Science.gov

Sample records for 5s rrna assay

  1. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  2. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families. PMID:25315165

  3. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    PubMed

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  4. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  5. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  6. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    PubMed Central

    Durovic, P; Kutay, U; Schleper, C; Dennis, P P

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-coding sequence. This result suggests that the primary transcript of the 5S rRNA gene corresponds in length (within 1 or 2 nucleotides) to the mature 5S rRNA sequence found in 50S ribosomal subunits. Images PMID:8288546

  7. Evidence for the presence of 5S rRNA in mammalian mitochondria.

    PubMed

    Magalhães, P J; Andreu, A L; Schon, E A

    1998-09-01

    Mammalian mitochondrial ribosomes contain two prokaryotic-like rRNAs, 12S and 16S, both encoded by mitochondrial DNA. As opposed to cytosolic ribosomes, however, these ribosomes are not thought to contain 5S rRNA. For this reason, it has been unclear whether 5S rRNA, which can be detected in mitochondrial preparations, is an authentic organellar species imported from the cytosol or is merely a copurifying cytosol-derived contaminant. We now show that 5S rRNA is tightly associated with highly purified mitochondrial fractions of human and rat cells and that 5S rRNA transcripts derived from a synthetic gene transfected transiently into human cells are both expressed in vivo and present in highly purified mitochondria and mitoplasts. We conclude that 5S rRNA is imported into mammalian mitochondria, but its function there still remains to be clarified. PMID:9725900

  8. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  9. Diversity of 5S rRNA genes within individual prokaryotic genomes

    PubMed Central

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V.; Parsons, Tamasha; Yang, Liying; Gerz, Erika A.; Lee, Peng; Xiang, Charlie; Nossa, Carlos W.; Pei, Zhiheng

    2012-01-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1168 genomes from 779 unique species, 96 species exhibited >3% diversity. Twenty seven species with >10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there were tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. There is supplementary material. PMID:22765222

  10. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  11. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    PubMed

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  12. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  13. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  14. 5 S Rrna Is Involved in Fidelity of Translational Reading Frame

    PubMed Central

    Dinman, J. D.; Wickner, R. B.

    1995-01-01

    Chromosomal mutants (maintenance of frame = mof) in which the efficiency of -1 ribosomal frame-shifting is increased can be isolated using constructs in which lacZ expression is dependent upon a -1 shift of reading frame. We isolate a new mof mutation, mof9, in Saccharomyces cerevisiae and show that it is complemented by both single and multi-copy 5 S rDNA clones. Two independent insertion mutations in the rDNA locus (rDNA::LEU2 and rDNA::URA3) also display the Mof(-) phenotype and are also complemented by single and multi-copy 5 S rDNA clones. Mutant 5 S rRNAs expressed from a plasmid as 20-50% of total 5 S rRNA in a wild-type host also induced the Mof(-) phenotype. The increase in frameshifting is greatest when the lacZ reporter gene is expressed on a high copy, episomal vector. No differences were found in 5 S rRNA copy number or electrophoretic mobilities in mof9 strains. Both mof9 and rDNA::LEU2 increase the efficiency of +1 frameshifting as well but have no effect on readthrough of UAG or UAA termination codons, indicating that not all translational specificity is affected. These data suggest a role for 5 S rRNA in the maintenance of frame in translation. PMID:8536994

  15. Phylogenetic analysis of the genera Thiobacillus and Thiomicrospira by 5S rRNA sequences.

    PubMed Central

    Lane, D J; Stahl, D A; Olsen, G J; Heller, D J; Pace, N R

    1985-01-01

    5S rRNA nucleotide sequences from Thiobacillus neapolitanus, Thiobacillus ferrooxidans, Thiobacillus thiooxidans, Thiobacillus intermedius, Thiobacillus perometabolis, Thiobacillus thioparus, Thiobacillus versutus, Thiobacillus novellus, Thiobacillus acidophilus, Thiomicrospira pelophila, Thiomicrospira sp. strain L-12, and Acidiphilium cryptum were determined. A phylogenetic tree, based upon comparison of these and other related 5S rRNA sequences, is presented. The results place the thiobacilli, Thiomicrospira spp., and Acidiphilium spp. in the "purple photosynthetic" bacterial grouping which also includes the enteric, vibrio, pseudomonad, and other familiar eubacterial groups in addition to the purple photosynthetic bacteria. The genus Thiobacillus is not an evolutionarily coherent grouping but rather spans the full breadth of the purple photosynthetic bacteria. PMID:3924899

  16. Construction of the mycoplasma evolutionary tree from 5S rRNA sequence data.

    PubMed Central

    Rogers, M J; Simmons, J; Walker, R T; Weisburg, W G; Woese, C R; Tanner, R S; Robinson, I M; Stahl, D A; Olsen, G; Leach, R H

    1985-01-01

    The 5S rRNA sequences of eubacteria and mycoplasmas have been analyzed and a phylogenetic tree constructed. We determined the sequences of 5S rRNA from Clostridium innocuum, Acholeplasma laidlawii, Acholeplasma modicum, Anaeroplasma bactoclasticum, Anaeroplasma abactoclasticum, Ureaplasma urealyticum, Mycoplasma mycoides mycoides, Mycoplasma pneumoniae, and Mycoplasma gallisepticum. Analysis of these and published sequences shows that mycoplasmas form a coherent phylogenetic group that, with C. innocuum, arose as a branch of the low G+C Gram-positive tree, near the lactobacilli and streptococci. The initial event in mycoplasma phylogeny was formation of the Acholeplasma branch; hence, loss of cell wall probably occurred at the time of genome reduction to approximately to 1000 MDa. A subsequent branch produced the Spiroplasma. This branch appears to have been the origin of sterol-requiring mycoplasmas. During development of the Spiroplasma branch there were several independent genome reductions, each to approximately 500 MDa, resulting in Mycoplasma and Ureaplasma species. Mycoplasmas, particularly species with the smallest genomes, have high mutation rates, suggesting that they are in a state of rapid evolution. PMID:2579388

  17. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  18. Phylogenetic tree derived from bacterial, cytosol and organelle 5S rRNA sequences.

    PubMed Central

    Küntzel, H; Heidrich, M; Piechulla, B

    1981-01-01

    A phylogenetic tree was constructed by computer analysis of 47 completely determined 5S rRNA sequences. The wheat mitochondrial sequence is significantly more related to prokaryotic than to eukaryotic sequences, and its affinity to that of the thermophilic Gram-negative bacterium Thermus aquaticus is comparable to the affinity between Anacystis nidulans and chloroplastic sequences. This strongly supports the idea of an endosymbiotic origin of plant mitochondria. A comparison of the plant cytosol and chloroplast sub-trees suggests a similar rate of nucleotide substitution in nuclear genes and chloroplastic genes. Other features of the tree are a common precursor of protozoa and metazoa, which appears to be more related to the fungal than to the plant protosequence, and an early divergence of the archebacterial sequence (Halobacterium cutirubrum) from the prokaryotic branch. PMID:6785727

  19. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  20. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  1. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  2. Comparative structural analysis of eubacterial 5S rRNA by oxidation of adenines in the N-1 position.

    PubMed Central

    Pieler, T; Schreiber, A; Erdmann, V A

    1984-01-01

    Adenines in free 5S rRNA from Escherichia coli, Bacillus stearothermophilus and Thermus thermophilus have been oxidized at their N-1 position using monoperphthalic acid. The determination of the number of adenine 1-N-oxides was on the basis of UV spectroscopic data of the intact molecule. Identification of the most readily accessible nucleotides by sequencing gel analysis reveals that they are located in conserved positions within loops, exposed hairpin loops and single-base bulge loops. Implications for the structure and function of 5S rRNA will be discussed on the basis of this comparative analysis. Images PMID:6201825

  3. 5S rRNA sequences from four marine invertebrates and implications for base pairing models of metazoan sequences.

    PubMed

    Walker, W F; Doolittle, W F

    1983-08-11

    The nucleotide sequences of 5S rRNAs from the starfish Asterias vulgaris, the squid Illex illecebrosus, the sipunculid Phascolopsis gouldii and the jellyfish Aurelia aurita were determined. The sequence from Asterias lends support for one of two previous base pairing models for helix E in metazoan sequences. The Aurelia sequence differs by five nucleotides from that previously reported and does not violate the consensus secondary structure model for eukaryotic 5S rRNA. PMID:6136024

  4. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  5. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  6. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  7. Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

    PubMed Central

    Carol, P; Rozier, C; Lazaro, E; Ballesta, J P; Mache, R

    1993-01-01

    The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain. Images PMID:8441674

  8. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  9. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    PubMed

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  10. mTOR associates with TFIIIC, is found at tRNA and 5S rRNA genes, and targets their repressor Maf1.

    PubMed

    Kantidakis, Theodoros; Ramsbottom, Ben A; Birch, Joanna L; Dowding, Sarah N; White, Robert J

    2010-06-29

    Synthesis of tRNA and 5S rRNA by RNA polymerase (pol) III is regulated by the mTOR pathway in mammalian cells. The mTOR kinase localizes to tRNA and 5S rRNA genes, providing an opportunity for direct control. Its presence at these sites can be explained by interaction with TFIIIC, a DNA-binding factor that recognizes the promoters of these genes. TFIIIC contains a TOR signaling motif that facilitates its association with mTOR. Maf1, a repressor that binds and inhibits pol III, is phosphorylated in a mTOR-dependent manner both in vitro and in vivo at serine 75, a site that contributes to its function as a transcriptional inhibitor. Proximity ligation assays confirm the interaction of mTOR with Maf1 and TFIIIC in nuclei. In contrast to Maf1 regulation in yeast, no evidence is found for nuclear export of Maf1 in response to mTOR signaling in HeLa cells. We conclude that mTOR associates with TFIIIC, is recruited to pol III-transcribed genes, and relieves their repression by Maf1. PMID:20543138

  11. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    PubMed Central

    Leontis, N B; Westhof, E

    1998-01-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  12. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    PubMed

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. PMID:26800847

  13. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  14. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment. PMID:22724546

  15. Involvement of multiple basic amino acids in yeast ribosomal protein L1 in 5S rRNA recognition.

    PubMed

    Yeh, L C; Lee, J C

    1995-01-01

    The role of basic amino acid residues located at the C-terminal region of the yeast ribosomal protein L1 in 5S rRNA binding was characterized in vitro and in vivo. Mutant proteins containing single or multiple amino acid substitutions were generated by site-directed mutagenesis of the L1 gene carried on a plasmid. In vitro RNP formation was examined by production of the mutant protein in the presence of the RNA molecule. The thermostability of the resultant RNP was also studied. Effects of these mutations on cell viability and ribosome assembly were characterized by transformation of a conditional null L1 yeast mutant with the mutated L1 gene expressed from the plasmid. Substitution of any one of the lysine or arginine residue did not affect significantly RNA binding in vitro or cell growth in vivo. However, several mutant proteins with substitutions of two of these basic amino acids bound RNA weakly and the RNPs were less stable. Cells expressing these mutant proteins were lethal. Theoretical structural prediction of these amino acids further provided information regarding their collective contributions to RNA recognition and to interaction between the RNP and other components of the 60S ribosomal subunit. PMID:8643400

  16. Accurate transcription of homologous 5S rRNA and tRNA genes and splicing of tRNA in vitro by soluble extracts of Neurospora.

    PubMed Central

    Tyler, B M; Giles, N H

    1984-01-01

    We have developed soluble extracts from Neurospora crassa capable of accurately and efficiently transcribing homologous 5S rRNA and tRNA genes. The extracts also appear to quantitatively end-process and splice the primary tRNA transcripts. Although the extracts could not transcribe a heterologous (yeast) 5S rRNA gene, they did transcribe a yeast tRNALeu gene and slowly process the transcripts. In addition, we have developed a novel strategy for rapidly sequencing uniformly labelled RNAs using base-specific ribonucleases. We have used this procedure to verify the identity of the in vitro transcripts and processing products. Images PMID:6235482

  17. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  18. What does the 5S rRNA multigene family tell us about the origin of the annual Triticeae (Poaceae)?

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2013-05-01

    We have investigated the complex relationships among the annual genera within the tribe Triticeae through phylogenetic analyses of the 5S rRNA multigene family. Cloned sequences were assigned to groups of orthologous sequences, called unit classes, that were subjected to several analyses including BLAST (Basic Local Alignment Search Tool) searches to assess possible ancestral relationships with perennial genera; phylogenetic analyses using parsimony (Pars), maximum likelihood (ML), and Bayesian methods; and minimum reticulation networks from the Pars, ML, and Bayesian trees. In this study, we included genera with both annual and perennial species, such as Dasypyrum, Hordeum, and Secale. BLAST pointed to Pseudoroegneria (carrier of the St genome) and possibly Thinopyrum (carrier of the J genome) as the potential next of kin. However, Thinopyrum and Pseudoroegneria have never fallen together on the individual trees with the former generally associated with Crithopsis, Aegilops, Triticum, and Dasypyrum, while the latter is usually associated with the rest of the genera within Triticeae. The "long" unit classes placed Dasypyrum breviaristatum together with Dasypyrum villosum, whereas the "short" unit classes put them far apart on the trees. None of the gene trees alone was able to summarize the complex relationships among the genera, in line with previous results in the Triticeae. However, the application of tools designed to display phylogenetic networks was able to depict the complex links among the genera based on the short and the long gene trees, including the close link between Thinopyrum and Pseudoroegneria suggested by the phylogenetic analyses. In addition, our analyses provide support for the hypothesis that at least some annual Triticeae taxa are derived from their perennial relatives. PMID:23789993

  19. Natural Microbial Community Compositions Compared by a Back-Propagating Neural Network and Cluster Analysis of 5S rRNA

    PubMed Central

    Noble, P. A.; Bidle, K. D.; Fletcher, M.

    1997-01-01

    The community compositions of free-living and particle-associated bacteria in the Chesapeake Bay estuary were analyzed by comparing banding patterns of stable low-molecular-weight RNA (SLMW RNA) which include 5S rRNA and tRNA molecules. By analyzing images of autoradiographs of SLMW RNAs on polyacrylamide gels, band intensities of 5S rRNA were converted to binary format for transmission to a back-propagating neural network (NN). The NN was trained to relate binary input to sample stations, collection times, positions in the water column, and sample types (e.g., particle-associated versus free-living communities). Dendrograms produced by using Euclidean distance and average and Ward's linkage methods on data of three independently trained NNs yielded the following results. (i) Community compositions of Chesapeake Bay water samples varied both seasonally and spatially. (ii) Although there was no difference in the compositions of free-living and particle-associated bacteria in the summer, these community types differed significantly in the winter. (iii) In the summer, most bay samples had a common 121-nucleotide 5S rRNA molecule. Although this band occurred in the top water of midbay samples, it did not occur in particle-associated communities of bottom-water samples. (iv) Regardless of the season, midbay samples had the greatest variety of 5S rRNA sizes. The utility of NNs for interpreting complex banding patterns in electrophoresis gels was demonstrated. PMID:16535593

  20. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  1. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    PubMed Central

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387

  2. Comparative analysis of the genes encoding 23S-5S rRNA intergenic spacer regions of Lactobacillus casei-related strains.

    PubMed

    Chen, H; Lim, C K; Lee, Y K; Chan, Y N

    2000-03-01

    In this study, investigations into the 23S-5S rRNA intergenic spacer regions (ISRs) of the Lactobacillus casei group were performed. A 1.6 kb fragment, from Lactobacillus paracasei strain ATCC 27092, containing part of the 5S rRNA gene (60 bp), the 5S-23S spacer region (198 bp) and part of the 23S rRNA gene (1295 bp) was cloned and sequenced (GenBank no. AF098107). This fragment was used as a probe to determine the rRNA restriction fragment length polymorphism (RFLP) patterns of nine strains belonging to the Lactobacillus casei group, along with four other non-Lactobacillus casei lactobacilli species. A pair of PCR primers, 23-Fl and 5-Ru, was designed and used for PCR amplification of the 23S-5S rRNA ISRs of these strains. The ISR length and sequence polymorphisms provided additional information for the taxonomic study of the Lactobacillus casei group. The spacer-length polymorphism of Lactobacillus rhamnosus was distinct from those of the other strains and this observation is consistent with the classification of Lactobacillus rhamnosus proposed by Mori et al. For all Lactobacillus casei and Lactobacillus paracasei strains, two major bands (approx. 250 and 170 bp in size) were obtained except in the case of Lactobacillus paracasei subsp. tolerans strain NCIMB 9709T, which yielded only one amplified product (250 bp). The sequencing data of the PCR products of seven well-characterized Lactobacillus casei and Lactobacillus paracasei strains revealed the presence of a 76/80 bp insertion/deletion with some random, single-base substitutions between the longer and shorter spacers for each respective strain. A few base variations were also detected within different strains in this group although the overall sequence similarity was very high (95.9-99.5%). The rRNA RFLP and the spacer sequence of Lactobacillus casei type strain ATCC 393T exhibited unique identities in this cluster. On the other hand, Lactobacillus casei strain ATCC 334 showed a high level of similarity

  3. Localization of 5S and 25S rRNA genes on somatic and meiotic chromosomes in Capsicum species of chili pepper.

    PubMed

    Kwon, Jin-Kyung; Kim, Byung-Dong

    2009-02-28

    The loci of the 5S and 45S rRNA genes were localized on chromosomes in five species of Capsicum, namely, annuum, chacoense, frutescens, baccatum, and chinense by FISH. The 5S rDNA was localized to the distal region of one chromosome in all species observed. The number of 45S rDNA loci varied among species; one in annuum, two in chacoense, frutescens, and chinense, and four in baccatum, with the exceptions that 'CM334' of annuum had three loci and 'tabasco' of frutescens had one locus. 'CM334'-derived BAC clones, 384B09 and 365P05, were screened with 5S rDNA as a probe, and BACs 278M03 and 262A23 were screened with 25S rDNA as a probe. Both ends of these BAC clones were sequenced. FISH with these BAC probes on pachytenes from 'CM334' plant showed one 5S rDNA locus and three 45S rDNA loci, consistent with the patterns on the somatic chromosomes. The 5S rDNA probe was also applied on extended DNA fibers to reveal that its coverage measured as long as 0.439 Mb in the pepper genome. FISH techniques applied on somatic and meiotic chromosomes and fibers have been established for chili to provide valuable information about the copy number variation of 45S rDNA and the actual physical size of the 5S rDNA in chili. PMID:19277503

  4. The karyotype and 5S rRNA genes from Spanish individuals of the bat species Rhinolophus hipposideros (Rhinolophidae; Chiroptera).

    PubMed

    Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio

    2008-11-01

    The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair. PMID:18066670

  5. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  6. Mutations in TFIIIA that increase stability of the TFIIIA-5 S rRNA gene complex: unusual effects on the kinetics of complex assembly and dissociation.

    PubMed

    Brady, Kristina L; Ponnampalam, Stephen N; Bumbulis, Michael J; Setzer, David R

    2005-07-22

    We have identified four mutations in Xenopus TFIIIA that increase the stability of TFIIIA-5 S rRNA gene complexes. In each case, the mutation has a relatively modest effect on equilibrium binding affinity. In three cases, these equilibrium binding effects can be ascribed primarily to decreases in the rate constant for protein-DNA complex dissociation. In the fourth case, however, a substitution of phenylalanine for the wild-type leucine at position 148 in TFIIIA results in much larger compensating changes in the kinetics of complex assembly and dissociation. The data support a model in which a relatively unstable population of complexes with multi-component dissociation kinetics forms rapidly; complexes then undergo a slow conformational change that results in very stable, kinetically homogeneous TFIIIA-DNA complexes. The L148F mutant protein acts as a particularly potent transcriptional activator when it is fused to the VP16 activation domain and expressed in yeast cells. Substitution of L148 to tyrosine or tryptophan produces an equally strong transcriptional activator. Substitution to histidine results in genetic and biochemical effects that are more modest than, but similar to, those observed with the L148F mutation. We propose that an amino acid with a planar side chain at position 148 can intercalate between adjacent base pairs in the intermediate element of the 5 S rRNA gene. Intercalation occurs slowly but results in a very stable DNA-protein complex. These results suggest that transcriptional activation by a cis-acting sequence element is largely dependent on the kinetic, rather than the thermodynamic, stability of the complex formed with an activator protein. Thus, transcriptional activation is dependent in large part on the lifetime of the activator-DNA complex rather than on binding site occupancy at steady state. Introduction of intercalating amino acids into zinc finger proteins may be a useful tool for producing artificial transcription factors with

  7. Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp.

    EPA Science Inventory

    Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

  8. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. PMID:25261903

  9. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    PubMed

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes. PMID:26835745

  10. Comparison of Gull Feces-specific Assays Targeting the 16S rRNA Gene of Catellicoccus Marimammalium and Streptococcus spp.

    EPA Science Inventory

    Two novel gull-specific qPCR assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR-green-based assay targeting Streptococcus spp. (i.e., gull3) and a TaqMan qPCR assay targeting Catellicoccus marimammalium (i.e., gull4). The main objectives ...

  11. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central

    2012-01-01

    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  12. Genetic and cytogenetic analyses of the A genome of Triticum monococcum. VIII. Localization of rDNAs and characterization of 5S rRNA genes.

    PubMed

    Kim, N S; Kuspira, J; Armstrong, K; Bhambhani, R

    1993-02-01

    In situ hybridization with [3H]dCTP labelled pScT7 (5S rDNA) and pTa80 (18S + 26S rDNA) indicated that both hybridized to the terminal regions of two pairs of chromosomes in Triticum monococcum. When the hybridization was performed with a mixture of both probes, only two pairs of chromosome arms were labelled, which suggested that the loci of both genes were located in juxtaposition to one another. Both probes labelled one pair of sites more heavily than the other. Southern analysis of 5S with BamHI-digested DNA from 12 accessions of T. monococcum (including T. urartu) produced two superimposed ladders of approximate sizes of 500 and 330 bp, which differ from T. aestivum in which 500- and 420-bp ladders were found. The 500-bp ladder is derived from chromosome 5A (5SDna-A2) and the 330-bp ladder from chromosome 1A (5SDna-A1). The recognition site for SstI was present in the long spacer region but absent in the short spacer as in T. aestivum; however, unlike T. aestivum, there were HaeIII (GGCC) and HindIII (AAGCTT) recognition sites in the short spacer region. The TaqI recognition sites (TCGA) in the long and short spacer regions are probably more highly methylated in T. monococcum than in T. aestivum. The results have implications regarding the evolutionary changes that occurred in the A genome of the hexaploid compared with the diploid. PMID:18469972

  13. Loop-mediated isothermal amplification assay for 16S rRNA methylase genes in Gram-negative bacteria.

    PubMed

    Nagasawa, Mitsuaki; Kaku, Mitsuo; Kamachi, Kazunari; Shibayama, Keigo; Arakawa, Yoshichika; Yamaguchi, Keizo; Ishii, Yoshikazu

    2014-10-01

    Using the loop-mediated isothermal amplification (LAMP) method, we developed a rapid assay for detection of 16S rRNA methylase genes (rmtA, rmtB, and armA), and investigated 16S rRNA methylase-producing strains among clinical isolates. Primer Explorer V3 software was used to design the LAMP primers. LAMP primers were prepared for each gene, including two outer primers (F3 and B3), two inner primers (FIP and BIP), and two loop primers (LF and LB). Detection was performed with the Loopamp DNA amplification kit. For all three genes (rmtA, rmtB, and armA), 10(2) copies/tube could be detected with a reaction time of 60 min. When nine bacterial species (65 strains saved in National Institute of Infectious Diseases) were tested, which had been confirmed to possess rmtA, rmtB, or armA by PCR and DNA sequencing, the genes were detected correctly in these bacteria with no false negative or false positive results. Among 8447 clinical isolates isolated at 36 medical institutions, the LAMP method was conducted for 191 strains that were resistant to aminoglycosides based on the results of antimicrobial susceptibility tests. Eight strains were found to produce 16S rRNA methylase (0.09%), with rmtB being identified in three strains (0.06%) of 4929 isolates of Enterobacteriaceae, rmtA in three strains (0.10%) of 3284 isolates of Pseudomonas aeruginosa, and armA in two strains (0.85%) of 234 isolates of Acinetobacter spp. At present, the incidence of strains possessing 16S rRNA methylase genes is very low in Japan. However, when Gram-negative bacteria showing high resistance to aminoglycosides are isolated by clinical laboratories, it seems very important to investigate the status of 16S rRNA methylase gene-harboring bacilli and monitor their trends among Japanese clinical settings. PMID:25179393

  14. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  15. Physical and genetic maps of the Leptospira interrogans serovar icterohaemorrhagiae strain Ictero no.1 chromosome and sequencing of a 19-kb region of the genome containing the 5S rRNA gene.

    PubMed

    Takahashi, Y; Akase, K; Hirano, H; Fukunaga, M

    1998-07-17

    We report the construction of physical and genetic maps of the chromosome of Leptospira interrogans serovar icterohaemorrhagiae strain Ictero No.1 using pulsed-field gel electrophoresis of DNA fragments generated by digestion with enzymes SrfI, AscI, FseI, and NotI and using reciprocal hybridization. We also sequenced the 19-kilobase (kb) DNA segment including the one gene for 5S rRNA (rrf) of pathogenic Leptospira. The size of the chromosome of the strain Ictero No.1 was estimated to be 4673kb and was found to be similar to those of the chromosomes of the leptospira strains Verdun (serovar icterohaemorrhagiae) and RZ11 (serovar pomona). The strains Verdun and RZ11 carry a small 350-kb replicon (minichromosome), and the strain Ictero No.1 also contained the same kind of molecule together with the chromosome. The physical maps of the strains Ictero No.1 and Verdun were almost identical, as were the locations of the selected genes, except for the location of one of the 16S rRNA genes. Overall, the genetic organization appeared to be conserved within the serovar icterohaemorrhagiae strains. In the sequenced region, we identified 10 putative ORFs and one rrf sequence, and the transcription orientations were all the same. A homology search for the products deduced from the sequenced data revealed that the orf H exhibited high similarity to malic acid enzyme of Haemophilus influenzae and fumarate hydratase of Escherichia coli (orf J). The rest of the putative products encoded by ORFs in the sequenced region showed little similarity with the proteins contained in the databases and were considered to be unknown proteins. PMID:9666070

  16. Survey of Culture, GoldenGate Assay, Universal Biosensor Assay, and 16S rRNA Gene Sequencing as Alternative Methods of Bacterial Pathogen Detection

    PubMed Central

    Pop, Mihai; Antonio, Martin; Walker, Alan W.; Mai, Volker; Ahmed, Dilruba; Oundo, Joseph; Tamboura, Boubou; Panchalingam, Sandra; Levine, Myron M.; Kotloff, Karen; Li, Shan; Magder, Laurence S.; Paulson, Joseph N.; Liu, Bo; Ikumapayi, Usman; Ebruke, Chinelo; Dione, Michel; Adeyemi, Mitchell; Rance, Richard; Stares, Mark D.; Ukhanova, Maria; Barnes, Bret; Lewis, Ian; Ahmed, Firoz; Alam, Meer Taifur; Amin, Ruhul; Siddiqui, Sabbir; Ochieng, John B.; Ouma, Emmanuel; Juma, Jane; Mailu, Eunice; Omore, Richard; O'Reilly, Ciara E.; Hannis, James; Manalili, Sheri; DeLeon, Jonna; Yasuda, Irene; Blyn, Lawrence; Ranken, Raymond; Li, Feng; Housley, Roberta; Ecker, David J.; Hossain, M. Anowar; Breiman, Robert F.; Morris, J. Glenn; McDaniel, Timothy K.; Parkhill, Julian; Saha, Debasish; Sampath, Rangarajan; Stine, O. Colin; Nataro, James P.

    2013-01-01

    Cultivation-based assays combined with PCR or enzyme-linked immunosorbent assay (ELISA)-based methods for finding virulence factors are standard methods for detecting bacterial pathogens in stools; however, with emerging molecular technologies, new methods have become available. The aim of this study was to compare four distinct detection technologies for the identification of pathogens in stools from children under 5 years of age in The Gambia, Mali, Kenya, and Bangladesh. The children were identified, using currently accepted clinical protocols, as either controls or cases with moderate to severe diarrhea. A total of 3,610 stool samples were tested by established clinical culture techniques: 3,179 DNA samples by the Universal Biosensor assay (Ibis Biosciences, Inc.), 1,466 DNA samples by the GoldenGate assay (Illumina), and 1,006 DNA samples by sequencing of 16S rRNA genes. Each method detected different proportions of samples testing positive for each of seven enteric pathogens, enteroaggregative Escherichia coli (EAEC), enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), Shigella spp., Campylobacter jejuni, Salmonella enterica, and Aeromonas spp. The comparisons among detection methods included the frequency of positive stool samples and kappa values for making pairwise comparisons. Overall, the standard culture methods detected Shigella spp., EPEC, ETEC, and EAEC in smaller proportions of the samples than either of the methods based on detection of the virulence genes from DNA in whole stools. The GoldenGate method revealed the greatest agreement with the other methods. The agreement among methods was higher in cases than in controls. The new molecular technologies have a high potential for highly sensitive identification of bacterial diarrheal pathogens. PMID:23884998

  17. Survey of culture, goldengate assay, universal biosensor assay, and 16S rRNA Gene sequencing as alternative methods of bacterial pathogen detection.

    PubMed

    Lindsay, Brianna; Pop, Mihai; Antonio, Martin; Walker, Alan W; Mai, Volker; Ahmed, Dilruba; Oundo, Joseph; Tamboura, Boubou; Panchalingam, Sandra; Levine, Myron M; Kotloff, Karen; Li, Shan; Magder, Laurence S; Paulson, Joseph N; Liu, Bo; Ikumapayi, Usman; Ebruke, Chinelo; Dione, Michel; Adeyemi, Mitchell; Rance, Richard; Stares, Mark D; Ukhanova, Maria; Barnes, Bret; Lewis, Ian; Ahmed, Firoz; Alam, Meer Taifur; Amin, Ruhul; Siddiqui, Sabbir; Ochieng, John B; Ouma, Emmanuel; Juma, Jane; Mailu, Eunice; Omore, Richard; O'Reilly, Ciara E; Hannis, James; Manalili, Sheri; Deleon, Jonna; Yasuda, Irene; Blyn, Lawrence; Ranken, Raymond; Li, Feng; Housley, Roberta; Ecker, David J; Hossain, M Anowar; Breiman, Robert F; Morris, J Glenn; McDaniel, Timothy K; Parkhill, Julian; Saha, Debasish; Sampath, Rangarajan; Stine, O Colin; Nataro, James P

    2013-10-01

    Cultivation-based assays combined with PCR or enzyme-linked immunosorbent assay (ELISA)-based methods for finding virulence factors are standard methods for detecting bacterial pathogens in stools; however, with emerging molecular technologies, new methods have become available. The aim of this study was to compare four distinct detection technologies for the identification of pathogens in stools from children under 5 years of age in The Gambia, Mali, Kenya, and Bangladesh. The children were identified, using currently accepted clinical protocols, as either controls or cases with moderate to severe diarrhea. A total of 3,610 stool samples were tested by established clinical culture techniques: 3,179 DNA samples by the Universal Biosensor assay (Ibis Biosciences, Inc.), 1,466 DNA samples by the GoldenGate assay (Illumina), and 1,006 DNA samples by sequencing of 16S rRNA genes. Each method detected different proportions of samples testing positive for each of seven enteric pathogens, enteroaggregative Escherichia coli (EAEC), enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), Shigella spp., Campylobacter jejuni, Salmonella enterica, and Aeromonas spp. The comparisons among detection methods included the frequency of positive stool samples and kappa values for making pairwise comparisons. Overall, the standard culture methods detected Shigella spp., EPEC, ETEC, and EAEC in smaller proportions of the samples than either of the methods based on detection of the virulence genes from DNA in whole stools. The GoldenGate method revealed the greatest agreement with the other methods. The agreement among methods was higher in cases than in controls. The new molecular technologies have a high potential for highly sensitive identification of bacterial diarrheal pathogens. PMID:23884998

  18. Sensitivity and Specificity of a Rapid rRNA Gene Probe Assay for Simultaneous Identification of Staphylococcus aureus and Detection of mecA

    PubMed Central

    Kaplan, Shannon; Marlowe, Elizabeth M.; Hogan, James J.; Doymaz, Mehmet; Bruckner, David A.; Simor, Andrew E.

    2005-01-01

    rRNA gene sequences were used for identification and target adequacy controls in a DNA probe assay to identify isolates as Staphylococcus and, more specifically, as S. aureus within 1 hour. mecA status was simultaneously determined using a specific DNA probe. The target adequacy control guarded against false-negative mecA results. PMID:16000472

  19. Quantitative identification of fecal water pollution sources by TaqMan real-time PCR assays using Bacteroidales 16S rRNA genetic markers.

    PubMed

    Lee, Dae-Young; Weir, Susan C; Lee, Hung; Trevors, Jack T

    2010-12-01

    PCR-based analysis of Bacteroidales 16S rRNA genes has emerged as a promising tool to identify sources of fecal water pollution. In this study, three TaqMan real-time PCR assays (BacGeneral, BacHuman, and BacBovine) were developed and evaluated for their ability to quantitatively detect general (total), human-specific, and bovine-specific Bacteroidales 16S rRNA genetic markers. The detection sensitivity was determined to be 6.5 copies of 16S rRNA gene for the BacGeneral and BacHuman assays and 10 copies for the BacBovine assay. The assays were capable of detecting approximately one to two cells per PCR. When tested with 70 fecal samples from various sources (human, cattle, pig, deer, dog, cat, goose, gull, horse, and raccoon), the three assays positively identified the target markers in all samples without any false-negative results. The BacHuman and BacBovine assays exhibited false-positive reactions with non-target samples in a few cases. However, the level of the false-positive reactions was about 50 times smaller than that of the true-positive ones, and therefore, these cross-reactions were unlikely to cause misidentifications of the fecal pollution sources. Microbial source-tracking capability was tested at two freshwater streams of which water quality was influenced by human and cattle feces, respectively. The assays accurately detected the presence of the corresponding host-specific markers upon fecal pollution and the persistence of the markers in downstream areas. The assays are expected to reliably determine human and bovine fecal pollution sources in environmental water samples. PMID:20871990

  20. Loop-mediated isothermal amplification assay for detection of Histomonas meleagridis infection in chickens targeting the 18S rRNA sequences.

    PubMed

    Xu, Jinjun; Qu, Chanbao; Tao, Jianping

    2014-01-01

    Histomonas meleagridis is the causative agent of histomonosis, a disease of gallinaceous fowl characterized by necrotic typhlitis, hepatitis, and high mortality. To develop a rapid and sensitive method for specific detection of H. meleagridis, an assay based on loop-mediated isothermal amplification (LAMP) targeting the 18S rRNA gene was established. The detection limit of the LAMP assay was 10 copies for standard plasmids containing an 18S rRNA gene fragment, which was superior to that of a classical PCR method. Specificity tests revealed that there was no cross-reaction with other protozoa such as Trichomonas gallinae, Blastocytis sp, Tetratrichomonas gallinarum, Plasmodium gallinaceum, Toxoplasma gondii, Eimeria tenella, Leucocytozoon caulleryi and Leucocytozoon sabrazesi. The assay was evaluated for its diagnostic utility using liver and caeca samples collected from suspected field cases, the detection rate was 100 and 97.92%, respectively. These results indicate that the LAMP assay may be a useful tool for rapid detection and identification of H. meleagridis in poultry. PMID:24320623

  1. Comparison of Gull Feces-Specific Assays Targeting the 16S rRNA Genes of Catellicoccus marimammalium and Streptococcus spp.

    PubMed Central

    Ryu, Hodon; Griffith, John F.; Khan, Izhar U. H.; Hill, Stephen; Edge, Thomas A.; Toledo-Hernandez, Carlos; Gonzalez-Nieves, Joel

    2012-01-01

    Two novel gull-specific quantitative PCR (qPCR) assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR green assay targeting Streptococcus spp. (gull3) and a hydrolysis TaqMan assay targeting Catellicoccus marimammalium (gull4). The objectives of this study were to compare the host specificity of a previous C. marimammalium qPCR assay (gull2) with that of the new markers and to examine the presence of the three gull markers in environmental water samples from different geographic locations. Most of the gull fecal samples tested (n = 255) generated positive signals with the gull2 and gull4 assays (i.e., >86%), whereas only 28% were positive with gull3. Low prevalence and abundance of tested gull markers (0.6 to 15%) were observed in fecal samples from six nonavian species (n = 180 fecal samples), whereas the assays cross-reacted to some extent (13 to 31%) with other (nongull) avian fecal samples. The gull3 assay was positive against fecal samples from 11 of 15 avian species, including gull. Of the presumed gull-impacted water samples (n = 349), 86%, 59%, and 91% were positive with the gull2, the gull3, and the gull4 assays, respectively. Approximately 5% of 239 non-gull-impacted water samples were positive with the gull2 and the gull4 assays, whereas 21% were positive witg the gull3 assay. While the relatively high occurrence of gull2 and gull4 markers in waters impacted by gull feces suggests that these assays could be used in environmental monitoring studies, the data also suggest that multiple avian-specific assays will be needed to accurately assess the contribution of different avian sources in recreational waters. PMID:22226950

  2. Comparison of gull feces-specific assays targeting the 16S rRNA genes of Catellicoccus marimammalium and Streptococcus spp.

    PubMed

    Ryu, Hodon; Griffith, John F; Khan, Izhar U H; Hill, Stephen; Edge, Thomas A; Toledo-Hernandez, Carlos; Gonzalez-Nieves, Joel; Santo Domingo, Jorge

    2012-03-01

    Two novel gull-specific quantitative PCR (qPCR) assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR green assay targeting Streptococcus spp. (gull3) and a hydrolysis TaqMan assay targeting Catellicoccus marimammalium (gull4). The objectives of this study were to compare the host specificity of a previous C. marimammalium qPCR assay (gull2) with that of the new markers and to examine the presence of the three gull markers in environmental water samples from different geographic locations. Most of the gull fecal samples tested (n = 255) generated positive signals with the gull2 and gull4 assays (i.e., >86%), whereas only 28% were positive with gull3. Low prevalence and abundance of tested gull markers (0.6 to 15%) were observed in fecal samples from six nonavian species (n = 180 fecal samples), whereas the assays cross-reacted to some extent (13 to 31%) with other (nongull) avian fecal samples. The gull3 assay was positive against fecal samples from 11 of 15 avian species, including gull. Of the presumed gull-impacted water samples (n = 349), 86%, 59%, and 91% were positive with the gull2, the gull3, and the gull4 assays, respectively. Approximately 5% of 239 non-gull-impacted water samples were positive with the gull2 and the gull4 assays, whereas 21% were positive witg the gull3 assay. While the relatively high occurrence of gull2 and gull4 markers in waters impacted by gull feces suggests that these assays could be used in environmental monitoring studies, the data also suggest that multiple avian-specific assays will be needed to accurately assess the contribution of different avian sources in recreational waters. PMID:22226950

  3. Comparison of two poultry litter qPCR assays targeting the 16S rRNA gene of Brevibacterium sp.

    PubMed

    Ryu, Hodon; Elk, Michael; Khan, Izhar U H; Harwood, Valerie J; Molina, Marirosa; Edge, Thomas A; Domingo, Jorge Santo

    2014-01-01

    Chicken feces commonly contain human pathogens and are also important sources of fecal pollution in environmental waters. Consequently, methods that can detect chicken fecal pollution are needed in public health and environmental monitoring studies. In this study, we compared a previously developed SYBR green qPCR assay (LA35) to a novel TaqMan qPCR assay (CL) for the environmental detection of poultry-associated fecal pollution. We tested both assays against chicken litter (n = 40), chicken fecal samples (n = 186), non-chicken fecal sources (n = 484), and environmental water samples (n = 323). Most chicken litter samples (i.e., ≥ 98%) were positive for both assays with relatively high signal intensities, whereas only 23% and 12% of poultry fecal samples (n = 186) were positive with the LA35 and the CL assays, respectively. Data using fecal samples from non-target animal species showed that the assays are highly host-associated (≥ 95%). Bayesian statistical models showed that the two assays are associated with relatively low probability of false-positive and false-negative signals in water samples. The CL marker had a lower prevalence than the LA35 assay when tested against environmental water samples (i.e., 21% vs. 31% positive signals). However, by combining the results from the two assays the detection levels increased to 41%, suggesting that using multiple assays can improve the detection of chicken-fecal pollution in environmental waters. PMID:24169514

  4. Development and evaluation of a 28S rRNA gene-based nested PCR assay for P. falciparum and P. vivax

    PubMed Central

    Pakalapati, Deepak; Garg, Shilpi; Middha, Sheetal; Acharya, Jyoti; Subudhi, Amit K; Boopathi, Arunachalam P; Saxena, Vishal; Kochar, Sanjay K; Kochar, Dhanpat K; Das, Ashis

    2013-01-01

    The 28S rRNA gene was amplified and sequenced from P. falciparum and P. vivax isolates collected from northwest India. Based upon the sequence diversity of the Plasmodium 28SrRNA gene in comparison with its human counterpart, various nested polymerase chain reaction (PCR) primers were designed from the 3R region of the 28SrRNA gene and evaluated on field isolates. This is the first report demonstrating the utility of this gene for species-specific diagnosis of malaria for these two species, prevalent in India. The initial evaluation on 363 clinical isolates indicated that, in comparison with microscopy, which showed sensitivity and specificity of 85.39% and 100% respectively, the sensitivity and specificity of the nested PCR assay was found to be 99.08% and 100% respectively. This assay was also successful in detecting mixed infections that are undetected by microscopy. Our results demonstrate the utility of the 28S rRNA gene as a diagnostic target for the detection of the major plasmodial species infecting humans. PMID:23816509

  5. PCR assay based on DNA coding for 16S rRNA for detection and identification of mycobacteria in clinical samples.

    PubMed Central

    Kox, L F; van Leeuwen, J; Knijper, S; Jansen, H M; Kolk, A H

    1995-01-01

    A PCR and a reverse cross blot hybridization assay were developed for the detection and identification of mycobacteria in clinical samples. The PCR amplifies a part of the DNA coding for 16S rRNA with a set of primers that is specific for the genus Mycobacterium and that flanks species-specific sequences within the genes coding for 16S rRNA. The PCR product is analyzed in a reverse cross blot hybridization assay with probes specific for M. tuberculosis complex (pTub1), M. avium (pAvi3), M. intracellulare (pInt5 and pInt7), M. kansasii complex-M. scrofulaceum complex (pKan1), M. xenopi (pXen1), M. fortuitum (pFor1), M. smegmatis (pSme1), and Mycobacterium spp. (pMyc5a). The PCR assay can detect 10 fg of DNA, the equivalent of two mycobacteria. The specificities of the probes were tested with 108 mycobacterial strains (33 species) and 31 nonmycobacterial strains (of 17 genera). The probes pAvi3, pInt5, pInt7, pKan1, pXen1, and pMyc5a were specific. With probes pTub1, pFor1, and pSme1, slight cross hybridization occurred. However, the mycobacterial strains from which the cross-hybridizing PCR products were derived belonged to nonpathogenic or nonopportunistic species which do not occur in clinical samples. The test was used on 31 different clinical specimens obtained from patients suspected of having mycobacterial disease, including a patient with a double mycobacterial infection. The samples included sputum, bronchoalveolar lavage, tissue biopsy samples, cerebrospinal fluid, pus, peritoneal fluid, pleural fluid, and blood. The results of the PCR assay agreed with those of conventional identification methods or with clinical data, showing that the test can be used for the direct and rapid detection and identification of mycobacteria in clinical samples. PMID:8586707

  6. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  7. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  8. 5SRNAdb: an information resource for 5S ribosomal RNAs

    PubMed Central

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A.; Karlowski, Wojciech M.

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA–protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  9. A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

    PubMed

    Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

    2016-06-01

    The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia. PMID:26687075

  10. Detection of the A2058G and A2059G 23S rRNA Gene Point Mutations Associated with Azithromycin Resistance in Treponema pallidum by Use of a TaqMan Real-Time Multiplex PCR Assay

    PubMed Central

    Chi, Kai-Hua; Pillay, Allan; Nachamkin, Eli; Su, John R.; Ballard, Ronald C.

    2013-01-01

    Macrolide treatment failure in syphilis patients is associated with a single point mutation (either A2058G or A2059G) in both copies of the 23S rRNA gene in Treponema pallidum strains. The conventional method for the detection of both point mutations uses nested PCR combined with restriction enzyme digestions, which is laborious and time-consuming. We initially developed a TaqMan-based real-time duplex PCR assay for detection of the A2058G mutation, and upon discovery of the A2059G mutation, we modified the assay into a triplex format to simultaneously detect both mutations. The point mutations detected by the real-time triplex PCR were confirmed by pyrosequencing. A total of 129 specimens PCR positive for T. pallidum that were obtained from an azithromycin resistance surveillance study conducted in the United States were analyzed. Sixty-six (51.2%) of the 129 samples with the A2058G mutation were identified by both real-time PCR assays. Of the remaining 63 samples that were identified as having a macrolide-susceptible genotype by the duplex PCR assay, 17 (27%) were found to contain the A2059G mutation by the triplex PCR. The proportions of macrolide-susceptible versus -resistant genotypes harboring either the A2058G or the A2059G mutation among the T. pallidum strains were 35.6, 51.2, and 13.2%, respectively. None of the T. pallidum strains examined had both point mutations. The TaqMan-based real-time triplex PCR assay offers an alternative to conventional nested PCR and restriction fragment length polymorphism analyses for the rapid detection of both point mutations associated with macrolide resistance in T. pallidum. PMID:23284026

  11. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  12. Mitochondrial Enzyme Rhodanese Is Essential for 5 S Ribosomal RNA Import into Human Mitochondria*

    PubMed Central

    Smirnov, Alexandre; Comte, Caroline; Mager-Heckel, Anne-Marie; Addis, Vanessa; Krasheninnikov, Igor A.; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan

    2010-01-01

    5 S rRNA is an essential component of ribosomes. In eukaryotic cells, it is distinguished by particularly complex intracellular traffic, including nuclear export and re-import. The finding that in mammalian cells 5 S rRNA can eventually escape its usual circuit toward nascent ribosomes to get imported into mitochondria has made the scheme more complex, and it has raised questions about both the mechanism of 5 S rRNA mitochondrial targeting and its function inside the organelle. Previously, we showed that import of 5 S rRNA into mitochondria requires unknown cytosolic proteins. Here, one of them was identified as mitochondrial thiosulfate sulfurtransferase, rhodanese. Rhodanese in its misfolded form was found to possess a strong and specific 5 S rRNA binding activity, exploiting sites found earlier to function as signals of 5 S rRNA mitochondrial localization. The interaction with 5 S rRNA occurs cotranslationally and results in formation of a stable complex in which rhodanese is preserved in a compact enzymatically inactive conformation. Human 5 S rRNA in a branched Mg2+-free form, upon its interaction with misfolded rhodanese, demonstrates characteristic functional traits of Hsp40 cochaperones implicated in mitochondrial precursor protein targeting, suggesting that it may use this mechanism to ensure its own mitochondrial localization. Finally, silencing of the rhodanese gene caused not only a proportional decrease of 5 S rRNA import but also a general inhibition of mitochondrial translation, indicating the functional importance of the imported 5 S rRNA inside the organelle. PMID:20663881

  13. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  14. 4.5S ribonucleic acid, a novel ribosome component in the chloroplasts of flowering plants.

    PubMed Central

    Bowman, C M; Dyer, T A

    1979-01-01

    A species of low-molecular-weight ribosomal RNA, referred to as '4.5S rRNA', was found in addition to 5S rRNA in the large subunit of chloroplast ribosomes of a wide range of flowering plants. It was shown by sequence analysis that several variants of this RNA may occur in a plant. Furthermore, although in most flowering plants the predominant variant contains about 100 nucleotides, in the broad bean it has less than 80. It seems, therefore, to be much more diverse in size and sequence than the other ribosomal RNA species. Like 5S rRNA , it does not contain modified nucleotides and it is also unusual in having an unphosphorylated 5'-end. It is apparently neither a homologue of cytosol 5.8S rRNA nor a fragment of 23S rRNA. Images Fig. 1. Fig. 3. Fig. 4. PMID:540035

  15. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  16. Complete sequence and gene organization of the Nosema spodopterae rRNA gene.

    PubMed

    Tsai, Shu-Jen; Huang, Wei-Fone; Wang, Chung-Hsiung

    2005-01-01

    By sequencing the entire ribosomal RNA (rRNA) gene of Nosema spodopterae, we show here that its gene organization follows a pattern similar to the Nosema type species, Nosema bombycis, i.e. 5'-large subunit rRNA (2,497 bp)-internal transcribed spacer (185 bp)-small subunit rRNA (1,232 bp)-intergenic spacer (277 bp)-5S rRNA (114 bp)-3'. Gene sequences and the secondary structures of large subunit rRNA, small subunit rRNA, and 5S rRNA are compared with the known corresponding sequences and structures of closely related microsporidia. The results suggest that the Nosema genus may be heterogeneous and that the rRNA gene organization may be a useful characteristic for determining which species are closely related to the type species. PMID:15702980

  17. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA. PMID:21574431

  18. Nucleotide sequence of 5S ribosomal RNA from Aspergillus nidulans and Neurospora crassa.

    PubMed Central

    Piechulla, B; Hahn, U; McLaughlin, L W; Küntzel, H

    1981-01-01

    The nucleotide sequences of 5S rRNA molecules isolated from the cytosol and the mitochondria of the ascomycetes A. nidulans and N. crassa were determined by partial chemical cleavage of 3'-terminally labelled RNA. The sequence identity of the cytosolic and mitochondrial RNA preparations confirms the absence of mitochondrion-specific 5S rRNA in these fungi. The sequences of the two organisms differ in 35 positions, and each sequence differs from yeast 5S rRNA in 44 positions. Both molecules contain the sequence GCUC in place of GAAC or GAUY found in all other 5S rRNAs, indicating that this region is not universally involved in base-pairing to the invariant GTpsiC sequence of tRNAs. Images PMID:6453331

  19. 5S RRNA GENE DELETIONS CAUSE AN UNEXPECTEDLY HIGH FITNESS LOSS IN ESCHERICHIA COLI. (R825354)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  20. Microbial identification by immunohybridization assay of artificial RNA labels

    NASA Technical Reports Server (NTRS)

    Kourentzi, Katerina D.; Fox, George E.; Willson, Richard C.

    2002-01-01

    Ribosomal RNA (rRNA) and engineered stable artificial RNAs (aRNAs) are frequently used to monitor bacteria in complex ecosystems. In this work, we describe a solid-phase immunocapture hybridization assay that can be used with low molecular weight RNA targets. A biotinylated DNA probe is efficiently hybridized in solution with the target RNA, and the DNA-RNA hybrids are captured on streptavidin-coated plates and quantified using a DNA-RNA heteroduplex-specific antibody conjugated to alkaline phosphatase. The assay was shown to be specific for both 5S rRNA and low molecular weight (LMW) artificial RNAs and highly sensitive, allowing detection of as little as 5.2 ng (0.15 pmol) in the case of 5S rRNA. Target RNAs were readily detected even in the presence of excess nontarget RNA. Detection using DNA probes as small as 17 bases targeting a repetitive artificial RNA sequence in an engineered RNA was more efficient than the detection of a unique sequence.

  1. Secondary structure and domain architecture of the 23S and 5S rRNAs

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hershkovits, Eli; Xue, Yuzhen; Waterbury, Chris C.; Hsiao, Chiaolong; Stepanov, Victor G.; Gaucher, Eric A.; Grover, Martha A.; Harvey, Stephen C.; Hud, Nicholas V.; Wartell, Roger M.; Fox, George E.; Williams, Loren Dean

    2013-01-01

    We present a de novo re-determination of the secondary (2°) structure and domain architecture of the 23S and 5S rRNAs, using 3D structures, determined by X-ray diffraction, as input. In the traditional 2° structure, the center of the 23S rRNA is an extended single strand, which in 3D is seen to be compact and double helical. Accurately assigning nucleotides to helices compels a revision of the 23S rRNA 2° structure. Unlike the traditional 2° structure, the revised 2° structure of the 23S rRNA shows architectural similarity with the 16S rRNA. The revised 2° structure also reveals a clear relationship with the 3D structure and is generalizable to rRNAs of other species from all three domains of life. The 2° structure revision required us to reconsider the domain architecture. We partitioned the 23S rRNA into domains through analysis of molecular interactions, calculations of 2D folding propensities and compactness. The best domain model for the 23S rRNA contains seven domains, not six as previously ascribed. Domain 0 forms the core of the 23S rRNA, to which the other six domains are rooted. Editable 2° structures mapped with various data are provided (http://apollo.chemistry.gatech.edu/RibosomeGallery). PMID:23771137

  2. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana.

    PubMed

    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D

    1992-03-15

    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  3. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  4. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  5. Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

    PubMed Central

    Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

    2015-01-01

    RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

  6. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  7. Nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi and their phylogenetic positions

    PubMed Central

    Komiya, Hiroyuki; Hasegawa, Masami; Takemura, Shosuke

    1983-01-01

    The nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi were determined by chemical and enzymatic gel methods. Their phylogenetic positions among metazoans were derived from the 5S rRNA sequences by a computer analysis based on the maximum parsimony principle. It was suggested that the sponge is closely related to several invertebrates and the tunicate has affinity to vertebrates rather than invertebrates. PMID:6835845

  8. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. PMID:11779838

  9. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.

    2016-01-01

    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  10. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    PubMed Central

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding. PMID:11350033

  11. Development of multiplex loop-mediated isothermal amplification assays to detect medically important yeasts in dairy products.

    PubMed

    Kasahara, Kohei; Ishikawa, Hiroshi; Sato, Sumie; Shimakawa, Yasuhisa; Watanabe, Koichi

    2014-08-01

    Rapid detection of yeast contamination is important in the food industry. We have developed loop-mediated isothermal amplification (LAMP) assays to detect the emerging opportunistic pathogenic yeasts: Candida albicans, Candida glabrata, Candida tropicalis, the Candida parapsilosis group, Trichosporon asahii, and Trichosporon mucoides. These yeasts may cause deep-seated candidiasis or trichosporonosis. Four LAMP primer sets specific for Candida were designed to target the internal transcribed spacer 2 (ITS2) region between the 5.8S and 26S rRNA genes, and two LAMP primer sets specific for Trichosporon were designed to target the intergenic spacer 1 (IGS1) region between the 26S and 5S rRNA genes. The LAMP assays could detect these yeasts in a range between 10(0) and 10(3)  cells mL(-1) in a contaminated dairy product within 1 h. We also developed multiplex LAMP assays to detect these Candida or Trichosporon species in a single reaction. Multiplex LAMP assays can detect contamination if at least one of the target species is present; they are more time- and cost-efficient than conventional methods and could detect target yeasts with sensitivity close to that of the LAMP assays. Multiplex LAMP assays established in this study can be used as a primary screening method for yeast contamination in food products. PMID:24965944

  12. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  13. Direct detection of 16S rRNA in soil extracts by using oligonucleotide microarrays.

    PubMed

    Small, J; Call, D R; Brockman, F J; Straub, T M; Chandler, D P

    2001-10-01

    We report on the development and validation of a simple microarray method for the direct detection of intact 16S rRNA from unpurified soil extracts. Total RNAs from Geobacter chapellei and Desulfovibrio desulfuricans were hybridized to an oligonucleotide array consisting of universal and species-specific 16S rRNA probes. PCR-amplified products from Geobacter and Desulfovibrio were easily and specifically detected under a range of hybridization times, temperatures, and buffers. However, reproducible, specific hybridization and detection of intact rRNA could be accomplished only by using a chaperone-detector probe strategy. With this knowledge, assay conditions were developed for rRNA detection using a 2-h hybridization time at room temperature. Hybridization specificity and signal intensity were enhanced using fragmented RNA. Formamide was required in the hybridization buffer in order to achieve species-specific detection of intact rRNA. With the chaperone detection strategy, we were able to specifically hybridize and detect G. chapellei 16S rRNA directly from a total-RNA soil extract, without further purification or removal of soluble soil constituents. The detection sensitivity for G. chapellei 16S rRNA in soil extracts was at least 0.5 microg of total RNA, representing approximately 7.5 x 10(6) Geobacter cell equivalents of RNA. These results suggest that it is now possible to apply microarray technology to the direct detection of microorganisms in environmental samples, without using PCR. PMID:11571176

  14. Multiplex-polymerase chain reaction assay for the authentication of the mackerel Scomber colias in commercial canned products.

    PubMed

    Infante, Carlos; Manchado, Manuel

    2006-01-01

    A multiplex-polymerase chain reaction (PCR) system was developed for the authentication of the mackerel Scomber colias in commercial canned products. This novel method consists of an S. colias-specific fragment [159 base pairs (bp)] located in the nontranscribed spacer (NTS) sequence, and a Scomber genus-specific PCR product in the 5S rRNA gene (196-201 bp) as a positive amplification control. The system was assayed using 18 different canned products labeled as S. colias. A positive identification was made in all but one sample, revealing this methodology as a potential molecular tool for direct application in the authentication of S. colias canned products. PMID:16792069

  15. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. PMID:23933480

  16. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    PubMed

    Cangelosi, G A; Brabant, W H

    1997-07-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA probes to measure steady-state cellular pre-16S rRNA pools during growth state transitions in Escherichia coli. Pre-16S rRNA became undetectable when cells entered the stationary phase on rich medium and was replenished upon restoration of favorable growth conditions. These fluctuations were of much greater magnitude than concurrent fluctuations in the mature 16S rRNA pool. The extent of pre-16S rRNA depletion depended upon the circumstances limiting growth. It was significantly more pronounced in carbon-energy-starved cells than in nitrogen-starved cells or in cells treated with energy uncouplers. In the presence of the transcriptional inhibitor rifampin, rates of pre-16S rRNA depletion in carbon-energy-starved cells and nitrogen-starved cells were similar, suggesting that the difference between these conditions resides primarily at the level of pre-rRNA synthesis. Chloramphenicol, which inhibits the final steps in rRNA maturation, halted pre-16S rRNA depletion under all conditions. The data show that E. coli cells continue to process pre-rRNA after growth and rrn operon transcription cease, leading to drainage of the pre-rRNA pool. This supports the feasibility of using pre-rRNA-targeted probes to monitor bacterial growth in natural systems, with the caveat that patterns of pre-rRNA depletion vary with the conditions limiting growth. PMID:9226253

  17. Molecular phylogenetic studies on filarial parasites based on 5S ribosomal spacer sequences.

    PubMed

    Xie, H; Bain, O; Williams, S A

    1994-06-01

    This paper is the first large-scale molecular phylogenetic study on filarial parasites (family Onchocercidae) which includes 16 species of 6 genera: Brugia beaveri Ash et Little, 1962, B. buckleyi Dissanaike et Paramananthan, 1961; B. malayi (Brug, 1927) Buckley, 1960; B. pahangi (Buckley et Edeson, 1956) Buckley, 1960; B. patei (Buckley, Nelson et Heisch, 1958) Buckley, 1960; B. timori Partono et al, 1977; Wuchereria bancrofti (Cobbold, 1877) Seurat, 1921: W. kalimantani Palmieri. Purnomo, Dennis and Marwoto, 1980: Mansonella perstans (Manson, 1891) Eberhard et Orihel, 1984; loa loc, Stiles, 1905; Onchocerca volvulus (Leuckart, 1983) Railliet er Henry, 1910; O. ochengi Bwangamoi, 1969; O. gutturosa Neumann, 1910; Dirofilaria immitis (Leidy, 1856) Railliet e Henry, 1911; Acanthocheilonema viteae (Krepkogorskaya, 1933) Bain, Baker et Chabaud, 1982 and Litomosoides sigmodontis Chandler, 1931. 5S rRNA gene spacer region sequence data were collected by PCR, cloning and dideoxy sequencing. The 5S rRNA gene spacer region sequences were aligned and analyzed by maximum parsimony algorithms, distance methods and maximum likelihood methods to construct phylogenetic trees. Bootstrap analysis was used to test the robustness of the different phylogenetic reconstructions. The data indicated that 5S spacer region sequences are highly conserved within species yet differ significantly between species. Spliced leader sequences were observed in all of the 5S rDNA spacers with no sequence variation, although flanking region sequence and length heterogeneity was observed even within species. All of the various tree-building methods gave very similar results. This study identified four clades which are strongly supported by bootstrap analysis the Brugia clade; the Wuchereria clade; the Brugia-Wuchereria clade and the Onchocerca clade. The analyses indicated that L. sigmodontis and A. viteae may be the most primitive among the 16 species studied. The data did not show any close

  18. Analysis of the 5S RNA Pool in Arabidopsis thaliana: RNAs Are Heterogeneous and Only Two of the Genomic 5S Loci Produce Mature 5S RNA

    PubMed Central

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5′- and 3′-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. [EMBL accession nos: AF330825-AF331032; AF335777-AF335873.] PMID:11779838

  19. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  20. Higher-order structure of rRNA

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  1. Secondary structure of Tetrahymena thermophilia 5S ribosomal RNA as revealed by enzymatic digestion and microdensitometric analysis.

    PubMed Central

    Sneath, B; Vary, C; Pavlakis, G; Vournakis, J

    1986-01-01

    The secondary structure of [32P] end-labeled 5S rRNA from Tetrahymena thermophilia (strain B) has been investigated using the enzymes S1 nuclease, cobra venom ribonuclease and T2 ribonuclease. The results, analyzed by scanning microdensitometry and illustrated by three-dimensional computer graphics, support the secondary structure model of Curtiss and Vournakis for 5S rRNA. Aberrent mobility of certain RNA fragments on sequencing gels was observed as regions of band compression. These regions are postulated to be caused by stable internal base-pairing. The molecule was probed with T2 RNase in neutral (pH 7.5) and acidic (pH 4.5) buffers and only minor structural differences were revealed. One of the helices was found to be susceptible to enzymatic attack by both the single-strand and double-strand specific enzymes. These observations are evidence for the existence of dynamic structural equilibria in 5S rRNA. Images PMID:3005972

  2. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-04-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  3. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio

    2008-01-04

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  4. Mouse nucleolin binds to 4.5S RNAh, a small noncoding RNA.

    PubMed

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAh is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAh is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAh-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAhin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAh-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAh recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAh was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus. PMID:17971306

  5. Organization of rRNA structural genes in the archaebacterium Thermoplasma acidophilum.

    PubMed Central

    Tu, J; Zillig, W

    1982-01-01

    In the archaebacterium Thermoplasma acidophilum, each of the structural genes for 5S, 16S and 23S rRNA occur once per genome. In contrast to those of eubacteria and eukaryotes, they appear unlinked. The distance between the 16S and the 23S rDNA is at least 7.5 Kb, that between 23S and 5S rDNA at least 6 Kb and that between 16S and 5S rDNA at least 1.5 Kb. No linkage between those genes has been found by the analysis of recombinant plasmids carrying Bam HI and Hind III rDNA fragments as by hybridizing those plasmids to fragments of Thermoplasma DNA generated by 6 individual restriction endonucleases, recognizing hexanucleotide sequences. Images PMID:7155894

  6. Mouse Oocytes Transcribe Injected Xenopus 5S RNA Gene

    PubMed Central

    Brinster, Ralph L.; Chen, Howard Y.; Trumbauer, Myrna E.

    2016-01-01

    Transcripts produced after injection of the Xenopus 5S RNA gene into oocyte germinal vesicles of mice migrate electrophoretically with the 5S RNA marker, an indication that the gene is transcribed and processed with considerable accuracy, Approximately two 5S RNA molecules are transcribed per gene per hour. This system may be useful in studying DNA processing and gene regulation by the mammalian ovum and might be modified to allow permanent incorporation of specific genes into mice. PMID:7194505

  7. Renibacterium salmoninarum isolates from different sources possess two highly conserved copies of the rRNA operon .

    PubMed

    Grayson, T H; Alexander, S M; Cooper, L F; Gilpin, M L

    2000-07-01

    The nucleotide sequences of the rRNA genes and the 5' flanking region were determined for R. salmoninarum ATCC 33209T from overlapping products generated by PCR amplification from the genomic DNA. Comparison of the sequences with rRNA genes from a variety of bacteria demonstrated the close relatedness between R. salmoninarum and the high G+C group of the actinobacteria, in particular, Arthrobacter species. A regulatory element within the 5' leader of the rRNA operon was identical to an element, CL2, described for mycobacteria. PCR, DNA sequence analysis, and DNA hybridisation were performed to examine variation between isolates from diverse sources which represented the four 16S-23S rRNA intergenic spacer sequevars previously described for R. salmoninarum. Two 23S-5S rRNA intergenic spacer sequevars of identical length were found. DNA hybridisation using probes complementary to 23S rDNA and 16S rDNA identified two rRNA operons which were identical or nearly identical amongst 40 isolates sourced from a variety of countries. PMID:11016696

  8. Variable rRNA gene copies in extreme halobacteria

    SciTech Connect

    Sanz, J.L.; Marin, I.; Ramirez, L.; Amils, R. ); Abad, J.P.; Smith, C.L. )

    1988-08-25

    Using PFG electrophoresis techniques, the authors have examined the organization of rRNA gene in halobacterium species. The results show that the organization of rRNA genes among closely related halobacteria is quite heterogeneous. This contrasts with the high degree of conservation of rRNA sequence. The possible mechanism of such rRNA gene amplification and its evolutionary implications are discussed.

  9. 5S RNA sequence from the Philosamia silkworm: evidence for variable evolutionary rates in insect 5S RNA.

    PubMed Central

    Xian-Rong, G; Nicoghosian, K; Cedergren, R J

    1982-01-01

    The primary structure of 5S RNA isolated from the posterior silkgland of Philosamia cynthia ricini was determined using three in vitro labelling techniques. The derived sequence consists of 119 nucleotides and can be folded into the secondary structure model proposed for eukaryotic 5S RNAs. This 5S RNA differs from the Bombyx mori molecule in 9 positions and from the Drosophila melanogaster sequence in 14 positions. The comparison of evolutionary rates in insect 5S RNA with inferred rates in other eukaryotic phyla leads to the conclusion that 5S RNA evolution is not constant in different eukaryotic branches, a condition which must be taken into account in phylogenetic tree constructions. Images PMID:7145713

  10. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae

    PubMed Central

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-01-01

    Methylation of ribose sugars at the 2′-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2′-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5′ central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D′ box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  11. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae.

    PubMed

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-02-27

    Methylation of ribose sugars at the 2'-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2'-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5' central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D' box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  12. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and relevance to genomovar assignment

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic variability in 16S rRNA gene sequences has been demonstrated among isolates of Flavobacterium columnare and a restriction fragment length polymorphism (RFLP) assay is available for genetic typing this important fish pathogen. Interpretation of restriction patterns can be difficult due to th...

  13. Phylogenetic Analysis of Bacteroidales 16S rRNA Genes Unveils Sequences Specific to Diverse Swine Fecal Sources

    EPA Science Inventory

    Two of the currently available methods to assess swine fecal pollution (Bac1 and PF163) target Bacteroidales 16S rRNA genes. However, these assays have been shown to exhibit poor host-specificity and low detection limits in environmental waters, in part due to the limited number...

  14. Karyotypic diversification in Mytilus mussels (Bivalvia: Mytilidae) inferred from chromosomal mapping of rRNA and histone gene clusters

    PubMed Central

    2014-01-01

    Background Mussels of the genus Mytilus present morphologically similar karyotypes that are presumably conserved. The absence of chromosome painting probes in bivalves makes difficult verifying this hypothesis. In this context, we comparatively mapped ribosomal RNA and histone gene families on the chromosomes of Mytilus edulis, M. galloprovincialis, M. trossulus and M. californianus by fluorescent in situ hybridization (FISH). Results Major rRNA, core and linker histone gene clusters mapped to different chromosome pairs in the four taxa. In contrast, minor rRNA gene clusters showed a different behavior. In all Mytilus two of the 5S rDNA clusters mapped to the same chromosome pair and one of them showed overlapping signals with those corresponding to one of the histone H1 gene clusters. The overlapping signals on mitotic chromosomes became a pattern of alternate 5S rRNA and linker histone gene signals on extended chromatin fibers. Additionally, M. trossulus showed minor and major rDNA clusters on the same chromosome pair. Conclusion The results obtained suggest that at least some of the chromosomes bearing these sequences are orthologous and that chromosomal mapping of rRNA and histone gene clusters could be a good tool to help deciphering some of the many unsolved questions in the systematic classification of Mytilidae. PMID:25023072

  15. Microsporidian Encephalitozoon cuniculi, a unicellular eukaryote with an unusual chromosomal dispersion of ribosomal genes and a LSU rRNA reduced to the universal core.

    PubMed Central

    Peyretaillade, E; Biderre, C; Peyret, P; Duffieux, F; Méténier, G; Gouy, M; Michot, B; Vivarès, C P

    1998-01-01

    Microsporidia are eukaryotic parasites lacking mitochondria, the ribosomes of which present prokaryote-like features. In order to better understand the structural evolution of rRNA molecules in microsporidia, the 5S and rDNA genes were investigated in Encephalitozoon cuniculi . The genes are not in close proximity. Non-tandemly arranged rDNA units are on every one of the 11 chromosomes. Such a dispersion is also shown in two other Encephalitozoon species. Sequencing of the 5S rRNA coding region reveals a 120 nt long RNA which folds according to the eukaryotic consensus structural shape. In contrast, the LSU rRNA molecule is greatly reduced in length (2487 nt). This dramatic shortening is essentially due to truncation of divergent domains, most of them being removed. Most variable stems of the conserved core are also deleted, reducing the LSU rRNA to only those structural features preserved in all living cells. This suggests that the E.cuniculi LSU rRNA performs only the basic mechanisms of translation. LSU rRNA phylogenetic analysis with the BASEML program favours a relatively recent origin of the fast evolving microsporidian lineage. Therefore, the prokaryote-like ribosomal features, such as the absence of ITS2, may be derived rather than primitive characters. PMID:9671812

  16. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    PubMed Central

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  17. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  18. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  19. A Pol V–Mediated Silencing, Independent of RNA–Directed DNA Methylation, Applies to 5S rDNA

    PubMed Central

    Douet, Julien; Tutois, Sylvie; Tourmente, Sylvette

    2009-01-01

    The plant-specific RNA polymerases Pol IV and Pol V are essential to RNA–directed DNA methylation (RdDM), which also requires activities from RDR2 (RNA–Dependent RNA Polymerase 2), DCL3 (Dicer-Like 3), AGO4 (Argonaute), and DRM2 (Domains Rearranged Methyltransferase 2). RdDM is dedicated to the methylation of target sequences which include transposable elements, regulatory regions of several protein-coding genes, and 5S rRNA–encoding DNA (rDNA) arrays. In this paper, we have studied the expression of the 5S-210 transcript, a marker of silencing release at 5S RNA genes, to show a differential impact of RNA polymerases IV and V on 5S rDNA arrays during early development of the plant. Using a combination of molecular and cytological assays, we show that Pol IV, RDR2, DRM2, and Pol V, actors of the RdDM, are required to maintain a transcriptional silencing of 5S RNA genes at chromosomes 4 and 5. Moreover, we have shown a derepression associated to chromatin decondensation specific to the 5S array from chromosome 4 and restricted to the Pol V–loss of function. In conclusion, our results highlight a new role for Pol V on 5S rDNA, which is RdDM–independent and comes specifically at chromosome 4, in addition to the RdDM pathway. PMID:19834541

  20. Topoisomerase Assays

    PubMed Central

    Nitiss, John L.; Soans, Eroica; Rogojina, Anna; Seth, Aman; Mishina, Margarita

    2012-01-01

    Topoisomerases are nuclear enzymes that play essential roles in DNA replication, transcription, chromosome segregation, and recombination. All cells have two major forms of topoisomerases: type I, which makes single-stranded cuts in DNA, and type II enzymes, which cut and pass double-stranded DNA. DNA topoisomerases are important targets of approved and experimental anti-cancer agents. The protocols described in this unit are of assays used to assess new chemical entities for their ability to inhibit both forms of DNA topoisomerase. Included are an in vitro assay for topoisomerase I activity based on relaxation of supercoiled DNA and an assay for topoisomerase II based on the decatenation of double-stranded DNA. The preparation of mammalian cell extracts for assaying topoisomerase activity is described, along with a protocol for an ICE assay for examining topoisomerase covalent complexes in vivo and an assay for measuring DNA cleavage in vitro. PMID:22684721

  1. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  2. Simple detection of the 5S ribosomal RNA of Pneumocystis carinii using in situ hybridisation.

    PubMed Central

    Kobayashi, M; Urata, T; Ikezoe, T; Hakoda, E; Uemura, Y; Sonobe, H; Ohtsuki, Y; Manabe, T; Miyagi, S; Miyoshi, I

    1996-01-01

    AIMS: To investigate the effectiveness of digoxigenin incorporated double stranded DNA probes produced by the polymerase chain reaction (PCR), for the detection of Pneumocystis carinii, using in situ hybridisation (ISH). METHODS: Formalin fixed, paraffin wax embedded sections of 26 human lung samples from 11 patients with P carinii pneumonia (PCP), and 15 with various types of fungal and viral pneumonia, were obtained during necropsy or transbronchial lung biopsy. Three additional PCP induced rat lung samples were also tested. PCR probes were prepared using the digoxigenin labelling mixture, and they were amplified from the DNA of a PCP induced rat lung after administration of dexamethasone, on the basis that 5S ribosomal RNA sequences are identical in human and rat P carinii. ISH was performed using this probe, and visualised using the digoxigenin nucleic acid detection kit. An immunohistochemical study using anti-human Pneumocystis monoclonal antibody was also carried out in parallel. RESULTS: ISH positively stained eight (of eight) lung necropsy specimens from patients with PCP, three (of three) transbronchial lung biopsy specimens from patients with PCP, and none of the three PCP induced rat lung specimens. In contrast, none of the specimens from patients with pneumonia caused by Aspergillus sp (n = 5), Candida sp (n = 4), Cryptococcus sp (n = 2), mucormycosis (n = 2), or cytomegalovirus (n = 2) were positive on ISH or immunohistochemistry. CONCLUSIONS: Using a digoxigenin labelled PCR probe for the entire 5S rRNA sequence in conjunction with conventional staining, ISH is highly reactive and specific for the diagnosis of PCP. Images PMID:9038753

  3. Development and evaluation of immunochromatography to detect Gram-negative bacteria producing ArmA 16S rRNA methylase responsible for aminoglycoside resistance.

    PubMed

    Oshiro, Satoshi; Tada, Tatsuya; Kameoka, Yousuke; Suzuki, Kazuo; Ohmagari, Norio; Miyoshi-Akiyama, Tohru; Kirikae, Teruo

    2015-11-01

    Rapid and reliable detection of aminoglycoside-resistant bacteria is an important infection-control measure and a crucial aspect of antimicrobial chemotherapy. The enzyme 16S rRNA methylase has been shown to mediate aminoglycoside resistance in bacteria. This study describes a newly developed immunochromatographic assay using novel monoclonal antibodies (mAbs) that recognize ArmA 16S rRNA methylase. Epitope mapping showed that these mAbs recognized amino acids 1-93 of ArmA, which consists of 257 amino acids. Evaluation of the assay using ArmA producing and non-producing bacterial species, as well as bacteria producing other types of 16S rRNA methylases, indicated that immunochromatographic detection of the ArmA-type 16S rRNA methylase was fully consistent with PCR analysis for armA genes, with all immunochromatographically positive strains being resistant to aminoglycosides (MIC≥128μg/mL). The detection limit of the assay was 12ng ArmA. These findings indicate that this assay can be used for the rapid and reliable detection of the production of ArmA 16S rRNA methylase by Gram-negative bacteria, including Acinetobacter baumannii and Escherichia coli. PMID:26381663

  4. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  5. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    PubMed Central

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  6. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  7. Oligodeoxynucleotide probes for Campylobacter fetus and Campylobacter hyointestinalis based on 16S rRNA sequences.

    PubMed Central

    Wesley, I V; Wesley, R D; Cardella, M; Dewhirst, F E; Paster, B J

    1991-01-01

    Deoxyoligonucleotide probes were constructed for the identification of Campylobacter fetus and Campylobacter hyointestinalis based on 16S rRNA sequence data. Probes were targeted to hypervariable regions of 16S rRNA. Specificity of oligonucleotide probes was tested in a colony blot assay with type strains of 15 Campylobacter and Arcobacter species as well as in a slot blot format using genomic DNA extracted from field strains of C. fetus and C. hyointestinalis. Two oligonucleotides were constructed for C. fetus that hybridized with equal specificity with each of 57 biochemically confirmed isolates of C. fetus but not with any other Campylobacter species. The C. hyointestinalis probe reacted with 47 of 48 biochemically confirmed field isolates of C. hyointestinalis. In Southern blot hybridization of BglII digests of genomic DNA, the respective probes reacted within three restriction fragments of either C. hyointestinalis (7.2, 8.2, and 10.1 kb) or C. fetus (7.0, 7.7, and 9.0 kb). This suggests multiple copies of genes encoding 16S rRNA. Images PMID:1723076

  8. 5S Clavam Biosynthesis Is Controlled by an Atypical Two-Component Regulatory System in Streptomyces clavuligerus

    PubMed Central

    Kwong, Thomas; Zelyas, Nathan J.; Cai, Hui; Tahlan, Kapil; Wong, Annie

    2012-01-01

    Streptomyces clavuligerus produces a collection of five clavam metabolites, including the clinically important β-lactamase inhibitor clavulanic acid, as well as four structurally related metabolites called 5S clavams. The paralogue gene cluster of S. clavuligerus is one of three clusters of genes for the production of these clavam metabolites. A region downstream of the cluster was analyzed, and snk, res1, and res2, encoding elements of an atypical two-component regulatory system, were located. Mutation of any one of the three genes had no effect on clavulanic acid production, but snk and res2 mutants produced no 5S clavams, whereas res1 mutants overproduced 5S clavams. Reverse transcriptase PCR analyses showed that transcription of cvm7p (which encodes a transcriptional activator of 5S clavam biosynthesis) and 5S clavam biosynthetic genes was eliminated in snk and in res2 mutants but that snk and res2 transcription was unaffected in a cvm7p mutant. Both snk and res2 mutants could be complemented by introduction of cvm7p under the control of an independently regulated promoter. In vitro assays showed that Snk can autophosphorylate and transfer its phosphate group to both Res1 and Res2, and Snk-H365, Res1-D52, and Res2-D52 were identified as the phosphorylation sites for the system. Dephosphorylation assays indicated that Res1 stimulates dephosphorylation of Res2∼P. These results suggest a regulatory cascade in which Snk and Res2 form a two-component system controlling cvm7p transcription, with Res1 serving as a checkpoint to modulate phosphorylation levels. Cvm7P then activates transcription of 5S clavam biosynthetic genes. PMID:22751548

  9. Promoter of the Mycoplasma pneumoniae rRNA operon.

    PubMed Central

    Hyman, H C; Gafny, R; Glaser, G; Razin, S

    1988-01-01

    RNA transcripts starting from the 5' end of the single Mycoplasma pneumoniae rRNA operon were analyzed by several methods. By primer extension analysis a start site was found 62 nucleotides upstream from the start site of the 16S rRNA. This site was preceded by a putative Pribnow box; however, a defined -35 recognition region was absent. The cloned rRNA operon was transcribed in vitro by using purified RNA polymerase of Escherichia coli. A single start site could be demonstrated within a few nucleotides of the start site found by primer extension analysis of M. pneumoniae transcripts. When fragments from the cloned operon were used as hybridization probes, S1 nuclease mapping yielded a single transcript extending approximately 193 nucleotides upstream from the 16S rRNA start site. The region surrounding this endpoint did not resemble any known promoter sequence. Dot blot hybridization of M. pneumoniae RNA to three oligonucleotides consisting of nucleotides -5 to -21, -38 to -54, and -112 to -132 (from the start of the 16S rRNA gene) indicated that most rRNA transcripts were processed at the stem site preceding the 16S rRNA gene. The majority of the longer precursor transcripts, extending beyond this point, did not extend further upstream to an oligonucleotide consisting of nucleotides -112 to -132. It was concluded that transcription of the rRNA operon of M. pneumoniae is initiated by a single promoter. The nucleotide sequence of the region is presented. Images PMID:2838465

  10. Molecular identification of adulteration in mutton based on mitochondrial 16S rRNA gene.

    PubMed

    Xu, Jia; Zhao, Wei; Zhu, Mengru; Wen, Yuanju; Xie, Tao; He, Xiaoqian; Zhang, Yongfeng; Cao, Suizhong; Niu, Lili; Zhang, Hongping; Zhong, Tao

    2016-01-01

    The aim of this study is to set up a protocol for identification of the adulteration in mutton based on mitochondrial 16S rRNA gene. The multiplex polymerase chain reaction (multi-PCR) assay was carried out to trace the impure DNA in mutton. A universal primer pair yielded an approximate 610 bp fragment in mutton, pork, duck, chicken, horse and cat meats. The amplicons of multi-PCR assay represented the species-specific products, which could be discriminated by the size ranging from 106 bp to 532 bp. Subsequently, the authentication of each fragment was also confirmed by sequencing. Random analyses of adulterants with various meats yielded the identical results to their components, showing the suitability of the multi-PCR assay for tracing of adulterant meats with high-accuracy and precision. This assay was sensitive to detect the species-specific DNA in different proportional mixtures of mutton and duck/pork (9.1%-90.9%). In conclusion, this multi-PCR assay successfully discriminated the double-, triple-, quadruple-, and quintuple-mixtures containing variant counterparts. This method will be particularly useful in the detection of mutton adulteration in processed foods further. PMID:24739005

  11. Measurement of rRNA Variations in Natural Communities of Microorganisms on the Southeastern U.S. Continental Shelf †

    PubMed Central

    Kramer, Jonathan G.; Singleton, Fred L.

    1993-01-01

    The development of a clear understanding of the physiology of marine prokaryotes is complicated by the difficulties inherent in resolving the activity of various components of natural microbial communities. Application of appropriate molecular biological techniques offers a means of overcoming some of these problems. In this regard, we have used direct probing of bulk RNA purified from selective size fractions to examine variations in the rRNA content of heterotrophic communities and Synechococcus populations on the southeastern U.S. continental shelf. Heterotrophic communities in natural seawater cultures amended with selected substrates were examined. Synechococcus populations were isolated from the water column by differential filtration. The total cellular rRNA content of the target populations was assayed by probing RNA purified from these samples with an oligonucleotide complementing a universally conserved region in the eubacterial 16S rRNA (heterotrophs) or with a 1.5-kbp fragment encoding the Synechococcus sp. strain WH 7803 16S rRNA (cyanobacteria). The analyses revealed that heterotrophic bacteria responded to the addition of glucose and trace nutrients after a 6-h lag period. However, no response was detected after amino acids were added. The cellular rRNA content increased 48-fold before dropping to a value 20 times that detected before nutrients were added. Variations in the rRNA content from Synechococcus spp. followed a distinct diel pattern imposed by the phasing of cell division within the irradiance cycle. The results indicate that careful application of these appropriate molecular biological techniques can be of great use in discerning basic physiological characteristics of selected natural populations and the mechanisms which regulate growth at the subcellular level. Images PMID:16349009

  12. Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonid fish, detected by nested reverse transcription-PCR of 16S rRNA sequences.

    PubMed Central

    Magnússon, H B; Fridjónsson, O H; Andrésson, O S; Benediktsdóttir, E; Gudmundsdóttir, S; Andrésdóttir, V

    1994-01-01

    An assay based on reverse transcription and nested PCR amplification of hypervariable regions within the 16S rRNA sequence was used to specifically detect Renibacterium salmoninarum, the slowly growing causative agent of bacterial kidney disease in salmonid fish. This assay detected 1 to 10 bacteria per sample and took 1 to 2 days to perform. The assay was used to detect R. salmoninarum in ovarian fluid obtained from naturally infected fish. The assay was unreliable when it was used to examine kidney tissue. Images PMID:7529017

  13. Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonid fish, detected by nested reverse transcription-PCR of 16S rRNA sequences.

    PubMed

    Magnússon, H B; Fridjónsson, O H; Andrésson, O S; Benediktsdóttir, E; Gudmundsdóttir, S; Andrésdóttir, V

    1994-12-01

    An assay based on reverse transcription and nested PCR amplification of hypervariable regions within the 16S rRNA sequence was used to specifically detect Renibacterium salmoninarum, the slowly growing causative agent of bacterial kidney disease in salmonid fish. This assay detected 1 to 10 bacteria per sample and took 1 to 2 days to perform. The assay was used to detect R. salmoninarum in ovarian fluid obtained from naturally infected fish. The assay was unreliable when it was used to examine kidney tissue. PMID:7529017

  14. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    PubMed Central

    2010-01-01

    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  15. Genus- and Species-Specific PCR-Based Detection of Dairy Propionibacteria in Environmental Samples by Using Primers Targeted to the Genes Encoding 16S rRNA

    PubMed Central

    Rossi, Franca; Torriani, Sandra; Dellaglio, Franco

    1999-01-01

    PCR assays with primers targeted to the genes encoding 16S rRNA were developed for detection of dairy propionibacteria. Propionibacterium thoenii specific oligonucleotide PT3 was selected after partial resequencing. Tests allowed the detection of less than 10 cells per reaction from milk and cheese and 102 cells per reaction from forage and soil. PMID:10473444

  16. An improved molecular assay for Tritrichomonas foetus.

    PubMed

    Grahn, R A; BonDurant, R H; van Hoosear, K A; Walker, R L; Lyons, L A

    2005-01-01

    Tritrichomonas foetus (T. foetus) is the causative agent of bovine trichomonosis, a sexually transmitted disease leading to abortion (from 1 to 8 months gestation), infertility, and occasional pyometra. The annual losses to the U.S. beef industry are estimated to be in the hundreds of millions of dollars. Currently, the "gold standard" diagnostic test for trichomonosis in most countries is the cultivation of live organisms from reproductive secretions. The cultured organisms can then be followed by PCR assays with primers that amplify T. foetus to the exclusion of all other trichomonad species. Thus, negative results present as null data, indistinguishable from failed PCR amplification during T. foetus specific amplification. Our newly developed assay improves previously developed PCR based techniques by using diagnostic size variants from within the internal transcribed spacer 1 (ITS1) region that is between the 18S rRNA and 5.8S rRNA subunits. This new PCR assay amplifies trichomonad DNA from a variety of genera and positively identifies the causative agent in the bovine trichomonad infection. This approach eliminates false negatives found in some current assays as well as identifying the causative agent of trichomonad infection. Additionally, our assay incorporates a fluorescently labeled primer enabling high sensitivity and rapid assessment of the specific trichomonad species. Moreover, electrophoretic separation of amplified samples can be outsourced, thus eliminating the need for diagnostic laboratories to purchase expensive analysis equipment. PMID:15619373

  17. Quantitative Northern Blot Analysis of Mammalian rRNA Processing.

    PubMed

    Wang, Minshi; Pestov, Dimitri G

    2016-01-01

    Assembly of eukaryotic ribosomes is an elaborate biosynthetic process that begins in the nucleolus and requires hundreds of cellular factors. Analysis of rRNA processing has been instrumental for studying the mechanisms of ribosome biogenesis and effects of stress conditions on the molecular milieu of the nucleolus. Here, we describe the quantitative analysis of the steady-state levels of rRNA precursors, applicable to studies in mammalian cells and other organisms. We include protocols for gel electrophoresis and northern blotting of rRNA precursors using procedures optimized for the large size of these RNAs. We also describe the ratio analysis of multiple precursors, a technique that facilitates the accurate assessment of changes in the efficiency of individual pre-rRNA processing steps. PMID:27576717

  18. Helicase Assays

    PubMed Central

    Wang, Xin; Li, Jing; Diaz, Jason; You, Jianxin

    2016-01-01

    Helicases are a class of enzymes which are motor proteins using energy derived from ATP hydrolysis to move directionally along a nucliec acid phosphodiester backbone (such as DNA, RNA and DNA-RNA hybrids) and separate two annealed nucleic acid strands. Many cellular processes, such as transcription, DNA replication, recombination and DNA repair involve helicase activity. Here, we provide a protocol to analyze helicase activities in vitro. In this protocol, the DNA helicase protein Merkel cell polyomavirus large T-antigen was expressed in the mammalian cell line HEK293 and immoblized on an IgG resin. The helicase assay is performing while the protein is immoblized on IgG resin.

  19. Imprint of Ancient Evolution on rRNA Folding.

    PubMed

    Lanier, Kathryn A; Athavale, Shreyas S; Petrov, Anton S; Wartell, Roger; Williams, Loren Dean

    2016-08-23

    In a model describing the origin and evolution of the translation system, ribosomal RNA (rRNA) grew in size by accretion [Petrov, A. S., et al. (2015) History of the Ribosome and the Origin of Translation. Proc. Natl. Acad. Sci. U.S.A. 112, 15396-15401]. Large rRNAs were built up by iterative incorporation and encasement of small folded RNAs, in analogy with addition of new LEGOs onto the surface of a preexisting LEGO assembly. In this model, rRNA robustness in folding arises from inherited autonomy of local folding. We propose that rRNAs can be decomposed at various granularities, retaining folding mechanism and folding competence. To test these predictions, we disassembled Domain III of the large ribosomal subunit (LSU). We determined whether local rRNA structure, stability, and folding pathways are autonomous. Thermal melting, chemical footprinting, and circular dichroism were used to infer rules that govern folding of rRNA. We deconstructed Domain III of the LSU rRNA by mapping out its complex multistep melting pathway. We studied Domain III and two equal-size "sub-Domains" of Domain III. The combined results are consistent with a model in which melting transitions of Domain III are conserved upon cleavage into sub-Domains. Each of the eight melting transitions of Domain III corresponds in Tm and ΔH with a transition observed in one of the two isolated sub-Domains. The results support a model in which structure, stability, and folding mechanisms are dominated by local interactions and are unaffected by separation of the sub-Domains. Domain III rRNA is distinct from RNAs that form long-range cooperative interaction networks at early stages of folding or that do not fold reversibly. PMID:27428664

  20. Post-transcriptional Modifications Modulate rRNA Structure and Ligand Interactions.

    PubMed

    Jiang, Jun; Seo, Hyosuk; Chow, Christine S

    2016-05-17

    structural diversity offered by specific modifications in the chosen rRNA motifs, phage display was used to select peptides that bind with moderate (low micromolar) affinity and selectivity to modified h31, h44, and H69. Interactions between peptide ligands and RNAs were monitored by biophysical methods, including electrospray ionization mass spectrometry (ESI-MS), NMR, and surface plasmon resonance (SPR). The peptides compare well with natural compounds such as aminoglycosides in their binding affinities to the modified rRNA constructs. Some candidates were shown to exhibit specificity toward different modification states of the rRNA motifs. The selected peptides may be further optimized for improved RNA targeting or used in screening assays for new drug candidates. In this Account, we hope to stimulate interest in bioorganic and biophysical approaches, which may be used to deepen our understanding of other functionally important, naturally modified RNAs beyond the rRNAs. PMID:27064497

  1. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    PubMed Central

    2010-01-01

    Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s) occurring in 39.6% of the analyzed individuals (both male and female) were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH) was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs) enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement. PMID:20051104

  2. Evolution of rRNA gene clusters and telomeric repeats during explosive genome repatterning in TATERILLUS X (Rodentia, Gerbillinae).

    PubMed

    Dobigny, G; Ozouf-Costaz, C; Bonillo, C; Volobouev, V

    2003-01-01

    A survey of 28S and 5S rRNA gene clusters, and telomeric repeats was performed using single and double FISH in the Taterillus genus (Rodentia, Muridae, Gerbillinae). Taterillus was previously demonstrated to have undergone a very recent and extensive chromosomal evolution. Our FISH results demonstrate that rRNA genes can vary in location and number irrespective of the phylogenetic relationships. Telomeric repeats were detected in pericentromeric and interstitial regions of several chromosomes, thus providing nonambiguous evolutionary footprints of Robertsonian and tandem translocation events. These footprints are discussed in reference to the molecular process of these karyotypical changes. Also, examples of colocation of rDNA clusters and telomeric repeats lend support to their possible involvement in nucleolus formation. Finally, the presence of rRNA genes, and the extensive amplification of telomeric repeats at specific loci within a double X-autosome translocated element which were not observed on the homologous Y1 and Y2, served as basis for an epigenomic hypothesis on X-autosome translocation viability in mammals. PMID:15004471

  3. Angiogenesis Assays.

    PubMed

    Nambiar, Dhanya K; Kujur, Praveen K; Singh, Rana P

    2016-01-01

    Neoangiogenesis constitutes one of the first steps of tumor progression beyond a critical size of tumor growth, which supplies a dormant mass of cancerous cells with the required nutrient supply and gaseous exchange through blood vessels essentially needed for their sustained and aggressive growth. In order to understand any biological process, it becomes imperative that we use models, which could mimic the actual biological system as closely as possible. Hence, finding the most appropriate model is always a vital part of any experimental design. Angiogenesis research has also been much affected due to lack of simple, reliable, and relevant models which could be easily quantitated. The angiogenesis models have been used extensively for studying the action of various molecules for agonist or antagonistic behaviour and associated mechanisms. Here, we have described two protocols or models which have been popularly utilized for studying angiogenic parameters. Rat aortic ring assay tends to bridge the gap between in vitro and in vivo models. The chorioallantoic membrane (CAM) assay is one of the most utilized in vivo model system for angiogenesis-related studies. The CAM is highly vascularized tissue of the avian embryo and serves as a good model to study the effects of various test compounds on neoangiogenesis. PMID:26608294

  4. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  5. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation

    PubMed Central

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G.; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S. Kundhavai; Klaholz, Bruno P.; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  6. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  7. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  8. Development and Validation of an Improved PCR Method Using the 23S-5S Intergenic Spacer for Detection of Rickettsiae in Dermacentor variabilis Ticks and Tissue Samples from Humans and Laboratory Animals.

    PubMed

    Kakumanu, Madhavi L; Ponnusamy, Loganathan; Sutton, Haley T; Meshnick, Steven R; Nicholson, William L; Apperson, Charles S

    2016-04-01

    A novel nested PCR assay was developed to detectRickettsiaspp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) ofRickettsiaspp. The newly designed primers were evaluated using genomic DNA from 11Rickettsiaspecies belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to otherRickettsia-specific PCR targets (ompA,gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11Rickettsiaspp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from "CandidatusRickettsia amblyommii." Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adultDermacentor variabilisticks. The nested 23S-5S IGS assay detectedRickettsiaDNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species ofRickettsia The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species ofRickettsiain the ticks. "CandidatusRickettsia amblyommii,"R. montanensis,R. felis, andR. belliiwere frequently identified species, along with some potentially novelRickettsiastrains that were closely related toR. belliiandR. conorii. PMID:26818674

  9. Development and Validation of an Improved PCR Method Using the 23S-5S Intergenic Spacer for Detection of Rickettsiae in Dermacentor variabilis Ticks and Tissue Samples from Humans and Laboratory Animals

    PubMed Central

    Kakumanu, Madhavi L.; Ponnusamy, Loganathan; Sutton, Haley T.; Meshnick, Steven R.; Nicholson, William L.

    2016-01-01

    A novel nested PCR assay was developed to detect Rickettsia spp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) of Rickettsia spp. The newly designed primers were evaluated using genomic DNA from 11 Rickettsia species belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to other Rickettsia-specific PCR targets (ompA, gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11 Rickettsia spp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from “Candidatus Rickettsia amblyommii.” Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adult Dermacentor variabilis ticks. The nested 23S-5S IGS assay detected Rickettsia DNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species of Rickettsia. The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species of Rickettsia in the ticks. “Candidatus Rickettsia amblyommii,” R. montanensis, R. felis, and R. bellii were frequently identified species, along with some potentially novel Rickettsia strains that were closely related to R. bellii and R. conorii. PMID:26818674

  10. Real-Time PCR and Sequencing Assays for Rapid Detection and Identification of Avian Schistosomes in Environmental Samples

    PubMed Central

    Mull, Bonnie J.; Brant, Sara V.; Loker, Eric S.; Collinson, Jeremy; Secor, W. Evan; Hill, Vincent R.

    2015-01-01

    Cercarial dermatitis, also known as swimmer's itch, is an allergenic skin reaction followed by intense itching caused by schistosome cercariae penetrating human skin. Cercarial dermatitis outbreaks occur globally and are frequently associated with freshwater lakes and are occasionally associated with marine or estuarine waters where birds reside year-round or where migratory birds reside. In this study, a broadly reactive TaqMan assay targeting 18S rRNA gene (ribosomal DNA [rDNA]) sequences that was based on a genetically diverse panel of schistosome isolates representing 13 genera and 20 species (the 18S rDNA TaqMan assay) was developed. A PCR assay was also developed to amplify a 28S rDNA region for subsequent sequencing to identify schistosomes. When applied to surface water samples seeded with Schistosoma mansoni cercariae, the 18S rDNA TaqMan assay enabled detection at a level of 5 S. mansoni cercariae in 100 liters of lake water. The 18S rDNA TaqMan and 28S rDNA PCR sequencing assays were also applied to 100-liter water samples collected from lakes in Nebraska and Wisconsin where there were reported dermatitis outbreaks. Avian schistosome DNA was detected in 11 of 34 lake water samples using the TaqMan assay. Further 28S rDNA sequence analysis of positive samples confirmed the presence of avian schistosome DNA and provided a preliminary identification of the avian schistosomes in 10 of the 11 samples. These data indicate that the broadly schistosome-reactive TaqMan assay can be effective for rapid screening of large-volume water samples for detection of avian schistosomes, thereby facilitating timely response actions to mitigate or prevent dermatitis outbreaks. Additionally, samples positive by the 18S rDNA TaqMan assay can be further assayed using the 28S rDNA sequencing assay to both confirm the presence of schistosomes and contribute to their identification. PMID:25862226

  11. Single Laboratory Comparison of Quantitative Real-time PCR Assays for the Detection of Fecal Pollution

    EPA Science Inventory

    There are numerous quantitative real-time PCR (qPCR) assays available to detect and enumerate fecal pollution in ambient waters. Each assay employs distinct primers and probes that target different rRNA genes and microorganisms leading to potential variations in concentration es...

  12. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq

    2015-01-01

    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  13. Identification of Erwinia stewartii by a ligase chain reaction assay.

    PubMed Central

    Wilson, W J; Wiedmann, M; Dillard, H R; Batt, C A

    1994-01-01

    A PCR-coupled ligase chain reaction (LCR) assay was developed to distinguish the plant pathogenic bacterium Erwinia stewartii from other erwiniae. This new technique allows discrimination to the species level on the basis of a single-base-pair difference in the 16S rRNA gene which is unique to E. stewartii. Portions of the 16S rRNA genes of E. stewartii and the closely related Erwinia herbicola were sequenced. From comparison of the two 16S rRNA gene regions, two primer pairs were constructed such that only E. stewartii DNA gave a product in the LCR assay. The ligated product was separated from the radioactively labelled primers by denaturing polyacrylamide gel electrophoresis and visualized by autoradiography. Twenty-four different Erwinia species and strains were tested by PCR-coupled LCR to verify the specificity of the assay, and only E. stewartii strains gave a positive reaction. In addition, infected and healthy plant material was also assayed. E. stewartii was detected in infected plant material, even when large populations of epiphytic bacteria were present. No enrichment was necessary for detection of the pathogen in corn leaves. This assay has potential as a diagnostic technique for the detection of E. stewartii in infected plant and vector material. Images PMID:7509585

  14. Targeting single-nucleotide polymorphisms in the 16S rRNA gene to detect and differentiate Legionella pneumophila and non-Legionella pneumophila species.

    PubMed

    Zhan, Xiao-Yong; Hu, Chao-Hui; Zhu, Qing-Yi

    2016-08-01

    A PCR-based method targeting single-nucleotide polymorphisms (SNPs) in the 16S rRNA gene was developed for differential identification of Legionella pneumophila and non-Legionella pneumophila. Based on the bioinformatics analysis for 176 Legionella 16S rRNA gene fragments of 56 different Legionella species, a set of SNPs, A(628)C(629) was found to be highly specific to L. pneumophila strains. A multiplex assay was designed that was able to distinguish sites with limited sequence heterogeneity between L. pneumophila and non-L. pneumophila in the targeted 16S rRNA gene. The assay amplified a 261-bp amplicon for Legionella spp. and a set of 203- and 97-bp amplicons only specific to L. pneumophila species. Among 49 ATCC strains and 284 Legionella isolates from environmental water and clinical samples, 100 % of L. pneumophila and non-L. pneumophila strains were correctly identified and differentiated by this assay. The assay presents a more rapid, sensitive and alternative method to the currently available PCR-sequencing detection and differentiation method. PMID:27112927

  15. Ribosomal Protein S14 of Saccharomyces cerevisiae Regulates Its Expression by Binding to RPS14B Pre-mRNA and to 18S rRNA

    PubMed Central

    Fewell, Sheara W.; Woolford, John L.

    1999-01-01

    Production of ribosomal protein S14 in Saccharomyces cerevisiae is coordinated with the rate of ribosome assembly by a feedback mechanism that represses expression of RPS14B. Three-hybrid assays in vivo and filter binding assays in vitro demonstrate that rpS14 directly binds to an RNA stem-loop structure in RPS14B pre-mRNA that is necessary for RPS14B regulation. Moreover, rpS14 binds to a conserved helix in 18S rRNA with approximately five- to sixfold-greater affinity. These results support the model that RPS14B regulation is mediated by direct binding of rpS14 either to its pre-mRNA or to rRNA. Investigation of these interactions with the three-hybrid system reveals two regions of rpS14 that are involved in RNA recognition. D52G and E55G mutations in rpS14 alter the specificity of rpS14 for RNA, as indicated by increased affinity for RPS14B RNA but reduced affinity for the rRNA target. Deletion of the C terminus of rpS14, where multiple antibiotic resistance mutations map, prevents binding of rpS14 to RNA and production of functional 40S subunits. The emetine-resistant protein, rpS14-EmRR, which contains two mutations near the C terminus of rpS14, does not bind either RNA target in the three-hybrid or in vitro assays. This is the first direct demonstration that an antibiotic resistance mutation alters binding of an r protein to rRNA and is consistent with the hypothesis that antibiotic resistance mutations can result from local alterations in rRNA structure. PMID:9858605

  16. Molecular identification of Trichinella spiralis and Trichinella britovi by diagnostic multiprimer large mitochondrial rRNA amplification.

    PubMed

    Borsuk, P; Moskwa, B; Pastusiak, K; Cabaj, W

    2003-11-01

    Trichinella parasites with different epidemiological features still occur in Europe and four species of genus Trichinella have been identified: T. spiralis, T. britovi, T. nativa and T. pseudospiralis. Until now, two of them, T. spiralis and T. britovi, have been identified in Poland. In our studies we selected sequence coding for large mitochondrial rRNA (mt LrDNA) as a genetic marker and developed a sensitive LrDNA multiprimer PCR assay allowing for rapid identification of T. spiralis and T. britovi, parasites present in wild and domestic animals in Poland. PMID:14505042

  17. Alternate rRNA secondary structures as regulators of translation.

    PubMed

    Feng, Shu; Li, Heng; Zhao, Jing; Pervushin, Konstantin; Lowenhaupt, Ky; Schwartz, Thomas U; Dröge, Peter

    2011-02-01

    Structural dynamics of large molecular assemblies are intricately linked to function. For ribosomes, macromolecular changes occur especially during mRNA translation and involve participation of ribosomal RNA. Without suitable probes specific to RNA secondary structure, however, elucidation of more subtle dynamic ribosome structure-function relationships, especially in vivo, remains challenging. Here we report that the Z-DNA- and Z-RNA-binding domain Zα, derived from the human RNA editing enzyme ADAR1-L, binds with high stability to specific rRNA segments of Escherichia coli and human ribosomes. Zα impaired in Z-RNA recognition does not associate with ribosomes. Notably, Zα(ADAR1)-ribosome interaction blocks translation in vitro and in vivo, with substantial physiological consequences. Our study shows that ribosomes can be targeted by a protein that specifically recognizes an alternate rRNA secondary structure, and suggests a new mechanism of translational regulation on the ribosome. PMID:21217697

  18. Robust Computational Analysis of rRNA Hypervariable Tag Datasets

    PubMed Central

    Sipos, Maksim; Jeraldo, Patricio; Chia, Nicholas; Qu, Ani; Dhillon, A. Singh; Konkel, Michael E.; Nelson, Karen E.; White, Bryan A.; Goldenfeld, Nigel

    2010-01-01

    Next-generation DNA sequencing is increasingly being utilized to probe microbial communities, such as gastrointestinal microbiomes, where it is important to be able to quantify measures of abundance and diversity. The fragmented nature of the 16S rRNA datasets obtained, coupled with their unprecedented size, has led to the recognition that the results of such analyses are potentially contaminated by a variety of artifacts, both experimental and computational. Here we quantify how multiple alignment and clustering errors contribute to overestimates of abundance and diversity, reflected by incorrect OTU assignment, corrupted phylogenies, inaccurate species diversity estimators, and rank abundance distribution functions. We show that straightforward procedural optimizations, combining preexisting tools, are effective in handling large () 16S rRNA datasets, and we describe metrics to measure the effectiveness and quality of the estimators obtained. We introduce two metrics to ascertain the quality of clustering of pyrosequenced rRNA data, and show that complete linkage clustering greatly outperforms other widely used methods. PMID:21217830

  19. Physical mapping of 5S and 18S-5.8S-26S RNA gene families in polyploid series of Cenchrus ciliaris Linnaeus, 1771 (Poaceae)

    PubMed Central

    Kharrat-Souissi, Amina; Siljak-Yakovlev, Sonja; Pustahija, Fatima; Chaieb, Mohamed

    2012-01-01

    Abstract The Buffelgrass (Cenchrus ciliaris L., Poaceae) is one of the most important pasturage grasses due to its high productivity and good forage qualities. This species possess a high adaptability to bioclimatic constraints of arid zones and may be used for the restoration of degraded arid ecosystems. Tunisian populations present three ploidy levels (4x, 5x and 6x) with a basic chromosome number x=9. This study reported for the first time the distribution of the ribosomal genes (rRNA) for pentaploid and hexaploid cytotypes of Cenchrus ciliaris. Molecular cytogenetic study using double fluorescence in situ hybridization has shown that the two rDNA families, 5S and 18S-5.8S-26S (18S), displayed intraspecific variation in number of loci among different ploidy levels. Each ploidy level was characterized by specific number of both 5S and 18S rDNA loci (two loci in tetraploid, five in pentaploid and six in hexaploid level). For three studied cytotypes (4x, 5x and 6x) all 5S rDNA loci were localized on the subcentromeric region of chromosomes, while 18S loci were situated on the telomeric region of short chromosome arms. Data of the FISH experiments show proportional increase of ribosomal loci number during polyploidization processes. PMID:24260668

  20. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency.

    PubMed

    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa

    2016-05-01

    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2'-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2'-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA fromPyrococcus furiosus We find that the methylation efficacy at sites D and D' differ substantially, with substrate D' turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D' is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D' sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5'-end of the product. PMID:26925607

  1. Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

  2. A Neurospora crassa ribosomal protein gene, homologous to yeast CRY1, contains sequences potentially coordinating its transcription with rRNA genes.

    PubMed Central

    Tyler, B M; Harrison, K

    1990-01-01

    We have isolated and sequenced a Neurospora crassa ribosomal protein gene (designated crp-2) strongly homologous to the rp59 gene (CRY1) of yeast and the S14 ribosomal protein gene of mammals. The inferred sequence of the crp-2 protein is more homologous (83%) to the mammalian S14 sequence than to the yeast rp59 sequence (69%). The gene has three intervening sequences (IVSs) two of which are offset 7 bp from the position of IVSs in the mammalian genes. None correspond to the position of the IVS in the yeast gene. Crp-2 was mapped by RFLP analysis to the right arm of linkage group III. The 5' region of the gene contains three copies of a sequence, the Ribo box, previously shown to be required for transcription of both 5S and 40S rRNA genes. We speculate that the Ribo box may coordinate ribosomal protein and rRNA gene transcription. Images PMID:1977135

  3. Identification of coagulase-negative staphylococci isolated from ovine milk samples by PCR-RFLP of 16S rRNA and gap genes.

    PubMed

    Onni, T; Sanna, G; Cubeddu, G P; Marogna, G; Lollai, S; Leori, G; Tola, S

    2010-08-26

    The identification of coagulase-negative staphylococci (CNS) causing ovine infections remains problematic, although these bacteria are considered the main etiologic agents of subclinical mastitis in sheep and goats. In this study, 226 CNS isolates were collected from 2201 milking sarda sheep belonging to 15 flocks with high somatic cell count scores. All isolates were subjected to identification with the API Staph ID test, and then to the amplification of staphylococcal 16S rRNA and gap genes by PCR assays. The gap gene was subjected to restriction fragment length polymorphism analysis with the restriction endonuclease AluI, whereas the 16S rRNA gene was subjected to ribosomal fingerprinting with the restriction endonucleases RsaI, PstI and AluI. When PCR-RFLP patterns of CNS isolates were different from those of their reference strains, gap gene amplicons were sequenced for definitive identification. The API Staph ID test, in alternative to the genotypic identification method, produced considerably different results in terms of species identified within each group. Using the PCR-RFLP assay, most of the isolates clustered together with the Staphylococcus epidermidis type strain (131, corresponding to 57.9%), followed by S. caprae (34, corresponding to 15%) and S. chromogenes (30, corresponding to 13.2%). In conclusion, the PCR-RFLP assay of 16S rRNA and gap genes is a more reliable and reproducible method than the API Staph ID test for the identification of CNS causing sheep mastitis. PMID:20167442

  4. Formation of Tertiary Interactions during rRNA GTPase Center Folding.

    PubMed

    Rau, Michael J; Welty, Robb; Tom Stump, W; Hall, Kathleen B

    2015-08-28

    The 60-nt GTPase center (GAC) of 23S rRNA has a phylogenetically conserved secondary structure with two hairpin loops and a 3-way junction. It folds into an intricate tertiary structure upon addition of Mg(2+) ions, which is stabilized by the L11 protein in cocrystal structures. Here, we monitor the kinetics of its tertiary folding and Mg(2+)-dependent intermediate states by observing selected nucleobases that contribute specific interactions to the GAC tertiary structure in the cocrystals. The fluorescent nucleobase 2-aminopurine replaced three individual adenines, two of which make long-range stacking interactions and one that also forms hydrogen bonds. Each site reveals a unique response to Mg(2+) addition and temperature, reflecting its environmental change from secondary to tertiary structure. Stopped-flow fluorescence experiments revealed that kinetics of tertiary structure formation upon addition of MgCl2 are also site specific, with local conformational changes occurring from 5 ms to 4s and with global folding from 1 to 5s. Site-specific substitution with (15)N-nucleobases allowed observation of stable hydrogen bond formation by NMR experiments. Equilibrium titration experiments indicate that a stable folding intermediate is present at stoichiometric concentrations of Mg(2+) and suggest that there are two initial sites of Mg(2+) ion association. PMID:26210661

  5. Rapid diagnosis of leptospirosis in patients with different clinical manifestations by 16S rRNA gene based nested PCR

    PubMed Central

    Natarajaseenivasan, K.; Raja, V.; Narayanan, R.

    2011-01-01

    Leptospirosis, a zoonosis of global importance and it is underreported in India and more than 50,000 severe cases are reported each year. Here we present the evaluation of 16S rRNA based nested PCR assay for the rapid identification of human leptospires using serum and urine samples. The study includes 261 suspected cases for leptospirosis with different clinical manifestations. 16S rRNA based nested PCR assay was compared and evaluated against the conventional serological methods such as MAT and ELISA. The technique enabled amplification of a 289 bp product with notable percentage of positivity in all sample groups including 94.8 in pediatric cases, 93 in pregnant women, 94.2 in renal failure, 87.8 in jaundice and 94.6 in common febrile cases. The sensitivity and specificity was 94.4% and 100%, respectively. The technique proved to be prompt and effective for the diagnosis of leptospiral infection at the acute phase of the disease. PCR based approach detects leptospiral DNA from the clinical samples both at the acute and leptospiruria phase on comparison with its counter parts where detection is made possible only after 7 days or 7–30 days post-infection. In this regard PCR based diagnosis of leptospirosis should be made available for clinicians for the early diagnosis and prompt treatment of the disease. PMID:23961174

  6. Impact of acquisition of 16S rRNA methylase RmtB on the fitness of Escherichia coli.

    PubMed

    Ou, Bingming; Chen, Lin; Song, Yujie; Yang, Ying; Zhang, Qian; Yang, Yi; Li, Luan; Tham, Wai Liang; Francis, David H; Zhu, Guoqiang

    2016-09-01

    The aim of this study was to elucidate the biological phenotypes of 16S rRNA methylase RmtB in Escherichia coli and the impact of RmtB acquisition on the fitness of the target bacterium. An rmtB in-frame deletion mutant in E. coli was constructed using a suicide vector (pDMS197)-based double crossover allelic exchange, and its corresponding complemented strain was established. Combined studies of microdilution susceptibility testing, conjugation experiments, growth kinetics assays, competitive experiments, biofilm formation tests and motility assays were performed to study the rmtB-mediated fitness among the prototype E. coli strain, its isogenic mutant and the corresponding complemented strain. The minimum inhibitory concentrations (MICs) of 4,6-disubstituted 2-deoxystreptamines for the rmtB wild-type strain, its isogenic mutant and the complemented strain were ≥1024, ≤2 and ≥1024mg/L, respectively. Both the growth rates and the competitive abilities of the wild-type and complemented strains were relatively inferior to the ΔrmtB mutant. There was no significant difference in biofilm formation and motility among the three strains. In conclusion, the data presented here suggest that acquisition of the 16S rRNA methylase gene rmtB in E. coli can exact a fitness cost on the bacteria, subsequently reducing the growth rate slightly and decreasing the competitive capacity of the bacterium, whereas it does not affect biofilm formation or motility. PMID:27530836

  7. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.

    PubMed

    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A

    2008-01-01

    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  8. Determining Fungi rRNA Copy Number by PCR

    PubMed Central

    Black, Jonathan; Dean, Timothy; Byfield, Grace; Foarde, Karin; Menetrez, Marc

    2013-01-01

    The goal of this project is to improve the quantification of indoor fungal pollutants via the specific application of quantitative PCR (qPCR). Improvement will be made in the controls used in current qPCR applications. This work focuses on the use of two separate controls within a standard qPCR reaction. The first control developed was the internal standard control gene, benA. This gene encodes for β-tubulin and was selected based on its single-copy nature. The second control developed was the standard control plasmid, which contained a fragment of the ribosomal RNA (rRNA) gene and produced a specific PCR product. The results confirm the multicopy nature of the rRNA region in several filamentous fungi and show that we can quantify fungi of unknown genome size over a range of spore extractions by inclusion of these two standard controls. Advances in qPCR have led to extremely sensitive and quantitative methods for single-copy genes; however, it has not been well established that the rRNA can be used to quantitate fungal contamination. We report on the use of qPCR, combined with two controls, to identify and quantify indoor fungal contaminants with a greater degree of confidence than has been achieved previously. Advances in indoor environmental health have demonstrated that contamination of the built environment by the filamentous fungi has adverse impacts on the health of building occupants. This study meets the need for more accurate and reliable methods for fungal identification and quantitation in the indoor environment. PMID:23543828

  9. Interactions of aminoglycoside antibiotics with rRNA.

    PubMed

    Trylska, Joanna; Kulik, Marta

    2016-08-15

    Aminoglycoside antibiotics are protein synthesis inhibitors applied to treat infections caused mainly by aerobic Gram-negative bacteria. Due to their adverse side effects they are last resort antibiotics typically used to combat pathogens resistant to other drugs. Aminoglycosides target ribosomes. We describe the interactions of aminoglycoside antibiotics containing a 2-deoxystreptamine (2-DOS) ring with 16S rRNA. We review the computational studies, with a focus on molecular dynamics (MD) simulations performed on RNA models mimicking the 2-DOS aminoglycoside binding site in the small ribosomal subunit. We also briefly discuss thermodynamics of interactions of these aminoglycosides with their 16S RNA target. PMID:27528743

  10. Growth rate regulation of rRNA content of a marine Synechococcus (cyanobacterium) strain

    SciTech Connect

    Binder, B.J.; Liu, Y.C.

    1998-09-01

    The relationship between growth rate and rRNA content in a marine Synechococcus strain was examined. A combination of flow cytometry and whole-cell hybridization with fluorescently labeled 16S rRNA-targeted oligonucleotide probes was used to measure the rRNA content of Synechococcus strain WH8101 cells grown at a range of light-limited growth rates. The sensitivity of this approach was sufficient for the analysis of rRNA even in very slowly growing Synechococcus cells. The relationship between growth rate and cellular rRNA content comprised three phases: (1) at low growth rates, rRNA cell{sup {minus}1} remained approximately constant; (2) at intermediate rates, rRNA cell{sup {minus}1} increased proportionally with growth rate; and (3) at the highest, light-saturated rates, rRNA cell{sup {minus}1} dropped abruptly. Total cellular RNA was well correlated with the probe-based measure of rRNA and varied in a similar manner with growth rate. Mean cell volume and rRNA concentration were related to growth rate in a manner similar to rRNA cell{sup {minus}1}, although the overall magnitude linear increase in ribosome efficiency with increasing growth rate, which is consistent with the prevailing prokaryotic model at low growth rates. Taken together, these results support the notion that measurements of cellular rRNA content might be useful for estimating in situ growth rates in natural Synechococcus populations.

  11. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    PubMed

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  12. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  13. Quantitative Real-Time PCR Assay for QPX (Thraustochytriidae), a Parasite of the Hard Clam (Mercenaria mercenaria)▿

    PubMed Central

    Liu, Qianqian; Allam, Bassem; Collier, Jackie L.

    2009-01-01

    We developed a real-time quantitative PCR (qPCR) assay targeting the rRNA internal transcribed spacer region of the hard clam pathogen QPX. The qPCR assay was more sensitive than was histology in detecting clams with light QPX infections. QPX was detected in 4 of 43 sediment samples but in none of 40 seawater samples. PMID:19465523

  14. The specific isolation of complete 5S rDNA units from chromosome 1A of hexaploid, tetraploid, and diploid wheat species using PCR with head-to-head oriented primers.

    PubMed

    Van Campenhout, S; Stappen, J V; Volckaert, G

    2001-08-01

    The presence of 5S rDNA units on chromosome 1A of Triticum aestivum was shown by the development of a specific PCR test, using head-to-head oriented primers. This primer set allowed the amplification of complete 5S DNA units and was used to isolate SS-Rrna-A1 sequences from polyploid and diploid wheat species. Multiple-alignment and parsimony analyses of the 132 sequences divided the sequences into four types. The isolates from T. aestivum and the tetraploid species (T. dicoccoides, T. dicoccum, T durum, T. araraticum, and T timopheevi) were all of one type, which was shown to be closely related to the type mainly characteristic for T. urartu. The other two types were isolated exclusively from the diploid species T. monococcum, T aegilopoides, T. thaoudar, and T. sinskajae and the hexaploid species T. zhukovski. Triticum monococcum was the only species for which representatives of each of the four sequence types were found to be present. Further, we discuss the possible multicluster arrangement of the 5S-Rrna-A1 array. PMID:11550886

  15. Chromosomal Organization of Rrna Operons in Bacillus Subtilis

    PubMed Central

    Jarvis, E. D.; Widom, R. L.; LaFauci, G.; Setoguchi, Y.; Richter, I. R.; Rudner, R.

    1988-01-01

    Integrative mapping with vectors containing ribosomal DNA sequences were used to complete the mapping of the 10 rRNA gene sets in the endospore forming bacterium Bacillus subtilis. Southern hybridizations allowed the assignment of nine operons to distinct BclI restriction fragments and their genetic locus identified by transductional crosses. Nine of the ten rRNA gene sets are located between 0 and 70° on the genomic map. In the region surrounding cysA14, two sets of closely spaced tandem clusters are present. The first (rrnJ and rrnW) is located between purA16 and cysA14 closely linked to the latter; the second (rrnI, rrnH and rrnG) previously mapped within this area is located between attSPO2 and glpT6. The operons at or near the origin of replication (rrnO,rrnA and rrnJ,rrnW) represent ``hot spots'' of plasmid insertion. PMID:2465199

  16. Evaluation of 16S rRNA Gene PCR Sensitivity and Specificity for Diagnosis of Prosthetic Joint Infection: a Prospective Multicenter Cross-Sectional Study

    PubMed Central

    Plouzeau, Chloé; Tande, Didier; Léger, Julie; Giraudeau, Bruno; Valentin, Anne Sophie; Jolivet-Gougeon, Anne; Vincent, Pascal; Corvec, Stéphane; Gibaud, Sophie; Juvin, Marie Emmanuelle; Héry-Arnaud, Genevieve; Lemarié, Carole; Kempf, Marie; Bret, Laurent; Quentin, Roland; Coffre, Carine; de Pinieux, Gonzague; Bernard, Louis; Burucoa, Christophe

    2014-01-01

    There is no standard method for the diagnosis of prosthetic joint infection (PJI). The contribution of 16S rRNA gene PCR sequencing on a routine basis remains to be defined. We performed a prospective multicenter study to assess the contributions of 16S rRNA gene assays in PJI diagnosis. Over a 2-year period, all patients suspected to have PJIs and a few uninfected patients undergoing primary arthroplasty (control group) were included. Five perioperative samples per patient were collected for culture and 16S rRNA gene PCR sequencing and one for histological examination. Three multicenter quality control assays were performed with both DNA extracts and crushed samples. The diagnosis of PJI was based on clinical, bacteriological, and histological criteria, according to Infectious Diseases Society of America guidelines. A molecular diagnosis was modeled on the bacteriological criterion (≥1 positive sample for strict pathogens and ≥2 for commensal skin flora). Molecular data were analyzed according to the diagnosis of PJI. Between December 2010 and March 2012, 264 suspected cases of PJI and 35 control cases were included. PJI was confirmed in 215/264 suspected cases, 192 (89%) with a bacteriological criterion. The PJIs were monomicrobial (163 cases [85%]; staphylococci, n = 108; streptococci, n = 22; Gram-negative bacilli, n = 16; anaerobes, n = 13; others, n = 4) or polymicrobial (29 cases [15%]). The molecular diagnosis was positive in 151/215 confirmed cases of PJI (143 cases with bacteriological PJI documentation and 8 treated cases without bacteriological documentation) and in 2/49 cases without confirmed PJI (sensitivity, 73.3%; specificity, 95.5%). The 16S rRNA gene PCR assay showed a lack of sensitivity in the diagnosis of PJI on a multicenter routine basis. PMID:25056331

  17. Evaluation of 16S rRNA gene PCR sensitivity and specificity for diagnosis of prosthetic joint infection: a prospective multicenter cross-sectional study.

    PubMed

    Bémer, Pascale; Plouzeau, Chloé; Tande, Didier; Léger, Julie; Giraudeau, Bruno; Valentin, Anne Sophie; Jolivet-Gougeon, Anne; Vincent, Pascal; Corvec, Stéphane; Gibaud, Sophie; Juvin, Marie Emmanuelle; Héry-Arnaud, Genevieve; Lemarié, Carole; Kempf, Marie; Bret, Laurent; Quentin, Roland; Coffre, Carine; de Pinieux, Gonzague; Bernard, Louis; Burucoa, Christophe

    2014-10-01

    There is no standard method for the diagnosis of prosthetic joint infection (PJI). The contribution of 16S rRNA gene PCR sequencing on a routine basis remains to be defined. We performed a prospective multicenter study to assess the contributions of 16S rRNA gene assays in PJI diagnosis. Over a 2-year period, all patients suspected to have PJIs and a few uninfected patients undergoing primary arthroplasty (control group) were included. Five perioperative samples per patient were collected for culture and 16S rRNA gene PCR sequencing and one for histological examination. Three multicenter quality control assays were performed with both DNA extracts and crushed samples. The diagnosis of PJI was based on clinical, bacteriological, and histological criteria, according to Infectious Diseases Society of America guidelines. A molecular diagnosis was modeled on the bacteriological criterion (≥ 1 positive sample for strict pathogens and ≥ 2 for commensal skin flora). Molecular data were analyzed according to the diagnosis of PJI. Between December 2010 and March 2012, 264 suspected cases of PJI and 35 control cases were included. PJI was confirmed in 215/264 suspected cases, 192 (89%) with a bacteriological criterion. The PJIs were monomicrobial (163 cases [85%]; staphylococci, n = 108; streptococci, n = 22; Gram-negative bacilli, n = 16; anaerobes, n = 13; others, n = 4) or polymicrobial (29 cases [15%]). The molecular diagnosis was positive in 151/215 confirmed cases of PJI (143 cases with bacteriological PJI documentation and 8 treated cases without bacteriological documentation) and in 2/49 cases without confirmed PJI (sensitivity, 73.3%; specificity, 95.5%). The 16S rRNA gene PCR assay showed a lack of sensitivity in the diagnosis of PJI on a multicenter routine basis. PMID:25056331

  18. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  19. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  20. A search for the Bs meson in Υ(5S) decays

    NASA Astrophysics Data System (ADS)

    Shipsey, Ian

    2004-05-01

    The CLEO III detector has recorded approximately 0.5 fb-1 of e^+ e^- annihilation data at the Υ(5S) resonance. Using this data sample, we have searched for fully reconstructed Bs mesons in the reaction Υ(5S) arrow B_s^(*) barB_s^(*)

  1. Appearance and evolution of the specific chromosomal rearrangements associated with malignant transformation of mouse m5S cells

    SciTech Connect

    Kodama, S.; Okumura, Y.; Komatsu, K.; Sasaki, M.S. )

    1991-06-01

    Chromosomal alterations were studied during the acquisition of malignant phenotypes in two karyotypically distinct cells isolated from transformed foci induced by x-irradiation in mouse m5S cells. Because the transformants, despite foci origin, showed low ability to grow in agar, they were cultured in vitro with serial transfer schedules to allow further cell generations and assayed for anchorage independence (AI) at each passage level. The AI frequency increased with the cell doubling numbers. Chromosome analysis showed that a focus was one cell origin, but the transformants showed karyotypic instability during cell proliferation, giving rise to the rearrangements clustered in the distal region of the specific chromosomes. These rearrangements appeared to be directed toward the acquisition of malignant phenotypes. Analysis of the types and sites of rearrangements indicated that a mechanism exists that induces frequent rearrangements of the specific region of a chromosome during the process of transformation into the malignant state.

  2. The 5S lean method as a tool of industrial management performances

    NASA Astrophysics Data System (ADS)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  3. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  4. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  5. Exchange of Spacer Regions between Rrna Operons in Escherichia Coli

    PubMed Central

    Harvey, S.; Hill, C. W.

    1990-01-01

    The Escherichia coli rRNA operons each have one of two types of spacer separating the 16S and 23S coding regions. The spacers of four operons encode tRNA(Glu2) and the other three encode both tRNA(Ile) and tRNA(Ala 1 B). We have prepared a series of mutants in which the spacer region of a particular rrn operon has been replaced by the opposite type. Included among these were a mutant retaining only a single copy of the tRNA(Glu2) spacer (at rrnG) and another retaining only a single copy of the tRNA(Ile)-tRNA(Ala 1 B) spacer (at rrnA). While both mutants grew more slowly than controls, the mutant deficient in tRNA(Glu2) spacers was more severely affected. At a frequency of 6 X 10(-5), these mutants phenotypically reverted to faster growing types by increasing the copy number of the deficient spacer. In most of these phenotypic revertants, the deficient spacer type appeared in a rrn operon which previously contained the surplus type, bringing the ratio of spacer types closer to normal. In a few cases, these spacer changes were accompanied by an inversion of the chromosomal material between the donor and recipient rrn operons. Two examples of inversion of one-half of the E. coli chromosome between rrnG and rrnH were observed. The correlation of spacer change with inversion indicated that, in these particular cases, the change was due to an intrachromatid gene conversion event accompanied by a reciprocal crossover rather than reciprocal exchange between sister chromatids. PMID:2168847

  6. Structural polymorphism in the major groove of a 5S RNA gene complements the zinc finger domains of transcription factor IIIA.

    PubMed Central

    Huber, P W; Morii, T; Mei, H Y; Barton, J K

    1991-01-01

    Metal complexes that bind to DNA on the basis of shape-selection have been used to map the conformational features of the DNA binding site for transcription factor IIIA. Conformationally distinct segments are detected on the 5S rRNA gene that correspond closely to the binding sites identified for the individual zinc finger domains of the protein. The local conformations are characterized by a major groove opened because of a change in base pair inclination and/or displacement at a central 5'-pyrimidine-purine-3' step, flanked by a widened minor groove, as would arise at the junctions between alternating B- and A-like DNA segments. Docking experiments with a consensus structure of a zinc finger reveal that the mixed A-B binding site accommodates the peptide domain better than either canonical B- or A-DNA helices. The close structural matching of the conformational variations in the 5S rDNA both to the proposed sites of zinc finger binding and to the shape of an individual zinc finger domain points to DNA structural polymorphism as providing an important determinant in recognition. In particular, shape selection in the 5' half of the internal control region may orient the multiple finger domains. Images PMID:1961749

  7. New Site of Modification of 23S rRNA Associated with Clarithromycin Resistance of Helicobacter pylori Clinical Isolates

    PubMed Central

    Fontana, Carla; Favaro, Marco; Minelli, Silvia; Criscuolo, Anna Angela; Pietroiusti, Antonio; Galante, Alberto; Favalli, Cartesio

    2002-01-01

    Resistance of Helicobacter pylori to clarithromycin occurs with a prevalence ranging from 0 to 15%. This has an important clinical impact on dual and triple therapies, in which clarithromycin seems to be the better choice to achieve H. pylori eradication. In order to evaluate the possibility of new mechanisms of clarithromycin resistance, a PCR assay that amplified a portion of 23S rRNA from H. pylori isolates was used. Gastric tissue biopsy specimens from 230 consecutive patients were cultured for H. pylori isolation. Eighty-six gastric biopsy specimens yielded H. pylori-positive results, and among these 12 isolates were clarithromycin resistant. The latter were studied to detect mutations in the 23S rRNA gene. Sequence analysis of the 1,143-bp PCR product (portion of the 23S rRNA gene) did not reveal mutation such as that described at position 2142 to 2143. On the contrary, our findings show, for seven isolates, a T-to-C transition at position 2717. This mutation conferred a low level of resistance, equivalent to the MIC for the isolates, selected using the E-test as well as using the agar dilution method: 1 μg/ml. Moreover, T2717C transition is located in a highly conserved region of the 23S RNA associated with functional sites: domain VI. This fact has a strong effect on the secondary structure of the 23S RNA and on its interaction with macrolide. Mutation at position 2717 also generated an HhaI restriction site; therefore, restriction analysis of the PCR product also permits a rapid detection of resistant isolates. PMID:12435674

  8. 104. JOB NO. 1347F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    104. JOB NO. 1347-F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD MOTOR COMPANY; LONGITUDINAL SECTION AND TRUSS DETAILS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  9. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  10. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  11. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  12. Yeast Nop2 and Rcm1 methylate C2870 and C2278 of the 25S rRNA, respectively.

    PubMed

    Sharma, Sunny; Yang, Jun; Watzinger, Peter; Kötter, Peter; Entian, Karl-Dieter

    2013-10-01

    Yeast 25S rRNA was reported to contain a single cytosine methylation (m(5)C). In the present study using a combination of RP-HPLC, mung bean nuclease assay and rRNA mutagenesis, we discovered that instead of one, yeast contains two m(5)C residues at position 2278 and 2870. Furthermore, we identified and characterized two putative methyltransferases, Rcm1 and Nop2 to be responsible for these two cytosine methylations, respectively. Both proteins are highly conserved, which correlates with the presence of two m(5)C residues at identical positions in higher eukaryotes, including humans. The human homolog of yeast Nop2, p120 has been discovered to be upregulated in various cancer tissues, whereas the human homolog of Rcm1, NSUN5 is completely deleted in the William's-Beuren Syndrome. The substrates and function of both human homologs remained unknown. In the present study, we also provide insights into the significance of these two m(5)C residues. The loss of m(5)C2278 results in anisomycin hypersensitivity, whereas the loss of m(5)C2870 affects ribosome synthesis and processing. Establishing the locations and enzymes in yeast will not only help identifying the function of their homologs in higher organisms, but will also enable understanding the role of these modifications in ribosome function and architecture. PMID:23913415

  13. Genomic organization and evolution of the 5S ribosomal DNA in Tilapiini fishes.

    PubMed

    Alves-Costa, F A; Wasko, A P; Oliveira, C; Foresti, F; Martins, C

    2006-05-01

    5S rDNA sequences present an intense dynamism and have proved to be valuable as genetic markers to distinguish closed related species and also in the understanding of the evolutionary dynamic of repetitive sequences in the genomes. In order to identify patterns of 5S rDNA organization and their evolution in the genome of fish species, such genomic segment was investigated in the tilapias Oreochromis niloticus and Tilapia rendalli, and in the hybrid O. urolepis hornorum x O. mossambicus. A dual 5S rDNA system was identified in the three analyzed tilapia samples. Although each 5S rDNA class was conserved among the three samples, a distinct 5S rDNA genome organization pattern could be evidenced for each sample. The presence of a dual 5S rDNA system seems to be a general trait among non-related teleost fish orders, suggesting that evolutionary events of duplication have occurred before the divergence of the main groups of teleost fishes. PMID:16850228

  14. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    PubMed Central

    Suslu, Hikmet Turan; Celikoglu, Erhan; Borekcı, Ali; Hıcdonmez, Tufan; Suslu, Hüsnü

    2011-01-01

    Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches. PMID:23125496

  15. Secondary structure of mouse 28S rRNA and general model for the folding of the large rRNA in eukaryotes.

    PubMed Central

    Michot, B; Hassouna, N; Bachellerie, J P

    1984-01-01

    We present a secondary structure model for the entire sequence of mouse 28S rRNA (1) which is based on an extensive comparative analysis of the available eukaryotic sequences, i.e. yeast (2, 3), Physarum polycephalum (4), Xenopus laevis (5) and rat (6). It has been derived with close reference to the models previously proposed for yeast 26S rRNA (2) and for prokaryotic 23S rRNA (7-9). Examination of the recently published eukaryotic sequences confirms that all pro- and eukaryotic large rRNAs share a largely conserved secondary structure core, as already apparent from the previous analysis of yeast 26S rRNA (2). These new comparative data confirm most features of the yeast model (2). They also provide the basis for a few modifications and for new proposals which extend the boundaries of the common structural core (now representing about 85% of E. coli 23S rRNA length) and bring new insights for tracing the structural evolution, in higher eukaryotes, of the domains which have no prokaryotic equivalent and are inserted at specific locations within the common structural core of the large subunit rRNA. PMID:6374617

  16. Chromosomal organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the evolutionary dynamics of multigene families and heterochromatin

    PubMed Central

    2011-01-01

    Background Scarabaeinae beetles show a high level of macro-chromosomal variability, although the karyotypic organization of heterochromatin and multigene families (rDNAs and histone genes) is poorly understood in this group. To better understand the chromosomal organization and evolution in this group, we analyzed the karyotypes, heterochromatin distribution and chromosomal locations of the rRNAs and histone H3 genes in beetles belonging to eight tribes from the Scarabaeinae subfamily (Coleoptera, Scarabaeidae). Results The number of 18S rRNA gene (a member of the 45S rDNA unit) sites varied from one to 16 and were located on the autosomes, sex chromosomes or both, although two clusters were most common. Comparison of the 45S rDNA cluster number and the diploid numbers revealed a low correlation value. However, a comparison between the number of 45S rDNA sites per genome and the quantity of heterochromatin revealed (i) species presenting heterochromatin restricted to the centromeric/pericentromeric region that contained few rDNA sites and (ii) species with a high quantity of heterochromatin and a higher number of rDNA sites. In contrast to the high variability for heterochromatin and 45S rDNA cluster, the presence of two clusters (one bivalent cluster) co-located on autosomal chromosomes with the 5S rRNA and histone H3 genes was highly conserved. Conclusions Our results indicate that the variability of the 45S rDNA chromosomal clusters is not associated with macro-chromosomal rearrangements but are instead related to the spread of heterochromatin. The data obtained also indicate that both heterochromatin and the 45S rDNA loci could be constrained by similar evolutionary forces regulating spreading in the distinct Scarabaeinae subfamily lineages. For the 5S rRNA and the histone H3 genes, a similar chromosomal organization could be attributed to their association/co-localization in the Scarabaeinae karyotypes. These data provide evidence that different evolutionary

  17. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  18. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  19. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

    PubMed

    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina

    2016-05-15

    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. PMID:27084467

  20. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  1. Subnuclear partitioning of rRNA genes between the nucleolus and nucleoplasm reflects alternative epiallelic states

    PubMed Central

    Pontvianne, Frederic; Blevins, Todd; Chandrasekhara, Chinmayi; Mozgová, Iva; Hassel, Christiane; Pontes, Olga M.F.; Tucker, Sarah; Mokroš, Petr; Muchová, Veronika; Fajkus, Jiří; Pikaard, Craig S.

    2013-01-01

    Eukaryotes can have thousands of 45S ribosomal RNA (rRNA) genes, many of which are silenced during development. Using fluorescence-activated sorting techniques, we show that active rRNA genes in Arabidopsis thaliana are present within sorted nucleoli, whereas silenced rRNA genes are excluded. DNA methyltransferase (met1), histone deacetylase (hda6), or chromatin assembly (caf1) mutants that disrupt silencing abrogate this nucleoplasmic–nucleolar partitioning. Bisulfite sequencing data indicate that active nucleolar rRNA genes are nearly completely demethylated at promoter CGs, whereas silenced genes are nearly fully methylated. Collectively, the data reveal that rRNA genes occupy distinct but changeable nuclear territories according to their epigenetic state. PMID:23873938

  2. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  3. Species identification of cattle and buffalo fat through PCR assay.

    PubMed

    Vaithiyanathan, S; Kulkarni, V V

    2016-04-01

    A method was standardized to isolate quality DNA from cattle and buffalo fat for species identification using QIAamp DNA stool mini kit. The quality of the DNA was sufficient enough to amplify universal primers viz., mt 12S rRNA and mt 16S rRNA, and species specific D loop primers for cattle and buffalo. The sensitivity of the PCR assay in the species specific D loop primer amplification was with a detection level of 0. 47 ng cattle DNA and 0.23 ng buffalo DNA in simplex and, 0. 47 ng cattle DNA and 0.12 ng buffalo DNA in duplex PCR. It is a potentially reliable method for DNA detection to authenticate animal fat. PMID:27413237

  4. Development and evaluation of 16S rRNA gene targeting Enterococcus genus- and species-specific assays

    EPA Science Inventory

    Enterococci have been widely used as indicators of fecal pollution in recreational waters. Most studies enumerate enterococci using culture-based techniques that are time consuming and do not provide information on the identity of enterococci species within a given sample. Althou...

  5. Dasytricha dominance in Surti buffalo rumen revealed by 18S rRNA sequences and real-time PCR assay.

    PubMed

    Singh, K M; Tripathi, A K; Pandya, P R; Rank, D N; Kothari, R K; Joshi, C G

    2011-09-01

    The genetic diversity of protozoa in Surti buffalo rumen was studied by amplified ribosomal DNA restriction analysis, 18S rDNA sequence homology and phylogenetic and Real-time PCR analysis methods. Three animals were fed diet comprised green fodder Napier bajra 21 (Pennisetum purpureum), mature pasture grass (Dicanthium annulatum) and concentrate mixture (20% crude protein, 65% total digestible nutrients). A protozoa-specific primer (P-SSU-342f) and a eukarya-specific primer (Medlin B) were used to amplify a 1,360 bp fragment of DNA encoding protozoal small subunit (SSU) ribosomal RNA from rumen fluid. A total of 91 clones were examined and identified 14 different 18S RNA sequences based on PCR-RFLP pattern. These 14 phylotypes were distributed into four genera-based 18S rDNA database sequences and identified as Dasytricha (57 clones), Isotricha (14 clones), Ostracodinium (11 clones) and Polyplastron (9 clones). Phylogenetic analyses were also used to infer the makeup of protozoa communities in the rumen of Surti buffalo. Out of 14 sequences, 8 sequences (69 clones) clustered with the Dasytricha ruminantium-like clone and 4 sequences (13 clones) were also phylogenetically placed with the Isotricha prostoma-like clone. Moreover, 2 phylotypes (9 clones) were related to Polyplastron multivesiculatum-like clone. In addition, the number of 18S rDNA gene copies of Dasytricha ruminantium (0.05% to ciliate protozoa) was higher than Entodinium sp. (2.0 × 10(5) vs. 1.3 × 10(4)) in per ml ruminal fluid. PMID:21744288

  6. Comparison of two poultry litter qPCR assays targeting the 16S rRNA gene of Brevibacterium sp

    EPA Science Inventory

    Chicken feces are vectors of human pathogens and are also important sources of fecal pollution in environmental waters. Consequently, methods that can detect chicken fecal pollution are needed in public health and environmental monitoring studies. In this study, we compared a pre...

  7. Photoionization study of Xe 5s: ionization cross sections and photoelectron angular distributions

    NASA Astrophysics Data System (ADS)

    Aarthi, G.; Jose, J.; Deshmukh, S.; Radojevic, V.; Deshmukh, P. C.; Manson, S. T.

    2014-01-01

    We report studies of photoelectron angular distribution and cross-section for photoionization of xenon 5s electrons using the relativistic multiconfiguration Tamm-Dancoff (MCTD) approximation. We find that MCTD provides a significantly improved agreement with experiment, compared to some of the other relativistic many body approximations such as the relativistic random phase approximation and the relativistic random phase approximation with relaxation, over the entire photon energy region bracketing the near-threshold 5s Cooper minimum, from the 5s threshold up to about 70 eV. The MCTD results in the length form are in much better agreement with the experiment than those in the velocity form, suggesting residual correlations that must be of importance.

  8. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  9. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  10. Absolute nuclear material assay

    DOEpatents

    Prasad, Manoj K.; Snyderman, Neal J.; Rowland, Mark S.

    2012-05-15

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  11. Absolute nuclear material assay

    DOEpatents

    Prasad, Manoj K.; Snyderman, Neal J.; Rowland, Mark S.

    2010-07-13

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  12. Trans-splicing and RNA editing of LSU rRNA in Diplonema mitochondria

    PubMed Central

    Valach, Matus; Moreira, Sandrine; Kiethega, Georgette N.; Burger, Gertraud

    2014-01-01

    Mitochondrial ribosomal RNAs (rRNAs) often display reduced size and deviant secondary structure, and sometimes are fragmented, as are their corresponding genes. Here we report a mitochondrial large subunit rRNA (mt-LSU rRNA) with unprecedented features. In the protist Diplonema, the rnl gene is split into two pieces (modules 1 and 2, 534- and 352-nt long) that are encoded by distinct mitochondrial chromosomes, yet the rRNA is continuous. To reconstruct the post-transcriptional maturation pathway of this rRNA, we have catalogued transcript intermediates by deep RNA sequencing and RT-PCR. Gene modules are transcribed separately. Subsequently, transcripts are end-processed, the module-1 transcript is polyuridylated and the module-2 transcript is polyadenylated. The two modules are joined via trans-splicing that retains at the junction ∼26 uridines, resulting in an extent of insertion RNA editing not observed before in any system. The A-tail of trans-spliced molecules is shorter than that of mono-module 2, and completely absent from mitoribosome-associated mt-LSU rRNA. We also characterize putative antisense transcripts. Antisense-mono-modules corroborate bi-directional transcription of chromosomes. Antisense-mt-LSU rRNA, if functional, has the potential of guiding concomitantly trans-splicing and editing of this rRNA. Together, these findings open a window on the investigation of complex regulatory networks that orchestrate multiple and biochemically diverse post-transcriptional events. PMID:24259427

  13. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON QSAR

    EPA Science Inventory

    Dyer, S.D., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to predict HC5's Based on QSARs (Abstract). To be presented at the SETAC Europe 14th Annual Meeting: Environmental Science Solution: A Pan-European Perspective, 18-...

  14. Sacrum fracture following L5-S1 stand-alone interbody fusion for isthmic spondylolisthesis.

    PubMed

    Phan, Kevin; Mobbs, Ralph J

    2015-11-01

    We report a 72-year-old man with a rare sacral fracture following stand-alone L5-S1 anterior lumbar interbody fusion for isthmic spondylolisthesis. The man underwent a minimally invasive management strategy using posterior percutaneous pedicle fixation and partial reduction of the deformity. We also discuss the current literature on fusion procedures for isthmic spondylolisthesis. PMID:26100158

  15. 5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO BRIDGE WITH EAST BRIDGE HOUSE IN RIGHT FOREGROUND. VIEW TO WEST. - MacArthur Bridge, Spanning Mississippi River on Highway 34 between IA & IL, Burlington, Des Moines County, IA

  16. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON MINIMAL DATA

    EPA Science Inventory

    Dyer, S., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to Predict HC5's Based on Minimal Data (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portland, OR. 1 p. (ERL,GB R1013).

  17. [Analysis of 5S rDNA changes in synthetic allopolyploids Triticum x Aegilops].

    PubMed

    Shcherban', A B; Sergeeva, E M; Badaeva, E D; Salina, E A

    2008-01-01

    By the example of three synthetic allopolyploids: Aegilops sharonensis x Ae. umbellulata (2n =28), Triticum urartu x Ae. tauschii (2n =28), T. dicoccoides x Ae. tauschii (2n =42) the 5S rDNA changes at the early stage of allopolyploidization were investigated. Using fluorescent in situ hybridization (FISH), the quantitative changes affecting the separate loci of one of the parental genomes were revealed in plants of S3 generation of each hybrid combination. Souther hybridization with genomic DNA of allopolyploid T. urartu x Ae. tauschii (TMU38 x TQ27) revealed lower intensity of the fragments from Ae. tauschii compared with the T. urartu fragments. It may be confirmation of the reduction of signal on 1D chromosome that was revealed in this hybrid using FISH. Both appearance of a new 5S rDNA fragments and full disappearance of fragments from parental species were not showed by Southern hybridization, as well as PCR-analysis of 5-15 plants of S2-S3 generations. The changes were not found under comparison of primary structure of nine 5S rDNA sequences of allopolyploid TMU38 x TQ27 with analogous sequences from parental species genomes. The observable similarity by FISH results of one of the studied synthetic allopolyploids with natural allopolyploid of similar genome composition indicates the early formation of unique for each allopolyploid 5S rDNA organization. PMID:18856060

  18. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  19. Adaptation of the S-5-S pendulum seismometer for measurement of rotational ground motion

    NASA Astrophysics Data System (ADS)

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-10-01

    The Russian electrodynamic seismometer model S-5-S has been adapted for the measurement of rotational ground motion. The mechanical system of the original S-5-S seismometer consists of electrodynamic sensing and damping transducer coils mounted on an asymmetrical double-arm pendulum. This pendulum is suspended on a footing using two pairs of crossed flat springs, which operate as the axis of rotation. The pendulum is stabilised by an additional spring. The S-5-S can be used either as a vertical or as a horizontal sensor. The adaptation of the S-5-S seismometer described below involves removal of the additional spring and installation of an additional mass on the damping arm. Strain gauge angle sensors are installed on one pair of the crossed flat springs. The main dynamic parameters of the rotational seismometer created in this way, i.e. the natural period and damping, are controlled electronically by feedback currents proportional to the angular displacement and angular velocity, both fed to the damping transducer coil. This new seismometer, named the S-5-SR, enables measurement of the rotational component of ground motion around the horizontal or the vertical axes. The output signal from this S-5-SR seismometer can be proportional either to rotational displacement or rotational velocity.

  20. Nucleolus-like bodies of fully-grown mouse oocytes contain key nucleolar proteins but are impoverished for rRNA.

    PubMed

    Shishova, Kseniya V; Lavrentyeva, Elena A; Dobrucki, Jurek W; Zatsepina, Olga V

    2015-01-15

    It is well known that fully-grown mammalian oocytes, rather than typical nucleoli, contain prominent but structurally homogenous bodies called "nucleolus-like bodies" (NLBs). NLBs accumulate a vast amount of material, but their biochemical composition and functions remain uncertain. To clarify the composition of the NLB material in mouse GV oocytes, we devised an assay to detect internal oocyte proteins with fluorescein-5-isothiocyanate (FITC) and applied the fluorescent RNA-binding dye acridine orange to examine whether NLBs contain RNA. Our results unequivocally show that, similarly to typical nucleoli, proteins and RNA are major constituents of transcriptionally active (or non-surrounded) NLBs as well as of transcriptionally silent (or surrounded) NLBs. We also show, by exposing fixed oocytes to a mild proteinase K treatment, that the NLB mass in oocytes of both types contains nucleolar proteins that are involved in all major steps of ribosome biogenesis, including rDNA transcription (UBF), early rRNA processing (fibrillarin), and late rRNA processing (NPM1/nucleophosmin/B23, nucleolin/C23), but none of the nuclear proteins tested, including SC35, NOBOX, topoisomerase II beta, HP1α, and H3. The ribosomal RPL26 protein was detected within the NLBs of NSN-type oocytes but is virtually absent from NLBs of SN-type oocytes. Taking into account that the major class of nucleolar RNA is ribosomal RNA (rRNA), we applied fluorescence in situ hybridization with oligonucleotide probes targeting 18S and 28S rRNAs. The results show that, in contrast to active nucleoli, NLBs of fully-grown oocytes are impoverished for the rRNAs, which is consistent with the absence of transcribed ribosomal genes in the NLB mass. Overall, the results of this study suggest that NLBs of fully-grown mammalian oocytes serve for storing major nucleolar proteins but not rRNA. PMID:25481757

  1. Immunochromatographic assay on thread.

    PubMed

    Zhou, Gina; Mao, Xun; Juncker, David

    2012-09-18

    Lateral-flow immunochromatographic assays are low-cost, simple-to-use, rapid tests for point-of-care screening of infectious diseases, drugs of abuse, and pregnancy. However, lateral flow assays are generally not quantitative, give a yes/no answer, and lack multiplexing. Threads have recently been proposed as a support for transporting and mixing liquids in lateral-flow immunochromatographic assays, but their use for quantitative high-sensitivity immunoassays has yet to be demonstrated. Here, we introduce the immunochromatographic assay on thread (ICAT) in a cartridge format that is suitable for multiplexing. The ICAT is a sandwich assay performed on a cotton thread knotted to a nylon fiber bundle, both of which are precoated with recognition antibodies against one target analyte. Upon sample application, the assay results become visible to the eye within a few minutes and are quantified using a flatbed scanner. Assay conditions were optimized, the binding curves for C-reactive protein (CRP) in buffer and diluted serum were established and a limit of detection of 377 pM was obtained. The possibility of multiplexing was demonstrated using three knotted threads coated with antibodies against CRP, osteopontin, and leptin proteins. The performance of the ICAT was compared with that of the paper-based and conventional assays. The results suggest that thread is a suitable support for making low-cost, sensitive, simple-to-use, and multiplexed diagnostic tests. PMID:22889381

  2. Rapid mercury assays

    SciTech Connect

    Szurdoki, S.; Kido, H.; Hammock, B.D.

    1996-10-01

    We have developed rapid assays with the potential of detecting mercury in environmental samples. our methods combine the simple ELISA-format with the selective, high affinity complexation of mercuric ions by sulfur-containing ligands. The first assay is based on a sandwich chelate formed by a protein-bound ligand immobilized on the wells of a microliter plate, mercuric ion of the analyzed sample, and another ligand conjugated to a reporter enzyme. The second assay involves competition between mercuric ions and an organomercury-conjugate to bind to a chelating conjugate. Several sulfur containing chelators (e.g., dithiocarbamates) and organomercurials linked to macromolecular carriers have been investigated in these assay formats. The assays detect mercuric ions in ppb/high ppt concentrations with high selectivity.

  3. Thermus thermophilus 16S rRNA is transcribed from an isolated transcription unit.

    PubMed Central

    Hartmann, R K; Erdmann, V A

    1989-01-01

    A cloned 16S rRNA gene from the extreme thermophilic eubacterium Thermus thermophilus HB8 was used to characterize the in vivo expression of the 16S rRNA genes in this organism by nuclease S1 mapping. The gene represents an isolated transcription unit encoding solely 16S rRNA. Under exponential growth conditions, transcription was initiated at a single promoter, which represents the structural equivalent of Escherichia coli rrn P2 promoters. The promoter-leader region was very similar to the E. coli rrn P2 promoter-leader segment that is responsible for antitermination. The T. thermophilus leader region was approximately 85 nucleotides shorter than its E. coli P2 counterpart. Potential processing intermediates were correlated with a proposed secondary structure of T. thermophilus pre-16S rRNA. Images PMID:2722737

  4. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  5. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  6. Effects of single-base substitutions within the acanthamoeba castellanii rRNA promoter on transcription and on binding of transcription initiation factor and RNA polymerase I

    SciTech Connect

    Kownin, P.; Bateman, E.; Paule, M.R.

    1988-02-01

    Single-point mutations were introduced into the promoter region of the Acanthamoeba castellanii rRNA gene by chemical mutagen treatment of a single-stranded clone in vitro, followed by reverse transcription and cloning of the altered fragment. The promoter mutants were tested for transcription initiation factor (TIF) binding by a template commitment assay plus DNase I footprinting and for transcription by an in vitro runoff assay. Point mutations within the previously identified TIF interaction region (between -20 and -47, motifs A and B) indicated that TIF interacts most strongly with a sequence centered at -29 and less tightly with sequences upstream and downstream. Some alterations of the base sequence closer to the transcription start site (and outside the TIF-protected site) also significantly decrease specific RNA synthesis in vitro. These were within the region which is protected from DNAse I digestion by polymerase I, but these mutations did not detectably affect the binding of polymerase to the promoter.

  7. Fine mapping of 28S rRNA sites specifically cleaved in cells undergoing apoptosis.

    PubMed Central

    Houge, G; Robaye, B; Eikhom, T S; Golstein, J; Mellgren, G; Gjertsen, B T; Lanotte, M; Døskeland, S O

    1995-01-01

    Bona fide apoptosis in rat and human leukemia cells, rat thymocytes, and bovine endothelial cells was accompanied by limited and specific cleavage of polysome-associated and monosome-associated 28S rRNA, with 18S rRNA being spared. Specific 28S rRNA cleavage was observed in all instances of apoptotic death accompanied by internucleosomal DNA fragmentation, with cleavage of 28S rRNA and of DNA being linked temporally. This indicates that 28S rRNA fragmentation may be as general a feature of apoptosis as internucleosomal DNA fragmentation and that concerted specific cleavage of intra- and extranuclear polynucleotides occurs in apoptosis. Apoptosis-associated cleavage sites were mapped to the 28S rRNA divergent domains D2, D6 (endothelial cells), and D8. The D2 cuts occurred in hairpin loop junctions considered to be buried in the intact ribosome, suggesting that this rRNA region becomes a target for RNase attack in apoptotic cells. D8 was cleaved in two exposed UU(U) sequences in bulge loops. Treatment with agents causing necrotic cell death or aging of cell lysates failed to produce any detectable limited D2 cleavage but did produce a more generalized cleavage in the D8 region. Of potential functional interest was the finding that the primary cuts in D2 exactly flanked a 0.3-kb hypervariable subdomain (D2c), allowing excision of the latter. The implication of hypervariable rRNA domains in apoptosis represents the first association of any functional process with these enigmatic parts of the ribosomes. PMID:7891700

  8. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  9. 1s2s2p2 5p3 5S transition in B ii

    NASA Astrophysics Data System (ADS)

    Mannervik, S.; Cederquist, H.; Martinson, I.; Brage, T.; Froese Fischer, C.

    1987-04-01

    An experimental and theoretical study has been made of the 1s2s2p2 5P-1s2p3 5S transition in B ii. The experimental wavelength and lifetime (1323.92+/-0.07 Å and 0.65+/-0.01 ns), determined by beam-foil spectroscopy, are more than five times more accurate than previous experimental results. Our theoretical data, from multiconfiguration Hartree-Fock calculations, 1311.6 Å and 0.601 ns, are in excellent agreement with previous theoretical predictions of Beck and Nicolaides [Phys. Lett. 61A, 227 (1977)]. We have also observed the 1s2p3 5S-1s2p23s 5P transition, at 857.7+/-0.2 Å, in accord with the theoretical value 859.1 Å.

  10. Optical characterization of CuIn5S8 crystals by ellipsometry measurements

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2016-04-01

    Optical properties of CuIn5S8 crystals grown by Bridgman method were investigated by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficients were obtained from the analysis of ellipsometry experiments performed in the 1.2-6.2 eV spectral region. Analysis of spectral dependence of the absorption coefficient revealed the existence of direct band gap transitions with energy 1.53 eV. Wemple-DiDomenico and Spitzer-Fan models were used to find the oscillator energy, dispersion energy, zero-frequency refractive index and high-frequency dielectric constant values. Structural properties of the CuIn5S8 crystals were investigated using X-ray diffraction and energy dispersive spectroscopy analysis.

  11. Ellipsometry study of optical parameters of AgIn5S8 crystals

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2015-12-01

    AgIn5S8 crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2-6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn5S8 crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  12. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report

    PubMed Central

    Lee, Sin Hang

    2016-01-01

    Lyme disease (LD), the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA) gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. PMID:27186082

  13. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report.

    PubMed

    Lee, Sin Hang

    2016-01-01

    Lyme disease (LD), the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA) gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. PMID:27186082

  14. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium

    NASA Astrophysics Data System (ADS)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.

    2014-07-01

    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  15. Interplay of RNA Pol IV and ROS1 during post-embryonic 5S rDNA chromatin remodeling.

    PubMed

    Douet, Julien; Blanchard, Bertrand; Cuvillier, Claudine; Tourmente, Sylvette

    2008-12-01

    We have investigated the chromatin structure of 5S rDNA, a heterochromatic pericentromeric tandemly repeated family, at 2, 3, 4 and 5 days post-germination. Our results revealed a large-scale reorganization of 5S rDNA chromatin that occurs during the first days of development. Unexpectedly, there is a decondensation followed by a 're'condensation of 5S rDNA chromatin, to obtain almost mature nuclei 5 d post-germination. The reorganization of 5S rDNA chromatin is accompanied by a rapid and active demethylation of 5S rDNA mediated by the ROS1 (repressor of silencing 1) demethylase, whereas the plant-specific RNA polymerase IV (Pol IV) is essential to the 5S chromatin 're'condensation. In conclusion, Pol IV and ROS1 collaborate to unlock the 5S rDNA chromatin inherited from the seed, and establish adult features. PMID:18845569

  16. Accurate taxonomy assignments from 16S rRNA sequences produced by highly parallel pyrosequencers

    PubMed Central

    Liu, Zongzhi; DeSantis, Todd Z.; Andersen, Gary L.; Knight, Rob

    2008-01-01

    The recent introduction of massively parallel pyrosequencers allows rapid, inexpensive analysis of microbial community composition using 16S ribosomal RNA (rRNA) sequences. However, a major challenge is to design a workflow so that taxonomic information can be accurately and rapidly assigned to each read, so that the composition of each community can be linked back to likely ecological roles played by members of each species, genus, family or phylum. Here, we use three large 16S rRNA datasets to test whether taxonomic information based on the full-length sequences can be recaptured by short reads that simulate the pyrosequencer outputs. We find that different taxonomic assignment methods vary radically in their ability to recapture the taxonomic information in full-length 16S rRNA sequences: most methods are sensitive to the region of the 16S rRNA gene that is targeted for sequencing, but many combinations of methods and rRNA regions produce consistent and accurate results. To process large datasets of partial 16S rRNA sequences obtained from surveys of various microbial communities, including those from human body habitats, we recommend the use of Greengenes or RDP classifier with fragments of at least 250 bases, starting from one of the primers R357, R534, R798, F343 or F517. PMID:18723574

  17. Global determinants of mortality in under 5s: 10 year worldwide longitudinal study

    PubMed Central

    Nacher, Mathieu; Guihenneuc, Chantal; Tubert-Bitter, Pascale; Chavance, Michel

    2013-01-01

    Objective To assess at country level the association of mortality in under 5s with a large set of determinants. Design Longitudinal study. Setting 193 United Nations member countries, 2000-09. Methods Yearly data between 2000 and 2009 based on 12 world development indicators were used in a multivariable general additive mixed model allowing for non-linear relations and lag effects. Main outcome measure National rate of deaths in under 5s per 1000 live births Results The model retained the variables: gross domestic product per capita; percentage of the population having access to improved water sources, having access to improved sanitation facilities, and living in urban areas; adolescent fertility rate; public health expenditure per capita; prevalence of HIV; perceived level of corruption and of violence; and mean number of years in school for women of reproductive age. Most of these variables exhibited non-linear behaviours and lag effects. Conclusions By providing a unified framework for mortality in under 5s, encompassing both high and low income countries this study showed non-linear behaviours and lag effects of known or suspected determinants of mortality in this age group. Although some of the determinants presented a linear action on log mortality indicating that whatever the context, acting on them would be a pertinent strategy to effectively reduce mortality, others had a threshold based relation potentially mediated by lag effects. These findings could help designing efficient strategies to achieve maximum progress towards millennium development goal 4, which aims to reduce mortality in under 5s by two thirds between 1990 and 2015. PMID:24212105

  18. Assessment of fecal pollution sources in a small northern-plains watershed using PCR and phylogenetic analyses of Bacteroidetes 16S rRNA gene

    USGS Publications Warehouse

    Lamendella, R.; Domingo, J.W.S.; Oerther, D.B.; Vogel, J.R.; Stoeckel, D.M.

    2007-01-01

    We evaluated the efficacy, sensitivity, host-specificity, and spatial/temporal dynamics of human- and ruminant-specific 16S rRNA gene Bacteroidetes markers used to assess the sources of fecal pollution in a fecally impacted watershed. Phylogenetic analyses of 1271 fecal and environmental 16S rRNA gene clones were also performed to study the diversity of Bacteroidetes in this watershed. The host-specific assays indicated that ruminant feces were present in 28-54% of the water samples and in all sampling seasons, with increasing frequency in downstream sites. The human-targeted assays indicated that only 3-5% of the water samples were positive for human fecal signals, although a higher percentage of human-associated signals (19-24%) were detected in sediment samples. Phylogenetic analysis indicated that 57% of all water clones clustered with yet-to-be-cultured Bacteroidetes species associated with sequences obtained from ruminant feces, further supporting the prevalence of ruminant contamination in this watershed. However, since several clusters contained sequences from multiple sources, future studies need to consider the potential cosmopolitan nature of these bacterial populations when assessing fecal pollution sources using Bacteroidetes markers. Moreover, additional data is needed in order to understand the distribution of Bacteroidetes host-specific markers and their relationship to water quality regulatory standards. ?? 2006 Federation of European Microbiological Societies.

  19. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  20. CPTAC Assay Portal: a repository of targeted proteomic assays

    SciTech Connect

    Whiteaker, Jeffrey R.; Halusa, Goran; Hoofnagle, Andrew N.; Sharma, Vagisha; MacLean, Brendan; Yan, Ping; Wrobel, John; Kennedy, Jacob; Mani, DR; Zimmerman, Lisa J.; Meyer, Matthew R.; Mesri, Mehdi; Rodriguez, Henry; Abbateillo, Susan E.; Boja, Emily; Carr, Steven A.; Chan, Daniel W.; Chen, Xian; Chen, Jing; Davies, Sherri; Ellis, Matthew; Fenyo, David; Hiltket, Tara; Ketchum, Karen; Kinsinger, Christopher; Kuhn, Eric; Liebler, Daniel; Lin, De; Liu, Tao; Loss, Michael; MacCoss, Michael; Qian, Weijun; Rivers, Robert; Rodland, Karin D.; Ruggles, Kelly; Scott, Mitchell; Smith, Richard D.; Thomas, Stefani N.; Townsend, Reid; Whiteley, Gordon; Wu, Chaochao; Zhang, Hui; Zhang, Zhen; Paulovich, Amanda G.

    2014-06-27

    To address these issues, the Clinical Proteomic Tumor Analysis Consortium (CPTAC) of the National Cancer Institute (NCI) has launched an Assay Portal (http://assays.cancer.gov) to serve as a public repository of well-characterized quantitative, MS-based, targeted proteomic assays. The purpose of the CPTAC Assay Portal is to facilitate widespread adoption of targeted MS assays by disseminating SOPs, reagents, and assay characterization data for highly characterized assays. A primary aim of the NCI-supported portal is to bring together clinicians or biologists and analytical chemists to answer hypothesis-driven questions using targeted, MS-based assays. Assay content is easily accessed through queries and filters, enabling investigators to find assays to proteins relevant to their areas of interest. Detailed characterization data are available for each assay, enabling researchers to evaluate assay performance prior to launching the assay in their own laboratory.

  1. PCR–Enzyme-Linked Immunosorbent Assay for Detection and Identification of Campylobacter Species: Application to Isolates and Stool Samples

    PubMed Central

    Metherell, L. A.; Logan, J. M. J.; Stanley, J.

    1999-01-01

    We report a PCR–enzyme-linked immunosorbent assay which identifies Campylobacter species by capture hybridization of a single-stranded 16S rRNA gene amplicon with species-specific probes in a microtiter plate format. Specificities were confirmed for both reference and field strains, but the type strain of Campylobacter coli was atypical. The assay was rapid, informative, and usable with stool-extracted DNA. PMID:9889235

  2. Novel Approach to Quantitative Detection of Specific rRNA in a Microbial Community, Using Catalytic DNA

    PubMed Central

    Suenaga, Hikaru; Liu, Rui; Shiramasa, Yuko; Kanagawa, Takahiro

    2005-01-01

    We developed a novel method for the quantitative detection of the 16S rRNA of a specific bacterial species in the microbial community by using deoxyribozyme (DNAzyme), which possesses the catalytic function to cleave RNA in a sequence-specific manner. A mixture of heterogeneous 16S rRNA containing the target 16S rRNA was incubated with a species-specific DNAzyme. The cleaved target 16S rRNA was separated from the intact 16S rRNA by electrophoresis, and then their amounts were compared for the quantitative detection of target 16S rRNA. This method was used to determine the abundance of the 16S rRNA of a filamentous bacterium, Sphaerotilus natans, in activated sludge, which is a microbial mixture used in wastewater treatment systems. The result indicated that this DNAzyme-based approach would be applicable to actual microbial communities. PMID:16085888

  3. Lateral flow assays

    PubMed Central

    Koczula, Katarzyna M.

    2016-01-01

    Lateral flow assays (LFAs) are the technology behind low-cost, simple, rapid and portable detection devices popular in biomedicine, agriculture, food and environmental sciences. This review presents an overview of the principle of the method and the critical components of the assay, focusing on lateral flow immunoassays. This type of assay has recently attracted considerable interest because of its potential to provide instantaneous diagnosis directly to patients. The range and interpretation of results and parameters used for evaluation of the assay will also be discussed. The main advantages and disadvantages of LFAs will be summarized and relevant future improvements to testing devices and strategies will be proposed. Finally, the major recent advances and future diagnostic applications in the LFA field will be explored. PMID:27365041

  4. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    PubMed

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  5. Mutations of mitochondrial 12S rRNA in gastric carcinoma and their significance

    PubMed Central

    Han, Cheng-Bo; Ma, Jia-Ming; Xin, Yan; Mao, Xiao-Yun; Zhao, Yu-Jie; Wu, Dong-Ying; Zhang, Su-Min; Zhang, Yu-Kui

    2005-01-01

    AIM: To detect the variations of mitochondrial 12S rRNA in patients with gastric carcinoma, and to study their significance and the relationship between these variations and the genesis of gastric carcinoma. METHODS: PCR amplified mitochondrial 12S rRNA of 44 samples including 22 from gastric carcinoma tissues and 22 from adjacent normal tissues, was detected by direct DNA sequencing. Then laser capture microdissection technique (LCM) was used to separate the cancerous cells and dysplasia cells with specific mutations. Denaturing high performance liquid chromatography (DHPLC) plus allele-specific PCR (AS-PCR), nest-PCR and polyacrylamide gel electrophoresis (PAGE) were used to further evaluate this mutant property and quantitative difference of mutant type between cancerous and dysplasia cells. Finally, RNAdraw biosoft was used to analyze the RNA secondary structure of mutant-type 12S rRNA. RESULTS: Compared with Mitomap database, some new variations were found, among which np652 G insertion and np716 T-G transversion were found only in cancerous tissues. There was a statistic difference in the frequency of 12S rRNA variation between intestinal type (12/17, 70.59%) and diffusive type (5/17, 29.41%) of gastric carcinoma (P<0.05). DHPLC analysis showed that 12S rRNA np652 G insertion and np716 T-G transversion were heteroplasmic mutations. The frequency of 12S rRNA variation in cancerous cells was higher than that in dysplasia cells (P<0.01). 12S rRNA np652 G insertion showed obviously negative effects on the stability of 12S rRNA secondary structure, while others such as T-G transversion did not. CONCLUSION: The mutations of mitochondrial 12S rRNA may be associated with the occurrence of intestinal-type gastric carcinoma. Most variations exist both in gastric carcinomas and in normal tissues, and they might not be the characteristics of tumors. However, np652 G insertion and np716 T-G transversion may possess some molecular significance in gastric carcinogenesis

  6. Doped colorimetric assay liposomes

    DOEpatents

    Charych, Deborah; Stevens, Raymond C.

    2001-01-01

    The present invention provides compositions comprising colorimetric assay liposomes. The present invention also provides methods for producing colorimetric liposomes and calorimetric liposome assay systems. In preferred embodiments, these calorimetric liposome systems provide high levels of sensitivity through the use of dopant molecules. As these dopants allow the controlled destabilization of the liposome structure, upon exposure of the doped liposomes to analyte(s) of interest, the indicator color change is facilitated and more easily recognized.

  7. SNAP Assay Technology.

    PubMed

    O'Connor, Thomas P

    2015-12-01

    The most widely used immunoassay configuration is the enzyme-linked immunosorbent assay (ELISA) because the procedure produces highly sensitive and specific results and generally is easy to use. By definition, ELISAs are immunoassays used to detect a substance (typically an antigen or antibody) in which an enzyme is attached (conjugated) to one of the reactants and an enzymatic reaction is used to amplify the signal if the substance is present. Optimized ELISAs include several steps that are performed in sequence using a defined protocol that typically includes application of sample and an enzyme-conjugated antibody or antigen to an immobilized reagent, followed by wash and enzyme reaction steps. The SNAP assay is an in-clinic device that performs each of the ELISA steps in a timed sequential fashion with little consumer interface. The components and mechanical mechanism of the assay device are described. Detailed descriptions of features of the assay, which minimize nonspecific binding and enhance the ability to read results from weak-positive samples, are given. Basic principles used in assays with fundamentally different reaction mechanisms, namely, antigen-detection, antibody-detection, and competitive assays are given. Applications of ELISA technology, which led to the development of several multianalyte SNAP tests capable of testing for up to 6 analytes using a single-sample and a single-SNAP device are described. PMID:27154596

  8. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  9. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  10. Performance Assessment PCR-Based Assays Targeting Bacteroidales Genetic Markers of Bovine Fecal Pollution▿

    PubMed Central

    Shanks, Orin C.; White, Karen; Kelty, Catherine A.; Hayes, Sam; Sivaganesan, Mano; Jenkins, Michael; Varma, Manju; Haugland, Richard A.

    2010-01-01

    There are numerous PCR-based assays available to characterize bovine fecal pollution in ambient waters. The determination of which approaches are most suitable for field applications can be difficult because each assay targets a different gene, in many cases from different microorganisms, leading to variation in assay performance. We describe a performance evaluation of seven end-point PCR and real-time quantitative PCR (qPCR) assays reported to be associated with either ruminant or bovine feces. Each assay was tested against a reference collection of DNA extracts from 247 individual bovine fecal samples representing 11 different populations and 175 fecal DNA extracts from 24 different animal species. Bovine-associated genetic markers were broadly distributed among individual bovine samples ranging from 39 to 93%. Specificity levels of the assays spanned 47.4% to 100%. End-point PCR sensitivity also varied between assays and among different bovine populations. For qPCR assays, the abundance of each host-associated genetic marker was measured within each bovine population and compared to results of a qPCR assay targeting 16S rRNA gene sequences from Bacteroidales. Experiments indicate large discrepancies in the performance of bovine-associated assays across different bovine populations. Variability in assay performance between host populations suggests that the use of bovine microbial source-tracking applications will require a priori characterization at each watershed of interest. PMID:20061457

  11. Two spatially separated phases in semiconducting Rb0.8Fe1.5S2

    DOE PAGESBeta

    Wang, Meng; Tian, Wei; Valdivia, P.; Chi, Songxue; Bourret-Courchesne, E.; Dai, Pengcheng; Birgeneau, R. J.

    2014-09-26

    We report neutron scattering and transport measurements on semiconducting Rb0.8Fe1.5S2, a compound isostructural and isoelectronic to the well-studied A0.8FeySe2(A = K, Rb, Cs, Tl/K) superconducting systems. Both resistivity and DC susceptibility measurements reveal a magnetic phase transition at T = 275 K. Neutron diffraction studies show that the 275 K transition originates from a phase with rhombic iron vacancy order which exhibits an in-plane stripe antiferromagnetic ordering below 275 K. In addition, the stripe antiferromagnetic phase interdigitates mesoscopically with an ubiquitous phase with √5 x√5 iron vacancy order. This phase has a magnetic transition at TN = 425 K andmore » an iron vacancy order-disorder transition at TS = 600 K. These two different structural phases are closely similar to those observed in the isomorphous Se materials. Based on the close similarities of the in-plane antiferromagnetic structures, moments sizes, and ordering temperatures in semiconducting Rb0.8Fe1.5S2 and K0.81Fe1.58Se2, we argue that the in-plane antiferromagnetic order arises from strong coupling between local moments. Superconductivity, previously observed in the A0.8FeySe2₋ zSz system, is absent in A0.8Fe1.5S2, which has a semiconducting ground state. We discuss the implied relationship between stripe and block antiferromagnetism and superconductivity in these materials as well as a strategy for further investigation.« less

  12. SAXS investigation on the temperature dependence of the conformation of Carcinus aestuarii 5S hemocyanin subunit

    NASA Astrophysics Data System (ADS)

    Beltramini, M.; Di Muro, P.; Favilla, R.; La Monaca, A.; Mariani, P.; Sabatucci, A. L.; Salvato, B.; Solari, P. L.

    1999-01-01

    The small-angle X-ray scattering technique has been used to study the spatial distribution of a subunit isolated from Carcinus hemocyanin, in solution at pH 7.5 in the 20°C-40°C temperature range. From the obtained scattering profiles, two species with different gyration radius have been detected by Guinier approximation: one species with Rg1≈25 Å is assigned to the 75 kDa 5S subunit whereas a second species with Rg2≈48 Å, and accounting for ≈3% of the total protein, is attributed to the 450 kDa 16S hexamer. Whereas Rg2 decreases slightly (≈10%) and reversibly on increasing the temperature, Rg2 decreases more markedly (≈30%), but irreversibly. The scattering data have been analysed also on the basis of the impenetrable spheres model and by means of the distance distribution function: the temperature dependence of the geometrical dimensions of the particles is confirmed. In addition, for the 5S subunit also the cross-section gyration radius decreases appreciably (15%) and reversibly with temperature. These results are interpreted on the basis of temperature induced structural rearrangements among the three domains of 5S subunit leading to an increased compactness of the molecule and a more elongated form. In contrast, the effect on the hexamer is assigned to its irreversible dissociation to monomers. This interpretation agrees with the analysis of the distance distribution functions, calculated from the Fourier's transforms of the scattering curves at the different temperatures.

  13. Magic wavelengths for the 5 s -18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, E. A.; Norris, D. G.; Koller, S. B.; Wyllie, R.; Brown, R. C.; Porto, J. V.; Safronova, U. I.; Safronova, M. S.

    2015-03-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s -18 s transition of rubidium, and compare the calculation to experiment by measuring the light shift for atoms held in an optical dipole trap at a range of wavelengths near a calculated magic value.

  14. Nucleotide sequences of 5S ribosomal RNA from four oomycete and chytrid water molds.

    PubMed

    Walker, W F; Doolittle, W F

    1982-09-25

    The nucleotide sequences of the 5S rRNAs of the oomycete water molds Saprolegnia ferax and Pythium hydnosporum and of the chytrid water molds Blastocladiella simplex and Phlyctochytrium irregulare were determined by chemical and enzymatic partial degradation of 3' and 5' end-labelled molecules, followed by gel sequence analysis. The two oomycete sequences differed in 24 positions and the two chytrid sequences differed in 27 positions. These pairs differed in a mean of 44 positions. The chytrid sequences clearly most resemble the sequence from the zygomycete Phycomyces, while the oomycete sequences appear to be allied with those from protozoa and slime molds. PMID:6890670

  15. Minimally invasive L5-S1 oblique lumbar interbody fusion with anterior plate.

    PubMed

    Pham, Martin H; Jakoi, Andre M; Hsieh, Patrick C

    2016-07-01

    Lumbar interbody fusion is an important technique for the treatment of degenerative disc disease and degenerative scoliosis. The oblique lumbar interbody fusion (OLIF) establishes a minimally invasive retroperitoneal exposure anterior to the psoas and lumbar plexus. In this video case presentation, the authors demonstrate the techniques of the OLIF at L5-S1 performed on a 69-year-old female with degenerative scoliosis as one component of an overall strategy for her deformity correction. The video can be found here: https://youtu.be/VMUYWKLAl0g . PMID:27364428

  16. Refinement of the spinal muscular atrophy locus to the interval between D5S435 and MAP1B

    SciTech Connect

    Soares, V.M.; Brzustowicz, L.M.; Kleyn, P.W.; Knowles, J.A.; Palmer, D.A.; Asokan, S.; Penchaszadeh, G.K.; Gilliam, T.C. ); Munsat, T.L. )

    1993-02-01

    The childhood-onset SMA locus has been mapped to chromosome 5q13, in a region bounded by the proximal locus, D5S6, and the closely linked distal loci, D5S112 and MAP1B. We now describe a highly polymorphic, tightly linked microsatellite marker (D5S435) that is very likely the closet proximal marker to the SMA locus. Multipoint linkage analysis firmly establishes the following order of markers at 5q13; centromere-D5S76-D5S6-D5S435-MAP1B/D5S112-D5S39-telomere. The data indicate that SMA resides in an approximately 0.7-cM (range 01.-2.1) region between D5S435 and MAP1B. This finding reduces by approximately fourfold the genetic region that most likely harbors the SMA locus and will facilitate the physical mapping and cloning of the disease gene region. 24 refs., 3 figs., 1 tab.

  17. Decreases in average bacterial community rRNA operon copy number during succession.

    PubMed

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  18. Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

    PubMed Central

    Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

    1996-01-01

    Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

  19. Tax4Fun: predicting functional profiles from metagenomic 16S rRNA data

    PubMed Central

    Aßhauer, Kathrin P.; Wemheuer, Bernd; Daniel, Rolf; Meinicke, Peter

    2015-01-01

    Motivation: The characterization of phylogenetic and functional diversity is a key element in the analysis of microbial communities. Amplicon-based sequencing of marker genes, such as 16S rRNA, is a powerful tool for assessing and comparing the structure of microbial communities at a high phylogenetic resolution. Because 16S rRNA sequencing is more cost-effective than whole metagenome shotgun sequencing, marker gene analysis is frequently used for broad studies that involve a large number of different samples. However, in comparison to shotgun sequencing approaches, insights into the functional capabilities of the community get lost when restricting the analysis to taxonomic assignment of 16S rRNA data. Results: Tax4Fun is a software package that predicts the functional capabilities of microbial communities based on 16S rRNA datasets. We evaluated Tax4Fun on a range of paired metagenome/16S rRNA datasets to assess its performance. Our results indicate that Tax4Fun provides a good approximation to functional profiles obtained from metagenomic shotgun sequencing approaches. Availability and implementation: Tax4Fun is an open-source R package and applicable to output as obtained from the SILVAngs web server or the application of QIIME with a SILVA database extension. Tax4Fun is freely available for download at http://tax4fun.gobics.de/. Contact: kasshau@gwdg.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25957349

  20. The impact of transcriptional tuning on in vitro integrated rRNA transcription and ribosome construction

    PubMed Central

    Fritz, Brian R.; Jewett, Michael C.

    2014-01-01

    In vitro ribosome construction could enable studies of ribosome assembly and function, provide a route toward constructing minimal cells for synthetic biology, and permit the construction of ribosome variants with new functions. Toward these long-term goals, we recently reported on an integrated, one-pot ribosomal RNA synthesis (rRNA), ribosome assembly, and translation technology (termed iSAT) for the construction of Escherichia coli ribosomes in crude ribosome-free S150 extracts. Here, we aimed to improve the activity of iSAT through transcriptional tuning. Specifically, we increased transcriptional efficiency through 3′ modifications to the rRNA gene sequences, optimized plasmid and polymerase concentrations, and demonstrated the use of a T7-promoted rRNA operon for stoichiometrically balanced rRNA synthesis and native rRNA processing. Our modifications produced a 45-fold improvement in iSAT protein synthesis activity, enabling synthesis of 429 ± 15 nmol/l green fluorescent protein in 6 h batch reactions. Further, we show that the translational activity of ribosomes purified from iSAT reactions is about 20% the activity of native ribosomes purified directly from E. coli cells. Looking forward, we believe iSAT will enable unique studies to unravel the systems biology of ribosome biogenesis and open the way to new methods for making and studying ribosomal variants. PMID:24792158

  1. Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces

    PubMed Central

    Orsi, William; Biddle, Jennifer F.; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface. PMID:23418556

  2. Interactions between 23S rRNA and tRNA in the ribosomal E site.

    PubMed Central

    Bocchetta, M; Xiong, L; Shah, S; Mankin, A S

    2001-01-01

    Interactions between tRNA or its analogs and 23S rRNA in the large ribosomal subunit were analyzed by RNA footprinting and by modification-interference selection. In the E site, tRNA protected bases G2112, A2392, and C2394 of 23S rRNA. Truncated tRNA, lacking the anticodon stem-loop, protected A2392 and C2394, but not G2112, and tRNA derivatives with a shortened 3' end protected only G2112, but not A2392 or C2394. Modification interference revealed C2394 as the only accessible nucleotide in 23S rRNA whose modification interferes with binding of tRNA in the large ribosomal subunit E site. The results suggest a direct contact between A76 of tRNA A76 and C2394 of 23S rRNA. Protections at G2112 may reflect interaction of this 23S rRNA region with the tRNA central fold. PMID:11214181

  3. Sequence and phylogenetic analysis of SSU rRNA gene of five microsporidia.

    PubMed

    Dong, ShiNan; Shen, ZhongYuan; Xu, Li; Zhu, Feng

    2010-01-01

    The complete small subunit rRNA (SSU rRNA) gene sequences of five microsporidia including Nosema heliothidis, and four novel microsporidia isolated from Pieris rapae, Phyllobrotica armta, Hemerophila atrilineata, and Bombyx mori, respectively, were obtained by PCR amplification, cloning, and sequencing. Two phylogenetic trees based on SSU rRNA sequences had been constructed by using Neighbor-Joining of Phylip software and UPGMA of MEGA4.0 software. The taxonomic status of four novel microsporidia was determined by analysis of phylogenetic relationship, length, G+C content, identity, and divergence of the SSU rRNA sequences. The results showed that the microsporidia isolated from Pieris rapae, Phyllobrotica armta, and Hemerophila atrilineata have close phylogenetic relationship with the Nosema, while another microsporidium isolated from Bombyx mori is closely related to the Endoreticulatus. So, we temporarily classify three novel species of microsporidia to genus Nosema, as Nosema sp. PR, Nosema sp. PA, Nosema sp. HA. Another is temporarily classified into genus Endoreticulatus, as Endoreticulatus sp. Zhenjiang. The result indicated as well that it is feasible and valuable to elucidate phylogenetic relationships and taxonomic status of microsporidian species by analyzing information from SSU rRNA sequences of microsporidia. PMID:19768503

  4. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    NASA Astrophysics Data System (ADS)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-03-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

  5. Intraspecific and Interspecific Variation in 5s RNA Genes Are Decoupled in Diploid Wheat Relatives

    PubMed Central

    Kellogg, E. A.; Appels, R.

    1995-01-01

    5S RNAs form part of the ribosome in most organisms. In some, e.g., prokaryotes and some fungi, the genes are part of the ribosomal operon, but in most eukaryotes they are in tandem arrays of hundreds to thousands of copies separate from the main ribosomal array. 5S RNA genes can be aligned across kingdoms. We were therefore surprised to find that, for 28 diploid species of the wheat tribe (Triticeae), nucleotide diversity within an array is up to 6.2% in the genes, not significantly different from that of the nontranscribed spacers. Rates of concerted evolution must therefore be insufficient to homogenize the entire array. Between species, there are significantly fewer fixed differences in the gene than would be expected, given the high within-species variation. In contrast, the amount of variation between species in the spacer is the same as or greater than that within individuals. This leads to a paradox. High variation within an individual suggests that there is little selection on any particular gene within an array. But conservation of the gene across species implies that polymorphisms are periodically eliminated at a rate approximately equal to or greater than that of speciation. Levels of intraspecific polymorphism and interspecific divergence are thus decoupled. This implies that selective mechanisms exist to eliminate mutations in the gene without also affecting the spacer. PMID:7635297

  6. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure.

    PubMed

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30-70 K in pressure range of 100-170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50-70 K in pressure range of 100-150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  7. Magnetization reversal phenomena in (Cr0.70Ti0.30)5S6

    NASA Astrophysics Data System (ADS)

    Hashimoto, Satoshi; Matsuda, Yuji; Sato, Tetsuya; Anzai, Shuichiro

    2005-12-01

    Magnetization reversal phenomena (MRP) along magnetic order-order transitions have recently been reported on impurity-doped magnetic systems. Because imperfect long-range magnetic order exists in these systems, it is expected that a systematic investigation of MRP will give physical information on thermomagnetic processes of magnetic systems in the range from the micro- to nanoscales. As a typical order-order transition (a state doubly modulated by helical and canting orders to a collinear ferrimagnetic state) has been known to occur on Cr5S6 at a transition temperature Tt, we investigate the magnetizations of (Cr0.70Ti0.30)5S6 on heating and cooling runs in various magnetic fields. At 20Oe, the field-cooled magnetization just below the Curie temperature has a positive sign; the sign turns negative below the compensation temperature TCM (first step) and finally returns to positive below Tt (second step). The first-step MRP observed in this system is explained by the potential barriers resulting from anisotropy energy when the preferred direction of collinear ferrimagnetic moment reverses. The proposed mechanism for second-step MRP is the pinning effect caused by the impurity atoms (Ti) in the helical long-range-order chains. Comparing other examples of MRPs, we discuss the roles of local impurity centers in the thermomagnetic process in magnetic order-order transitions.

  8. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    PubMed Central

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  9. Molecular phylogeny of pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences.

    PubMed

    Li, ZiHui; Feng, XianMin; Lu, SiQi; Zhang, Fan; Wang, FengYun; Huang, Song

    2008-05-01

    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis. PMID:18785590

  10. Homology of the 3' terminal sequences of the 18S rRNA of Bombyx mori and the 16S rRNA of Escherchia coli.

    PubMed Central

    Samols, D R; Hagenbuchle, O; Gage, L P

    1979-01-01

    The terminal 220 base pairs (bp) of the gene for 18S rRNA and 18 bp of the adjoining spacer rDNA of the silkworm Bombyx mori have been sequenced. Comparison with the sequence of the 16S rRNA gene of Escherichia coli has shown that a region including 45 bp of the B. mori sequence at the 3' end is remarkably homologous with the 3' terminal E. coli sequence. Other homologies occur in the terminal regions of the 18S and 16S rRNAs, including a perfectly conserved stretch of 13 bp within a longer homology located 150--200 bp from the 3' termini. These homologies are the most extensive so far reported between prokaryotic and eukaryotic genomic DNA. Images PMID:390496

  11. Rover waste assay system

    SciTech Connect

    Akers, D.W.; Stoots, C.M.; Kraft, N.C.; Marts, D.J.

    1997-11-01

    The Rover Waste Assay System (RWAS) is a nondestructive assay system designed for the rapid assay of highly-enriched {sup 235}U contaminated piping, tank sections, and debris from the Rover nuclear rocket fuel processing facility at the Idaho Chemical Processing Plant. A scanning system translates a NaI(Tl) detector/collimator system over the structural components where both relative and calibrated measurements for {sup 137}Cs are made. Uranium-235 concentrations are in operation and is sufficiently automated that most functions are performed by the computer system. These functions include system calibration, problem identification, collimator control, data analysis, and reporting. Calibration of the system was done through a combination of measurements on calibration standards and benchmarked modeling. A description of the system is presented along with the methods and uncertainties associated with the calibration and analysis of the system for components from the Rover facility. 4 refs., 2 figs., 4 tabs.

  12. Against vaccine assay secrecy

    PubMed Central

    Herder, Matthew; Hatchette, Todd F; Halperin, Scott A; Langley, Joanne M

    2015-01-01

    Increasing the transparency of the evidence base behind health interventions such as pharmaceuticals, biologics, and medical devices, has become a major point of critique, conflict, and policy focus in recent years. Yet the lack of publicly available information regarding the immunogenicity assays upon which many important, widely used vaccines are based has received no attention to date. In this paper we draw attention to this critical public health problem by reporting on our efforts to secure vaccine assay information in respect of 10 vaccines through Canada's access to information law. We argue, under Canadian law, that the public health interest in having access to the methods for these laboratory procedures should override claims by vaccine manufacturers and regulators that this information is proprietary; and, we call upon several actors to take steps to ensure greater transparency with respect to vaccine assays, including regulators, private firms, researchers, research institutions, research funders, and journal editors. PMID:25826194

  13. Chromosome mapping of 18S rDNA and 5S rDNA by dual-color fluorescence in situ hybridization in the half-smooth tongue sole (Cynoglossus semilaevis).

    PubMed

    Jiang, L; Jiang, J; Liu, J; Yuan, J; Chen, Y; Zhang, Q; Wang, X

    2014-01-01

    Half-smooth tongue sole (Cynoglossus semilaevis) is an important aquaculture flatfish in China. Cytogenetic analysis has revealed that its sex determination system is female heterogametic (ZZ/ZW). The W chromosome is morphologically larger and has been considered evolutionarily younger than any other chromosome in the set. However, the genetic origin and evolution process of this neo-chromosome remains unclear. In this study, 2 tandem arrays of rRNA genes were chosen to address this question. Both the major rDNA (18S rDNA) and the minor rDNA (5S rDNA) were located on the C. semilaevis chromosomes by fluorescence in situ hybridization (FISH). Six 18S rDNA signals were observed on the centromeric regions of 3 pairs of autosomes in both males and females. In females, there was an additional 18S rDNA signal mapping to the telomeric region of the W chromosome long arm. With respect to the 5S rDNA, 12 signals were mapped to the centromeric regions of six pairs of autosomes. Two-color FISH further confirmed that the two pairs of the 5S rDNA signals were correspondingly located at the same positions of the same autosomes as those of the 18S rDNA signals. These results allowed us to speculate about the evolution process of the W chromosome. Chromosome fusions and repetitive sequence accumulations might have occurred in C. semilaevis. The synteny and non-synteny of C. semilaevis 18S rDNA and 5S rDNA might imply the original and evolutionary characteristics of this species. These findings will facilitate studies on karyotype evolution of the order Pleuronectiformes. PMID:25526196

  14. Lateral flow strip assay

    SciTech Connect

    Miles, Robin R.; Benett, William J.; Coleman, Matthew A.; Pearson, Francesca S.; Nasarabadi, Shanavaz L.

    2011-03-08

    A lateral flow strip assay apparatus comprising a housing; a lateral flow strip in the housing, the lateral flow strip having a receiving portion; a sample collection unit; and a reagent reservoir. Saliva and/or buccal cells are collected from an individual using the sample collection unit. The sample collection unit is immersed in the reagent reservoir. The tip of the lateral flow strip is immersed in the reservoir and the reagent/sample mixture wicks up into the lateral flow strip to perform the assay.

  15. The human 18S rRNA base methyltransferases DIMT1L and WBSCR22-TRMT112 but not rRNA modification are required for ribosome biogenesis

    PubMed Central

    Zorbas, Christiane; Nicolas, Emilien; Wacheul, Ludivine; Huvelle, Emmeline; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2015-01-01

    At the heart of the ribosome lie rRNAs, whose catalytic function in translation is subtly modulated by posttranscriptional modifications. In the small ribosomal subunit of budding yeast, on the 18S rRNA, two adjacent adenosines (A1781/A1782) are N6-dimethylated by Dim1 near the decoding site, and one guanosine (G1575) is N7-methylated by Bud23-Trm112 at a ridge between the P- and E-site tRNAs. Here we establish human DIMT1L and WBSCR22-TRMT112 as the functional homologues of yeast Dim1 and Bud23-Trm112. We report that these enzymes are required for distinct pre-rRNA processing reactions leading to synthesis of 18S rRNA, and we demonstrate that in human cells, as in budding yeast, ribosome biogenesis requires the presence of the modification enzyme rather than its RNA-modifying catalytic activity. We conclude that a quality control mechanism has been conserved from yeast to human by which binding of a methyltransferase to nascent pre-rRNAs is a prerequisite to processing, so that all cleaved RNAs are committed to faithful modification. We further report that 18S rRNA dimethylation is nuclear in human cells, in contrast to yeast, where it is cytoplasmic. Yeast and human ribosome biogenesis thus have both conserved and distinctive features. PMID:25851604

  16. Diversity of host species and strains of Pneumocystis carinii is based on rRNA sequences.

    PubMed Central

    Shah, J S; Pieciak, W; Liu, J; Buharin, A; Lane, D J

    1996-01-01

    We have amplified by PCR Pneumocystis carinii cytoplasmic small-subunit rRNA (variously referred to as 16S-like or 18S-like rRNA) genes from DNA extracted from bronchoalveolar lavage and induced sputum specimens from patients positive for P. carinii and from infected ferret lung tissue. The amplification products were cloned into pUC18, and individual clones were sequenced. Comparison of the determined sequences with each other and with published rat and partial human P.carinii small-subunit rRNA gene sequences reveals that, although all P. carinii small-subunit rRNAs are closely related (approximately 96% identity), small-subunit rRNA genes isolated from different host species (human, rat, and ferret) exhibit distinctive patterns of sequence variation. Two types of sequences were isolated from the infected ferret lung tissue, one as a predominant species and the other as a minor species. There was 96% identity between the two types. In situ hybridization of the infected ferret lung tissue with oligonucleotide probes specific for each type revealed that there were two distinct strains of P. carinii present in the ferret lung tissue. Unlike the ferret P. carinii isolates, the small-subunit rRNA gene sequences from different human P. carinii isolates have greater than 99% identity and are distinct from all rat and ferret sequences so far inspected or reported in the literature. Southern blot hybridization analysis of PCR amplification products from several additional bronchoalveolar lavage or induced sputum specimens from P. carinii-infected patients, using a 32P-labeled oligonucleotide probe specific for human P. carinii, also suggests that all of the human P. carinii isolates are identical. These findings indicate that human P. carinii isolates may represent a distinct species of P. carinii distinguishable from rat and ferret P. carinii on the basis of characterization of small-subunit rRNA gene sequences. PMID:8770515

  17. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  18. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy.

    PubMed

    Wang, Qiong; Garrity, George M; Tiedje, James M; Cole, James R

    2007-08-01

    The Ribosomal Database Project (RDP) Classifier, a naïve Bayesian classifier, can rapidly and accurately classify bacterial 16S rRNA sequences into the new higher-order taxonomy proposed in Bergey's Taxonomic Outline of the Prokaryotes (2nd ed., release 5.0, Springer-Verlag, New York, NY, 2004). It provides taxonomic assignments from domain to genus, with confidence estimates for each assignment. The majority of classifications (98%) were of high estimated confidence (> or = 95%) and high accuracy (98%). In addition to being tested with the corpus of 5,014 type strain sequences from Bergey's outline, the RDP Classifier was tested with a corpus of 23,095 rRNA sequences as assigned by the NCBI into their alternative higher-order taxonomy. The results from leave-one-out testing on both corpora show that the overall accuracies at all levels of confidence for near-full-length and 400-base segments were 89% or above down to the genus level, and the majority of the classification errors appear to be due to anomalies in the current taxonomies. For shorter rRNA segments, such as those that might be generated by pyrosequencing, the error rate varied greatly over the length of the 16S rRNA gene, with segments around the V2 and V4 variable regions giving the lowest error rates. The RDP Classifier is suitable both for the analysis of single rRNA sequences and for the analysis of libraries of thousands of sequences. Another related tool, RDP Library Compare, was developed to facilitate microbial-community comparison based on 16S rRNA gene sequence libraries. It combines the RDP Classifier with a statistical test to flag taxa differentially represented between samples. The RDP Classifier and RDP Library Compare are available online at http://rdp.cme.msu.edu/. PMID:17586664

  19. Instrument for assaying radiation

    DOEpatents

    Coleman, Jody Rustyn; Farfan, Eduardo B.

    2016-03-22

    An instrument for assaying radiation includes a flat panel detector having a first side opposed to a second side. A collimated aperture covers at least a portion of the first side of the flat panel detector. At least one of a display screen or a radiation shield may cover at least a portion of the second side of the flat panel detector.

  20. Kinetic tetrazolium microtiter assay

    NASA Technical Reports Server (NTRS)

    Pierson, Duane L. (Inventor); Stowe, Raymond P. (Inventor); Koeing, David W. (Inventor)

    1992-01-01

    A method for conducting an in vitro cell assay using a tetrazolium indicator is disclosed. The indicator includes a nonionic detergent which solubilizes a tetrazolium reduction product in vitro and has low toxicity for the cells. The incubation of test cells in the presence of zolium bromide and octoxynol (TRITON X-100) permits kinetics of the cell metabolism to be determined.

  1. Macroautophagic cargo sequestration assays.

    PubMed

    Seglen, Per O; Luhr, Morten; Mills, Ian G; Sætre, Frank; Szalai, Paula; Engedal, Nikolai

    2015-03-01

    Macroautophagy, the process responsible for bulk sequestration and lysosomal degradation of cytoplasm, is often monitored by means of the autophagy-related marker protein LC3. This protein is linked to the phagophoric membrane by lipidation during the final steps of phagophore assembly, and it remains associated with autophagic organelles until it is degraded in the lysosomes. The transfer of LC3 from cytosol to membranes and organelles can be measured by immunoblotting or immunofluorescence microscopy, but these assays provide no information about functional macroautophagic activity, i.e., whether the phagophores are actually engaged in the sequestration of cytoplasmic cargo and enclosing this cargo into sealed autophagosomes. Moreover, accumulating evidence suggest that macroautophagy can proceed independently of LC3. There is therefore a need for alternative methods, preferably effective cargo sequestration assays, which can monitor actual macroautophagic activity. Here, we provide an overview of various approaches that have been used over the last four decades to measure macroautophagic sequestration activity in mammalian cells. Particular emphasis is given to the so-called "LDH sequestration assay", which measures the transfer of the autophagic cargo marker enzyme LDH (lactate dehydrogenase) from the cytosol to autophagic vacuoles. The LDH sequestration assay was originally developed to measure macroautophagic activity in primary rat hepatocytes. Subsequently, it has found use in several other cell types, and in this article we demonstrate a further validation and simplification of the method, and show that it is applicable to several cell lines that are commonly used to study autophagy. PMID:25576638

  2. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    PubMed Central

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1–RpL5-N–RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1–RpL5–RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  3. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  4. 16S rRNA Phylogenetic Investigation of the Candidate Division “Korarchaeota”

    PubMed Central

    Auchtung, Thomas A.; Takacs-Vesbach, Cristina D.; Cavanaugh, Colleen M.

    2006-01-01

    The environmental distribution and phylogeny of “Korarchaeota,” a proposed ancient archaeal division, was investigated by using the 16S rRNA gene framework. Korarchaeota-specific primers were designed based on previously published sequences and used to screen a variety of environments. Korarchaeota 16S rRNA genes were amplified exclusively from high temperature Yellowstone National Park hot springs and a 9°N East Pacific Rise deep-sea hydrothermal vent. Phylogenetic analyses of these and all available sequences suggest that Korarchaeota exhibit a high level of endemicity. PMID:16820509

  5. Phylogeny of protostome worms derived from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade. PMID:7659019

  6. 16S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects.

    PubMed Central

    O'Neill, S L; Giordano, R; Colbert, A M; Karr, T L; Robertson, H M

    1992-01-01

    Bacterial endosymbionts of insects have long been implicated in the phenomenon of cytoplasmic incompatibility, in which certain crosses between symbiont-infected individuals lead to embryonic death or sex ratio distortion. The taxonomic position of these bacteria has, however, not been known with any certainty. Similarly, the relatedness of the bacteria infecting various insect hosts has been unclear. The inability to grow these bacteria on defined cell-free medium has been the major factor underlying these uncertainties. We circumvented this problem by selective PCR amplification and subsequent sequencing of the symbiont 16S rRNA genes directly from infected insect tissue. Maximum parsimony analysis of these sequences indicates that the symbionts belong in the alpha-subdivision of the Proteobacteria, where they are most closely related to the Rickettsia and their relatives. They are all closely related to each other and are assigned to the type species Wolbachia pipientis. Lack of congruence between the phylogeny of the symbionts and their insect hosts suggest that horizontal transfer of symbionts between insect species may occur. Comparison of the sequences for W. pipientis and for Wolbachia persica, an endosymbiont of ticks, shows that the genus Wolbachia is polyphyletic. A PCR assay based on 16S primers was designed for the detection of W. pipientis in insect tissue, and initial screening of insects indicates that cytoplasmic incompatibility may be a more general phenomenon in insects than is currently recognized. Images PMID:1557375

  7. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    SciTech Connect

    Vilkas, M J; Ishikawa, Y; Trabert, E

    2008-02-29

    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  8. Solution-Based Processing of the Phase-Change Material KSb5S8

    SciTech Connect

    Mitzi,D.; Raoux, S.; Schrott, A.; Copel, M.; Kellock, A.; Jordan-Sweet, J.

    2006-01-01

    A hydrazine-based process for solution-depositing phase-change materials (PCMs) is demonstrated, using KSb{sub 5}S{sub 8} (KSS) as an example. The process involves dissolving the elemental metals and chalcogen in hydrazine at room temperature and spin-coating the solution onto a substrate, followed by a short low-temperature (T {<=} 250 C) anneal. The spin-coated KSS films, which range in thickness from 10 to 90 nm, are examined using variable temperature X-ray diffraction, medium energy ion scattering (MEIS), Rutherford backscattering spectroscopy (RBS), and scanning electron microscopy (SEM). The spin-coated KSS films exhibit a reversible amorphous-crystalline transition with a relatively high crystallization temperature ({approx}280 C). Selected other chalcogenide-based PCMs are also expected to be suitable for thin-film deposition using this approach.

  9. Minimally Invasive Approach For Extraforaminal Synovial Cyst L5-S1

    PubMed Central

    Torres Campa-Santamarina, Jose; Towne, Sara; Alimi, Marjan; Härtl, Roger

    2015-01-01

    Symptoms from synovial cysts are produced by neural compression in the spinal canal or the foramen. Few cases of extraforaminal synovial cyst have been published in the literature. This is a case report of a 65-year-old female who presented with a three-month history of sciatic pain and no relief with conservative treatment. MRI showed a left-sided extraforaminal synovial cyst at L5-S1 with compression of the L5 nerve root at the lateral portion of the foramen. Minimally invasive surgery for resection was performed using an extraforaminal tubular microscopic endoscopy-assisted approach. The patient improved clinically and remained symptom-free for the entire follow-up of 30 months. PMID:26623217

  10. Magic wavelengths for the 5 s - 18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, Elizabeth; Norris, David; Koller, Silvio; Wyllie, Robert; Brown, Roger; Porto, Trey; Safronova, Ulyana; Safronova, Marianna

    2015-05-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s - 18 s transition of rubidium near the 18 s - 6 p resonances. We compare the calculation to experiment by measuring the light shift for atoms held in a crossed optical dipole trap with wavelength tuned around the 18 s - 6p3 / 2 resonance at the experimentally convenient wavelength of 1064 nm.

  11. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    PubMed Central

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  12. Chromosome-specific NOR inactivation explains selective rRNA gene silencing and dosage control in Arabidopsis

    PubMed Central

    Chandrasekhara, Chinmayi; Mohannath, Gireesha; Blevins, Todd; Pontvianne, Frederic; Pikaard, Craig S.

    2016-01-01

    In eukaryotes, scores of excess ribosomal RNA (rRNA) genes are silenced by repressive chromatin modifications. Given the near sequence identity of rRNA genes within a species, it is unclear how specific rRNA genes are reproducibly chosen for silencing. Using Arabidopsis thaliana ecotype (strain) Col-0, a systematic search identified sequence polymorphisms that differ between active and developmentally silenced rRNA gene subtypes. Recombinant inbred mapping populations derived from three different ecotype crosses were then used to map the chromosomal locations of silenced and active RNA gene subtypes. Importantly, silenced and active rRNA gene subtypes are not intermingled. All silenced rRNA gene subtypes mapped to the nucleolus organizer region (NOR) on chromosome 2 (NOR2). All active rRNA gene subtypes mapped to NOR4. Using an engineered A. thaliana line in which a portion of Col-0 chromosome 4 was replaced by sequences of another ecotype, we show that a major rRNA gene subtype silenced at NOR2 is active when introgressed into the genome at NOR4. Collectively, these results reveal that selective rRNA gene silencing is not regulated gene by gene based on mechanisms dependent on subtle gene sequence variation. Instead, we propose that a subchromosomal silencing mechanism operates on a multimegabase scale to inactivate NOR2. PMID:26744421

  13. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells

    PubMed Central

    Cao, Weibiao

    2016-01-01

    Mechanisms of the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA. PMID:26901778

  14. Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.

    PubMed

    Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A

    2016-07-01

    Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. PMID:27084674

  15. Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

    PubMed Central

    Tatti, Enrico; McKew, Boyd A.; Whitby, Corrine; Smith, Cindy J.

    2016-01-01

    Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with 'end-point' PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included. PMID:27341629

  16. E sub 1 BF is an essential RNA polymerase I transcription factor with an intrinsic protein kinase activity that can modulate rRNA gene transcription

    SciTech Connect

    Ji Zhang; Huifeng Niu; Jacob, S.T. )

    1991-10-01

    The authors previously described the purification and characterization of E{sub 1}BF, a rat rRNA gene core promoter-binding factor that consists of two polypeptides of 89 and 79 kDa. When this factor was incubated in the absence of any exogenous protein kinase under conditions optimal for protein phosphorylation, the 79-kDa polypeptide of E{sub 1}BF was selectively phosphorylated. The labeled phosphate could be removed from the E{sub 1}BF polypeptide by treatment with calf intestinal alkaline phosphatase or potato acid phosphatase. Elution of the protein from the E{sub 1}BF-promoter complex formed in an electrophoretic mobility-shift assay followed by incubation of the concentrated eluent with ({gamma}-{sup 32}P)ATP resulted in the selective labeling o the 79-kDa band. The E{sub 1}BF-associated protein kinase did not phosphorylate casein or histone H1. These data demonstrate that (1) polymerase I promoter-binding factor E{sub 1}BF contains an intrinsic substrate-specific protein kinase and (2) E{sub 1}BF is an essential polymerase I transcription factor that can modulate rRNA gene transcription by protein phosphorylation. Further, these studies have provided a direct means to identify a protein kinase or any other enzyme that can interact with a specific DNA sequence.

  17. Modified nucleotides m(2)G966/m(5)C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon.

    PubMed

    Prokhorova, Irina V; Osterman, Ilya A; Burakovsky, Dmitry E; Serebryakova, Marina V; Galyamina, Maria A; Pobeguts, Olga V; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G; Govorun, Vadim M; Bogdanov, Alexey A; Sergiev, Petr V; Dontsova, Olga A

    2013-01-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show--using proteomic analysis and dual fluorescence reporter in vivo assays--that m(2)G966 and m(5)C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m(2)G966 and m(5)C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon. PMID:24241179

  18. Source bioaerosol concentration and rRNA gene-based identification of microorganisms aerosolized at a flood irrigation wastewater reuse site.

    PubMed

    Paez-Rubio, Tania; Viau, Emily; Romero-Hernandez, Socorro; Peccia, Jordan

    2005-02-01

    Reuse of partially treated domestic wastewater for agricultural irrigation is a growing practice in arid regions throughout the world. A field sampling campaign to determine bioaerosol concentration, culturability, and identity at various wind speeds was conducted at a flooded wastewater irrigation site in Mexicali, Baja California, Mexico. Direct fluorescent microscopy measurements for total microorganisms, culture-based assays for heterotrophs and gram-negative enteric bacteria, and small-subunit rRNA gene-based cloning were used for microbial characterizations of aerosols and effluent wastewater samples. Bioaerosol results were divided into two wind speed regimens: (i) below 1.9 m/s, average speed 0.5 m/s, and (ii) above 1.9 m/s, average speed 4.5 m/s. Average air-borne concentration of total microorganisms, culturable heterotrophs, and gram-negative enteric bacteria were, respectively, 1.1, 4.2, and 6.2 orders of magnitude greater during the high-wind-speed regimen. Small-subunit rRNA gene clone libraries processed from samples from air and the irrigation effluent wastewater during a high-wind sampling event indicate that the majority of air clone sequences were more than 98% similar to clone sequences retrieved from the effluent wastewater sample. Overall results indicate that wind is a potential aerosolization mechanism of viable wastewater microorganisms at flood irrigation sites. PMID:15691934

  19. Mechanistic Study on the Nuclear Modifier Gene MSS1 Mutation Suppressing Neomycin Sensitivity of the Mitochondrial 15S rRNA C1477G Mutation in Saccharomyces cerevisiae

    PubMed Central

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations. PMID:24595024

  20. 23S rRNA gene-based enterococci community signatures in Lake Pontchartrain, Louisiana, USA, following urban runoff inputs after Hurricane Katrina.

    PubMed

    Bae, Hee-Sung; Hou, Aixin

    2013-02-01

    Little is known about the impacts of fecal polluted urban runoff inputs on the structure of enterococci communities in estuarine waters. This study employed a 23S rRNA gene-based polymerase chain reaction (PCR) assay with newly designed genus-specific primers, Ent127F-Ent907R, to determine the possible impacts of Hurricane Katrina floodwaters via the 17th Street Canal discharge on the community structure of enterococci in Lake Pontchartrain. A total of 94 phylotypes were identified through the restriction fragment length polymorphism (RFLP) screening of 494 clones while only 8 phylotypes occurred among 88 cultivated isolates. Sequence analyses of representative phylotypes and their temporal and spatial distribution in the lake and the canal indicated the Katrina floodwater input introduced a large portion of Enterococcus flavescens, Enterococcus casseliflavus, and Enterococcus dispar into the lake; typical fecal groups Enterococcus faecium, Enterococcus durans, Enterococcus hirae, and Enterococcus mundtii were detected primarily in the floodwater-impacted waters. This study provides a global picture of enterococci in estuarine waters impacted by Hurricane Katrina-derived urban runoff. It also demonstrates the culture-independent PCR approach using 23S rRNA gene as a molecular marker could be a good alternative in ecological studies of enterococci in natural environments to overcome the limitation of conventional cultivation methods. PMID:23269456

  1. Source Bioaerosol Concentration and rRNA Gene-Based Identification of Microorganisms Aerosolized at a Flood Irrigation Wastewater Reuse Site

    PubMed Central

    Paez-Rubio, Tania; Viau, Emily; Romero-Hernandez, Socorro; Peccia, Jordan

    2005-01-01

    Reuse of partially treated domestic wastewater for agricultural irrigation is a growing practice in arid regions throughout the world. A field sampling campaign to determine bioaerosol concentration, culturability, and identity at various wind speeds was conducted at a flooded wastewater irrigation site in Mexicali, Baja California, Mexico. Direct fluorescent microscopy measurements for total microorganisms, culture-based assays for heterotrophs and gram-negative enteric bacteria, and small-subunit rRNA gene-based cloning were used for microbial characterizations of aerosols and effluent wastewater samples. Bioaerosol results were divided into two wind speed regimens: (i) below 1.9 m/s, average speed 0.5 m/s, and (ii) above 1.9 m/s, average speed 4.5 m/s. Average air-borne concentration of total microorganisms, culturable heterotrophs, and gram-negative enteric bacteria were, respectively, 1.1, 4.2, and 6.2 orders of magnitude greater during the high-wind-speed regimen. Small-subunit rRNA gene clone libraries processed from samples from air and the irrigation effluent wastewater during a high-wind sampling event indicate that the majority of air clone sequences were more than 98% similar to clone sequences retrieved from the effluent wastewater sample. Overall results indicate that wind is a potential aerosolization mechanism of viable wastewater microorganisms at flood irrigation sites. PMID:15691934

  2. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    NASA Astrophysics Data System (ADS)

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

    2013-11-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  3. The utility of diversity profiling using Illumina 18S rRNA gene amplicon deep sequencing to detect and discriminate Toxoplasma gondii among the cyst-forming coccidia.

    PubMed

    Cooper, Madalyn K; Phalen, David N; Donahoe, Shannon L; Rose, Karrie; Šlapeta, Jan

    2016-01-30

    Next-generation sequencing (NGS) has the capacity to screen a single DNA sample and detect pathogen DNA from thousands of host DNA sequence reads, making it a versatile and informative tool for investigation of pathogens in diseased animals. The technique is effective and labor saving in the initial identification of pathogens, and will complement conventional diagnostic tests to associate the candidate pathogen with a disease process. In this report, we investigated the utility of the diversity profiling NGS approach using Illumina small subunit ribosomal RNA (18S rRNA) gene amplicon deep sequencing to detect Toxoplasma gondii in previously confirmed cases of toxoplasmosis. We then tested the diagnostic approach with species-specific PCR genotyping, histopathology and immunohistochemistry of toxoplasmosis in a Risso's dolphin (Grampus griseus) to systematically characterise the disease and associate causality. We show that the Euk7A/Euk570R primer set targeting the V1-V3 hypervariable region of the 18S rRNA gene can be used as a species-specific assay for cyst-forming coccidia and discriminate T. gondii. Overall, the approach is cost-effective and improves diagnostic decision support by narrowing the differential diagnosis list with more certainty than was previously possible. Furthermore, it supplements the limitations of cryptic protozoan morphology and surpasses the need for species-specific PCR primer combinations. PMID:26801593

  4. Kinetic Tetrazolium Microtiter Assay

    NASA Technical Reports Server (NTRS)

    Pierson, Duane L.; Stowe, Raymond; Koenig, David

    1993-01-01

    Kinetic tetrazolium microtiter assay (KTMA) involves use of tetrazolium salts and Triton X-100 (or equivalent), nontoxic, in vitro color developer solubilizing colored metabolite formazan without injuring or killing metabolizing cells. Provides for continuous measurement of metabolism and makes possible to determine rate of action of antimicrobial agent in real time as well as determines effective inhibitory concentrations. Used to monitor growth after addition of stimulatory compounds. Provides for kinetic determination of efficacy of biocide, greatly increasing reliability and precision of results. Also used to determine relative effectiveness of antimicrobial agent as function of time. Capability of generating results on day of test extremely important in treatment of water and waste, disinfection of hospital rooms, and in pharmaceutical, agricultural, and food-processing industries. Assay also used in many aspects of cell biology.

  5. Molecular Diagnosis of Actinomadura madurae Infection by 16S rRNA Deep Sequencing

    PubMed Central

    SenGupta, Dhruba J.; Hoogestraat, Daniel R.; Cummings, Lisa A.; Bryant, Bronwyn H.; Natividad, Catherine; Thielges, Stephanie; Monsaas, Peter W.; Chau, Mimosa; Barbee, Lindley A.; Rosenthal, Christopher; Cookson, Brad T.; Hoffman, Noah G.

    2013-01-01

    Next-generation DNA sequencing can be used to catalog individual organisms within complex, polymicrobial specimens. Here, we utilized deep sequencing of 16S rRNA to implicate Actinomadura madurae as the cause of mycetoma in a diabetic patient when culture and conventional molecular methods were overwhelmed by overgrowth of other organisms. PMID:24108607

  6. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples. PMID:25343859

  7. Ribosome origins: The relative age of 23S rRNA Domains

    NASA Astrophysics Data System (ADS)

    Hury, James; Nagaswamy, Uma; Larios-Sanz, Maia; Fox, George E.

    2006-08-01

    The modern ribosome and its component RNAs are quite large and it is likely that at an earlier time they were much smaller. Hence, not all regions of the modern ribosomal RNAs (rRNA) are likely to be equally old. In the work described here, it is hypothesized that the oldest regions of the RNAs will usually be highly integrated into the machinery. When this is the case, an examination of the interconnectivity between local RNA regions can provide insight to the relative age of the various regions. Herein, we describe an analysis of all known long-range RNA/RNA interactions within the 23S rRNA and between the 23S rRNA and the 16S rRNA in order to assess the interconnectivity between the usual Domains as defined by secondary structure. Domain V, which contains the peptidyl transferase center is centrally located, extensively connected, and therefore likely to be the oldest region. Domain IV and Domain II are extensively interconnected with both themselves and Domain V. A portion of Domain IV is also extensively connected with the 30S subunit and hence Domain IV may be older than Domain II. These results are consistent with other evidence relating to the relative age of RNA regions. Although the relative time of addition of the GTPase center can not be reliably deduced it is pointed out that the development of this may have dramatically affected the progenotes that preceded the last common ancestor.

  8. Ribosomal Database Project: data and tools for high throughput rRNA analysis

    PubMed Central

    Cole, James R.; Wang, Qiong; Fish, Jordan A.; Chai, Benli; McGarrell, Donna M.; Sun, Yanni; Brown, C. Titus; Porras-Alfaro, Andrea; Kuske, Cheryl R.; Tiedje, James M.

    2014-01-01

    Ribosomal Database Project (RDP; http://rdp.cme.msu.edu/) provides the research community with aligned and annotated rRNA gene sequence data, along with tools to allow researchers to analyze their own rRNA gene sequences in the RDP framework. RDP data and tools are utilized in fields as diverse as human health, microbial ecology, environmental microbiology, nucleic acid chemistry, taxonomy and phylogenetics. In addition to aligned and annotated collections of bacterial and archaeal small subunit rRNA genes, RDP now includes a collection of fungal large subunit rRNA genes. RDP tools, including Classifier and Aligner, have been updated to work with this new fungal collection. The use of high-throughput sequencing to characterize environmental microbial populations has exploded in the past several years, and as sequence technologies have improved, the sizes of environmental datasets have increased. With release 11, RDP is providing an expanded set of tools to facilitate analysis of high-throughput data, including both single-stranded and paired-end reads. In addition, most tools are now available as open source packages for download and local use by researchers with high-volume needs or who would like to develop custom analysis pipelines. PMID:24288368

  9. Unequal Crossing over at the Rrna Tandon as a Source of Quantitative Genetic Variation in Drosophila

    PubMed Central

    Frankham, R.; Briscoe, D. A.; Nurthen, R. K.

    1980-01-01

    Abdominal bristle selection lines (three high and three low) and controls were founded from a marked homozygous line to measure the contribution of sex-linked "mutations" to selection response. Two of the low lines exhibited a period of rapid response to selection in females, but not in males. There were corresponding changes in female variance, in heritabilities in females, in the sex ratio (a deficiency of females) and in fitness, as well as the appearance of a mutant phenotype in females of one line. All of these changes were due to bb alleles (partial deficiencies for the rRNA tandon) in the X chromosomes of these lines, while the Y chromosomes remained wild-type bb+. We argue that the bb alleles arose by unequal crossing over in the rRNA tandon.—A prediction of this hypothesis is that further changes can occur in the rRNA tandon as selection is continued. This has now been shown to occur.—Our minimum estimate of the rate of occurrence of changes at the rRNA tandon is 3 x 10-4. As this is substantially higher than conventional mutation rates, the questions of the mechanisms and rates of origin of new quantitative genetic variation require careful re-examination. PMID:7439683

  10. 16S rRNA region based PCR protocol for identification and subtyping of Parvimonas micra

    PubMed Central

    Ota-Tsuzuki, C.; Brunheira, A.T.P.; Mayer, M.P.A.

    2008-01-01

    The present study established a PCR protocol in order to identify Parvimonas micra and to evaluate the intra-species diversity by PCR-RFLP of 16S rRNA partial sequence. The data indicated that the protocol was able to identify this species which could be clustered in five genotypes. PMID:24031274

  11. Radioreceptor assay for oxyphenonium.

    PubMed

    Ensing, K; de Zeeuw, R A

    1984-01-01

    The development of a radioreceptor assay for the quaternary anticholinergic drug, oxyphenonium, in plasma is reported. It is based on competition between this drug and 3H-dexetimide for binding to muscarinic receptors. After ion pair extraction and reextraction, the drug can be determined in plasma at concentrations down to a value of 100 pg/ml. This permits pharmacokinetic studies to be made after inhalation of oxyphenonium. PMID:6428927

  12. Analysis of 5S rDNA arrays in Arabidopsis thaliana: physical mapping and chromosome-specific polymorphisms.

    PubMed

    Cloix, C; Tutois, S; Mathieu, O; Cuvillier, C; Espagnol, M C; Picard, G; Tourmente, S

    2000-05-01

    A physical map of a pericentromeric region of chromosome 5 containing a 5S rDNA locus and spanning approximately 1000 kb was established using the CIC YAC clones. Three 5S rDNA arrays were resolved in this YAC contig by PFGE analysis and we have mapped different types of sequences between these three blocks. 5S rDNA units from each of these three arrays of chromosome 5, and from chromosomes 3 and 4, were isolated by PCR. A total of 38 new DNA sequences were obtained. Two types of 5S rDNA repeated units exist: the major variant with 0.5-kb repeats and one with short repeats (251 bp) only detected on YAC 11A3 from chromosome 3. Although the 38 sequences displayed noticeable heterogeneity, we were able to group them according to their 5S array origin. The presence of 5S array-specific variants was confirmed with the restriction polymorphism study of all the YACs carrying 5S units. PMID:10810091

  13. Robust quantitative scratch assay

    PubMed Central

    Vargas, Andrea; Angeli, Marc; Pastrello, Chiara; McQuaid, Rosanne; Li, Han; Jurisicova, Andrea; Jurisica, Igor

    2016-01-01

    The wound healing assay (or scratch assay) is a technique frequently used to quantify the dependence of cell motility—a central process in tissue repair and evolution of disease—subject to various treatments conditions. However processing the resulting data is a laborious task due its high throughput and variability across images. This Robust Quantitative Scratch Assay algorithm introduced statistical outputs where migration rates are estimated, cellular behaviour is distinguished and outliers are identified among groups of unique experimental conditions. Furthermore, the RQSA decreased measurement errors and increased accuracy in the wound boundary at comparable processing times compared to previously developed method (TScratch). Availability and implementation: The RQSA is freely available at: http://ophid.utoronto.ca/RQSA/RQSA_Scripts.zip. The image sets used for training and validation and results are available at: (http://ophid.utoronto.ca/RQSA/trainingSet.zip, http://ophid.utoronto.ca/RQSA/validationSet.zip, http://ophid.utoronto.ca/RQSA/ValidationSetResults.zip, http://ophid.utoronto.ca/RQSA/ValidationSet_H1975.zip, http://ophid.utoronto.ca/RQSA/ValidationSet_H1975Results.zip, http://ophid.utoronto.ca/RQSA/RobustnessSet.zip, http://ophid.utoronto.ca/RQSA/RobustnessSet.zip). Supplementary Material is provided for detailed description of the development of the RQSA. Contact: juris@ai.utoronto.ca Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26722119

  14. The nature of Z_b states from a combined analysis of Upsilon (5S)rightarrow h_b(mP) π ^+ π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π

    NASA Astrophysics Data System (ADS)

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-03-01

    With a combined analysis of data on Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π in an effective field theory approach, we determine resonance parameters of Z_b states in two scenarios. In one scenario we assume that Z_b states are pure molecular states, while in the other one we assume that Z_b states contain compact components. We find that the present data favor that there should be some compact components inside Z_b^{(' )} associated with the molecular components. By fitting the invariant mass spectra of Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{*}π , we determine that the probability of finding the compact components in Z_b states may be as large as about 40 %.

  15. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing.

    PubMed Central

    Schmidt, T M; DeLong, E F; Pace, N R

    1991-01-01

    The phylogenetic diversity of an oligotrophic marine picoplankton community was examined by analyzing the sequences of cloned ribosomal genes. This strategy does not rely on cultivation of the resident microorganisms. Bulk genomic DNA was isolated from picoplankton collected in the north central Pacific Ocean by tangential flow filtration. The mixed-population DNA was fragmented, size fractionated, and cloned into bacteriophage lambda. Thirty-eight clones containing 16S rRNA genes were identified in a screen of 3.2 x 10(4) recombinant phage, and portions of the rRNA gene were amplified by polymerase chain reaction and sequenced. The resulting sequences were used to establish the identities of the picoplankton by comparison with an established data base of rRNA sequences. Fifteen unique eubacterial sequences were obtained, including four from cyanobacteria and eleven from proteobacteria. A single eucaryote related to dinoflagellates was identified; no archaebacterial sequences were detected. The cyanobacterial sequences are all closely related to sequences from cultivated marine Synechococcus strains and with cyanobacterial sequences obtained from the Atlantic Ocean (Sargasso Sea). Several sequences were related to common marine isolates of the gamma subdivision of proteobacteria. In addition to sequences closely related to those of described bacteria, sequences were obtained from two phylogenetic groups of organisms that are not closely related to any known rRNA sequences from cultivated organisms. Both of these novel phylogenetic clusters are proteobacteria, one group within the alpha subdivision and the other distinct from known proteobacterial subdivisions. The rRNA sequences of the alpha-related group are nearly identical to those of some Sargasso Sea picoplankton, suggesting a global distribution of these organisms. Images PMID:2066334

  16. Molecular Methods for Identification of Acinetobacter Species by Partial Sequencing of the rpoB and 16S rRNA Genes

    PubMed Central

    Khosravi, Azar Dokht; Shahraki, Abdolrazagh Hashemi; Heidarieh, Parvin; Sheikhi, Nasrin

    2015-01-01

    Background Acinetobacter spp. is a diverse group of Gram-negative bacteria which are ubiquitous in soil and water, and an important cause of nosocomial infections. The purpose of this study was to identify a collection of Acinetobacter spp. clinical isolates accurately and to investigate their antibiotic susceptibility patterns. Materials and Methods A total of 197 non-duplicate clinical isolates of Acinetobacter spp. isolates identified using conventional biochemical tests. The molecular technique of PCR-RFLP and sequence analysis of rpoB and 16S rRNA genes was applied for species identification. Antimicrobial susceptibility test was performed with a disk diffusion assay. Results Based on 16S rRNA and rpoB genes analysis separately, most of clinical isolates can be identified with high bootstrap values. However, the identity of the isolate 555T was uncertain due to high similarity of A. grimontii and A. junii. Identification by concatenation of 16S rRNA and rpoB confirmed the identity of clinical isolates of Acenitobacer to species level confidently. Accordingly, the isolate 555T assigned as A. grimontii due to 100% similarity to A. grimontii. Moreover, this isolate showed 98.64% to A. junii. Besides, the identity of the isolates 218T and 364T was confirmed as Genomic species 3 and A. calcoaceticus respectively. So, the majority of Acinetobacter spp. isolates, were identified as: A. baumannii (131 isolates, 66%), A. calcoaceticus (9 isolates, 4.5%), and A. genomosp 16 (8 isolates, 4%). The rest of identified species showed the lower frequencies. In susceptibility test, 105 isolates (53%), presented high antibiotic resistance of 90% to ceftriaxone, piperacillin, piperacillin tazobactam, amikacin, and 81% to ciprofloxacin. Conclusion Sequence analysis of the 16S rRNA and rpoB spacer simultaneously was able to do identification of Acinetobacter spp. to species level. A.baumannii was identified as the most prevalent species with high antibiotic resistance. Other

  17. Origin and evolution of organisms as deduced from 5S ribosomal RNA sequences.

    PubMed

    Hori, H; Osawa, S

    1987-09-01

    A phylogenetic tree of most of the major groups of organisms has been constructed from the 352 5S ribosomal RNA sequences now available. The tree suggests that there are several major groups of eubacteria that diverged during the early stages of their evolution. Metabacteria (= archaebacteria) and eukaryotes separated after the emergence of eubacteria. Among eukaryotes, red algae emerged first; and, later, thraustochytrids (a Proctista group), ascomycetes (yeast), green plants (green algae and land plants), "yellow algae" (brown algae, diatoms, and chrysophyte algae), basidiomycetes (mushrooms and rusts), slime- and water molds, various protozoans, and animals emerged, approximately in that order. Three major types of photosynthetic eukaryotes--i.e., red algae (= Chlorophyll a group), green plants (Chl. a + b group) and yellow algae (Chl. a + c)--are remotely related to one another. Other photosynthetic unicellular protozoans--such as Cyanophora (Chl. a), Euglenophyta (Chl. a + b), Cryptophyta (Chl. a + c), and Dinophyta (Chl. a + c)--seem to have separated shortly after the emergence of the yellow algae. PMID:2452957

  18. Hard X-ray XAFS beamline, BL5S1, at AichiSR

    NASA Astrophysics Data System (ADS)

    Tabuchi, M.; Asakura, H.; Morimoto, H.; Watanabe, N.; Takeda, Y.

    2016-05-01

    A XAFS beamline, BL5S1, had been operated at Aichi Synchrotron Radiation Center, Japan since March 2013. The beamline was designed for the measurements in the energy range from 5 to 20 keV. The photon flux of 6 x 1010 at around 9 keV and beam spot size of 0.5 x 0.3 mm at sample position are as good as designed. For the standard transmission XAFS measurement, both of the step- and quick- scan modes are available. Energy resolution at around 9keV is good enough to discuss the energy shift of the order of 0.1 eV or higher even when the measurements are conducted in the quick-scan mode. With several kinds of detectors for fluorescence and/or CEY detection mode measurements, and various kinds of sample holders which are supported by the XAFS measurement software, users easily obtain spectra for their samples. Such a standard, well operated and easy to access XAFS beamline must be very important to broaden the base of the XAFS society further.

  19. Design and performance of a 1 MW-5 s high temperature superconductor magnetic energy storage system

    NASA Astrophysics Data System (ADS)

    Morandi, Antonio; Gholizad, Babak; Fabbri, Massimo

    2016-01-01

    The feasibility of a 1 MW-5 s superconducting magnetic energy storage (SMES) system based on state-of-the-art high-temperature superconductor (HTS) materials is investigated in detail. Both YBCO coated conductors and MgB2 are considered. A procedure for the electromagnetic design of the coil is introduced and the final layout is arrived at and compared for the two materials. The choice of the inductance of the coil is carried out as part of the design procedure. Both low-field (3 T) and high-field (8 T) designs are considered for the YBCO. AC losses during a complete charge/discharge cycle at full power are estimated and the cooling power needed for continuous operation is derived. The power conditioning system and control algorithms needed to carry out various operations are discussed in detail. Performances of the SMES system during voltage sag compensation, load leveling and power factor correction are investigated by means of numerical simulation.

  20. BactQuant: An enhanced broad-coverage bacterial quantitative real-time PCR assay

    PubMed Central

    2012-01-01

    Background Bacterial load quantification is a critical component of bacterial community analysis, but a culture-independent method capable of detecting and quantifying diverse bacteria is needed. Based on our analysis of a diverse collection of 16 S rRNA gene sequences, we designed a broad-coverage quantitative real-time PCR (qPCR) assay—BactQuant—for quantifying 16 S rRNA gene copy number and estimating bacterial load. We further utilized in silico evaluation to complement laboratory-based qPCR characterization to validate BactQuant. Methods The aligned core set of 4,938 16 S rRNA gene sequences in the Greengenes database were analyzed for assay design. Cloned plasmid standards were generated and quantified using a qPCR-based approach. Coverage analysis was performed computationally using >670,000 sequences and further evaluated following the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines. Results A bacterial TaqMan® qPCR assay targeting a 466 bp region in V3-V4 was designed. Coverage analysis showed that 91% of the phyla, 96% of the genera, and >80% of the 89,537 species analyzed contained at least one perfect sequence match to the BactQuant assay. Of the 106 bacterial species evaluated, amplification efficiencies ranged from 81 to 120%, with r2-value of >0.99, including species with sequence mismatches. Inter- and intra-run coefficient of variance was <3% and <16% for Ct and copy number, respectively. Conclusions The BactQuant assay offers significantly broader coverage than a previously reported universal bacterial quantification assay BactQuant in vitro performance was better than the in silico predictions. PMID:22510143

  1. Rhizobium sp. strain BN4 (a selenium oxyanion-reducing bacterium) 16S rRNA gene complete sequence

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1482 base pair 16S rRNA gene sequence methods in conjunction with other biochemical and morphological studies to confirm the identification of a bacterium (refer to as the BN4 strain) as a Rhizobium sp. The 16S rRNA gene sequence places it with the Rhizobium clade that includes R. d...

  2. Nucleolin is required for DNA methylation state and the expression of rRNA gene variants in Arabidopsis thaliana.

    PubMed

    Pontvianne, Frédéric; Abou-Ellail, Mohamed; Douet, Julien; Comella, Pascale; Matia, Isabel; Chandrasekhara, Chinmayi; Debures, Anne; Blevins, Todd; Cooke, Richard; Medina, Francisco J; Tourmente, Sylvette; Pikaard, Craig S; Sáez-Vásquez, Julio

    2010-11-01

    In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1). Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre-rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis. PMID:21124873

  3. Nucleolin Is Required for DNA Methylation State and the Expression of rRNA Gene Variants in Arabidopsis thaliana

    PubMed Central

    Pontvianne, Frédéric; Abou-Ellail, Mohamed; Douet, Julien; Comella, Pascale; Matia, Isabel; Chandrasekhara, Chinmayi; DeBures, Anne; Blevins, Todd; Cooke, Richard; Medina, Francisco J.; Tourmente, Sylvette; Pikaard, Craig S.; Sáez-Vásquez, Julio

    2010-01-01

    In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1). Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre–rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis. PMID:21124873

  4. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus. PMID:26959315

  5. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus.

    PubMed

    Caradonna, Fabio; Bellavia, Daniele; Clemente, Ann Maria; Sisino, Giorgia; Barbieri, Rainer

    2007-09-01

    In this paper the chromosomal localization and molecular cloning and characterization of three 5S rDNA clusters of 700 bp (base pairs), 900 bp, and 950 bp in the sea urchin Paracentrotus lividus are reported. Southern blot hybridization demonstrated the existence of three 5S rDNA repeats of differing length in the P. lividus genome. Fluorescence in situ hybridization analysis, performed in parallel on both haploid and diploid metaphases and interphase nuclei using different 5S rDNA units as probes, localized these 5S rDNA clusters in 3 different pairs of P. lividus chromosomes. This is the first complete gene mapping not only in a sea urchin but also in the phylum of echinoderms as a whole. PMID:17893727

  6. Guanine nucleotide metabolism in a mutant strain of Escherichia coli with a temperature sensitive lesion in rRNA synthesis.

    PubMed

    Harris, J S; Chaney, S G

    1978-12-21

    We have described a mutant of Escherichia coli (designated 2S142) which shows specific inhibition of rRNA synthesis at 42 degrees C. ppGpp levels increase at the restrictive temperature, as expected. However, when the cells are returned to 30 degrees C, rRNA synthesis resumes before ppGpp levels have returned to normal. Furthermore, when ppGpp levels are decreased by the addition of tetracycline or choramphenicol, rRNA synthesis does not resume at 42 degrees C. Also, a derivative of 2S142 with a temperature-sensitive G factor (which cannot synthesize either protein or ppGpp at 42 degrees C) shows identical kinetics of rRNA shut-off at 42 degrees C as 2S142. Thus, the elevated ppGpp levels in this mutant do not appear to be directly responsible for the cessation of rRNA synthesis at 42 degrees C. PMID:367439

  7. Conformation of 4.5S RNA in the signal recognition particle and on the 30S ribosomal subunit

    PubMed Central

    GU, SHAN-QING; JÖCKEL, JOHANNES; BEINKER, PHILIPP; WARNECKE, JENS; SEMENKOV, YURI P.; RODNINA, MARINA V.; WINTERMEYER, WOLFGANG

    2005-01-01

    The signal recognition particle (SRP) from Escherichia coli consists of 4.5S RNA and protein Ffh. It is essential for targeting ribosomes that are translating integral membrane proteins to the translocation pore in the plasma membrane. Independently of Ffh, 4.5S RNA also interacts with elongation factor G (EF-G) and the 30S ribosomal subunit. Here we use a cross-linking approach to probe the conformation of 4.5S RNA in SRP and in the complex with the 30S ribosomal subunit and to map the binding site. The UV-activatable cross-linker p-azidophenacyl bromide (AzP) was attached to positions 1, 21, and 54 of wild-type or modified 4.5S RNA. In SRP, cross-links to Ffh were formed from AzP in all three positions in 4.5S RNA, indicating a strongly bent conformation in which the 5′ end (position 1) and the tetraloop region (including position 54) of the molecule are close to one another and to Ffh. In ribosomal complexes of 4.5S RNA, AzP in both positions 1 and 54 formed cross-links to the 30S ribosomal subunit, independently of the presence of Ffh. The major cross-linking target on the ribosome was protein S7; minor cross-links were formed to S2, S18, and S21. There were no cross-links from 4.5S RNA to the 50S subunit, where the primary binding site of SRP is located close to the peptide exit. The functional role of 4.5S RNA binding to the 30S subunit is unclear, as the RNA had no effect on translation or tRNA translocation on the ribosome. PMID:16043501

  8. Macrophage Inflammatory Assay

    PubMed Central

    Ylostalo, Joni H.

    2016-01-01

    Macrophages represent a widely distributed and functionally diverse population of innate myeloid cells involved in inflammatory response to pathogens, tissue homeostasis and tissue repair (Murray and Wynn, 2011). Macrophages can be broadly grouped into two subpopulations with opposing activites: M1 or pro-inflammatory macrophages that promote T-helper type 1 (Th1) cell immunity and tissue damage, and M2 or anti-inflammatory/alternatively activated macrophages implicated in Th2 response and resolution of inflammation. Here we describe a rapid assay we used previously to monitor changes in pro-inflammatory and anti-inflammatory cytokine production by lipopolysaccharide (LPS)-activated macrophages in response to therapeutic paracrine factors produced by adult stem cells (Bartosh et al., 2010; Ylostalo et al., 2012; Bartosh et al., 2013). The assay can be adapted appropriately to test macrophage response to other agents as well that will be referred to herein as ‘test reagents’ or ‘test compounds’. In this protocol, the mouse macrophage cell line J774A.1 is expanded as an adherent monolayer on petri dishes allowing for the cells to be harvested easily without enzymes or cell scrapers that can damage the cells. The macropahges are then stimulated in suspension with LPS and seeded into 12-well cell culture plates containing the test reagents. After 16–18 h, the medium conditioned by the macrophages is harvested and the cytokine profile in the medium determined with enzyme-linked immunosorbent assays (ELISA). We routinely measure levels of the pro-inflammtory cytokine TNF-alpha and the anti-inflammatory cytokine interleukin-10 (IL-10).

  9. C. elegans chemotaxis assay.

    PubMed

    Margie, Olivia; Palmer, Chris; Chin-Sang, Ian

    2013-01-01

    Many organisms use chemotaxis to seek out food sources, avoid noxious substances, and find mates. Caenorhabditis elegans has impressive chemotaxis behavior. The premise behind testing the response of the worms to an odorant is to place them in an area and observe the movement evoked in response to an odorant. Even with the many available assays, optimizing worm starting location relative to both the control and test areas, while minimizing the interaction of worms with each other, while maintaining a significant sample size remains a work in progress (1-10). The method described here aims to address these issues by modifying the assay developed by Bargmann et al.(1). A Petri dish is divided into four quadrants, two opposite quadrants marked "Test" and two are designated "Control". Anesthetic is placed in all test and control sites. The worms are placed in the center of the plate with a circle marked around the origin to ensure that non-motile worms will be ignored. Utilizing a four-quadrant system rather than one 2 or two 1 eliminates bias in the movement of the worms, as they are equidistant from test and control samples, regardless of which side of the origin they began. This circumvents the problem of worms being forced to travel through a cluster of other worms to respond to an odorant, which can delay worms or force them to take a more circuitous route, yielding an incorrect interpretation of their intended path. This method also shows practical advantages by having a larger sample size and allowing the researcher to run the assay unattended and score the worms once the allotted time has expired. PMID:23644543

  10. Radon assay for SNO+

    SciTech Connect

    Rumleskie, Janet

    2015-12-31

    The SNO+ experiment will study neutrinos while located 6,800 feet below the surface of the earth at SNOLAB. Though shielded from surface backgrounds, emanation of radon radioisotopes from the surrounding rock leads to back-grounds. The characteristic decay of radon and its daughters allows for an alpha detection technique to count the amount of Rn-222 atoms collected. Traps can collect Rn-222 from various positions and materials, including an assay skid that will collect Rn-222 from the organic liquid scintillator used to detect interactions within SNO+.

  11. Radon assay for SNO+

    NASA Astrophysics Data System (ADS)

    Rumleskie, Janet

    2015-12-01

    The SNO+ experiment will study neutrinos while located 6,800 feet below the surface of the earth at SNOLAB. Though shielded from surface backgrounds, emanation of radon radioisotopes from the surrounding rock leads to back-grounds. The characteristic decay of radon and its daughters allows for an alpha detection technique to count the amount of Rn-222 atoms collected. Traps can collect Rn-222 from various positions and materials, including an assay skid that will collect Rn-222 from the organic liquid scintillator used to detect interactions within SNO+.

  12. Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

    NASA Technical Reports Server (NTRS)

    Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

    1985-01-01

    The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

  13. Biosensors: Viruses for ultrasensitive assays

    NASA Astrophysics Data System (ADS)

    Donath, Edwin

    2009-04-01

    A three-dimensional assay based on genetically engineered viral nanoparticles and nickel nanohairs can detect much lower levels of protein markers associated with heart attacks than conventional assays.

  14. Quantitative detection of the nosZ gene, encoding nitrous oxide reductase, and comparison of the abundances of 16S rRNA, narG, nirK, and nosZ genes in soils.

    PubMed

    Henry, S; Bru, D; Stres, B; Hallet, S; Philippot, L

    2006-08-01

    Nitrous oxide (N2O) is an important greenhouse gas in the troposphere controlling ozone concentration in the stratosphere through nitric oxide production. In order to quantify bacteria capable of N2O reduction, we developed a SYBR green quantitative real-time PCR assay targeting the nosZ gene encoding the catalytic subunit of the nitrous oxide reductase. Two independent sets of nosZ primers flanking the nosZ fragment previously used in diversity studies were designed and tested (K. Kloos, A. Mergel, C. Rösch, and H. Bothe, Aust. J. Plant Physiol. 28:991-998, 2001). The utility of these real-time PCR assays was demonstrated by quantifying the nosZ gene present in six different soils. Detection limits were between 10(1) and 10(2) target molecules per reaction for all assays. Sequence analysis of 128 cloned quantitative PCR products confirmed the specificity of the designed primers. The abundance of nosZ genes ranged from 10(5) to 10(7) target copies g(-1) of dry soil, whereas genes for 16S rRNA were found at 10(8) to 10(9) target copies g(-1) of dry soil. The abundance of narG and nirK genes was within the upper and lower limits of the 16S rRNA and nosZ gene copy numbers. The two sets of nosZ primers gave similar gene copy numbers for all tested soils. The maximum abundance of nosZ and nirK relative to 16S rRNA was 5 to 6%, confirming the low proportion of denitrifiers to total bacteria in soils. PMID:16885263

  15. TOTAL CULTURABLE VIRUS QUANTAL ASSAY

    EPA Science Inventory

    This chapter describes a quantal method for assaying culturable human enteric viruses from water matrices. The assay differs from the plaque assay described in Chapter 10 (December 1987 Revision) in that it is based upon the direct microscopic viewing of cells for virus-induced ...

  16. Detection of fecal bacteria and source tracking identifiers in environmental waters using rRNA-based RT-qPCR and rDNA-based qPCR assays.

    PubMed

    Pitkänen, Tarja; Ryu, Hodon; Elk, Michael; Hokajärvi, Anna-Maria; Siponen, Sallamaari; Vepsäläinen, Asko; Räsänen, Pia; Santo Domingo, Jorge W

    2013-01-01

    In this study, we evaluated the use of RT-qPCR assays targeting rRNA gene sequences for the detection of fecal bacteria in water samples. We challenged the RT-qPCR assays against RNA extracted from sewage effluent (n = 14), surface water (n = 30), and treated source water (n = 15) samples. Additionally, we applied the same assays using DNA as the qPCR template. The targeted fecal bacteria were present in most of the samples tested, although in several cases, the detection frequency increased when RNA was used as the template. For example, the majority of samples that tested positive for E. coli and Campylobacter spp. in surface waters, and for human-specific Bacteroidales, E. coli, and Enterococcus spp. in treated source waters were only detected when rRNA was used as the original template. The difference in detection frequency using rRNA or rDNA (rRNA gene) was sample- and assay-dependent, suggesting that the abundance of active and nonactive populations differed between samples. Statistical analyses for each population exhibiting multiple quantifiable results showed that the rRNA copy numbers were significantly higher than the rDNA counterparts (p < 0.05). Moreover, the detection frequency of rRNA-based assays were in better agreement with the culture-based results of E. coli, intestinal enterococci, and thermotolerant Campylobacter spp. in surface waters than that of rDNA-based assays, suggesting that rRNA signals were associated to active bacterial populations. Our data show that using rRNA-based approaches significantly increases detection sensitivity for common fecal bacteria in environmental waters. These findings have important implications for microbial water quality monitoring and public health risk assessments. PMID:24187936

  17. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment.

    PubMed

    Kwasniewska, Jolanta; Jaskowiak, Joanna

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  18. A renaissance for the pioneering 16S rRNA gene

    SciTech Connect

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  19. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment

    PubMed Central

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  20. Rapid identification of Renibacterium salmoninarum using an oligonucleotide probe complementary to 16S rRNA.

    PubMed

    Mattsson, J G; Gersdorf, H; Jansson, E; Hongslo, T; Göbel, U B; Johansson, K E

    1993-02-01

    Bacterial kidney disease in salmonid fish is caused by the slow-growing Gram-positive rod, Renibacterium salmoninarum. The partial sequence of 16S rRNA from R. salmoninarum was determined and compared with published bacterial 16S rRNA sequences. From this sequence information, a 30-bases-long oligonucleotide was designed and used as a specific probe for identification of R. salmoninarum in filter hybridization experiments. Strong specific hybridization signals were observed for all strains of R. salmoninarum tested. Furthermore, no cross-hybridization could be seen against 22 other bacterial species, among them other salmonid fish pathogens. The detection limit for the probe in direct filter hybridization by the dot-blot technique was 2.5 x 10(4) bacteria. It was also possible to detect R. salmoninarum in clinical samples by direct filter hybridization. PMID:8455640

  1. Structural Analysis of Base Substitutions in Thermus thermophilus 16S rRNA Conferring Streptomycin Resistance

    PubMed Central

    Demirci, Hasan; Murphy, Frank V.; Murphy, Eileen L.; Connetti, Jacqueline L.; Dahlberg, Albert E.; Jogl, Gerwald

    2014-01-01

    Streptomycin is a bactericidal antibiotic that induces translational errors. It binds to the 30S ribosomal subunit, interacting with ribosomal protein S12 and with 16S rRNA through contacts with the phosphodiester backbone. To explore the structural basis for streptomycin resistance, we determined the X-ray crystal structures of 30S ribosomal subunits from six streptomycin-resistant mutants of Thermus thermophilus both in the apo form and in complex with streptomycin. Base substitutions at highly conserved residues in the central pseudoknot of 16S rRNA produce novel hydrogen-bonding and base-stacking interactions. These rearrangements in secondary structure produce only minor adjustments in the three-dimensional fold of the pseudoknot. These results illustrate how antibiotic resistance can occur as a result of small changes in binding site conformation. PMID:24820088

  2. Molecular systematics of hystricognath rodents: evidence from the mitochondrial 12S rRNA gene.

    PubMed

    Nedbal, M A; Allard, M W; Honeycutt, R L

    1994-09-01

    Nucleotide sequence variation among 22 representatives of 14 families of hystricognathid rodents was examined using an 814-bp region of the mitochondrial 12S ribosomal RNA (rRNA) gene composing domains I-III. The purpose of this study was twofold. First, the phylogenetic relationships among Old World phiomorph (primarily African) and New World caviomorph (primarily South American) families were investigated, with a special emphasis on testing hypotheses pertaining to the origin of New World families and the identification of major monophyletic groups. Second, divergence times derived from molecular data were compared to those suggested by the fossil record. The resultant 12S rRNA gene phylogeny, analyzed separately and in combination with other morphological and molecular data, supported a monophyletic Caviomorpha. This finding is counter to the idea of a multiple origin for the South American families. The most strongly supported relationships within the Caviomorpha were a monophyletic Octodontoidea (containing five families) and the placement of New World porcupines (family Erethizontidae) as the most divergent family. Although comparisons to other data were more equivocal, the most parsimonious 12S rRNA trees also supported a monophyletic Phiomorpha that could be subdivided into two major groups, a clade containing the Thryonomyoidea (Thryonomyidae and Petromuridae) plus Bathyergidae and the more divergent Hystricidae (Old World porcupines). No significant differences in rates of 12S rRNA gene divergence were observed for hystricognathids in comparison to other rodent groups. Although time since divergence estimates were influenced by the fossil dates chosen to calibrate absolute rates, the overall divergence times derived from both transversions only and Kimura corrected distances and calibrations using two independent dates revealed a divergence time between Old and New World groups dating in the Eocene. PMID:7820285

  3. Application of 12S rRNA gene for the identification of animal-derived drugs.

    PubMed

    Luo, Jiaoyang; Yan, Dan; Zhang, Da; Han, Yumei; Dong, Xiaoping; Yang, Yong; Deng, Kejun; Xiao, Xiaohe

    2011-01-01

    PURPOSE. Animal-derived drugs are the major source of biological products and traditional medicine, but they are often difficult to identify, causing confusion in the clinical application. Among these medicinal animals, a number of animal species are endangered, leading to the destruction of biodiversity. The identification of animal-derived drugs and their alternatives would be a first step toward biodiversity conservation and safe medication. Until now, no effective method for identifying animal-derived drugs has been demonstrated; DNA-based species identification presents a brand-new technique. METHODS. We designed primers to amplify a 523-bp fragment of 12S rRNA and generated sequences for 13 individuals within six medicinal animal species. We examined the efficiency of species recognition based on this sequence, and we also tested the taxonomic affiliations against the GenBank database. RESULTS. All the tested drugs were identified successfully, and a visible gap was found between the inter-specific and intra-specific variation. We further demonstrated the importance of data exploration in DNA-based species identification practice by examining the sequence characteristics of relative genera in GenBank. This region of the 12S rRNA gene had a 100% success rate of species recognition within the six medicinal animal species. CONCLUSIONS. We propose that the 12S rRNA locus might be universal for identifying animal-derived drugs and their adulterants. The development of 12S rRNA for indentifying animal-derived drugs that share a common gene target would contribute significantly to the clinical application of animal-derived drugs and the conservation of medicinal animal species. This article is open to POST-PUBLICATION REVIEW. Registered readers (see "For Readers") may comment by clicking on ABSTRACT on the issue's contents page. PMID:21906480

  4. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    SciTech Connect

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  5. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    PubMed

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general. PMID:26119842

  6. Characterization of the genus Bifidobacterium by automated ribotyping and 16S rRNA gene sequences.

    PubMed

    Sakata, Shinji; Ryu, Chun Sun; Kitahara, Maki; Sakamoto, Mitsuo; Hayashi, Hidenori; Fukuyama, Masafumi; Benno, Yoshimi

    2006-01-01

    In order to characterize the genus Bifidobacterium, ribopatterns and approximately 500 bp (Escherichia coli positions 27 to 520) of 16S rRNA gene sequences of 28 type strains and 64 reference strains of the genus Bifidobacterium were determined. Ribopatterns obtained from Bifidobacterium strains were divided into nine clusters (clusters I-IX) with a similarity of 60%. Cluster V, containing 17 species, was further subdivided into 22 subclusters with a similarity of 90%. In the genus Bifidobacterium, four groups were shown according to Miyake et al.: (i) the Bifidobacterium longum infantis-longum-suis type group, (ii) the B. catenulatum-pseudocatenulatum group, (iii) the B. gallinarum-saeculare-pullorum group, and (iv) the B. coryneforme-indicum group, which showed higher than 97% similarity of the 16S rRNA gene sequences in each group. Using ribotyping analysis, unique ribopatterns were obtained from these species, and they could be separated by cluster analysis. Ribopatterns of six B. adolescentis strains were separated into different clusters, and also showed diversity in 16S rRNA gene sequences. B. adolescentis consisted of heterogeneous strains. The nine strains of B. pseudolongum subsp. pseudolongum were divided into five subclusters. Each type strain of B. pseudolongum subsp. pseudolongum and B. pseudolongum subsp. globosum and two intermediate groups, which were suggested by Yaeshima et al., consisted of individual clusters. B. animalis subsp. animalis and B. animalis subsp. lactis could not be separated by ribotyping using Eco RI. We conclude that ribotyping is able to provide another characteristic of Bifidobacterium strains in addition to 16S rRNA gene sequence phylogenetic analysis, and this information suggests that ribotyping analysis is a useful tool for the characterization of Bifidobacterium species in combination with other techniques for taxonomic characterization. PMID:16428867

  7. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    PubMed Central

    Kiryk, Anna; Sowodniok, Katharina; Kreiner, Grzegorz; Rodriguez-Parkitna, Jan; Sönmez, Aynur; Górkiewicz, Tomasz; Bierhoff, Holger; Wawrzyniak, Marcin; Janusz, Artur K.; Liss, Birgit; Konopka, Witold; Schütz, Günther; Kaczmarek, Leszek; Parlato, Rosanna

    2013-01-01

    Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer's disease (AD) and may play a role in dementia. Moreover, aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3, and dentate gyrus (DG). Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that 36 transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF) binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the DG a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving neuronal function. PMID:24273493

  8. HIV-1 Fusion Assay

    PubMed Central

    Cavrois, Marielle; Neidleman, Jason; Greene, Warner C.

    2016-01-01

    The HIV-1 fusion assay measures all steps in the HIV-1 life cycle up to and including viral fusion. It relies on the incorporation of a β-lactamase Vpr (BlaM-Vpr) protein chimera into the virion and the subsequent transfer of this chimera into the target cell by fusion (Figure 1). The transfer is monitored by the enzymatic cleavage of CCF2, a fluorescent dye substrate of β-lactamase, loaded into the target cells. Cleavage of the β-lactam ring in CCF2 by β-lactamase changes the fluorescence emission spectrum of the dye from green (520 nm) to blue (447 nm). This change reflects virion fusion and can be detected by flow cytometry (Figure 2).

  9. Chemotaxis: Under Agarose Assay.

    PubMed

    Brazill, Derrick

    2016-01-01

    The unicellular eukaryote Dictyostelium discoideum represents a superb model for examining chemotaxis. Under vegetative conditions, the amoebae are chemotactically responsive to pterins, such as folate. Under starved conditions, they lose their sensitivity to pterins, and become chemotactically responsive to cAMP. As an NIH model system, Dictyostelium offers a variety of advantages in studying chemotaxis, including its conservation of mammalian signaling pathways, its ease of growth, and its genetic tractability. In this chapter, we describe the use of the under agarose chemotaxis assay to identify proteins involved in controlling motility and directional sensing in Dictyostelium discoideum. Given the similarities between Dictyostelium and mammalian cells, this allows us to dissect the conserved pathways involved in eukaryotic chemotaxis. PMID:26498795

  10. Molecular inversion probe assay.

    PubMed

    Absalan, Farnaz; Ronaghi, Mostafa

    2007-01-01

    We have described molecular inversion probe technologies for large-scale genetic analyses. This technique provides a comprehensive and powerful tool for the analysis of genetic variation and enables affordable, large-scale studies that will help uncover the genetic basis of complex disease and explain the individual variation in response to therapeutics. Major applications of the molecular inversion probes (MIP) technologies include targeted genotyping from focused regions to whole-genome studies, and allele quantification of genomic rearrangements. The MIP technology (used in the HapMap project) provides an efficient, scalable, and affordable way to score polymorphisms in case/control populations for genetic studies. The MIP technology provides the highest commercially available multiplexing levels and assay conversion rates for targeted genotyping. This enables more informative, genome-wide studies with either the functional (direct detection) approach or the indirect detection approach. PMID:18025701

  11. Elucidating the role of C/D snoRNA in rRNA processing and modification in Trypanosoma brucei.

    PubMed

    Barth, Sarit; Shalem, Boaz; Hury, Avraham; Tkacz, Itai Dov; Liang, Xue-Hai; Uliel, Shai; Myslyuk, Inna; Doniger, Tirza; Salmon-Divon, Mali; Unger, Ron; Michaeli, Shulamit

    2008-01-01

    Most eukaryotic C/D small nucleolar RNAs (snoRNAs) guide 2'-O methylation (Nm) on rRNA and are also involved in rRNA processing. The four core proteins that bind C/D snoRNA in Trypanosoma brucei are fibrillarin (NOP1), NOP56, NOP58, and SNU13. Silencing of NOP1 by RNA interference identified rRNA-processing and modification defects that caused lethality. Systematic mapping of 2'-O-methyls on rRNA revealed the existence of hypermethylation at certain positions of the rRNA in the bloodstream form of the parasites, suggesting that this modification may assist the parasites in coping with the major temperature changes during cycling between their insect and mammalian hosts. The rRNA-processing defects of NOP1-depleted cells suggest the involvement of C/D snoRNA in trypanosome-specific rRNA-processing events to generate the small rRNA fragments. MRP RNA, which is involved in rRNA processing, was identified in this study in one of the snoRNA gene clusters, suggesting that trypanosomes utilize a combination of unique C/D snoRNAs and conserved snoRNAs for rRNA processing. PMID:17981991

  12. A Mutation in the 16S rRNA Decoding Region Attenuates the Virulence of Mycobacterium tuberculosis.

    PubMed

    Watanabe, Shinya; Matsumura, Kazunori; Iwai, Hiroki; Funatogawa, Keiji; Haishima, Yuji; Fukui, Chie; Okumura, Kayo; Kato-Miyazawa, Masako; Hashimoto, Masahito; Teramoto, Kanae; Kirikae, Fumiko; Miyoshi-Akiyama, Tohru; Kirikae, Teruo

    2016-08-01

    Mycobacterium tuberculosis contains a single rRNA operon that encodes targets for antituberculosis agents, including kanamycin. To date, only four mutations in the kanamycin binding sites of 16S rRNA have been reported in kanamycin-resistant clinical isolates. We hypothesized that another mutation(s) in the region may dramatically decrease M. tuberculosis viability and virulence. Here, we describe an rRNA mutation, U1406A, which was generated in vitro and confers resistance to kanamycin while highly attenuating M. tuberculosis virulence. The mutant showed decreased expression of 20% (n = 361) of mycobacterial proteins, including central metabolic enzymes, mycolic acid biosynthesis enzymes, and virulence factors such as antigen 85 complexes and ESAT-6. The mutation also induced three proteins, including KsgA (Rv1010; 16S rRNA adenine dimethyltransferase), which closely bind to the U1406A mutation site on the ribosome; these proteins were associated with ribosome maturation and translation initiation processes. The mutant showed an increase in 17S rRNA (precursor 16S rRNA) and a decrease in the ratio of 30S subunits to the 70S ribosomes, suggesting that the U1406A mutation in 16S rRNA attenuated M. tuberculosis virulence by affecting these processes. PMID:27245411

  13. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    PubMed Central

    Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  14. Details of gastropod phylogeny inferred from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Steiner, G; Backeljau, T; De Wachter, R

    1998-02-01

    Some generally accepted viewpoints on the phylogenetic relationships within the molluscan class Gastropoda are reassessed by comparing complete 18S rRNA sequences. Phylogenetic analyses were performed using the neighbor-joining and maximum parsimony methods. The previously suggested basal position of Archaeogastropoda, including Neritimorpha and Vetigastropoda, in the gastropod clade is confirmed. The present study also provides new molecular evidence for the monophyly of both Caenogastropoda and Euthyneura (Pulmonata and Opisthobranchia), making Prosobranchia paraphyletic. The relationships within Caenogastropoda and Euthyneura data turn out to be very unstable on the basis of the present 18S rRNA sequences. The present 18S rRNA data question, but are insufficient to decide on, muricacean (Neogastropoda), neotaenioglossan, pulmonate, or stylommatophoran monophyly. The analyses also focus on two systellommatophoran families, namely, Veronicellidae and Onchidiidae. It is suggested that Systellommatophora are not a monophyletic unit but, due to the lack of stability in the euthyneuran clade, their affinity to either Opisthobranchia or Pulmonata could not be determined. PMID:9479694

  15. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    PubMed

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  16. Rare Events of Intragenus and Intraspecies Horizontal Transfer of the 16S rRNA Gene

    PubMed Central

    Tian, Ren-Mao; Cai, Lin; Zhang, Wei-Peng; Cao, Hui-Luo; Qian, Pei-Yuan

    2015-01-01

    Horizontal gene transfer (HGT) of operational genes has been widely reported in prokaryotic organisms. However, informational genes such as those involved in transcription and translation processes are very difficult to be horizontally transferred, as described by Woese’s complexity hypothesis. Here, we analyzed all of the completed prokaryotic genome sequences (2,143 genomes) in the NCBI (National Center for Biotechnology Information) database, scanned for genomes with high intragenomic heterogeneity of 16S rRNA gene copies, and explored potential HGT events of ribosomal RNA genes based on the phylogeny, genomic organization, and secondary structures of the ribosomal RNA genes. Our results revealed 28 genomes with relatively high intragenomic heterogeneity of multiple 16S rRNA gene copies (lowest pairwise identity <98.0%), and further analysis revealed HGT events and potential donors of the heterogeneous copies (such as HGT from Chlamydia suis to Chlamydia trachomatis) and mutation events of some heterogeneous copies (such as Streptococcus suis JS14). Interestingly, HGT of the 16S rRNA gene only occurred at intragenus or intraspecies levels, which is quite different from the HGT of operational genes. Our results improve our understanding regarding the exchange of informational genes. PMID:26220935

  17. Characterization of Xanthomonas campestris Pathovars by rRNA Gene Restriction Patterns

    PubMed Central

    Berthier, Yvette; Verdier, Valérie; Guesdon, Jean-Luc; Chevrier, Danièle; Denis, Jean-Baptiste; Decoux, Guy; Lemattre, Monique

    1993-01-01

    Genomic DNA of 191 strains of the family Pseudomonadaceae, including 187 strains of the genus Xanthomonas, was cleaved by EcoRI endonuclease. After hybridization of Southern transfer blots with 2-acetylamino-fluorene-labelled Escherichia coli 16+23S rRNA probe, 27 different patterns were obtained. The strains are clearly distinguishable at the genus, species, and pathovar levels. The variability of the rRNA gene restriction patterns was determined for four pathovars of Xanthomonas campestris species. The 16 strains of X. campestris pv. begoniae analyzed gave only one pattern. The variability of rRNA gene restriction patterns of X. campestris pv. manihotis strains could be related to ecotypes. In contrast, the variability of patterns observed for X. campestris pv. malvacearum was not correlated with pathogenicity or with the geographical origins of the strains. The highest degree of variability of DNA fingerprints was observed within X. campestris pv. dieffenbachiae, which is pathogenic to several hosts of the Araceae family. In this case, variability was related to both host plant and pathogenicity. Images PMID:16348894

  18. Molecular systematics of Volvocales (Chlorophyceae, Chlorophyta) based on exhaustive 18S rRNA phylogenetic analyses.

    PubMed

    Nakada, Takashi; Misawa, Kazuharu; Nozaki, Hisayoshi

    2008-07-01

    The taxonomy of Volvocales (Chlorophyceae, Chlorophyta) was traditionally based solely on morphological characteristics. However, because recent molecular phylogeny largely contradicts the traditional subordinal and familial classifications, no classification system has yet been established that describes the subdivision of Volvocales in a manner consistent with the phylogenetic relationships. Towards development of a natural classification system at and above the generic level, identification and sorting of hundreds of sequences based on subjective phylogenetic definitions is a significant step. We constructed an 18S rRNA gene phylogeny based on 449 volvocalean sequences collected using exhaustive BLAST searches of the GenBank database. Many chimeric sequences, which can cause fallacious phylogenetic trees, were detected and excluded during data collection. The results revealed 21 strongly supported primary clades within phylogenetically redefined Volvocales. Phylogenetic classification following PhyloCode was proposed based on the presented 18S rRNA gene phylogeny along with the results of previous combined 18S and 26S rRNA and chloroplast multigene analyses. PMID:18430591

  19. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  20. Nucleation by rRNA Dictates the Precision of Nucleolus Assembly.

    PubMed

    Falahati, Hanieh; Pelham-Webb, Bobbie; Blythe, Shelby; Wieschaus, Eric

    2016-02-01

    Membrane-less organelles are intracellular compartments specialized to carry out specific cellular functions. There is growing evidence supporting the possibility that such organelles form as a new phase, separating from cytoplasm or nucleoplasm. However, a main challenge to such phase separation models is that the initial assembly, or nucleation, of the new phase is typically a highly stochastic process and does not allow for the spatiotemporal precision observed in biological systems. Here, we investigate the initial assembly of the nucleolus, a membrane-less organelle involved in different cellular functions including ribosomal biogenesis. We demonstrate that the nucleolus formation is precisely timed in D. melanogaster embryos and follows the transcription of rRNA. We provide evidence that transcription of rRNA is necessary for overcoming the highly stochastic nucleation step in the formation of the nucleolus, through a seeding mechanism. In the absence of rDNA, the nucleolar proteins studied are able to form high-concentration assemblies. However, unlike the nucleolus, these assemblies are highly variable in number, location, and time at which they form. In addition, quantitative study of the changes in the nucleoplasmic concentration and distribution of these nucleolar proteins in the wild-type embryos is consistent with the role of rRNA in seeding the nucleolus formation. PMID:26776729

  1. Sequences implicated in the processing of Thermus thermophilus HB8 23S rRNA.

    PubMed Central

    Hartmann, R K; Ulbrich, N; Erdmann, V A

    1987-01-01

    Nuclease S1 mapping analyses were performed in order to detect processing intermediates of pre-23S rRNA from Thermus thermophilus HB8. Two processing sites were identified downstream the start of transcription and several consecutive cleavage sites are associated with the mature 5'-end. In the 3'-flanking region one "primary" site and two cleavages which generate short-living intermediates were detected. A series of successive intermediates in the region of the mature 3'-end implies the existence of--in analogy to Escherichia coli--a 3'-exonucleolytic activity. The data were correlated with potential secondary structures within the pre-23S rRNA, which exhibit various repeated sequence elements. M13 sequencing data support the existence of one secondary structural element associated with the strong "primary" cleavage site in the 3'-flanking region. In T. thermophilus we can exclude the formation of an extended base-paired and precursor-specific stem enclosing the 23S rRNA which is inferred to mediate recognition by RNase III in E. coli. Images PMID:3313273

  2. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  3. rRNA Binding Sites and the Molecular Mechanism of Action of the Tetracyclines.

    PubMed

    Chukwudi, Chinwe U

    2016-08-01

    The tetracycline antibiotics are known to be effective in the treatment of both infectious and noninfectious disease conditions. The 16S rRNA binding mechanism currently held for the antibacterial action of the tetracyclines does not explain their activity against viruses, protozoa that lack mitochondria, and noninfectious conditions. Also, the mechanism by which the tetracyclines selectively inhibit microbial protein synthesis against host eukaryotic protein synthesis despite conservation of ribosome structure and functions is still questionable. Many studies have investigated the binding of the tetracyclines to the 16S rRNA using the small ribosomal subunit of different bacterial species, but there seems to be no agreement between various reports on the exact binding site on the 16S rRNA. The wide range of activity of the tetracyclines against a broad spectrum of bacterial pathogens, viruses, protozoa, and helminths, as well as noninfectious conditions, indicates a more generalized effect on RNA. In the light of recent evidence that the tetracyclines bind to various synthetic double-stranded RNAs (dsRNAs) of random base sequences, suggesting that the double-stranded structures may play a more important role in the binding of the tetracyclines to RNA than the specific base pairs, as earlier speculated, it is imperative to consider possible alternative binding modes or sites that could help explain the mechanisms of action of the tetracyclines against various pathogens and disease conditions. PMID:27246781

  4. In vivo translation of a region within the rrnB 16S rRNA gene of Escherichia coli.

    PubMed Central

    Berg, K L; Squires, C L; Squires, C

    1987-01-01

    In this study we show that a segment of the Escherichia coli rrnB 16S gene can be translated in vivo. Other laboratories have previously reported that there are internal transcription and translation signals and open reading frames within the E. coli rrnB rRNA operon. Their studies revealed a translation start signal followed by a 252-base-pair open reading frame (ORF16) within the 16S gene and detected a promoter (p16) in the same general region by using in vitro RNA polymerase binding and transcription initiation assays. By using plasmid gene fusions of ORF16 to lacZ we showed that an ORF16'-'beta-galactosidase fusion protein was made in vivo. Transcripts encoding the fusion protein were expressed either from the rrnB p1p2 control region or from a hybrid trp-lac promoter (tacP), but the amount of expression was considerably less than for a lacZ control plasmid. We used fusions to the cat gene to show that p16 is one-half as active as lacP. Deletions were used to show that p16 is located within ORF16 and thus cannot promote a transcript encoding the ORF16 peptide. A comparison of sequences from different organisms shows that ORF16 and p16 lie in a highly conserved region of the procaryotic 16S RNA structure. The first 20 amino acids of ORF16 are conserved in most eubacterial and plant organellar sequences, and promoter activity has been detected in this region of the Caulobacter crescentus sequence by other workers. Images PMID:2435709

  5. Aminoglycoside resistance 16S rRNA methyltransferases block endogenous methylation, affect translation efficiency and fitness of the host

    PubMed Central

    Lioy, Virginia S.; Goussard, Sylvie; Guerineau, Vincent; Yoon, Eun-Jeong; Courvalin, Patrice; Galimand, Marc; Grillot-Courvalin, Catherine

    2014-01-01

    In Gram-negative bacteria, acquired 16S rRNA methyltransferases ArmA and NpmA confer high-level resistance to all clinically useful aminoglycosides by modifying, respectively, G1405 and A1408 in the A-site. These enzymes must coexist with several endogenous methyltransferases that are essential for fine-tuning of the decoding center, such as RsmH and RsmI in Escherichia coli, which methylate C1402 and RsmF C1407. The resistance methyltransferases have a contrasting distribution—ArmA has spread worldwide, whereas a single clinical isolate producing NpmA has been reported. The rate of dissemination of resistance depends on the fitness cost associated with its expression. We have compared ArmA and NpmA in isogenic Escherichia coli harboring the corresponding structural genes and their inactive point mutants cloned under the control of their native constitutive promoter in the stable plasmid pGB2. Growth rate determination and competition experiments showed that ArmA had a fitness cost due to methylation of G1405, whereas NpmA conferred only a slight disadvantage to the host due to production of the enzyme. MALDI MS indicated that ArmA impeded one of the methylations at C1402 by RsmI, and not at C1407 as previously proposed, whereas NpmA blocked the activity of RsmF at C1407. A dual luciferase assay showed that methylation at G1405 and A1408 and lack of methylation at C1407 affect translation accuracy. These results indicate that resistance methyltransferases impair endogenous methylation with different consequences on cell fitness. PMID:24398977

  6. Phylogenetic analysis of complete rRNA gene sequence of Nosema philosamiae isolated from the lepidopteran Philosamia cynthia ricini.

    PubMed

    Zhu, Feng; Shen, Zhongyuan; Xu, Xiaofang; Tao, Hengping; Dong, Shinan; Tang, Xudong; Xu, Li

    2010-01-01

    ABSTRACT. The microsporidian Nosema philosamiae is a pathogen that infects the eri-silkworm Philosamia cynthia ricini. The complete sequence of rRNA gene (4,314 bp) was obtained by polymerase chain reaction amplification with specific primers and sequencing. The sequence analysis showed that the organization of the rRNA of N. philosamiae was similar to the pattern of Nosema bombycis. Phylogenetic analysis of rRNA gene sequences revealed that N. philosamiae had a close relationship with other Nosema species, confirming that N. philosamiae is correctly assigned to the genus Nosema. PMID:20384905

  7. rRNA gene restriction patterns of Haemophilus influenzae biogroup aegyptius strains associated with Brazilian purpuric fever.

    PubMed Central

    Irino, K; Grimont, F; Casin, I; Grimont, P A

    1988-01-01

    The rRNA gene restriction patterns of 92 isolates of Haemophilus influenzae biogroup aegyptius, associated with conjunctivitis or Brazilian purpuric fever in the State of São Paulo, Brazil, were studied with 16 + 23S rRNA from Escherichia coli as a probe. All strains were classified into 15 patterns. Isolates from Brazilian purpuric fever cases were seen only in patterns 3 (most frequently) and 4 (rarely), whereas isolates from conjunctivitis were found in all 15 patterns. The study demonstrated that rRNA from E. coli can serve as a probe for molecular epidemiology. Images PMID:2459153

  8. Effects of induction of rRNA overproduction on ribosomal protein synthesis and ribosome subunit assembly in Escherichia coli.

    PubMed Central

    Yamagishi, M; Nomura, M

    1988-01-01

    Overproduction of rRNA was artificially induced in Escherichia coli cells to test whether the synthesis of ribosomal protein (r-protein) is normally repressed by feedback regulation. When rRNA was overproduced more than twofold from a hybrid plasmid carrying the rrnB operon fused to the lambda pL promoter (pL-rrnB), synthesis of individual r-proteins increased by an average of about 60%. This demonstrates that the synthesis of r-proteins is repressed under normal conditions. The increase of r-protein production, however, for unknown reasons, was not as great as the increase in rRNA synthesis and resulted in an imbalance between the amounts of rRNA and r-protein synthesis. Therefore, only a small (less than 20%) increase in the synthesis of complete 30S and 50S ribosome subunits was detected, and a considerable fraction of the excess rRNA was degraded. Lack of complete cooperativity in the assembly of ribosome subunits in vivo is discussed as a possible explanation for the absence of a large stimulation of ribosome synthesis observed under these conditions. In addition to the induction of intact rRNA overproduction from the pL-rrnB operon, the effects of unbalanced overproduction of each of the two large rRNAs, 16S rRNA and 23S rRNA, on r-protein synthesis were examined using pL-rrnB derivatives carrying a large deletion in either the 23S rRNA gene or the 16S rRNA gene. Operon-specific derepression after 23S or 16S rRNA overproduction correlated with the overproduction of rRNA containing the target site for the operon-specific repressor r-protein. These results are discussed to explain the apparent coupling of the assembly of one ribosomal subunit with that of the other which was observed in earlier studies on conditionally lethal mutants with defects in ribosome assembly. PMID:3053641

  9. Molecular Surveillance of True Nontypeable Haemophilus influenzae: An Evaluation of PCR Screening Assays

    PubMed Central

    Binks, Michael J.; Temple, Beth; Kirkham, Lea-Ann; Wiertsema, Selma P.; Dunne, Eileen M.; Richmond, Peter C.; Marsh, Robyn L.; Leach, Amanda J.; Smith-Vaughan, Heidi C.

    2012-01-01

    Background Unambiguous identification of nontypeable Haemophilus influenzae (NTHi) is not possible by conventional microbiology. Molecular characterisation of phenotypically defined NTHi isolates suggests that up to 40% are Haemophilus haemolyticus (Hh); however, the genetic similarity of NTHi and Hh limits the power of simple molecular techniques such as PCR for species discrimination. Methodology/Principal Findings Here we assess the ability of previously published and novel PCR-based assays to identify true NTHi. Sixty phenotypic NTHi isolates, classified by a dual 16S rRNA gene PCR algorithm as NTHi (n = 22), Hh (n = 27) or equivocal (n = 11), were further characterised by sequencing of the 16S rRNA and recA genes then interrogated by PCR-based assays targeting the omp P2, omp P6, lgtC, hpd, 16S rRNA, fucK and iga genes. The sequencing data and PCR results were used to define NTHi for this study. Two hpd real time PCR assays (hpd#1 and hpd#3) and the conventional iga PCR assay were equally efficient at differentiating study-defined NTHi from Hh, each with a receiver operator characteristic curve area of 0.90 [0.83; 0.98]. The hpd#1 and hpd#3 assays were completely specific against a panel of common respiratory bacteria, unlike the iga PCR, and the hpd#3 assay was able to detect below 10 copies per reaction. Conclusions/Significance Our data suggest an evolutionary continuum between NTHi and Hh and therefore no single gene target could completely differentiate NTHi from Hh. The hpd#3 real time PCR assay proved to be the superior method for discrimination of NTHi from closely related Haemophilus species with the added potential for quantification of H. influenzae directly from specimens. We suggest the hpd#3 assay would be suitable for routine NTHi surveillance and to assess the impact of antibiotics and vaccines, on H. influenzae carriage rates, carriage density, and disease. PMID:22470516

  10. Application of PRECEDE-PROCEED model to tackle problems identified with diarrhoea burden among under-5s in Botswana.

    PubMed

    Popoola, Tosin; Mchunu, Gugu

    2015-05-01

    Diarrhoea has been identified as the second leading cause of mortality among under-5s and also claims more life than HIV, measles and malaria combined together in the same category of population. This article is a combination of literature review and personal experience of lessons learnt from past diarrhoea outbreaks in Botswana that caused significant rate of mortality among under-5s. The paper used literature review to identify contributory factors to diarrhoea burden among under-5s in Botswana and applied a community health nursing framework (PRECEDE-PROCEED) to tackle the problems identified. The study revealed that Botswana mothers are lacking in knowledge related to exclusive breastfeeding, prevention and treatment of diarrhoea disease. The paper recommends that health-care workers in Botswana be sensitized on current diarrhoea management to tailor their health education methods appropriately. PMID:26125574

  11. Xenopus transcription factor IIIA binds primarily at junctions between double helical stems and internal loops in oocyte 5S RNA.

    PubMed Central

    Christiansen, J; Brown, R S; Sproat, B S; Garrett, R A

    1987-01-01

    RNases and chemical probes were used to study the accessibility of each nucleotide of 5S RNA in the native and reconstituted 7S particle from Xenopus laevis oocytes. RNase or chemically treated 5S RNA from intact 7S particles was isolated and analysed using an oligodeoxynucleotide primer and reverse transcriptase. The results were superimposed on a cylindrical projection of an RNA double helix and the protection effects were shown to cluster at two regions on the molecular surface. A three-dimensional model is proposed for the 7S particle in which protein-RNA contacts occur mainly in the major groove of 5S RNA. Images Fig. 1. Fig. 2. PMID:3582366

  12. Transsacral transdiscal L5-S1 screws for the management of high-grade spondylolisthesis in an adolescent.

    PubMed

    Palejwala, Ali; Fridley, Jared; Jea, Andrew

    2016-06-01

    The surgical management of high-grade spondylolisthesis in adolescents remains a controversial issue. Because the basic procedure, posterolateral fusion, is associated with a significant rate of pseudarthrosis and listhesis progression, there is a pressing need for alternative surgical techniques. In the present report, the authors describe the case of an adolescent patient with significant low-back pain who was found to have Grade IV spondylolisthesis at L5-S1 that was treated with transsacral transdiscal screw fixation. Bilateral pedicle screws were placed starting from the top of the S-1 pedicle, across the L5-S1 intervertebral disc space, and into the L-5 body. At 14 months after surgery, the patient had considerable improvement in his pain and radiographic fusion across L5-S1. The authors conclude that transsacral transdiscal pedicle screws may serve as an efficacious and safe option for the correction of high-grade spondylolisthesis in adolescent patients. PMID:26894520

  13. Dissociative excitation of the N(+)(5S) state by electron impact on N2 - Excitation function and quenching

    NASA Technical Reports Server (NTRS)

    Erdman, P. W.; Zipf, E. C.

    1986-01-01

    Metastable N(+)(5S) ions were produced in the laboratory by dissociative excitation of N2 with energetic electrons. The resulting radiative decay of the N(+)(5S) state was observed with sufficient resolution to completely resolve the doublet from the nearby N2 molecular radiation. The excitation function was measured from threshold to 500 eV. The cross section peaks at a high electron energy and also exhibits a high threshold energy both of which are typical of dissociative excitation-ionization processes. This finding complicates the explanation of electron impact on N2 as the mechanism for the source of the 2145 A 'auroral mystery feature' by further increasing the required peak cross section. It is suggested that the apparent N(+)(5S) quenching in auroras may be an artifact due to the softening of the electron energy spectrum in the auroral E region.

  14. Expansion of the aminoglycoside-resistance 16S rRNA (m1A1408) methyltransferase family: expression and functional characterization of four hypothetical enzymes of diverse bacterial origin

    PubMed Central

    Witek, Marta A.; Conn, Graeme L.

    2014-01-01

    The global dissemination, potential activity in diverse species and broad resistance spectrum conferred by the aminoglycoside-resistance ribosomal RNA methyltransferases make them a significant potential new threat to the efficacy of aminoglycoside antibiotics in the treatment of serious bacterial infections. The N1 methylation of adenosine 1408 (m1A1408) confers resistance to structurally diverse aminoglycosides, including kanamycin, neomycin and apramycin. The limited analyses to date of the enzymes responsible have identified common features but also potential differences in their molecular details of action. Therefore, with the goal of expanding the known 16S rRNA (m1A1408) methyltransferase family as a platform for developing a more complete mechanistic understanding, we report here the cloning, expression and functional analyses of four hypothetical aminoglycoside-resistance rRNA methyltransferases from recent genome sequences of diverse bacterial species. Each of the genes produced a soluble, folded protein with a secondary structure, as determined from circular dichroism (CD) spectra, consistent with enzymes for which high-resolution structures are available. For each enzyme, antibiotic minimum inhibitory concentration (MIC) assays revealed a resistance spectrum characteristic of the known 16S rRNA (m1A1408) methyltransferases and the modified nucleotide was confirmed by reverse transcription as A1408. In common with other family members, higher binding affinity for the methylation reaction by-product S-adenosylhomocysteine (SAH) than the cosubstrate S-adenosyl-L-methionine (SAM) was observed for three methyltransferases, while one unexpectedly showed no measurable affinity for SAH. Collectively, these results confirm each hypothetical enzyme is a functional 16S rRNA (m1A1408) methyltransferase but also point to further potential mechanistic variation within this enzyme family. PMID:24963996

  15. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.

    PubMed

    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B

    2016-07-01

    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex. PMID:26974236

  16. Domain rearrangement of SRP protein Ffh upon binding 4.5S RNA and the SRP receptor FtsY

    PubMed Central

    BUSKIEWICZ, IWONA; KUBARENKO, ANDRIY; PESKE, FRANK; RODNINA, MARINA V.; WINTERMEYER, WOLFGANG

    2005-01-01

    The signal recognition particle (SRP) mediates membrane targeting of translating ribosomes displaying a signal-anchor sequence. In Escherichia coli, SRP consists of 4.5S RNA and a protein, Ffh, that recognizes the signal peptide emerging from the ribosome and the SRP receptor at the membrane, FtsY. In the present work, we studied the interactions between the NG and M domains in Ffh and their rearrangements upon complex formation with 4.5S RNA and/or FtsY. In free Ffh, the NG and M domains are facing one another in an orientation that allows cross-linking between positions 231 in the G domain and 377 in the M domain. There are binding interactions between the two domains, as the isolated domains form a strong complex. The interdomain contacts are disrupted upon binding of Ffh to 4.5S RNA, consuming a part of the total binding energy of 4.5S RNA-Ffh association that is roughly equivalent to the free energy of domain binding to each other. In the SRP particle, the NG domain binds to 4.5S RNA in a region adjacent to the binding site of the M domain. Ffh binding to FtsY also requires a reorientation of NG and M domains. These results suggest that in free Ffh, the binding sites for 4.5S RNA and FtsY are occluded by strong domain–domain interactions which must be disrupted for the formation of SRP or the Ffh-FtsY complex. PMID:15923378

  17. Domain rearrangement of SRP protein Ffh upon binding 4.5S RNA and the SRP receptor FtsY.

    PubMed

    Buskiewicz, Iwona; Kubarenko, Andriy; Peske, Frank; Rodnina, Marina V; Wintermeyer, Wolfgang

    2005-06-01

    The signal recognition particle (SRP) mediates membrane targeting of translating ribosomes displaying a signal-anchor sequence. In Escherichia coli, SRP consists of 4.5S RNA and a protein, Ffh, that recognizes the signal peptide emerging from the ribosome and the SRP receptor at the membrane, FtsY. In the present work, we studied the interactions between the NG and M domains in Ffh and their rearrangements upon complex formation with 4.5S RNA and/or FtsY. In free Ffh, the NG and M domains are facing one another in an orientation that allows cross-linking between positions 231 in the G domain and 377 in the M domain. There are binding interactions between the two domains, as the isolated domains form a strong complex. The interdomain contacts are disrupted upon binding of Ffh to 4.5S RNA, consuming a part of the total binding energy of 4.5S RNA-Ffh association that is roughly equivalent to the free energy of domain binding to each other. In the SRP particle, the NG domain binds to 4.5S RNA in a region adjacent to the binding site of the M domain. Ffh binding to FtsY also requires a reorientation of NG and M domains. These results suggest that in free Ffh, the binding sites for 4.5S RNA and FtsY are occluded by strong domain-domain interactions which must be disrupted for the formation of SRP or the Ffh-FtsY complex. PMID:15923378

  18. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location. PMID:27334092

  19. Identification of a 5S rDNA spacer type specific Triticum urartu and wheats containing the T. urartu genome.

    PubMed

    Allaby, R G; Brown, T A

    2000-04-01

    A PCR system was designed to amplify 5S spacer rDNA specifically from homeologous chromosome 1 in a variety of species representative of the Aegilops and Triticum genera. Two polymerase chain reaction (PCR) primer combinations were used, one of which appears to be apomorphic in nature and specific to chromosome 1A in Triticum urartu and tetraploid and hexaploid wheats containing the AA genome donated by T. urartu. The value of studying single repeat types to investigate the molecular evolution of 5S-rDNA arrays is considered. PMID:10791812

  20. Identification of Clinical Coryneform Bacterial Isolates: Comparison of Biochemical Methods and Sequence Analysis of 16S rRNA and rpoB Genes▿

    PubMed Central

    Adderson, Elisabeth E.; Boudreaux, Jan W.; Cummings, Jessica R.; Pounds, Stanley; Wilson, Deborah A.; Procop, Gary W.; Hayden, Randall T.

    2008-01-01

    We compared the relative levels of effectiveness of three commercial identification kits and three nucleic acid amplification tests for the identification of coryneform bacteria by testing 50 diverse isolates, including 12 well-characterized control strains and 38 organisms obtained from pediatric oncology patients at our institution. Between 33.3 and 75.0% of control strains were correctly identified to the species level by phenotypic systems or nucleic acid amplification assays. The most sensitive tests were the API Coryne system and amplification and sequencing of the 16S rRNA gene using primers optimized for coryneform bacteria, which correctly identified 9 of 12 control isolates to the species level, and all strains with a high-confidence call were correctly identified. Organisms not correctly identified were species not included in the test kit databases or not producing a pattern of reactions included in kit databases or which could not be differentiated among several genospecies based on reaction patterns. Nucleic acid amplification assays had limited abilities to identify some bacteria to the species level, and comparison of sequence homologies was complicated by the inclusion of allele sequences obtained from uncultivated and uncharacterized strains in databases. The utility of rpoB genotyping was limited by the small number of representative gene sequences that are currently available for comparison. The correlation between identifications produced by different classification systems was poor, particularly for clinical isolates. PMID:18160450

  1. An assay for adjuvanticity

    PubMed Central

    Dresser, D. W.

    1968-01-01

    Adult mice injected with an adequate amount of a non-immunogenic antigen progress to a specific state of immunological paralysis, unless a substance with `extrinsic' adjuvanticity is injected before the induction of paralysis is completed. Consequently incipiently paralysed mice can be used to assay substances for adjuvanticity. Conventional adjuvants such as Freund's adjuvant and pertussis possess adjuvanticity; other substances with varying degrees of adjuvanticity are listed in the tables. It has been shown that the adjuvanticity effect of an injection of pertussis lasts for only a few days, although the effect of such an injection of pertussis on phagocytosis of carbon particles does not reach a maximum until 2 weeks after the injection. The dose-effectiveness of alum precipitated (highly phagocytosable) bovine γ-globulin was greatly increased by the intraperitoneal injection of pertussis. The evidence is considered to be incompatible with increased phagocytosis being either an essential factor in the role of pertussis as a conventional adjuvant, or in the adjuvanticity effect of pertussis. PMID:4179956

  2. Membrane Flotation Assay

    PubMed Central

    Vogt, Dorothee A; Ott, Melanie

    2016-01-01

    Many postitive-stranded RNA viruses, such as Hepatitis C virus (HCV), highjack cellular membranes, including the Golgi, ER, mitchondria, lipid droplets, and utilize them for replication of their RNA genome or assembly of new virions. By investigating how viral proteins associate with cellular membranes we will better understand the roles of cellular membranes in the viral life cycle. Our lab has focused specifically on the role of lipid droplets and lipid-rich membranes in the life cycle of HCV. To analyze the role of lipid-rich membranes in HCV RNA replication, we utilized a membrane flotation assay based on an 10–20–30% iodixanol density gradient developed by Yeaman et al. (2001). This gradient results in a linear increase in density over almost the entire length of the gradient, and membrane particles are separated in the gradient based on their buoyant characteristics. To preserve membranes in the lysate, cells are broken mechanically in a buffer lacking detergent. The cell lysate is loaded on the bottom of the gradient, overlaid with the gradient, and membranes float up as the iodixanol gradient self-generates. The lipid content of membranes and the concentration of associated proteins will determine the separation of different membranes within the gradient. After centrifugation, fractions can be sampled from the top of the gradient and analyzed using standard SDS-PAGE and western blot analysis for proteins of interest.

  3. Performance evaluation of canine-associated Bacteroidales assays in a multi-laboratory comparison study.

    PubMed

    Schriewer, Alexander; Goodwin, Kelly D; Sinigalliano, Christopher D; Cox, Annie M; Wanless, David; Bartkowiak, Jakob; Ebentier, Darcy L; Hanley, Kaitlyn T; Ervin, Jared; Deering, Louise A; Shanks, Orin C; Peed, Lindsay A; Meijer, Wim G; Griffith, John F; SantoDomingo, Jorge; Jay, Jennifer A; Holden, Patricia A; Wuertz, Stefan

    2013-11-15

    The contribution of fecal pollution from dogs in urbanized areas can be significant and is an often underestimated problem. Microbial source tracking methods (MST) utilizing quantitative PCR of dog-associated gene sequences encoding 16S rRNA of Bacteroidales are a useful tool to estimate these contributions. However, data about the performance of available assays are scarce. The results of a multi-laboratory study testing two assays for the determination of dog-associated Bacteroidales (DogBact and BacCan-UCD) on 64 single and mixed fecal source samples created from pooled fecal samples collected in California are presented here. Standardization of qPCR data treatment lowered inter-laboratory variability of sensitivity and specificity results. Both assays exhibited 100% sensitivity. Normalization methods are presented that eliminated random and confirmed non-target responses. The combination of standardized qPCR data treatment, use of normalization via a non-target specific Bacteroidales assay (GenBac3), and application of threshold criteria improved the calculated specificity significantly for both assays. Such measures would reasonably improve MST data interpretation not only for canine-associated assays, but for all qPCR assays used in identifying and monitoring fecal pollution in the environment. PMID:23916711

  4. Simultaneous alignment and folding of 28S rRNA sequences uncovers phylogenetic signal in structure variation.

    PubMed

    Letsch, Harald O; Greve, Carola; Kück, Patrick; Fleck, Günther; Stocsits, Roman R; Misof, Bernhard

    2009-12-01

    Secondary structure models of mitochondrial and nuclear (r)RNA sequences are frequently applied to aid the alignment of these molecules in phylogenetic analyses. Additionally, it is often speculated that structure variation of (r)RNA sequences might profitably be used as phylogenetic markers. The benefit of these approaches depends on the reliability of structure models. We used a recently developed approach to show that reliable inference of large (r)RNA secondary structures as a prerequisite of simultaneous sequence and structure alignment is feasible. The approach iteratively establishes local structure constraints of each sequence and infers fully folded individual structures by constrained MFE optimization. A comparison of structure edit distances of individual constraints and fully folded structures showed pronounced phylogenetic signal in fully folded structures. As model sequences we characterized secondary structures of 28S rRNA sequences of selected insects and examined their phylogenetic signal according to established phylogenetic hypotheses. PMID:19654047

  5. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

    1992-01-01

    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  6. Primary and secondary structure of 5.8S rRNA from the silkgland of Bombyx mori.

    PubMed Central

    Fujiwara, H; Kawata, Y; Ishikawa, H

    1982-01-01

    Nucleotide sequence of 5.8S rRNA of the silkworm, Bombyx mori has been determined by gel sequencing methods. The 5.8S rRNA was the longest so far reported, with the 5'-terminal sequence several nucleotides longer than those of the other organisms. Upon constructing the secondary structure in accordance with the "burp gun" model (12), the Bombyx 5.8S rRNA formed a wide-open "muzzle" due to several unpaired bases at the ends. The overall structure also appeared less stable with less G . C pairs and more unpaired bases than that of the HeLa 5.8S rRNA. These structural features may be essential for those 5.8S rRNAs which interact with 28S rRNAs containing the hidden break to form a stable complex. PMID:7088713

  7. Molecular Evolution of Mycoplasma capricolum subsp. capripneumoniae Strains, Based on Polymorphisms in the 16S rRNA Genes

    PubMed Central

    Pettersson, Bertil; Bölske, Göran; Thiaucourt, François; Uhlén, Mathias; Johansson, Karl-Erik

    1998-01-01

    Mycoplasma capricolum subsp. capripneumoniae belongs to the so-called Mycoplasma mycoides cluster and is the causal agent of contagious caprine pleuropneumonia (CCPP). All members of the M. mycoides cluster have two rRNA operons. The sequences of the 16S rRNA genes of both rRNA operons from 20 strains of M. capricolum subsp. capripneumoniae of different geographical origins in Africa and Asia were determined. Nucleotide differences which were present in only one of the two operons (polymorphisms) were detected in 24 positions. The polymorphisms were not randomly distributed in the 16S rRNA genes, and some of them were found in regions of low evolutionary variability. Interestingly, 11 polymorphisms were found in all the M. capricolum subsp. capripneumoniae strains, thus defining a putative ancestor. A sequence length difference between the 16S rRNA genes in a poly(A) region and 12 additional polymorphisms were found in only one or some of the strains. A phylogenetic tree was constructed by comparative analysis of the polymorphisms, and this tree revealed two distinct lines of descent. The nucleotide substitution rate of strains within line II was up to 50% higher than within line I. A tree was also constructed from individual operonal 16S rRNA sequences, and the sequences of the two operons were found to form two distinct clades. The topologies of both clades were strikingly similar, which supports the use of 16S rRNA sequence data from homologous operons for phylogenetic studies. The strain-specific polymorphism patterns of the 16S rRNA genes of M. capricolum subsp. capripneumoniae may be used as epidemiological markers for CCPP. PMID:9573185

  8. The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3; end of 16S rRNA

    SciTech Connect

    Tu, Chao; Zhou, Xiaomei; Tarasov, Sergey G.; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua

    2012-03-26

    Era, composed of a GTPase domain and a K homology domain, is essential for bacterial cell viability. It is required for the maturation of 16S rRNA and assembly of the 30S ribosomal subunit. We showed previously that the protein recognizes nine nucleotides (1531{sup AUCACCUCC}1539) near the 3{prime} end of 16S rRNA, and that this recognition stimulates GTP-hydrolyzing activity of Era. In all three kingdoms of life, the 1530{sup GAUCA}1534 sequence and helix 45 (h45) (nucleotides 1506-1529) are highly conserved. It has been shown that the 1530{sup GA}1531 to 1530{sup AG}1531 double mutation severely affects the viability of bacteria. However, whether Era interacts with G1530 and/or h45 and whether such interactions (if any) contribute to the stimulation of Era's GTPase activity were not known. Here, we report two RNA structures that contain nucleotides 1506-1542 (RNA301), one in complex with Era and GDPNP (GNP), a nonhydrolysable GTP-analogue, and the other in complex with Era, GNP, and the KsgA methyltransferase. The structures show that Era recognizes 10 nucleotides, including G1530, and that Era also binds h45. Moreover, GTPase assay experiments show that G1530 does not stimulate Era's GTPase activity. Rather, A1531 and A1534 are most important for stimulation and h45 further contributes to the stimulation. Although G1530 does not contribute to the intrinsic GTPase activity of Era, its interaction with Era is important for binding and is essential for the protein to function, leading to the discovery of a new cold-sensitive phenotype of Era.

  9. rRNA Gene Expression of Abundant and Rare Activated-Sludge Microorganisms and Growth Rate Induced Micropollutant Removal.

    PubMed

    Vuono, David C; Regnery, Julia; Li, Dong; Jones, Zackary L; Holloway, Ryan W; Drewes, Jörg E

    2016-06-21

    The role of abundant and rare taxa in modulating the performance of wastewater-treatment systems is a critical component of making better predictions for enhanced functions such as micropollutant biotransformation. In this study, we compared 16S rRNA genes (rDNA) and rRNA gene expression of taxa in an activated-sludge-treatment plant (sequencing batch membrane bioreactor) at two solids retention times (SRTs): 20 and 5 days. These two SRTs were used to influence the rates of micropollutant biotransformation and nutrient removal. Our results show that rare taxa (<1%) have disproportionally high ratios of rRNA to rDNA, an indication of higher protein synthesis, compared to abundant taxa (≥1%) and suggests that rare taxa likely play an unrecognized role in bioreactor performance. There were also significant differences in community-wide rRNA expression signatures at 20-day SRT: anaerobic-oxic-anoxic periods were the primary driver of rRNA similarity. These results indicate differential expression of rRNA at high SRTs, which may further explain why high SRTs promote higher rates of micropollutant biotransformation. An analysis of micropollutant-associated degradation genes via metagenomics and direct measurements of a suite of micropollutants and nutrients further corroborates the loss of enhanced functions at 5-day SRT operation. This work advances our knowledge of the underlying ecosystem properties and dynamics of abundant and rare organisms associated with enhanced functions in engineered systems. PMID:27196630

  10. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes.

    PubMed

    Soni, Dharmendra Kumar; Dubey, Suresh Kumar

    2014-12-01

    The discrimination between Listeria monocytogenes and Listeria species has been detected. The 16S rRNA and hlyA were PCR amplified with set of oligonucleotide primers with flank 1,500 and 456 bp fragments, respectively. Based on the differences in 16S rRNA and hlyA genes, a total 80 isolates from different environmental, food and clinical samples confirmed it to be L. monocytogenes. The 16S rRNA sequence similarity suggested that the isolates were similar to the previously reported ones from different habitats by others. The phylogenetic interrelationships of the genus Listeria were investigated by sequencing of 16S rRNA and hlyA gene. The 16S rRNA sequence indicated that genus Listeria is comprised of following closely related but distinct lines of descent, one is the L. monocytogenes species group (including L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) and other, the species L. grayi, L. rocourtiae and L. fleischmannii. The phylogenetic tree based on hlyA gene sequence clearly differentiates between the L. monocytogenes, L. ivanovii and L. seeligeri. In the present study, we identified 80 isolates of L. monocytogenes originating from different clinical, food and environmental samples based on 16S rRNA and hlyA gene sequence similarity. PMID:25205124

  11. rRNA distribution during microspore development in anthers of Beta vulgaris L. quantitative in situ hybridization analysis.

    PubMed

    Majewska-Sawka, A; Rodriguez-Garcia, M I

    1996-04-01

    We related changes in the ultrastructural organization of the nucleoli with the results of quantitative in situ hybridizations to characterize rRNA metabolism during the development of microspore mother cells in the sugar beet anther (Beta vulgaris L.). In the course of meiotic prophase and early postmeiotic interphase the morphological characteristics of the nucleoli are typical of low or no transcriptional activity and a low rate of rRNA processing. However, we found evidence of an apparent increase in the relative numbers of 18 S rRNA transcripts in some stages of microsporogenesis. This was found in both the nucleoli and cytoplasm of pachytene meiocytes, and in later stages there was a spectacular accumulation of rRNA transcripts in nucleoli of the tetrad cells. Quantitative data are analyzed in the light of morphometric findings in the cell and their compartments to elucidate the degree to which changes in cell size are related to changes in labeling density and distribution. The results are discussed in terms of rRNA synthesis, transport and degradation as processes involved in the regulation of rRNA within microsporocytes and microspores. PMID:8718677

  12. Control by Phytochrome of Cytoplasmic Precursor rRNA Synthesis in the Cotyledons of Mustard Seedlings 1

    PubMed Central

    Thien, Wilfried; Schopfer, Peter

    1982-01-01

    The influence of phytochrome (high irradiance reaction; operationally, continuous far red light) on the incorporation of [3H]uridine into the cytoplasmic 2.5 megadalton precursor rRNA in the cotyledons of mustard (Sinapis alba L.) seedlings has been investigated. After irradiating 36-hour-old etiolated seedlings with 12 hours of far red light, the rate of incorporation is stimulated about 2-fold, leading to 50% labeling of the precursor rRNA pool about 15 minutes after the tracer has reached the nucleotide precursor pool. In the dark control, there is a significantly smaller pool of precursor rRNA which is half-saturated with label only after about 27 minutes. Since neither the specific radioactivity of the UTP pool nor the processing of the precursor rRNA demonstrate a corresponding light-dependent change, it is concluded that phytochrome mediates an increase of the transcription of the rRNA genes. This gene activation accounts for the increased accumulation of mature cytoplasmic rRNA during the course of photomorphogenesis of the cotyledons. PMID:16662362

  13. Multi-site-specific 16S rRNA Methyltransferase RsmF from Thermus thermophilus

    SciTech Connect

    Demirci, H.; Larsen, L; Hansen, T; Rasmussen, A; Cadambi, A; Gregory, S; Kirpekar, F; Jogl, G

    2010-01-01

    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m{sup 5}C) modifications in 16S rRNA of Thermus thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m{sup 5}C967. In contrast to E. coli RsmF, which introduces a single m{sup 5}C1407 modification, T. thermophilus RsmF modifies three positions, generating m{sup 5}C1400 and m{sup 5}C1404 in addition to m{sup 5}C1407. These three residues are clustered near the decoding site of the ribosome, but are situated in distinct structural contexts, suggesting a requirement for flexibility in the RsmF active site that is absent from the E. coli enzyme. Two of these residues, C1400 and C1404, are sufficiently buried in the mature ribosome structure so as to require extensive unfolding of the rRNA to be accessible to RsmF. In vitro, T. thermophilus RsmF methylates C1400, C1404, and C1407 in a 30S subunit substrate, but only C1400 and C1404 when naked 16S rRNA is the substrate. The multispecificity of T. thermophilus RsmF is potentially explained by three crystal structures of the enzyme in a complex with cofactor S-adenosyl-methionine at up to 1.3 {angstrom} resolution. In addition to confirming the overall structural similarity to E. coli RsmF, these structures also reveal that key segments in the active site are likely to be dynamic in solution, thereby expanding substrate recognition by T. thermophilus RsmF.

  14. Analysis, Optimization and Verification of Illumina-Generated 16S rRNA Gene Amplicon Surveys

    PubMed Central

    Nelson, Michael C.; Morrison, Hilary G.; Benjamino, Jacquelynn; Grim, Sharon L.; Graf, Joerg

    2014-01-01

    The exploration of microbial communities by sequencing 16S rRNA genes has expanded with low-cost, high-throughput sequencing instruments. Illumina-based 16S rRNA gene sequencing has recently gained popularity over 454 pyrosequencing due to its lower costs, higher accuracy and greater throughput. Although recent reports suggest that Illumina and 454 pyrosequencing provide similar beta diversity measures, it remains to be demonstrated that pre-existing 454 pyrosequencing workflows can transfer directly from 454 to Illumina MiSeq sequencing by simply changing the sequencing adapters of the primers. In this study, we modified 454 pyrosequencing primers targeting the V4-V5 hyper-variable regions of the 16S rRNA gene to be compatible with Illumina sequencers. Microbial communities from cows, humans, leeches, mice, sewage, and termites and a mock community were analyzed by 454 and MiSeq sequencing of the V4-V5 region and MiSeq sequencing of the V4 region. Our analysis revealed that reference-based OTU clustering alone introduced biases compared to de novo clustering, preventing certain taxa from being observed in some samples. Based on this we devised and recommend an analysis pipeline that includes read merging, contaminant filtering, and reference-based clustering followed by de novo OTU clustering, which produces diversity measures consistent with de novo OTU clustering analysis. Low levels of dataset contamination with Illumina sequencing were discovered that could affect analyses that require highly sensitive approaches. While moving to Illumina-based sequencing platforms promises to provide deeper insights into the breadth and function of microbial diversity, our results show that care must be taken to ensure that sequencing and processing artifacts do not obscure true microbial diversity. PMID:24722003

  15. Greengenes, a Chimera-checked 16S rRNA gene database and workbenchcompatible with ARB

    SciTech Connect

    DeSantis, Todd Z.; Hugenholtz, Philip; Larsen, Neils; Rojas,Mark; Brodie, Eoin L.; Keller, Keith; Huber, Thomas; Dalevi, Daniel; Hu,Ping; Andersen, Gary L.

    2006-04-10

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that in congruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3 percent of environmental sequences and 0.2 percent of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  16. Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

    NASA Technical Reports Server (NTRS)

    Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1991-01-01

    Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

  17. Detection of Mycobacterium tuberculosis directly from spiked human sputum by Q-beta replicase-amplified assay.

    PubMed Central

    Shah, J S; Liu, J; Buxton, D; Stone, B; Nietupski, R; Olive, D M; King, W; Klinger, J D

    1995-01-01

    We report on a rapid, sensitive, Q-Beta replicase-amplified nucleic acid hybridization assay for the detection of Mycobacterium tuberculosis directly from spiked human sputum. Specimens were processed by either an N-acetyl-L-cysteine-NaOH or a 2% NaOH digestion-decontamination method and then washed to neutralize the pH of the cell pellet. The washed sputum pellets were heated at 100 degrees C to inactivate the M. tuberculosis organisms. The heat-inactivated samples were mechanically lysed at 5,000 rpm for 6 min in the GENE-TRAK Sample Processing Instrument in the presence of zirconium oxide beads and a buffer containing guanidine thiocyanate. The released nucleic acid was subjected to the GENE-TRAK Q-Beta replicase-amplified, dual-capture assay. The assay sensitivity was 10(3) purified rRNA targets or 1 CFU of M. tuberculosis spiked into M. tuberculosis-negative human sputum. There was a low level of noise because of the limitations of performing a signal amplification assay in an open system. High levels of other mycobacterial rRNA (approximately 10(7) organisms), including rRNAs of Mycobacterium avium and Mycobacterium gordonae, did not interfere with the sensitivity of the assay. PMID:7536213

  18. Development and Evaluation of Three Real-Time PCR Assays for Genotyping and Source Tracking Cryptosporidium spp. in Water

    PubMed Central

    Li, Na; Neumann, Norman F.; Ruecker, Norma; Alderisio, Kerri A.; Sturbaum, Gregory D.; Villegas, Eric N.; Chalmers, Rachel; Monis, Paul; Feng, Yaoyu

    2015-01-01

    The occurrence of Cryptosporidium oocysts in drinking source water can present a serious public health risk. To rapidly and effectively assess the source and human-infective potential of Cryptosporidium oocysts in water, sensitive detection and correct identification of oocysts to the species level (genotyping) are essential. In this study, we developed three real-time PCR genotyping assays, two targeting the small-subunit (SSU) rRNA gene (18S-LC1 and 18S-LC2 assays) and one targeting the 90-kDa heat shock protein (hsp90) gene (hsp90 assay), and evaluated the sensitivity and Cryptosporidium species detection range of these assays. Using fluorescence resonance energy transfer probes and melt curve analysis, the 18S-LC1 and hsp90 assays could differentiate common human-pathogenic species (C. parvum, C. hominis, and C. meleagridis), while the 18S-LC2 assay was able to differentiate nonpathogenic species (such as C. andersoni) from human-pathogenic ones commonly found in source water. In sensitivity evaluations, the 18S-LC2 and hsp90 genotyping assays could detect as few as 1 Cryptosporidium oocyst per sample. Thus, the 18S-LC2 and hsp90 genotyping assays might be used in environmental monitoring, whereas the 18S-LC1 genotyping assay could be useful for genotyping Cryptosporidium spp. in clinical specimens or wastewater samples. PMID:26092455

  19. Development and Evaluation of Three Real-Time PCR Assays for Genotyping and Source Tracking Cryptosporidium spp. in Water.

    PubMed

    Li, Na; Neumann, Norman F; Ruecker, Norma; Alderisio, Kerri A; Sturbaum, Gregory D; Villegas, Eric N; Chalmers, Rachel; Monis, Paul; Feng, Yaoyu; Xiao, Lihua

    2015-09-01

    The occurrence of Cryptosporidium oocysts in drinking source water can present a serious public health risk. To rapidly and effectively assess the source and human-infective potential of Cryptosporidium oocysts in water, sensitive detection and correct identification of oocysts to the species level (genotyping) are essential. In this study, we developed three real-time PCR genotyping assays, two targeting the small-subunit (SSU) rRNA gene (18S-LC1 and 18S-LC2 assays) and one targeting the 90-kDa heat shock protein (hsp90) gene (hsp90 assay), and evaluated the sensitivity and Cryptosporidium species detection range of these assays. Using fluorescence resonance energy transfer probes and melt curve analysis, the 18S-LC1 and hsp90 assays could differentiate common human-pathogenic species (C. parvum, C. hominis, and C. meleagridis), while the 18S-LC2 assay was able to differentiate nonpathogenic species (such as C. andersoni) from human-pathogenic ones commonly found in source water. In sensitivity evaluations, the 18S-LC2 and hsp90 genotyping assays could detect as few as 1 Cryptosporidium oocyst per sample. Thus, the 18S-LC2 and hsp90 genotyping assays might be used in environmental monitoring, whereas the 18S-LC1 genotyping assay could be useful for genotyping Cryptosporidium spp. in clinical specimens or wastewater samples. PMID:26092455

  20. Development of a loop-mediated isothermal amplification assay for rapid detection of Trichosporon asahii in experimental and clinical samples.

    PubMed

    Zhou, Jianfeng; Liao, Yong; Li, Haitao; Lu, Xuelian; Han, Xiufeng; Tian, Yanli; Chen, Shanshan; Yang, Rongya

    2015-01-01

    Invasive trichosporonosis is a deep mycosis found mainly in immunocompromised hosts, and the major pathogen is Trichosporon asahii. We detected the species-specific intergenic spacers (IGS) of rRNA gene of T. asahii using a loop-mediated isothermal amplification (LAMP) assay in 15 isolates with 3 different visualization methods, including SYBR green detection, gel electrophoresis, and turbidimetric methods. The LAMP assay displayed superior rapidity to other traditional methods in the detection time; that is, only 1 h was needed for detection and identification of the pathogen DNA. Furthermore, the detection limit of the LAMP assay was more sensitive than the PCR assay. We also successfully detect the presence of T. asahii in samples from experimentally infected mice and samples from patients with invasive trichosporonosis caused by T. asahii, suggesting that this method may become useful in clinical applications in the near future. PMID:25692144

  1. Development of a Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Trichosporon asahii in Experimental and Clinical Samples

    PubMed Central

    Zhou, Jianfeng; Liao, Yong; Li, Haitao; Lu, Xuelian; Han, Xiufeng; Tian, Yanli; Chen, Shanshan; Yang, Rongya

    2015-01-01

    Invasive trichosporonosis is a deep mycosis found mainly in immunocompromised hosts, and the major pathogen is Trichosporon asahii. We detected the species-specific intergenic spacers (IGS) of rRNA gene of T. asahii using a loop-mediated isothermal amplification (LAMP) assay in 15 isolates with 3 different visualization methods, including SYBR green detection, gel electrophoresis, and turbidimetric methods. The LAMP assay displayed superior rapidity to other traditional methods in the detection time; that is, only 1 h was needed for detection and identification of the pathogen DNA. Furthermore, the detection limit of the LAMP assay was more sensitive than the PCR assay. We also successfully detect the presence of T. asahii in samples from experimentally infected mice and samples from patients with invasive trichosporonosis caused by T. asahii, suggesting that this method may become useful in clinical applications in the near future. PMID:25692144

  2. From Antenna to Assay

    PubMed Central

    Moore, Evan G.; Samuel, Amanda P. S.; Raymond, Kenneth N.

    2009-01-01

    Conspectus Ligand-sensitized, luminescent lanthanide(III) complexes are of considerable importance because their unique photophysical properties (microsecond to millisecond lifetimes, characteristic and narrow emission bands, and large Stokes shifts) make them well suited as labels in fluorescence-based bioassays. The long-lived emission of lanthanide(III) cations can be temporally resolved from scattered light and background fluorescence to vastly enhance measurement sensitivity. One challenge in this field is the design of sensitizing ligands that provide highly emissive complexes with sufficient stability and aqueous solubility for practical applications. In this Account, we give an overview of some of the general properties of the trivalent lanthanides and follow with a summary of advances made in our laboratory in the development of highly luminescent Tb(III) and Eu(III) complexes for applications in biotechnology. A focus of our research has been the optimization of these compounds as potential commercial agents for use in Homogeneous Time-Resolved Fluorescence (HTRF) technology. Our approach involves developing high-stability octadentate Tb(III) and Eu(III) complexes that rely on all-oxygen donor atoms and using multi-chromophore chelates to increase molar absorptivity; earlier examples utilized a single pendant chromophore (that is, a single “antenna”). Ligands based on 2-hydroxyisophthalamide (IAM) provide exceptionally emissive Tb(III) complexes with quantum yield values up to ∼60% that are stable at the nanomolar concentrations required for commercial assays. Through synthetic modification of the IAM chromophore and time-dependent density functional theory (TD-DFT) calculations, we have developed a method to predict absorption and emission properties of these chromophores as a tool to guide ligand design. Additionally, we have investigated chiral IAM ligands that yield Tb(III) complexes possessing both high quantum yield values and strong

  3. Mutation analysis of 16S rRNA in patients with Rett syndrome.

    PubMed

    Armstrong, J; Pineda, M; Monrós, E

    2000-07-01

    Rett syndrome (RTT) is a progressive neurodevelopmental disorder that affects one in 10,000-15,000 females. RTT is mainly sporadic; familial cases have an estimated frequency of less than 1%. Before the recent identification of de novo dominant mutations in the X-linked MECP2 gene, many other hypotheses had been proposed to explain the particular pattern of inheritance and the phenotypic expression of the disease. The involvement of mitochondrial DNA had been investigated because of the structural and functional mitochondrial abnormalities evident in the patients. In 1997 the finding of mutations at 16S rRNA in several affected RTT females and their mothers was reported, suggesting that mitochondrial DNA might play a key role in the pathogenesis of RTT. To investigate the relevance of such mutations, we used the same methodologic approach to analyze RTT mitochondrial DNA in our series. No 16S rRNA alterations were evident in 27 Spanish patients with classic RTT. PMID:10963979

  4. Greengenes: 16S rRNA Database and Workbench Compatible with ARB

    DOE Data Explorer

    DeSantis, T. Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie, E. L.; Keller, K.; Huber, T.; Dalevi, D. Hu, P. Andersen, G. L.

    Greengenes was developed, as the abstract of an AEM reprint states, to "addresse limitations of public repositories by providing chimera screening, standard alignment, and taxonomic classification using multiple published taxonomies. It was found that there is incongruent taxonomic nomenclature among curators even at the phylum level. Putative chimeras were identified in 3% of environmental sequences and in 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages in the Archaea and Bacteria....Greengenes is also a functional workbench to assist in analysis of user-generated 16S rRNA gene sequences. Batches of sequencing reads can be uploaded for quality-based trimming and creation of multiple-sequence alignments (9). Three types of non-MSA similarity searches are also available, seed extension by BLAST (1), similarity based on shared 7-mers by a tool called Simrank, and a direct degenerative pattern match for probe/primer evaluation. Results are displayed using user-preferred taxonomic nomenclature and can be saved between sessions. [Taken from DeSantis, T. Z., P. Hugenholtz, N. Larsen, M. Rojas, E. L. Brodie, K. Keller, T. Huber, D. Dalevi, P. Hu, and G. L. Andersen. 2006. Greengenes, a Chimera-Checked 16S rRNA Gene Database and Workbench Compatible with ARB. Appl Environ Microbiol 72:5069-72, pages 1 and 3] (Specialized Interface)

  5. The Unique 16S rRNA Genes of Piezophiles Reflect both Phylogeny and Adaptation▿ †

    PubMed Central

    Lauro, Federico M.; Chastain, Roger A.; Blankenship, Lesley E.; Yayanos, A. Aristides; Bartlett, Douglas H.

    2007-01-01

    In the ocean's most extreme depths, pressures of 70 to 110 megapascals prevent the growth of all but the most hyperpiezophilic (pressure-loving) organisms. The physiological adaptations required for growth under these conditions are considered to be substantial. Efforts to determine specific adaptations permitting growth at extreme pressures have thus far focused on relatively few γ-proteobacteria, in part due to the technical difficulties of obtaining piezophilic bacteria in pure culture. Here, we present the molecular phylogenies of several new piezophiles of widely differing geographic origins. Included are results from an analysis of the first deep-trench bacterial isolates recovered from the southern hemisphere (9.9-km depth) and of the first gram-positive piezophilic strains. These new data allowed both phylogenetic and structural 16S rRNA comparisons among deep-ocean trench piezophiles and closely related strains not adapted to high pressure. Our results suggest that (i) the Circumpolar Deep Water acts as repository for hyperpiezophiles and drives their dissemination to deep trenches in the Pacific Ocean and (ii) the occurrence of elongated helices in the 16S rRNA genes increases with the extent of adaptation to growth at elevated pressure. These helix changes are believed to improve ribosome function under deep-sea conditions. PMID:17158629

  6. PhylOPDb: a 16S rRNA oligonucleotide probe database for prokaryotic identification

    PubMed Central

    Jaziri, Faouzi; Parisot, Nicolas; Abid, Anis; Denonfoux, Jérémie; Ribière, Céline; Gasc, Cyrielle; Boucher, Delphine; Brugère, Jean-François; Mahul, Antoine; Hill, David R.C.; Peyretaillade, Eric; Peyret, Pierre

    2014-01-01

    In recent years, high-throughput molecular tools have led to an exponential growth of available 16S rRNA gene sequences. Incorporating such data, molecular tools based on target-probe hybridization were developed to monitor microbial communities within complex environments. Unfortunately, only a few 16S rRNA gene-targeted probe collections were described. Here, we present PhylOPDb, an online resource for a comprehensive phylogenetic oligonucleotide probe database. PhylOPDb provides a convivial and easy-to-use web interface to browse both regular and explorative 16S rRNA-targeted probes. Such probes set or subset could be used to globally monitor known and unknown prokaryotic communities through various techniques including DNA microarrays, polymerase chain reaction (PCR), fluorescent in situ hybridization (FISH), targeted gene capture or in silico rapid sequence identification. PhylOPDb contains 74 003 25-mer probes targeting 2178 genera including Bacteria and Archaea. Database URL: http://g2im.u-clermont1.fr/phylopdb/ PMID:24771669

  7. Functional Specialization of Domains Tandemly Duplicated Witin 16S rRNA Methyltransferase RsmC

    SciTech Connect

    Sunita,S.; Purta, E.; Durawa, M.; Tkaczuk, K.; Swaathi, J.; Bujnicki, J.; Sivaraman, J.

    2007-01-01

    RNA methyltransferases (MTases) are important players in the biogenesis and regulation of the ribosome, the cellular machine for protein synthesis. RsmC is a MTase that catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (SAM) to G1207 of 16S rRNA. Mutations of G1207 have dominant lethal phenotypes in Escherichia coli, underscoring the significance of this modified nucleotide for ribosome function. Here we report the crystal structure of E. coli RsmC refined to 2.1 Angstroms resolution, which reveals two homologous domains tandemly duplicated within a single polypeptide. We characterized the function of the individual domains and identified key residues involved in binding of rRNA and SAM, and in catalysis. We also discovered that one of the domains is important for the folding of the other. Domain duplication and subfunctionalization by complementary degeneration of redundant functions (in particular substrate binding versus catalysis) has been reported for many enzymes, including those involved in RNA metabolism. Thus, RsmC can be regarded as a model system for functional streamlining of domains accompanied by the development of dependencies concerning folding and stability.

  8. rRNA genes from the lower chordate Herdmania momus: structural similarity with higher eukaryotes.

    PubMed Central

    Degnan, B M; Yan, J; Hawkins, C J; Lavin, M F

    1990-01-01

    Ascidians, primitive chordates that have retained features of the likely progenitors to all vertebrates, are a useful model to study the evolutionary relationship of chordates to other animals. We have selected the well characterized ribosomal RNA (rRNA) genes to investigate this relationship, and we describe here the cloning and characterization of an entire ribosomal DNA (rDNA) tandem repeat unit from a lower chordate, the ascidian Herdmania momus. rDNA copy number and considerable sequence differences were observed between two H. momus populations. Comparison of rDNA primary sequence and rRNA secondary structures from H. momus with those from other well characterized organisms, demonstrated that the ascidians are more closely related to other chordates than invertebrates. The rDNA tandem repeat makes up a larger percentage (7%) of the genome of this animal than in other higher eukaryotes. The total length of the spacer and transcribed region in H. momus rDNA is small compared to most higher eukaryotes, being less than 8 kb, and the intergenic spacer region consists of smaller internal repeats. Comparative analysis of rDNA sequences has allowed the construction of secondary structures for the 18S, 5.8S and 26S rRNAs. Images PMID:2263465

  9. Tracking the interactions of rRNA processing proteins during nucleolar assembly in living cells.

    PubMed

    Angelier, Nicole; Tramier, Marc; Louvet, Emilie; Coppey-Moisan, Maïté; Savino, Tula M; De Mey, Jan R; Hernandez-Verdun, Danièle

    2005-06-01

    Reorganization of the nuclear machinery after mitosis is a fundamental but poorly understood process. Here, we investigate the recruitment of the nucleolar processing proteins in the nucleolus of living cells at the time of nucleus formation. We question the role of the prenucleolar bodies (PNBs), during migration of the processing proteins from the chromosome periphery to sites of rDNA transcription. Surprisingly, early and late processing proteins pass through the same PNBs as demonstrated by rapid two-color four-dimensional imaging and quantification, whereas a different order of processing protein recruitment into nucleoli is supported by differential sorting. Protein interactions along the recruitment pathway were investigated using a promising time-lapse analysis of fluorescence resonance energy transfer. For the first time, it was possible to detect in living cells the interactions between proteins of the same rRNA processing machinery in nucleoli. Interestingly interactions between such proteins also occur in PNBs but not at the chromosome periphery. The dynamics of these interactions suggests that PNBs are preassembly platforms for rRNA processing complexes. PMID:15814843

  10. The cytoplasmic mRNA degradation factor Pat1 is required for rRNA processing.

    PubMed

    Muppavarapu, Mridula; Huch, Susanne; Nissan, Tracy

    2016-04-01

    Pat1 is a key cytoplasmic mRNA degradation factor, the loss of which severely increases mRNA half-lives. Several recent studies have shown that Pat1 can enter the nucleus and can shuttle between the nucleus and the cytoplasm. As a result, many nuclear roles have been proposed for Pat1. In this study, we analyzed four previously suggested nuclear roles of Pat1 and show that Pat1 is not required for efficient pre-mRNA splicing or pre-mRNA decay in yeast. However, lack of Pat1 results in accumulation of pre-rRNA processing intermediates. Intriguingly, we identified a novel genetic relationship between Pat1 and the rRNA decay machinery, specifically the exosome and the TRAMP complex. While the pre-rRNA processing intermediates that accumulate in the pat1 deletion mutant are, at least to some extent, recognized as aberrant by the rRNA degradation machinery, it is unlikely that these accumulations are the cause of their synthetic sick relationship. Here, we show that the dysregulation of the levels of mRNAs related to ribosome biogenesis could be the cause of the accumulation of the pre-rRNA processing intermediates. Although our results support a role for Pat1 in transcription, they nevertheless suggest that the primary cause of the dysregulated mRNA levels is most likely due to Pat1's role in mRNA decapping and mRNA degradation. PMID:26918764

  11. Transporter assays and assay ontologies: useful tools for drug discovery.

    PubMed

    Zdrazil, Barbara; Chichester, Christine; Zander Balderud, Linda; Engkvist, Ola; Gaulton, Anna; Overington, John P

    2014-06-01

    Transport proteins represent an eminent class of drug targets and ADMET (absorption, distribution, metabolism, excretion, toxicity) associated genes. There exists a large number of distinct activity assays for transport proteins, depending on not only the measurement needed (e.g. transport activity, strength of ligand–protein interaction), but also due to heterogeneous assay setups used by different research groups. Efforts to systematically organize this (divergent) bioassay data have large potential impact in Public-Private partnership and conventional commercial drug discovery. In this short review, we highlight some of the frequently used high-throughput assays for transport proteins, and we discuss emerging assay ontologies and their application to this field. Focusing on human P-glycoprotein (Multidrug resistance protein 1; gene name: ABCB1, MDR1), we exemplify how annotation of bioassay data per target class could improve and add to existing ontologies, and we propose to include an additional layer of metadata supporting data fusion across different bioassays. PMID:25027375

  12. The assay of diphtheria toxin

    PubMed Central

    Gerwing, Julia; Long, D. A.; Mussett, Marjorie V.

    1957-01-01

    A precise assay of diphtheria toxin is described, based on the linear relationship between the diameter of the skin reaction to, and logarithm of the dose of, toxin. It eliminates the need for preliminary titrations, is economical, provides information about the slope of the log-dose response lines and, therefore, of the validity of the assay, and yields limits of error of potency from the internal evidence of the assay. A study has been made of the effects of avidity, combining power, toxicity and buffering on the assay of diphtheria toxins against the International Standards for both Diphtheria Antitoxin and Schick-Test Toxin. All the toxins assayed against the standard toxin, whatever their other properties might be, gave log-dose response lines of similar slope provided that they were diluted in buffered physiological saline. The assays were therefore valid. These experiments were repeated concurrently in non-immune and in actively immunized guinea-pigs, and comparable figures for potency obtained in both groups. The result was not significantly affected by the avidity or combining power of the toxin. However, non-avid toxins gave low values in Schick units when assayed, by the Römer & Sames technique, in terms of the International Standard for Diphtheria Antitoxin. The problem of the ultimate standard and the implications of these findings are discussed. PMID:13511133

  13. Transwell(®) invasion assays.

    PubMed

    Marshall, John

    2011-01-01

    The need to identify inhibitors of cancer invasion has driven the development of quantitative in vitro invasion assays. The most common assays used are based on the original Boyden assay system. Today commercially available plastic inserts for multi-well plates, which possess a cell-permeable membrane, as typified by Transwell(®) Permeable Supports, permit accurate repeatable invasion assays. When placed in the well of a multi-well tissue culture plate these inserts create a two-chamber system separated by the cell-permeable membrane. To create an invasion assay the pores in the membrane are blocked with a gel composed of extracellular matrix that is meant to mimic the typical matrices that tumour cells encounter during the invasion process in vivo. By placing the cells on one side of the gel and a chemoattractant on the other side of the gel, invasion is determined by counting those cells that have traversed the cell-permeable membrane having invaded towards the higher concentration of chemoattractant. In this chapter, in addition to protocols for performing Transwell invasion assays, there is consideration of the limitations of current assay designs with regard to available matrices and the absence of tumour microenvironment cells. PMID:21748672

  14. Modified Method of rRNA Structure Analysis Reveals Novel Characteristics of Box C/D RNA Analogues.

    PubMed

    Filippova, J A; Stepanov, G A; Semenov, D V; Koval, O A; Kuligina, E V; Rabinov, I V; Richter, V A

    2015-01-01

    Ribosomal RNA (rRNA) maturation is a complex process that involves chemical modifications of the bases or sugar residues of specific nucleotides. One of the most abundant types of rRNA modifications, ribose 2'-O-methylation, is guided by ribonucleoprotein complexes containing small nucleolar box C/D RNAs. Since the majority of 2'-O-methylated nucleotides are located in the most conserved regions of rRNA that comprise functionally important centers of the ribosome, an alteration in a 2'-O-methylation profile can affect ribosome assembly and function. One of the key approaches for localization of 2'-O-methylated nucleotides in long RNAs is a method based on the termination of reverse transcription. The current study presents an adaptation of this method for the use of fluorescently labeled primers and analysis of termination products by capillary gel electrophoresis on an automated genetic analyzer. The developed approach allowed us to analyze the influence of the synthetic analogues of box C/D RNAs on post-transcriptional modifications of human 28S rRNA in MCF-7 cells. It has been established that the transfection of MCF-7 cells with a box C/D RNA analogue leads to an enhanced modification level of certain native sites of 2'-O-methylation in the target rRNA. The observed effect of synthetic RNAs on the 2'-O-methylation of rRNA in human cells demonstrates a path towards targeted regulation of rRNA post-transcriptional maturation. The described approach can be applied in the development of novel diagnostic methods for detecting diseases in humans. PMID:26085946

  15. Case of localized recombination in 23S rRNA genes from divergent bradyrhizobium lineages associated with neotropical legumes.

    PubMed

    Parker, M A

    2001-05-01

    Enzyme electrophoresis and rRNA sequencing were used to analyze relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legumes (Clitoria javitensis, Erythrina costaricensis, Rhynchosia pyramidalis, and Desmodium axillare) growing on Barro Colorado Island (BCI), Panama. Bacteria with identical multilocus allele profiles were commonly found in association with two or more legume genera. Among the 16 multilocus genotypes (electrophoretic types [ETs]) detected, six ETs formed a closely related cluster that included isolates from all four legume taxa. Bacteria from two other BCI legumes (Platypodium and Machaerium) sampled in a previous study were also identical to certain ETs in this group. Isolates from different legume genera that had the same ET had identical nucleotide sequences for both a 5' portion of the 23S rRNA and the nearly full-length 16S rRNA genes. These results suggest that Bradyrhizobium genotypes with low host specificity may be prevalent in this tropical forest. Parsimony analysis of 16S rRNA sequence variation indicated that most isolates were related to Bradyrhizobium japonicum USDA 110, although one ET sampled from C. javitensis had a 16S rRNA gene highly similar to that of Bradyrhizobium elkanii USDA 76. However, this isolate displayed a mosaic structure within the 5' 23S rRNA region: one 84-bp segment was identical to that of BCI isolate Pe1-3 (a close relative of B. japonicum USDA 110, based on 16S rRNA data), while an adjacent 288-bp segment matched that of B. elkanii USDA 76. This mosaic structure is one of the first observations suggesting recombination in nature between Bradyrhizobium isolates related to B. japonicum versus B. elkanii. PMID:11319084

  16. The phylogeny of intestinal porcine spirochetes (Serpulina species) based on sequence analysis of the 16S rRNA gene.

    PubMed Central

    Pettersson, B; Fellström, C; Andersson, A; Uhlén, M; Gunnarsson, A; Johansson, K E

    1996-01-01

    Four type or reference strains and twenty-two field strains of intestinal spirochetes isolated from Swedish pig herds were subjected to phylogenetic analysis based on 16S rRNA sequences. Almost complete (>95%) 16S rRNA sequences were obtained by solid-phase DNA sequencing of in vitro-amplified rRNA genes. The genotypic patterns were compared with a previously proposed biochemical classification scheme, comprising beta-hemolysis, indole production, hippurate hydrolysis, and alpha-galactosidase, alpha-glucosidase, and beta-glucosidase activities. Comparison of the small-subunit rRNA sequences showed that the strains of the genus Serpulina were closely related. Phylogenetic trees were constructed, and three clusters were observed. This was also confirmed by signature nucleotide analysis of the serpulinas. The indole-producing strains, including the strains of S. hyodysenteriae and some weakly beta-hemolytic Serpulina strains, formed one cluster. A second cluster comprised weakly beta-hemolytic strains that showed beta-galactosidase activity but lacked indole production and hippurate-hydrolyzing capacity. The second cluster contained two subclusters with similar phenotypic profiles. A third cluster involved strains that possessed a hippurate-hydrolyzing capacity which was distinct from that of the former two clusters, because of 17 unique nucleotide positions of the 16S rRNA gene. Interestingly, the strains of this third cluster were found likely to have a 16S rRNA structure in the V2 region of the molecule different from that of the serpulinas belonging to the other clusters. As a consequence of these findings, we propose that the intestinal spirochetes of this phenotype (i.e., P43/6/78-like strains) should be regarded as a separate Serpulina species. Furthermore, this cluster was found to be by far the most homogeneous one. In conclusion, the biochemical classification of porcine intestinal spirochetes was comparable to that by phylogenetic analysis based on 16S rRNA

  17. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  18. The 9S RNA precursor of Escherichia coli 5S RNA has three structural domains: implications for processing.

    PubMed Central

    Christiansen, J

    1988-01-01

    The secondary structure of the 9S RNA precursor to ribosomal 5S RNA in Escherichia coli has been determined using chemical reagents and ribonucleases in combination with a reverse transcription procedure. The 9S RNA precursor was generated in vitro by T7 RNA polymerase, and the rrnB operon terminator, T1, was able to terminate the in vitro transcript. The secondary structure model exhibits three structural domains corresponding to a 5' region, a mature region and a terminator region. The mature domain is structurally identical to 5S RNA, and the ribosomal proteins L18 and L25 are able to bind to the precursor. The processing endoribonuclease RNase E cleaves between the structural domains. Moreover, an intramolecular refolding of the nascent transcript must take place if the current view of RNase III processing stems is correct. Images PMID:3045757

  19. Photocarrier dynamics in transition metal dichalcogenide alloy Mo0.5W0.5S2.

    PubMed

    He, Jiaqi; He, Dawei; Wang, Yongsheng; Zhao, Hui

    2015-12-28

    We report a transient absorption study of photocarrier dynamics in transition metal dichalcogenide alloy, Mo0.5W0.5S2. Photocarriers were injected by a 400-nm pump pulse and detected by a 660-nm probe pulse. We observed a fast energy relaxation process of about 0.7 ps. The photocarrier lifetime is in the range of 50 - 100 ps, which weakly depends on the injected photocarrier density and is a few times shorter than MoS2 and WS2, reflecting the relatively lower crystalline quality of the alloy. Saturable absorption was also observed in Mo0.5W0.5S2, with a saturation energy fluence of 32 μJ cm(-2). These results provide important parameters on photocarrier properties of transition metal dichalcogenide alloys. PMID:26832001

  20. Analysis of the Precursor rRNA Fractions of Rapidly Growing Mycobacteria: Quantification by Methods That Include the Use of a Promoter (rrnA P1) as a Novel Standard†

    PubMed Central

    Menéndez, María del Carmen; Rebollo, María José; Núñez, María del Carmen; Cox, Robert A.; García, María Jesús

    2005-01-01

    Mycobacterial species are able to control rRNA production through variations in the number and strength of promoters controlling their rrn operons. Mycobacterium chelonae and M. fortuitum are members of the rapidly growing mycobacterial group. They carry a total of five promoters each, encoded, respectively, by one and two rrn operons per genome. Quantification of precursor rrn transcriptional products (pre-rrn) has allowed detection of different promoter usage during cell growth. Bacteria growing in several culture media with different nutrient contents were compared. Balanced to stationary phases were analyzed. Most promoters were found to be used at different levels depending on the stage of bacterial growth and the nutrient content of the culture medium. Some biological implications are discussed. Sequences of the several promoters showed motifs that could be correlated to their particular level of usage. A product corresponding to the first rrnA promoter in both species, namely, rrnA P1, was found to contribute at a low and near-constant level to pre-rRNA synthesis, regardless of the culture medium used and the stage of growth analyzed. This product was used as a standard to quantitate rRNA gene expression by real-time PCR when M. fortuitum infected macrophages. It was shown that this bacterium actively synthesizes rRNA during the course of infection and that one of its rrn operons is preferentially used under such conditions. PMID:15629925

  1. Theoretical study on the adsorption of carbon dioxide on individual and alkali-metal doped MOF-5s

    NASA Astrophysics Data System (ADS)

    Ha, Nguyen Thi Thu; Lefedova, O. V.; Ha, Nguyen Ngoc

    2016-01-01

    Density functional theory (DFT) calculations were performed to investigate the adsorption of carbon dioxide (CO2) on metal-organic framework (MOF-5) and alkali-metal (Li, K, Na) doped MOF-5s. The adsorption energy calculation showed that metal atom adsorption is exothermic in MOF-5 system. Moreover, alkali-metal doping can significantly improve the adsorption ability of carbon dioxide on MOF-5. The best influence is observed for Li-doping.

  2. Foraminoplastic transfacet epidural endoscopic approach for removal of intraforaminal disc herniation at the L5-S1 level

    PubMed Central

    Kaczmarczyk, Jacek; Nowakowski, Andrzej; Sulewski, Adam

    2014-01-01

    Transforaminal endoscopic disc removal in the L5-S1 motion segment of the lumbar spine creates a technical challenge due to anatomical reasons and individual variability. The majority of surgeons prefer a posterior classical or minimally invasive approach. There is only one foraminoplastic modification of the technique in the literature so far. In this paper we present a new technique with a foraminoplastic transfacet approach that may be suitable in older patients with advanced degenerative disease of the spine. PMID:24729817

  3. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  4. A Tale of Two Lines: Searching for the 5s - 5p Resonance Lines in Pm-like Ion Spectra

    SciTech Connect

    Trabert, E; Vilkas, M J; Ishikawa, Y

    2008-10-24

    Highly charged ions in the promethium sequence have been suggested to show spectral features resembling the alkali sequence ions. Guided by calculations, the 5s-5p resonance lines have been sought in a variety of experiments. In the light of the most extensive calculations of Pm-like ions yet, applying relativistic multi-reference Moeller-Plesset second-order perturbation theory, the experimental evidence is reviewed and the line identification problem assessed.

  5. Describing a new syndrome in L5-S1 disc herniation: Sexual and sphincter dysfunction without pain and muscle weakness

    PubMed Central

    Akca, Nezih; Ozdemir, Bulent; Kanat, Ayhan; Batcik, Osman Ersagun; Yazar, Ugur; Zorba, Orhan Unal

    2014-01-01

    Context: Little seems to be known about the sexual dysfunction (SD) in lumbar intervertebral disc herniation. Aims: Investigation of sexual and sphincter dysfunction in patient with lumbar disc hernitions. Settings and Design: A retrospective analysis. Materials and Methods: Sexual and sphincter dysfunction in patients admitted with lumbar disc herniations between September 2012-March 2014. Statistical Analysis Used: Statistical analysis was performed using the Predictive Analytics SoftWare (PASW) Statistics 18.0 for Windows (Statistical Package for the Social Sciences, SPSS Inc., Chicago, Illinois). The statistical significance was set at P < 0.05. The Wilcoxon signed ranks test was used to evaluate the difference between patients. Results: Four patients with sexual and sphincter dysfunction were found, including two women and two men, aged between 20 and 52 years. All of them admitted without low back pain. In addition, on neurological examination, reflex and motor deficit were not found. However, almost all patients had perianal sensory deficit and sexual and sphincter dysfunction. Magnetic resonance imaging (MRI) of three patients displayed a large extruded disc fragment at L5-S1 level on the left side. In fourth patient, there were not prominent disc herniations. There was not statistically significant difference between pre-operative and post-operative sexual function, anal-urethral sphincter function, and perianal sensation score. A syndrome in L5-S1 disc herniation with sexual and sphincter dysfunction without pain and muscle weakness was noted. We think that it is crucial for neurosurgeons to early realise that paralysis of the sphincter and sexual dysfunction are possible in patients with lumbar L5-S1 disc disease. Conclusion: A syndrome with perianal sensory deficit, paralysis of the sphincter, and sexual dysfunction may occur in patients with lumbar L5-S1 disc disease. The improvement of perianal sensory deficit after surgery was counteracted by a trend

  6. A 5' Nuclease Genotyping Assay for Identification of Macrolide-Resistant Mycoplasma genitalium in Clinical Specimens.

    PubMed

    Kristiansen, Gitte Qvist; Lisby, Jan Gorm; Schønning, Kristian

    2016-06-01

    Rapid and sensitive detection of macrolide resistance in Mycoplasma genitalium is required for the guidance of adequate antimicrobial treatment. Previous studies have confirmed that single-base mutations at position 2058 or 2059 in domain V of the 23S rRNA gene of M. genitalium result in high-level macrolide resistance. Sequencing of PCR products remains the gold standard for the identification of mutations conferring resistance to macrolides but is laborious and time-consuming. The aim of the present study was to develop a 5' nuclease genotyping assay to detect single nucleotide polymorphisms in the 23S rRNA gene of Mycoplasma genitalium that are associated with macrolide resistance by combining PCR with hydrolysis probes and subsequent endpoint genotyping analysis. The 5' nuclease genotyping assay was used as a referral test to be used on M. genitalium-positive samples and was validated on 259 positive samples, of which 253 (97.7%) were successfully sequenced. With the newly developed assay, 237/259 (91.5%) investigated M. genitalium-positive samples were genotyped. The positive and the negative predictive values were 100% when evaluated on successfully genotyped samples. The newly developed assay discriminated macrolide-resistant M. genitalium in clinical specimens possessing A2058G, A2058C, A2058T, and A2059G mutations with a sensitivity of 94.4% (95% confidence interval [CI], 90.7% to 98.2%) and a specificity of 92.7% (95% CI, 87.8% to 97.6%) when evaluated on successfully sequenced samples. The assay can correctly guide antimicrobial treatment of M. genitalium infections. PMID:27053672

  7. Rapid Polymerase Chain Reaction-based Screening Assay for Bacterial Biothreat Agents

    PubMed Central

    Yang, Samuel; Rothman, Richard E.; Hardick, Justin; Kuroki, Marcos; Hardick, Andrew; Doshi, Vishal; Ramachandran, Padmini; Gaydos, Charlotte A.

    2013-01-01

    Objectives To design and evaluate a rapid polymerase chain reaction (PCR)-based assay for detecting Eubacteria and performing early screening for selected Class A biothreat bacterial pathogens. Methods The authors designed a two-step PCR-based algorithm consisting of an initial broad-based universal detection step, followed by specific pathogen identification targeted for identification of the Class A bacterial biothreat agents. A region in the bacterial 16S rRNA gene containing a highly variable sequence flanked by clusters of conserved sequences was chosen as the target for the PCR assay design. A previously described highly conserved region located within the 16S rRNA amplicon was selected as the universal probe (UniProbe, Integrated DNA Technology, Coralville, IA). Pathogen-specific TaqMan probes were designed for Bacillus anthracis, Yersinia pestis, and Francisella tularensis. Performance of the assay was assessed using genomic DNA extracted from the aforementioned biothreat-related organisms (inactivated or surrogate) and other common bacteria. Results The UniProbe detected the presence of all tested Eubacteria (31 / 31) with high analytical sensitivity. The biothreat-specific probes accurately identified organisms down to the closely related species and genus level, but were unable to discriminate between very close surrogates, such as Yersinia philomiragia and Bacillus cereus. Conclusions A simple, two-step PCR-based assay proved capable of both universal bacterial detection and identification of select Class A bacterial biothreat and biothreat-related pathogens. Although this assay requires confirmatory testing for definitive species identification, the method has great potential for use in ED-based settings for rapid diagnosis in cases of suspected Category A bacterial biothreat agents. PMID:18370996

  8. Minimally Invasive Transforaminal Lumbar Interbody Fusion at L5-S1 through a Unilateral Approach: Technical Feasibility and Outcomes

    PubMed Central

    Choi, Won-Suh; Kim, Jin-Sung; Ryu, Kyeong-Sik; Hur, Jung-Woo; Seong, Ji-Hoon

    2016-01-01

    Background. Minimally invasive spinal transforaminal lumbar interbody fusion (MIS-TLIF) at L5-S1 is technically more demanding than it is at other levels because of the anatomical and biomechanical traits. Objective. To determine the clinical and radiological outcomes of MIS-TLIF for treatment of single-level spinal stenosis low-grade isthmic or degenerative spondylolisthesis at L5-S1. Methods. Radiological data and electronic medical records of patients who underwent MIS-TLIF between May 2012 and December 2014 were reviewed. Fusion rate, cage position, disc height (DH), disc angle (DA), disc slope angle, segmental lordotic angle (SLA), lumbar lordotic angle (LLA), and pelvic parameters were assessed. For functional assessment, the visual analogue scale (VAS), Oswestry disability index (ODI), and patient satisfaction rate (PSR) were utilized. Results. A total of 21 levels in 21 patients were studied. DH, DA, SLA, and LLA had increased from their preoperative measures at the final follow-up. Fusion rate was 86.7% (18/21) at 12 months' follow-up. The most common cage position was anteromedial (15/21). The mean VAS scores for back and leg pain mean ODI scores improved significantly at the final follow-up. PSR was 88%. Cage subsidence was observed in 33.3% (7/21). Conclusions. The clinical and radiologic outcomes after MIS-TLIF at L5-S1 in patients with spinal stenosis or spondylolisthesis are generally favorable. PMID:27433472

  9. Temporal and tissue specific gene expression patterns of the zebrafish kinesin-1 heavy chain family, kif5s, during development

    PubMed Central

    Campbell, Philip D.; Marlow, Florence L.

    2013-01-01

    Homo- and heterodimers of Kif5 proteins form the motor domain of Kinesin-1, a major plus-end directed microtubule motor. Kif5s have been implicated in the intracellular transport of organelles, vesicles, proteins, and RNAs in many cell types. There are three mammalian KIF5s. KIF5A and KIF5C proteins are strictly neural in mouse whereas, KIF5B is ubiquitously expressed. Mouse knockouts indicate crucial roles for KIF5 in development and human mutations in KIF5A lead to the neurodegenerative disease Hereditary Spastic Paraplegia. However, the developmental functions and the extent to which individual kif5 functions overlap have not been elucidated. Zebrafish possess five kif5 genes: kif5Aa, kif5Ab, kif5Ba, kif5Bb, and kif5C. Here we report their tissue specific expression patterns in embryonic and larval stages. Specifically, we find that kif5As are strictly zygotic and exhibit neural-specific expression. In contrast, kif5Bs exhibit strong maternal contribution and are ubiquitously expressed. Lastly, kif5C exhibits weak maternal expression followed by enrichment in neural populations. In addition, kif5s show distinct expression domains in the larval retina. PMID:23684767

  10. Allele-specific PCR for detecting the deafness-associated mitochondrial 12S rRNA mutations.

    PubMed

    Ding, Yu; Xia, Bo-Hou; Liu, Qi; Li, Mei-Ya; Huang, Shui-Xian; Zhuo, Guang-Chao

    2016-10-10

    Mutations in mitochondrial 12S rRNA (MT-RNR1) are the important causes of sensorineural hearing loss. Of these mutations, the homoplasmic m.1555A>G or m.1494C>T mutation in the highly conserved A-site of MT-RNR1 gene has been found to be associated with both aminoglycoside-induced and non-syndromic hearing loss in many families worldwide. Since the m.1555A>G and m.1494C>T mutations are sensitive to ototoxic drugs, therefore, screening for the presence of these mutations is important for early diagnosis and prevention of deafness. For this purpose, we recently developed a novel allele-specific PCR (AS-PCR) which is able to simultaneously detect these mutations. To assess its accuracy, in this study, we employed this method to screen the frequency of m.1555A>G and m.1494C>T mutations in 200 deafness patients and 120 healthy subjects. Consequently, four m.1555A>G and four m.1494C>T mutations were identified; among these, only one patient with the m.1494C>T mutation had an obvious family history of hearing loss. Strikingly, clinical evaluation showed that this family exhibited a high penetrance of hearing loss. In particular, the penetrances of hearing loss were 80% with the aminoglycoside included and 20% when excluded. PCR-Sanger sequencing of the mitochondrial genomes confirmed the presence of the m.1494C>T mutation and identified a set of polymorphisms belonging to mitochondrial haplogroup A. However, the lack of functional variants in mitochondrial and nuclear modified genes (GJB2 and TRMU) in this family indicated that mitochondrial haplogroup and nuclear genes may not play important roles in the phenotypic expression of the m.1494C>T mutation. Thus, other modification factors, such as environmental factor, aminoglycosides or epigenetic modification may have contributed to the high penetrance of hearing loss in this family. Taken together, our data showed that this assay is an effective approach that could be used for detection the deafness-associated MT-RNR1

  11. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.

    PubMed

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G

    2005-09-01

    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  12. A temporal assessment of cattle fecal pollution in the watersheds using 16S rRNA gene-based and metagenome-based assays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Microbial source tracking methods need to be accurate, sensitive and exhibit spatiotemporal stability to provide useful field application data. The objective of this study was to investigate the effect of spatial and temporal variability on the frequency of detecting 16S rDNA-based Bacterioidales an...

  13. IDENTIFYING MICROORGANISMS INVOLVED IN SPECIFIC IN SITU FUNCTIONS: EXPERIMENTAL DESIGN CONSIDERATIONS FOR RRNA GENE-BASED POPULATION STUDIES AND SEQUENCE-SELECTIVE PCR ASSAYS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This chapter examines experimental design considerations for a population-based approach for identifying microorganisms involved in specific in situ functions. Here, the term function is used in its broadest sense, and may refer to any number of defined biochemical, physiological or ecological pheno...

  14. Development of quantitative PCR assays targeting 16S rRNA gene of Enterococcus spp. and their application to the identification of Enterococcus species in environmental samples

    EPA Science Inventory

    The detection of environmental enterococci has primarily been determined using culture-based techniques that might exclude some enterococci species as well as those that are nonculturable. To address this, the relative abundance of enterococci was examined by challenging fecal an...

  15. Lack of specificity for PCR assays targeting human Bacteroides 16S rRNA gene: cross-amplification with fish feces

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Methods focused on members of the genus Bacteroides have been increasingly utilized in microbial source tracking studies for identifying and quantifying sources of non-point fecal contamination. We present results using real-time PCR to show significant cross-amplification of a human-specific Bacter...

  16. [Strategy of selecting 16S rRNA hypervariable regions for metagenome-phylogenetic marker genes based analysis].

    PubMed

    Zhang, Jun-yi; Zhu, Bing-chuan; Xu, Chao; Ding, Xiao; Li, Jun-feng; Zhang, Xue-gong; Lu, Zu-hong

    2015-11-01

    The advent of next generation sequencing technology enables parallel analysis of the whole microbial community from multiple samples. Particularly, sequencing 16S rRNA hypervariable tags has become the most efficient and cost-effective method for assessing microbial diversity. Due to its short read length of the 2nd-generation sequencing methods that cannot cover the full 16S rRNA genomic region, specific hypervariable regions or V-regions must be selected to act as the proxy. Over the past decade, selection of V-regions has not been consistent in assessing microbial diversity. Here we evaluated the current strategies of selecting 16S rRNA hypervariable regions for surveying microbial diversity. The environmental condition was considered as one of the important factors for selection of 16S rRNA hypervariable regions. We suggested that a pilot study to test different V-regions is required in bacterial diversity studies based on 16S rRNA genes. PMID:26915214

  17. RRNA and dnaK relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legume trees in Costa Rica.

    PubMed

    Parker, Matthew A

    2004-05-01

    Enzyme electrophoresis and sequencing of rRNA and dnaK genes revealed high genetic diversity among root nodule bacteria from the Costa Rican trees Andira inermis, Dalbergia retusa, Platymiscium pinnatum (Papilionoideae tribe Dalbergieae) and Lonchocarpus atropurpureus (Papilionoideae tribe Millettieae). A total of 21 distinct multilocus genotypes [ETs (electrophoretic types)] was found among the 36 isolates analyzed, and no ETs were shared in common by isolates from different legume hosts. However, three of the ETs from D. retusa were identical to Bradyrhizobium sp. isolates detected in prior studies of several other legume genera in both Costa Rica and Panama. Nearly full-length 16S rRNA sequences and partial 23S rRNA sequences confirmed that two isolates from D. retusa were highly similar or identical to Bradyrhizobium strains isolated from the legumes Erythrina and Clitoria (Papilionoideae tribe Phaseoleae) in Panama. rRNA sequences for five isolates from L. atropurpureus, P. pinnatum and A. inermis were not closely related to any currently known strains from Central America or elsewhere, but had affinities to the reference strains Bradyrhizobium japonicum USDA 110 (three isolates) or to B. elkanii USDA 76 (two isolates). A phylogenetic tree for 21 Bradyrhizobium strains based on 603 bp of the dnaK gene showed several significant conflicts with the rRNA tree, suggesting that genealogical relationships may have been altered by lateral gene transfer events. PMID:15214639

  18. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes.

    PubMed

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-06-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  19. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes

    PubMed Central

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-01-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  20. Strengths and Limitations of 16S rRNA Gene Amplicon Sequencing in Revealing Temporal Microbial Community Dynamics

    PubMed Central

    Poretsky, Rachel; Rodriguez-R, Luis M.; Luo, Chengwei; Tsementzi, Despina; Konstantinidis, Konstantinos T.

    2014-01-01

    This study explored the short-term planktonic microbial community structure and resilience in Lake Lanier (GA, USA) while simultaneously evaluating the technical aspects of identifying taxa via 16S rRNA gene amplicon and metagenomic sequence data. 16S rRNA gene amplicons generated from four temporally discrete samples were sequenced with 454 GS-FLX-Ti yielding ∼40,000 rRNA gene sequences from each sample and representing ∼300 observed OTUs. Replicates obtained from the same biological sample clustered together but several biases were observed, linked to either the PCR or sequencing-preparation steps. In comparisons with companion whole-community shotgun metagenome datasets, the estimated number of OTUs at each timepoint was concordant, but 1.5 times and ∼10 times as many phyla and genera, respectively, were identified in the metagenomes. Our analyses showed that the 16S rRNA gene captures broad shifts in community diversity over time, but with limited resolution and lower sensitivity compared to metagenomic data. We also identified OTUs that showed marked shifts in abundance over four close timepoints separated by perturbations and tracked these taxa in the metagenome vs. 16S rRNA amplicon data. A strong summer storm had less of an effect on community composition than did seasonal mixing, which revealed a distinct succession of organisms. This study provides insights into freshwater microbial communities and advances the approaches for assessing community diversity and dynamics in situ. PMID:24714158

  1. Group I introns are inherited through common ancestry in the nuclear-encoded rRNA of Zygnematales (Charophyceae).

    PubMed Central

    Bhattacharya, D; Surek, B; Rüsing, M; Damberger, S; Melkonian, M

    1994-01-01

    Group I introns are found in organellar genomes, in the genomes of eubacteria and phages, and in nuclear-encoded rRNAs. The origin and distribution of nuclear-encoded rRNA group I introns are not understood. To elucidate their evolutionary relationships, we analyzed diverse nuclear-encoded small-subunit rRNA group I introns including nine sequences from the green-algal order Zygnematales (Charophyceae). Phylogenetic analyses of group I introns and rRNA coding regions suggest that lateral transfers have occurred in the evolutionary history of group I introns and that, after transfer, some of these elements may form stable components of the host-cell nuclear genomes. The Zygnematales introns, which share a common insertion site (position 1506 relative to the Escherichia coli small-subunit rRNA), form one subfamily of group I introns that has, after its origin, been inherited through common ancestry. Since the first Zygnematales appear in the middle Devonian within the fossil record, the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding region for 350-400 million years. PMID:7937917

  2. Mutational analysis of the L1 binding site of 23S rRNA in Escherichia coli.

    PubMed Central

    Said, B; Cole, J R; Nomura, M

    1988-01-01

    The L11 ribosomal protein operon of Escherichia coli contains the genes for L11 and L1 and is feedback regulated by the translational repressor L1. Both the L1 binding site on 23S rRNA and the L1 repressor target site on L11 operon mRNA share similar proposed secondary structures and contain some primary sequence identity. Several site-directed mutations in the binding region of 23S rRNA were constructed and their effects on binding were examined. For in vitro analysis, a filter binding method was used. For in vivo analysis, a conditional expression system was used to overproduce a 23S rRNA fragment containing the L1 binding region, which leads to specific derepression of the synthesis of L11 and L1. Changes in the shared region of the 23S rRNA L1 binding site produced effects on L1 binding similar to those found previously in analysis of corresponding changes in the L11 operon mRNA target site. The results support the hypothesis that r-protein L1 interacts with both 23S rRNA and L11 operon mRNA by recognizing similar features on both RNAs. Images PMID:3060846

  3. METAXA2: improved identification and taxonomic classification of small and large subunit rRNA in metagenomic data.

    PubMed

    Bengtsson-Palme, Johan; Hartmann, Martin; Eriksson, Karl Martin; Pal, Chandan; Thorell, Kaisa; Larsson, Dan Göran Joakim; Nilsson, Rolf Henrik

    2015-11-01

    The ribosomal rRNA genes are widely used as genetic markers for taxonomic identification of microbes. Particularly the small subunit (SSU; 16S/18S) rRNA gene is frequently used for species- or genus-level identification, but also the large subunit (LSU; 23S/28S) rRNA gene is employed in taxonomic assignment. The METAXA software tool is a popular utility for extracting partial rRNA sequences from large sequencing data sets and assigning them to an archaeal, bacterial, nuclear eukaryote, mitochondrial or chloroplast origin. This study describes a comprehensive update to METAXA - METAXA2 - that extends the capabilities of the tool, introducing support for the LSU rRNA gene, a greatly improved classifier allowing classification down to genus or species level, as well as enhanced support for short-read (100 bp) and paired-end sequences, among other changes. The performance of METAXA2 was compared to other commonly used taxonomic classifiers, showing that METAXA2 often outperforms previous methods in terms of making correct predictions while maintaining a low misclassification rate. METAXA2 is freely available from http://microbiology.se/software/metaxa2/. PMID:25732605

  4. Methods to assay Drosophila behavior.

    PubMed

    Nichols, Charles D; Becnel, Jaime; Pandey, Udai B

    2012-01-01

    Drosophila melanogaster, the fruit fly, has been used to study molecular mechanisms of a wide range of human diseases such as cancer, cardiovascular disease and various neurological diseases(1). We have optimized simple and robust behavioral assays for determining larval locomotion, adult climbing ability (RING assay), and courtship behaviors of Drosophila. These behavioral assays are widely applicable for studying the role of genetic and environmental factors on fly behavior. Larval crawling ability can be reliably used for determining early stage changes in the crawling abilities of Drosophila larvae and also for examining effect of drugs or human disease genes (in transgenic flies) on their locomotion. The larval crawling assay becomes more applicable if expression or abolition of a gene causes lethality in pupal or adult stages, as these flies do not survive to adulthood where they otherwise could be assessed. This basic assay can also be used in conjunction with bright light or stress to examine additional behavioral responses in Drosophila larvae. Courtship behavior has been widely used to investigate genetic basis of sexual behavior, and can also be used to examine activity and coordination, as well as learning and memory. Drosophila courtship behavior involves the exchange of various sensory stimuli including visual, auditory, and chemosensory signals between males and females that lead to a complex series of well characterized motor behaviors culminating in successful copulation. Traditional adult climbing assays (negative geotaxis) are tedious, labor intensive, and time consuming, with significant variation between different trials(2-4). The rapid iterative negative geotaxis (RING) assay(5) has many advantages over more widely employed protocols, providing a reproducible, sensitive, and high throughput approach to quantify adult locomotor and negative geotaxis behaviors. In the RING assay, several genotypes or drug treatments can be tested simultaneously

  5. Microbiological assay using bioluminescent organism

    SciTech Connect

    Stiffey, A.V.

    1987-12-21

    This invention relates to testing processes for toxicity involving microorganisms and, more particularly, to testing processes for toxicity involving bioluminescent organisms. The present known method of testing oil-well drilling fluids for toxicity employs the mysid shrimp (Mysidopsis bahia) as the assay organism. The shrimp are difficult to raise and handle as laboratory assay organisms. This method is labor-intensive, because it requires a assay time of about 96 hours. Summary of the Invention: A microbiological assay in which the assay organism is the dinoflagellate, Pyrocystis lunula. A sample of a substance to be assayed is added to known numbers of the bioluminescent dinoflagellate and the mixture is agitated to subject the organisms to a shear stress causing them to emit light. The amount of light emitted is measured and compared with the amount of light emitted by a known non-toxic control mixture to determine if there is diminution or non-diminution of light emitted by the sample under test which is an indication of the presence or absence of toxicity, respectively. Accordingly, an object of the present invention is the provision of an improved method of testing substances for toxicity. A further object of the invention is the provision of an improved method of testing oil-well drilling fluids for toxicity using bioluminescent dinoflagellate (Pyrocystis lunula).

  6. Spatial distribution of Escherichia coli in the mouse large intestine inferred from rRNA in situ hybridization.

    PubMed Central

    Poulsen, L K; Lan, F; Kristensen, C S; Hobolth, P; Molin, S; Krogfelt, K A

    1994-01-01

    Fluorescent oligonucleotide probes targeting rRNA were used to develop an in situ hybridization technique by which the spatial distribution of Escherichia coli in the large intestines of streptomycin-treated mice was determined. Single E. coli cells were identified in thin frozen sections from the large intestines by the use of a probe specific for E. coli 23S rRNA. Furthermore, the total bacterial population was visualized with an rRNA probe targeting the domain Bacteria. By this technique, all E. coli cells were seen embedded in the mucosal material overlying the epithelial cells of the large intestine, and no direct attachment to the epithelium was observed. Images PMID:7927805

  7. PCR primers to amplify 16S rRNA genes from cyanobacteria.

    PubMed Central

    Nübel, U; Garcia-Pichel, F; Muyzer, G

    1997-01-01

    We developed and tested a set of oligonucleotide primers for the specific amplification of 16S rRNA gene segments from cyanobacteria and plastids by PCR. PCR products were recovered from all cultures of cyanobacteria and diatoms that were checked but not from other bacteria and archaea. Gene segments selectively retrieved from cyanobacteria and diatoms in unialgal but nonaxenic cultures and from cyanobionts in lichens could be directly sequenced. In the context of growing sequence databases, this procedure allows rapid and phylogenetically meaningful identification without pure cultures or molecular cloning. We demonstrate the use of this specific PCR in combination with denaturing gradient gel electrophoresis to probe the diversity of oxygenic phototrophic microorganisms in cultures, lichens, and complex microbial communities. PMID:9251225

  8. Identification of Scopulariopsis species by partial 28S rRNA gene sequence analysis.

    PubMed

    Jagielski, Tomasz; Kosim, Kinga; Skóra, Magdalena; Macura, Anna Barbara; Bielecki, Jacek

    2013-01-01

    The genus Scopulariopsis contains over 30 species of mitosporic moulds, which although usually saprophytic may also act as opportunistic pathogens in humans. They have mainly been associated with onychomycosis, and only sporadically reported as a cause of deep tissue infections or systemic disease. Identification of Scopulariopsis species still largely relies on phenotype-based methods. There is a need for a molecular diagnostic approach, that would allow to reliably discriminate between different Scopulariopsis species. The aim of this study was to apply sequence analysis of partial 28S rRNA gene for species identification of Scopulariopsis clinical isolates. Although the method employed did reveal some genetic polymorphism among Scopulariopsis isolates tested, it was not enough for species delineation. For this to be achieved, other genetic loci, within and beyond the rDNA operon, need to be investigated. PMID:24459837

  9. Novelty in phylogeny of gastrotricha: evidence from 18S rRNA gene.

    PubMed

    Wirz, A; Pucciarelli, S; Miceli, C; Tongiorgi, P; Balsamo, M

    1999-11-01

    Gastrotricha form a phylum which is crucial for defining the origin of pseudocoelomates, in that they share a number of characters with Rotifera and Nematoda but also with acoelomates, and even the evolutionary relationships within the phylum are anything but defined. For this reason the first extensive molecular data on Gastrotricha from the 18S rRNA sequences of both orders have been obtained and analyzed. Sequence analyses show that the phylum Gastrotricha is strictly monophyletic along an evolutionary line quite distinct from that of both Rotifera and Nematoda. A new view of the evolutionary history of the phylum Gastrotricha is put forward, in which Chaetonotida, and not Macrodasyida, are the most primitive forms of the group, contrary to the commonly held view. A polyphyletic origin of aschelminthes is supported, and the misleading term pseudocoelomates should be discarded. PMID:10603259

  10. Preliminary study on mitochondrial 16S rRNA gene sequences and phylogeny of flatfishes (Pleuronectiformes)

    NASA Astrophysics Data System (ADS)

    You, Feng; Liu, Jing; Zhang, Peijun; Xiang, Jianhai

    2005-09-01

    A 605 bp section of mitochondrial 16S rRNA gene from Paralichthys olivaceus, Pseudorhombus cinnamomeus, Psetta maxima and Kareius bicoloratus, which represent 3 families of Order Pleuronectiformes was amplified by PCR and sequenced to show the molecular systematics of Pleuronectiformes for comparison with related gene sequences of other 6 flatfish downloaded from GenBank. Phylogenetic analysis based on genetic distance from related gene sequences of 10 flatfish showed that this method was ideal to explore the relationship between species, genera and families. Phylogenetic trees set-up is based on neighbor-joining, maximum parsimony and maximum likelihood methods that accords to the general rule of Pleuronectiformes evolution. But they also resulted in some confusion. Unlike data from morphological characters, P. olivaceus clustered with K. bicoloratus, but P. cinnamomeus did not cluster with P. olivaceus, which is worth further studying.

  11. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae.

    PubMed

    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C

    2016-09-01

    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  12. Identification of the Microbiota in Carious Dentin Lesions Using 16S rRNA Gene Sequencing

    PubMed Central

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4–76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  13. Species identification of oral viridans streptococci by restriction fragment polymorphism analysis of rRNA genes.

    PubMed Central

    Rudney, J D; Larson, C J

    1993-01-01

    Oral streptococci formerly classified as Streptococcus sanguis have been divided into six genetic groups. Methods to identify those species by genotype are needed. This study compared restriction fragment polymorphisms of rRNA genes (ribotypes) for seven S. gordonii, three S. sanguis, four S. oralis, three S. mitis, one S. crista, and seven S. parasanguis strains classified in previous DNA hybridization studies, as well as one clinical isolate. DNA was digested with HindIII, PvuII, HindIII and PvuII combined, EcoRI, BamHI, AatII, AlwNI, and DraII. DNA fragments were hybridized with a digoxigenin-labeled cDNA probe obtained by reverse transcription of Escherichia coli 16S and 23S rRNA. S. oralis, S. mitis, and S. parasanguis all showed an isolated 2,290-bp band in AatII ribotypes that was absent from S. gordonii, S. sanguis, and S. crista. The last three groups showed species-specific bands with AatII and also with PvuII. S. oralis could be distinguished from S. mitis and S. parasanguis in AlwNI and DraII ribotypes. S. mitis and S. parasanguis could not be distinguished, since they shared multiple bands in PvuII, AlwNI, and EcoRI patterns. The clinical isolate in the panel was very similar to S. sanguis by all enzymes used. Our findings suggest that ribotyping may be useful for genotypic identification of oral viridans streptococci. Initial digests of clinical isolates might be made with AatII, followed by PvuII or AlwNI. Isolates then could be identified by comparing ribotype patterns with those of reference strains. This approach could facilitate clinical studies of these newly defined species. Images PMID:7691875

  14. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    PubMed Central

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  15. Improved PCR primers to amplify 16S rRNA genes from NC10 bacteria.

    PubMed

    He, Zhanfei; Wang, Jiaqi; Hu, Jiajie; Zhang, Hao; Cai, Chaoyang; Shen, Jiaxian; Xu, Xinhua; Zheng, Ping; Hu, Baolan

    2016-06-01

    Anaerobic oxidation of methane (AOM) coupled to nitrite reduction (AOM-NIR) is ecologically significant for mitigating the methane-induced greenhouse effect. The microbes responsible for this reaction, NC10 bacteria, have been widely detected in diverse ecosystems. However, some defects were discovered in the commonly used NC10-specific primers, 202F and qP1F. In the present work, the primers were redesigned and improved to overcome the defects found in the previous primers. A new nested PCR method was developed using the improved primers to amplify 16S ribosomal RNA (rRNA) genes from NC10 bacteria. In the new nested PCR method, the qP1mF/1492R and 1051F/qP2R primer sets were used in the first and second rounds, respectively. The PCR products were sequenced, and more operational taxonomic units (OTUs) of the NC10 phylum were obtained using the new primers compared to the previous primers. The sensitivity of the new nested PCR was tested by the serial dilution method, and the limit of detection was approximately 10(3) copies g(-1) dry sed. for the environmental samples compared to approximately 10(5) copies g(-1) dry sed. by the previous method. Finally, the improved primer, qP1mF, was used in quantitative PCR (qPCR) to determine the abundance of NC10 bacteria, and the results agreed well with the activity of AOM-NIR measured by isotope tracer experiments. The improved primers are able to amplify NC10 16S rRNA genes more efficiently than the previous primers and useful to explore the microbial community of the NC10 phylum in different systems. PMID:27020287

  16. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    PubMed

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  17. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  18. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.

    PubMed

    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V

    2015-02-25

    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences. PMID:25523504

  19. Endoscopic Trans-iliac Approach to L5-S1 Disc and Foramen – A Report on Clinical Experience

    PubMed Central

    Osman, Said G; Sherlekar, Sandeep; Malik, Atif; Winters, Charles; Grewal, PK; Narayanan, Malini; Gemechu, Nigussie

    2014-01-01

    Background The lumbosacral junction is a difficult area for spine surgery because of the complex anatomy. In the era of minimally invasive spine surgery, the presence of the iliac wing has, at the level of lumbosacral junction, created a major obstacle in the paths of two of the major approaches, namely, the direct lateral and percutaneous posterolateral endoscopic approaches. A trans-iliac cadaver study published by the senior author and co-workers in 1997, suggested the possibility of an alternative approach to the lumbosacral junction. Purpose To determine the feasibility of percutaneous, endoscopic trans-iliac approach to the L5-S1 disc and foramen Study Design Prospective case series study. Materials and Methods 15 consecutive patients undergoing the transiliac approach to L5-S1 disc and foramen were included in the study. Pre- and postoperative visual analogue scale (VAS); Oswestry Disability Index (ODI); and intra-operative blood loss and operative time, were obtained for the study. Preoperative MRI or CT scan was used to determine the need for trans-iliac access. The procedure was performed with the patient in prone position and under monitored sedation for decompression. Endotracheal anesthesia was used for fusion cases. The transiliac access was established with a cannulated drill or core drill through the iliac wing. Once the trans-iliac window had been created, the rest of the procedure proceeded as for percutaneous endoscopic transforaminal decompression and fusion. Results 15 patients (9 male and 6 female) participated in the study. The VAS for back and leg pain significantly improved in all patients. The ODI dropped by more than 50%. There was minimal blood loss, and transient post-operative dysesthesia in 2 cases which resolved after 3 weeks. Conclusion Endoscopic trans-iliac approach to the L5-S1 disc and foramen is feasible and safe. Decompression can be performed safely via trans-iliac access with minimal blood loss, and in a short operative time

  20. Multiplex Real-Time PCR Assay for Rapid Detection of Methicillin-Resistant Staphylococci Directly from Positive Blood Cultures

    PubMed Central

    Wang, Hye-young; Kim, Sunghyun; Kim, Jungho; Park, Soon-Deok

    2014-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is the most prevalent cause of bloodstream infections (BSIs) and is recognized as a major nosocomial pathogen. This study aimed to evaluate a newly designed multiplex real-time PCR assay capable of the simultaneous detection of mecA, S. aureus, and coagulase-negative staphylococci (CoNS) in blood culture specimens. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays (M&D, Republic of Korea) use the TaqMan probes 16S rRNA for Staphylococcus spp., the nuc gene for S. aureus, and the mecA gene for methicillin resistance. The detection limit of the multiplex real-time PCR assay was 103 CFU/ml per PCR for each gene target. The multiplex real-time PCR assay was evaluated using 118 clinical isolates from various specimen types and a total of 350 positive blood cultures from a continuous monitoring blood culture system. The results obtained with the multiplex real-time PCR assay for the three targets were in agreement with those of conventional identification and susceptibility testing methods except for one organism. Of 350 positive bottle cultures, the sensitivities of the multiplex real-time PCR kit were 100% (166/166 cultures), 97.2% (35/36 cultures), and 99.2% (117/118 cultures) for the 16S rRNA, nuc, and mecA genes, respectively, and the specificities for all three targets were 100%. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays are very useful for the rapid accurate diagnosis of staphylococcal BSIs. In addition, the Real-MRSA and Real-MRCoNS multiplex real-time PCR assays could have an important impact on the choice of appropriate antimicrobial therapy, based on detection of the mecA gene. PMID:24648566

  1. Development of a Quantitative PCR Assay for Thermophilic Spore-Forming Geobacillus stearothermophilus in Canned Food.

    PubMed

    Nakano, Miyo

    2015-01-01

    The thermophilic spore forming bacteria Geobacillus stearothermophilus is recognized as a major cause of spoilage in canned food. A quantitative real-time PCR assay was developed to specifically detect and quantify the species G. stearothermophilus in samples from canned food. The selected primer pairs amplified a 163-bp fragment of the 16S rRNA gene in a specific PCR assay with a detection limit of 12.5 fg of pure culture DNA, corresponding to DNA extracted from approximately 0.7 CFU/mL of G. stearothermophilus. Analysis showed that the bacterial species G. stearothermophilus was not detected in any canned food sample. Our approach presented here will be useful for tracking or quantifying species G. stearotethermophilus in canned food and ingredients. PMID:26412704

  2. Hadron physics potential of future high-luminosity B-factories at the ϒ(5S) and above

    NASA Astrophysics Data System (ADS)

    Drutskoy, A. G.; Guo, F.-K.; Llanes-Estrada, F. J.; Nefediev, A. V.; Torres-Rincon, J. M.

    2013-01-01

    We point out the physics opportunities of future high-luminosity B-factories at the ϒ(5 S) resonance and above. Currently the two B-factories, the SuperB factory in Tor Vergata, Italy and the Belle II factory in KEK, Japan, are under development and are expected to start operation in 2017 and 2016, respectively. In this paper we discuss numerous interesting investigations, which can be performed in the e + e - center-of-mass energy region from the ϒ(5 S) and up to 11.5GeV, where an efficient data taking operation should be possible with the planned B-factories. These studies include abundant Bs production and decay properties; independent confirmation and, if found, exhaustive exploration of Belle's claimed charged bottomonia; clarification of puzzles of interquarkonium dipion transitions; extraction of the light-quark mass ratio from hadronic ϒ(5 S) decays; analysis of quarkonium and exotic internal structure from open flavour decays, leading to severe SU(3) symmetry violations; clarification of whether a hybrid state has similar mass to the ϒ(5 S) bottomonium, making it a double state; searches for molecular/tetraquark states that should be more stable with heavy quarks; completion of the table of positive-parity BJ mesons and study of their basic properties; production of Λ _b bar Λ _b heavy baryon pairs, that, following weak decay, open vistas on the charmed baryon spectrum and new channels to study CP violation; confirmation or refutation of the deviation from pQCD of the pion transition form factor, by extending the Q2 reach of current analysis; and possibly reaching the threshold for the production of triply charmed baryons. If, in addition, the future colliders can be later upgraded to 12.5GeV, then the possibility of copious production of B_c bar B_c pairs opens, entailing new studies of CP violation and improved, independent tests of the CKM picture (through determination of V bc , and of effective theories for heavy quarks.

  3. Emergence of 16S rRNA methylase-producing Acinetobacter baumannii and Pseudomonas aeruginosa isolates in hospitals in Vietnam

    PubMed Central

    2013-01-01

    Background 16S rRNA methylase-producing Gram-negative bacteria are highly resistant to all clinically important aminoglycosides. We analyzed clinical strains of 16S rRNA methylase-producing Acinetobactor baumannii and Pseudomonas aeruginosa obtained from clinical isolates in medical settings in Vietnam. Methods From 2008 to 2011, 101 clinical strains of A. baumannii and 15 of P. aeruginosa were isolated from patients in intensive care units (ICUs) in two medical settings in Vietnam. Antimicrobial susceptibilities were determined using the microdilution method and epidemiological analysis was performed by pulsed-field gel electrophoresis and MLST. Genes encoding the 16S rRNA methylases, OXAs and CTX-Ms were analyzed by PCR and sequence analysis. Results 16S rRNA methylase-producing Gram-negative pathogens were detected in two hospitals in Vietnam. Of the 101 clinical isolates of A. baumannii and the 15 of P. aeruginosa isolated from two ICUs in these hospitals, 72 (71.3%) were highly resistant to amikacin, arbekacin and gentamicin, with MICs greater than 1,024 mg/L. The 16S rRNA methylases ArmA and RmtB were produced by 61 and 9 isolates of A. baumannii, respectively, and RmtB was produced by 2 isolates of P. aeruginosa. Moreover, 52 of the A. baumannii isolates producing 16S rRNA methylases harbored both blaOXA-23-like and blaOXA-51-like genes. Most A. baumannii isolates producing 16S rRNA methylase obtained in hospital A in Hanoi were ST91 and ST231, whereas most from hospital B in Ho Chi Minh City were ST136, ST195, and ST254. The two P. aeruginosa isolates harboring rmtB showed different patterns on PFGE, one each corresponding to ST217 and ST313. Conclusions Gram-negative bacteria producing the 16S rRNA methylases ArmA and RmtB are emerging in medical settings in Vietnam. A. baumannii isolates in northern and southern regions of Vietnam may be of different lineages. PMID:23721359

  4. Assessing the Fecal Microbiota: An Optimized Ion Torrent 16S rRNA Gene-Based Analysis Protocol

    PubMed Central

    Foroni, Elena; Duranti, Sabrina; Turroni, Francesca; Lugli, Gabriele Andrea; Sanchez, Borja; Martín, Rebeca; Gueimonde, Miguel; van Sinderen, Douwe; Margolles, Abelardo; Ventura, Marco

    2013-01-01

    Assessing the distribution of 16S rRNA gene sequences within a biological sample represents the current state-of-the-art for determination of human gut microbiota composition. Advances in dissecting the microbial biodiversity of this ecosystem have very much been dependent on the development of novel high-throughput DNA sequencing technologies, like the Ion Torrent. However, the precise representation of this bacterial community may be affected by the protocols used for DNA extraction as well as by the PCR primers employed in the amplification reaction. Here, we describe an optimized protocol for 16S rRNA gene-based profiling of the fecal microbiota. PMID:23869230

  5. Intragenomic heterogeneity of the 16S rRNA gene in strain UFO1 caused by a 100-bp insertion in helix 6

    SciTech Connect

    Allison E. Ray; Stephanie A. Connon; Peter P. Sheridan; Jeremy Gilbreath; Malcolm S. Shields; Deborah T. Newby; Yoshiko Fujita; Timothy S. Magnuson

    2010-06-01

    The determination of variation in 16S rRNA gene sequences is perhaps the most common method for assessing microbial community diversity. However, the occurrence of multiple copies of 16S rRNA genes within some organisms can bias estimates of microbial diversity. During phylogenetic characterization of a metal-transforming, fermentative bacterium (strain UFO1) isolated from the Field Research Center (FRC) in Oak Ridge, TN, we detected an apparent 16S rRNA pseudogene. The putative 16S rRNA pseudogene was first detected in clone libraries constructed with 16S rRNA genes amplified from UFO1 genomic DNA. Sequencing revealed two distinct 16S rRNA genes, with one differing from the other by a 100 bp insert near the 5’ end. Ribosomal RNA was extracted from strain UFO1 and analyzed by RT-qPCR with insert and non-insert specific primers; however, only the non-insert 16S rRNA sequence was expressed. Reverse-transcribed rRNA from strain UFO1 was also used to construct a cDNA library. Of 190 clones screened by PCR, none contained the 16S rRNA gene with the 100 bp insert. Examination of GenBank 16S rRNA gene sequences revealed that the same insert sequence was present in other clones, including those from an environmental library constructed from FRC enrichments. These findings demonstrate the existence of widely disparate copies of the 16S rRNA gene in the same species and a putative 16S rRNA pseudogene, which may confound 16S rRNA-based methods for assessments of microbial diversity in environmental samples.

  6. Enzymatic assay for calmodulins based on plant NAD kinase activity

    SciTech Connect

    Harmon, A.C.; Jarrett, H.W.; Cormier, M.J.

    1984-01-01

    NAD kinase with increased sensitivity to calmodulin was purified from pea seedlings (Pisum sativum L., Willet Wonder). Assays for calmodulin based on the activities of NAD kinase, bovine brain cyclic nucleotide phosphodiesterase, and human erythrocyte Ca/sup 2 -/-ATPase were compared for their sensitivities to calmodulin and for their abilities to discriminate between calmodulins from different sources. The activities of the three enzymes were determined in the presence of various concentrations of calmodulins from human erythrocyte, bovine brain, sea pansy (Renilla reniformis), mung bean seed (Vigna radiata L. Wilczek), mushroom (Agaricus bisporus), and Tetrahymena pyriformis. The concentrations of calmodulin required for 50% activation of the NAD kinase (K/sub 0.5/) ranged from 0.520 ng/ml for Tetrahymena to 2.20 ng/ml for bovine brain. The A/sub 0.5/ s ranged from 19.6 ng/ml for bovine brain calmodulin to 73.5 ng/ml for mushroom calmodulin for phosphodiesterase activation. The K/sub 0.5/'s for the activation of Ca/sup 2 +/-ATPase ranged from 36.3 ng/mol for erythrocyte calmodulin to 61.7 ng/ml for mushroom calmodulin. NAD kinase was not stimulated by phosphatidylcholine, phosphatidylserine, cardiolipin, or palmitoleic acid in the absence or presence of Ca/sup 2 +/. Palmitic acid had a slightly stimulatory effect in the presence of Ca/sup 2 +/ (10% of maximum), but no effect in the absence of Ca/sup 2 +/. Palmitoleic acid inhibited the calmodulin-stimulated activity by 50%. Both the NAD kinase assay and radioimmunoassay were able to detect calmodulin in extracts containing low concentrations of calmodulin. Estimates of calmodulin contents of crude homogenates determined by the NAD kinase assay were consistent with amounts obtained by various purification procedures. 30 references, 1 figure, 4 tables.

  7. Sensitive Detection and Serovar Differentiation of Typhoidal and Nontyphoidal Salmonella enterica Species Using 16S rRNA Gene PCR Coupled with High-Resolution Melt Analysis

    PubMed Central

    Masek, Billie J.; Hardick, Justin; Won, Helen; Yang, Samuel; Hsieh, Yu-Hsiang; Rothman, Richard E.; Gaydos, Charlotte A.

    2015-01-01

    Salmonella enterica species infections are a significant public health problem causing high morbidity rates worldwide and high mortality rates in the developing world. These infections are not always rapidly diagnosed as a cause of bloodstream infections because of the limitations of blood culture, which greatly affects clinical care as a result of treatment delays. A molecular diagnostic assay that could rapidly detect and identify S. enterica species infections as a cause of sepsis is needed. Nine typhoidal and nontyphoidal S. enterica serovars were used to establish the limit of detection (LOD) of a previously published 16S rRNA gene PCR (16S PCR) in mock whole blood specimens. In addition, 16 typhoidal and nontyphoidal S. enterica serovars were used to evaluate the serovar differentiation capability of 16S PCR coupled with high-resolution melt analysis. The overall LOD of 16S PCR for the nine typhoidal and nontyphoidal S. enterica serovars analyzed was <10 colony-forming units per milliliter (CFU/mL) in mock whole blood specimens, with the lowest and highest LOD at <1 CFU/mL and 9 CFU/mL, respectively. By high-resolution melt analysis, the typhoidal and nontyphoidal S. enterica serovar groups analyzed each generated a unique grouping code, allowing for serovar-level identification. 16S PCR coupled with high-resolution melt analysis could be a useful molecular diagnostic that could enhance the current diagnostic, treatment, and surveillance methods of S. enterica bloodstream infections. PMID:24365382

  8. Direct detection of Brucella spp. in raw milk by PCR and reverse hybridization with 16S-23S rRNA spacer probes.

    PubMed Central

    Rijpens, N P; Jannes, G; Van Asbroeck, M; Rossau, R; Herman, L M

    1996-01-01

    The 16S-23S rRNA spacer regions of Brucella abortus, B. melitensis, and B. suis were cloned and subcloned after PCR amplification. Sequence analysis of the inserts revealed a spacer of about 800 bp with very high ( > 99%) homology among the three species examined. Two genus-specific primer pairs, BRU-P5-BRU-P8 and BRU-P6-BRU-P7, that could be used in a nested PCR format and three genus-specific DNA probes, BRU-ICG2, BRU-ICG3, and BRU-ICG4, were deduced from this spacer. The specificity and sensitivity of both primer sets and probes were examined by testing them against a collection of 18 Brucella strains and 56 strains from other relevant taxa by using PCR and the Line Probe Assay (LiPA), respectively. A method for direct detection of Brucella spp. in 1 ml of raw milk was developed on the basis of enzymatic treatment of the milk components and subsequent PCR and LiPA hybridization. After a single PCR, sensitivities of 2.8 x 10(5) and 2.8 x 10(4) CFU/ml were obtained for detection by agarose gel electrophoresis and LiPA, respectively. Nested PCR yielded a sensitivity of 2.8 x 10(2) CFU/ml for both methods. PMID:8633866

  9. Quantification of Listeria monocytogenes in minimally processed leafy vegetables using a combined method based on enrichment and 16S rRNA real-time PCR.

    PubMed

    Aparecida de Oliveira, Maria; Abeid Ribeiro, Eliana Guimarães; Morato Bergamini, Alzira Maria; Pereira De Martinis, Elaine Cristina

    2010-02-01

    Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of minimally processed leafy vegetables were evaluated by the Most Probable Number (MPN) with detection by classical culture method and also culture method combined with real-time PCR (RTi-PCR) for 16S rRNA genes of L. monocytogenes. Positive MPN enrichment tubes were analyzed by RTi-PCR with primers specific for L. monocytogenes using the commercial preparation ABSOLUTE QPCR SYBR Green Mix (ABgene, UK). Real-time PCR assay presented good exclusivity and inclusivity results and no statistical significant difference was found in comparison with the conventional culture method (p < 0.05). Moreover, RTi-PCR was fast and easy to perform, with MPN results obtained in ca. 48 h for RTi-PCR in comparison to 7 days for conventional method. PMID:19913686

  10. HIV-1 Capsid Stabilization Assay.

    PubMed

    Fricke, Thomas; Diaz-Griffero, Felipe

    2016-01-01

    The stability of the HIV-1 core in the cytoplasm is crucial for productive HIV-1 infection. Mutations that stabilize or destabilize the core showed defects in HIV-1 reverse transcription and infection. We developed a novel and simple assay to measure stability of in vitro-assembled HIV-1 CA-NC complexes. This assay allowed us to demonstrate that cytosolic extracts strongly stabilize the HIV-1 core (Fricke et al., J Virol 87:10587-10597, 2013). By using our novel assay, one can measure the ability of different drugs to modulate the stability of in vitro-assembled HIV-1 CA-NC complexes, such as PF74, CAP-1, IXN-053, cyclosporine A, Bi2, and the peptide CAI. We also found that purified CPSF6 (1-321) protein stabilizes in vitro-assembled HIV-1 CA-NC complexes (Fricke et al., J Virol 87:10587-10597, 2013). Here we describe in detail the use of this capsid stability assay. We believe that our assay can be a powerful tool to assess HIV-1 capsid stability in vitro. PMID:26714703

  11. Quantitative Molecular Assay for Fingerprinting Microbial Communities of Wastewater and Estrogen-Degrading Consortia

    PubMed Central

    Yu, Chang-Ping; Ahuja, Rajiv; Sayler, Gary; Chu, Kung-Hui

    2005-01-01

    A quantitative fingerprinting method, called the real-time terminal restriction fragment length polymorphism (real-time-t-RFLP) assay, was developed for simultaneous determination of microbial diversity and abundance within a complex community. The real-time-t-RFLP assay was developed by incorporating the quantitative feature of real-time PCR and the fingerprinting feature of t-RFLP analysis. The assay was validated by using a model microbial community containing three pure strains, an Escherichia coli strain (gram negative), a Pseudomonas fluorescens strain (gram negative), and a Bacillus thuringiensis strain (gram positive). Subsequently, the real-time-t-RFLP assay was applied to and proven to be useful for environmental samples; the richness and abundance of species in microbial communities (expressed as the number of 16S rRNA gene copies of each ribotype per milliliter) of wastewater and estrogen-degrading consortia (enriched with 17α-estradiol, 17β-estradiol, or estrone) were successfully characterized. The results of this study strongly suggested that the real-time-t-RFLP assay can be a powerful molecular tool for gaining insight into microbial communities in various engineered systems and natural habitats. PMID:15746346

  12. RAPHIDOPHYCEAE [CHADEFAUD EX SILVA] SYSTEMATICS AND RAPID IDENTIFICATION: SEQUENCE ANALYSES AND REAL-TIME PCR ASSAYS

    PubMed Central

    Bowers, Holly A.; Tomas, Carmelo; Tengs, Torstein; Kempton, Jason W.; Lewitus, Alan J.; Oldach, David W.

    2010-01-01

    Species within the class Raphidophyceae were associated with fish kill events in Japanese, European, Canadian, and U.S. coastal waters. Fish mortality was attributable to gill damage with exposure to reactive oxygen species (peroxide, superoxide, and hydroxide radicals), neurotoxins, physical clogging, and hemolytic substances. Morphological identification of these organisms in environmental water samples is difficult, particularly when fixatives are used. Because of this difficulty and the continued global emergence of these species in coastal estuarine waters, we initiated the development and validation of a suite of real-time polymerase chain reaction (PCR) assays. Sequencing was used to generate complete data sets for nuclear encoded small-subunit ribosomal RNA (SSU rRNA; 18S); internal transcribed spacers 1 and 2, 5.8S; and plastid encoded SSU rRNA (16S) for confirmed raphidophyte cultures from various geographic locations. Sequences for several Chattonella species (C. antiqua, C. marina, C. ovata, C. subsalsa, and C. verruculosa), Heterosigma akashiwo, and Fibrocapsa japonica were generated and used to design rapid and specific PCR assays for several species including C. verruculosa Hara et Chihara, C. subsalsa Biecheler, the complex comprised of C. marina Hara et Chihara, C. antiqua Ono and C. ovata, H. akashiwo Ono, and F. japonica Toriumi et Takano using appropriate loci. With this comprehensive data set, we were also able to perform phylogenetic analyses to determine the relationship between these species. PMID:20411032

  13. Structural and functional exchangeability of 5 S RNA species from the eubacterium E.coli and the thermoacidophilic archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Teixidò, J; Altamura, S; Londei, P; Amils, R

    1989-01-01

    The role of 5 S RNA within the large ribosomal subunit of the extremely thermophilic archaebacterium Sulfolobus solfataricus has been analysed by means of in vitro reconstitution procedures. It is shown that Sulfolobus 50 S subunits reconstituted in the absence of 5 S RNA are inactive in protein synthesis and lack 2-3 ribosomal proteins. Furthermore, it has been determined that in the course of the in vitro assembly process Sulfolobus 5 S RNA can be replaced by the correspondent RNA species of E.coli; Sulfolobus reconstituted particles containing the eubacterial 5 S molecule are stable and active in polypeptide synthesis at high temperatures. Images PMID:2493632

  14. FungiQuant: A broad-coverage fungal quantitative real-time PCR assay

    PubMed Central

    2012-01-01

    Background Fungal load quantification is a critical component of fungal community analyses. Limitation of current approaches for quantifying the fungal component in the human microbiome suggests the need for new broad-coverage techniques. Methods We analyzed 2,085 18S rRNA gene sequences from the SILVA database for assay design. We generated and quantified plasmid standards using a qPCR-based approach. We evaluated assay coverage against 4,968 sequences and performed assay validation following the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines. Results We designed FungiQuant, a TaqMan® qPCR assay targeting a 351 bp region in the fungal 18S rRNA gene. Our in silico analysis showed that FungiQuant is a perfect sequence match to 90.0% of the 2,617 fungal species analyzed. We showed that FungiQuant’s is 100% sensitive and its amplification efficiencies ranged from 76.3% to 114.5%, with r2-values of >0.99 against the 69 fungal species tested. Additionally, FungiQuant inter- and intra-run coefficients of variance ranged from <10% and <20%, respectively. We further showed that FungiQuant has a limit of quantification 25 copies and a limit of detection at 5 copies. Lastly, by comparing results from human-only background DNA with low-level fungal DNA, we showed that amplification in two or three of a FungiQuant performed in triplicate is statistically significant for true positive fungal detection. Conclusions FungiQuant has comprehensive coverage against diverse fungi and is a robust quantification and detection tool for delineating between true fungal detection and non-target human DNA. PMID:23136846

  15. RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility

    PubMed Central

    Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

    2015-01-01

    Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmAII enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmAII, rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmAII in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmAII activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmAII, thereby facilitating TEL binding to the ribosome. PMID:26365244

  16. Comparative Studies of 5S rDNA Profiles and Cyt b Sequences in two Onychostoma Species (Cyprinidae)

    PubMed Central

    Han, Chiao-Chuan; Yen, Tsair-Bor; Chen, Nian-Cih; Tseng, Mei-Chen

    2015-01-01

    Onychostoma barbatulum and O. alticorpus, two primarily freshwater cyprinid fish, have similar morphological characters and partially overlapping ecological habitats. In order to explore the genetic differences between these two species, chromosomal characteristics and genetic variations were examined by fluorescence in situ hybridization (FISH) of 5S rDNA and cytochrome (Cyt) b gene analysis. Ten specimens of O. barbatulum and O. alticorpus were collected from the Nanzihsian Stream in southern Taiwan. FISH revealed that the 5S rDNA loci of O. barbatulum and O. alticorpus were found at a pericentromeric and subtelomeric position, respectively, in a pair of submetacentric chromosomes. Cyt b genes were amplified and sequenced from five individuals of each species. Intraspecific genetic distances ranged from 0.001–0.004 in O. barbatulum and from 0.001–0.006 in O. alticorpus. Genetic distances between these two species ranged from 0.132–0.142. The phylogenetic tree showed these two species are not sister species. In conclusion, FISH cytogenetic information and Cyt b gene analyses indicated that these two species have significantly different genetic characteristics; nevertheless, their morphological similarities may be due to environmental adaptation. PMID:26690426

  17. Li(V0.5Ti0.5)S2 as a 1 V lithium intercalation electrode

    NASA Astrophysics Data System (ADS)

    Clark, Steve J.; Wang, Da; Armstrong, A. Robert; Bruce, Peter G.

    2016-03-01

    Graphite, the dominant anode in rechargeable lithium batteries, operates at ~0.1 V versus Li+/Li and can result in lithium plating on the graphite surface, raising safety concerns. Titanates, for example, Li4Ti5O12, intercalate lithium at~1.6 V versus Li+/Li, avoiding problematic lithium plating at the expense of reduced cell voltage. There is interest in 1 V anodes, as this voltage is sufficiently high to avoid lithium plating while not significantly reducing cell potential. The sulfides, LiVS2 and LiTiS2, have been investigated as possible 1 V intercalation electrodes but suffer from capacity fading, large 1st cycle irreversible capacity or polarization. Here we report that the 50/50 solid solution, Li1+x(V0.5Ti0.5)S2, delivers a reversible capacity to store charge of 220 mAhg-1 (at 0.9 V), 99% of theoretical, at a rate of C/2, retaining 205 mAhg-1 at C-rate (92% of theoretical). Rate capability is excellent with 200 mAhg-1 at 3C. C-rate is discharge in 1 h. Polarization is low, 100 mV at C/2. To the best of our knowledge, the properties/performances of Li(V0.5Ti0.5)S2 exceed all previous 1 V electrodes.

  18. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).

    PubMed

    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F

    2014-01-01

    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera. PMID:25501173

  19. Thickness-Dependent and Magnetic-Field-Driven Suppression of Antiferromagnetic Order in Thin V5S8 Single Crystals.

    PubMed

    Hardy, Will J; Yuan, Jiangtan; Guo, Hua; Zhou, Panpan; Lou, Jun; Natelson, Douglas

    2016-06-28

    With materials approaching the 2D limit yielding many exciting systems with intriguing physical properties and promising technological functionalities, understanding and engineering magnetic order in nanoscale, layered materials is generating keen interest. One such material is V5S8, a metal with an antiferromagnetic ground state below the Néel temperature TN ∼ 32 K and a prominent spin-flop signature in the magnetoresistance (MR) when H∥c ∼ 4.2 T. Here we study nanoscale-thickness single crystals of V5S8, focusing on temperatures close to TN and the evolution of material properties in response to systematic reduction in crystal thickness. Transport measurements just below TN reveal magnetic hysteresis that we ascribe to a metamagnetic transition, the first-order magnetic-field-driven breakdown of the ordered state. The reduction of crystal thickness to ∼10 nm coincides with systematic changes in the magnetic response: TN falls, implying that antiferromagnetism is suppressed; and while the spin-flop signature remains, the hysteresis disappears, implying that the metamagnetic transition becomes second order as the thickness approaches the 2D limit. This work demonstrates that single crystals of magnetic materials with nanometer thicknesses are promising systems for future studies of magnetism in reduced dimensionality and quantum phase transitions. PMID:27163511

  20. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    PubMed Central

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  1. 5S program to reduce change-over time on forming department (case study on CV Piranti Works temanggung)

    NASA Astrophysics Data System (ADS)

    Rosiana Dewi, Septika; Setiawan, Budi; P, Susatyo Nugroho W.

    2013-06-01

    Productivity is one aspect that determines the success of a company in the competitive world of business. There are seven main types of activities that do not have value-added in manufacturing processes such as overproduction, waiting time, transportation, excess inventory, unnecessary motion and defects. The whole activity is a waste (waste) that can cause harm to the Company. Therefore, in production activities is important to pay attention so that the objectives of production productivity can be achieved. Problems experienced by CV Piranti Works is a production target is not achieved resulting in a lost sale raises the cost of which can cause harm to the Company. From the analysis conducted major known cause of the problem is the length of time required for changeover. This is supported by the high non-value added activity in the changeover activities. Lean Manufacturing is an approach to make system more efficient by reducing waste. This study refers to the book compiled by Takashi Osada (2004) and several other references. In this research used method 5S (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) for the of forming departement. The purpose of this research is to design a work environment using the 5S method (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) and make arrangement of equipment and working tool cabinet design with TRIZ methods. From these results, is expected to eliminate or reduce of non-value added activity and improved the changeover time so as to meet production targets completion of the company.

  2. Functional importance of individual rRNA 2′-O-ribose methylations revealed by high-resolution phenotyping

    PubMed Central

    Esguerra, Jonathan; Warringer, Jonas; Blomberg, Anders

    2008-01-01

    Ribosomal RNAs contain numerous modifications at specific nucleotides. Despite their evolutionary conservation, the functional role of individual 2′-O-ribose methylations in rRNA is not known. A distinct family of small nucleolar RNAs, box C/D snoRNAs, guides the methylating complex to specific rRNA sites. Using a high-resolution phenotyping approach, we characterized 20 box C/D snoRNA gene deletions for altered growth dynamics under a wide array of environmental perturbations, encompassing intraribosomal antibiotics, inhibitors of specific cellular features, as well as general stressors. Ribosome-specific antibiotics generated phenotypes indicating different and long-ranging structural effects of rRNA methylations on the ribosome. For all studied box C/D snoRNA mutants we uncovered phenotypes to extraribosomal growth inhibitors, most frequently reflected in alteration in growth lag (adaptation time). A number of strains were highly pleiotropic and displayed a great number of sensitive phenotypes, e.g., deletion mutants of snR70 and snR71, which both have clear human homologues, and deletion mutants of snR65 and snR68. Our data indicate that individual rRNA ribose methylations can play either distinct or general roles in the workings of the ribosome. PMID:18256246

  3. Distinct Ectomycorrhizospheres Share Similar Bacterial Communities as Revealed by Pyrosequencing-Based Analysis of 16S rRNA Genes

    PubMed Central

    Oger, P.; Morin, E.; Frey-Klett, P.

    2012-01-01

    Analysis of the 16S rRNA gene sequences generated from Xerocomus pruinatus and Scleroderma citrinum ectomycorrhizospheres revealed that similar bacterial communities inhabited the two ectomycorrhizospheres in terms of phyla and genera, with an enrichment of the Burkholderia genus. Compared to the bulk soil habitat, ectomycorrhizospheres hosted significantly more Alpha-, Beta-, and Gammaproteobacteria. PMID:22307291

  4. Microbial rRNA: rDNA gene ratios may be unexpectedly low due to extracellular DNA preservation in soils

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We tested a method of estimating the activity of detectable individual bacterial and archaeal OTUs within a community by calculating ratios of absolute 16S rRNA to rDNA copy numbers. We investigated phylogenetically coherent patterns of activity among soil prokaryotes in non-growing soil communitie...

  5. Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

    NASA Technical Reports Server (NTRS)

    Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.

    1995-01-01

    Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

  6. 23S rRNA gene mutations contributing to macrolide resistance in Campylobacter jejuni and Campylobacter coli

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Operon specific 23S rRNA mutations affecting minimum inhibitory concentrations (MICs) of macrolides (erythromycin [ERY], azithromycin [AZM], tylosin [TYL]) and a lincosamide (clindamycin [CLI]) were examined in a collection of Campylobacter jejuni and C. coli isolates. The three copies of the Campy...

  7. Sequencing and characterization of full-length sequence of 18S rRNA gene from the reniform nematode

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Variation within this gene is rare but it has been observed in few metazoan species. For the first time, we h...

  8. Species Identification and Profiling of Complex Microbial Communities Using Shotgun Illumina Sequencing of 16S rRNA Amplicon Sequences

    PubMed Central

    Lay, Christophe; Ho, Eliza Xin Pei; Low, Louie; Hibberd, Martin Lloyd; Nagarajan, Niranjan

    2013-01-01

    The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequencing of the bacterial 16S rRNA gene, optimized to amplify more than 90% of sequences in the Greengenes database and with the ability to distinguish nearly twice as many species-level OTUs compared to existing protocols. Using several in silico and experimental datasets, we demonstrate that despite the presence of multiple variable and conserved regions, the resulting shotgun sequences can be used to accurately quantify the constituents of complex microbial communities. The reconstruction of a significant fraction of the 16S rRNA gene also enabled high precision (>90%) in species-level identification thereby opening up potential application of this approach for clinical microbial characterization. PMID:23579286

  9. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei

    PubMed Central

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K. Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit

    2016-01-01

    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts. PMID:27142987

  10. Gradual reduction in rRNA transcription triggers p53 acetylation and apoptosis via MYBBP1A

    PubMed Central

    Kumazawa, Takuya; Nishimura, Kazuho; Katagiri, Naohiro; Hashimoto, Sayaka; Hayashi, Yuki; Kimura, Keiji

    2015-01-01

    The nucleolus, whose primary function is ribosome biogenesis, plays an essential role in p53 activation. Ribosome biogenesis is inhibited in response to cellular stress and several nucleolar proteins translocate from the nucleolus to the nucleoplasm, where they activate p53. In this study, we analysed precisely how impaired ribosome biogenesis regulates the activation of p53 by depleting nucleolar factors involved in rRNA transcription or rRNA processing. Nucleolar RNA content decreased when rRNA transcription was inhibited. In parallel with the reduced levels of nucleolar RNA content, the nucleolar protein Myb-binding protein 1 A (MYBBP1A) translocated to the nucleoplasm and increased p53 acetylation. The acetylated p53 enhanced p21 and BAX expression and induced apoptosis. In contrast, when rRNA processing was inhibited, MYBBP1A remained in the nucleolus and nonacetylated p53 accumulated, causing cell cycle arrest at the G1 phase by inducing p21 but not BAX. We propose that the nucleolus functions as a stress sensor to modulate p53 protein levels and its acetylation status, determining cell fate between cell cycle arrest and apoptosis by regulating MYBBP1A translocation. PMID:26044764

  11. Ureaplasma urealyticum continuous ambulatory peritoneal dialysis-associated peritonitis diagnosed by 16S rRNA gene PCR.

    PubMed

    Yager, Jessica E; Ford, Emily S; Boas, Zachary P; Haseley, Leah A; Cookson, Brad T; Sengupta, Dhruba J; Fang, Ferric C; Gottlieb, Geoffrey S

    2010-11-01

    In some patients with peritonitis complicating continuous ambulatory peritoneal dialysis (CAPD), a causative organism is never identified. We report a case of Ureaplasma urealyticum CAPD-associated peritonitis diagnosed by 16S rRNA gene PCR. Ureaplasma may be an underrecognized cause of peritonitis because it cannot be recovered using routine culture methods. PMID:20739488

  12. Sequence requirements for maturation of the 5' terminus of human 18 S rRNA in vitro.

    PubMed

    Yu, Y T; Nilsen, T W

    1992-05-01

    Creation of the mature 5' terminus of human 18 S rRNA in vitro occurs via a two-step processing reaction. In the first step, an endonucleolytic activity found in HeLa cell nucleolar extract cleaves an rRNA precursor spanning the external transcribed spacer-18 S boundary at a position 3 bases upstream from the mature 18 S terminus leaving 2',3'-cyclic phosphate, 5' hydroxyl termini. In the second step, a nucleolytic activity(s) found in HeLa cell cytoplasmic extract removes the 3 extra bases and creates the authentic 5'-phosphorylated terminus of 18 S rRNA. Here we have examined the sequence requirements for the trimming reaction. The trimming activity(s), in addition to requiring a 5' hydroxyl terminus, prefers the naturally occurring adenosine as the 5'-terminal base. By a combination of deletion, site-directed mutagenesis, and chemical modification interference approaches we have also identified a region of 18 S rRNA spanning bases +6 to +25 (with respect to the mature 5' end) which comprises a critical recognition sequence for the trimming activity(s). PMID:1577760

  13. Complication of Corticosteroid Treatment by Acute Plasmodium malariae Infection Confirmed by Small-Subunit rRNA Sequencing▿

    PubMed Central

    To, Kelvin K. W.; Teng, Jade L. L.; Wong, Samson S. Y.; Ngan, Antonio H. Y.; Yuen, Kwok-Yung; Woo, Patrick C. Y.

    2010-01-01

    We report a case of acute Plasmodium malariae infection complicating corticosteroid treatment for membranoproliferative glomerulonephritis in a patient from an area where P. malariae infection is not endemic. A peripheral blood smear showed typical band-form trophozoites compatible with P. malariae or Plasmodium knowlesi. SSU rRNA sequencing confirmed the identity to be P. malariae. PMID:20739487

  14. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei.

    PubMed

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit

    2016-01-01

    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts. PMID:27142987

  15. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and relevance to genomovar assignment

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Flavobacterium columnare is the causative agent of columnaris disease which severely impacts channel catfish production in the USA and may be emerging as an important pathogen in the rainbow trout industry. The 16S rRNA gene is a housekeeping gene commonly used for bacterial taxonomy and genotyping...

  16. Improved HF183 quantitative real-time PCR assay for characterization of human fecal pollution in ambient surface water samples.

    PubMed

    Green, Hyatt C; Haugland, Richard A; Varma, Manju; Millen, Hana T; Borchardt, Mark A; Field, Katharine G; Walters, William A; Knight, R; Sivaganesan, Mano; Kelty, Catherine A; Shanks, Orin C

    2014-05-01

    Quantitative real-time PCR (qPCR) assays that target the human-associated HF183 bacterial cluster within members of the genus Bacteroides are among the most widely used methods for the characterization of human fecal pollution in ambient surface waters. In this study, we show that a current TaqMan HF183 qPCR assay (HF183/BFDrev) routinely forms nonspecific amplification products and introduce a modified TaqMan assay (HF183/BacR287) that alleviates this problem. The performance of each qPCR assay was compared in head-to-head experiments investigating limits of detection, analytical precision, predicted hybridization to 16S rRNA gene sequences from a reference database, and relative marker concentrations in fecal and sewage samples. The performance of the modified HF183/BacR287 assay is equal to or improves upon that of the original HF183/BFDrev assay. In addition, a qPCR chemistry designed to combat amplification inhibition and a multiplexed internal amplification control are included. In light of the expanding use of PCR-based methods that rely on the detection of extremely low concentrations of DNA template, such as qPCR and digital PCR, the new TaqMan HF183/BacR287 assay should provide more accurate estimations of human-derived fecal contaminants in ambient surface waters. PMID:24610857

  17. Three dimensional colorimetric assay assemblies

    SciTech Connect

    Charych, D.; Reichart, A.

    2000-06-27

    A direct assay is described using novel three-dimensional polymeric assemblies which change from a blue to red color when exposed to an analyte, in one case a flu virus. The assemblies are typically in the form of liposomes which can be maintained in a suspension, and show great intensity in their color changes. Their method of production is also described.

  18. Three dimensional colorimetric assay assemblies

    DOEpatents

    Charych, Deborah; Reichart, Anke

    2000-01-01

    A direct assay is described using novel three-dimensional polymeric assemblies which change from a blue to red color when exposed to an analyte, in one case a flu virus. The assemblies are typically in the form of liposomes which can be maintained in a suspension, and show great intensity in their color changes. Their method of production is also described.

  19. Biochemical Assays of Cultured Cells

    NASA Technical Reports Server (NTRS)

    Barlow, G. H.

    1985-01-01

    Subpopulations of human embryonic kidney cells isolated from continuous flow electrophoresis experiments performed at McDonnell Douglas and on STS-8 have been analyzed. These analyses have included plasminogen activator assays involving indirect methodology on fibrin plated and direct methodology using chromogenic substrates. Immunological studies were performed and the conditioned media for erythropoietin activity and human granulocyte colony stimulating (HGCSF) activity was analyzed.

  20. An improved choline monooxygenase assay

    SciTech Connect

    Lafontaine, P.J.; Hanson, A.D. )

    1991-05-01

    Glycine betaine accumulates in leaves of plants from several angiosperm families in response to drought or salinization. Its synthesis, from the oxidation of choline, is mediated by a two step pathway. In spinach the first enzyme of this pathway is a ferredoxin-dependent choline monooxygenase (CMO). In order to purify this enzyme a sensitive and reliable assay is necessary. Two types of modifications were explored to improve the existing assay. (1) Ferredoxin reduction - one way of providing reduced Fd to CMO is by the addition of isolated spinach thylakoids in the assay mixture. In order to optimize the reduction of Fd two different systems were compared: (a) where only PS is active, by adding DCMU to inhibit electron transport from PS II and DAD as electron donor for PS I; (b) where both PS II and PS I are active. (2) Betaine aldehyde estimation - to simplify this, it is possible to couple the CMO reaction with betaine aldehyde dehydrogenase (BADH) from E. coli. BADH converts betaine aldehyde to betaine as it is formed in the assay, eliminating the need for a chemical oxidation step.