suborder Heteroptera). The arrangement of mt genes in these true bugs is usually the same as the ancestral mt gene arrangement of insects. Rearrangement of transfer RNA (tRNA) genes, however, has been found in two subfamilies of flat bugs (Mezirinae and Calisiinae, family Aradidae). In this study, we sequenced the complete mt genomes of four species from three other subfamilies (Aradinae, Carventinae and Aneurinae). We found tRNA gene rearrangement in all of these four species. All of the rearranged tRNA genes are located between the mitochondrial control region and cox1, indicating this region as a hotspot for gene rearrangement in flat bugs; the rearrangement is likely caused by events of tandem duplication and random deletion of genes. Furthermore, our phylogenetic and dating analyses indicated that the swap of positions between trnQ and trnI occurred ~162 million years ago (MYA) in the most recent common ancestor of the five subfamilies of flat bugs investigated to date, whereas the swap of positions between trnC and trnW occurred later in the lineage leading to Calisiinae, and the translocation of trnC and trnY occurred later than 134 MYA in the lineage leading to Aradinae. PMID:27180804

  13. RNA interference can be used to disrupt gene function in tardigrades.

    PubMed

    Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob

    2013-05-01

    How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800

  14. Integrating mRNA and miRNA Weighted Gene Co-Expression Networks with eQTLs in the Nucleus Accumbens of Subjects with Alcohol Dependence.

    PubMed

    Mamdani, Mohammed; Williamson, Vernell; McMichael, Gowon O; Blevins, Tana; Aliev, Fazil; Adkins, Amy; Hack, Laura; Bigdeli, Tim; van der Vaart, Andrew D; Web, Bradley Todd; Bacanu, Silviu-Alin; Kalsi, Gursharan; Kendler, Kenneth S; Miles, Michael F; Dick, Danielle; Riley, Brien P; Dumur, Catherine; Vladimirov, Vladimir I

    2015-01-01

    Alcohol consumption is known to lead to gene expression changes in the brain. After performing weighted gene co-expression network analyses (WGCNA) on genome-wide mRNA and microRNA (miRNA) expression in Nucleus Accumbens (NAc) of subjects with alcohol dependence (AD; N = 18) and of matched controls (N = 18), six mRNA and three miRNA modules significantly correlated with AD were identified (Bonferoni-adj. p≤ 0.05). Cell-type-specific transcriptome analyses revealed two of the mRNA modules to be enriched for neuronal specific marker genes and downregulated in AD, whereas the remaining four mRNA modules were enriched for astrocyte and microglial specific marker genes and upregulated in AD. Gene set enrichment analysis demonstrated that neuronal specific modules were enriched for genes involved in oxidative phosphorylation, mitochondrial dysfunction and MAPK signaling. Glial-specific modules were predominantly enriched for genes involved in processes related to immune functions, i.e. cytokine signaling (all adj. p≤ 0.05). In mRNA and miRNA modules, 461 and 25 candidate hub genes were identified, respectively. In contrast to the expected biological functions of miRNAs, correlation analyses between mRNA and miRNA hub genes revealed a higher number of positive than negative correlations (χ2 test p≤ 0.0001). Integration of hub gene expression with genome-wide genotypic data resulted in 591 mRNA cis-eQTLs and 62 miRNA cis-eQTLs. mRNA cis-eQTLs were significantly enriched for AD diagnosis and AD symptom counts (adj. p = 0.014 and p = 0.024, respectively) in AD GWAS signals in a large, independent genetic sample from the Collaborative Study on Genetics of Alcohol (COGA). In conclusion, our study identified putative gene network hubs coordinating mRNA and miRNA co-expression changes in the NAc of AD subjects, and our genetic (cis-eQTL) analysis provides novel insights into the etiological mechanisms of AD.

  15. Integrating mRNA and miRNA Weighted Gene Co-Expression Networks with eQTLs in the Nucleus Accumbens of Subjects with Alcohol Dependence.

    PubMed

    Mamdani, Mohammed; Williamson, Vernell; McMichael, Gowon O; Blevins, Tana; Aliev, Fazil; Adkins, Amy; Hack, Laura; Bigdeli, Tim; van der Vaart, Andrew D; Web, Bradley Todd; Bacanu, Silviu-Alin; Kalsi, Gursharan; Kendler, Kenneth S; Miles, Michael F; Dick, Danielle; Riley, Brien P; Dumur, Catherine; Vladimirov, Vladimir I

    2015-01-01

    Alcohol consumption is known to lead to gene expression changes in the brain. After performing weighted gene co-expression network analyses (WGCNA) on genome-wide mRNA and microRNA (miRNA) expression in Nucleus Accumbens (NAc) of subjects with alcohol dependence (AD; N = 18) and of matched controls (N = 18), six mRNA and three miRNA modules significantly correlated with AD were identified (Bonferoni-adj. p≤ 0.05). Cell-type-specific transcriptome analyses revealed two of the mRNA modules to be enriched for neuronal specific marker genes and downregulated in AD, whereas the remaining four mRNA modules were enriched for astrocyte and microglial specific marker genes and upregulated in AD. Gene set enrichment analysis demonstrated that neuronal specific modules were enriched for genes involved in oxidative phosphorylation, mitochondrial dysfunction and MAPK signaling. Glial-specific modules were predominantly enriched for genes involved in processes related to immune functions, i.e. cytokine signaling (all adj. p≤ 0.05). In mRNA and miRNA modules, 461 and 25 candidate hub genes were identified, respectively. In contrast to the expected biological functions of miRNAs, correlation analyses between mRNA and miRNA hub genes revealed a higher number of positive than negative correlations (χ2 test p≤ 0.0001). Integration of hub gene expression with genome-wide genotypic data resulted in 591 mRNA cis-eQTLs and 62 miRNA cis-eQTLs. mRNA cis-eQTLs were significantly enriched for AD diagnosis and AD symptom counts (adj. p = 0.014 and p = 0.024, respectively) in AD GWAS signals in a large, independent genetic sample from the Collaborative Study on Genetics of Alcohol (COGA). In conclusion, our study identified putative gene network hubs coordinating mRNA and miRNA co-expression changes in the NAc of AD subjects, and our genetic (cis-eQTL) analysis provides novel insights into the etiological mechanisms of AD. PMID:26381263

  16. Integrating mRNA and miRNA Weighted Gene Co-Expression Networks with eQTLs in the Nucleus Accumbens of Subjects with Alcohol Dependence

    PubMed Central

    Blevins, Tana; Aliev, Fazil; Adkins, Amy; Hack, Laura; Bigdeli, Tim; D. van der Vaart, Andrew; Web, Bradley Todd; Bacanu, Silviu-Alin; Kalsi, Gursharan; Kendler, Kenneth S.; Miles, Michael F.; Dick, Danielle; Riley, Brien P.; Dumur, Catherine; Vladimirov, Vladimir I.

    2015-01-01

    Alcohol consumption is known to lead to gene expression changes in the brain. After performing weighted gene co-expression network analyses (WGCNA) on genome-wide mRNA and microRNA (miRNA) expression in Nucleus Accumbens (NAc) of subjects with alcohol dependence (AD; N = 18) and of matched controls (N = 18), six mRNA and three miRNA modules significantly correlated with AD were identified (Bonferoni-adj. p≤ 0.05). Cell-type-specific transcriptome analyses revealed two of the mRNA modules to be enriched for neuronal specific marker genes and downregulated in AD, whereas the remaining four mRNA modules were enriched for astrocyte and microglial specific marker genes and upregulated in AD. Gene set enrichment analysis demonstrated that neuronal specific modules were enriched for genes involved in oxidative phosphorylation, mitochondrial dysfunction and MAPK signaling. Glial-specific modules were predominantly enriched for genes involved in processes related to immune functions, i.e. cytokine signaling (all adj. p≤ 0.05). In mRNA and miRNA modules, 461 and 25 candidate hub genes were identified, respectively. In contrast to the expected biological functions of miRNAs, correlation analyses between mRNA and miRNA hub genes revealed a higher number of positive than negative correlations (χ2 test p≤ 0.0001). Integration of hub gene expression with genome-wide genotypic data resulted in 591 mRNA cis-eQTLs and 62 miRNA cis-eQTLs. mRNA cis-eQTLs were significantly enriched for AD diagnosis and AD symptom counts (adj. p = 0.014 and p = 0.024, respectively) in AD GWAS signals in a large, independent genetic sample from the Collaborative Study on Genetics of Alcohol (COGA). In conclusion, our study identified putative gene network hubs coordinating mRNA and miRNA co-expression changes in the NAc of AD subjects, and our genetic (cis-eQTL) analysis provides novel insights into the etiological mechanisms of AD. PMID:26381263

  17. Virus-induced gene silencing of RPC5-like subunit of RNA polymerase III caused pleiotropic effects in Nicotiana benthamiana

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In eukaryotic cells, RNA polymerase III is highly conserved, contains 17 subunits and transcribes housekeeping genes such as ribosomal 50S rRNA, tRNA and other small RNAs. Functional roles of the RPC5 are poorly characterized in the literature. In this work, we report that virus-induced gene silenci...

  18. Silent no more: Endogenous small RNA pathways promote gene expression.

    PubMed

    Wedeles, Christopher J; Wu, Monica Z; Claycomb, Julie M

    2014-01-01

    Endogenous small RNA pathways related to RNA interference (RNAi) play a well-documented role in protecting host genomes from the invasion of foreign nucleic acids. In C. elegans, the PIWI type Argonaute, PRG-1, through an association with 21U-RNAs, mediates a genome surveillance process by constantly scanning the genome for potentially deleterious invading elements. Upon recognition of foreign nucleic acids, PRG-1 initiates a cascade of cytoplasmic and nuclear events that results in heritable epigenetic silencing of these transcripts and their coding genomic loci. If the PRG-1/21U-RNA genome surveillance pathway has the capacity to target most of the C. elegans transcriptome, what mechanisms exist to protect endogenous transcripts from being silenced by this pathway? In this commentary, we discuss three recent publications that implicate the CSR-1 small RNA pathway in the heritable activation of germline transcripts, propose a model as to why not all epialleles behave similarly, and touch on the practical implications of these findings.

  19. Inhibition of avian metapneumovirus (AMPV) replication by RNA interference targeting nucleoprotein gene (N) in cultured cells.

    PubMed

    Ferreira, Helena Lage; Spilki, Fernando Rosado; de Almeida, Renata Servan; Santos, Márcia M A B; Arns, Clarice Weis

    2007-04-01

    Avian metapneumovirus (AMPV) is the primary causative agent of severe rhinotracheitis in turkeys. It is associated with swollen head syndrome in chickens and is the source of significant economic losses to animal food production. In this study, we designed specific short interfering RNA (siRNA) targeting the AMPV nucleoprotein (N) and fusion (F) genes. Three days post-virus infection, virus titration, real time RT-PCR, and RT-PCR assays were performed to verify the effect of siRNA in AMPV replication. A marked decrease in virus titers from transfected CER cells treated with siRNA/N was observed. Also, the production of N, F, and G mRNAs in AMPV was decreased. Results indicate that N-specific siRNA can inhibit virus replication. In future studies, a combination of siRNAs targeting the RNA polymerase complex may be used as a tool to study AMPV replication and/or antiviral therapy.

  20. Identification of Survival Genes in Human Glioblastoma Cells by Small Interfering RNA Screening

    PubMed Central

    Thaker, Nikhil G.; Zhang, Fang; McDonald, Peter R.; Shun, Tong Ying; Lewen, Michael D.; Pollack, Ian F.

    2009-01-01

    Target identification and validation remain difficult steps in the drug discovery process, and uncovering the core genes and pathways that are fundamental for cancer cell survival may facilitate this process. Glioblastoma represents a challenging form of cancer for chemotherapy. Therefore, we assayed 16,560 short interfering RNA (siRNA) aimed at identifying which of the 5520 unique therapeutically targetable gene products were important for the survival of human glioblastoma. We analyzed the viability of T98G glioma cells 96 h after siRNA transfection with two orthogonal statistical methods and identified 55 survival genes that encoded proteases, kinases, and transferases. It is noteworthy that 22% (12/55) of the survival genes were constituents of the 20S and 26S proteasome subunits. An expression survey of a panel of glioma cell lines demonstrated expression of the proteasome component PSMB4, and the validity of the proteasome complex as a target for survival inhibition was confirmed in a series of glioma and nonglioma cell lines by pharmacological inhibition and RNA interference. Biological networks were built with the other survival genes using a protein-protein interaction network, which identified clusters of cellular processes, including protein ubiquitination, purine and pyrimidine metabolism, nucleotide excision repair, and NF-κB signaling. The results of this study should broaden our understanding of the core genes and pathways that regulate cell survival; through either small molecule inhibition or RNA interference, we highlight the potential significance of proteasome inhibition. PMID:19783622

  1. Transcription factors and microRNA-co-regulated genes in gastric cancer invasion in ex vivo.

    PubMed

    Shi, Yue; Wang, Jihan; Xin, Zhuoyuan; Duan, Zipeng; Wang, Guoqing; Li, Fan

    2015-01-01

    Aberrant miRNA expression abnormally modulates gene expression in cells and can contribute to tumorigenesis in humans. This study identified functionally relevant differentially expressed genes using the transcription factors and miRNA-co-regulated network analysis for gastric cancer. The TF-miRNA co-regulatory network was constructed based on data obtained from cDNA microarray and miRNA expression profiling of gastric cancer tissues. The network along with their co-regulated genes was analyzed using Database for Annotation, Visualization and Integrated Discovery (DAVID) and Transcriptional Regulatory Element Database (TRED). We found eighteen (17 up-regulated and 1 down-regulated) differentially expressed genes that were co-regulated by transcription factors and miRNAs. KEGG pathway analysis revealed that these genes were part of the extracellular matrix-receptor interaction and focal adhesion signaling pathways. In addition, qRT- PCR and Western blot data showed an increase in COL1A1 and decrease in NCAM1 mRNA and protein levels in gastric cancer tissues. Thus, these data provided the first evidence to illustrate that altered gene network was associated with gastric cancer invasion. Further study with a large sample size and more functional experiments is needed to confirm these data and contribute to diagnostic and treatment strategies for gastric cancer.

  2. Transcription Factors and microRNA-Co-Regulated Genes in Gastric Cancer Invasion in Ex Vivo

    PubMed Central

    Shi, Yue; Wang, Jihan; Xin, Zhuoyuan; Duan, Zipeng; Wang, Guoqing; Li, Fan

    2015-01-01

    Aberrant miRNA expression abnormally modulates gene expression in cells and can contribute to tumorigenesis in humans. This study identified functionally relevant differentially expressed genes using the transcription factors and miRNA-co-regulated network analysis for gastric cancer. The TF-miRNA co-regulatory network was constructed based on data obtained from cDNA microarray and miRNA expression profiling of gastric cancer tissues. The network along with their co-regulated genes was analyzed using Database for Annotation, Visualization and Integrated Discovery (DAVID) and Transcriptional Regulatory Element Database (TRED). We found eighteen (17 up-regulated and 1 down-regulated) differentially expressed genes that were co-regulated by transcription factors and miRNAs. KEGG pathway analysis revealed that these genes were part of the extracellular matrix-receptor interaction and focal adhesion signaling pathways. In addition, qRT- PCR and Western blot data showed an increase in COL1A1 and decrease in NCAM1 mRNA and protein levels in gastric cancer tissues. Thus, these data provided the first evidence to illustrate that altered gene network was associated with gastric cancer invasion. Further study with a large sample size and more functional experiments is needed to confirm these data and contribute to diagnostic and treatment strategies for gastric cancer. PMID:25860484

  3. Bottom-up assembly of RNA nanoparticles containing phi29 motor pRNA to silence the asthma STAT5b gene.

    PubMed

    Qiu, C; Peng, W K; Shi, F; Zhang, T

    2012-09-13

    Activation of the transcription factor signal transducer and activator of transcription 5b (STAT5b) is a key event in the development of asthma. The potent ability of small interfering RNA (siRNA) to inhibit the expression of STAT5b mRNA has provided a new class of therapeutics for asthma. However, efficient delivery of siRNAs remains a key obstacle to their successful application. A targeted intracellular delivery approach for siRNA to specific cell types would be highly desirable. We used packaging RNA (pRNA), a component of the bacteriophage phi29-packaging motor, to deliver STAT5b siRNA to asthmatic spleen lymphocytes. This pRNA was able to spontaneously carry siRNA/STAT5b and aptamer/CD4, which is a ligand to CD4 molecule. Based on RT-PCR data, the pRNA dimer effectively inhibited STAT5b gene mRNA expression of asthmatic spleen lymphocytes, without the need for additional transfections. We conclude that the pRNA dimer carrying both siRNA and aptamer can deliver functional siRNA to cells; possibly, the aptamer acts as a ligand to interact with specific receptors. The pRNAs were evaluated with a CCK-8 kit and were found to have little cytotoxicity. We conclude that pRNA as a novel nanovehicle for RNA worth further study.

  4. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  5. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  6. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  7. Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound.

    PubMed

    Kopechek, Jonathan A; Carson, Andrew R; McTiernan, Charles F; Chen, Xucai; Klein, Edwin C; Villanueva, Flordeliza S

    2016-01-01

    RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease. PMID:27471848

  8. Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound

    PubMed Central

    McTiernan, Charles F.; Chen, Xucai; Klein, Edwin C.; Villanueva, Flordeliza S.

    2016-01-01

    RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease. PMID:27471848

  9. Islander: A database of precisely mapped genomic islands in tRNA and tmRNA genes

    SciTech Connect

    Hudson, Corey M.; Lau, Britney Y.; Williams, Kelly P.

    2014-11-05

    Genomic islands are mobile DNAs that are major agents of bacterial and archaeal evolution. Integration into prokaryotic chromosomes usually occurs site-specifically at tRNA or tmRNA gene (together, tDNA) targets, catalyzed by tyrosine integrases. This splits the target gene, yet sequences within the island restore the disrupted gene; the regenerated target and its displaced fragment precisely mark the endpoints of the island. We applied this principle to search for islands in genomic DNA sequences. Our algorithm identifies tDNAs, finds fragments of those tDNAs in the same replicon and removes unlikely candidate islands through a series of filters. A search for islands in 2168 whole prokaryotic genomes produced 3919 candidates. The website Islander (recently moved to http://bioinformatics.sandia.gov/islander/) presents these precisely mapped candidate islands, the gene content and the island sequence. The algorithm further insists that each island encode an integrase, and attachment site sequence identity is carefully noted; therefore, the database also serves in the study of integrase site-specificity and its evolution.

  10. Islander: A database of precisely mapped genomic islands in tRNA and tmRNA genes

    DOE PAGES

    Hudson, Corey M.; Lau, Britney Y.; Williams, Kelly P.

    2014-11-05

    Genomic islands are mobile DNAs that are major agents of bacterial and archaeal evolution. Integration into prokaryotic chromosomes usually occurs site-specifically at tRNA or tmRNA gene (together, tDNA) targets, catalyzed by tyrosine integrases. This splits the target gene, yet sequences within the island restore the disrupted gene; the regenerated target and its displaced fragment precisely mark the endpoints of the island. We applied this principle to search for islands in genomic DNA sequences. Our algorithm identifies tDNAs, finds fragments of those tDNAs in the same replicon and removes unlikely candidate islands through a series of filters. A search for islandsmore » in 2168 whole prokaryotic genomes produced 3919 candidates. The website Islander (recently moved to http://bioinformatics.sandia.gov/islander/) presents these precisely mapped candidate islands, the gene content and the island sequence. The algorithm further insists that each island encode an integrase, and attachment site sequence identity is carefully noted; therefore, the database also serves in the study of integrase site-specificity and its evolution.« less

  11. Regulation of bacterial photosynthesis genes by the small noncoding RNA PcrZ.

    PubMed

    Mank, Nils N; Berghoff, Bork A; Hermanns, Yannick N; Klug, Gabriele

    2012-10-01

    The small RNA PcrZ (photosynthesis control RNA Z) of the facultative phototrophic bacterium Rhodobacter sphaeroides is induced upon a drop of oxygen tension with similar kinetics to those of genes for components of photosynthetic complexes. High expression of PcrZ depends on PrrA, the response regulator of the PrrB/PrrA two-component system with a central role in redox regulation in R. sphaeroides. In addition the FnrL protein, an activator of some photosynthesis genes at low oxygen tension, is involved in redox-dependent expression of this small (s)RNA. Overexpression of full-length PcrZ in R. sphaeroides affects expression of a small subset of genes, most of them with a function in photosynthesis. Some mRNAs from the photosynthetic gene cluster were predicted to be putative PcrZ targets and results from an in vivo reporter system support these predictions. Our data reveal a negative effect of PcrZ on expression of its target mRNAs. Thus, PcrZ counteracts the redox-dependent induction of photosynthesis genes, which is mediated by protein regulators. Because PrrA directly activates photosynthesis genes and at the same time PcrZ, which negatively affects photosynthesis gene expression, this is one of the rare cases of an incoherent feed-forward loop including an sRNA. Our data identified PcrZ as a trans acting sRNA with a direct regulatory function in formation of photosynthetic complexes and provide a model for the control of photosynthesis gene expression by a regulatory network consisting of proteins and a small noncoding RNA.

  12. Long Non-Coding RNA and Epigenetic Gene Regulation of KSHV

    PubMed Central

    Campbell, Mel; Kung, Hsing-Jien; Izumiya, Yoshihiro

    2014-01-01

    Kaposi’s sarcoma-associated herpesvirus (KSHV/human herpesvirus 8) is a γ-herpesvirus linked to Kaposi’s sarcoma (KS) and two lymphoproliferative disorders, primary effusion lymphoma (PEL or body-cavity B-lymphoma [BCBL]) and a subset of Multicentric Castleman’s Disease. During lytic growth, pervasive viral transcription generating a variety of transcripts with uncertain protein-coding potential has been described on a genome-wide scale in β- and γ-herpesviruses. One class of such RNAs is called long non-coding RNAs (lncRNAs). KSHV encodes a viral lncRNA known as polyadenylated nuclear RNA (PAN RNA), a copious early gene product. PAN RNA has been implicated in KSHV gene expression, replication, and immune modulation. PAN RNA expression is required for optimal expression of the entire KSHV lytic gene expression program. Latent KSHV episomes are coated with viral latency-associated nuclear antigen (LANA). LANA rapidly dissociates from episomes during reactivation. Here we review recent studies suggesting that PAN RNA may function as a viral lncRNA, including a role in the facilitation of LANA-episomal dissociation during lytic replication. PMID:25375882

  13. MAGIA, a web-based tool for miRNA and Genes Integrated Analysis

    PubMed Central

    Sales, Gabriele; Coppe, Alessandro; Bisognin, Andrea; Biasiolo, Marta; Bortoluzzi, Stefania; Romualdi, Chiara

    2010-01-01

    MAGIA (miRNA and genes integrated analysis) is a novel web tool for the integrative analysis of target predictions, miRNA and gene expression data. MAGIA is divided into two parts: the query section allows the user to retrieve and browse updated miRNA target predictions computed with a number of different algorithms (PITA, miRanda and Target Scan) and Boolean combinations thereof. The analysis section comprises a multistep procedure for (i) direct integration through different functional measures (parametric and non-parametric correlation indexes, a variational Bayesian model, mutual information and a meta-analysis approach based on P-value combination) of mRNA and miRNA expression data, (ii) construction of bipartite regulatory network of the best miRNA and mRNA putative interactions and (iii) retrieval of information available in several public databases of genes, miRNAs and diseases and via scientific literature text-mining. MAGIA is freely available for Academic users at http://gencomp.bio.unipd.it/magia. PMID:20484379

  14. MAGIA, a web-based tool for miRNA and Genes Integrated Analysis.

    PubMed

    Sales, Gabriele; Coppe, Alessandro; Bisognin, Andrea; Biasiolo, Marta; Bortoluzzi, Stefania; Romualdi, Chiara

    2010-07-01

    MAGIA (miRNA and genes integrated analysis) is a novel web tool for the integrative analysis of target predictions, miRNA and gene expression data. MAGIA is divided into two parts: the query section allows the user to retrieve and browse updated miRNA target predictions computed with a number of different algorithms (PITA, miRanda and Target Scan) and Boolean combinations thereof. The analysis section comprises a multistep procedure for (i) direct integration through different functional measures (parametric and non-parametric correlation indexes, a variational Bayesian model, mutual information and a meta-analysis approach based on P-value combination) of mRNA and miRNA expression data, (ii) construction of bipartite regulatory network of the best miRNA and mRNA putative interactions and (iii) retrieval of information available in several public databases of genes, miRNAs and diseases and via scientific literature text-mining. MAGIA is freely available for Academic users at http://gencomp.bio.unipd.it/magia.

  15. New class of gene-termini-associated human RNAs suggests a novel RNA copying mechanism.

    PubMed

    Kapranov, Philipp; Ozsolak, Fatih; Kim, Sang Woo; Foissac, Sylvain; Lipson, Doron; Hart, Chris; Roels, Steve; Borel, Christelle; Antonarakis, Stylianos E; Monaghan, A Paula; John, Bino; Milos, Patrice M

    2010-07-29

    Small (<200 nucleotide) RNA (sRNA) profiling of human cells using various technologies demonstrates unexpected complexity of sRNAs with hundreds of thousands of sRNA species present. Genetic and in vitro studies show that these RNAs are not merely degradation products of longer transcripts but could indeed have a function. Furthermore, profiling of RNAs, including the sRNAs, can reveal not only novel transcripts, but also make clear predictions about the existence and properties of novel biochemical pathways operating in a cell. For example, sRNA profiling in human cells indicated the existence of an unknown capping mechanism operating on cleaved RNA, a biochemical component of which was later identified. Here we show that human cells contain a novel type of sRNA that has non-genomically encoded 5' poly(U) tails. The presence of these RNAs at the termini of genes, specifically at the very 3' ends of known mRNAs, strongly argues for the presence of a yet uncharacterized endogenous biochemical pathway in cells that can copy RNA. We show that this pathway can operate on multiple genes, with specific enrichment towards transcript-encoding components of the translational machinery. Finally, we show that genes are also flanked by sense, 3' polyadenylated sRNAs that are likely to be capped. PMID:20671709

  16. Origin and evolution of group I introns in cyanobacterial tRNA genes.

    PubMed Central

    Paquin, B; Kathe, S D; Nierzwicki-Bauer, S A; Shub, D A

    1997-01-01

    Many tRNA(Leu)UAA genes from plastids contain a group I intron. An intron is also inserted in the same gene at the same position in cyanobacteria, the bacterial progenitors of plastids, suggesting an ancient bacterial origin for this intron. A group I intron has also been found in the tRNA(fMet) gene of some cyanobacteria but not in plastids, suggesting a more recent origin for this intron. In this study, we investigate the phylogenetic distributions of the two introns among cyanobacteria, from the earliest branching to the more derived species. The phylogenetic distribution of the tRNA(Leu)UAA intron follows the clustering of rRNA sequences, being either absent or present in clades of closely related species, with only one exception in the Pseudanabaena group. Our data support the notion that the tRNA(Leu)UAA intron was inherited by cyanobacteria and plastids through a common ancestor. Conversely, the tRNA(fMet) intron has a sporadic distribution, implying that many gains and losses occurred during cyanobacterial evolution. Interestingly, a phylogenetic tree inferred from intronic sequences clearly separates the different tRNA introns, suggesting that each family has its own evolutionary history. PMID:9352932

  17. Major role for mRNA stability in shaping the kinetics of gene induction

    PubMed Central

    2010-01-01

    Background mRNA levels in cells are determined by the relative rates of RNA production and degradation. Yet, to date, most analyses of gene expression profiles were focused on mechanisms which regulate transcription, while the role of mRNA stability in modulating transcriptional networks was to a large extent overlooked. In particular, kinetic waves in transcriptional responses are usually interpreted as resulting from sequential activation of transcription factors. Results In this study, we examined on a global scale the role of mRNA stability in shaping the kinetics of gene response. Analyzing numerous expression datasets we revealed a striking global anti-correlation between rapidity of induction and mRNA stability, fitting the prediction of a kinetic mathematical model. In contrast, the relationship between kinetics and stability was less significant when gene suppression was analyzed. Frequently, mRNAs that are stable under standard conditions were very rapidly down-regulated following stimulation. Such effect cannot be explained even by a complete shut-off of transcription, and therefore indicates intense modulation of RNA stability. Conclusion Taken together, our results demonstrate the key role of mRNA stability in determining induction kinetics in mammalian transcriptional networks. PMID:20409322

  18. Construction and identification of recombinant adenovirus carrying human TIMP-1shRNA gene.

    PubMed

    Sun, Y L; Xie, H; Lin, H L; Feng, Q; Liu, Y

    2015-01-16

    The aim of this study was to construct the recombinant adenovirus carrying human TIMP-1shRNA gene expression system for preliminary identification to lay the foundation for the further study of gene therapy. Using the Adeno-X system, the recombinant adenovirus plasmid pAdeno-X green fluorescent protein (GFP)-tissue inhibitor of metalloprotease (TIMP)-1 small hairpin (1shRNA) was constructed by including the target gene fragment of the TIMP-1shRNA shuttle plasmid pShuttle2-GFP-TIMP-1shRNA and the backbone plasmid pAdeno-X by homologous recombination in Escherichia coli. Recombinant plasmids were transfected into HEK293A cells to package the recombinant adenovirus rvAdeno-XGFP-TIMP-1shRNA. The recombinant adenovirus was identified by polymerase chain reaction, and the viral titer and infection efficiency were detected using GFP. Polymerase chain reaction and restriction endonuclease digestion demonstrated that rvAdeno-XGFP-TIMP-1shRNA had been successfully constructed, which has a strong ability to infect the kidney. The TIMP-1shRNA adenovirus expression vector was successfully constructed using homologous recombination methods.

  19. Characterizing Milk Production Related Genes in Holstein Using RNA-seq

    PubMed Central

    Seo, Minseok; Lee, Hyun-Jeong; Kim, Kwondo; Caetano-Anolles, Kelsey; Jeong, Jin Young; Park, Sungkwon; Oh, Young Kyun; Cho, Seoae; Kim, Heebal

    2016-01-01

    Although the chemical, physical, and nutritional properties of bovine milk have been extensively studied, only a few studies have attempted to characterize milk-synthesizing genes using RNA-seq data. RNA-seq data was collected from 21 Holstein samples, along with group information about milk production ability; milk yield; and protein, fat, and solid contents. Meta-analysis was employed in order to generally characterize genes related to milk production. In addition, we attempted to investigate the relationship between milk related traits, parity, and lactation period. We observed that milk fat is highly correlated with lactation period; this result indicates that this effect should be considered in the model in order to accurately detect milk production related genes. By employing our developed model, 271 genes were significantly (false discovery rate [FDR] adjusted p-value<0.1) detected as milk production related differentially expressed genes. Of these genes, five (albumin, nitric oxide synthase 3, RNA-binding region (RNP1, RRM) containing 3, secreted and transmembrane 1, and serine palmitoyltransferase, small subunit B) were technically validated using quantitative real-time polymerase chain reaction (qRT-PCR) in order to check the accuracy of RNA-seq analysis. Finally, 83 gene ontology biological processes including several blood vessel and mammary gland development related terms, were significantly detected using DAVID gene-set enrichment analysis. From these results, we observed that detected milk production related genes are highly enriched in the circulation system process and mammary gland related biological functions. In addition, we observed that detected genes including caveolin 1, mammary serum amyloid A3.2, lingual antimicrobial peptide, cathelicidin 4 (CATHL4), cathelicidin 6 (CATHL6) have been reported in other species as milk production related gene. For this reason, we concluded that our detected 271 genes would be strong candidates for

  20. Integrative Analysis of miRNA and Inflammatory Gene Expression After Acute Particulate Matter Exposure

    PubMed Central

    Motta, Valeria

    2013-01-01

    MicroRNAs (miRNAs) are environmentally sensitive inhibitors of gene expression that may mediate the effects of metal-rich particulate matter (PM) and toxic metals on human individuals. Previous environmental miRNA studies have investigated a limited number of candidate miRNAs and have not yet evaluated the functional effects on gene expression. In this study, we wanted to identify PM-sensitive miRNAs using microarray profiling on matched baseline and postexposure RNA from foundry workers with well-characterized exposure to metal-rich PM and to characterize miRNA relations with expression of candidate inflammatory genes. We applied microarray analysis of 847 human miRNAs and real-time PCR analysis of 18 candidate inflammatory genes on matched blood samples collected from foundry workers at baseline and after 3 days of work (postexposure). We identified differentially expressed miRNAs (fold change [FC] > 2 and p < 0.05) and correlated their expression with the inflammatory associated genes. We performed in silico network analysis in MetaCore v6.9 to characterize the biological pathways connecting miRNA-mRNA pairs. Microarray analysis identified four miRNAs that were differentially expressed in postexposure compared with baseline samples, including miR-421 (FC = 2.81, p < 0.001), miR-146a (FC = 2.62, p = 0.007), miR-29a (FC = 2.91, p < 0.001), and let-7g (FC = 2.73, p = 0.019). Using false discovery date adjustment for multiple comparisons, we found 11 miRNA-mRNA correlated pairs involving the 4 differentially expressed miRNAs and candidate inflammatory genes. In silico network analysis with MetaCore database identified biological interactions for all the 11 miRNA-mRNA pairs, which ranged from direct mRNA targeting to complex interactions with multiple intermediates. Acute PM exposure may affect gene regulation through PM-responsive miRNAs that directly or indirectly control inflammatory gene expression. PMID:23358196

  1. From single-cell to cell-pool transcriptomes: stochasticity in gene expression and RNA splicing.

    PubMed

    Marinov, Georgi K; Williams, Brian A; McCue, Ken; Schroth, Gary P; Gertz, Jason; Myers, Richard M; Wold, Barbara J

    2014-03-01

    Single-cell RNA-seq mammalian transcriptome studies are at an early stage in uncovering cell-to-cell variation in gene expression, transcript processing and editing, and regulatory module activity. Despite great progress recently, substantial challenges remain, including discriminating biological variation from technical noise. Here we apply the SMART-seq single-cell RNA-seq protocol to study the reference lymphoblastoid cell line GM12878. By using spike-in quantification standards, we estimate the absolute number of RNA molecules per cell for each gene and find significant variation in total mRNA content: between 50,000 and 300,000 transcripts per cell. We directly measure technical stochasticity by a pool/split design and find that there are significant differences in expression between individual cells, over and above technical variation. Specific gene coexpression modules were preferentially expressed in subsets of individual cells, including one enriched for mRNA processing and splicing factors. We assess cell-to-cell variation in alternative splicing and allelic bias and report evidence of significant differences in splice site usage that exceed splice variation in the pool/split comparison. Finally, we show that transcriptomes from small pools of 30-100 cells approach the information content and reproducibility of contemporary RNA-seq from large amounts of input material. Together, our results define an experimental and computational path forward for analyzing gene expression in rare cell types and cell states.

  2. From single-cell to cell-pool transcriptomes: stochasticity in gene expression and RNA splicing.

    PubMed

    Marinov, Georgi K; Williams, Brian A; McCue, Ken; Schroth, Gary P; Gertz, Jason; Myers, Richard M; Wold, Barbara J

    2014-03-01

    Single-cell RNA-seq mammalian transcriptome studies are at an early stage in uncovering cell-to-cell variation in gene expression, transcript processing and editing, and regulatory module activity. Despite great progress recently, substantial challenges remain, including discriminating biological variation from technical noise. Here we apply the SMART-seq single-cell RNA-seq protocol to study the reference lymphoblastoid cell line GM12878. By using spike-in quantification standards, we estimate the absolute number of RNA molecules per cell for each gene and find significant variation in total mRNA content: between 50,000 and 300,000 transcripts per cell. We directly measure technical stochasticity by a pool/split design and find that there are significant differences in expression between individual cells, over and above technical variation. Specific gene coexpression modules were preferentially expressed in subsets of individual cells, including one enriched for mRNA processing and splicing factors. We assess cell-to-cell variation in alternative splicing and allelic bias and report evidence of significant differences in splice site usage that exceed splice variation in the pool/split comparison. Finally, we show that transcriptomes from small pools of 30-100 cells approach the information content and reproducibility of contemporary RNA-seq from large amounts of input material. Together, our results define an experimental and computational path forward for analyzing gene expression in rare cell types and cell states. PMID:24299736

  3. Efficient shRNA-mediated inhibition of gene expression in zebrafish.

    PubMed

    De Rienzo, Gianluca; Gutzman, Jennifer H; Sive, Hazel

    2012-09-01

    Despite the broad repertoire of loss of function (LOF) tools available for use in the zebrafish, there remains a need for a simple and rapid method that can inhibit expression of genes at later stages. RNAi would fulfill that role, and a previous report (Dong et al. 2009) provided encouraging data. The goal of this study was to further address the ability of expressed shRNAs to inhibit gene expression. This included quantifying RNA knockdown, testing specificity of shRNA effects, and determining whether tissue-specific LOF could be achieved. Using an F0 transgenic approach, this report demonstrates that for two genes, wnt5b and zDisc1, each with described mutant and morphant phenotypes, shRNAs efficiently decrease endogenous RNA levels. Phenotypes elicited by shRNA resemble those of mutants and morphants, and are reversed by expression of cognate RNA, further demonstrating specificity. Tissue-specific expression of zDisc1 shRNAs in F0 transgenics demonstrates that conditional LOF can be readily obtained. These results suggest that shRNA expression presents a viable approach for rapid inhibition of zebrafish gene expression.

  4. RNA-based, transient modulation of gene expression in human haematopoietic stem and progenitor cells

    PubMed Central

    Diener, Yvonne; Jurk, Marion; Kandil, Britta; Choi, Yeong-Hoon; Wild, Stefan; Bissels, Ute; Bosio, Andreas

    2015-01-01

    Modulation of gene expression is a useful tool to study the biology of haematopoietic stem and progenitor cells (HSPCs) and might also be instrumental to expand these cells for therapeutic approaches. Most of the studies so far have employed stable gene modification by viral vectors that are burdensome when translating protocols into clinical settings. Our study aimed at exploring new ways to transiently modify HSPC gene expression using non-integrating, RNA-based molecules. First, we tested different methods to deliver these molecules into HSPCs. The delivery of siRNAs with chemical transfection methods such as lipofection or cationic polymers did not lead to target knockdown, although we observed more than 90% fluorescent cells using a fluorochrome-coupled siRNA. Confocal microscopic analysis revealed that despite extensive washing, siRNA stuck to or in the cell surface, thereby mimicking a transfection event. In contrast, electroporation resulted in efficient, siRNA-mediated protein knockdown. For transient overexpression of proteins, we used optimised mRNA molecules with modified 5′- and 3′-UTRs. Electroporation of mRNA encoding GFP resulted in fast, efficient and persistent protein expression for at least seven days. Our data provide a broad-ranging comparison of transfection methods for hard-to-transfect cells and offer new opportunities for DNA-free, non-integrating gene modulation in HSPCs. PMID:26599627

  5. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA.

  6. The Riia Gene of Bacteriophage T4. II. Regulation of Its Messenger RNA Synthesis

    PubMed Central

    Daegelen, P.; Brody, E.

    1990-01-01

    When the rII genes are first introduced into cells which had been previously infected by T4 phage deleted for these genes, the kinetics of synthesis of rIIA and rIIB RNA are rapid and identical. We show that this rapid synthesis depends on a functional motA gene for rIIB, but not for rIIA, RNA synthesis. By primer-extension mapping of T4 messenger RNA, we find three promoters close to the rIIA gene. One of them is an early promoter just before the rIIA.1 gene; it is used under all conditions tested. Another is in the coding portion of the rIIA.1 gene; it is weak, primarily because of a 19-bp spacing between the -10 and -35 elements, and its use is stimulated by T4 functions. The third is a motA-dependent (middle) promoter which has an unusual CCCGCTT box at -33. We present results which suggest that none of these promoters is likely to be the site at which the motB and motC gene products exercise their major influence on rIIA RNA synthesis. PMID:2379818

  7. Widespread horizontal gene transfer from double-stranded RNA viruses to eukaryotic nuclear genomes.

    PubMed

    Liu, Huiquan; Fu, Yanping; Jiang, Daohong; Li, Guoqing; Xie, Jiatao; Cheng, Jiasen; Peng, Youliang; Ghabrial, Said A; Yi, Xianhong

    2010-11-01

    Horizontal gene transfer commonly occurs from cells to viruses but rarely occurs from viruses to their host cells, with the exception of retroviruses and some DNA viruses. However, extensive sequence similarity searches in public genome databases for various organisms showed that the capsid protein and RNA-dependent RNA polymerase genes from totiviruses and partitiviruses have widespread homologs in the nuclear genomes of eukaryotic organisms, including plants, arthropods, fungi, nematodes, and protozoa. PCR amplification and sequencing as well as comparative evidence of junction coverage between virus and host sequences support the conclusion that these viral homologs are real and occur in eukaryotic genomes. Sequence comparison and phylogenetic analysis suggest that these genes were likely transferred horizontally from viruses to eukaryotic genomes. Furthermore, we present evidence showing that some of the transferred genes are conserved and expressed in eukaryotic organisms and suggesting that these viral genes are also functional in the recipient genomes. Our findings imply that horizontal transfer of double-stranded RNA viral genes is widespread among eukaryotes and may give rise to functionally important new genes, thus entailing that RNA viruses may play significant roles in the evolution of eukaryotes.

  8. Tissue- and Time-Specific Expression of Otherwise Identical tRNA Genes.

    PubMed

    Sagi, Dror; Rak, Roni; Gingold, Hila; Adir, Idan; Maayan, Gadi; Dahan, Orna; Broday, Limor; Pilpel, Yitzhak; Rechavi, Oded

    2016-08-01

    Codon usage bias affects protein translation because tRNAs that recognize synonymous codons differ in their abundance. Although the current dogma states that tRNA expr