Science.gov

Sample records for 5s rrna assay

  1. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  2. Direct 5S rRNA assay for monitoring mixed-culture bioprocesses

    SciTech Connect

    Stoner, D.L.; Bulmer, D.K.; Ward, T.E.

    1996-06-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis in denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the general Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. 40 refs., 12 figs., 1 tab.

  3. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  4. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  5. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  6. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  7. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  8. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  9. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  10. Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA.

    PubMed

    Bullerwell, Charles E; Schnare, Murray N; Gray, Michael W

    2003-03-01

    Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.

  11. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  12. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    PubMed

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level.

  13. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  14. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    PubMed

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis.

  15. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  16. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  17. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

    2001-01-01

    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  18. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  19. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    PubMed

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  20. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    PubMed

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  1. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    PubMed

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  2. Identification of the gene encoding the 5S ribosomal RNA maturase in Bacillus subtilis: mature 5S rRNA is dispensable for ribosome function.

    PubMed Central

    Condon, C; Brechemier-Baey, D; Beltchev, B; Grunberg-Manago, M; Putzer, H

    2001-01-01

    Over 25 years ago, Pace and coworkers described an activity called RNase M5 in Bacillus subtilis cell extracts responsible for 5S ribosomal RNA maturation (Sogin & Pace, Nature, 1974, 252:598-600). Here we show that RNase M5 is encoded by a gene of previously unknown function that is highly conserved among the low G + C gram-positive bacteria. We propose that the gene be named rnmV. The rnmV gene is nonessential. B. subtilis strains lacking RNase M5 do not make mature 5S rRNA, indicating that this process is not necessary for ribosome function. 5S rRNA precursors can, however, be found in both free and translating ribosomes. In contrast to RNase E, which cleaves the Escherichia coli 5S precursor in a single-stranded region, which is then trimmed to yield mature 5S RNA, RNase M5 cleaves the B. subtilis equivalent in a double-stranded region to yield mature 5S rRNA in one step. For the most part, eubacteria contain one or the other system for 5S rRNA production, with an imperfect division along gram-negative and gram-positive lines. A potential correlation between the presence of RNase E or RNase M5 and the single- or double-stranded nature of the predicted cleavage sites is explored. PMID:11233981

  3. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria.

    PubMed

    Smirnov, Alexandre; Tarassov, Ivan; Mager-Heckel, Anne-Marie; Letzelter, Michel; Martin, Robert P; Krasheninnikov, Igor A; Entelis, Nina

    2008-04-01

    RNA import into mitochondria is a widespread phenomenon. Studied in details for yeast, protists, and plants, it still awaits thorough investigation for human cells, in which the nuclear DNA-encoded 5S rRNA is imported. Only the general requirements for this pathway have been described, whereas specific protein factors needed for 5S rRNA delivery into mitochondria and its structural determinants of import remain unknown. In this study, a systematic analysis of the possible role of human 5S rRNA structural elements in import was performed. Our experiments in vitro and in vivo show that two distinct regions of the human 5S rRNA molecule are needed for its mitochondrial targeting. One of them is located in the proximal part of the helix I and contains a conserved uncompensated G:U pair. The second and most important one is associated with the loop E-helix IV region with several noncanonical structural features. Destruction or even destabilization of these sites leads to a significant decrease of the 5S rRNA import efficiency. On the contrary, the beta-domain of the 5S rRNA was proven to be dispensable for import, and thus it can be deleted or substituted without affecting the 5S rRNA importability. This finding was used to demonstrate that the 5S rRNA can function as a vector for delivering heterologous RNA sequences into human mitochondria. 5S rRNA-based vectors containing a substitution of a part of the beta-domain by a foreign RNA sequence were shown to be much more efficiently imported in vivo than the wild-type 5S rRNA.

  4. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    PubMed

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA.

  5. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  6. Release of ribosome-bound 5S rRNA upon cleavage of the phosphodiester bond between nucleotides A54 and A55 in 5S rRNA.

    PubMed

    Holmberg, L; Nygård, O

    2000-11-01

    Reticulocyte lysates contain ribosome-bound and free populations of 5S RNA. The free population is sensitive to nuclease cleavage in the internal loop B, at the phosphodiester bond connecting nucleotides A54 and A55. Similar cleavage sites were detected in 5S rRNA in 60S subunits and 80S ribosomes. However, 5S rRNA in reticulocyte polysomes is insensitive to cleavage unless ribosomes are salt-washed. This suggests that a translational factor protects the backbone surrounding A54 from cleavage in polysomes. Upon nuclease treatment of mouse 60S subunits or reticulocyte lysates a small population of ribosomes released its 5S rRNA together with ribosomal protein L5. Furthermore, rRNA sequences from 5.8S, 28S and 18S rRNA were released. In 18S rRNA the sequences mainly originate from the 630 loop and stem (helix 18) in the 5' domain, whereas in 28S rRNA a majority of fragments is derived from helices 47 and 81 in domains III and V, respectively. We speculate that this type of rRNA-fragmentation may mimic a ribosome degradation pathway.

  7. Triphosphate residues at the 5' ends of rRNA precursor and 5S RNA from Dictyostelium discoideum.

    PubMed Central

    Batts-Young, B; Lodish, H F

    1978-01-01

    We present here direct evidence for the preservation of a transcriptional initiation sequence in a eukaryotic rRNA precursor: the 5'-end group for precursor to 17S rRNA (p17S RNA) from Dictyostelium discoideum is identified as the triphosphate residue pppA-. We also show that mature 5S RNA form Dictyostelium bears a different triphosphate residue, pppG-. In contrast, we find no evidence for more than one phosphate at the 5' end of the 25S rRNA precursor (p25S RNA). These observations indicate that synthesis of the large ribosomal RNAs of Dictyostelium begins with the 5'-terminal sequence of the p17S RNA, and that 5S RNA transcription must be initiated independently, despite the close association of the 5S and rRNA coding segments. Images PMID:204930

  8. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  9. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    PubMed

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  10. Seasonal dynamics of bacterioplankton community structure in a eutrophic lake as determined by 5S rRNA analysis.

    PubMed

    Höfle, M G; Haas, H; Dominik, K

    1999-07-01

    Community structure of bacterioplankton was studied during the major growth season for phytoplankton (April to October) in the epilimnion of a temperate eutrophic lake (Lake Plusssee, northern Germany) by using comparative 5S rRNA analysis. Estimates of the relative abundances of single taxonomic groups were made on the basis of the amounts of single 5S rRNA bands obtained after high-resolution electrophoresis of RNA directly from the bacterioplankton. Full-sequence analysis of single environmental 5S rRNAs enabled the identification of single taxonomic groups of bacteria. Comparison of partial 5S rRNA sequences allowed the detection of changes of single taxa over time. Overall, the whole bacterioplankton community showed two to eight abundant (>4% of the total 5S rRNA) taxa. A distinctive seasonal succession was observed in the taxonomic structure of this pelagic community. A rather-stable community structure, with seven to eight different taxonomic units, was observed beginning in April during the spring phytoplankton bloom. A strong reduction in this diversity occurred at the beginning of the clear-water phase (early May), when only two to four abundant taxa were observed, with one taxon dominating (up to 72% of the total 5S rRNA). The community structure during summer stagnation (June and July) was characterized by frequent changes of different dominating taxa. During late summer, a dinoflagellate bloom (Ceratium hirudinella) occurred, with Comamonas acidovorans (beta-subclass of the class Proteobacteria) becoming the dominant bacterial species (average abundance of 43% of the total 5S rRNA). Finally, the seasonal dynamics of the community structure of bacterioplankton were compared with the abundances of other major groups of the aquatic food web, such as phyto- and zooplankton, revealing that strong grazing pressure by zooplankton can reduce microbial diversity substantially in pelagic environments.

  11. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  12. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  13. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  14. Characterization of a novel association between two trypanosome-specific proteins and 5S rRNA.

    PubMed

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC.

  15. Chromosomal localization of 5S rRNA gene loci and the implications for relationships within the Allium complex.

    PubMed

    Lee, S H; Do, G S; Seo, B B

    1999-01-01

    Chromosomal localizations and distribution patterns of the 5S rRNA genes by means of fluorescence in-situ hybridization in diploid Allium species could help to classify species into chromosome types and aid in determining relationships among genomes. All eleven diploid species were classified into five types, A to E. Species of type A showed a pair of 5S rRNA signals on the short arm of chromosome 5 and two pairs of signals on both arms of chromosome 7. Species of types B and C showed one pair and two pairs of signals on the short arm of chromosome 7, respectively. Type D species showed two pairs of signals on the satellite region of the short arm and a pair of signals on the long arm of chromosome 7. Type E species showed three distinct 5S rRNA gene loci signals on the short arm of chromosome 7. Information on chromosomal localization of 5S rRNA gene loci and distribution patterns within chromosomes in diploid Allium species could help to infer the pathway of origin of the three kinds of alloploid species. Data indicate that A. wakegi is an allopolyploid with genomes of types B and C, and A. deltoide-fistulosum is an allotetraploid derived from a natural hybridization between different species within chromosome type A. Results indicate that A. senescens is an allopolyploid with type B chromosomes and an unidentified chromosomal type. PMID:10328620

  16. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  17. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  18. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed Central

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-01-01

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  19. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period.

  20. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  1. Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

    PubMed Central

    Carol, P; Rozier, C; Lazaro, E; Ballesta, J P; Mache, R

    1993-01-01

    The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain. Images PMID:8441674

  2. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  3. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    PubMed

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  4. A 5 S rRNA gene is present in the mitochondrial genome of the protist Reclinomonas americana but is absent from red algal mitochondrial DNA.

    PubMed

    Lang, B F; Goff, L J; Gray, M W

    1996-09-01

    Except in the case of land plants, mitochondrial ribosomes apparently lack a 5 S rRNA species, even though this small RNA is a component of all prokaryotic, chloroplast and eukaryotic cytosol ribosomes. In plants, the mitochondrial 5 S rRNA is encoded by mtDNA and differs in sequence from the 5 S rRNA specified by plant nuclear and chloroplast genomes. A distinctive 5 S rRNA component has not been found in the mitochondrial ribosomes of non-plant eukaryotes and, with the notable exception of the chlorophycean alga, Prototheca wickerhamii, a 5 S rRNA gene has not been identified in those non-plant mtDNAs characterized to date. Here, we report the presence of a 5 S rRNA gene in the mtDNA of the heterotrophic flagellate Reclinomonas americana. This unicellular eukaryote is a member of the jakobid flagellates, an early-diverging group of protists that share ultrastructural characteristics with the retortamonads, primitive protists that lack mitochondria. We report sequence data from the mtDNAs of the red algae Porphyra purpurea and Gracilariopsis lemaneiformis, which we use to evaluate a recent claim that a 5 S rRNA gene exists in the mtDNA of a third rhodophyte alga, Chondrus crispus. Our results lead us to the opposite conclusion: that a 5 S rRNA gene is not encoded by red algal mtDNA. In view of the accumulating evidence favoring a monophyletic origin of the mitochondrial genome, it is likely that a 5 S rRNA gene was present in an ancestral proto-mitochondrial genome, and that contemporary mtDNA-encoded 5 S rRNA genes have all descended from this ancestral gene. Considering the highly restricted phylogenetic distribution of identified mtDNA-encoded 5 S rRNA genes, it follows that the mitochondrial 5 S rRNA gene must have been lost multiple times during evolutionary diversification of the eukaryotic lineage.

  5. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  6. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    PubMed

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends.

  7. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment. PMID:22724546

  8. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

  9. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    PubMed

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  10. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  11. What does the 5S rRNA multigene family tell us about the origin of the annual Triticeae (Poaceae)?

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2013-05-01

    We have investigated the complex relationships among the annual genera within the tribe Triticeae through phylogenetic analyses of the 5S rRNA multigene family. Cloned sequences were assigned to groups of orthologous sequences, called unit classes, that were subjected to several analyses including BLAST (Basic Local Alignment Search Tool) searches to assess possible ancestral relationships with perennial genera; phylogenetic analyses using parsimony (Pars), maximum likelihood (ML), and Bayesian methods; and minimum reticulation networks from the Pars, ML, and Bayesian trees. In this study, we included genera with both annual and perennial species, such as Dasypyrum, Hordeum, and Secale. BLAST pointed to Pseudoroegneria (carrier of the St genome) and possibly Thinopyrum (carrier of the J genome) as the potential next of kin. However, Thinopyrum and Pseudoroegneria have never fallen together on the individual trees with the former generally associated with Crithopsis, Aegilops, Triticum, and Dasypyrum, while the latter is usually associated with the rest of the genera within Triticeae. The "long" unit classes placed Dasypyrum breviaristatum together with Dasypyrum villosum, whereas the "short" unit classes put them far apart on the trees. None of the gene trees alone was able to summarize the complex relationships among the genera, in line with previous results in the Triticeae. However, the application of tools designed to display phylogenetic networks was able to depict the complex links among the genera based on the short and the long gene trees, including the close link between Thinopyrum and Pseudoroegneria suggested by the phylogenetic analyses. In addition, our analyses provide support for the hypothesis that at least some annual Triticeae taxa are derived from their perennial relatives. PMID:23789993

  12. A novel association between two trypanosome-specific factors and the conserved L5-5S rRNA complex.

    PubMed

    Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis.

  13. Natural Microbial Community Compositions Compared by a Back-Propagating Neural Network and Cluster Analysis of 5S rRNA

    PubMed Central

    Noble, P. A.; Bidle, K. D.; Fletcher, M.

    1997-01-01

    The community compositions of free-living and particle-associated bacteria in the Chesapeake Bay estuary were analyzed by comparing banding patterns of stable low-molecular-weight RNA (SLMW RNA) which include 5S rRNA and tRNA molecules. By analyzing images of autoradiographs of SLMW RNAs on polyacrylamide gels, band intensities of 5S rRNA were converted to binary format for transmission to a back-propagating neural network (NN). The NN was trained to relate binary input to sample stations, collection times, positions in the water column, and sample types (e.g., particle-associated versus free-living communities). Dendrograms produced by using Euclidean distance and average and Ward's linkage methods on data of three independently trained NNs yielded the following results. (i) Community compositions of Chesapeake Bay water samples varied both seasonally and spatially. (ii) Although there was no difference in the compositions of free-living and particle-associated bacteria in the summer, these community types differed significantly in the winter. (iii) In the summer, most bay samples had a common 121-nucleotide 5S rRNA molecule. Although this band occurred in the top water of midbay samples, it did not occur in particle-associated communities of bottom-water samples. (iv) Regardless of the season, midbay samples had the greatest variety of 5S rRNA sizes. The utility of NNs for interpreting complex banding patterns in electrophoresis gels was demonstrated. PMID:16535593

  14. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  15. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    PubMed

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  16. Interaction of ribosomal proteins S5, S6, S11, S12, S18 and S21 with 16 S rRNA.

    PubMed

    Stern, S; Powers, T; Changchien, L M; Noller, H F

    1988-06-20

    We have examined the effects of assembly of ribosomal proteins S5, S6, S11, S12, S18 and S21 on the reactivities of residues in 16 S rRNA towards chemical probes. The results show that S6, S18 and S11 interact with the 690-720 and 790 loop regions of 16 S rRNA in a highly co-operative manner, that is consistent with the previously defined assembly map relationships among these proteins. The results also indicate that these proteins, one of which (S18) has previously been implicated as a component of the ribosomal P-site, interact with residues near some of the recently defined P-site (class II tRNA protection) nucleotides in 16 S rRNA. In addition, assembly of protein S12 has been found to result in the protection of residues in both the 530 stem/loop and the 900 stem regions; the latter group is closely juxtaposed to a segment of 16 S rRNA recently shown to be protected from chemical probes by streptomycin. Interestingly, both S5 and S12 appear to protect, to differing degrees, a well-defined set of residues in the 900 stem/loop and 5'-terminal regions. These observations are discussed in terms of the effects of S5 and S12 on streptomycin binding, and in terms of the class III tRNA protection found in the 900 stem of 16 S rRNA. Altogether these results show that many of the small subunit proteins, which have previously been shown to be functionally important, appear to be associated with functionally implicated segments of 16 S rRNA.

  17. Species identification of Crassostrea and Ostrea oysters by polymerase chain reaction amplification of the 5S rRNA gene.

    PubMed

    Cross, Ismael; Rebordinos, Laureana; Diaz, Edgardo

    2006-01-01

    A specific multiplex polymerase chain reaction (PCR) was developed for the identification of Crassostrea angulata, C. gigas, Ostrea edulis, and O. stentina oyster species. Universal primers were used for the amplification of complete repetition units of 5S rDNA in each of the 4 species. The alignment of the obtained sequences was the basis for the specific design of species-specific primers (ED1, ED2, ST1, ST2, CR1, and CR2) located in the nontranscribed spacer regions. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed identification of Crassostrea and Ostrea species. A multiplex PCR with a set of the 6 designed primers showed that they did not interfere with each other and bound specifically to the DNA target. This genetic marker can be very useful for traceability of the species, application in the management of oyster cultures, and conservation of the genetic resources of the species. PMID:16512239

  18. Cocrystallizing natural RNA with its unnatural mirror image: biochemical and preliminary X-ray diffraction analysis of a 5S rRNA A-helix racemate

    SciTech Connect

    Förster, Charlotte; Brauer, Arnd B. E.; Lehmann, Daniel; Borowski, Tordis; Brode, Svenja; Fürste, Jens P.; Perbandt, Markus; Betzel, Christian

    2007-10-01

    A 5S rRNA A-helix 7-mer oligonucleotide was chemically synthesized both as d-RNA and as l-RNA, biochemically investigated, crystallized as a stochiometric racemate and examined by X-ray diffraction. Chemically synthesized RNAs with the unnatural l-configuration possess enhanced in vivo stability and nuclease resistance, which is a highly desirable property for pharmacological applications. For a structural comparison, both l- and d-RNA oligonucleotides of a shortened Thermus flavus 5S rRNA A-helix were chemically synthesized. The enantiomeric RNA duplexes were stochiometrically cocrystallized as a racemate, which enabled analysis of the d- and l-RNA enantiomers in the same crystals. In addition to a biochemical investigation, diffraction data were collected to 3.0 Å resolution using synchrotron radiation. The crystals belonged to space group P3{sub 1}21, with unit-cell parameters a = b = 35.59, c = 135.30 Å, γ = 120° and two molecules per asymmetric unit.

  19. Diagnostic assay for Helicobacter hepaticus based on nucleotide sequence of its 16S rRNA gene.

    PubMed Central

    Battles, J K; Williamson, J C; Pike, K M; Gorelick, P L; Ward, J M; Gonda, M A

    1995-01-01

    Conserved primers were used to PCR amplify 95% of the Helicobacter hepaticus 16S rRNA gene. Its sequence was determined and aligned to those of related bacteria, enabling the selection of primers to highly diverged regions of the 16S rRNA gene and an oligonucleotide probe for the development of a PCR-liquid hybridization assay. This assay was shown to be both sensitive and specific for H. hepaticus 16S rRNA gene sequences. PMID:7542270

  20. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  1. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

  2. Regulation of the rplY gene encoding 5S rRNA binding protein L25 in Escherichia coli and related bacteria.

    PubMed

    Aseev, Leonid V; Bylinkina, Natalia S; Boni, Irina V

    2015-05-01

    Ribosomal protein (r-protein) L25 is one of the three r-proteins (L25, L5, L18) that interact with 5S rRNA in eubacteria. Specific binding of L25 with a certain domain of 5S r-RNA, a so-called loop E, has been studied in detail, but information about regulation of L25 synthesis has remained totally lacking. In contrast to the rplE (L5) and rplR (L18) genes that belong to the polycistronic spc-operon and are regulated at the translation level by r-protein S8, the rplY (L25) gene forms an independent transcription unit. The main goal of this work was to study the regulation of the rplY expression in vivo. We show that the rplY promoter is down-regulated by ppGpp and its cofactor DksA in response to amino acid starvation. At the level of translation, the rplY expression is subjected to the negative feedback control. The 5'-untranslated region of the rplY mRNA comprises specific sequence/structure features, including an atypical SD-like sequence, which are highly conserved in a subset of gamma-proteobacterial families. Despite the lack of a canonical SD element, the rplY'-'lacZ single-copy reporter showed unusually high translation efficiency. Expression of the rplY gene in trans decreased the translation yield, indicating the mechanism of autogenous repression. Site-directed mutagenesis of the rplY 5' UTR revealed an important role of the conserved elements in the translation control. Thus, the rplY expression regulation represents one more example of regulatory pathways that control ribosome biogenesis in Escherichia coli and related bacteria.

  3. Mutations in TFIIIA that increase stability of the TFIIIA-5 S rRNA gene complex: unusual effects on the kinetics of complex assembly and dissociation.

    PubMed

    Brady, Kristina L; Ponnampalam, Stephen N; Bumbulis, Michael J; Setzer, David R

    2005-07-22

    We have identified four mutations in Xenopus TFIIIA that increase the stability of TFIIIA-5 S rRNA gene complexes. In each case, the mutation has a relatively modest effect on equilibrium binding affinity. In three cases, these equilibrium binding effects can be ascribed primarily to decreases in the rate constant for protein-DNA complex dissociation. In the fourth case, however, a substitution of phenylalanine for the wild-type leucine at position 148 in TFIIIA results in much larger compensating changes in the kinetics of complex assembly and dissociation. The data support a model in which a relatively unstable population of complexes with multi-component dissociation kinetics forms rapidly; complexes then undergo a slow conformational change that results in very stable, kinetically homogeneous TFIIIA-DNA complexes. The L148F mutant protein acts as a particularly potent transcriptional activator when it is fused to the VP16 activation domain and expressed in yeast cells. Substitution of L148 to tyrosine or tryptophan produces an equally strong transcriptional activator. Substitution to histidine results in genetic and biochemical effects that are more modest than, but similar to, those observed with the L148F mutation. We propose that an amino acid with a planar side chain at position 148 can intercalate between adjacent base pairs in the intermediate element of the 5 S rRNA gene. Intercalation occurs slowly but results in a very stable DNA-protein complex. These results suggest that transcriptional activation by a cis-acting sequence element is largely dependent on the kinetic, rather than the thermodynamic, stability of the complex formed with an activator protein. Thus, transcriptional activation is dependent in large part on the lifetime of the activator-DNA complex rather than on binding site occupancy at steady state. Introduction of intercalating amino acids into zinc finger proteins may be a useful tool for producing artificial transcription factors with

  4. Regulation of the rplY gene encoding 5S rRNA binding protein L25 in Escherichia coli and related bacteria

    PubMed Central

    Aseev, Leonid V.; Bylinkina, Natalia S.; Boni, Irina V.

    2015-01-01

    Ribosomal protein (r-protein) L25 is one of the three r-proteins (L25, L5, L18) that interact with 5S rRNA in eubacteria. Specific binding of L25 with a certain domain of 5S r-RNA, a so-called loop E, has been studied in detail, but information about regulation of L25 synthesis has remained totally lacking. In contrast to the rplE (L5) and rplR (L18) genes that belong to the polycistronic spc-operon and are regulated at the translation level by r-protein S8, the rplY (L25) gene forms an independent transcription unit. The main goal of this work was to study the regulation of the rplY expression in vivo. We show that the rplY promoter is down-regulated by ppGpp and its cofactor DksA in response to amino acid starvation. At the level of translation, the rplY expression is subjected to the negative feedback control. The 5′-untranslated region of the rplY mRNA comprises specific sequence/structure features, including an atypical SD-like sequence, which are highly conserved in a subset of gamma-proteobacterial families. Despite the lack of a canonical SD element, the rplY’-‘lacZ single-copy reporter showed unusually high translation efficiency. Expression of the rplY gene in trans decreased the translation yield, indicating the mechanism of autogenous repression. Site-directed mutagenesis of the rplY 5′ UTR revealed an important role of the conserved elements in the translation control. Thus, the rplY expression regulation represents one more example of regulatory pathways that control ribosome biogenesis in Escherichia coli and related bacteria. PMID:25749694

  5. Cytogenetic characterization by in situ hybridization techniques and molecular analysis of 5S rRNA genes of the European hazelnut (Corylus avellana).

    PubMed

    Falistocco, E; Marconi, G

    2013-03-01

    The European hazelnut (Corylus avellana L.) is widespread in Europe, where it has been cultivated for centuries. Despite progress in genetics, most of the cytogenetic aspects of this species have been overlooked. The aim of this study was to fill in this gap and obtain basic information on the chromosome structure of this species. Karyomorphological analysis confirmed the chromosome number 2n = 22 and showed that, despite their apparent uniformity, the chromosomes could be separated into three groups of different size: large (L), medium (M), and small (S). As a first step towards the physical mapping of the hazelnut chromosomes, we applied FISH to localize the position of rRNA genes (rDNA). The sites of 45S and 5S rDNA enabled us to identify two chromosome pairs belonging, respectively, to the L and S groups. The self-GISH procedure revealed that repetitive DNA is concentrated in the pericentromeric regions of the chromosomes, as with other species with rather small genomes. The analysis of 5S rDNA repeats offered additional information on the hazelnut genome by obtaining the whole sequence of the transcribed region so far unpublished. The overall results constitute a substantial advance in hazelnut cytogenetics. Further investigation of other species of Corylus could be an effective approach to understanding the phylogenesis of the genus and resolving taxonomic problems.

  6. Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp.

    EPA Science Inventory

    Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

  7. Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells.

    PubMed

    Wang, Xinyu; Ren, Yanli; Wang, Zhiqiong; Xiong, Xiangyu; Han, Sichong; Pan, Wenting; Chen, Hongwei; Zhou, Liqing; Zhou, Changchun; Yuan, Qipeng; Yang, Ming

    2015-12-21

    5S rRNA plays an important part in ribosome biology and is over-expression in multiple cancers. In this study, we found that 5S rRNA is a direct target of miR-150 and miR-383 in esophageal squamous cell carcinoma (ESCC). Overexpression of miR-150 and miR-383 inhibited ESCC cell proliferation in vitro and in vivo. Moreover, 5S rRNA silencing by miR-150 and miR-383 might intensify rpL11-c-Myc interaction, which attenuated role of c-Myc as an oncogenic transcriptional factor and dysregulation of multiple c-Myc target genes. Taken together, our results highlight the involvement of miRNAs in ribosomal regulation during tumorigenesis.

  8. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides

    PubMed Central

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S.; McBee, Megan E.; Dedon, Peter C.

    2015-01-01

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. PMID:25539917

  9. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    PubMed

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria.

  10. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. PMID:25261903

  11. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps.

  12. Chromosomal localization of the 18S-28S and 5S rRNA genes and (TTAGGG)n sequences of butterfly lizards (Leiolepis belliana belliana and Leiolepis boehmei, Agamidae, Squamata).

    PubMed

    Srikulnath, Kornsorn; Uno, Yoshinobu; Matsubara, Kazumi; Thongpan, Amara; Suputtitada, Saowanee; Apisitwanich, Somsak; Nishida, Chizuko; Matsuda, Yoichi

    2011-10-01

    Chromosomal mapping of the butterfly lizards Leiolepis belliana belliana and L. boehmei was done using the 18S-28S and 5S rRNA genes and telomeric (TTAGGG)n sequences. The karyotype of L. b. belliana was 2n = 36, whereas that of L. boehmei was 2n = 34. The 18S-28S rRNA genes were located at the secondary constriction of the long arm of chromosome 1, while the 5S rRNA genes were found in the pericentromeric region of chromosome 6 in both species. Hybridization signals for the (TTAGGG)n sequence were observed at the telomeric ends of all chromosomes, as well as interstitially at the same position as the 18S-28S rRNA genes in L. boehmei. This finding suggests that in L. boehmei telomere-to-telomere fusion probably occurred between chromosome 1 and a microchromosome where the 18S-28S rRNA genes were located or, alternatively, at the secondary constriction of chromosome 1. The absence of telomeric sequence signals in chromosome 1 of L. b. belliana suggested that its chromosomes may have only a few copies of the (TTAGGG)n sequence or that there may have been a gradual loss of the repeat sequences during chromosomal evolution.

  13. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    PubMed

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes.

  14. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    PubMed

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes. PMID:26835745

  15. Molecular characterization and chromosomal mapping of the 5S rRNA gene in Solea senegalensis: a new linkage to the U1, U2, and U5 small nuclear RNA genes.

    PubMed

    Manchado, Manuel; Zuasti, Eugenia; Cross, Ismael; Merlo, Alejandro; Infante, Carlos; Rebordinos, Laureana

    2006-01-01

    Some units of the 5S rDNA of Solea senegalensis were amplified by PCR and sequenced. Three main PCR products (227, 441, and 2166 bp) were identified. The 227- and 441-bp fragments were characterized by highly divergent nontranscribed spacer sequences (referred to as NTS-I and NTS-II) that were 109 and 324 bp long, respectively, yet their coding sequences were nearly identical. The 2166-bp 5S rDNA unit was composed of two 5S rRNA genes separated by NTS-I and followed by a 1721-bp spacer containing the U2, U5, and U1 small nuclear RNA genes (snRNAs). They were inverted and arranged in the transcriptional direction opposite that of the 5S rRNA gene. This simultaneous linkage of 3 different snRNAs had never been observed before. The PCR products were used as probes in fluorescence in situ hybridization experiments to locate the corresponding loci on the chromosomes of S. senegalensis. A major 5S rDNA chromosomal site was located along most of the short arm of a submetacentric pair, while a minor site was detected near the centromeric region of an acrocentric pair.

  16. Bead Array Direct rRNA Capture Assay (rCapA) for Amplification Free Speciation of Mycobacterium Cultures

    PubMed Central

    de Ronde, Hans; González Alonso, Paula; van Soolingen, Dick; Klatser, Paul R.; Anthony, Richard M.

    2012-01-01

    Mycobacterium cultures, from patients suspected of tuberculosis or nontuberculous mycobacteria (NTM) infection, need to be identified. It is most critical to identify cultures belonging to the Mycobacterium tuberculosis complex, but also important to recognize clinically irrelevant or important NTM to allow appropriate patient management. Identification of M. tuberculosis can be achieved by a simple and cheap lateral flow assay, but identification of other Mycobacterium spp. generally requires more complex molecular methods. Here we demonstrate that a paramagnetic liquid bead array method can be used to capture mycobacterial rRNA in crude lysates of positive cultures and use a robust reader to identify the species in a direct and sensitive manner. We developed an array composed of paramagnetic beads coupled to oligonucleotides to capture 16 rRNA from eight specific Mycobacterium species and a single secondary biotinilated reporter probe to allow the captured rRNA to be detected. A ninth less specific bead and its associated reporter probe, designed to capture 23S rRNA from mycobacteria and related genera, is included as an internal control to confirm the presence of bacterial rRNA from a GC rich Gram variable genera. Using this rRNA capture assay (rCapA) with the array developed we were already able to confirm the presence of members of the M. tuberculosis complex and to discriminate a range of NTM species. This approach is not based on DNA amplification and therefore does not require precautions to avoid amplicon contamination. Moreover, the new generation of stable and cost effective liquid bead readers provides the necessary multiplexing potential to develop a robust and highly discriminatory assay. PMID:22396779

  17. Comparative calorimetric studies on the dynamic conformation of plant 5S rRNA. I. Thermal unfolding pattern of lupin seeds and wheat germ 5S rRNAs, also in the presence of magnesium and sperminium cations.

    PubMed Central

    Barciszewski, J; Bratek-Wiewiórowska, M D; Górnicki, P; Naskret-Barciszewska, M; Wiewiórowski, M; Zielenkiewicz, A; Zielenkiewicz, W

    1988-01-01

    An attempt has been made to correlate differential scanning calorimetry melting profiles of 5S rRNAs from lupin seeds (L.s.) and wheat germ (W.g.) with their structure. It is suggested that the observed differences in thermal unfolding are due to differences in RNA nucleotide sequence and as a consequence in higher order structures. Interesting effects induced by magnesium cation, perprotonated and permethylated sperminium tetracations are discussed. It is suggested that the difference in the stabilizing effect of the three cations results from different mode of their interactions with RNA. "Pure" electrostatic interactions expected for permethylated tetracations are rather weak due to the steric hindrance around each positively charged nitrogen atom. Electrostatic interactions of the other two cations are significantly enhanced by coordination bonding for magnesium and by hydrogen bonding for protonated sperminium cation. PMID:3340550

  18. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central

    2012-01-01

    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  19. Comparison of Gull Feces-specific Assays Targeting the 16S rRNA Gene of Catellicoccus Marimammalium and Streptococcus spp.

    EPA Science Inventory

    Two novel gull-specific qPCR assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR-green-based assay targeting Streptococcus spp. (i.e., gull3) and a TaqMan qPCR assay targeting Catellicoccus marimammalium (i.e., gull4). The main objectives ...

  20. Loop-mediated isothermal amplification assay for 16S rRNA methylase genes in Gram-negative bacteria.

    PubMed

    Nagasawa, Mitsuaki; Kaku, Mitsuo; Kamachi, Kazunari; Shibayama, Keigo; Arakawa, Yoshichika; Yamaguchi, Keizo; Ishii, Yoshikazu

    2014-10-01

    Using the loop-mediated isothermal amplification (LAMP) method, we developed a rapid assay for detection of 16S rRNA methylase genes (rmtA, rmtB, and armA), and investigated 16S rRNA methylase-producing strains among clinical isolates. Primer Explorer V3 software was used to design the LAMP primers. LAMP primers were prepared for each gene, including two outer primers (F3 and B3), two inner primers (FIP and BIP), and two loop primers (LF and LB). Detection was performed with the Loopamp DNA amplification kit. For all three genes (rmtA, rmtB, and armA), 10(2) copies/tube could be detected with a reaction time of 60 min. When nine bacterial species (65 strains saved in National Institute of Infectious Diseases) were tested, which had been confirmed to possess rmtA, rmtB, or armA by PCR and DNA sequencing, the genes were detected correctly in these bacteria with no false negative or false positive results. Among 8447 clinical isolates isolated at 36 medical institutions, the LAMP method was conducted for 191 strains that were resistant to aminoglycosides based on the results of antimicrobial susceptibility tests. Eight strains were found to produce 16S rRNA methylase (0.09%), with rmtB being identified in three strains (0.06%) of 4929 isolates of Enterobacteriaceae, rmtA in three strains (0.10%) of 3284 isolates of Pseudomonas aeruginosa, and armA in two strains (0.85%) of 234 isolates of Acinetobacter spp. At present, the incidence of strains possessing 16S rRNA methylase genes is very low in Japan. However, when Gram-negative bacteria showing high resistance to aminoglycosides are isolated by clinical laboratories, it seems very important to investigate the status of 16S rRNA methylase gene-harboring bacilli and monitor their trends among Japanese clinical settings.

  1. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  2. Rapid assay of A2058T-mutated 23S rRNA allelic profiles associated with high-level macrolide resistance in Moraxella catarrhalis.

    PubMed

    Saito, Ryoichi; Kasai, Ayako; Ogihara, Shinji; Yamada, Kageto; Tao, Kazuyuki

    2015-09-01

    We report on a restriction fragment-length polymorphism (HpyCH4III) assay for profile analysis of 23S rRNA gene A2058T-mutated alleles associated with high-level macrolide resistance in Moraxella catarrhalis. Our assay results were supported by DNA sequencing analysis, allowed for simultaneous testing of many strains, and produced results from pure-cultured colonies within 4 h.

  3. Development of quantitative PCR assays targeting the 16S rRNA genes of Enterococcus spp. and their application to the identification of enterococcus species in environmental samples.

    PubMed

    Ryu, Hodon; Henson, Michael; Elk, Michael; Toledo-Hernandez, Carlos; Griffith, John; Blackwood, Denene; Noble, Rachel; Gourmelon, Michèle; Glassmeyer, Susan; Santo Domingo, Jorge W

    2013-01-01

    The detection of environmental enterococci has been determined primarily by using culture-based techniques that might exclude some enterococcal species as well as those that are nonculturable. To address this, the relative abundances of enterococci were examined by challenging fecal and water samples against a currently available genus-specific assay (Entero1). To determine the diversity of enterococcal species, 16S rRNA gene-based group-specific quantitative PCR (qPCR) assays were developed and evaluated against eight of the most common environmental enterococcal species. Partial 16S rRNA gene sequences of 439 presumptive environmental enterococcal strains were analyzed to study further the diversity of enterococci and to confirm the specificities of group-specific assays. The group-specific qPCR assays showed relatively high amplification rates with targeted species (>98%), although some assays cross-amplified with nontargeted species (1.3 to 6.5%). The results with the group-specific assays also showed that different enterococcal species co-occurred in most fecal samples. The most abundant enterococci in water and fecal samples were Enterococcus faecalis and Enterococcus faecium, although we identified more water isolates as Enterococcus casseliflavus than as any of the other species. The prevalence of the Entero1 marker was in agreement with the combined number of positive signals determined by the group-specific assays in most fecal samples, except in gull feces. On the other hand, the number of group-specific assay signals was lower in all water samples tested, suggesting that other enterococcal species are present in these samples. While the results highlight the value of genus- and group-specific assays for detecting the major enterococcal groups in environmental water samples, additional studies are needed to determine further the diversity, distributions, and relative abundances of all enterococcal species found in water.

  4. Development of Quantitative PCR Assays Targeting the 16S rRNA Genes of Enterococcus spp. and Their Application to the Identification of Enterococcus Species in Environmental Samples

    PubMed Central

    Ryu, Hodon; Henson, Michael; Elk, Michael; Toledo-Hernandez, Carlos; Griffith, John; Blackwood, Denene; Noble, Rachel; Gourmelon, Michèle; Glassmeyer, Susan

    2013-01-01

    The detection of environmental enterococci has been determined primarily by using culture-based techniques that might exclude some enterococcal species as well as those that are nonculturable. To address this, the relative abundances of enterococci were examined by challenging fecal and water samples against a currently available genus-specific assay (Entero1). To determine the diversity of enterococcal species, 16S rRNA gene-based group-specific quantitative PCR (qPCR) assays were developed and evaluated against eight of the most common environmental enterococcal species. Partial 16S rRNA gene sequences of 439 presumptive environmental enterococcal strains were analyzed to study further the diversity of enterococci and to confirm the specificities of group-specific assays. The group-specific qPCR assays showed relatively high amplification rates with targeted species (>98%), although some assays cross-amplified with nontargeted species (1.3 to 6.5%). The results with the group-specific assays also showed that different enterococcal species co-occurred in most fecal samples. The most abundant enterococci in water and fecal samples were Enterococcus faecalis and Enterococcus faecium, although we identified more water isolates as Enterococcus casseliflavus than as any of the other species. The prevalence of the Entero1 marker was in agreement with the combined number of positive signals determined by the group-specific assays in most fecal samples, except in gull feces. On the other hand, the number of group-specific assay signals was lower in all water samples tested, suggesting that other enterococcal species are present in these samples. While the results highlight the value of genus- and group-specific assays for detecting the major enterococcal groups in environmental water samples, additional studies are needed to determine further the diversity, distributions, and relative abundances of all enterococcal species found in water. PMID:23087032

  5. Escherichia coli and Enterococcus spp. in rainwater tank samples: comparison of culture-based methods and 23S rRNA gene quantitative PCR assays.

    PubMed

    Ahmed, W; Richardson, K; Sidhu, J P S; Toze, S

    2012-10-16

    In this study, culture-based methods and quantitative PCR (qPCR) assays were compared with each other for the measurement of Escherichia coli and Enterococcus spp. in water samples collected from rainwater tanks in Southeast Queensland, Australia. Among the 50 rainwater tank samples tested, 26 (52%) and 46 (92%) samples yielded E. coli numbers as measured by EPA Method 1603 and E. coli 23S rRNA gene qPCR assay, respectively. Similarly, 49 (98%) and 47 (94%) samples yielded Enterococcus spp. numbers as measured by EPA Method 1600 and Enterococcus spp. 23S rRNA gene qPCR assay, respectively. The mean E. coli (2.49 ± 0.85) log(10) and Enterococcus spp. (2.72 ± 0.32) log(10) numbers as measured by qPCR assays were significantly (P < 0001) different than E. coli (0.91 ± 0.80) log(10) and Enterococcus spp. (1.86 ± 0.60) log(10) numbers as measured by culture-based method. Weak but significant correlations were observed between both EPA Method 1603 and the E. coli qPCR assay (r = 0.47, P = 0.0009), and EPA Method 1600 and the Enterococcus spp. qPCR assay (r = 0.42, P = 0.002). Good qualitative agreement was found between the culture-based method and the Enterococcus spp. qPCR assay in terms of detecting fecal pollution in water samples from the studied rainwater tanks. More research studies, however, are needed to shed some light on the discrepancies associated with the culture-based methods and qPCR assays for measuring fecal indicator bacteria.

  6. Loop-mediated isothermal amplification assay for detection of Histomonas meleagridis infection in chickens targeting the 18S rRNA sequences.

    PubMed

    Xu, Jinjun; Qu, Chanbao; Tao, Jianping

    2014-01-01

    Histomonas meleagridis is the causative agent of histomonosis, a disease of gallinaceous fowl characterized by necrotic typhlitis, hepatitis, and high mortality. To develop a rapid and sensitive method for specific detection of H. meleagridis, an assay based on loop-mediated isothermal amplification (LAMP) targeting the 18S rRNA gene was established. The detection limit of the LAMP assay was 10 copies for standard plasmids containing an 18S rRNA gene fragment, which was superior to that of a classical PCR method. Specificity tests revealed that there was no cross-reaction with other protozoa such as Trichomonas gallinae, Blastocytis sp, Tetratrichomonas gallinarum, Plasmodium gallinaceum, Toxoplasma gondii, Eimeria tenella, Leucocytozoon caulleryi and Leucocytozoon sabrazesi. The assay was evaluated for its diagnostic utility using liver and caeca samples collected from suspected field cases, the detection rate was 100 and 97.92%, respectively. These results indicate that the LAMP assay may be a useful tool for rapid detection and identification of H. meleagridis in poultry. PMID:24320623

  7. Comparison of Gull Feces-Specific Assays Targeting the 16S rRNA Genes of Catellicoccus marimammalium and Streptococcus spp.

    PubMed Central

    Ryu, Hodon; Griffith, John F.; Khan, Izhar U. H.; Hill, Stephen; Edge, Thomas A.; Toledo-Hernandez, Carlos; Gonzalez-Nieves, Joel

    2012-01-01

    Two novel gull-specific quantitative PCR (qPCR) assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR green assay targeting Streptococcus spp. (gull3) and a hydrolysis TaqMan assay targeting Catellicoccus marimammalium (gull4). The objectives of this study were to compare the host specificity of a previous C. marimammalium qPCR assay (gull2) with that of the new markers and to examine the presence of the three gull markers in environmental water samples from different geographic locations. Most of the gull fecal samples tested (n = 255) generated positive signals with the gull2 and gull4 assays (i.e., >86%), whereas only 28% were positive with gull3. Low prevalence and abundance of tested gull markers (0.6 to 15%) were observed in fecal samples from six nonavian species (n = 180 fecal samples), whereas the assays cross-reacted to some extent (13 to 31%) with other (nongull) avian fecal samples. The gull3 assay was positive against fecal samples from 11 of 15 avian species, including gull. Of the presumed gull-impacted water samples (n = 349), 86%, 59%, and 91% were positive with the gull2, the gull3, and the gull4 assays, respectively. Approximately 5% of 239 non-gull-impacted water samples were positive with the gull2 and the gull4 assays, whereas 21% were positive witg the gull3 assay. While the relatively high occurrence of gull2 and gull4 markers in waters impacted by gull feces suggests that these assays could be used in environmental monitoring studies, the data also suggest that multiple avian-specific assays will be needed to accurately assess the contribution of different avian sources in recreational waters. PMID:22226950

  8. PCR assay based on DNA coding for 16S rRNA for detection and identification of mycobacteria in clinical samples.

    PubMed Central

    Kox, L F; van Leeuwen, J; Knijper, S; Jansen, H M; Kolk, A H

    1995-01-01

    A PCR and a reverse cross blot hybridization assay were developed for the detection and identification of mycobacteria in clinical samples. The PCR amplifies a part of the DNA coding for 16S rRNA with a set of primers that is specific for the genus Mycobacterium and that flanks species-specific sequences within the genes coding for 16S rRNA. The PCR product is analyzed in a reverse cross blot hybridization assay with probes specific for M. tuberculosis complex (pTub1), M. avium (pAvi3), M. intracellulare (pInt5 and pInt7), M. kansasii complex-M. scrofulaceum complex (pKan1), M. xenopi (pXen1), M. fortuitum (pFor1), M. smegmatis (pSme1), and Mycobacterium spp. (pMyc5a). The PCR assay can detect 10 fg of DNA, the equivalent of two mycobacteria. The specificities of the probes were tested with 108 mycobacterial strains (33 species) and 31 nonmycobacterial strains (of 17 genera). The probes pAvi3, pInt5, pInt7, pKan1, pXen1, and pMyc5a were specific. With probes pTub1, pFor1, and pSme1, slight cross hybridization occurred. However, the mycobacterial strains from which the cross-hybridizing PCR products were derived belonged to nonpathogenic or nonopportunistic species which do not occur in clinical samples. The test was used on 31 different clinical specimens obtained from patients suspected of having mycobacterial disease, including a patient with a double mycobacterial infection. The samples included sputum, bronchoalveolar lavage, tissue biopsy samples, cerebrospinal fluid, pus, peritoneal fluid, pleural fluid, and blood. The results of the PCR assay agreed with those of conventional identification methods or with clinical data, showing that the test can be used for the direct and rapid detection and identification of mycobacteria in clinical samples. PMID:8586707

  9. Chaperoning 5S RNA assembly.

    PubMed

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit.

  10. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  11. Use of 18S rRNA Gene-Based PCR Assay for Diagnosis of Acanthamoeba Keratitis in Non-Contact Lens Wearers in India

    PubMed Central

    Pasricha, Gunisha; Sharma, Savitri; Garg, Prashant; Aggarwal, Ramesh K.

    2003-01-01

    Identification of Acanthamoeba cysts and trophozoites in ocular tissues requires considerable expertise and is often time-consuming. An 18S rRNA gene-based PCR test, highly specific for the genus Acanthamoeba, has recently been reported in the molecular diagnosis of Acanthamoeba keratitis. This PCR assay was compared with conventional microbiological tests for the diagnosis of Acanthamoeba keratitis. In a pilot study, the PCR conditions with modifications were first tested on corneal scrapings from patients with culture-proven non-contact lens-related Acanthamoeba, bacterial, and fungal keratitis. This was followed by testing of corneal scrapings from 53 consecutive cases of microbial keratitis to determine sensitivity, specificity, and predictive values of the assay. All corneal scrapings from patients with proven Acanthamoeba keratitis showed a 463-bp amplicon, while no amplicon was obtained from patients with bacterial or fungal keratitis. Some of these amplified products were sequenced and compared with EMBL database reference sequences to validate these to be of Acanthamoeba origin. Out of 53 consecutive cases of microbial keratitis included for evaluating the PCR, 10 (18.9%) cases were diagnosed as Acanthamoeba keratitis on the basis of combined results of culture, smear, and PCR of corneal scrapings. Based on culture results as the “gold standard,” the sensitivity of PCR was the same as that of the smear (87.5%); however, the specificity and the positive and negative predictive values of PCR were marginally higher than the smear examination (97.8 versus 95.6%, 87.5 versus 77.8%, and 97.8 versus 97.7%) although the difference was not significant. This study confirms the efficacy of the PCR assay and is the first study to evaluate a PCR-based assay against conventional methods of diagnosis in a clinical setting. PMID:12843065

  12. Real-Time Quantitative Broad-Range PCR Assay for Detection of the 16S rRNA Gene Followed by Sequencing for Species Identification

    PubMed Central

    Zucol, Franziska; Ammann, Roland A.; Berger, Christoph; Aebi, Christoph; Altwegg, Martin; Niggli, Felix K.; Nadal, David

    2006-01-01

    Here we determined the analytical sensitivities of broad-range real-time PCR-based assays employing one of three different genomic DNA extraction protocols in combination with one of three different primer pairs targeting the 16S rRNA gene to detect a panel of 22 bacterial species. DNA extraction protocol III, using lysozyme, lysostaphin, and proteinase K, followed by PCR with the primer pair Bak11W/Bak2, giving amplicons of 796 bp in length, showed the best overall sensitivity, detecting DNA of 82% of the strains investigated at concentrations of ≤102 CFU in water per reaction. DNA extraction protocols I and II, using less enzyme treatment, combined with other primer pairs giving shorter amplicons of 466 bp and 342 or 346 bp, respectively, were slightly more sensitive for the detection of gram-negative but less sensitive for the detection of gram-positive bacteria. The obstacle of detecting background DNA in blood samples spiked with bacteria was circumvented by introducing a broad-range hybridization probe, and this preserved the minimal detection limits observed in samples devoid of blood. Finally, sequencing of the amplicons generated using the primer pair Bak11W/Bak2 allowed species identification of the detected bacterial DNA. Thus, broad-spectrum PCR targeting the 16S rRNA gene in the quantitative real-time format can achieve an analytical sensitivity of 1 to 10 CFU per reaction in water, avoid detection of background DNA with the introduction of a broad-range probe, and generate amplicons that allow species identification of the detected bacterial DNA by sequencing. These prerequisites are important for its application to blood-containing patient samples. PMID:16891488

  13. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  14. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces.

  15. Comparison between a Broad-Range Real-Time and a Broad-Range End-Point PCR Assays for the Detection of Bacterial 16S rRNA in Clinical Samples.

    PubMed

    Meddeb, Mariam; Koebel, Christelle; Jaulhac, Benoît; Schramm, Frédéric

    2016-01-01

    Broad range PCR targeting the 16S rRNA gene is widely used to test clinical samples for the presence of bacterial DNA. End-point 16S PCR is both time-consuming and at high risk of cross-contamination. Prior to the replacement of the 16S end-point PCR assay routinely used in our clinical laboratory by a new 16S real-time PCR assay, we aimed to compare the performances of both techniques for the direct diagnosis of bacterial infections in clinical samples. In this prospective study, 129 clinical samples were included for direct comparison of both techniques. The sensitivity of 16S real-time PCR assay (76%) was significantly higher than that of end-point 16S PCR assay (41%) (p<0.01). Specificities of both PCR assays did not differ significantly (p=0.43). The 16S real-time PCR assay yielded an etiological diagnosis in 19% of culture-negative samples. It constitutes a reliable and complementary diagnostic tool to the bacterial culture.

  16. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  17. Development of a 16S-23S rRNA intergenic spacer-based quantitative PCR assay for improved detection and enumeration of Lactococcus garvieae.

    PubMed

    Thanh, Hien Dang; Park, Hee Kuk; Kim, Wonyong; Shin, Hyoung-Shik

    2013-02-01

    Lactococcus garvieae is an important foodborne pathogen causing lactococcosis associated with hemorrhagic septicemia in fish worldwide. A real-time quantitative polymerase chain reaction (qPCR) protocol targeting the 16S-23S rRNA intergenic spacer (ITS) region was developed for the detection and enum-eration of L. garvieae. The specificity was evaluated using genomic DNAs extracted from 66 cocci strains. Fourteen L. garvieae strains tested were positive, whereas 52 other strains including Lactococcus lactis ssp. lactis, Lactococcus lactis ssp. hordniae and Lactococcus lactis ssp. cremoris did not show a specific signal. The minimal limit of detection was 2.63 fg of purified genomic DNA, equivalent to 1 genome of L. garvieae. The optimized protocol was applied for the survey of L. garvieae in naturally contaminated fish samples. Our results suggest that the qPCR protocol using ITS is a sensitive and efficient tool for the rapid detection and enumeration of L. garvieae in fish and fish-containing foods.

  18. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  19. A Novel SimpleProbe PCR Assay for Detection of Mutations in the 23S rRNA Gene Associated with Macrolide Resistance in Mycoplasma genitalium in Clinical Samples

    PubMed Central

    Lysvand, Hilde; Pukstad, Brita; Nordbø, Svein Arne

    2016-01-01

    Macrolide-resistant strains of Mycoplasma genitalium are an increasing problem throughout the world, and the implementation of a rapid and sensitive assay for mutation detection to guide treatment is needed. Macrolide-resistant strains have been shown to contain base substitutions in positions 2058 and 2059 (Escherichia coli numbering) in region V of the 23S rRNA gene. In this study, we present a SimpleProbe PCR followed by melting curve analysis to differentiate between macrolide-resistant mutants and wild types. The assay was performed on 159 Mycoplasma genitalium-positive samples, and the results were compared with DNA sequencing. We also looked at the prevalence of macrolide-resistant strains in a Norwegian population. Of 139 samples characterized successfully by sequencing, 54 (39%) were wild types and 85 (61%) were mutants, consisting of 59 (42%) A2059G, 24 (17%) A2058G, 1 (1%) A2058T, and 1 (1%) A2059C mutation. The melting curve analysis correctly differentiated between wild-type and mutant strains in all cases, but it could not identify the different mutant types. The SimpleProbe PCR proved to be a simple, rapid, and reliable method for the detection of macrolide-resistant isolates of Mycoplasma genitalium in a clinical setting. PMID:27487958

  20. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    PubMed

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  1. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  2. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA.

  3. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.

    PubMed

    Rozier, C; Mache, R

    1984-10-11

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  4. Two sequence classes of kinetoplastid 5S ribosomal RNA gene revealed among bodonid spliced leader RNA gene arrays.

    PubMed

    Santana, D M; Lukes, J; Sturm, N R; Campbell, D A

    2001-11-13

    The spliced leader RNA genes of Bodo saltans, Cryptobia helicis and Dimastigella trypaniformis were analyzed as molecular markers for additional taxa within the suborder Bodonina. The non-transcribed spacer regions were distinctive for each organism, and 5S rRNA genes were present in Bodo and Dimastigella but not in C. helicis. Two sequence classes of 5S rRNA were evident from analysis of the bodonid genes. The two classes of 5S rRNA genes were found in other Kinetoplastids independent of co-localization with the spliced leader RNA gene.

  5. RAPID DETECTION OF MICROORGANISMS USING 5S RRNA SPECIFIC MOLECULAR BEACONS. (R825354)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  6. 5S RRNA GENE DELETIONS CAUSE AN UNEXPECTEDLY HIGH FITNESS LOSS IN ESCHERICHIA COLI. (R825354)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  7. Microbial identification by immunohybridization assay of artificial RNA labels

    NASA Technical Reports Server (NTRS)

    Kourentzi, Katerina D.; Fox, George E.; Willson, Richard C.

    2002-01-01

    Ribosomal RNA (rRNA) and engineered stable artificial RNAs (aRNAs) are frequently used to monitor bacteria in complex ecosystems. In this work, we describe a solid-phase immunocapture hybridization assay that can be used with low molecular weight RNA targets. A biotinylated DNA probe is efficiently hybridized in solution with the target RNA, and the DNA-RNA hybrids are captured on streptavidin-coated plates and quantified using a DNA-RNA heteroduplex-specific antibody conjugated to alkaline phosphatase. The assay was shown to be specific for both 5S rRNA and low molecular weight (LMW) artificial RNAs and highly sensitive, allowing detection of as little as 5.2 ng (0.15 pmol) in the case of 5S rRNA. Target RNAs were readily detected even in the presence of excess nontarget RNA. Detection using DNA probes as small as 17 bases targeting a repetitive artificial RNA sequence in an engineered RNA was more efficient than the detection of a unique sequence.

  8. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    PubMed

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  9. Abundant 5S rRNA-like transcripts encoded by the mitochondrial genome in amoebozoa.

    PubMed

    Bullerwell, Charles E; Burger, Gertraud; Gott, Jonatha M; Kourennaia, Olga; Schnare, Murray N; Gray, Michael W

    2010-05-01

    5S rRNAs are ubiquitous components of prokaryotic, chloroplast, and eukaryotic cytosolic ribosomes but are apparently absent from mitochondrial ribosomes (mitoribosomes) of many eukaryotic groups including animals and fungi. Nevertheless, a clearly identifiable, mitochondrion-encoded 5S rRNA is present in Acanthamoeba castellanii, a member of Amoebozoa. During a search for additional mitochondrial 5S rRNAs, we detected small abundant RNAs in other members of Amoebozoa, namely, in the lobose amoeba Hartmannella vermiformis and in the myxomycete slime mold Physarum polycephalum. These RNAs are encoded by mitochondrial DNA (mtDNA), cosediment with mitoribosomes in glycerol gradients, and can be folded into a secondary structure similar to that of bona fide 5S rRNAs. Further, in the mtDNA of another slime mold, Didymium nigripes, we identified a region that in sequence, potential secondary structure, and genomic location is similar to the corresponding region encoding the Physarum small RNA. A mtDNA-encoded small RNA previously identified in Dictyostelium discoideum is here shown to share several characteristics with known 5S rRNAs. Again, we detected genes encoding potential homologs of this RNA in the mtDNA of three other species of the genus Dictyostelium as well as in a related genus, Polysphondylium. Taken together, our results indicate a widespread occurrence of small, abundant, mtDNA-encoded RNAs with 5S rRNA-like structures that are associated with the mitoribosome in various amoebozoan taxa. Our working hypothesis is that these novel small abundant RNAs represent radically divergent mitochondrial 5S rRNA homologs. We posit that currently unrecognized 5S-like RNAs may exist in other mitochondrial systems in which a conventional 5S rRNA cannot be identified.

  10. TFIIIA binds to different domains of 5S RNA and the Xenopus borealis 5S RNA gene.

    PubMed Central

    Sands, M S; Bogenhagen, D F

    1987-01-01

    We have established the conditions for the reassociation of 5S RNA and TFIIIA to form 7S particles. We tested the ability of altered 5S RNAs to bind TFIIIA, taking advantage of the slower mobility of 7S particles compared with free 5S RNA in native polyacrylamide gels. Linker substitution mutants were constructed encompassing the entire gene, including the intragenic control region. In vitro transcripts of the linker substitution mutants were tested for their ability to bind TFIIIA to form 7S ribonucleoprotein particles. Altered 5S RNAs with base changes in or around helices IV and V, which would interfere with the normal base pairing of that region, showed decreased ability to bind TFIIIA. The transcripts of some mutant genes that were efficiently transcribed (greater than 50% of wild-type efficiency) failed to bind TFIIIA in this gel assay. In contrast, the RNA synthesized from a poorly transcribed mutant, LS 86/97, in which residues 87 to 96 of the RNA were replaced in the single-stranded loop at the base of helix V, bound TFIIIA well. The data indicate that TFIIIA binds to different domains in the 5S RNA gene and 5S RNA. Images PMID:3431548

  11. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  12. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    PubMed

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-01

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  13. 5 S and 5.8 S ribosomal RNA sequences and protist phylogenetics.

    PubMed

    Walker, W F

    1985-01-01

    More than 100 5 S 5.8 S rRNA sequences from protists, including fungi, are known. Through a combination of quantitative treeing and special consideration of "signature' nucleotide combinations, the most significant phylogenetic implications of these data are emphasized. Also, limitations of the data for phylogenetic inferences are discussed and other significant data are brought to bear on the inferences obtained. 5 S sequences from red algae are seen as the most isolated among eukaryotics. A 5 S sequence lineage consisting of oomycetes, euglenoids, most protozoa, most slime molds and perhaps dinoflagellates and mesozoa is defined. Such a lineage is not evident from 5.8 S rRNA or cytochrome c sequence data. 5 S sequences from Ascomycota and Basidiomycota are consistent with the proposal that each is derived from a mycelial form with a haploid yeast phase and simple septal pores, probably most resembling present Taphrinales. 5 S sequences from Chytridiomycota and Zygomycota are not clearly distinct from each other and suggest that a major lineage radiation occurred in the early history of each. Qualitative biochemical data clearly supports a dichotomy between an Ascomycota-Basidiomycota lineage and a Zygomycota-Chytridiomycota lineage.

  14. Generalized oscillator strengths for 5s, 5s{sup '}, and 5p excitations of krypton

    SciTech Connect

    Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing

    2003-06-01

    The absolute generalized oscillator strengths (GOSs) for 5s, 5s{sup '}, 5p [5/2]{sub 3,2}, 5p [3/2]{sub 1,2}, and 5p [1/2]{sub 0} transitions of krypton have been determined in a large K{sup 2} region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s{sup '} transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s{sup '} transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)].

  15. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    PubMed

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  16. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules

    PubMed Central

    Valach, Matus; Burger, Gertraud; Gray, Michael W.; Lang, B. Franz

    2014-01-01

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. PMID:25429974

  17. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    PubMed

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator.

  18. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array.

  19. {upsilon}(5S) Results from CLEO

    SciTech Connect

    Pavlunin, Victor

    2006-07-11

    Using the CLEO detector at the Cornell Electron Storage Ring, we have observed the Bs meson in e+e- annihilation at the {upsilon}(5S) resonance. We have fully reconstructed 14 candidates consistent with Bs decays into final states with a J/{psi} or a D{sub s}{sup (*)-}. The probability that this is a background fluctuation is less than 8 x 10-10. We have established that Bs production proceeds predominantly through the creation of B{sub s}*B-bar{sub s}* pairs with {sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) =0[ .11{sub -0.03}{sup +0.04}(stat) {+-} 0.02(syst)] nb. The following limits are set: {sigma}(e{sup +}e{sup -} {yields} B{sub s}B-bar{sub s})/{sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) < 0.16 and [{sigma}(e{sup +}e{sup -} {yields} B{sub s}B-bar{sub s}*) + {sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s})]/{sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) < 0.16 (90% CL). In a separate analysis, by comparing production rates of D{sub s}{sup +} mesons in {upsilon}(5S) and {upsilon}(4S) decays, an estimate of the ratio of B{sub s}{sup (*)} B-bar{sub s}{sup (*)} to the total bb-bar quark pair production at the {upsilon}(5S) energy of (16 {+-} 3 {+-} 6)% is obtained.

  20. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    PubMed

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production.

  1. Cytogenetic mapping of 5S and 18S rRNAs and H3 histone genes in 4 ancient Proscopiidae grasshopper species: contribution to understanding the evolutionary dynamics of multigene families.

    PubMed

    Cabral-de-Mello, D C; Martins, C; Souza, M J; Moura, R C

    2011-01-01

    This paper reports on the chromosomal location of 18S rRNA, 5S rRNA and H3 histone multigene families in 4 species of a relatively ancient and diversified group of grasshoppers belonging to the family Proscopiidae. The 5S rRNA and H3 histone genes were highly conserved in the number of sites and chromosomal position in the 4th chromosome pair in all species analyzed, whereas the 18S rRNA genes showed slightly more variation because they were present on one or 2 chromosome pairs, depending on the species. The 5S and 18S rRNA gene families occurred in different chromosomes; in contrast, H3 histone and 5S rRNA genes co-localized in the same chromosomal position, with an apparently interspersed organization. Considering that the Proscopiidae family is a relatively ancient group compared with the Acrididae family, the association of the H3 histone and 5S rRNA multigene families can represent a basal condition for grasshoppers, although more research is needed on other representatives of this insect group to confirm this statement. The presence of such an association of 5S rDNA and H3 histone in mussels and arthropods (beetles, grasshoppers and crustaceans) suggests that this linked configuration could represent an ancestral pattern for invertebrates. These results provide new insights into the understanding of the genome organization and the evolution of multigene families in grasshoppers and in insects as a whole.

  2. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    PubMed

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  3. Fresh-water planarias and a marine planaria are relatively dissimilar in the 5S rRNA sequences.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S; Takai, M

    1983-01-25

    The nucleotide sequences from fresh-water Dugesia japonica and marine Planocera reticulata have been determined. The similarity between these two species is only 69%. The Planocera sequence reveals nearly 80% similarity (72-81%) to the sequences of multicellular animals, while the Dugesia sequences are considerably different from them (66-73%).

  4. Characterization of Ffh of Mycobacterium tuberculosis and its interaction with 4.5S RNA.

    PubMed

    Palaniyandi, Kannan; Veerasamy, Malini; Narayanan, Sujatha

    2012-10-12

    Signal recognition particle (SRP) mediates targeting of proteins to appropriate cellular compartments, which is an important process in all living organisms. In prokaryotes, SRP consists of Ffh, a protein, and 4.5S RNA that recognizes signal peptide emerging from ribosomes. The SRP (Ffh) of one the most successful intracellular pathogen, Mycobacterium tuberculosis, has been investigated with respect to biochemical properties. In the present study, Ffh of M. tuberculosis was overexpressed and was confirmed to be a GTPase using thin layer chromatography and malachite green assay. The GTP binding ability was confirmed by GTP overlay assay. The 4.5S RNA sequence of M. tuberculosis was synthesized by in vitro transcription assay. The interaction between Ffh and 4.5S RNA was confirmed by overlay assay and RNA gel shift assay. The results show that the biochemical properties of M. tuberculosis Ffh have been conserved, and this is the first report that shows the interaction of components of SRP in M. tuberculosis, namely Ffh protein and 4.5S RNA.

  5. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status.

  6. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. PMID:23933480

  7. Evolutionary dynamics of the 5S rDNA gene family in the mussel Mytilus: mixed effects of birth-and-death and concerted evolution.

    PubMed

    Freire, Ruth; Arias, Alberto; Insua, Ana M; Méndez, Josefina; Eirín-López, José M

    2010-05-01

    In higher eukaryotes, the gene family encoding the 5S ribosomal RNA (5S rRNA) has been used (together with histones) to showcase the archetypal example of a gene family subject to concerted evolution. However, recent studies have revealed conspicuous features challenging the predictions of this model, including heterogeneity of repeat units, the presence of functional 5S gene variants as well as the existence of 5S rDNA divergent pseudogenes lacking traces of homogenization. In the present work, we have broadened the scope in the evolutionary study of ribosomal gene families by studying the 5S rRNA family in mussels, a model organism which stands out among other animals due to the heterogeneity it displays regarding sequence and organization. To this end, 48 previously unknown 5S rDNA units (coding and spacer regions) were sequenced in five mussel species, leading to the characterization of two new types of units (referred to here as small-beta 5S rDNA and gamma-5S rDNA) coexisting in the genome with alpha and beta rDNA units. The intense genetic dynamics of this family is further supported by the first description of an association between gamma-5S rDNA units and tRNA genes. Molecular evolutionary and phylogenetic analyses revealed an extensive lack of homology among spacer sequences belonging to different rDNA types, suggesting the presence of independent evolutionary pathways leading to their differentiation. Overall, our results suggest that the long-term evolution of the 5S rRNA gene family in mussels is most likely mediated by a mixed mechanism involving the generation of genetic diversity through birth-and-death, followed by a process of local homogenization resulting from concerted evolution in order to maintain the genetic identities of the different 5S units, probably after their transposition to independent chromosomal locations.

  8. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    PubMed

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  9. Molecular organization of the 5S rDNA gene type II in elasmobranchs

    PubMed Central

    Castro, Sergio I.; Hleap, Jose S.; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    ABSTRACT The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  10. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  11. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.

    2016-01-01

    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  12. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio

    2008-01-04

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  13. Multiplex-polymerase chain reaction assay for the authentication of the mackerel Scomber colias in commercial canned products.

    PubMed

    Infante, Carlos; Manchado, Manuel

    2006-01-01

    A multiplex-polymerase chain reaction (PCR) system was developed for the authentication of the mackerel Scomber colias in commercial canned products. This novel method consists of an S. colias-specific fragment [159 base pairs (bp)] located in the nontranscribed spacer (NTS) sequence, and a Scomber genus-specific PCR product in the 5S rRNA gene (196-201 bp) as a positive amplification control. The system was assayed using 18 different canned products labeled as S. colias. A positive identification was made in all but one sample, revealing this methodology as a potential molecular tool for direct application in the authentication of S. colias canned products. PMID:16792069

  14. The nucleotide sequences of 5S rRNAs from a sea-cucumber, a starfish and a sea-urchin.

    PubMed Central

    Ohama, T; Hori, H; Osawa, S

    1983-01-01

    The nucleotide sequences of 5S rRNA from three echinoderms, a sea-cucumber Stichopus oshimae, a starfish Asterina pectinifera and a sea-urchin Hemicentrotus pulcherrimus have been determined. These 5S rRNAs are all 120 nucleotides long. The echinoderm sequences are more related to the sequences of proterostomes animals such as mollusc, annelids and some others (87% identity on average) than to those of vertebrates (82% identity on average). PMID:6878041

  15. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  16. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    PubMed

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  17. Ultraviolet damage and nucleosome folding of the 5S ribosomal RNA gene.

    SciTech Connect

    Liu, X; Mann, David B.; Suquet, C; Springer, David L. ); Smerdon, Michael J.

    2000-01-25

    The Xenopus borealis somatic 5S ribosomal RNA gene was used as a model system to determine the mutual effects of nucleosome folding and formation of ultraviolet (UV) photoproducts (primarily cis-syn cyclobutane pyrimidine dimers, or CPDs) in chromatin. We analyzed the preferred rotational and translational settings of 5S rDNA on the histone octamer surface after induction of up to 0.8 CPD/nucleosome core (2.5 kJ/m(2) UV dose). DNase I and hydroxyl radical footprints indicate that UV damage at these levels does not affect the average rotational setting of the 5S rDNA molecules. Moreover, a combination of nuclease trimming and restriction enzyme digestion indicates the preferred translational positions of the histone octamer are not affected by this level of UV damage. We also did not observe differences in the UV damage patterns of irradiated 5S rDNA before or after nucleosome formation, indicating there is little difference in the inhibition of nucleosome folding by specific CPD sites in the 5S rRNA gene. Conversely, nucleosome folding significantly restricts CPD formation at all sites in the three helical turns of the nontranscribed strand located in the dyad axis region of the nucleosome, where DNA is bound exclusively by the histone H3-H4 tetramer. Finally, modulation of the CPD distribution in a 14 nt long pyrimidine tract correlates with its rotational setting on the histone surface, when the strong sequence bias for CPD formation in this tract is minimized by normalization. These results help establish the mutual roles of histone binding and UV photoproducts on their formation in chromatin.

  18. Direct detection of 16S rRNA in soil extracts by using oligonucleotide microarrays.

    PubMed

    Small, J; Call, D R; Brockman, F J; Straub, T M; Chandler, D P

    2001-10-01

    We report on the development and validation of a simple microarray method for the direct detection of intact 16S rRNA from unpurified soil extracts. Total RNAs from Geobacter chapellei and Desulfovibrio desulfuricans were hybridized to an oligonucleotide array consisting of universal and species-specific 16S rRNA probes. PCR-amplified products from Geobacter and Desulfovibrio were easily and specifically detected under a range of hybridization times, temperatures, and buffers. However, reproducible, specific hybridization and detection of intact rRNA could be accomplished only by using a chaperone-detector probe strategy. With this knowledge, assay conditions were developed for rRNA detection using a 2-h hybridization time at room temperature. Hybridization specificity and signal intensity were enhanced using fragmented RNA. Formamide was required in the hybridization buffer in order to achieve species-specific detection of intact rRNA. With the chaperone detection strategy, we were able to specifically hybridize and detect G. chapellei 16S rRNA directly from a total-RNA soil extract, without further purification or removal of soluble soil constituents. The detection sensitivity for G. chapellei 16S rRNA in soil extracts was at least 0.5 microg of total RNA, representing approximately 7.5 x 10(6) Geobacter cell equivalents of RNA. These results suggest that it is now possible to apply microarray technology to the direct detection of microorganisms in environmental samples, without using PCR. PMID:11571176

  19. Viability-qPCR for detecting Legionella: Comparison of two assays based on different amplicon lengths.

    PubMed

    Ditommaso, Savina; Giacomuzzi, Monica; Ricciardi, Elisa; Zotti, Carla M

    2015-08-01

    Two different real-time quantitative PCR (PMA-qPCR) assays were applied for quantification of Legionella spp. by targeting a long amplicon (approx 400 bp) of 16S rRNA gene and a short amplicon (approx. 100 bp) of 5S rRNA gene. Purified DNA extracts from pure cultures of Legionella spp. and from environmental water samples were quantified. Application of the two assays to quantify Legionella in artificially contaminated water achieved that both assays were able to detect Legionella over a linear range of 10 to 10(5) cells ml(-1). A statistical analysis of the standard curves showed that both assays were linear with a good correlation coefficient (R(2) = 0.99) between the Ct and the copy number. Amplification with the reference assay was the most effective for detecting low copy numbers (1 bacterium per PCR mixture). Using selective quantification of viable Legionella by the PMA-qPCR method we obtained a greater inhibition of the amplification of the 400-bp 16S gene fragment (Δlog(10) = 3.74 ± 0.39 log(10) GU ml(-1)). A complete inhibition of the PCR signal was obtained when heat-killed cells in a concentration below 1 × 10(5) cells ml(-1) were pretreated with PMA. Analysing short amplicon sizes led to only 2.08 log reductions in the Legionella dead-cell signal. When we tested environmental water samples, the two qPCR assays were in good agreement according to the kappa index (0.741). Applying qPCR combined with PMA treatment, we also obtained a good agreement (kappa index 0.615). The comparison of quantitative results shows that both assays yielded the same quantification sensitivity (mean log = 4.59 vs mean log = 4.31).

  20. Higher-order structure of rRNA

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  1. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  2. Taxonomy of 5 S ribosomal RNA by the linguistic technique: probing with mitochondrial and mammalian sequences.

    PubMed

    Guimarães, R C; Trifonov, E N; Lagunez-Otero, J

    1997-09-01

    Linguistic similarities and dissimilarities between 5 S rRNA sequences allowed taxonomical separation of species and classes. Comparisons with the molecule from mammals distinguished fungi and plants from protists and animals. Similarities to mammalians progressively increased from protists to invertebrates and to somatic-type molecules of the vertebrates lineage. In this, deviations were detected in avian, oocyte type, and pseudogene sequences. Among bacteria, actinobacteria were most similar to the mammalians, which could be related to the high frequency of associations among members of these groups. Some archaebacterial species most similar to the mammalians belonged to the Thermoproteales and Halobacteria groups. Comparisons with the soybean mitochondrial molecule revealed high internal homogeneity among plant mitochondria. The eubacterial groups most similar to it were Thermus and Rhodobacteria gamma-1 and alpha-2. Other procedures have already indicated similarities of Rhodobacteria alpha to mitochondria but the linguistic similarities were on the average higher with the first two groups.

  3. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae.

    PubMed

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-02-27

    Methylation of ribose sugars at the 2'-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2'-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5' central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D' box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications.

  4. Ribosomal protein-dependent orientation of the 16 S rRNA environment of S15.

    PubMed

    Jagannathan, Indu; Culver, Gloria M

    2004-01-30

    Ribosomal protein S15 binds specifically to the central domain of 16 S ribosomal RNA (16 S rRNA) and directs the assembly of four additional proteins to this domain. The central domain of 16 S rRNA along with these five proteins form the platform of the 30 S subunit. Previously, directed hydroxyl radical probing from Fe(II)-S15 in small ribonucleoprotein complexes was used to study assembly of the central domain of 16 S rRNA. Here, this same approach was used to understand the 16 S rRNA environment of Fe(II)-S15 in 30 S subunits and to determine the ribosomal proteins that are involved in forming the mature S15-16 S rRNA environment. We have identified additional sites of Fe(II)-S15-directed cleavage in 30S subunits compared to the binary complex of Fe(II)-S15/16 S rRNA. Along with novel targets in the central domain, sites within the 5' and 3' minor domains are also cleaved. This suggests that during the course of 30S subunit assembly these elements are positioned in the vicinity of S15. Besides the previously determined role for S8, roles for S5, S6+S18, and S16 in altering the 16 S rRNA environment of S15 were established. These studies reveal that ribosomal proteins can alter the assembly of regions of the 30 S subunit from a considerable distance and influence the overall conformation of this ribonucleoprotein particle.

  5. Molecular cloning and characterization of an rRNA operon in Streptomyces lividans TK21.

    PubMed Central

    Suzuki, Y; Ono, Y; Nagata, A; Yamada, T

    1988-01-01

    The number of rRNA genes in Streptomyces lividans was examined by Southern hybridization. Randomly labeled 23 and 16S rRNAs were hybridized with BamHI, BglII, PstI, SalI, or XhoI digests of S. lividans TK21 DNA. BamHi, BglII, SalI and XhoI digests yielded six radioactive bands each for the 23 and 16S rRNAs, whereas PstI digests gave one band for the 23S rRNA and one high-intensity band and six low-density bands for the 16S rRNA. The 7.4-kilobase-pair BamHI fragment containing one of the rRNA gene clusters was cloned into plasmid pBR322. The hybrid plasmid, pSLTK1, was characterized by physical mapping, Southern hybridization, and electron microscopic analysis of the R loops formed between pSLTK1 and the 23 and 16S rRNAs. There were at least six rRNA genes in S. lividans TK21. The 16 and 23S rRNA genes were estimated to be about 1.40 and 3.17 kilobase pairs, respectively. The genes for the rRNAs were aligned in the sequence 16S-23S-5S. tRNA genes were not found in the spacer region or in the context of the rRNA genes. The G + C content of the spacer region was calculated to be approximately 58%, in contrast to 73% for the chromosome as a whole. Images PMID:2832372

  6. High-Resolution Infrared Spectroscopy of Carbon-Sulfur Chains: II. C_5S and SC_5S

    NASA Astrophysics Data System (ADS)

    Thorwirth, Sven; Salomon, Thomas; Dudek, John B.

    2016-06-01

    Unbiased high-resolution infrared survey scans of the ablation products from carbon-sulfur targets in the 2100 to 2150 cm-1 regime reveal two bands previously not observed in the gas phase. On the basis of comparison against laboratory matrix-isolation work and new high-level quantum-chemical calculations these bands are attributed to the linear C_5S and SC_5S clusters. While polar C_5S was studied earlier using Fourier-transform microwave techniques, the present work marks the first gas-phase spectroscopic detection of SC_5S. H. Wang, J. Szczepanski, P. Brucat, and M. Vala 2005, Int. J. Quant. Chem. 102, 795 Y. Kasai, K. Obi, Y. Ohshima, Y. Hirahara, Y. Endo, K. Kawaguchi, and A. Murakami 1993, ApJ 410, L45 V. D. Gordon, M. C. McCarthy, A. J. Apponi, and P. Thaddeus 2001, ApJS 134, 311

  7. Enterococcus faecium PBP5-S/R, the missing link between PBP5-S and PBP5-R.

    PubMed

    Pietta, Ester; Montealegre, Maria Camila; Roh, Jung Hyeob; Cocconcelli, Pier Sandro; Murray, Barbara E

    2014-11-01

    During a study to investigate the evolution of ampicillin resistance in Enterococcus faecium, we observed that a number of E. faecium strains, mainly from the recently described subclade A2, showed PBP5 sequences in between PBP5-S and PBP5-R. These hybrid PBP5-S/R patterns reveal a progression of amino acid changes from the S form to the R form of this protein; however, these changes do not strictly correlate with changes in ampicillin MICs.

  8. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.

    PubMed

    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa

    2011-03-01

    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained.

  9. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.

    PubMed

    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa

    2011-03-01

    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained. PMID:21429462

  10. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  11. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  12. Depletion of ribosomal protein S19 causes a reduction of rRNA synthesis

    PubMed Central

    Juli, Giada; Gismondi, Angelo; Monteleone, Valentina; Caldarola, Sara; Iadevaia, Valentina; Aspesi, Anna; Dianzani, Irma; Proud, Christopher G.; Loreni, Fabrizio

    2016-01-01

    Ribosome biogenesis plays key roles in cell growth by providing increased capacity for protein synthesis. It requires coordinated production of ribosomal proteins (RP) and ribosomal RNA (rRNA), including the processing of the latter. Here, we show that, the depletion of RPS19 causes a reduction of rRNA synthesis in cell lines of both erythroid and non-erythroid origin. A similar effect is observed upon depletion of RPS6 or RPL11. The deficiency of RPS19 does not alter the stability of rRNA, but instead leads to an inhibition of RNA Polymerase I (Pol I) activity. In fact, results of nuclear run-on assays and ChIP experiments show that association of Pol I with the rRNA gene is reduced in RPS19-depleted cells. The phosphorylation of three known regulators of Pol I, CDK2, AKT and AMPK, is altered during ribosomal stress and could be involved in the observed downregulation. Finally, RNA from patients with Diamond Blackfan Anemia (DBA), shows, on average, a lower level of 47S precursor. This indicates that inhibition of rRNA synthesis could be one of the molecular alterations at the basis of DBA. PMID:27734913

  13. Transcription factor IIIA induced bending of the Xenopus somatic 5S gene promoter.

    PubMed

    Schroth, G P; Cook, G R; Bradbury, E M; Gottesfeld, J M

    1989-08-10

    Transcription factor IIIA (TFIIIA), the canonical zinc-finger protein, is a protein of relative molecular mass 39,000 (39K) that is required for transcription of 5S-ribosomal subunit genes in Xenopus. It binds in a sequence-specific manner to the internal control region of the 5S gene (see Fig. 1) and facilitates transcription of the gene by RNA polymerase III. It also binds to the 5S gene product to form a 7S ribonucleoprotein particle. In oocytes the 7S particle acts as a storage form of the RNA to be utilized later in development. TFIIIA binds to DNA through its 30 K N-terminal domain, which contains nine zinc-fingers. TFIIIA was the first protein described to have this type of DNA binding motif, but numerous other proteins have now been shown to have zinc-finger domains. A structure for a single zinc-finger from the yeast protein ADR1, was recently proposed based on two-dimensional NMR data (ref. 8), and a similar structure was proposed based on comparison with crystal structures of other metalloproteins. Although models for the interaction of TFIIIA with the 5S-ribosomal gene DNA have been proposed, based on nuclease digestion and methylation interference data, little precise structural information is available for TFIIIA and the physical basis for the interaction of zinc-fingers with DNA is not understood. Using both circular permutation and circularization assays we provide convincing biochemical evidence that TFIIIA bends the DNA at the internal promoter of the 5S gene.

  14. L5-S1 Laparoscopic Anterior Interbody Fusion

    PubMed Central

    Zeni, Tallal M.; Phillips, Frank M.; Mathur, Sameer; Zografakis, John G.; Moore, Ronald M.; Laguna, Luis E.

    2006-01-01

    Objective: We evaluated our experience with laparoscopic L5-S1 anterior lumbar interbody fusion (ALIF). Methods: This represents a retrospective analysis of consecutive patients who underwent L5-S1 laparoscopic ALIF between February 1998 and August 2003. Results: Twenty-eight patients underwent L5-S1 LAIF (15 males and 13 females). The mean age was 43 years (range, 26 to 67). Mean operative time was 225 minutes (range, 137 to 309 minutes). No conversions to an open procedure were necessary. Twenty-four (85.7%) patients underwent successful bilateral cage placement. Four patients (14.3%) in whom only a single cage could be placed underwent supplementary posterior pedicle screw placement. Mean length of stay (LOS) was 4.1 days (range, 2 to 15). Two patients underwent reoperation subacutely secondary to symptomatic lateral displacement of the cage. One patient developed radiculopathy 6 months postoperatively and required reoperation. One patient developed a small bowel obstruction secondary to adhesions to the cage requiring laparoscopic reoperation. Fusion was achieved in all patients. Visual analogue scale scores for back pain were significantly improved from 8.6±0.8 to 2.8±0.8 (P<0.0001) at 1 year. Conclusion: L5-S1 LAIF is feasible and safe with all the advantages of minimally invasive surgery. Fusion rates and pain improvement were comparable to those with an open repair. PMID:17575763

  15. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  16. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron.

    PubMed Central

    MacKay, R M; Salgado, D; Bonen, L; Stackebrandt, E; Doolittle, W F

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are (formula: see text), respectively. Specific phylogenetic relationships of P. denitrificans with purple non-sulphur bacteria, and of Prochloron with cyanobacteria are demonstrated, and unique features of potential secondary structure are described. PMID:7099971

  17. Functional domains of the Xenopus laevis 5S gene promoter.

    PubMed Central

    Pieler, T; Oei, S L; Hamm, J; Engelke, U; Erdmann, V A

    1985-01-01

    To study the fine structure of the Xenopus laevis somatic 5S gene internal control region, we have created 15 different transversions using mutagenic oligonucleotide primers. The effects of these mutations on 5S DNA transcription in vitro as well as on stable complex formation with transcription factor TF III A and TF III C in crude nuclear extracts were analyzed. Mutations in the common class III 5' promoter element (nucleotides 50-61 in the 5S gene) interfere with transcription activity and stable complex formation whenever they contradict the tDNA box A consensus sequence. The second promoter element is defined by a major sequence block (nucleotides 80-89, box C) and two additional internal residues (70 and 71) at a distance of roughly one helical turn from both the major 3' and 5' control sequences; these two 3' elements contain the primary TF III A binding domain. The remaining nucleotides (62-69 and 71-79) when mutated do not interfere with transcription activity or factor binding and thus they constitute two spacer elements within a symmetrically structured 5S gene promoter. An increase in the relative spacing of box A and box C by insertion of 3 bp between nucleotides 66 and 67 leads to a drastic reduction in transcription activity and the ability to form a stable complex with TF III A and/or TF III C. Thus, accurate spacing is essential for the proper orientation of TF III A on 5S DNA and/or TF III C binding. Images Fig. 1. Fig. 3. Fig. 4. PMID:3004969

  18. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  19. Molecular characterization and physical mapping of two classes of 5S rDNA in the genomes of Gymnotus sylvius and G. inaequilabiatus (Gymnotiformes, Gymnotidae).

    PubMed

    Scacchetti, P C; Alves, J C P; Utsunomia, R; Claro, F L; de Almeida Toledo, L F; Oliveira, C; Foresti, F

    2012-01-01

    The nucleotide sequences of the 5S rRNA multigene family and their distribution across the karyotypes in 2 species of Gymnotiformes, genus Gymnotus (G. sylvius and G. inaequilabiatus) were investigated by means of fluorescence in situ hybridization (FISH). The results showed the existence of 2 distinct classes of 5S rDNA sequences in both species: class I and class II. A high conservative pattern of the codifying region of the 5S rRNA gene was identified, contrasting with significant alterations detected in the nontranscribed spacer (NTS). The presence of TATA-like sequences along the NTS of both species was an expected occurrence, since such sequences have been associated with the regulation of the gene expression. FISH using 5S rDNA class I and class II probes revealed that both gene classes were collocated in the same chromosome pair in the genome of G. sylvius, while in that of G. inaequilabiatus, class II appeared more disperse than class I.

  20. Eukaryotic origins: string analysis of 5S ribosomal RNA sequences from some relevant organisms.

    PubMed

    Nanney, D L; Mobley, D O; Preparata, R M; Meyer, E B; Simon, E M

    1991-04-01

    Using the PHYLOGEN tree-forming programs, we evaluate the published 5S rRNA sequences in certain of the files in the Berlin DataBank in an attempt to identify the connection between archaebacteria and the eukaryotic protists. These programs are based on methods of string analysis developed by Sankoff and others. Their discriminatory power is derived from their continuous realignment of sequences through repeated assessment of insertions and deletions as well as substitutions. The programs demonstrate that even these small molecules (ca. 120 bases) retain substantial records of evolutionary events that occurred over a billion years ago. The eukaryotes seem to have been derived from ancestors near the common origins of the halobacterial and Methanococcales groups. Identifying what might have been a primordial eukaryote is more difficult because several of the species considered as early derivatives from the common root are isolated species with large genetic differences from each other and from all other extant forms that have been sequenced. The ameboid, flagellated, and ciliated protists seem to have emerged nearly simultaneously from an ancient cluster, but the sarcodinid protozoa have preference as the group of most ancient origin. The euglenozoa and the ciliates are of later derivation. Our ability to tease plausible trees from such small molecules suggests that the mode of analysis rather than the size of the molecule is often a major limitation in the reconstruction of acceptable ancient phylogenics.(ABSTRACT TRUNCATED AT 250 WORDS)

  1. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae

    PubMed Central

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-01-01

    Methylation of ribose sugars at the 2′-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2′-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5′ central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D′ box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  2. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and relevance to genomovar assignment

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic variability in 16S rRNA gene sequences has been demonstrated among isolates of Flavobacterium columnare and a restriction fragment length polymorphism (RFLP) assay is available for genetic typing this important fish pathogen. Interpretation of restriction patterns can be difficult due to th...

  3. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and standard protocol for genomovar assignment

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic variability in 16S rRNA gene sequences has been demonstrated among isolates of Flavobacterium columnare and a restriction fragment length polymorphism (RFLP) assay is available for genetic typing this important fish pathogen. Interpretation of restriction patterns can be difficult due to th...

  4. Phylogenetic Analysis of Bacteroidales 16S rRNA Genes Unveils Sequences Specific to Diverse Swine Fecal Sources

    EPA Science Inventory

    Two of the currently available methods to assess swine fecal pollution (Bac1 and PF163) target Bacteroidales 16S rRNA genes. However, these assays have been shown to exhibit poor host-specificity and low detection limits in environmental waters, in part due to the limited number...

  5. Karyotypic diversification in Mytilus mussels (Bivalvia: Mytilidae) inferred from chromosomal mapping of rRNA and histone gene clusters

    PubMed Central

    2014-01-01

    Background Mussels of the genus Mytilus present morphologically similar karyotypes that are presumably conserved. The absence of chromosome painting probes in bivalves makes difficult verifying this hypothesis. In this context, we comparatively mapped ribosomal RNA and histone gene families on the chromosomes of Mytilus edulis, M. galloprovincialis, M. trossulus and M. californianus by fluorescent in situ hybridization (FISH). Results Major rRNA, core and linker histone gene clusters mapped to different chromosome pairs in the four taxa. In contrast, minor rRNA gene clusters showed a different behavior. In all Mytilus two of the 5S rDNA clusters mapped to the same chromosome pair and one of them showed overlapping signals with those corresponding to one of the histone H1 gene clusters. The overlapping signals on mitotic chromosomes became a pattern of alternate 5S rRNA and linker histone gene signals on extended chromatin fibers. Additionally, M. trossulus showed minor and major rDNA clusters on the same chromosome pair. Conclusion The results obtained suggest that at least some of the chromosomes bearing these sequences are orthologous and that chromosomal mapping of rRNA and histone gene clusters could be a good tool to help deciphering some of the many unsolved questions in the systematic classification of Mytilidae. PMID:25023072

  6. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  7. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease.

  8. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    PubMed Central

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  9. 5S rDNA genome regions of Lens species.

    PubMed

    Fernández, M; Ruiz, M L; Linares, C; Fominaya, A; Pérez de la Vega, M

    2005-10-01

    The length variability of the nontranscribed spacer (NTS) of the 5S rDNA repeats was analyzed in species of the genus Lens by means of PCR amplification. The NTS ranged from approximately 227 to approximately 952 bp. The polymorphism detected was higher than previous NTS polymorphisms described in this genus. Three NTS length variants from Lens culinaris subsp. culinaris and 2 from Lens culinaris subsp. orientalis were sequenced. The culinaris NTS fragment lengths were 239, 371, and 838 bp, whereas the orientalis ones were 472 bp and 506 bp, respectively. As a result of sequence similarities, 2 families of sequences were distinguished, 1 including the sequences of 838 and 506 bp, and others with the sequences of 239, 371, and 472 bp. The 1st family was characterized by the presence of a repeated sequence designated A, whereas the 2nd family showed a single A sequence and other repeated sequences designated B, C, and D. The presence of an (AT)n microsatellite was also observed in the 2nd family of sequences. The fragments, which included the 239-bp and 838-bp NTS sequences, as well as the intergenic spacer (IGS) of the 18S-5.8S-26S ribosomal DNA also from L. culinaris subsp. culinaris, were used to localize the nucleolar organizer region (NOR) and the 5S rDNA loci in the chromosomes of several species of the genus Lens by means of fluorescence in situ hybridization (FISH). The selective hybridization of the 2 NTS probes allowed us to distinguish between different 5S rDNA chromosomal loci.

  10. Reverse transcription and polymerase chain reaction amplification of rRNA for detection of Helicobacter species.

    PubMed

    Engstrand, L; Nguyen, A M; Graham, D Y; el-Zaatari, F A

    1992-09-01

    Sequence data on Helicobacter pylori 16S rRNA were used to select two 22-base oligonucleotide primers for use in a polymerase chain reaction (PCR) for detection of H. pylori. H. pylori cells were treated with lysis buffer, boiled, and chloroform extracted. Reverse transcription of rRNA was followed by PCR amplification (RT-PCR) of the synthesized cDNA and 16S rRNA gene. The amplified PCR products were analyzed by agarose gel electrophoresis and Southern blotting. Using ethidium bromide-stained agarose gels, we were able to detect the expected 500-bp DNA fragment from as few as two H. pylori organisms per reaction. The specificity of the RT-PCR assay was tested with 27 clinical isolates and related reference strains; although the number of bacterial cells used per reaction was 10(5)-fold greater than the number of H. pylori organisms used, amplification was detected only with bacteria in the same genus, H. cinaedi and H. mustelae. Ten H. pylori organisms per biopsy specimen were detected on agarose gels when organisms were added to samples prepared from a processed colon biopsy sample. RT-PCR results were consistent with urea breath test and culture results in 14 of 15 gastric biopsy specimens; the specificity was 100%. RT-PCR of rRNA from H. pylori increased the sensitivity of pathogen detection at least 25- to 50-fold compared with that of previous PCR assays. This low level of detection by RT-PCR assay may prove to be well suited for verifying eradication following therapy. PMID:1383268

  11. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    PubMed Central

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  12. 5S clavam biosynthesis is controlled by an atypical two-component regulatory system in Streptomyces clavuligerus.

    PubMed

    Kwong, Thomas; Zelyas, Nathan J; Cai, Hui; Tahlan, Kapil; Wong, Annie; Jensen, Susan E

    2012-09-01

    Streptomyces clavuligerus produces a collection of five clavam metabolites, including the clinically important β-lactamase inhibitor clavulanic acid, as well as four structurally related metabolites called 5S clavams. The paralogue gene cluster of S. clavuligerus is one of three clusters of genes for the production of these clavam metabolites. A region downstream of the cluster was analyzed, and snk, res1, and res2, encoding elements of an atypical two-component regulatory system, were located. Mutation of any one of the three genes had no effect on clavulanic acid production, but snk and res2 mutants produced no 5S clavams, whereas res1 mutants overproduced 5S clavams. Reverse transcriptase PCR analyses showed that transcription of cvm7p (which encodes a transcriptional activator of 5S clavam biosynthesis) and 5S clavam biosynthetic genes was eliminated in snk and in res2 mutants but that snk and res2 transcription was unaffected in a cvm7p mutant. Both snk and res2 mutants could be complemented by introduction of cvm7p under the control of an independently regulated promoter. In vitro assays showed that Snk can autophosphorylate and transfer its phosphate group to both Res1 and Res2, and Snk-H365, Res1-D52, and Res2-D52 were identified as the phosphorylation sites for the system. Dephosphorylation assays indicated that Res1 stimulates dephosphorylation of Res2∼P. These results suggest a regulatory cascade in which Snk and Res2 form a two-component system controlling cvm7p transcription, with Res1 serving as a checkpoint to modulate phosphorylation levels. Cvm7P then activates transcription of 5S clavam biosynthetic genes.

  13. Description of an unusual Neisseria meningitidis isolate containing and expressing Neisseria gonorrhoeae-Specific 16S rRNA gene sequences.

    PubMed

    Walcher, Marion; Skvoretz, Rhonda; Montgomery-Fullerton, Megan; Jonas, Vivian; Brentano, Steve

    2013-10-01

    An apparently rare Neisseria meningitidis isolate containing one copy of a Neisseria gonorrhoeae 16S rRNA gene is described herein. This isolate was identified as N. meningitidis by biochemical identification methods but generated a positive signal with Gen-Probe Aptima assays for the detection of Neisseria gonorrhoeae. Direct 16S rRNA gene sequencing of the purified isolate revealed mixed bases in signature regions that allow for discrimination between N. meningitidis and N. gonorrhoeae. The mixed bases were resolved by sequencing individually PCR-amplified single copies of the genomic 16S rRNA gene. A total of 121 discrete sequences were obtained; 92 (76%) were N. meningitidis sequences, and 29 (24%) were N. gonorrhoeae sequences. Based on the ratio of species-specific sequences, the N. meningitidis strain seems to have replaced one of its four intrinsic 16S rRNA genes with the gonococcal gene. Fluorescence in situ hybridization (FISH) probes specific for meningococcal and gonococcal rRNA were used to demonstrate the expression of the rRNA genes. Interestingly, the clinical isolate described here expresses both N. meningitidis and N. gonorrhoeae 16S rRNA genes, as shown by positive FISH signals with both probes. This explains why the probes for N. gonorrhoeae in the Gen-Probe Aptima assays cross-react with this N. meningitidis isolate. The N. meningitidis isolate described must have obtained N. gonorrhoeae-specific DNA through interspecies recombination.

  14. Proteins associated with rRNA in the Escherichia coli ribosome.

    PubMed

    Bernabeu, C; Vazquez, D; Ballesta, J P

    1978-04-27

    Ribosomal proteins located near the rRNA have been identified by cross linking to [14C]spermine with 1,5-difluoro-2,4-dinitrobenzene. The polyamine binds to double-stranded rRNA; those proteins showing radioactivity covalently bound after treatment with the bifunctional reagent should therefore be located in the vicinity of these regions of rRNA. Six proteins from the small subunit, S4, S5, S9, S18, S19 and S20 and ten proteins from the large subunit L2, L6, L13, L14, L16, L17, L18, L19, L22 and L27 preferentially take up the label. The results obtained with three proteins from the large subunit, L6, L16 and L27, show a high degree of variability that could reflect differences of conformation in the subunit population. Several proteins were drastically modified by the cross-linking agent but were not detected in the two-dimensional gel electrophoresis (e.g., S1, S11, S21, L7, L8 and L12) and therefore could not be studied.

  15. Cellulase Assays

    NASA Astrophysics Data System (ADS)

    Zhang, Y. H. Percival; Hong, Jiong; Ye, Xinhao

    Cellulose is a heterogeneous polysaccharide, and its enzymatic hydrolysis requires endoglucanase, exoglucanase (cellobiohydrolase), and β-glucosidase to work together. We summarize the most commonly used assays for individual enzymes and cellulase mixture.

  16. Detection and identification of mycobacteria by amplification of rRNA.

    PubMed

    Böddinghaus, B; Rogall, T; Flohr, T; Blöcker, H; Böttger, E C

    1990-08-01

    Oligonucleotides specific at a genus, group, or species level were defined by a systematic comparison of small-subunit rRNA sequences from Mycobacterium tuberculosis, M. bovis, M. africanum, M. bovis BCG, M. avium, M. kansasii, M. marinum, M. gastri, M. chelonae, M. smegmatis, M. terrae, M. nonchromogenicum, M. xenopi, M. malmoense, M. szulgai, M. scrofulaceum, M. fortuitum, M. gordonae, M. intracellulare, M. simiae, M. flavescens, M. paratuberculosis, M. sphagni, M. cookii, M. komossense, M. phlei, and M. farcinica. On the basis of the defined oligonucleotides, the polymerase chain reaction technique was explored to develop a sensitive taxon-specific detection system for mycobacteria. By using M. tuberculosis as a model system, fewer than 10 bacteria could be reliably detected by this kind of assay. These results suggest that amplification of rRNA sequences by the polymerase chain reaction may provide a highly sensitive and specific tool for the direct detection of microorganisms without the need for prior cultivation.

  17. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    PubMed Central

    2010-01-01

    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  18. Detection of Pathogenic Yersinia enterocolitica by a Rapid and Sensitive Duplex PCR Assay

    PubMed Central

    Wannet, Wim J. B.; Reessink, Michiel; Brunings, Henk A.; Maas, Henny M. E.

    2001-01-01

    A duplex PCR assay targeting the ail and 16S rRNA genes of Yersinia enterocolitica was developed to specifically identify pathogenic Y. enterocolitica from pure culture. Validation of the assay was performed with 215 clinical Yersinia strains and 40 strains of other bacterial species. Within an assay time of 4 h, this assay offers a very specific, reliable, and inexpensive alternative to the conventional phenotypic assays used in clinical laboratories to identify pathogenic Y. enterocolitica. PMID:11724866

  19. rRNA operons and genome size of 'Candidatus Liberibacter americanus', a bacterium associated with citrus huanglongbing in Brazil.

    PubMed

    Wulff, N A; Eveillard, S; Foissac, X; Ayres, A J; Bové, J-M

    2009-08-01

    Huanglongbing is one of the most severe diseases of citrus worldwide and is associated with 'Candidatus (Ca.) Liberibacter africanus' in Africa, 'Ca. Liberibacter asiaticus' in Asia and the Americas (Brazil, USA and Cuba) and 'Ca. Liberibacter americanus' (Lam) in Brazil. In the absence of axenic cultures, genetic information on liberibacters is scarce. The sequences of the entire 23S rRNA and 5S rRNA genes from Lam have now been obtained, using a consensus primer designed on known tRNAMet sequences of rhizobia. The size of the Lam genome was determined by PFGE, using Lam-infected periwinkle plants for bacterial enrichment, and was found to be close to 1.31 Mbp. In order to determine the number of ribosomal operons on the Lam genome, probes designed to detect the 16S rRNA gene and the 3' end of the 23S rRNA gene were developed and used for Southern hybridization with I-CeuI-treated genomic DNA. Our results suggest that there are three ribosomal operons in a circular genome. Lam is the first liberibacter species for which such data are available.

  20. Repumping and spectroscopy of laser-cooled Sr atoms using the (5s5p)3P2-(5s4d)3D2 transition

    NASA Astrophysics Data System (ADS)

    Mickelson, P. G.; Martinez de Escobar, Y. N.; Anzel, P.; De Salvo, B. J.; Nagel, S. B.; Traverso, A. J.; Yan, M.; Killian, T. C.

    2009-12-01

    We describe repumping and spectroscopy of laser-cooled strontium (Sr) atoms using the (5s5p)3P2-(5s4d)3D2 transition. Atom number in a magneto-optical trap is enhanced by driving this transition because Sr atoms that have decayed into the (5s5p)3P2 dark state are repumped back into the (5s2)1S0 ground state. Spectroscopy of 84Sr, 86Sr, 87Sr and 88Sr improves the value of the (5s5p)3P2-(5s4d)3D2 transition frequency and determines the isotope shifts for the transition accurately enough to guide laser-cooling experiments with less abundant isotopes.

  1. The Role of 16S rRNA Gene Sequencing in Confirmation of Suspected Neonatal Sepsis.

    PubMed

    El Gawhary, Somaia; El-Anany, Mervat; Hassan, Reem; Ali, Doaa; El Gameel, El Qassem

    2016-02-01

    Different molecular assays for the detection of bacterial DNA in the peripheral blood represented a diagnostic tool for neonatal sepsis. We targeted to evaluate the role of 16S rRNA gene sequencing to screen for bacteremia to confirm suspected neonatal sepsis (NS) and compare with risk factors and septic screen testing. Sixty-two neonates with suspected NS were enrolled. White blood cells count, I/T ratio, C-reactive protein, blood culture and 16S rRNA sequencing were performed. Blood culture was positive in 26% of cases, and PCR was positive in 26% of cases. Evaluation of PCR for the diagnosis of NS showed sensitivity 62.5%, specificity 86.9%, PPV 62.5%, NPV 86.9% and accuracy of 79.7%. 16S rRNA PCR increased the sensitivity of detecting bacterial DNA in newborns with signs of sepsis from 26 to 35.4%, and its use can be limited to cases with the most significant risk factors and positive septic screen.

  2. Essential role of conserved DUF177A protein in plastid 23S rRNA accumulation and plant embryogenesis

    PubMed Central

    Yang, Jiani; Suzuki, Masaharu; McCarty, Donald R.

    2016-01-01

    DUF177 proteins are nearly universally conserved in bacteria and plants except the Chlorophyceae algae. Thus far, duf177 mutants in bacteria have not established a function. In contrast, duf177a mutants have embryo lethal phenotypes in maize and Arabidopsis. In maize inbred W22, duf177a mutant embryos arrest at an early transition stage, whereas the block is suppressed in the B73 inbred background, conditioning an albino seedling phenotype. Background-dependent embryo lethal phenotypes are characteristic of maize plastid gene expression mutants. Consistent with the plastid gene expression hypothesis, quantitative real-time PCR revealed a significant reduction of 23S rRNA in an Escherichia coli duf177 knockout. Plastid 23S rRNA contents of duf177a mutant tissues were also markedly reduced compared with the wild-type, whereas plastid 16S, 5S, and 4.5S rRNA contents were less affected, indicating that DUF177 is specifically required for accumulation of prokaryote-type 23S rRNA. An AtDUF177A–green fluorescent protein (GFP) transgene controlled by the native AtDUF177A promoter fully complemented the Arabidopsis atduf177a mutant. Transient expression of AtDUF177A–GFP in Nicotiana benthamiana leaves showed that the protein was localized in chloroplasts. The essential role of DUF177A in chloroplast–ribosome formation is reminiscent of IOJAP, another highly conserved ribosome-associated protein, suggesting that key mechanisms controlling ribosome formation in plastids evolved from non-essential pathways for regulation of the prokaryotic ribosome. PMID:27574185

  3. Nested PCR Assay for Detection of Granulocytic Ehrlichiae

    PubMed Central

    Massung, Robert F.; Slater, Kim; Owens, Jessica H.; Nicholson, William L.; Mather, Thomas N.; Solberg, Victoria B.; Olson, James G.

    1998-01-01

    A sensitive and specific nested PCR assay was developed for the detection of granulocytic ehrlichiae. The assay amplifies the 16S rRNA gene and was used to examine acute-phase EDTA-blood and serum samples obtained from seven humans with clinical presentations compatible with human granulocytic ehrlichiosis. Five of the seven suspected cases were positive by the PCR assay using DNA extracted from whole blood as the template, compared with a serologic assay that identified only one positive sample. The PCR assay using DNA extracted from the corresponding serum samples as the template identified three positive samples. The sensitivity of the assay on human samples was examined, and the limit of detection was shown to be fewer than 2 copies of the 16S rRNA gene. The application of the assay to nonhuman samples demonstrated products amplified from template DNA extracted from Ixodes scapularis ticks collected in Rhode Island and from EDTA-blood specimens obtained from white-tailed deer in Maryland. All PCR products were sequenced and identified as specific to granulocytic ehrlichiae. A putative variant granulocytic ehrlichia 16S rRNA gene sequence was detected among products amplified from both the ticks and the deer blood specimens. PMID:9542943

  4. Ultraviolet light-induced crosslinking reveals a unique region of local tertiary structure in potato spindle tuber viroid and HeLa 5S RNA

    SciTech Connect

    Branch, A.D.; Benenfeld, B.J.; Robertson, H.D.

    1985-10-01

    The positions of intramolecular crosslinks induced by irradiation with ultraviolet light were mapped into potato spindle tuber viroid RNA and HeLa 5S rRNA. Crosslinking in each of these molecules occurred at a single major site, which was located by RNA fingerprinting and secondary analysis. Various lines of evidence suggest that these crosslinks identify a previously undescribed element of local tertiary structure common to these two widely divergent RNA molecules: (i) both crosslinks occur in an identical eight-base context, with the sequence 5 GGGAA 3 on one side and the sequence 5 UAC 3 on the other; (ii) both crosslinks connect bases that are not thought to be involved in conventional hydrogen bonding, within regions usually depicted as single-stranded loops flanked by short helical segments; and (iii) both crosslinks connect a purine and a pyrimidine residue, and both may generate the same G-U dimer. Furthermore, it is likely that the crosslinking site is of functional significance because it is located within the most highly conserved region of the viroid sequence and involves bases that are essentially invariant among eukaryotic 5S rRNA molecules.

  5. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq

    2015-01-01

    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  6. Development and Validation of an Improved PCR Method Using the 23S-5S Intergenic Spacer for Detection of Rickettsiae in Dermacentor variabilis Ticks and Tissue Samples from Humans and Laboratory Animals.

    PubMed

    Kakumanu, Madhavi L; Ponnusamy, Loganathan; Sutton, Haley T; Meshnick, Steven R; Nicholson, William L; Apperson, Charles S

    2016-04-01

    A novel nested PCR assay was developed to detectRickettsiaspp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) ofRickettsiaspp. The newly designed primers were evaluated using genomic DNA from 11Rickettsiaspecies belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to otherRickettsia-specific PCR targets (ompA,gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11Rickettsiaspp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from "CandidatusRickettsia amblyommii." Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adultDermacentor variabilisticks. The nested 23S-5S IGS assay detectedRickettsiaDNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species ofRickettsia The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species ofRickettsiain the ticks. "CandidatusRickettsia amblyommii,"R. montanensis,R. felis, andR. belliiwere frequently identified species, along with some potentially novelRickettsiastrains that were closely related toR. belliiandR. conorii.

  7. Development and Validation of an Improved PCR Method Using the 23S-5S Intergenic Spacer for Detection of Rickettsiae in Dermacentor variabilis Ticks and Tissue Samples from Humans and Laboratory Animals.

    PubMed

    Kakumanu, Madhavi L; Ponnusamy, Loganathan; Sutton, Haley T; Meshnick, Steven R; Nicholson, William L; Apperson, Charles S

    2016-04-01

    A novel nested PCR assay was developed to detectRickettsiaspp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) ofRickettsiaspp. The newly designed primers were evaluated using genomic DNA from 11Rickettsiaspecies belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to otherRickettsia-specific PCR targets (ompA,gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11Rickettsiaspp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from "CandidatusRickettsia amblyommii." Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adultDermacentor variabilisticks. The nested 23S-5S IGS assay detectedRickettsiaDNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species ofRickettsia The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species ofRickettsiain the ticks. "CandidatusRickettsia amblyommii,"R. montanensis,R. felis, andR. belliiwere frequently identified species, along with some potentially novelRickettsiastrains that were closely related toR. belliiandR. conorii. PMID:26818674

  8. Molecular identification of adulteration in mutton based on mitochondrial 16S rRNA gene.

    PubMed

    Xu, Jia; Zhao, Wei; Zhu, Mengru; Wen, Yuanju; Xie, Tao; He, Xiaoqian; Zhang, Yongfeng; Cao, Suizhong; Niu, Lili; Zhang, Hongping; Zhong, Tao

    2016-01-01

    The aim of this study is to set up a protocol for identification of the adulteration in mutton based on mitochondrial 16S rRNA gene. The multiplex polymerase chain reaction (multi-PCR) assay was carried out to trace the impure DNA in mutton. A universal primer pair yielded an approximate 610 bp fragment in mutton, pork, duck, chicken, horse and cat meats. The amplicons of multi-PCR assay represented the species-specific products, which could be discriminated by the size ranging from 106 bp to 532 bp. Subsequently, the authentication of each fragment was also confirmed by sequencing. Random analyses of adulterants with various meats yielded the identical results to their components, showing the suitability of the multi-PCR assay for tracing of adulterant meats with high-accuracy and precision. This assay was sensitive to detect the species-specific DNA in different proportional mixtures of mutton and duck/pork (9.1%-90.9%). In conclusion, this multi-PCR assay successfully discriminated the double-, triple-, quadruple-, and quintuple-mixtures containing variant counterparts. This method will be particularly useful in the detection of mutton adulteration in processed foods further. PMID:24739005

  9. Towards a phylogeny of the genus Vibrio based on 16S rRNA sequences.

    PubMed

    Dorsch, M; Lane, D; Stackebrandt, E

    1992-01-01

    The inter- and intrageneric relationships of the genus Vibrio were investigated by performing a comparative analysis of the 16S rRNAs of 10 species, including four pathogenic representatives. The results of immunological and 5S rRNA studies were confirmed in that the genus is a neighboring taxon of the family Enterobacteriaceae. With regard to the intrageneric structure, Vibrio alginolyticus, Vibrio campbellii, Vibrio natriegens, Vibrio harveyi, Vibrio proteolyticus, Vibrio parahaemolyticus, and Vibrio vulnificus form the core of the genus, while Vibrio (Listonella) anguillarum, Vibrio diazotrophicus, and Vibrio hollisae are placed on the outskirts of the genus. Variable regions around positions 80, 180, and 450 could be used as target sites for genus- and species-specific oligonucleotide probes and polymerase chain reaction primers to be used in molecular identification.

  10. Promoter of the Mycoplasma pneumoniae rRNA operon.

    PubMed Central

    Hyman, H C; Gafny, R; Glaser, G; Razin, S

    1988-01-01

    RNA transcripts starting from the 5' end of the single Mycoplasma pneumoniae rRNA operon were analyzed by several methods. By primer extension analysis a start site was found 62 nucleotides upstream from the start site of the 16S rRNA. This site was preceded by a putative Pribnow box; however, a defined -35 recognition region was absent. The cloned rRNA operon was transcribed in vitro by using purified RNA polymerase of Escherichia coli. A single start site could be demonstrated within a few nucleotides of the start site found by primer extension analysis of M. pneumoniae transcripts. When fragments from the cloned operon were used as hybridization probes, S1 nuclease mapping yielded a single transcript extending approximately 193 nucleotides upstream from the 16S rRNA start site. The region surrounding this endpoint did not resemble any known promoter sequence. Dot blot hybridization of M. pneumoniae RNA to three oligonucleotides consisting of nucleotides -5 to -21, -38 to -54, and -112 to -132 (from the start of the 16S rRNA gene) indicated that most rRNA transcripts were processed at the stem site preceding the 16S rRNA gene. The majority of the longer precursor transcripts, extending beyond this point, did not extend further upstream to an oligonucleotide consisting of nucleotides -112 to -132. It was concluded that transcription of the rRNA operon of M. pneumoniae is initiated by a single promoter. The nucleotide sequence of the region is presented. Images PMID:2838465

  11. Measurement of rRNA Variations in Natural Communities of Microorganisms on the Southeastern U.S. Continental Shelf †

    PubMed Central

    Kramer, Jonathan G.; Singleton, Fred L.

    1993-01-01

    The development of a clear understanding of the physiology of marine prokaryotes is complicated by the difficulties inherent in resolving the activity of various components of natural microbial communities. Application of appropriate molecular biological techniques offers a means of overcoming some of these problems. In this regard, we have used direct probing of bulk RNA purified from selective size fractions to examine variations in the rRNA content of heterotrophic communities and Synechococcus populations on the southeastern U.S. continental shelf. Heterotrophic communities in natural seawater cultures amended with selected substrates were examined. Synechococcus populations were isolated from the water column by differential filtration. The total cellular rRNA content of the target populations was assayed by probing RNA purified from these samples with an oligonucleotide complementing a universally conserved region in the eubacterial 16S rRNA (heterotrophs) or with a 1.5-kbp fragment encoding the Synechococcus sp. strain WH 7803 16S rRNA (cyanobacteria). The analyses revealed that heterotrophic bacteria responded to the addition of glucose and trace nutrients after a 6-h lag period. However, no response was detected after amino acids were added. The cellular rRNA content increased 48-fold before dropping to a value 20 times that detected before nutrients were added. Variations in the rRNA content from Synechococcus spp. followed a distinct diel pattern imposed by the phasing of cell division within the irradiance cycle. The results indicate that careful application of these appropriate molecular biological techniques can be of great use in discerning basic physiological characteristics of selected natural populations and the mechanisms which regulate growth at the subcellular level. Images PMID:16349009

  12. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and standard protocol for genomovar assignment.

    PubMed

    LaFrentz, B R; Waldbieser, G C; Welch, T J; Shoemaker, C A

    2014-07-01

    Genetic variability in 16S rRNA gene sequences has been demonstrated among isolates of Flavobacterium columnare, and a restriction fragment length polymorphism (RFLP) assay is available for genetic typing of this important fish pathogen. Interpretation of restriction patterns can be difficult due to the lack of a formal description of the expected number and sizes of DNA fragments generated for each of the described genomovars. In this study, partial 16S rRNA gene sequences (ca. 1250-bp fragment) from isolates representing each described genomovar and isolates generating unique restriction patterns were cloned and sequenced. The results demonstrated that some isolates contained up to three different 16S rRNA genes whose sequences generate different RFLP patterns due to intragenomic heterogeneity within HaeIII restriction sites. The occurrence of HaeIII restriction sites within the portion of the 16S rRNA gene used for typing the F. columnare isolates and intragenomic heterogeneity within these sites explained the restriction patterns observed following RFLP analyses. This research provides a standard protocol for typing isolates of F. columnare by RFLP and a formal description of the expected restriction patterns for the previously described genomovars I, II, II-B and III. Additionally, we describe a new genomovar, I/II.

  13. Real-time PCR and sequencing assays for rapid detection and identification of avian schistosomes in environmental samples.

    PubMed

    Jothikumar, Narayanan; Mull, Bonnie J; Brant, Sara V; Loker, Eric S; Collinson, Jeremy; Secor, W Evan; Hill, Vincent R

    2015-06-15

    Cercarial dermatitis, also known as swimmer's itch, is an allergenic skin reaction followed by intense itching caused by schistosome cercariae penetrating human skin. Cercarial dermatitis outbreaks occur globally and are frequently associated with freshwater lakes and are occasionally associated with marine or estuarine waters where birds reside year-round or where migratory birds reside. In this study, a broadly reactive TaqMan assay targeting 18S rRNA gene (ribosomal DNA [rDNA]) sequences that was based on a genetically diverse panel of schistosome isolates representing 13 genera and 20 species (the 18S rDNA TaqMan assay) was developed. A PCR assay was also developed to amplify a 28S rDNA region for subsequent sequencing to identify schistosomes. When applied to surface water samples seeded with Schistosoma mansoni cercariae, the 18S rDNA TaqMan assay enabled detection at a level of 5 S. mansoni cercariae in 100 liters of lake water. The 18S rDNA TaqMan and 28S rDNA PCR sequencing assays were also applied to 100-liter water samples collected from lakes in Nebraska and Wisconsin where there were reported dermatitis outbreaks. Avian schistosome DNA was detected in 11 of 34 lake water samples using the TaqMan assay. Further 28S rDNA sequence analysis of positive samples confirmed the presence of avian schistosome DNA and provided a preliminary identification of the avian schistosomes in 10 of the 11 samples. These data indicate that the broadly schistosome-reactive TaqMan assay can be effective for rapid screening of large-volume water samples for detection of avian schistosomes, thereby facilitating timely response actions to mitigate or prevent dermatitis outbreaks. Additionally, samples positive by the 18S rDNA TaqMan assay can be further assayed using the 28S rDNA sequencing assay to both confirm the presence of schistosomes and contribute to their identification.

  14. Real-Time PCR and Sequencing Assays for Rapid Detection and Identification of Avian Schistosomes in Environmental Samples

    PubMed Central

    Mull, Bonnie J.; Brant, Sara V.; Loker, Eric S.; Collinson, Jeremy; Secor, W. Evan; Hill, Vincent R.

    2015-01-01

    Cercarial dermatitis, also known as swimmer's itch, is an allergenic skin reaction followed by intense itching caused by schistosome cercariae penetrating human skin. Cercarial dermatitis outbreaks occur globally and are frequently associated with freshwater lakes and are occasionally associated with marine or estuarine waters where birds reside year-round or where migratory birds reside. In this study, a broadly reactive TaqMan assay targeting 18S rRNA gene (ribosomal DNA [rDNA]) sequences that was based on a genetically diverse panel of schistosome isolates representing 13 genera and 20 species (the 18S rDNA TaqMan assay) was developed. A PCR assay was also developed to amplify a 28S rDNA region for subsequent sequencing to identify schistosomes. When applied to surface water samples seeded with Schistosoma mansoni cercariae, the 18S rDNA TaqMan assay enabled detection at a level of 5 S. mansoni cercariae in 100 liters of lake water. The 18S rDNA TaqMan and 28S rDNA PCR sequencing assays were also applied to 100-liter water samples collected from lakes in Nebraska and Wisconsin where there were reported dermatitis outbreaks. Avian schistosome DNA was detected in 11 of 34 lake water samples using the TaqMan assay. Further 28S rDNA sequence analysis of positive samples confirmed the presence of avian schistosome DNA and provided a preliminary identification of the avian schistosomes in 10 of the 11 samples. These data indicate that the broadly schistosome-reactive TaqMan assay can be effective for rapid screening of large-volume water samples for detection of avian schistosomes, thereby facilitating timely response actions to mitigate or prevent dermatitis outbreaks. Additionally, samples positive by the 18S rDNA TaqMan assay can be further assayed using the 28S rDNA sequencing assay to both confirm the presence of schistosomes and contribute to their identification. PMID:25862226

  15. Homologous genes for mouse 4.5S hybRNA are found in all eukaryotes and their low molecular weight RNA transcripts intermolecularly hybridize with eukaryotic 18S ribosomal RNAs.

    PubMed

    Trinh-Rohlik, Q; Maxwell, E S

    1988-07-11

    Previous work has reported the isolation and sequencing of a mouse low molecular weight RNA species designated 4.5S hybridizing RNA or hybRNA because of its ability to intermolecularly hybridize with mouse mRNA and 18S rRNA sequences. Using synthetic DNA oligonucleotide probes we have examined the conservation of this gene sequence and its expression as a lmwRNA transcript across evolution. Southern blot analysis has shown that homologous genes of single or low copy number are found in all eukaryotes examined as well as in E. coli. Northern blot analysis has demonstrated 4.5S hybRNA transcription in all mouse tissues as well as expression in yeast and Xenopus laevis as lmwRNAs of approximately 130 and 100 nucleotides, respectively, as compared with mouse/rat/hamster species of approximately 87 nucleotides. Yeast and X. laevis 4.5S hybRNA homologs, isolated by hybrid-selection, were shown by Northern blot analysis to intermolecularly hybridize with homologous as well as heterologous 18S rRNA sequences. The conservation of 4.5S hybRNA homologous genes and their expression as lmwRNA transcripts with common intermolecular RNA:RNA hybridization capabilities in fungi, amphibians, and mammals argues for a common, conserved and required biological function for this lmwRNA in all eukaryotes and potential utilization of its intermolecular RNA:RNA hybridization capabilities to carry out this function.

  16. RAP, the sole octotricopeptide repeat protein in Arabidopsis, is required for chloroplast 16S rRNA maturation.

    PubMed

    Kleinknecht, Laura; Wang, Fei; Stübe, Roland; Philippar, Katrin; Nickelsen, Jörg; Bohne, Alexandra-Viola

    2014-02-01

    The biogenesis and activity of chloroplasts in both vascular plants and algae depends on an intracellular network of nucleus-encoded, trans-acting factors that control almost all aspects of organellar gene expression. Most of these regulatory factors belong to the helical repeat protein superfamily, which includes tetratricopeptide repeat, pentatricopeptide repeat, and the recently identified octotricopeptide repeat (OPR) proteins. Whereas green algae express many different OPR proteins, only a single orthologous OPR protein is encoded in the genomes of most land plants. Here, we report the characterization of the only OPR protein in Arabidopsis thaliana, RAP, which has previously been implicated in plant pathogen defense. Loss of RAP led to a severe defect in processing of chloroplast 16S rRNA resulting in impaired chloroplast translation and photosynthesis. In vitro RNA binding and RNase protection assays revealed that RAP has an intrinsic and specific RNA binding capacity, and the RAP binding site was mapped to the 5' region of the 16S rRNA precursor. Nucleoid localization of RAP was shown by transient green fluorescent protein import assays, implicating the nucleoid as the site of chloroplast rRNA processing. Taken together, our data indicate that the single OPR protein in Arabidopsis is important for a basic process of chloroplast biogenesis.

  17. Single Laboratory Comparison of Quantitative Real-time PCR Assays for the Detection of Fecal Pollution

    EPA Science Inventory

    There are numerous quantitative real-time PCR (qPCR) assays available to detect and enumerate fecal pollution in ambient waters. Each assay employs distinct primers and probes that target different rRNA genes and microorganisms leading to potential variations in concentration es...

  18. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    PubMed Central

    2010-01-01

    Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s) occurring in 39.6% of the analyzed individuals (both male and female) were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH) was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs) enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement. PMID:20051104

  19. Quantitative Northern Blot Analysis of Mammalian rRNA Processing.

    PubMed

    Wang, Minshi; Pestov, Dimitri G

    2016-01-01

    Assembly of eukaryotic ribosomes is an elaborate biosynthetic process that begins in the nucleolus and requires hundreds of cellular factors. Analysis of rRNA processing has been instrumental for studying the mechanisms of ribosome biogenesis and effects of stress conditions on the molecular milieu of the nucleolus. Here, we describe the quantitative analysis of the steady-state levels of rRNA precursors, applicable to studies in mammalian cells and other organisms. We include protocols for gel electrophoresis and northern blotting of rRNA precursors using procedures optimized for the large size of these RNAs. We also describe the ratio analysis of multiple precursors, a technique that facilitates the accurate assessment of changes in the efficiency of individual pre-rRNA processing steps. PMID:27576717

  20. The terminal balls characteristic of eukaryotic rRNA transcription units in chromatin spreads are rRNA processing complexes.

    PubMed

    Mougey, E B; O'Reilly, M; Osheim, Y; Miller, O L; Beyer, A; Sollner-Webb, B

    1993-08-01

    When spread chromatin is visualized by electron microscopy, active rRNA genes have a characteristic Christmas tree appearance: From a DNA "trunk" extend closely packed "branches" of nascent transcripts whose ends are decorated with terminal "balls." These terminal balls have been known for more than two decades, are shown in most biology textbooks, and are reported in hundreds of papers, yet their nature has remained elusive. Here, we show that a rRNA-processing signal in the 5'-external transcribed spacer (ETS) of the Xenopus laevis ribosomal primary transcript forms a large, processing-related complex with factors of the Xenopus oocyte, analogous to 5' ETS processing complexes found in other vertebrate cell types. Using mutant rRNA genes, we find that the same rRNA residues are required for this biochemically defined complex formation and for terminal ball formation, analyzed electron microscopically after injection of these cloned genes into Xenopus oocytes. This, plus other presented evidence, implies that rRNA terminal balls in Xenopus, and by inference, also in the multitude of other species where they have been observed, are the ultrastructural visualization of an evolutionarily conserved 5' ETS processing complex that forms on the nascent rRNA.

  1. Control of rRNA transcription in Escherichia coli.

    PubMed Central

    Condon, C; Squires, C; Squires, C L

    1995-01-01

    The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

  2. Identification of Erwinia stewartii by a ligase chain reaction assay.

    PubMed Central

    Wilson, W J; Wiedmann, M; Dillard, H R; Batt, C A

    1994-01-01

    A PCR-coupled ligase chain reaction (LCR) assay was developed to distinguish the plant pathogenic bacterium Erwinia stewartii from other erwiniae. This new technique allows discrimination to the species level on the basis of a single-base-pair difference in the 16S rRNA gene which is unique to E. stewartii. Portions of the 16S rRNA genes of E. stewartii and the closely related Erwinia herbicola were sequenced. From comparison of the two 16S rRNA gene regions, two primer pairs were constructed such that only E. stewartii DNA gave a product in the LCR assay. The ligated product was separated from the radioactively labelled primers by denaturing polyacrylamide gel electrophoresis and visualized by autoradiography. Twenty-four different Erwinia species and strains were tested by PCR-coupled LCR to verify the specificity of the assay, and only E. stewartii strains gave a positive reaction. In addition, infected and healthy plant material was also assayed. E. stewartii was detected in infected plant material, even when large populations of epiphytic bacteria were present. No enrichment was necessary for detection of the pathogen in corn leaves. This assay has potential as a diagnostic technique for the detection of E. stewartii in infected plant and vector material. Images PMID:7509585

  3. A tandem array of 5S ribosomal RNA genes in Pythium irregulare.

    PubMed

    Belkhiri, A; Intengan, H; Klassen, G R

    1997-02-28

    The 5S ribosomal RNA genes of the oomycete Pythium irregulare exist in tandem arrays unlinked to the rDNA repeat unit. A clone with a 9.2-kb insert containing an array of 5S genes was identified in a lambda genomic library and was characterized by restriction mapping and partial sequencing. The array consisted of 9 apparently identical 5S genes and their spacers in tandem, followed by a diverged 5S-like sequence that is likely to be a pseudogene. This gene arrangement, although almost universal in plants and animals, is rare in fungi and protists.

  4. Quantitative rRNA-targeted solution-based hybridization assay using peptide nucleic acid molecular beacons.

    PubMed

    Li, Xu; Morgenroth, Eberhard; Raskin, Lutgarde

    2008-12-01

    The potential of a solution-based hybridization assay using peptide nucleic acid (PNA) molecular beacon (MB) probes to quantify 16S rRNA of specific populations in RNA extracts of environmental samples was evaluated by designing PNA MB probes for the genera Dechloromonas and Dechlorosoma. In a kinetic study with 16S rRNA from pure cultures, the hybridization of PNA MB to target 16S rRNA exhibited a higher final hybridization signal and a lower apparent rate constant than the hybridizations to nontarget 16S rRNAs. A concentration of 10 mM NaCl in the hybridization buffer was found to be optimal for maximizing the difference between final hybridization signals from target and nontarget 16S rRNAs. Hybridization temperatures and formamide concentrations in hybridization buffers were optimized to minimize signals from hybridizations of PNA MB to nontarget 16S rRNAs. The detection limit of the PNA MB hybridization assay was determined to be 1.6 nM of 16S rRNA. To establish proof for the application of PNA MB hybridization assays in complex systems, target 16S rRNA from Dechlorosoma suillum was spiked at different levels to RNA isolated from an environmental (bioreactor) sample, and the PNA MB assay enabled effective quantification of the D. suillum RNA in this complex mixture. For another environmental sample, the quantitative results from the PNA MB hybridization assay were compared with those from clone libraries.

  5. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-08-24

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon.

  6. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  7. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation

    PubMed Central

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G.; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S. Kundhavai; Klaholz, Bruno P.; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  8. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  9. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  10. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  11. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  12. A search for the Bs meson in Υ(5S) decays

    NASA Astrophysics Data System (ADS)

    Shipsey, Ian

    2004-05-01

    The CLEO III detector has recorded approximately 0.5 fb-1 of e^+ e^- annihilation data at the Υ(5S) resonance. Using this data sample, we have searched for fully reconstructed Bs mesons in the reaction Υ(5S) arrow B_s^(*) barB_s^(*)

  13. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  14. The 5S lean method as a tool of industrial management performances

    NASA Astrophysics Data System (ADS)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  15. Identifications of 5{{s}_{1/2}}-5{{p}_{3/2}} and 5{{s}^{2}}-5s5p EUV transitions of promethium-like Pt, Ir, Os and Re

    NASA Astrophysics Data System (ADS)

    Bekker, H.; Versolato, O. O.; Windberger, A.; Oreshkina, N. S.; Schupp, R.; Baumann, T. M.; Harman, Z.; Keitel, C. H.; Schmidt, P. O.; Ullrich, J.; Crespo López-Urrutia, J. R.

    2015-07-01

    We investigated Pm-, Nd-, and Pr-like spectra in the extreme ultra-violet region around 20 nm of Pt, Ir, Os, and Re (Z = 78-75) produced in the Heidelberg electron beam ion trap. Identification of the transitions was supported by several theoretical calculations, including collisional radiative modeling of the observed spectra. Special attention is given to the identifications of the alkaline-like 5{{s}1/2}-5{{p}3/2} resonance lines in promethium-like highly charged ions. Previous identifications of these lines have been tentative at best due to disagreements with theory and doubts about the experimental charge state identifications. Our experimental results for the 5{{s}1/2}-5{{p}3/2} wavelengths are accurate at the 0.005%-level. Understanding the level-structure of ions near the 4f-5s level crossing is of particular importance for future searches of a possible fine-structure constant variation, and new optical clocks.

  16. Appearance and evolution of the specific chromosomal rearrangements associated with malignant transformation of mouse m5S cells

    SciTech Connect

    Kodama, S.; Okumura, Y.; Komatsu, K.; Sasaki, M.S. )

    1991-06-01

    Chromosomal alterations were studied during the acquisition of malignant phenotypes in two karyotypically distinct cells isolated from transformed foci induced by x-irradiation in mouse m5S cells. Because the transformants, despite foci origin, showed low ability to grow in agar, they were cultured in vitro with serial transfer schedules to allow further cell generations and assayed for anchorage independence (AI) at each passage level. The AI frequency increased with the cell doubling numbers. Chromosome analysis showed that a focus was one cell origin, but the transformants showed karyotypic instability during cell proliferation, giving rise to the rearrangements clustered in the distal region of the specific chromosomes. These rearrangements appeared to be directed toward the acquisition of malignant phenotypes. Analysis of the types and sites of rearrangements indicated that a mechanism exists that induces frequent rearrangements of the specific region of a chromosome during the process of transformation into the malignant state.

  17. Targeting single-nucleotide polymorphisms in the 16S rRNA gene to detect and differentiate Legionella pneumophila and non-Legionella pneumophila species.

    PubMed

    Zhan, Xiao-Yong; Hu, Chao-Hui; Zhu, Qing-Yi

    2016-08-01

    A PCR-based method targeting single-nucleotide polymorphisms (SNPs) in the 16S rRNA gene was developed for differential identification of Legionella pneumophila and non-Legionella pneumophila. Based on the bioinformatics analysis for 176 Legionella 16S rRNA gene fragments of 56 different Legionella species, a set of SNPs, A(628)C(629) was found to be highly specific to L. pneumophila strains. A multiplex assay was designed that was able to distinguish sites with limited sequence heterogeneity between L. pneumophila and non-L. pneumophila in the targeted 16S rRNA gene. The assay amplified a 261-bp amplicon for Legionella spp. and a set of 203- and 97-bp amplicons only specific to L. pneumophila species. Among 49 ATCC strains and 284 Legionella isolates from environmental water and clinical samples, 100 % of L. pneumophila and non-L. pneumophila strains were correctly identified and differentiated by this assay. The assay presents a more rapid, sensitive and alternative method to the currently available PCR-sequencing detection and differentiation method.

  18. Chemical accessibility of the 4.5S RNA in spinach chloroplast ribosomes.

    PubMed Central

    Kumagai, I; Bartsch, M; Subramanian, A R; Erdmann, V A

    1983-01-01

    We have examined the accessibility to diethylpyrocarbonate of spinach chloroplast 4.5S ribosomal RNA when free and when it is part of the ribosomal structure. The modifications in free 4.5S RNA were found mostly in single-stranded regions of the secondary structure model proposed in our previous paper (Kumagai, I. et al. (1982) J.B.C. 257, 12924-28): adenines at positions 17, 19, 33, 36, 54, 55, 60, 64, 68, 72, 77, 86 and 87 were identified as the reactive residues. On the other hand, in 4.5S RNA in 70S ribosomes or 50S subunits, adenine 33 was exclusively modified, and its reactivity was much higher than in free 4.5S RNA. This highly accessible A33 of spinach 4.5S RNA is located within a characteristic seven nucleotide sequence, which is found in the 4.5S rRNAs from spinach, tobacco and a fern but deleted in 4.5S RNAs from maize and wheat. Images PMID:6828382

  19. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  20. Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer).

    PubMed

    Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

    2013-01-16

    The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples.

  1. Primary structure of the 5 S subunit of transcarboxylase as deduced from the genomic DNA sequence.

    PubMed

    Thornton, C G; Kumar, G K; Shenoy, B C; Haase, F C; Phillips, N F; Park, V M; Magner, W J; Hejlik, D P; Wood, H G; Samols, D

    1993-09-13

    Transcarboxylase from Propionibacterium shermanii is a complex biotin-containing enzyme composed of 30 polypeptides of three different types. It is composed of six dimeric outer subunits associated with a central cylindrical hexameric subunit through 12 biotinyl subunits; three outer subunits on each face of the central hexamer. Each outer dimer is termed a 5 S subunit which associates with two biotinyl subunits. The enzyme catalyzes a two-step reaction in which methylmalonyl-CoA and pyruvate form propionyl-CoA and oxalacetate, the 5 S subunit specifically catalyzing one of these reactions. We report here the cloning, sequencing and expression of the monomer of the 5 S subunit. The gene was identified by matching amino acid sequences derived from isolated authentic 5 S peptides with the deduced sequence of an open reading frame present on a cloned P. shermanii genomic fragment known to contain the gene encoding the 1.3 S biotinyl subunit. The cloned 5 S gene encodes a protein of 519 amino acids, M(r) 57,793. The deduced sequence shows regions of extensive homology with that of pyruvate carboxylase and oxalacetate decarboxylase, two enzymes which catalyze the same or reverse reaction. A fragment was subcloned into pUC19 in an orientation such that the 5 S open reading frame could be expressed from the lac promoter of the vector. Crude extracts prepared from these cells contained an immunoreactive band on Western blots which co-migrated with authentic 5 S and were fully active in catalyzing the 5 S partial reaction. We conclude that we have cloned, sequenced and expressed the monomer of the 5 S subunit and that the expressed product is catalytically active. PMID:8365490

  2. Angular distribution of Xe 5s. -->. epsilonp photoelectrons: Disagreement between experiment and theory

    SciTech Connect

    Fahlman, A.; Carlson, T.A.; Krause, M.O.

    1983-04-11

    The angular asymmetry parameter ..beta.. for the Xe 5s..-->..epsilonp photoelectrons has been studied with use of synchrotron radiation (h..nu.. = 28--65 eV). The present results show that the relativistic random-phase approximation theory does not satisfactorily describe the Xe 5s photoionization process close to the Cooper minimum and thus require a renewed theoretical approach. The 5s partial photoionization cross section was obtained over the same photon region and the results agree with experimental values found in the literature.

  3. Abridged 5S rDNA units in sea beet (Beta vulgaris subsp. maritima).

    PubMed

    Turner, Daniel J; Brown, Terence A

    2005-04-01

    Amplification by polymerase chain reaction of the 5S rDNA repeat units of Beta vulgaris subsp. maritima resulted in a 350-bp product corresponding to the full-length 5S unit, but also revealed 4 abridged unit classes, each with a deletion that removed most of the spacer and 12-76 bp of the coding sequence. Each abridged type lacks at least 1 of the conserved elements involved in transcription of the 5S gene, and so appear to be nonfunctional. Network analysis revealed that the abridged units are evolving in the same manner as the full-length versions.

  4. Genetic reconstruction of protozoan rRNA decoding sites provides a rationale for paromomycin activity against Leishmania and Trypanosoma.

    PubMed

    Hobbie, Sven N; Kaiser, Marcel; Schmidt, Sebastian; Shcherbakov, Dmitri; Janusic, Tanja; Brun, Reto; Böttger, Erik C

    2011-05-01

    Aminoglycoside antibiotics target the ribosomal decoding A-site and are active against a broad spectrum of bacteria. These compounds bind to a highly conserved stem-loop-stem structure in helix 44 of bacterial 16S rRNA. One particular aminoglycoside, paromomycin, also shows potent antiprotozoal activity and is used for the treatment of parasitic infections, e.g. by Leishmania spp. The precise drug target is, however, unclear; in particular whether aminoglycoside antibiotics target the cytosolic and/or the mitochondrial protozoan ribosome. To establish an experimental model for the study of protozoan decoding-site function, we constructed bacterial chimeric ribosomes where the central part of bacterial 16S rRNA helix 44 has been replaced by the corresponding Leishmania and Trypanosoma rRNA sequences. Relating the results from in-vitro ribosomal assays to that of in-vivo aminoglycoside activity against Trypanosoma brucei, as assessed in cell cultures and in a mouse model of infection, we conclude that aminoglycosides affect cytosolic translation while the mitochondrial ribosome of trypanosomes is not a target for aminoglycoside antibiotics.

  5. Pressure broadening and line shifting of atomic strontium 5s{sup 2} {sup 1}S{sub 0}{yields}5s5p {sup 3}P{sub 1} and 5s5p {sup 3}P{sub 0,1,2}{yields}5s6s {sup 3}S{sub 1} absorption transitions induced by noble-gas collisions

    SciTech Connect

    Holtgrave, Jeremy C.; Wolf, Paul J.

    2005-07-15

    The broadening and shifting of spectral lines induced by collisions with the five noble gases in both the intercombination 5s{sup 2} {sup 1}S{sub 0}{yields}5s5p {sup 3}P{sub 1} system and the triplet 5s5p {sup 3}P{sub 0,1,2}{yields}5s6s {sup 3}S{sub 1} manifold of Sr are studied using tunable dye laser absorption spectroscopy. Cross sections for impact broadening and line shifting are determined from an examination of the spectral line profiles. These results are utilized in an analysis to compute difference potentials modeled by the Lennard-Jones (6-12) potential and the coefficients C{sub 6} and C{sub 12} derived from this analysis are reported.

  6. 104. JOB NO. 1347F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    104. JOB NO. 1347-F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD MOTOR COMPANY; LONGITUDINAL SECTION AND TRUSS DETAILS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  7. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    PubMed

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-11-11

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  8. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  9. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  10. Evaluation of nucleic acid sequence based amplification using fluorescence resonance energy transfer (FRET-NASBA) in quantitative detection of Aspergillus 18S rRNA.

    PubMed

    Park, Chulmin; Kwon, Eun-Young; Shin, Na-Young; Choi, Su-Mi; Kim, Si-Hyun; Park, Sun Hee; Lee, Dong-Gun; Choi, Jung-Hyun; Yoo, Jin-Hong

    2011-01-01

    We attempted to apply fluorescence resonance energy transfer technology to nucleic acid sequence-based amplification (FRET-NASBA) on the platform of the LightCycler system to detect Aspergillus species. Primers and probes for the Aspergillus 18S rRNA were newly designed to avoid overlapping with homologous sequences of human 18s rRNA. NASBA using molecular beacon (MB) showed non-specific results which have been frequently observed from controls, although it showed higher sensitivity (10(-2) amol) than the FRET. FRET-NASBA showed a sensitivity of 10(-1) amol and a high fidelity of reproducibility from controls. As FRET technology was successfully applied to the NASBA assay, it could contribute to diverse development of the NASBA assay. These results suggest that FRET-NASBA could replace previous NASBA techniques in the detection of Aspergillus.

  11. Interaction of Xenopus TFIIIC with the TFIIIA.5 S RNA gene complex.

    PubMed

    Keller, H J; Romaniuk, P J; Gottesfeld, J M

    1992-09-01

    The general transcription factor TFIIIC is necessary for transcription initiation by RNA polymerase III. TFIIIC binds predominantly to the B-Block promoter element, which is present in tRNA genes, several viral RNA genes and repetitive DNA elements, and to the TFIIIA.DNA complex on 5 S RNA genes. Here we report a characterization of Xenopus laevis TFIIIC and its interaction with the TFIIIA.5 S RNA gene complex. A polypeptide with apparent molecular mass of 85 kDa was specifically cross-linked to a B-Block oligonucleotide by UV light. This polypeptide was present in the partially purified TFIIIC fraction and in a complex with a B-Block double-stranded oligonucleotide isolated by nondenaturing gel electrophoresis. TFIIIC.TFIIIA.DNA gel mobility shift complexes were obtained using B-Block DNA affinity-purified TFIIIC and buffer conditions employing low Mg2+ (1 mM) and high dithiothreitol (7 mM) concentrations. Three TFIIIC.TFIIIA.5 S RNA gene complexes were observed by gel mobility shift analysis. One of these complexes was resistant to dissociation by the addition of competing DNA, but the formation of all three complexes was prevented by the inclusion of excess specific competitor DNA in the initial binding reactions. The apparent affinity of TFIIIC for the TFIIIA.5 S DNA complex was 5-fold higher for the somatic-type 5 S RNA gene than for the oocyte-type 5 S RNA gene. Mutations near the 5' boundary of the TFIIIA binding site alter the DNase I footprint of the TFIIIA.DNA complex and reduce the affinity of TFIIIA-mutant 5 S gene complexes for TFIIIC. Differences in TFIIIC affinity for the two classes of 5 S RNA genes may play a role in the developmental regulation of these gene families. PMID:1517247

  12. Satellite DNA derived from 5S rDNA in Physalaemus cuvieri (Anura, Leiuperidae).

    PubMed

    Vittorazzi, S E; Lourenço, L B; Del-Grande, M L; Recco-Pimentel, S M

    2011-01-01

    In the present study, we describe for the first time a family of 190-bp satellite DNA related to 5S rDNA in anurans and the existence of 2 forms of 5S rDNA, type I (201 bp) and type II (690 bp). The sequences were obtained from genomic DNA of Physalaemus cuvieri from Palmeiras, State of Bahia, Brazil. Analysis of the nucleotide sequence revealed that the satellite DNA obtained by digestion with EcoRI, called PcP190EcoRI, is 70% similar to the coding region of type I 5S rDNA and 66% similar to the coding region of type II 5S rDNA. Membrane hybridization and PCR amplification of the sequence showed that PcP190EcoRI is tandemly repeated. The satellite DNA as well as type I and type II 5S rDNA were localized in P. cuvieri chromosomes by fluorescent in situ hybridization. The PcP190EcoRI sequence was found in the centromeres of chromosomes 1-5 and in the pericentromeric region of chromosome 3. Type I 5S rDNA was detected in chromosome 3, coincident with the site of PcP190EcoRI. Type II 5S rDNA was located interstitially in the long arm of chromosome 5. None of these sequences co-localized with nucleolar organizer regions. Our data suggests that this satellite DNA originates from the 5S ribosomal multigene family, probably by gene duplication, nucleotide divergence and sequence dispersion in the genome.

  13. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  14. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  15. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  16. Structural polymorphism in the major groove of a 5S RNA gene complements the zinc finger domains of transcription factor IIIA.

    PubMed Central

    Huber, P W; Morii, T; Mei, H Y; Barton, J K

    1991-01-01

    Metal complexes that bind to DNA on the basis of shape-selection have been used to map the conformational features of the DNA binding site for transcription factor IIIA. Conformationally distinct segments are detected on the 5S rRNA gene that correspond closely to the binding sites identified for the individual zinc finger domains of the protein. The local conformations are characterized by a major groove opened because of a change in base pair inclination and/or displacement at a central 5'-pyrimidine-purine-3' step, flanked by a widened minor groove, as would arise at the junctions between alternating B- and A-like DNA segments. Docking experiments with a consensus structure of a zinc finger reveal that the mixed A-B binding site accommodates the peptide domain better than either canonical B- or A-DNA helices. The close structural matching of the conformational variations in the 5S rDNA both to the proposed sites of zinc finger binding and to the shape of an individual zinc finger domain points to DNA structural polymorphism as providing an important determinant in recognition. In particular, shape selection in the 5' half of the internal control region may orient the multiple finger domains. Images PMID:1961749

  17. Intraspecific 16S rRNA gene diversity among clinical isolates of Neisseria species.

    PubMed

    Mechergui, Arij; Achour, Wafa; Hassen, Assia Ben

    2014-05-01

    In the present work, nearly the entire 16S rRNA gene sequences of 46 clinical samples of Neisseria spp. were determined, and the aligned sequences were analyzed to investigate the diversity of 16S rRNA genes in each commensal Neisseria species. Two 16S rRNA types were identified in two Neisseria sicca strains, three 16S rRNA types in five Neisseria macacae strains, fourteen 16S rRNA types in twenty Neisseria flavescens isolates, and fourteen 16S rRNA types in nineteen Neisseria mucosa isolates. The number of nucleotides that were different between 16S rRNA sequences within specie ranged from 1 to 15. We found high intraspecific sequence variation in 16S rRNA genes of Neisseria spp. strains.

  18. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    PubMed Central

    Suslu, Hikmet Turan; Celikoglu, Erhan; Borekcı, Ali; Hıcdonmez, Tufan; Suslu, Hüsnü

    2011-01-01

    Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches. PMID:23125496

  19. A Neurospora crassa ribosomal protein gene, homologous to yeast CRY1, contains sequences potentially coordinating its transcription with rRNA genes.

    PubMed Central

    Tyler, B M; Harrison, K

    1990-01-01

    We have isolated and sequenced a Neurospora crassa ribosomal protein gene (designated crp-2) strongly homologous to the rp59 gene (CRY1) of yeast and the S14 ribosomal protein gene of mammals. The inferred sequence of the crp-2 protein is more homologous (83%) to the mammalian S14 sequence than to the yeast rp59 sequence (69%). The gene has three intervening sequences (IVSs) two of which are offset 7 bp from the position of IVSs in the mammalian genes. None correspond to the position of the IVS in the yeast gene. Crp-2 was mapped by RFLP analysis to the right arm of linkage group III. The 5' region of the gene contains three copies of a sequence, the Ribo box, previously shown to be required for transcription of both 5S and 40S rRNA genes. We speculate that the Ribo box may coordinate ribosomal protein and rRNA gene transcription. Images PMID:1977135

  20. Random mutagenesis of yeast 25S rRNA identify bases critical for 60S subunit structural integrity and function

    PubMed Central

    Nemoto, Naoki; Udagawa, Tsuyoshi; Chowdhury, Wasimul; Kitabatake, Makoto; Shin, Byung-shik; Hiraishi, Hiroyuki; Wang, Suzhi; Singh, Chingakham Ranjit; Brown, Susan J.; Ohno, Mutsuhito; Asano, Katsura

    2013-01-01

    In yeast Saccharomyces cerevisiae, 25S rRNA makes up the major mass and shape of the 60S ribosomal subunit. During translation initiation, the 60S subunit joins the 40S initiation complex, producing the 80S initiation complex. During elongation, the 60S subunit binds the CCA-ends of aminoacyl- and peptidyl-tRNAs at the A-loop and P-loop, respectively, transferring the peptide onto the α-amino group of the aminoacyl-tRNA. To study the role of 25S rRNA in translation in vivo, we randomly mutated 25S rRNA and isolated and characterized seven point mutations that affected yeast cell growth and polysome profiles. Four of these mutations, G651A, A1435U, A1446G and A1587G, change a base involved in base triples crucial for structural integrity. Three other mutations change bases near the ribosomal surface: C2879U and U2408C alter the A-loop and P-loop, respectively, and G1735A maps near a Eukarya-specific bridge to the 40S subunit. By polysome profiling in mmslΔ mutants defective in nonfunctional 25S rRNA decay, we show that some of these mutations are defective in both the initiation and elongation phases of translation. Of the mutants characterized, C2879U displays the strongest defect in translation initiation. The ribosome transit-time assay directly shows that this mutation is also defective in peptide elongation/termination. Thus, our genetic analysis not only identifies bases critical for structural integrity of the 60S subunit, but also suggests a role for bases near the peptidyl transferase center in translation initiation. PMID:26824023

  1. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency.

    PubMed

    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa

    2016-05-01

    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2'-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2'-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA fromPyrococcus furiosus We find that the methylation efficacy at sites D and D' differ substantially, with substrate D' turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D' is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D' sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5'-end of the product. PMID:26925607

  2. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency.

    PubMed

    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa

    2016-05-01

    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2'-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2'-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA fromPyrococcus furiosus We find that the methylation efficacy at sites D and D' differ substantially, with substrate D' turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D' is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D' sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5'-end of the product.

  3. Formation of Tertiary Interactions during rRNA GTPase Center Folding.

    PubMed

    Rau, Michael J; Welty, Robb; Tom Stump, W; Hall, Kathleen B

    2015-08-28

    The 60-nt GTPase center (GAC) of 23S rRNA has a phylogenetically conserved secondary structure with two hairpin loops and a 3-way junction. It folds into an intricate tertiary structure upon addition of Mg(2+) ions, which is stabilized by the L11 protein in cocrystal structures. Here, we monitor the kinetics of its tertiary folding and Mg(2+)-dependent intermediate states by observing selected nucleobases that contribute specific interactions to the GAC tertiary structure in the cocrystals. The fluorescent nucleobase 2-aminopurine replaced three individual adenines, two of which make long-range stacking interactions and one that also forms hydrogen bonds. Each site reveals a unique response to Mg(2+) addition and temperature, reflecting its environmental change from secondary to tertiary structure. Stopped-flow fluorescence experiments revealed that kinetics of tertiary structure formation upon addition of MgCl2 are also site specific, with local conformational changes occurring from 5 ms to 4s and with global folding from 1 to 5s. Site-specific substitution with (15)N-nucleobases allowed observation of stable hydrogen bond formation by NMR experiments. Equilibrium titration experiments indicate that a stable folding intermediate is present at stoichiometric concentrations of Mg(2+) and suggest that there are two initial sites of Mg(2+) ion association. PMID:26210661

  4. Identification of coagulase-negative staphylococci isolated from ovine milk samples by PCR-RFLP of 16S rRNA and gap genes.

    PubMed

    Onni, T; Sanna, G; Cubeddu, G P; Marogna, G; Lollai, S; Leori, G; Tola, S

    2010-08-26

    The identification of coagulase-negative staphylococci (CNS) causing ovine infections remains problematic, although these bacteria are considered the main etiologic agents of subclinical mastitis in sheep and goats. In this study, 226 CNS isolates were collected from 2201 milking sarda sheep belonging to 15 flocks with high somatic cell count scores. All isolates were subjected to identification with the API Staph ID test, and then to the amplification of staphylococcal 16S rRNA and gap genes by PCR assays. The gap gene was subjected to restriction fragment length polymorphism analysis with the restriction endonuclease AluI, whereas the 16S rRNA gene was subjected to ribosomal fingerprinting with the restriction endonucleases RsaI, PstI and AluI. When PCR-RFLP patterns of CNS isolates were different from those of their reference strains, gap gene amplicons were sequenced for definitive identification. The API Staph ID test, in alternative to the genotypic identification method, produced considerably different results in terms of species identified within each group. Using the PCR-RFLP assay, most of the isolates clustered together with the Staphylococcus epidermidis type strain (131, corresponding to 57.9%), followed by S. caprae (34, corresponding to 15%) and S. chromogenes (30, corresponding to 13.2%). In conclusion, the PCR-RFLP assay of 16S rRNA and gap genes is a more reliable and reproducible method than the API Staph ID test for the identification of CNS causing sheep mastitis. PMID:20167442

  5. Impact of acquisition of 16S rRNA methylase RmtB on the fitness of Escherichia coli.

    PubMed

    Ou, Bingming; Chen, Lin; Song, Yujie; Yang, Ying; Zhang, Qian; Yang, Yi; Li, Luan; Tham, Wai Liang; Francis, David H; Zhu, Guoqiang

    2016-09-01

    The aim of this study was to elucidate the biological phenotypes of 16S rRNA methylase RmtB in Escherichia coli and the impact of RmtB acquisition on the fitness of the target bacterium. An rmtB in-frame deletion mutant in E. coli was constructed using a suicide vector (pDMS197)-based double crossover allelic exchange, and its corresponding complemented strain was established. Combined studies of microdilution susceptibility testing, conjugation experiments, growth kinetics assays, competitive experiments, biofilm formation tests and motility assays were performed to study the rmtB-mediated fitness among the prototype E. coli strain, its isogenic mutant and the corresponding complemented strain. The minimum inhibitory concentrations (MICs) of 4,6-disubstituted 2-deoxystreptamines for the rmtB wild-type strain, its isogenic mutant and the complemented strain were ≥1024, ≤2 and ≥1024mg/L, respectively. Both the growth rates and the competitive abilities of the wild-type and complemented strains were relatively inferior to the ΔrmtB mutant. There was no significant difference in biofilm formation and motility among the three strains. In conclusion, the data presented here suggest that acquisition of the 16S rRNA methylase gene rmtB in E. coli can exact a fitness cost on the bacteria, subsequently reducing the growth rate slightly and decreasing the competitive capacity of the bacterium, whereas it does not affect biofilm formation or motility. PMID:27530836

  6. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  7. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  8. rrnDB: documenting the number of rRNA and tRNA genes in bacteria and archaea.

    PubMed

    Lee, Zarraz May-Ping; Bussema, Carl; Schmidt, Thomas M

    2009-01-01

    A dramatic exception to the general pattern of single-copy genes in bacterial and archaeal genomes is the presence of 1-15 copies of each ribosomal RNA encoding gene. The original version of the Ribosomal RNA Database (rrnDB) cataloged estimates of the number of 16S rRNA-encoding genes; the database now includes the number of genes encoding each of the rRNAs (5S, 16S and 23S), an internally transcribed spacer region, and the number of tRNA genes. The rrnDB has been used largely by microbiologists to predict the relative rate at which microbial populations respond to favorable growth conditions, and to interpret 16S rRNA-based surveys of microbial communities. To expand the functionality of the rrnDB (http://ribosome.mmg.msu.edu/rrndb/index.php), the search engine has been redesigned to allow database searches based on 16S rRNA gene copy number, specific organisms or taxonomic subsets of organisms. The revamped database also computes average gene copy numbers for any collection of entries selected. Curation tools now permit rapid updates, resulting in an expansion of the database to include data for 785 bacterial and 69 archaeal strains. The rrnDB continues to serve as the authoritative, curated source that documents the phylogenetic distribution of rRNA and tRNA genes in microbial genomes.

  9. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.

    PubMed

    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A

    2008-01-01

    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  10. Interactions of aminoglycoside antibiotics with rRNA.

    PubMed

    Trylska, Joanna; Kulik, Marta

    2016-08-15

    Aminoglycoside antibiotics are protein synthesis inhibitors applied to treat infections caused mainly by aerobic Gram-negative bacteria. Due to their adverse side effects they are last resort antibiotics typically used to combat pathogens resistant to other drugs. Aminoglycosides target ribosomes. We describe the interactions of aminoglycoside antibiotics containing a 2-deoxystreptamine (2-DOS) ring with 16S rRNA. We review the computational studies, with a focus on molecular dynamics (MD) simulations performed on RNA models mimicking the 2-DOS aminoglycoside binding site in the small ribosomal subunit. We also briefly discuss thermodynamics of interactions of these aminoglycosides with their 16S RNA target. PMID:27528743

  11. Growth rate regulation of rRNA content of a marine Synechococcus (cyanobacterium) strain

    SciTech Connect

    Binder, B.J.; Liu, Y.C.

    1998-09-01

    The relationship between growth rate and rRNA content in a marine Synechococcus strain was examined. A combination of flow cytometry and whole-cell hybridization with fluorescently labeled 16S rRNA-targeted oligonucleotide probes was used to measure the rRNA content of Synechococcus strain WH8101 cells grown at a range of light-limited growth rates. The sensitivity of this approach was sufficient for the analysis of rRNA even in very slowly growing Synechococcus cells. The relationship between growth rate and cellular rRNA content comprised three phases: (1) at low growth rates, rRNA cell{sup {minus}1} remained approximately constant; (2) at intermediate rates, rRNA cell{sup {minus}1} increased proportionally with growth rate; and (3) at the highest, light-saturated rates, rRNA cell{sup {minus}1} dropped abruptly. Total cellular RNA was well correlated with the probe-based measure of rRNA and varied in a similar manner with growth rate. Mean cell volume and rRNA concentration were related to growth rate in a manner similar to rRNA cell{sup {minus}1}, although the overall magnitude linear increase in ribosome efficiency with increasing growth rate, which is consistent with the prevailing prokaryotic model at low growth rates. Taken together, these results support the notion that measurements of cellular rRNA content might be useful for estimating in situ growth rates in natural Synechococcus populations.

  12. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics.

  13. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  14. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  15. Strong nondipole effect created by multielectron correlation in 5s photoionization of xenon

    SciTech Connect

    Ricz, S.; Koever, A.; Varga, D.; Ricsoka, T.; Sankari, R.; Jurvansuu, M.; Nikkinen, J.; Aksela, H.; Aksela, S.

    2003-01-01

    The angular distribution of the Xe 5s photoelectrons was measured in the 90-225 eV photon energy range using linearly polarized synchrotron radiation. The experimentally determined angular distribution parameters were compared with theoretical values obtained from calculations based on the random-phase approximation and the time-dependent density-functional theory. Experiment shows that the dipole ({beta}) and nondipole ({gamma}) parameters vary strongly as a function of the photon energy, in accordance with calculations that account for the interchannel coupling. Nondipole effects observed clearly in experiment confirm the role of multielectron correlation in describing the 5s photoionization of Xe far from the ionization threshold.

  16. The radiative lifetime of the 5S(0)2 metastable level of O(2+)

    NASA Technical Reports Server (NTRS)

    Johnson, B. C.; Smith, P. L.; Knight, R. D.

    1984-01-01

    The radiative lifetime of the 5S(0)2 metastable level of O(2+) was measured as 1.22 + or - 0.08 ms at the 90 percent confidence level by observing the time dependence of the spontaneous emission from metastable ions created and stored in a cylindrical radio-frequency ion trap. The intersystem line emission 2s(2)2p(2) 3P - 2s2p(3) 5S(0) was observed at 1660.8 and 1666.2 A. Discrepancies between measured and calculated values indicate that certain calculated transition probabilities for intersystem lines may be less reliable than previously believed.

  17. The nucleotide sequences of 5S rRNAs from three ciliated protozoa.

    PubMed Central

    Kumazaki, T; Hori, H; Osawa, S; Mita, T; Higashinakagawa, T

    1982-01-01

    The nucleotide sequences of 5S rRNAs from three ciliated protozoa, Paramecium tetraurelia, Tetrahymena thermophila and Blepharisma japonicum have been determined. All of them are 120 nucleotides long and the sequence of probable tRNA binding site of position 41-44 is GAAC which is characteristic of the plant 5S rRNAs. The sequence similarity percents are 87% (Paramecium/Tetrahymena), 86% (Paramecium/Blepharisma) and 79% (Tetrahymena/Blepharisma), suggesting a close relationship of these three ciliates. PMID:7122243

  18. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    PubMed

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  19. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  20. RAS - Screens & Assays

    Cancer.gov

    A primary goal of the RAS Initiative is to develop assays for RAS activity, localization, and signaling and adapt those assays so they can be used for finding new drug candidates. Explore the work leading to highly validated screening protocols.

  1. Evaluation of 16S rRNA Gene PCR Sensitivity and Specificity for Diagnosis of Prosthetic Joint Infection: a Prospective Multicenter Cross-Sectional Study

    PubMed Central

    Plouzeau, Chloé; Tande, Didier; Léger, Julie; Giraudeau, Bruno; Valentin, Anne Sophie; Jolivet-Gougeon, Anne; Vincent, Pascal; Corvec, Stéphane; Gibaud, Sophie; Juvin, Marie Emmanuelle; Héry-Arnaud, Genevieve; Lemarié, Carole; Kempf, Marie; Bret, Laurent; Quentin, Roland; Coffre, Carine; de Pinieux, Gonzague; Bernard, Louis; Burucoa, Christophe

    2014-01-01

    There is no standard method for the diagnosis of prosthetic joint infection (PJI). The contribution of 16S rRNA gene PCR sequencing on a routine basis remains to be defined. We performed a prospective multicenter study to assess the contributions of 16S rRNA gene assays in PJI diagnosis. Over a 2-year period, all patients suspected to have PJIs and a few uninfected patients undergoing primary arthroplasty (control group) were included. Five perioperative samples per patient were collected for culture and 16S rRNA gene PCR sequencing and one for histological examination. Three multicenter quality control assays were performed with both DNA extracts and crushed samples. The diagnosis of PJI was based on clinical, bacteriological, and histological criteria, according to Infectious Diseases Society of America guidelines. A molecular diagnosis was modeled on the bacteriological criterion (≥1 positive sample for strict pathogens and ≥2 for commensal skin flora). Molecular data were analyzed according to the diagnosis of PJI. Between December 2010 and March 2012, 264 suspected cases of PJI and 35 control cases were included. PJI was confirmed in 215/264 suspected cases, 192 (89%) with a bacteriological criterion. The PJIs were monomicrobial (163 cases [85%]; staphylococci, n = 108; streptococci, n = 22; Gram-negative bacilli, n = 16; anaerobes, n = 13; others, n = 4) or polymicrobial (29 cases [15%]). The molecular diagnosis was positive in 151/215 confirmed cases of PJI (143 cases with bacteriological PJI documentation and 8 treated cases without bacteriological documentation) and in 2/49 cases without confirmed PJI (sensitivity, 73.3%; specificity, 95.5%). The 16S rRNA gene PCR assay showed a lack of sensitivity in the diagnosis of PJI on a multicenter routine basis. PMID:25056331

  2. Evaluation of 16S rRNA gene PCR sensitivity and specificity for diagnosis of prosthetic joint infection: a prospective multicenter cross-sectional study.

    PubMed

    Bémer, Pascale; Plouzeau, Chloé; Tande, Didier; Léger, Julie; Giraudeau, Bruno; Valentin, Anne Sophie; Jolivet-Gougeon, Anne; Vincent, Pascal; Corvec, Stéphane; Gibaud, Sophie; Juvin, Marie Emmanuelle; Héry-Arnaud, Genevieve; Lemarié, Carole; Kempf, Marie; Bret, Laurent; Quentin, Roland; Coffre, Carine; de Pinieux, Gonzague; Bernard, Louis; Burucoa, Christophe

    2014-10-01

    There is no standard method for the diagnosis of prosthetic joint infection (PJI). The contribution of 16S rRNA gene PCR sequencing on a routine basis remains to be defined. We performed a prospective multicenter study to assess the contributions of 16S rRNA gene assays in PJI diagnosis. Over a 2-year period, all patients suspected to have PJIs and a few uninfected patients undergoing primary arthroplasty (control group) were included. Five perioperative samples per patient were collected for culture and 16S rRNA gene PCR sequencing and one for histological examination. Three multicenter quality control assays were performed with both DNA extracts and crushed samples. The diagnosis of PJI was based on clinical, bacteriological, and histological criteria, according to Infectious Diseases Society of America guidelines. A molecular diagnosis was modeled on the bacteriological criterion (≥ 1 positive sample for strict pathogens and ≥ 2 for commensal skin flora). Molecular data were analyzed according to the diagnosis of PJI. Between December 2010 and March 2012, 264 suspected cases of PJI and 35 control cases were included. PJI was confirmed in 215/264 suspected cases, 192 (89%) with a bacteriological criterion. The PJIs were monomicrobial (163 cases [85%]; staphylococci, n = 108; streptococci, n = 22; Gram-negative bacilli, n = 16; anaerobes, n = 13; others, n = 4) or polymicrobial (29 cases [15%]). The molecular diagnosis was positive in 151/215 confirmed cases of PJI (143 cases with bacteriological PJI documentation and 8 treated cases without bacteriological documentation) and in 2/49 cases without confirmed PJI (sensitivity, 73.3%; specificity, 95.5%). The 16S rRNA gene PCR assay showed a lack of sensitivity in the diagnosis of PJI on a multicenter routine basis.

  3. Evaluation of 16S rRNA gene PCR sensitivity and specificity for diagnosis of prosthetic joint infection: a prospective multicenter cross-sectional study.

    PubMed

    Bémer, Pascale; Plouzeau, Chloé; Tande, Didier; Léger, Julie; Giraudeau, Bruno; Valentin, Anne Sophie; Jolivet-Gougeon, Anne; Vincent, Pascal; Corvec, Stéphane; Gibaud, Sophie; Juvin, Marie Emmanuelle; Héry-Arnaud, Genevieve; Lemarié, Carole; Kempf, Marie; Bret, Laurent; Quentin, Roland; Coffre, Carine; de Pinieux, Gonzague; Bernard, Louis; Burucoa, Christophe

    2014-10-01

    There is no standard method for the diagnosis of prosthetic joint infection (PJI). The contribution of 16S rRNA gene PCR sequencing on a routine basis remains to be defined. We performed a prospective multicenter study to assess the contributions of 16S rRNA gene assays in PJI diagnosis. Over a 2-year period, all patients suspected to have PJIs and a few uninfected patients undergoing primary arthroplasty (control group) were included. Five perioperative samples per patient were collected for culture and 16S rRNA gene PCR sequencing and one for histological examination. Three multicenter quality control assays were performed with both DNA extracts and crushed samples. The diagnosis of PJI was based on clinical, bacteriological, and histological criteria, according to Infectious Diseases Society of America guidelines. A molecular diagnosis was modeled on the bacteriological criterion (≥ 1 positive sample for strict pathogens and ≥ 2 for commensal skin flora). Molecular data were analyzed according to the diagnosis of PJI. Between December 2010 and March 2012, 264 suspected cases of PJI and 35 control cases were included. PJI was confirmed in 215/264 suspected cases, 192 (89%) with a bacteriological criterion. The PJIs were monomicrobial (163 cases [85%]; staphylococci, n = 108; streptococci, n = 22; Gram-negative bacilli, n = 16; anaerobes, n = 13; others, n = 4) or polymicrobial (29 cases [15%]). The molecular diagnosis was positive in 151/215 confirmed cases of PJI (143 cases with bacteriological PJI documentation and 8 treated cases without bacteriological documentation) and in 2/49 cases without confirmed PJI (sensitivity, 73.3%; specificity, 95.5%). The 16S rRNA gene PCR assay showed a lack of sensitivity in the diagnosis of PJI on a multicenter routine basis. PMID:25056331

  4. Chromosomal organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the evolutionary dynamics of multigene families and heterochromatin

    PubMed Central

    2011-01-01

    Background Scarabaeinae beetles show a high level of macro-chromosomal variability, although the karyotypic organization of heterochromatin and multigene families (rDNAs and histone genes) is poorly understood in this group. To better understand the chromosomal organization and evolution in this group, we analyzed the karyotypes, heterochromatin distribution and chromosomal locations of the rRNAs and histone H3 genes in beetles belonging to eight tribes from the Scarabaeinae subfamily (Coleoptera, Scarabaeidae). Results The number of 18S rRNA gene (a member of the 45S rDNA unit) sites varied from one to 16 and were located on the autosomes, sex chromosomes or both, although two clusters were most common. Comparison of the 45S rDNA cluster number and the diploid numbers revealed a low correlation value. However, a comparison between the number of 45S rDNA sites per genome and the quantity of heterochromatin revealed (i) species presenting heterochromatin restricted to the centromeric/pericentromeric region that contained few rDNA sites and (ii) species with a high quantity of heterochromatin and a higher number of rDNA sites. In contrast to the high variability for heterochromatin and 45S rDNA cluster, the presence of two clusters (one bivalent cluster) co-located on autosomal chromosomes with the 5S rRNA and histone H3 genes was highly conserved. Conclusions Our results indicate that the variability of the 45S rDNA chromosomal clusters is not associated with macro-chromosomal rearrangements but are instead related to the spread of heterochromatin. The data obtained also indicate that both heterochromatin and the 45S rDNA loci could be constrained by similar evolutionary forces regulating spreading in the distinct Scarabaeinae subfamily lineages. For the 5S rRNA and the histone H3 genes, a similar chromosomal organization could be attributed to their association/co-localization in the Scarabaeinae karyotypes. These data provide evidence that different evolutionary

  5. Structural insights into the function of aminoglycoside-resistance A1408 16S rRNA methyltransferases from antibiotic-producing and human pathogenic bacteria

    PubMed Central

    Macmaster, Rachel; Zelinskaya, Natalia; Savic, Miloje; Rankin, C. Robert; Conn, Graeme L.

    2010-01-01

    X-ray crystal structures were determined of the broad-spectrum aminoglycoside-resistance A1408 16S rRNA methyltransferases KamB and NpmA, from the aminoglycoside-producer Streptoalloteichus tenebrarius and human pathogenic Escherichia coli, respectively. Consistent with their common function, both are Class I methyltransferases with additional highly conserved structural motifs that embellish the core SAM-binding fold. In overall structure, the A1408 rRNA methyltransferase were found to be most similar to a second family of Class I methyltransferases of distinct substrate specificity (m7G46 tRNA). Critical residues for A1408 rRNA methyltransferase activity were experimentally defined using protein mutagenesis and bacterial growth assays with kanamycin. Essential residues for SAM coenzyme binding and an extended protein surface that likely interacts with the 30S ribosomal subunit were thus revealed. The structures also suggest potential mechanisms of A1408 target nucleotide selection and positioning. We propose that a dynamic extended loop structure that is positioned adjacent to both the bound SAM and a functionally critical structural motif may mediate concerted conformational changes in rRNA and protein that underpin the specificity of target selection and activation of methyltransferase activity. These new structures provide important new insights that may provide a starting point for strategies to inhibit these emerging causes of pathogenic bacterial resistance to aminoglycosides. PMID:20639535

  6. Differentiation of non-pylori Helicobacter species based on PCR-restriction fragment length polymorphism of the 23S rRNA gene.

    PubMed

    Yadegar, Abbas; Alebouyeh, Masoud; Lawson, Andy J; Mirzaei, Tabassom; Nazemalhosseini Mojarad, Ehsan; Zali, Mohammad Reza

    2014-06-01

    Phenotypic identification of non-pylori Helicobacter species has always been problematic and time-consuming in comparison with many other bacteria. We developed a rapid two-step identification assay based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 23S rRNA gene for differentiating between non-pylori Helicobacter species. A new genus-specific primer pair based on all available complete and partial 23S rRNA sequences of Helicobacter species was designed. In silico restriction analysis of variable regions of the 23S rRNA gene suggested SmaI and HindIII endonucleases would provide a good level of differentiation. Analysis of the obtained 23S rRNA RFLP patterns divided all Helicobacter study strains into three species groups (groups A-C) and 12 unique restriction patterns. Wolinella succinogenes also gave a unique pattern. Our proposed PCR-RFLP method was found to be as a valuable tool for routine identification of non-pylori Helicobacter species from human or animal samples.

  7. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON QSAR

    EPA Science Inventory

    Dyer, S.D., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to predict HC5's Based on QSARs (Abstract). To be presented at the SETAC Europe 14th Annual Meeting: Environmental Science Solution: A Pan-European Perspective, 18-...

  8. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica.

  9. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON MINIMAL DATA

    EPA Science Inventory

    Dyer, S., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to Predict HC5's Based on Minimal Data (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portland, OR. 1 p. (ERL,GB R1013).

  10. The 5-S RNA . protein complex from an extreme halophile, Halobacterium cutirubrum. Purification and characterization.

    PubMed

    Smith, N; Matheson, A T; Yaguchi, M; Willick, G E; Nazar, R N

    1978-09-01

    A 5-S RNA . protein complex has been isolated from the 50-S ribosomal subunit of an extreme halophile, Halobacterium cutirubrum. The 50-S ribosomal subunit from the extreme halophile requires 3.4 M K+ and 100 mM Mg2+ for stability. However, if the high K+ concentration is maintained but the Mg2+ concentration lowered to 0.3 mM, the 5-S RNA . protein complex is selectively extracted from the subunit. After being purified on an Agarose 0.5-m column the complex had a molecular weight of about 80000 and contained 5-S RNA and two proteins, HL13 and HL19, with molecular weights (by sedimentation equilibrium) of 18700 and 18000, respectively. No ATPase or GTPase activity could be detected in the 5-S RNA . protein complex. The amino acid composition and electrophoretic mobility on polyacrylamide gels indicated both proteins were much more acidic than the equivalent from Escherichia coli or Bacillus stearothermophilus. Partial amino acid sequence data suggest HL13 is homologous to EL18 and HL19 to EL5.

  11. 10. GIRDER APPROACH ON YORKTOWN SIDE, SHOWING PIERS 8S5S (LEFT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. GIRDER APPROACH ON YORKTOWN SIDE, SHOWING PIERS 8S-5S (LEFT TO RIGHT), AND FLOORBEAM/STRINGER SYSTEM. VIEW LOOKING NORTH. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

  12. Nucleolar association and transcriptional inhibition through 5S rDNA in mammals.

    PubMed

    Fedoriw, Andrew M; Starmer, Joshua; Yee, Della; Magnuson, Terry

    2012-01-01

    Changes in the spatial positioning of genes within the mammalian nucleus have been associated with transcriptional differences and thus have been hypothesized as a mode of regulation. In particular, the localization of genes to the nuclear and nucleolar peripheries is associated with transcriptional repression. However, the mechanistic basis, including the pertinent cis- elements, for such associations remains largely unknown. Here, we provide evidence that demonstrates a 119 bp 5S rDNA can influence nucleolar association in mammals. We found that integration of transgenes with 5S rDNA significantly increases the association of the host region with the nucleolus, and their degree of association correlates strongly with repression of a linked reporter gene. We further show that this mechanism may be functional in endogenous contexts: pseudogenes derived from 5S rDNA show biased conservation of their internal transcription factor binding sites and, in some cases, are frequently associated with the nucleolus. These results demonstrate that 5S rDNA sequence can significantly contribute to the positioning of a locus and suggest a novel, endogenous mechanism for nuclear organization in mammals.

  13. Relativistic effects on interchannel coupling in atomic photoionization: The photoelectron angular distribution of Xe 5s

    SciTech Connect

    Hemmers, O.; Manson, S. T.; Sant'Anna, M. M.; Focke, P.; Wang, H.; Sellin, I. A.; Lindle, D. W.

    2001-08-01

    Measurements of the photoelectron angular-distribution asymmetry parameter {beta} for Xe 5s photoionization have been performed in the 80--200 eV photon-energy region. The results show a substantial deviation from the nonrelativistic value of {beta}=2 and provide a clear signature of significant relativistic effects in interchannel coupling.

  14. 12. PIERS 5S AND 4S, SHOWING TRANSITION AT 4S FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. PIERS 5S AND 4S, SHOWING TRANSITION AT 4S FROM GIRDER SPAN TO 'SUSPENDED' TRUSS SPAN AT U0. VIEW LOOKING WEST. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

  15. An efficient synthetic approach to 6,5'-(S)- and 6,5'-(R)-cyclouridine.

    PubMed

    Theile, Christopher S; McLaughlin, Larry W

    2012-06-01

    Here we present new routes for the efficient syntheses of 6,5'-(S)- and 6,5'-(R)-cyclouridine. The syntheses utilize readily accessible uridine as a starting material. This route to the R diastereomer is significantly more efficient than previous synthetic efforts, allowing us to obtain large amounts of pure material for future biological testing.

  16. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  17. Adaptation of the S-5-S pendulum seismometer for measurement of rotational ground motion

    NASA Astrophysics Data System (ADS)

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-10-01

    The Russian electrodynamic seismometer model S-5-S has been adapted for the measurement of rotational ground motion. The mechanical system of the original S-5-S seismometer consists of electrodynamic sensing and damping transducer coils mounted on an asymmetrical double-arm pendulum. This pendulum is suspended on a footing using two pairs of crossed flat springs, which operate as the axis of rotation. The pendulum is stabilised by an additional spring. The S-5-S can be used either as a vertical or as a horizontal sensor. The adaptation of the S-5-S seismometer described below involves removal of the additional spring and installation of an additional mass on the damping arm. Strain gauge angle sensors are installed on one pair of the crossed flat springs. The main dynamic parameters of the rotational seismometer created in this way, i.e. the natural period and damping, are controlled electronically by feedback currents proportional to the angular displacement and angular velocity, both fed to the damping transducer coil. This new seismometer, named the S-5-SR, enables measurement of the rotational component of ground motion around the horizontal or the vertical axes. The output signal from this S-5-SR seismometer can be proportional either to rotational displacement or rotational velocity.

  18. Biosynthesis of resorcylic acid lactone (5S)-5-hydroxylasiodiplodin in Lasiodiplodia theobromae.

    PubMed

    Kashima, Takasumi; Takahashi, Kosaku; Matsuura, Hideyuki; Nabeta, Kensuke

    2009-11-01

    An administration study of (2)H-labeled precursors showed that the 9-hydroxydecanoyl unit, the acyl intermediate of lasiodiplodin (1), was also the intermediate of (5S)-5-hydroxylasiodiplodin (2) in Lasiodiplodia theobromae. The incorporation of [O-methyl-(2)H(3)]-lasiodiplodin (6) into 2 indicated that hydroxylation at C-5 occurred after cyclization. PMID:19897901

  19. Photodissociation dynamics of superexcited O2: Dissociation channels O(5S) vs. O(3S)

    NASA Astrophysics Data System (ADS)

    Zhou, Yiyong; Meng, Qingnan; Mo, Yuxiang

    2014-07-01

    The photodissociation dynamics of O2, O2 + hυ → O(3P) + O(2p3(4S)3s, 3S/5S), has been studied by combining the XUV laser pump / UV laser probe and velocity map imaging methods in the photon energy range 14.64-15.20 eV. The fragment yield spectra of O(3S) and O(5S) and their velocity map images have been recorded using the state-selective (1+1) REMPI method to detect the fragments. The fragment yield spectra show resolved fine structure that arises from the predissociated Rydberg states I, I' and I″ (3ΠΩ = 0,1,2). The branching ratios between the two decay channels have been measured by one-photon ionization of the fragments O(3S) and O(5S) simultaneously. It is surprising to find that the dissociation cross sections for the production of O(5S) are larger than, or comparable to, those of O(3S) for the I and I' states, while the cross sections for the production of O(5S) are smaller than those of O(3S) for the I″ state. All fragments O(5S) arise from perpendicular transitions, which provides direct experimental evidence about the symmetry assignments of the states I, I' and I″ excited in this energy region. Although most of the fragments O(3S) arise from perpendicular transitions, some of them are from parallel transitions. Based on the calculated ab initio potential energy curves, we propose that the neutral dissociation into O(3P) + O(3S) occurs mainly via the interaction of the Rydberg states I, I', and I″ with the vibrational continuum of the diabatic 83Πu state (1π _u^{ - 1} (a^4 {Π}_u {)3}sσ _g ,^3 Π_u), while the neutral dissociation into O(3P) + O(5S) occurs mainly via the interaction of Rydberg states I, I', and I″ with the diabatic 73Πu (1π _g^{ - 1} (X^2 {Π}_g {)3}p{σ }_u ,^3 Π_u).

  20. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  1. Detection and identification of Legionella species in hospital water supplies through Polymerase Chain Reaction (16S rRNA)

    PubMed Central

    2014-01-01

    Legionella spp. are important waterborne pathogens that are normally transmitted through aerosols. The present work was conducted to investigate the presence of Legionella spp. and its common species in hospital water supplies. Considering the limitations of culture method, polymerase chain reaction (PCR) assays were developed to detect the gene 16S rRNA irrespective of the bacterial serotype. Four well-established DNA extraction protocols (freeze & thaw and phenol-chloroform as two manual protocols and two commercial kits) were tested and evaluated to release DNA from bacterial cells. A total of 45 samples were collected from seven distinct hospitals’ sites during a period of 10 months. The PCR assay was used to amplify a 654-bp fragment of the 16S rRNA gene. Legionella were detected in 13 samples (28.9%) by all of the methods applied for DNA extraction. Significant differences were noted in the yield of extracted nucleic acids. Legionella were not detected in any of the samples when DNA extraction by freeze & thaw was used. Excluding this method and comparing manual protocol with commercial kits, Kappa coefficient was calculated as 0.619 with p < 0.05. Although no meaningful differences were found between the kits, DNA extraction with Bioneer kit exhibited a higher sensitivity than classical Qiagen. Showerheads and cold-water taps were the most and least contaminated sources with 55.5 and 9 percent positive samples, respectively. Moreover two positive samples were identified for species by DNA sequencing and submitted to the Gene Bank database with accession Nos. FJ480932 and FJ480933. The results obtained showed that despite the advantages of molecular assays in Legionella tracing in environmental sources, the use of optimised DNA extraction methods is critical. PMID:24860661

  2. Detection and identification of Legionella species in hospital water supplies through Polymerase Chain Reaction (16S rRNA).

    PubMed

    Rafiee, Mohammad; Jahangiri-Rad, Mahsa; Hajjaran, Homa; Mesdaghinia, Alireza; Hajaghazadeh, Mohammad

    2014-01-01

    Legionella spp. are important waterborne pathogens that are normally transmitted through aerosols. The present work was conducted to investigate the presence of Legionella spp. and its common species in hospital water supplies. Considering the limitations of culture method, polymerase chain reaction (PCR) assays were developed to detect the gene 16S rRNA irrespective of the bacterial serotype. Four well-established DNA extraction protocols (freeze & thaw and phenol-chloroform as two manual protocols and two commercial kits) were tested and evaluated to release DNA from bacterial cells. A total of 45 samples were collected from seven distinct hospitals' sites during a period of 10 months. The PCR assay was used to amplify a 654-bp fragment of the 16S rRNA gene. Legionella were detected in 13 samples (28.9%) by all of the methods applied for DNA extraction. Significant differences were noted in the yield of extracted nucleic acids. Legionella were not detected in any of the samples when DNA extraction by freeze & thaw was used. Excluding this method and comparing manual protocol with commercial kits, Kappa coefficient was calculated as 0.619 with p < 0.05. Although no meaningful differences were found between the kits, DNA extraction with Bioneer kit exhibited a higher sensitivity than classical Qiagen. Showerheads and cold-water taps were the most and least contaminated sources with 55.5 and 9 percent positive samples, respectively. Moreover two positive samples were identified for species by DNA sequencing and submitted to the Gene Bank database with accession Nos. FJ480932 and FJ480933. The results obtained showed that despite the advantages of molecular assays in Legionella tracing in environmental sources, the use of optimised DNA extraction methods is critical. PMID:24860661

  3. Transformation of tetrahymena thermophila with hypermethylated rRNA genes

    SciTech Connect

    Karrer, K.M.; Yao, M.C.

    1988-04-01

    The extrachromosomal rRNA genes (rDNA) of Tetrahymena thermophila contain 0.4% N/sup 6/-methyladenine. C3 strain rDNA was isolated, hypermethylated in vitro, and microinjected into B strain host cells. Clonal cell lines were established, and transformants were selected on the basis of resistance to paromomycin, conferred by the injected rDNA. The effects of methylation by three enzymes which methylate the sequence 5'-NAT-3'', the dam, EcoRI, and ClaI methylases, were tested. Hypermethylation of the injected rDNA had no effect on transformation efficiency relative to mock-methylated controls. The injected C3 strain rDNA efficiently replaced host rDNA as the major constituent of the population of rDNA molecules. Hypermethylation of the injected DNA was not maintained through 20 to 25 cell generations.

  4. New Site of Modification of 23S rRNA Associated with Clarithromycin Resistance of Helicobacter pylori Clinical Isolates

    PubMed Central

    Fontana, Carla; Favaro, Marco; Minelli, Silvia; Criscuolo, Anna Angela; Pietroiusti, Antonio; Galante, Alberto; Favalli, Cartesio

    2002-01-01

    Resistance of Helicobacter pylori to clarithromycin occurs with a prevalence ranging from 0 to 15%. This has an important clinical impact on dual and triple therapies, in which clarithromycin seems to be the better choice to achieve H. pylori eradication. In order to evaluate the possibility of new mechanisms of clarithromycin resistance, a PCR assay that amplified a portion of 23S rRNA from H. pylori isolates was used. Gastric tissue biopsy specimens from 230 consecutive patients were cultured for H. pylori isolation. Eighty-six gastric biopsy specimens yielded H. pylori-positive results, and among these 12 isolates were clarithromycin resistant. The latter were studied to detect mutations in the 23S rRNA gene. Sequence analysis of the 1,143-bp PCR product (portion of the 23S rRNA gene) did not reveal mutation such as that described at position 2142 to 2143. On the contrary, our findings show, for seven isolates, a T-to-C transition at position 2717. This mutation conferred a low level of resistance, equivalent to the MIC for the isolates, selected using the E-test as well as using the agar dilution method: 1 μg/ml. Moreover, T2717C transition is located in a highly conserved region of the 23S RNA associated with functional sites: domain VI. This fact has a strong effect on the secondary structure of the 23S RNA and on its interaction with macrolide. Mutation at position 2717 also generated an HhaI restriction site; therefore, restriction analysis of the PCR product also permits a rapid detection of resistant isolates. PMID:12435674

  5. Human Nopp140, Which Interacts with RNA Polymerase I: Implications for rRNA Gene Transcription and Nucleolar Structural Organization

    PubMed Central

    Chen, Hung-Kai; Pai, Chi-Yun; Huang, Jing-Yi; Yeh, Ning-Hsing

    1999-01-01

    Nopp140 is thought to shuttle between nucleolus and cytoplasm. However, the predominant nucleolar localization of Nopp140 homologues from different species suggests that Nopp140 is also involved in events occurring within the nucleolus. In this study, we demonstrated that the largest subunit of RNA polymerase I, RPA194, was coimmunoprecipitated with the human Nopp140 (hNopp140). Such an interaction is mediated through amino acids 204 to 382 of hNopp140. By double immunofluorescence, hNopp140 was colocalized with RNA polymerase I at the rDNA (rRNA genes) transcription active foci in the nucleolus. These results suggest that Nopp140 can interact with RNA polymerase I in vivo. Transfected cells expressing the amino-terminal half of hNopp140, hNopp140N382 (amino acids 1 to 382), displayed altered nucleoli with crescent-shaped structures. This phenotype is reminiscent of the segregated nucleoli induced by actinomycin D treatment, which is known to inhibit rRNA synthesis. Consistently, the hNopp140N382 protein mislocalized the endogenous RNA polymerase I and shut off cellular rRNA gene transcription as revealed by an in situ run-on assay. These dominant negative effects of the mutant hNopp140N382 suggest that Nopp140 plays an essential role in rDNA transcription. Interestingly, ectopic expression of hNopp140 to a very high level caused the formation of a transcriptionally inactive spherical structure occupying the entire nucleolar area which trapped the RNA polymerase I, fibrillarin, and hNopp140 but excluded the nucleolin. The mislocalizations of these nucleolar proteins after hNopp140 overexpression imply that Nopp140 may also play roles in maintenance of nucleolar integrity. PMID:10567578

  6. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium

    NASA Astrophysics Data System (ADS)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.

    2014-07-01

    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  7. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  8. Molecular epidemiology of Theileria annulata and identification of 18S rRNA gene and ITS regions sequences variants in apparently healthy buffaloes and cattle in Pakistan.

    PubMed

    Khan, Muhammad Kasib; He, Lan; Hussain, Altaf; Azam, Sabita; Zhang, Wen-Jie; Wang, Li-Xia; Zhang, Qing-Li; Hu, Min; Zhou, Yan-Qin; Zhao, Junlong

    2013-01-01

    A molecular epidemiological survey was conducted to determine the prevalence of piroplasms in buffaloes and cattle from Sheikhupura and Okara districts of Punjab, Pakistan using reverse line blot (RLB) hybridization assay. The genetic diversity within 18S rRNA gene and ITS regions sequences of various obtained Theileria species (spp.) was also investigated. Briefly, 102 blood samples from buffaloes and cattle in the study districts were collected on blood collection cards and brought to the laboratory. DNA was extracted; the V4 hypervariable region of 18S rRNA was amplified and analyzed using RLB. Out of total samples analyzed, 61 (59.8%) were hybridized with Babesia/Theileria (B/T) genus-specific probe. Only one species of piroplasm was detected in buffaloes and cattle in study districts, i.e. Theileria (T.) annulata. Six samples only hybridized with B/T genus-specific and Theileria genus-specific probes but not with any species-specific probe indicating the presence of novel species or variants. The sequences of 18S rRNA gene and ITS regions of these six samples revealed the presence of T. annulata variants as confirmed through sequence identity estimation and phylogenetic analyses. Meanwhile, an unexpected sequence variation was observed within the 18S rRNA gene and ITS regions sequences of T. annulata identified in the present study. This is the first report on the simultaneous detection of species of piroplasms infecting buffaloes and cattle in Pakistan and molecular characterization of T. annulata 18S rRNA gene and ITS regions. The present study may address the new insights into the epidemiology of theileriosis which will help researches in designing control strategies and developing various molecular diagnostic tools at national level.

  9. Absolute nuclear material assay

    DOEpatents

    Prasad, Manoj K.; Snyderman, Neal J.; Rowland, Mark S.

    2012-05-15

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  10. Absolute nuclear material assay

    DOEpatents

    Prasad, Manoj K.; Snyderman, Neal J.; Rowland, Mark S.

    2010-07-13

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  11. Species identification of cattle and buffalo fat through PCR assay.

    PubMed

    Vaithiyanathan, S; Kulkarni, V V

    2016-04-01

    A method was standardized to isolate quality DNA from cattle and buffalo fat for species identification using QIAamp DNA stool mini kit. The quality of the DNA was sufficient enough to amplify universal primers viz., mt 12S rRNA and mt 16S rRNA, and species specific D loop primers for cattle and buffalo. The sensitivity of the PCR assay in the species specific D loop primer amplification was with a detection level of 0. 47 ng cattle DNA and 0.23 ng buffalo DNA in simplex and, 0. 47 ng cattle DNA and 0.12 ng buffalo DNA in duplex PCR. It is a potentially reliable method for DNA detection to authenticate animal fat. PMID:27413237

  12. Climatic controls on drainage basin topography - a synopsis of the western Andean flanks between 15.5 S and 41.5 S lat

    NASA Astrophysics Data System (ADS)

    Rehak, K.; Strecker, M. R.; Echtler, H. P.; Bookhagen, B.

    2007-12-01

    Topography in tectonically active mountain ranges is determined by the interplay between tectonics and climate. Due to the complexity of natural systems it is difficult to evaluate tectonic versus climatic contributions to the long- term landscape evolution. Previous studies suggest that rainfall and its variability strongly influence the morphology of river profiles and mountain ranges. However, it is still controversially discussed how drainage basins reflect tectonic and climatic processes. The Andean Cordillera provides a unique natural setting for studying the relationship between climate, tectonics, and topography. The Andes host various climatic zones with pronounced differences in rainfall regimes. In the central to southern western Andes, climate ranges from hyperarid in the Atacama Desert, 22 to 23°S lat, with a mean annual rainfall of ~ 5 mm/yr to year-round humid conditions south of Valdivia, ~ 40°S lat, with more than 2500 mm/yr. This zonation is controlled by hemisphere-scale atmospheric circulation patterns. With the exception of a northward shift of the Southern Hemisphere Westerlies during glacials the overall precipitation pattern has remained stable on the west coast of South America. The shelf width is reasonably constant along the margin. Uplift rate and lithology vary non-systematically and do not correlate with climatic parameters. Here, we present an analysis of 120 drainage basins along the watershed of the western Andean flank between 15.5 S and 41.5 S lat, using SRTMV3-90m data and a high-resolution rainfall dataset (TRMM 5x5 km). The basins comprise drainage areas of 1 to ~ 30 x 103 km2 and were split into subsets according to position and size. For each basin, we extracted 21 geometry, relief, and climate parameters in order to unravel the determinants of drainage-basin morphology. Our data shows that river-profile concavity and slope, hypsometric integral, basin maximum and mean elevation decrease with increasing rainfall and

  13. Comparison of two poultry litter qPCR assays targeting the 16S rRNA gene of Brevibacterium sp

    EPA Science Inventory

    Chicken feces are vectors of human pathogens and are also important sources of fecal pollution in environmental waters. Consequently, methods that can detect chicken fecal pollution are needed in public health and environmental monitoring studies. In this study, we compared a pre...

  14. Development and evaluation of 16S rRNA gene targeting Enterococcus genus- and species-specific assays

    EPA Science Inventory

    Enterococci have been widely used as indicators of fecal pollution in recreational waters. Most studies enumerate enterococci using culture-based techniques that are time consuming and do not provide information on the identity of enterococci species within a given sample. Althou...

  15. Chromosomal mapping of repetitive DNAs in Gobionellus oceanicus and G. stomatus (Gobiidae; Perciformes): A shared XX/XY system and an unusual distribution of 5S rDNA sites on the Y chromosome.

    PubMed

    Lima-Filho, Paulo A; Amorim, Karlla D J; Cioffi, Marcelo B; Bertollo, Luiz A C; Molina, Wagner F

    2014-01-01

    With nearly 2,000 species, Gobiidae is the most specious family of the vertebrates. This high level of speciation is accompanied by conspicuous karyotypic modifications, where the role of repetitive sequences remains largely unknown. This study analyzed the karyotype of 2 species of the genus Gobionellus and mapped 18S and 5S ribosomal RNA genes and (CA)15 microsatellite sequences onto their chromosomes. G. oceanicus (2n = 56; ♂ 12 metacentrics (m) + 4 submetacentrics (sm) + 1 subtelocentric (st) + 39 acrocentrics (a); ♀ 12m + 4sm + 2st + 38a) and G. stomatus (2n = 56; ♂ 20m + 14sm + 1st + 21a; ♀ 20m + 14sm + 2st + 20a) possess the highest diploid chromosome number among the Gobiidae and have different karyotypes. Both species share an XX/XY sex chromosome system with a large subtelocentric X and a small acrocentric Y chromosome which is rich in (CA)15 sequences and bears 5S rRNA sites. Although coding and noncoding repetitive DNA sequences may be involved in the genesis or differentiation of the sex chromosomes, the exclusive presence of 5S rDNA sites on the Y, but not on the X chromosome of both species, represents a novelty in fishes. In summary, the karyotypic differences, as well as new data on the sex chromosome systems in these 2 Gobiidae species, confirm the high chromosomal dynamism observed in this family.

  16. Two spatially separated phases in semiconducting Rb0.8Fe1.5S2

    DOE PAGES

    Wang, Meng; Tian, Wei; Valdivia, P.; Chi, Songxue; Bourret-Courchesne, E.; Dai, Pengcheng; Birgeneau, R. J.

    2014-09-26

    We report neutron scattering and transport measurements on semiconducting Rb0.8Fe1.5S2, a compound isostructural and isoelectronic to the well-studied A0.8FeySe2(A = K, Rb, Cs, Tl/K) superconducting systems. Both resistivity and DC susceptibility measurements reveal a magnetic phase transition at T = 275 K. Neutron diffraction studies show that the 275 K transition originates from a phase with rhombic iron vacancy order which exhibits an in-plane stripe antiferromagnetic ordering below 275 K. In addition, the stripe antiferromagnetic phase interdigitates mesoscopically with an ubiquitous phase with √5 x√5 iron vacancy order. This phase has a magnetic transition at TN = 425 K andmore » an iron vacancy order-disorder transition at TS = 600 K. These two different structural phases are closely similar to those observed in the isomorphous Se materials. Based on the close similarities of the in-plane antiferromagnetic structures, moments sizes, and ordering temperatures in semiconducting Rb0.8Fe1.5S2 and K0.81Fe1.58Se2, we argue that the in-plane antiferromagnetic order arises from strong coupling between local moments. Superconductivity, previously observed in the A0.8FeySe2₋ zSz system, is absent in A0.8Fe1.5S2, which has a semiconducting ground state. We discuss the implied relationship between stripe and block antiferromagnetism and superconductivity in these materials as well as a strategy for further investigation.« less

  17. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

    PubMed

    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina

    2016-05-15

    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. PMID:27084467

  18. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

    PubMed

    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina

    2016-05-15

    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis.

  19. Physical mapping of 5S rDNA in two species of Knifefishes: Gymnotus pantanal and Gymnotus paraguensis (Gymnotiformes).

    PubMed

    da Silva, M; Matoso, D A; Vicari, M R; de Almeida, M C; Margarido, V P; Artoni, R F

    2011-01-01

    Physical mapping of 5S rDNA in 2 species of knifefishes, Gymnotuspantanal and G. paraguensis (Gymnotiformes), was performed using fluorescence in situ hybridization with a 5S rDNA probe. The 5S rDNA PCR product from the genomes of both species was also sequenced and aligned to determine non-transcribed spacer sequences (NTS). Both species under study had different patterns of 5S rDNA gene cluster distribution. While in the karyotype of G. pantanal two 5S rDNA-bearing pairs were observed, the karyotype of G. paraguensis possessed as many as 19 such pairs. Such multiplication of 5S rDNA gene clusters might be caused by the involvement of transposable elements because the NTS of G. paraguensis was 400 bp long with high identity (90%) with a mobile transposable element called Tc1-like transposon, described from the cyprinid fish Labeo rohita.

  20. Minimally invasive L5-S1 oblique lumbar interbody fusion with anterior plate.

    PubMed

    Pham, Martin H; Jakoi, Andre M; Hsieh, Patrick C

    2016-07-01

    Lumbar interbody fusion is an important technique for the treatment of degenerative disc disease and degenerative scoliosis. The oblique lumbar interbody fusion (OLIF) establishes a minimally invasive retroperitoneal exposure anterior to the psoas and lumbar plexus. In this video case presentation, the authors demonstrate the techniques of the OLIF at L5-S1 performed on a 69-year-old female with degenerative scoliosis as one component of an overall strategy for her deformity correction. The video can be found here: https://youtu.be/VMUYWKLAl0g . PMID:27364428

  1. Identification of Theileria parva and Theileria sp. (buffalo) 18S rRNA gene sequence variants in the African Buffalo (Syncerus caffer) in southern Africa.

    PubMed

    Chaisi, Mamohale E; Sibeko, Kgomotso P; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

    2011-12-15

    Theileria parva is the causative agent of Corridor disease in cattle in South Africa. The African buffalo (Syncerus caffer) is the reservoir host, and, as these animals are important for eco-tourism in South Africa, it is compulsory to test and certify them disease free prior to translocation. A T. parva-specific real-time polymerase chain reaction (PCR) test based on the small subunit ribosomal RNA (18S rRNA) gene is one of the tests used for the diagnosis of the parasite in buffalo and cattle in South Africa. However, because of the high similarity between the 18S rRNA gene sequences of T. parva and Theileria sp. (buffalo), the latter is also amplified by the real-time PCR primers, although it is not detected by the T. parva-specific hybridization probes. Preliminary sequencing studies have revealed a small number of sequence differences within the 18S rRNA gene in both species but the extent of this sequence variation is unknown. The aim of the current study was to sequence the 18S rRNA genes of T. parva and Theileria sp. (buffalo), and to determine whether all identified genotypes can be correctly detected by the real-time PCR assay. The reverse line blot (RLB) hybridization assay was used to identify T. parva and Theileria sp. (buffalo) positive samples from buffalo blood samples originating from the Kruger National Park, Hluhluwe-iMfolozi Park, the Greater Limpopo Transfrontier Park, and a private game ranch in the Hoedspruit area. T. parva and Theileria sp. (buffalo) were identified in 42% and 28%, respectively, of 252 samples, mainly as mixed infections. The full-length 18S rRNA gene of selected samples was amplified, cloned and sequenced. From a total of 20 sequences obtained, 10 grouped with previously published T. parva sequences from GenBank while 10 sequences grouped with a previously published Theileria sp. (buffalo) sequence. All these formed a monophyletic group with known pathogenic Theileria species. Our phylogenetic analyses confirm the

  2. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  3. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  4. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  5. Nucleolar Assembly of the Rrna Processing Machinery in Living Cells

    PubMed Central

    Savino, Tulia Maria; Gébrane-Younès, Jeannine; De Mey, Jan; Sibarita, Jean-Baptiste; Hernandez-Verdun, Danièle

    2001-01-01

    To understand how nuclear machineries are targeted to accurate locations during nuclear assembly, we investigated the pathway of the ribosomal RNA (rRNA) processing machinery towards ribosomal genes (nucleolar organizer regions [NORs]) at exit of mitosis. To follow in living cells two permanently transfected green fluorescence protein–tagged nucleolar proteins, fibrillarin and Nop52, from metaphase to G1, 4-D time-lapse microscopy was used. In early telophase, fibrillarin is concentrated simultaneously in prenucleolar bodies (PNBs) and NORs, whereas PNB-containing Nop52 forms later. These distinct PNBs assemble at the chromosome surface. Analysis of PNB movement does not reveal the migration of PNBs towards the nucleolus, but rather a directional flow between PNBs and between PNBs and the nucleolus, ensuring progressive delivery of proteins into nucleoli. This delivery appeared organized in morphologically distinct structures visible by electron microscopy, suggesting transfer of large complexes. We propose that the temporal order of PNB assembly and disassembly controls nucleolar delivery of these proteins, and that accumulation of processing complexes in the nucleolus is driven by pre-rRNA concentration. Initial nucleolar formation around competent NORs appears to be followed by regroupment of the NORs into a single nucleolus 1 h later to complete the nucleolar assembly. This demonstrates the formation of one functional domain by cooperative interactions between different chromosome territories. PMID:11381093

  6. Analysis of 5S rDNA organization and variation in polyploid hybrids from crosses of different fish subfamilies.

    PubMed

    Qin, Qinbo; He, Weiguo; Liu, Shaojun; Wang, Jing; Xiao, Jun; Liu, Yun

    2010-07-15

    In this article, sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) were conducted in red crucian carp (RCC), blunt snout bream (BSB), and their polyploid offspring. Three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) of RCC were characterized by distinct NTS types (designated NTS-I, II, and III for the 83, 220, and 357 bp monomers, respectively). In BSB, only one monomeric 5S rDNA was observed (designated class IV: 188 bp), which was characterized by one NTS type (designated NTS-IV: 68 bp). In the polyploid offspring, the tetraploid (4nRB) hybrids partially inherited 5S rDNA classes from their female parent (RCC); however, they also possessed a unique 5S rDNA sequence (designated class I-L: 203 bp) with a novel NTS sequence (designated NTS-I-L: 83 bp). The characteristic paternal 5S rDNA sequences (class IV) were not observed. The 5S rDNA of triploid (3nRB) hybrids was completely inherited from the parental species, and generally preserved the parental 5S rDNA structural organization. These results first revealed the influence of polyploidy on the organization and evolution of the multigene family of 5S rDNA of fish, and are also useful in clarifying aspects of vertebrate genome evolution.

  7. Electron-correlation-induced interchange of lifetime broadenings of 5s{sup -1} multiplet states in atomic Cs

    SciTech Connect

    Partanen, L.; Holappa, M.; Aksela, H.; Aksela, S.; Schulz, J.

    2009-10-15

    The lifetime broadenings of the most intense 5s photolines of Cs were studied. The aim of this study was to understand the origin of the remarkable differences in the lifetime widths of different 5s{sup -1} multiplet states. The 5s photoelectron spectra of the 6s{yields}6p{sub 1/2,3/2} laser-excited states are presented in the binding energy region of 30-34 eV showing the main 5s photolines of the ground state and laser-excited states as well as the 5s5p{sup 6}6p shakeup satellites. The lifetime widths of the states were determined. The Hartree-Fock calculations were carried out to predict the 5s photoelectron spectrum. The lifetime broadenings of the 5s photolines were found to be due to the transition rates of the subsequent Coster-Kronig transitions to the 5s{sup 2}5p{sup 5} states. It was found that a straightforward single-configuration explanation cannot be given for the lifetime differences. Instead, electron correlation plays an essential role and the lifetime broadenings were found to be predicted well only when configuration interaction between the 5s{sup -1} and 5p{sup -2}5d configurations is taking into account.

  8. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    PubMed Central

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  9. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    NASA Astrophysics Data System (ADS)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-03-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

  10. Bottomonium physics at Υ(4S, 5S, 6S) energies with the Belle detector

    NASA Astrophysics Data System (ADS)

    Tamponi, Umberto

    2016-08-01

    The description of quarkonia as pure quark anti-quark bound states has been recently challenged by the observation of charged states in both the charmonium and bottomonium region and large violations of the heavy quark spin symmetry in hadronic transitions. All these effects can be ascribable to non-negligible contributions from the light quark degrees of freedom in the description of both charmonia and bottomonia. We will report the most recent experimental measurements performed by the Belle collaboration in the Y(4S), Y(5S) and Y(6S) regions, including the measurement of the ratio σ[e+e- → bb̅]/σ[e+e- → μ+ μ- ], the search for neutral states near the B0B̅0 threshold, the first observation of the transition ϒ(4S) → ηhb (lP) and the study of the η transitions at the ϒ(5S) energy. The contribution to the study of the structure of these states coming from the measurement of hadronic transitions will be discussed.

  11. Magnetization reversal phenomena in (Cr0.70Ti0.30)5S6

    NASA Astrophysics Data System (ADS)

    Hashimoto, Satoshi; Matsuda, Yuji; Sato, Tetsuya; Anzai, Shuichiro

    2005-12-01

    Magnetization reversal phenomena (MRP) along magnetic order-order transitions have recently been reported on impurity-doped magnetic systems. Because imperfect long-range magnetic order exists in these systems, it is expected that a systematic investigation of MRP will give physical information on thermomagnetic processes of magnetic systems in the range from the micro- to nanoscales. As a typical order-order transition (a state doubly modulated by helical and canting orders to a collinear ferrimagnetic state) has been known to occur on Cr5S6 at a transition temperature Tt, we investigate the magnetizations of (Cr0.70Ti0.30)5S6 on heating and cooling runs in various magnetic fields. At 20Oe, the field-cooled magnetization just below the Curie temperature has a positive sign; the sign turns negative below the compensation temperature TCM (first step) and finally returns to positive below Tt (second step). The first-step MRP observed in this system is explained by the potential barriers resulting from anisotropy energy when the preferred direction of collinear ferrimagnetic moment reverses. The proposed mechanism for second-step MRP is the pinning effect caused by the impurity atoms (Ti) in the helical long-range-order chains. Comparing other examples of MRPs, we discuss the roles of local impurity centers in the thermomagnetic process in magnetic order-order transitions.

  12. Structural Preservation Percutaneous Endoscopic Lumbar Interlaminar Discectomy for L5-S1 Herniated Nucleus Pulposus

    PubMed Central

    Jang, Jee-Soo; Jang, Il-Tae

    2016-01-01

    Objective. Structures such as ligamentum flavum, annulus, and lamina play an important role in the segmental function. We proposed the surgical technique for achieving the sufficient preservation of segmental structures, in spite of sufficient removal of pathologic disc in the L5-S1 using the ligamentum flavum splitting and sealing technique. Methods. We retrospectively analyzed 80 cases that underwent percutaneous endoscopic lumbar discectomy for L5-S1 herniated nucleus pulposus, using the ligamentum flavum splitting and sealing technique between January 2011 and June 2013. Outcomes were assessed using VAS (leg, back), MacNab's criteria, and the immediate postoperative MRI for all patients. Structural preservation was classified as complete, sufficient, and incomplete. Results. The surgical results are as follows: 65 cases were complete, 15 cases were sufficient, and 0 cases were incomplete. The VAS was decreased at the last follow-up (leg: from 7.91 ± 0.73 to 1.15 ± 0.62; back: from 5.15 ± 0.71 to 1.19 ± 0.75). A favorable outcome (excellent or good outcome by MacNab's criteria) was achieved in 77 patients (96.25%). During the follow-up period, 2 cases (2.5%) of recurrence have occurred. Conclusion. According to the result, we could obtain the favorable clinical and radiological outcomes while simultaneously removing pathologic discs using the ligamentum flavum splitting and annular fissure sealing technique. PMID:27803927

  13. Strategies used by pathogenic and nonpathogenic mycobacteria to synthesize rRNA.

    PubMed Central

    Gonzalez-y-Merchand, J A; Garcia, M J; Gonzalez-Rico, S; Colston, M J; Cox, R A

    1997-01-01

    One rRNA operon of all mycobacteria studied so far is located downstream from a gene thought to code for the enzyme UDP-N-acetylglucosamine carboxyvinyl transferase (UNAcGCT), which is important to cell wall synthesis. This operon has been designated rrnAf for fast-growing mycobacteria and rrnAs for slow growers. We have investigated the upstream sequences and promoter activities of rrnA operons of typical fast growers which also possess a second rrn (rrnBf) operon and of the rrnA operons of the fast growers Mycobacterium abscessus and Mycobacterium chelonae, which each have a single rrn operon per genome. These fast growers have a common strategy for increasing the efficiency of transcription of their rrnA operons, thereby increasing the cells' potential for ribosome synthesis. This strategy involves the use of multiple (three to five) promoters which may have arisen through successive duplication events. Thus we have identified a hypervariable multiple promoter region (HMPR) located between the UNAcGCT gene and the 16S rRNA coding region. Two promoters, P1 and PCL1, appear to play pivotal roles in mycobacterial rRNA synthesis; they are present in all of the species examined and are the only promoters used for rRNA synthesis by the pathogenic slow growers. P1 is located within the coding region of the UNAcGCT gene, and PCL1 has a characteristic sequence that is related to but distinct from that of the additional promoters. In fast-growing species, P1 and PCL1 produce less than 10% of rRNA transcripts, so the additional promoters found in the HMPR are important in increasing the potential for rRNA synthesis during rapid growth. In contrast, rrnB operons appear to be regulated by a single promoter; because less divergence has taken place, rrnB appears to be younger than rrnA. PMID:9371439

  14. CPTAC Assay Portal: a repository of targeted proteomic assays

    SciTech Connect

    Whiteaker, Jeffrey R.; Halusa, Goran; Hoofnagle, Andrew N.; Sharma, Vagisha; MacLean, Brendan; Yan, Ping; Wrobel, John; Kennedy, Jacob; Mani, DR; Zimmerman, Lisa J.; Meyer, Matthew R.; Mesri, Mehdi; Rodriguez, Henry; Abbateillo, Susan E.; Boja, Emily; Carr, Steven A.; Chan, Daniel W.; Chen, Xian; Chen, Jing; Davies, Sherri; Ellis, Matthew; Fenyo, David; Hiltket, Tara; Ketchum, Karen; Kinsinger, Christopher; Kuhn, Eric; Liebler, Daniel; Lin, De; Liu, Tao; Loss, Michael; MacCoss, Michael; Qian, Weijun; Rivers, Robert; Rodland, Karin D.; Ruggles, Kelly; Scott, Mitchell; Smith, Richard D.; Thomas, Stefani N.; Townsend, Reid; Whiteley, Gordon; Wu, Chaochao; Zhang, Hui; Zhang, Zhen; Paulovich, Amanda G.

    2014-06-27

    To address these issues, the Clinical Proteomic Tumor Analysis Consortium (CPTAC) of the National Cancer Institute (NCI) has launched an Assay Portal (http://assays.cancer.gov) to serve as a public repository of well-characterized quantitative, MS-based, targeted proteomic assays. The purpose of the CPTAC Assay Portal is to facilitate widespread adoption of targeted MS assays by disseminating SOPs, reagents, and assay characterization data for highly characterized assays. A primary aim of the NCI-supported portal is to bring together clinicians or biologists and analytical chemists to answer hypothesis-driven questions using targeted, MS-based assays. Assay content is easily accessed through queries and filters, enabling investigators to find assays to proteins relevant to their areas of interest. Detailed characterization data are available for each assay, enabling researchers to evaluate assay performance prior to launching the assay in their own laboratory.

  15. Lateral flow assays.

    PubMed

    Koczula, Katarzyna M; Gallotta, Andrea

    2016-06-30

    Lateral flow assays (LFAs) are the technology behind low-cost, simple, rapid and portable detection devices popular in biomedicine, agriculture, food and environmental sciences. This review presents an overview of the principle of the method and the critical components of the assay, focusing on lateral flow immunoassays. This type of assay has recently attracted considerable interest because of its potential to provide instantaneous diagnosis directly to patients. The range and interpretation of results and parameters used for evaluation of the assay will also be discussed. The main advantages and disadvantages of LFAs will be summarized and relevant future improvements to testing devices and strategies will be proposed. Finally, the major recent advances and future diagnostic applications in the LFA field will be explored. PMID:27365041

  16. Lateral flow assays

    PubMed Central

    Koczula, Katarzyna M.

    2016-01-01

    Lateral flow assays (LFAs) are the technology behind low-cost, simple, rapid and portable detection devices popular in biomedicine, agriculture, food and environmental sciences. This review presents an overview of the principle of the method and the critical components of the assay, focusing on lateral flow immunoassays. This type of assay has recently attracted considerable interest because of its potential to provide instantaneous diagnosis directly to patients. The range and interpretation of results and parameters used for evaluation of the assay will also be discussed. The main advantages and disadvantages of LFAs will be summarized and relevant future improvements to testing devices and strategies will be proposed. Finally, the major recent advances and future diagnostic applications in the LFA field will be explored. PMID:27365041

  17. Tube-Forming Assays.

    PubMed

    Brown, Ryan M; Meah, Christopher J; Heath, Victoria L; Styles, Iain B; Bicknell, Roy

    2016-01-01

    Angiogenesis involves the generation of new blood vessels from the existing vasculature and is dependent on many growth factors and signaling events. In vivo angiogenesis is dynamic and complex, meaning assays are commonly utilized to explore specific targets for research into this area. Tube-forming assays offer an excellent overview of the molecular processes in angiogenesis. The Matrigel tube forming assay is a simple-to-implement but powerful tool for identifying biomolecules involved in angiogenesis. A detailed experimental protocol on the implementation of the assay is described in conjunction with an in-depth review of methods that can be applied to the analysis of the tube formation. In addition, an ImageJ plug-in is presented which allows automatic quantification of tube images reducing analysis times while removing user bias and subjectivity.

  18. New Rapid Spore Assay

    NASA Astrophysics Data System (ADS)

    Kminek, Gerhard; Conley, Catharine

    2012-07-01

    The presentation will detail approved Planetary Protection specifications for the Rapid Spore Assay for spacecraft components and subsystems. Outlined will be the research and studies on which the specifications were based. The research, funded by ESA and NASA/JPL, was conducted over a period of two years and was followed by limited cleanroom studies to assess the feasibility of this assay during spacecraft assembly.

  19. Doped colorimetric assay liposomes

    DOEpatents

    Charych, Deborah; Stevens, Raymond C.

    2001-01-01

    The present invention provides compositions comprising colorimetric assay liposomes. The present invention also provides methods for producing colorimetric liposomes and calorimetric liposome assay systems. In preferred embodiments, these calorimetric liposome systems provide high levels of sensitivity through the use of dopant molecules. As these dopants allow the controlled destabilization of the liposome structure, upon exposure of the doped liposomes to analyte(s) of interest, the indicator color change is facilitated and more easily recognized.

  20. SNAP Assay Technology.

    PubMed

    O'Connor, Thomas P

    2015-12-01

    The most widely used immunoassay configuration is the enzyme-linked immunosorbent assay (ELISA) because the procedure produces highly sensitive and specific results and generally is easy to use. By definition, ELISAs are immunoassays used to detect a substance (typically an antigen or antibody) in which an enzyme is attached (conjugated) to one of the reactants and an enzymatic reaction is used to amplify the signal if the substance is present. Optimized ELISAs include several steps that are performed in sequence using a defined protocol that typically includes application of sample and an enzyme-conjugated antibody or antigen to an immobilized reagent, followed by wash and enzyme reaction steps. The SNAP assay is an in-clinic device that performs each of the ELISA steps in a timed sequential fashion with little consumer interface. The components and mechanical mechanism of the assay device are described. Detailed descriptions of features of the assay, which minimize nonspecific binding and enhance the ability to read results from weak-positive samples, are given. Basic principles used in assays with fundamentally different reaction mechanisms, namely, antigen-detection, antibody-detection, and competitive assays are given. Applications of ELISA technology, which led to the development of several multianalyte SNAP tests capable of testing for up to 6 analytes using a single-sample and a single-SNAP device are described.

  1. Analysis of 23S rRNA genes in metagenomes - a case study from the Global Ocean Sampling Expedition.

    PubMed

    Yilmaz, Pelin; Kottmann, Renzo; Pruesse, Elmar; Quast, Christian; Glöckner, Frank Oliver

    2011-09-01

    As an evolutionary marker, 23S ribosomal RNA (rRNA) offers more diagnostic sequence stretches and greater sequence variation than 16S rRNA. However, 23S rRNA is still not as widely used. Based on 80 metagenome samples from the Global Ocean Sampling (GOS) Expedition, the usefulness and taxonomic resolution of 23S rRNA were compared to those of 16S rRNA. Since 23S rRNA is approximately twice as large as 16S rRNA, twice as many 23S rRNA gene fragments were retrieved from the GOS reads than 16S rRNA gene fragments, with 23S rRNA gene fragments being generally about 100bp longer. Datasets for 16S and 23S rRNA sequences revealed similar relative abundances for major marine bacterial and archaeal taxa. However, 16S rRNA sequences had a better taxonomic resolution due to their significantly larger reference database. Reevaluation of the specificity of previously published PCR amplification primers and group specific fluorescence in situ hybridization probes on this metagenomic set of non-amplified 23S rRNA sequences revealed that out of 16 primers investigated, only two had more than 90% target group coverage. Evaluations of two probes, BET42a and GAM42a, were in accordance with previous evaluations, with a discrepancy in the target group coverage of the GAM42a probe when evaluated against the GOS metagenomic dataset.

  2. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    PubMed

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  3. Strong nondipole effects in low-energy photoionization of the 5s and 5p subshells of xenon

    SciTech Connect

    Johnson, W. R.; Cheng, K. T.

    2001-02-01

    Large nondipole effects are predicted in the angular distribution of photoelectrons from the 5s and 5p subshells of xenon for photon energies below 200 eV. The nondipole parameter {gamma}{sub 5s} exhibits a dispersion-curve variation near the first minimum of the 5s cross section at 35 eV, reaching a minimum value of -0.8 near 40 eV. Rapid variation of {gamma}{sub 5s} is also found near the second minimum of the 5s cross section at 150 eV, where {gamma}{sub 5s} reaches a maximum value of 1.2. Smaller, but significant, nondipole effects are also found in the parameter {zeta}{sub 5p}={gamma}{sub 5p}+3{delta}{sub 5p}, which has a maximum value of 0.15 near 50 eV, and a second maximum value of 0.18 near 160 eV. The higher energy maxima in {gamma}{sub 5s} and {zeta}{sub 5p} arise from correlation enhanced by shape resonances in the 4p{yields}f quadrupole photoionization channels. These predictions are based on relativistic random-phase approximation calculations in which excitations from 5p, 5s, 4d, 4p, and 4s subshells are coupled.

  4. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  5. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    NASA Astrophysics Data System (ADS)

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  6. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA.

    PubMed

    Kumke, Katrin; Macas, Jiří; Fuchs, Jörg; Altschmied, Lothar; Kour, Jasmeet; Dhar, Manoj K; Houben, Andreas

    2016-01-01

    B chromosomes are supernumerary dispensable parts of the karyotype which appear in some individuals of some populations in some species. Using advanced sequencing technology, we in silico characterized the high-copy DNA composition of Plantago lagopus with and without B chromosomes. The nuclear genome (2.46 pg/2C) was found to be relatively rich in repetitive sequences, with highly and moderately repeated elements making up 68% of the genome. Besides a centromere-specific marker, we identified a B-specific satellite and a repeat enriched in polymorphic A chromosome segments. The B-specific tandem repeat PLsatB originated from sequence amplification including 5S rDNA fragments. PMID:27173804

  7. The FERRUM project: Experimental transition probabilities from highly excited even 5s levels in Cr ii

    NASA Astrophysics Data System (ADS)

    Engström, L.; Lundberg, H.; Nilsson, H.; Hartman, H.; Bäckström, E.

    2014-10-01

    We report lifetime measurements of the five levels in the 3d4(a5D)5s e6D term in Cr ii at an energy around 83 000 cm-1, and log(gf) values for 38 transitions from the investigated levels. The lifetimes are obtained using time-resolved, laser-induced fluorescence on ions from a laser-produced plasma. Since the levels have the same parity as the low-lying states directly populated in the plasma, we used a two-photon excitation scheme. This process is greatly facilitated by the presence of the 3d4(a5D)4p z6F levels at roughly half the energy difference. The f-values are obtained by combining the experimental lifetimes with branching fractions derived using relative intensities from a hollow cathode lamp recorded with a Fourier transform spectrometer.

  8. Direct lateral interbody fusion (DLIF) at the lumbosacral junction L5-S1.

    PubMed

    Shirzadi, Ali; Birch, Kurtis; Drazin, Doniel; Liu, John C; Acosta, Frank

    2012-07-01

    The direct lateral interbody fusion (DLIF), a minimally invasive lateral approach for placement of an interbody fusion device, does not require nerve root retraction or any contact with the great vessels and can lead to short operative times with little blood loss. Due to anatomical restrictions, this procedure has not been used at the lumbosacral (L5-S1) junction. Lumbosacral transitional vertebrae (LSTV), a structural anomaly of the lumbosacral spine associated with low back pain, can result in a level being wrongly identified pre-operatively due to misnumbering of the vertebral levels. To our knowledge, use of the DLIF graft in this patient is the first report of an interbody fusion graft being placed at the disc space between the LSTV and S1 via the transpsoas route. We present a review of the literature regarding the LSTV variation as well as the lateral placement of interbody fusion grafts at the lumbosacral junction.

  9. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    SciTech Connect

    Vilkas, M J; Ishikawa, Y; Trabert, E

    2008-02-29

    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  10. Phylogenetic relationships among diploid Aegilops species inferred from 5S rDNA units.

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2009-10-01

    Relationships among the currently recognized 11 diploid species within the genus Aegilops have been investigated. Sequence similarity analysis, based upon 363 sequenced 5S rDNA clones from 44 accessions plus 15 sequences retrieved from GenBank, depicted two unit classes labeled the long AE1 and short AE1. Several different analytical methods were applied to infer relationships within haplomes, between haplomes and among the species, including maximum parsimony and maximum likelihood analyses of consensus sequences, "total evidence" phylogeny analysis and "matrix representation with parsimony" analysis. None were able to depict suites of markers or unit classes that could discern among the seven haplomes as is observed among established haplomes in other genera within the tribe Triticeae; however, most species could be separated when displayed on gene trees. These results suggest that the haplomes currently recognized are so refined that they may be relegated as sub-haplomes or haplome variants. Amblyopyrum shares the same 5S rDNA unit classes with the diploid Aegilops species suggesting that it belongs within the latter. Comparisons of the Aegilops sequences with those of Triticum showed that the long AE1 unit class of Ae. tauschii shared the clade with the equivalent long D1 unit class, i.e., the putative D haplome donor, but the short AE1 unit class did not. The long AE1 unit class but not the short, of Ae. speltoides and Ae. searsii both share the clade with the previously identified long {S1 and long G1 unit classes meaning that both Aegilops species can be equally considered putative B haplome donors to tetraploid Triticum species. The semiconserved nature of the nontranscribed spacer in Aegilops and in Triticeae in general is discussed in view that it may have originated by processes of incomplete gene conversion or biased gene conversion or birth-and-death evolution.

  11. Measurement of {Upsilon}(5S) decays to B{sup 0} and B{sup +} mesons

    SciTech Connect

    Drutskoy, A.; Kinoshita, K.; Schwartz, A. J.; Adachi, I.; Haba, J.; Itoh, R.; Iwasaki, Y.; Katayama, N.; Kichimi, H.; Krokovny, P.; Nakao, M.; Nishida, S.; Sakai, Y.; Sumisawa, K.; Trabelsi, K.; Tsuboyama, T.; Uno, S.; Wicht, J.; Aihara, H.; Aulchenko, V.

    2010-06-01

    Decays of the {Upsilon}(5S) resonance to channels with B{sup +} and B{sup 0} mesons are studied using a 23.6 fb{sup -1} data sample collected with the Belle detector at the KEKB asymmetric-energy e{sup +}e{sup -} collider. Fully reconstructed B{sup +{yields}}J/{psi}K{sup +}, B{sup 0{yields}}J/{psi}K*{sup 0}, B{sup +{yields}}D{sup 0{pi}+}, and B{sup 0{yields}}D{sup -{pi}+} decays are used to obtain the charged and neutral B production rates per bb event, f(B{sup +})=(72.1{sub -3.8}{sup +3.9{+-}}5.0)% and f(B{sup 0})=(77.0{sub -5.6}{sup +5.8{+-}}6.1)%. Assuming equal rates to B{sup +} and B{sup 0} mesons in all channels produced at the {Upsilon}(5S) energy, we measure the fractions for transitions to two-body and three-body channels with B meson pairs, f(BB)=(5.5{sub -0.9}{sup +1.0{+-}}0.4)%, f(BB*+B*B)=(13.7{+-}1.3{+-}1.1)%, f(B*B*)=(37.5{sub -1.9}{sup +2.1{+-}}3.0)%, f(BB{pi})=(0.0{+-}1.2{+-}0.3)%, f(BB*{pi}+B*B{pi})=(7.3{sub -2.1}{sup +2.3{+-}}0.8)%, and f(B*B*{pi})=(1.0{sub -1.3}{sup +1.4{+-}}0.4)%. The latter three fractions are obtained assuming isospin conservation.

  12. Measuring B{sub s} width difference at the {Upsilon}(5s) using quantum entanglement

    SciTech Connect

    Atwood, David; Soni, Amarjit

    2010-08-01

    About 90% of B{sub s}B{sub s} pairs produced at the {Upsilon}(5s) resonance are initially B{sub s}{sup *}B{sub s}{sup *} pairs which decay radiatively to B{sub s}B{sub s}. This implies that the B{sub s}B{sub s} pair will then be in an eigenstate of charge conjugation (i.e. C=-1) and therefore in an entangled state. This allows for a determination of {Delta}{Gamma}{sub s}/{Gamma}{sub s} and the CP phase using a number of possible correlations between the decays of the two B{sub s} mesons. In particular, we consider the time integrated correlation, the time ordering asymmetry, and the time ordering-charge asymmetry, which in addition to time ordering distinguishes B{sub s} from B{sub s}, for various combinations of final states. With the statistics of about O(10{sup 7}-10{sup 8}) {Upsilon}(5s) events available at B factories, we find that the time ordering asymmetry between suitably defined hadronic and flavor specific (tagging) decays offers a promising method for determining the width difference. The corresponding time ordering-charge asymmetry can also bound the mixing phase. Similar observables involving exclusive decays are also considered. At the super B factories with O(50) times greater luminosity time ordering and time ordering-charge asymmetries between inclusive and exclusive modes may also provide additional bounds on the phases in those decays.

  13. Observation of B{sub s} Production at the {upsilon}(5S) Resonance

    SciTech Connect

    Bonvicini, G.; Cinabro, D.; Dubrovin, M.; Lincoln, A.; Bornheim, A.; Pappas, S.P.; Weinstein, A.; Asner, D.M.; Edwards, K.W.; Briere, R.A.; Chen, G.P.; Chen, J.; Ferguson, T.; Tatishvili, G.; Vogel, H.; Watkins, M.E.; Rosner, J.L.; Adam, N.E.; Alexander, J.P.; Berkelman, K.

    2006-01-20

    Using the CLEO detector at the Cornell Electron Storage Ring, we have observed the B{sub s} meson in e{sup +}e{sup -} annihilation at the {upsilon}(5S) resonance. We find 14 candidates consistent with B{sub s} decays into final states with a J/{psi} or a D{sub s}{sup (*)-}. The probability that we have observed a background fluctuation is less than 8x10{sup -10}. We have established that at the energy of the {upsilon}(5S) resonance B{sub s} production proceeds predominantly through the creation of B{sub s}*B{sub s}* pairs. We find {sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s}*)=[0.11{sub -0.03}{sup +0.04}(stat){+-}0.02(syst)] nb, and set the following limits: {sigma}(e{sup +}e{sup -}{yields}B{sub s}B{sub s})/{sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s}*)<0.16 and [{sigma}(e{sup +}e{sup -}{yields}B{sub s}B{sub s}*)+{sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s})]/{sigma}(e{sup +}e{sup -}{yields}B{sub s}*= B{sub s}*)<0.16 (90% C.L.). The mass of the B{sub s}* meson is measured to be M{sub B{sub s}}{sub *}=[5.414{+-}0.001(stat){+-}0.003(syst)] GeV/c{sup 2}.

  14. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy.

    PubMed

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure-sample entropy (SampEn)-and a more recently proposed complexity measure-distribution entropy (DistEn)-were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol.

  15. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    PubMed Central

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  16. Chromosome mapping of 18S rDNA and 5S rDNA by dual-color fluorescence in situ hybridization in the half-smooth tongue sole (Cynoglossus semilaevis).

    PubMed

    Jiang, L; Jiang, J; Liu, J; Yuan, J; Chen, Y; Zhang, Q; Wang, X

    2014-12-18

    Half-smooth tongue sole (Cynoglossus semilaevis) is an important aquaculture flatfish in China. Cytogenetic analysis has revealed that its sex determination system is female heterogametic (ZZ/ZW). The W chromosome is morphologically larger and has been considered evolutionarily younger than any other chromosome in the set. However, the genetic origin and evolution process of this neo-chromosome remains unclear. In this study, 2 tandem arrays of rRNA genes were chosen to address this question. Both the major rDNA (18S rDNA) and the minor rDNA (5S rDNA) were located on the C. semilaevis chromosomes by fluorescence in situ hybridization (FISH). Six 18S rDNA signals were observed on the centromeric regions of 3 pairs of autosomes in both males and females. In females, there was an additional 18S rDNA signal mapping to the telomeric region of the W chromosome long arm. With respect to the 5S rDNA, 12 signals were mapped to the centromeric regions of six pairs of autosomes. Two-color FISH further confirmed that the two pairs of the 5S rDNA signals were correspondingly located at the same positions of the same autosomes as those of the 18S rDNA signals. These results allowed us to speculate about the evolution process of the W chromosome. Chromosome fusions and repetitive sequence accumulations might have occurred in C. semilaevis. The synteny and non-synteny of C. semilaevis 18S rDNA and 5S rDNA might imply the original and evolutionary characteristics of this species. These findings will facilitate studies on karyotype evolution of the order Pleuronectiformes.

  17. Trans-splicing and RNA editing of LSU rRNA in Diplonema mitochondria

    PubMed Central

    Valach, Matus; Moreira, Sandrine; Kiethega, Georgette N.; Burger, Gertraud

    2014-01-01

    Mitochondrial ribosomal RNAs (rRNAs) often display reduced size and deviant secondary structure, and sometimes are fragmented, as are their corresponding genes. Here we report a mitochondrial large subunit rRNA (mt-LSU rRNA) with unprecedented features. In the protist Diplonema, the rnl gene is split into two pieces (modules 1 and 2, 534- and 352-nt long) that are encoded by distinct mitochondrial chromosomes, yet the rRNA is continuous. To reconstruct the post-transcriptional maturation pathway of this rRNA, we have catalogued transcript intermediates by deep RNA sequencing and RT-PCR. Gene modules are transcribed separately. Subsequently, transcripts are end-processed, the module-1 transcript is polyuridylated and the module-2 transcript is polyadenylated. The two modules are joined via trans-splicing that retains at the junction ∼26 uridines, resulting in an extent of insertion RNA editing not observed before in any system. The A-tail of trans-spliced molecules is shorter than that of mono-module 2, and completely absent from mitoribosome-associated mt-LSU rRNA. We also characterize putative antisense transcripts. Antisense-mono-modules corroborate bi-directional transcription of chromosomes. Antisense-mt-LSU rRNA, if functional, has the potential of guiding concomitantly trans-splicing and editing of this rRNA. Together, these findings open a window on the investigation of complex regulatory networks that orchestrate multiple and biochemically diverse post-transcriptional events. PMID:24259427

  18. Sequence arrangement of the rRNA genes of the dipteran Sarcophaga bullata.

    PubMed

    French, C K; Fouts, D L; Manning, J E

    1981-06-11

    Velocity sedimentation studies of RNA of Sarcophaga bullata show that the major rRNA species have sedimentation values of 26S and 18S. Analysis of the rRNA under denaturing conditions indicates that there is a hidden break centrally located in the 26S rRNA species. Saturation hybridization studies using total genomic DNA and rRNA show that 0.08% of the nuclear DNA is occupied by rRNA coding sequences and that the average repetition frequency of these coding sequences is approximately 144. The arrangement of the rRNA genes and their spacer sequences on long strands of purified rDNA was determined by the examination of the structure of rRNa:DNA hybrids in the electron microscope. Long DNA strands contain several gene sets (18S + 26S) with one repeat unit containing the following sequences in order given: (a) An 18S gene of length 2.12 kb, (b) an internal transcribed spacer of length 2.01 kb, which contains a short sequence that may code for a 5.8S rRNA, (c) A 26S gene of length 4.06 kb which, in 20% of the cases, contains an intron with an average length of 5.62 kb, and (d) an external spacer of average length of 9.23 kb.

  19. Complementarity of Bacillus subtilis 16S rRNA with sites of antibiotic-dependent ribosome stalling in cat and erm leaders.

    PubMed Central

    Rogers, E J; Ambulos, N P; Lovett, P S

    1990-01-01

    Inducible cat and erm genes are regulated by translational attenuation. In this regulatory model, gene activation results from chloramphenicol- or erythromycin-dependent stalling of a ribosome at a precise site in the leader region of cat or erm transcripts. The stalled ribosome is believed to destabilize a downstream region of RNA secondary structure that sequesters the ribosome-binding site for the cat or erm coding sequence. Here we show that the ribosome stall sites in cat and erm leader mRNAs, designated crb and erb, respectively, are largely complementary to an internal sequence in 16S rRNA of Bacillus subtilis. A tetracycline resistance gene that is likely regulated by translational attenuation also contains a sequence in its leader mRNA, trb, which is complementary to a sequence in 16S rRNA that overlaps with the crb and erb complements. An in vivo assay is described which is designed to test whether 16S rRNA of a translating ribosome can interact with the crb sequence in mRNA in an inducer-dependent reaction. The assay compares the growth rate of cells expressing crb-86 with the growth rate of cells lacking crb-86 in the presence of subinhibitory levels of inducers of cat-86, chloramphenicol, fluorothiamphenicol, amicetin, or erythromycin. Under these conditions, crb-86 retarded growth. Deletion of the crb-86 sequence, insertion of ochre mutations into crb-86, or synonymous codon changes in crb-86 that decreased its complementarity with 16S rRNA all eliminated from detection inducer-dependent growth retardation. Lincomycin, a ribosomally targeted antibiotic that is not an inducer of cat-86, failed to selectively retard the growth of cells expressing crb-86. We suggest that cat-86 inducers enable the crb-86 sequence in mRNA to base pair with 16S rRNA of translating ribosome. When the base pairing is extensive, as with crb-86, ribosomes become transiently trapped on crb and are temporarily withdrawn from protein synthesis to the extent that growth rate

  20. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells

    PubMed Central

    Cao, Weibiao

    2016-01-01

    Mechanisms of the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA. PMID:26901778

  1. Quantitative real-time PCR assays for sensitive detection of Canada goose-specific fecal pollution in water sources.

    PubMed

    Fremaux, B; Boa, T; Yost, C K

    2010-07-01

    Canada geese (Branta canadensis) are prevalent in North America and may contribute to fecal pollution of water systems where they congregate. This work provides two novel real-time PCR assays (CGOF1-Bac and CGOF2-Bac) allowing for the specific and sensitive detection of Bacteroides 16S rRNA gene markers present within Canada goose feces.

  2. Selecting rRNA binding sites for the ribosomal proteins L4 and L6 from randomly fragmented rRNA: application of a method called SERF.

    PubMed

    Stelzl, U; Spahn, C M; Nierhaus, K H

    2000-04-25

    Two-thirds of the 54 proteins of the Escherichia coli ribosome interact directly with the rRNAs, but the rRNA binding sites of only a very few proteins are known. We present a method (selection of random RNA fragments; SERF) that can identify the minimal binding region for proteins within ribonucleo-protein complexes such as the ribosome. The power of the method is exemplified with the ribosomal proteins L4 and L6. Binding sequences are identified for both proteins and characterized by phosphorothioate footprinting. Surprisingly, the binding region of L4, a 53-nt rRNA fragment of domain I of 23S rRNA, can simultaneously and independently bind L24, one of the two assembly initiator proteins of the large subunit.

  3. Nucleolus-like bodies of fully-grown mouse oocytes contain key nucleolar proteins but are impoverished for rRNA.

    PubMed

    Shishova, Kseniya V; Lavrentyeva, Elena A; Dobrucki, Jurek W; Zatsepina, Olga V

    2015-01-15

    It is well known that fully-grown mammalian oocytes, rather than typical nucleoli, contain prominent but structurally homogenous bodies called "nucleolus-like bodies" (NLBs). NLBs accumulate a vast amount of material, but their biochemical composition and functions remain uncertain. To clarify the composition of the NLB material in mouse GV oocytes, we devised an assay to detect internal oocyte proteins with fluorescein-5-isothiocyanate (FITC) and applied the fluorescent RNA-binding dye acridine orange to examine whether NLBs contain RNA. Our results unequivocally show that, similarly to typical nucleoli, proteins and RNA are major constituents of transcriptionally active (or non-surrounded) NLBs as well as of transcriptionally silent (or surrounded) NLBs. We also show, by exposing fixed oocytes to a mild proteinase K treatment, that the NLB mass in oocytes of both types contains nucleolar proteins that are involved in all major steps of ribosome biogenesis, including rDNA transcription (UBF), early rRNA processing (fibrillarin), and late rRNA processing (NPM1/nucleophosmin/B23, nucleolin/C23), but none of the nuclear proteins tested, including SC35, NOBOX, topoisomerase II beta, HP1α, and H3. The ribosomal RPL26 protein was detected within the NLBs of NSN-type oocytes but is virtually absent from NLBs of SN-type oocytes. Taking into account that the major class of nucleolar RNA is ribosomal RNA (rRNA), we applied fluorescence in situ hybridization with oligonucleotide probes targeting 18S and 28S rRNAs. The results show that, in contrast to active nucleoli, NLBs of fully-grown oocytes are impoverished for the rRNAs, which is consistent with the absence of transcribed ribosomal genes in the NLB mass. Overall, the results of this study suggest that NLBs of fully-grown mammalian oocytes serve for storing major nucleolar proteins but not rRNA.

  4. Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group.

    SciTech Connect

    Bayvkin, S. G.; Lysov, Y. P.; Zakhariev, V.; Kelly, J. J.; Jackman, J.; Stahl, D. A.; Cherni, A.; Engelhardt Inst. of Molecular Biology; Loyola Univ.; Johns Hopkins Univ.; Univ. of Washington

    2004-08-01

    In order to determine if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30 gyrB sequences for B. cereus group strains with published 16S rRNA sequences. Our findings indicated that the three most common species of the B. cereus group, B. cereus, Bacillus thuringiensis, and Bacillus mycoides, were each heterogeneous in all three gene sequences, while all analyzed strains of Bacillus anthracis were found to be homogeneous. Based on analysis of 16S and 23S rRNA sequence variations, the microorganisms within the B. cereus group were divided into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, and these seven subgroups were further organized into two distinct clusters. This classification of the B. cereus group conflicts with current taxonomic groupings, which are based on phenotypic traits. The presence of B. cereus strains in six of the seven subgroups and the presence of B. thuringiensis strains in three of the subgroups do not support the proposed unification of B. cereus and B. thuringiensis into one species. Analysis of the available phenotypic data for the strains included in this study revealed phenotypic traits that may be characteristic of several of the subgroups. Finally, our results demonstrated that rRNA and gyrB sequences may be used for discriminating B. anthracis from other microorganisms in the B. cereus group.

  5. Against vaccine assay secrecy.

    PubMed

    Herder, Matthew; Hatchette, Todd F; Halperin, Scott A; Langley, Joanne M

    2015-01-01

    Increasing the transparency of the evidence base behind health interventions such as pharmaceuticals, biologics, and medical devices, has become a major point of critique, conflict, and policy focus in recent years. Yet the lack of publicly available information regarding the immunogenicity assays upon which many important, widely used vaccines are based has received no attention to date. In this paper we draw attention to this critical public health problem by reporting on our efforts to secure vaccine assay information in respect of 10 vaccines through Canada's access to information law. We argue, under Canadian law, that the public health interest in having access to the methods for these laboratory procedures should override claims by vaccine manufacturers and regulators that this information is proprietary; and, we call upon several actors to take steps to ensure greater transparency with respect to vaccine assays, including regulators, private firms, researchers, research institutions, research funders, and journal editors.

  6. Rover waste assay system

    SciTech Connect

    Akers, D.W.; Stoots, C.M.; Kraft, N.C.; Marts, D.J.

    1997-11-01

    The Rover Waste Assay System (RWAS) is a nondestructive assay system designed for the rapid assay of highly-enriched {sup 235}U contaminated piping, tank sections, and debris from the Rover nuclear rocket fuel processing facility at the Idaho Chemical Processing Plant. A scanning system translates a NaI(Tl) detector/collimator system over the structural components where both relative and calibrated measurements for {sup 137}Cs are made. Uranium-235 concentrations are in operation and is sufficiently automated that most functions are performed by the computer system. These functions include system calibration, problem identification, collimator control, data analysis, and reporting. Calibration of the system was done through a combination of measurements on calibration standards and benchmarked modeling. A description of the system is presented along with the methods and uncertainties associated with the calibration and analysis of the system for components from the Rover facility. 4 refs., 2 figs., 4 tabs.

  7. Interpreting coagulation assays.

    PubMed

    Green, David

    2010-09-01

    The interpretation of coagulation assays requires knowledge of the principal clotting pathways. The activated partial thromboplastin time is sensitive to all hemostatic factors except FVII, whereas the prothrombin time reflects levels of prothrombin and FV, FVII, and FX. Using the two tests in concert is helpful in identifying hemophilia, the coagulopathy of liver disease, and disseminated intravascular coagulation. In addition, the activated partial thromboplastin time and prothrombin time are used for monitoring anticoagulant therapy with heparin and warfarin, respectively. Measurement of D-dimer is informative in patients suspected of having thrombotic disorders and determining the risk of thrombosis recurrence. Mixing tests distinguish clotting factor deficiencies from circulating anticoagulants such as heparin, the lupus anticoagulant, and antibodies directed against specific clotting factors. The modified Bethesda assay detects and provides an indication of the strength of FVIII inhibitors. However, interpreting the results of coagulation assays is not always straightforward, and expert consultation is occasionally required to resolve difficult clinical situations. PMID:20855988

  8. Against vaccine assay secrecy

    PubMed Central

    Herder, Matthew; Hatchette, Todd F; Halperin, Scott A; Langley, Joanne M

    2015-01-01

    Increasing the transparency of the evidence base behind health interventions such as pharmaceuticals, biologics, and medical devices, has become a major point of critique, conflict, and policy focus in recent years. Yet the lack of publicly available information regarding the immunogenicity assays upon which many important, widely used vaccines are based has received no attention to date. In this paper we draw attention to this critical public health problem by reporting on our efforts to secure vaccine assay information in respect of 10 vaccines through Canada's access to information law. We argue, under Canadian law, that the public health interest in having access to the methods for these laboratory procedures should override claims by vaccine manufacturers and regulators that this information is proprietary; and, we call upon several actors to take steps to ensure greater transparency with respect to vaccine assays, including regulators, private firms, researchers, research institutions, research funders, and journal editors. PMID:25826194

  9. Multiplex Flow Assays

    PubMed Central

    2016-01-01

    Lateral flow or dipstick assays (e.g., home pregnancy tests), where an analyte solution is drawn through a porous membrane and is detected by localization onto a capture probe residing at a specific site on the flow strip, are the most commonly and extensively used type of diagnostic assay. However, after over 30 years of use, these assays are constrained to measuring one or a few analytes at a time. Here, we describe a completely general method, in which any single-plex lateral flow assay is transformed into a multiplex assay capable of measuring an arbitrarily large number of analytes simultaneously. Instead of identifying the analyte by its localization onto a specific geometric location in the flow medium, the analyte-specific capture probe is identified by its association with a specific optically encoded region within the flow medium. The capture probes for nucleic acids, antigens, or antibodies are attached to highly porous agarose beads, which have been encoded using multiple lanthanide emitters to create a unique optical signature for each capture probe. The optically encoded capture probe-derivatized beads are placed in contact with the analyte-containing porous flow medium and the analytes are captured onto the encoded regions as the solution flows through the porous medium. To perform a multiplex diagnostic assay, a solution comprising multiple analytes is passed through the flow medium containing the capture probe-derivatized beads, and the captured analyte is treated with a suitable fluorescent reporter. We demonstrate this multiplex analysis technique by simultaneously measuring DNA samples, antigen–antibody pairs, and mixtures of multiple nucleic acids and antibodies.

  10. Fluorometric assay for aflatoxins

    SciTech Connect

    Chakrabarti, A.G.

    1984-11-01

    The method that is now widely adopted by the government laboratories for the assay of individual aflatoxin components (B/sub 1/, B/sub 2/, G/sub 1/, and G/sub 2/) utilizes a TLC technique. The extraction and clean-up steps of this technique were further researched but the method is still time consuming. It is, therefore, very important to develop a rapid and accurate assay technique for aflatoxins. The current research proposes a technique which utilizes a Turner Fluorometer.

  11. Lateral flow strip assay

    DOEpatents

    Miles, Robin R.; Benett, William J.; Coleman, Matthew A.; Pearson, Francesca S.; Nasarabadi, Shanavaz L.

    2011-03-08

    A lateral flow strip assay apparatus comprising a housing; a lateral flow strip in the housing, the lateral flow strip having a receiving portion; a sample collection unit; and a reagent reservoir. Saliva and/or buccal cells are collected from an individual using the sample collection unit. The sample collection unit is immersed in the reagent reservoir. The tip of the lateral flow strip is immersed in the reservoir and the reagent/sample mixture wicks up into the lateral flow strip to perform the assay.

  12. The nature of Z_b states from a combined analysis of Upsilon (5S)rightarrow h_b(mP) π ^+ π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π

    NASA Astrophysics Data System (ADS)

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-03-01

    With a combined analysis of data on Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π in an effective field theory approach, we determine resonance parameters of Z_b states in two scenarios. In one scenario we assume that Z_b states are pure molecular states, while in the other one we assume that Z_b states contain compact components. We find that the present data favor that there should be some compact components inside Z_b^{(' )} associated with the molecular components. By fitting the invariant mass spectra of Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{*}π , we determine that the probability of finding the compact components in Z_b states may be as large as about 40 %.

  13. Effects of single-base substitutions within the acanthamoeba castellanii rRNA promoter on transcription and on binding of transcription initiation factor and RNA polymerase I

    SciTech Connect

    Kownin, P.; Bateman, E.; Paule, M.R.

    1988-02-01

    Single-point mutations were introduced into the promoter region of the Acanthamoeba castellanii rRNA gene by chemical mutagen treatment of a single-stranded clone in vitro, followed by reverse transcription and cloning of the altered fragment. The promoter mutants were tested for transcription initiation factor (TIF) binding by a template commitment assay plus DNase I footprinting and for transcription by an in vitro runoff assay. Point mutations within the previously identified TIF interaction region (between -20 and -47, motifs A and B) indicated that TIF interacts most strongly with a sequence centered at -29 and less tightly with sequences upstream and downstream. Some alterations of the base sequence closer to the transcription start site (and outside the TIF-protected site) also significantly decrease specific RNA synthesis in vitro. These were within the region which is protected from DNAse I digestion by polymerase I, but these mutations did not detectably affect the binding of polymerase to the promoter.

  14. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  15. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  16. Nuclear rRNA transcript processing versus internal transcribed spacer secondary structure.

    PubMed

    Coleman, Annette W

    2015-03-01

    rRNA is one of the few universal features of life, making it uniquely suited to assess phylogenetic relationships. The processing of the initial polycistronic rRNA transcript is also a conserved process, involving numerous cleavage events and the generation of secondary structures. The secondary structure of the internal transcribed spacer (ITS) regions of nuclear rRNA transcripts are well known for a wide variety of eukaryotes and have been used to aid in the alignment of these sequences for phylogenetic comparisons. By contrast, study of the processing of the initial rRNA transcripts has been largely limited to yeast, mice, rats, and humans. Here I examine the known cleavage sites in the two ITS regions and their positions relative to the secondary structure. A better understanding of the conservation of secondary structures and cleavage sites within the ITS regions will improve evolutionary inferences based on these sequences.

  17. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage.

  18. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  19. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  20. Hard X-ray XAFS beamline, BL5S1, at AichiSR

    NASA Astrophysics Data System (ADS)

    Tabuchi, M.; Asakura, H.; Morimoto, H.; Watanabe, N.; Takeda, Y.

    2016-05-01

    A XAFS beamline, BL5S1, had been operated at Aichi Synchrotron Radiation Center, Japan since March 2013. The beamline was designed for the measurements in the energy range from 5 to 20 keV. The photon flux of 6 x 1010 at around 9 keV and beam spot size of 0.5 x 0.3 mm at sample position are as good as designed. For the standard transmission XAFS measurement, both of the step- and quick- scan modes are available. Energy resolution at around 9keV is good enough to discuss the energy shift of the order of 0.1 eV or higher even when the measurements are conducted in the quick-scan mode. With several kinds of detectors for fluorescence and/or CEY detection mode measurements, and various kinds of sample holders which are supported by the XAFS measurement software, users easily obtain spectra for their samples. Such a standard, well operated and easy to access XAFS beamline must be very important to broaden the base of the XAFS society further.

  1. Potentials for modeling cold collisions between Na (3S) and Rb (5S) atoms

    SciTech Connect

    Pashov, A.; Docenko, O.; Tamanis, M.; Ferber, R.; Knoeckel, H.; Tiemann, E.

    2005-12-15

    The experimental characterization of the electronic states correlated to the asymptote of ground state Na (3S) and Rb (5S) atoms was expanded by spectroscopic data on a {sup 3}{sigma}{sup +} state levels using a high resolution Fourier transform spectroscopy technique. The hyperfine splitting of the a {sup 3}{sigma}{sup +} state levels was partially resolved and analyzed for both Na {sup 85}Rb and Na {sup 87}Rb isotopomers. Transitions to high lying levels of the a {sup 3}{sigma}{sup +} and X {sup 1}{sigma}{sup +} states were recorded simultaneously which enables one to determine long range parameters of the molecular potentials. Coupled channels calculations based on the Fourier grid method were finally applied for deriving accurate potential energy curves of the a {sup 3}{sigma}{sup +} and X {sup 1}{sigma}{sup +} states capable of a reliable description of cold collisions between Na and Rb atoms in their ground states. Scattering lengths and Feshbach resonances were calculated for some quantum states.

  2. Design and performance of a 1 MW-5 s high temperature superconductor magnetic energy storage system

    NASA Astrophysics Data System (ADS)

    Morandi, Antonio; Gholizad, Babak; Fabbri, Massimo

    2016-01-01

    The feasibility of a 1 MW-5 s superconducting magnetic energy storage (SMES) system based on state-of-the-art high-temperature superconductor (HTS) materials is investigated in detail. Both YBCO coated conductors and MgB2 are considered. A procedure for the electromagnetic design of the coil is introduced and the final layout is arrived at and compared for the two materials. The choice of the inductance of the coil is carried out as part of the design procedure. Both low-field (3 T) and high-field (8 T) designs are considered for the YBCO. AC losses during a complete charge/discharge cycle at full power are estimated and the cooling power needed for continuous operation is derived. The power conditioning system and control algorithms needed to carry out various operations are discussed in detail. Performances of the SMES system during voltage sag compensation, load leveling and power factor correction are investigated by means of numerical simulation.

  3. Assessment of fecal pollution sources in a small northern-plains watershed using PCR and phylogenetic analyses of Bacteroidetes 16S rRNA gene

    USGS Publications Warehouse

    Lamendella, R.; Domingo, J.W.S.; Oerther, D.B.; Vogel, J.R.; Stoeckel, D.M.

    2007-01-01

    We evaluated the efficacy, sensitivity, host-specificity, and spatial/temporal dynamics of human- and ruminant-specific 16S rRNA gene Bacteroidetes markers used to assess the sources of fecal pollution in a fecally impacted watershed. Phylogenetic analyses of 1271 fecal and environmental 16S rRNA gene clones were also performed to study the diversity of Bacteroidetes in this watershed. The host-specific assays indicated that ruminant feces were present in 28-54% of the water samples and in all sampling seasons, with increasing frequency in downstream sites. The human-targeted assays indicated that only 3-5% of the water samples were positive for human fecal signals, although a higher percentage of human-associated signals (19-24%) were detected in sediment samples. Phylogenetic analysis indicated that 57% of all water clones clustered with yet-to-be-cultured Bacteroidetes species associated with sequences obtained from ruminant feces, further supporting the prevalence of ruminant contamination in this watershed. However, since several clusters contained sequences from multiple sources, future studies need to consider the potential cosmopolitan nature of these bacterial populations when assessing fecal pollution sources using Bacteroidetes markers. Moreover, additional data is needed in order to understand the distribution of Bacteroidetes host-specific markers and their relationship to water quality regulatory standards. ?? 2006 Federation of European Microbiological Societies.

  4. Electrochemical detection of synthetic DNA and native 16S rRNA fragments on a microarray using a biotinylated intercalator as coupling site for an enzyme label.

    PubMed

    Zimdars, Andreas; Gebala, Magdalena; Hartwich, Gerhard; Neugebauer, Sebastian; Schuhmann, Wolfgang

    2015-10-01

    The direct electrochemical detection of synthetic DNA and native 16S rRNA fragments isolated from Escherichia coli is described. Oligonucleotides are detected via selective post-labeling of double stranded DNA and DNA-RNA duplexes with a biotinylated intercalator that enables high-specific binding of a streptavidin/alkaline phosphatase conjugate. The alkaline phosphatase catalyzes formation of p-aminophenol that is subsequently oxidized at the underlying gold electrode and hence enables the detection of complementary hybridization of the DNA capture strands due to the enzymatic signal amplification. The hybridization assay was performed on microarrays consisting of 32 individually addressable gold microelectrodes. Synthetic DNA strands with sequences representing six different pathogens which are important for the diagnosis of urinary tract infections could be detected at concentrations of 60 nM. Native 16S rRNA isolated from the different pathogens could be detected at a concentration of 30 fM. Optimization of the sensing surface is described and influences on the assay performance are discussed.

  5. Dynamics and rRNA transcriptional activity of lactococci and lactobacilli during Cheddar cheese ripening.

    PubMed

    Desfossés-Foucault, Émilie; LaPointe, Gisèle; Roy, Denis

    2013-08-16

    Cheddar cheese is a complex ecosystem where both the bacterial population and the cheese making process contribute to flavor and texture development. The aim of this study was to use molecular methods to evaluate the impact of milk heat treatment and ripening temperature on starter lactococci and non-starter lactic acid bacteria (NSLAB) throughout ripening of Cheddar cheese. Eight Cheddar cheese batches were manufactured (four with thermized and four with pasteurized milk) and ripened at 4, 7 and 12°C to analyze the bacterial composition and rRNA transcriptional activity reflecting the ability of lactococci and lactobacilli to synthesize proteins. Abundance and rRNA transcription of lactococci and lactobacilli were quantified after DNA and RNA extraction by using quantitative PCR (qPCR) and reverse transcription-quantitative PCR (RT-qPCR) targeting the 16S rRNA gene, respectively. Results showed that lactococci remained dominant throughout ripening, although 16S rRNA genome and cDNA copies/g of cheese decreased by four and two log copy numbers, respectively. Abundance and rRNA transcription of Lactobacillus paracasei, Lactobacillus buchneri/parabuchneri, Lactobacillus rhamnosus, Lactobacillus brevis, and Lactobacillus coryniformis as well as total lactobacilli were also estimated using specific 16S rRNA primers. L. paracasei and L. buchneri/parabuchneri concomitantly grew in cheese made from thermized milk at 7 and 12°C, although L. paracasei displayed the most rRNA transcription among Lactobacillus species. This work showed that rRNA transcriptional activity of lactococci decreased throughout ripening and supports the usefulness of RNA analysis to assess which bacterial species have the ability to synthesize proteins during ripening, and could thereby contribute to cheese quality. PMID:23850855

  6. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  7. Use of Pyrosequencing of 16S rRNA Fragments to Differentiate between Bacteria Responsible for Neonatal Sepsis

    PubMed Central

    Jordan, Jeanne A.; Butchko, Allyson R.; Beth Durso, Mary

    2005-01-01

    Infants admitted to neonatal intensive care units for suspicion of bacterial sepsis receive at least two broad-spectrum antibiotics for a minimum of 48 to 72 hours to cover both gram-positive and gram-negative organisms while awaiting blood culture results. On average, bacterial growth becomes detectable within 12 to 24 hours, with an additional 24 to 48 hours required for identification. We have previously described using a 16S rRNA PCR assay for screening neonatal blood for bacterial DNA. Combining PCR with DNA sequencing could prove a faster means of detecting bacteria than culture-based identification. If successful, antibiotic therapy could be appropriately tailored sooner, thus sparing infants the administration of unnecessary antibiotics. Our goal was to assess the potential of pyrosequencing to differentiate between bacteria commonly associated with neonatal sepsis. To begin, full-length sequencing of the 380-bp 16S rRNA amplicons from representative bacteria was conducted (ABI 3100) and several databases queried. These included Staphylococcus sp., Streptococcus sp., Listeria sp., and numerous gram-negative rods. The sequences from clinical isolates were identical to those present in the published databases for the same bacteria. As a result, an informative 15 bases within the 380-bp amplicon was targeted for pyrosequencing following enrichment culture and PCR amplification. A total of 643 bacterial isolates commonly associated with neonatal sepsis, and 15 PCR-positive, culture-positive neonatal whole blood samples were analyzed by pyrosequencing. Results of DNA sequencing and culture identification were compared. In summary, we were successful at using PCR and pyrosequencing together to accurately differentiate between highly diverse bacterial groups. PMID:15681481

  8. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report

    PubMed Central

    Lee, Sin Hang

    2016-01-01

    Lyme disease (LD), the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA) gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. PMID:27186082

  9. Rapid differentiation of Francisella species and subspecies by fluorescent in situ hybridization targeting the 23S rRNA

    PubMed Central

    2010-01-01

    Background Francisella (F.) tularensis is the causative agent of tularemia. Due to its low infectious dose, ease of dissemination and high case fatality rate, F. tularensis was the subject in diverse biological weapons programs and is among the top six agents with high potential if misused in bioterrorism. Microbiological diagnosis is cumbersome and time-consuming. Methods for the direct detection of the pathogen (immunofluorescence, PCR) have been developed but are restricted to reference laboratories. Results The complete 23S rRNA genes of representative strains of F. philomiragia and all subspecies of F. tularensis were sequenced. Single nucleotide polymorphisms on species and subspecies level were confirmed by partial amplification and sequencing of 24 additional strains. Fluorescent In Situ Hybridization (FISH) assays were established using species- and subspecies-specific probes. Different FISH protocols allowed the positive identification of all 4 F. philomiragia strains, and more than 40 F. tularensis strains tested. By combination of different probes, it was possible to differentiate the F. tularensis subspecies holarctica, tularensis, mediasiatica and novicida. No cross reactivity with strains of 71 clinically relevant bacterial species was observed. FISH was also successfully applied to detect different F. tularensis strains in infected cells or tissue samples. In blood culture systems spiked with F. tularensis, bacterial cells of different subspecies could be separated within single samples. Conclusion We could show that FISH targeting the 23S rRNA gene is a rapid and versatile method for the identification and differentiation of F. tularensis isolates from both laboratory cultures and clinical samples. PMID:20205957

  10. Structural Insights into the Methylation of C1402 in 16S rRNA by Methyltransferase RsmI

    PubMed Central

    Liu, Guangfeng; Wang, Li; Wang, Jian; Gao, Zengqiang; Dong, Yuhui; Zhang, Linbo; Gong, Yong

    2016-01-01

    RsmI and RsmH are conserved S-Adenosylmethionine (AdoMet)-dependent methyltransferases (MTases) that are responsible for the 2′-O-methylation and N4-methylation of C1402 in bacterial 16S rRNA, respectively. Methylation of m4Cm1402 plays a role in fine-tuning the shape and functions of the P-site to increase the decoding fidelity, and was recently found to contribute to the virulence of Staphylococcus aureus in host animals. Here we report the 2.20-Å crystal structure of homodimeric RsmI from Escherichia coli in complex with the cofactor AdoMet. RsmI consists of an N-terminal putative RNA-binding domain (NTD) and a C-terminal catalytic domain (CTD) with a Rossmann-like fold, and belongs to the class III MTase family. AdoMet is specifically bound into a negatively charged deep pocket formed by both domains by making extensive contacts. Structure-based mutagenesis and isothermal titration calorimetry (ITC) assays revealed Asp100 and Ala124 are vital for AdoMet-binding. Although the overall fold of RsmI shows remarkable similarities to the characterized MTases involved in vitamin B12 biosynthesis, it exhibits a distinct charge distribution especially around the AdoMet-binding pocket because of different substrate specificity. The docking model of RsmI-AdoMet-RNA ternary complex suggested a possible base-flipping mechanism of the substrate RNA that has been observed in several known RNA MTases. Our structural and biochemical studies provide novel insights into the catalytic mechanism of C1402 methylation in 16S rRNA. PMID:27711192

  11. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report.

    PubMed

    Lee, Sin Hang

    2016-01-01

    Lyme disease (LD), the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA) gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain.

  12. Instrument for assaying radiation

    DOEpatents

    Coleman, Jody Rustyn; Farfan, Eduardo B.

    2016-03-22

    An instrument for assaying radiation includes a flat panel detector having a first side opposed to a second side. A collimated aperture covers at least a portion of the first side of the flat panel detector. At least one of a display screen or a radiation shield may cover at least a portion of the second side of the flat panel detector.

  13. Kinetic tetrazolium microtiter assay

    NASA Technical Reports Server (NTRS)

    Pierson, Duane L. (Inventor); Stowe, Raymond P. (Inventor); Koeing, David W. (Inventor)

    1992-01-01

    A method for conducting an in vitro cell assay using a tetrazolium indicator is disclosed. The indicator includes a nonionic detergent which solubilizes a tetrazolium reduction product in vitro and has low toxicity for the cells. The incubation of test cells in the presence of zolium bromide and octoxynol (TRITON X-100) permits kinetics of the cell metabolism to be determined.

  14. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    PubMed

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  15. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus. PMID:26959315

  16. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  17. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus.

    PubMed

    Caradonna, Fabio; Bellavia, Daniele; Clemente, Ann Maria; Sisino, Giorgia; Barbieri, Rainer

    2007-09-01

    In this paper the chromosomal localization and molecular cloning and characterization of three 5S rDNA clusters of 700 bp (base pairs), 900 bp, and 950 bp in the sea urchin Paracentrotus lividus are reported. Southern blot hybridization demonstrated the existence of three 5S rDNA repeats of differing length in the P. lividus genome. Fluorescence in situ hybridization analysis, performed in parallel on both haploid and diploid metaphases and interphase nuclei using different 5S rDNA units as probes, localized these 5S rDNA clusters in 3 different pairs of P. lividus chromosomes. This is the first complete gene mapping not only in a sea urchin but also in the phylum of echinoderms as a whole. PMID:17893727

  18. Chromosomal localization of 18S and 5S rDNA using FISH in the genus Tor (Pisces, Cyprinidae).

    PubMed

    Singh, Mamta; Kumar, Ravindra; Nagpure, N S; Kushwaha, B; Gond, Indramani; Lakra, W S

    2009-12-01

    Dual color fluorescence in situ hybridization (FISH) was performed to study the simultaneous chromosomal localization of 18S and 5S ribosomal genes in the genus Tor for the first time. The 18S and 5S rDNAs in four Tor species were amplified, sequenced and mapped on the metaphase chromosomes. The number and distribution of 18S and 5S rDNA clusters were examined on metaphase chromosome spreads using FISH. The specimens of T. chelynoides, T. putitora and T. progeneius showed six bright fluorescent signals of 18S rDNA and T. tor exhibited ten such signals. The 5S rDNA signals were present only on one pair of chromosomes in all the four Tor species. Ag-NORs were observed on two pairs of chromosomes in T. chelynoides, T. putitora, T. progeneius and four pairs in T. tor. Comparison of the observed 18S rDNA FISH signals and Ag-NORs strongly suggested a possible inactivation of NORs localized at the telomeres of a subtelocentric and telocentric chromosome pairs in all four species. The 5S rDNA contained an identical 120 bp long coding region and 81 bp long highly divergent non-transcribed spacers in all species examined. 18S and 5S rDNA sequencing and chromosomal localization can be a useful genetic marker in species identification as well as phylogenetic and evolutionary studies.

  19. Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

    NASA Technical Reports Server (NTRS)

    Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

    1985-01-01

    The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

  20. Localized frustration and binding-induced conformational change in recognition of 5S RNA by TFIIIA zinc finger.

    PubMed

    Tan, Cheng; Li, Wenfei; Wang, Wei

    2013-12-19

    Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.

  1. Novel Approach to Quantitative Detection of Specific rRNA in a Microbial Community, Using Catalytic DNA

    PubMed Central

    Suenaga, Hikaru; Liu, Rui; Shiramasa, Yuko; Kanagawa, Takahiro

    2005-01-01

    We developed a novel method for the quantitative detection of the 16S rRNA of a specific bacterial species in the microbial community by using deoxyribozyme (DNAzyme), which possesses the catalytic function to cleave RNA in a sequence-specific manner. A mixture of heterogeneous 16S rRNA containing the target 16S rRNA was incubated with a species-specific DNAzyme. The cleaved target 16S rRNA was separated from the intact 16S rRNA by electrophoresis, and then their amounts were compared for the quantitative detection of target 16S rRNA. This method was used to determine the abundance of the 16S rRNA of a filamentous bacterium, Sphaerotilus natans, in activated sludge, which is a microbial mixture used in wastewater treatment systems. The result indicated that this DNAzyme-based approach would be applicable to actual microbial communities. PMID:16085888

  2. Kinetic Tetrazolium Microtiter Assay

    NASA Technical Reports Server (NTRS)

    Pierson, Duane L.; Stowe, Raymond; Koenig, David

    1993-01-01

    Kinetic tetrazolium microtiter assay (KTMA) involves use of tetrazolium salts and Triton X-100 (or equivalent), nontoxic, in vitro color developer solubilizing colored metabolite formazan without injuring or killing metabolizing cells. Provides for continuous measurement of metabolism and makes possible to determine rate of action of antimicrobial agent in real time as well as determines effective inhibitory concentrations. Used to monitor growth after addition of stimulatory compounds. Provides for kinetic determination of efficacy of biocide, greatly increasing reliability and precision of results. Also used to determine relative effectiveness of antimicrobial agent as function of time. Capability of generating results on day of test extremely important in treatment of water and waste, disinfection of hospital rooms, and in pharmaceutical, agricultural, and food-processing industries. Assay also used in many aspects of cell biology.

  3. Radioreceptor assay for oxyphenonium.

    PubMed

    Ensing, K; de Zeeuw, R A

    1984-01-01

    The development of a radioreceptor assay for the quaternary anticholinergic drug, oxyphenonium, in plasma is reported. It is based on competition between this drug and 3H-dexetimide for binding to muscarinic receptors. After ion pair extraction and reextraction, the drug can be determined in plasma at concentrations down to a value of 100 pg/ml. This permits pharmacokinetic studies to be made after inhalation of oxyphenonium. PMID:6428927

  4. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  5. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  6. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  7. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  8. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  9. Transcription of the Drosophila melanogaster 5S RNA gene requires an upstream promoter and four intragenic sequence elements

    SciTech Connect

    Sharp, S.J.; Garcia, A.D.

    1988-03-01

    Linker-scanning (LS) mutations were constructed spanning the length of the Drosophila melanogaster 5S RNA gene. In vitro transcription analysis of the LS 5S DNAs revealed five transcription control regions. One control region essential for the transcription initiation was identified in the 5'-flanking sequence. The major sequence determinants of this upstream promoter region were located between coordinates -39 and -26 (-30 region), but important sequences extended to the transcription start site at position 1. Since mutations in the upstream promoter did not alter the ability of 5S DNA to sequester transcription factors into a stable transcription complex, it appears that this control region involved the interaction of RNA polymerase III. Active 5S DNA transcription additionally required the four intragenic control regions (ICRs) located between coordinates 3 and 18 (ICR I), 37 and 44 (ICR II), 48 and 61 (ICR III), and 78 and 98 (ICR IV). LS mutations in each ICR decreased the ability of 5S DNA to sequester transcription factors. ICR III, ICR IV, and the spacer sequence between were similar in sequence and position to the determinant elements of the multipartite ICR of Xenopus 5S DNA. The importance of ICR III and ICR IV in transcription initiation and in sequestering transcription factors suggests the presence of an activity in D. melanogaster similar to transcription factor TFIIIA of Xenopus laevis and HeLa cells. Transcription initiation of Drosophila 5S DNA was not eliminated by LS mutations in the spacer region even though these mutations reduced the ability of the TFIIIA-like activity to bind.

  10. Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

    PubMed

    Galián, José A; Rosato, Marcela; Rosselló, Josep A

    2014-03-01

    Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

  11. Contrasting patterns of the 5S and 45S rDNA evolutions in the Byblis liniflora complex (Byblidaceae).

    PubMed

    Fukushima, Kenji; Imamura, Kaori; Nagano, Katsuya; Hoshi, Yoshikazu

    2011-03-01

    To clarify the evolutionary dynamics of ribosomal RNA genes (rDNAs) in the Byblis liniflora complex (Byblidaceae), we investigated the 5S and 45S rDNA genes through (1) chromosomal physical mapping by fluorescence in situ hybridization (FISH) and (2) phylogenetic analyses using the nontranscribed spacer of 5S rDNA (5S-NTS) and the internal transcribed spacer of 45S rDNA (ITS). In addition, we performed phylogenetic analyses based on rbcL and trnK intron. The complex was divided into 2 clades: B. aquatica-B. filifolia and B. guehoi-B. liniflora-B. rorida. Although members of the complex had conservative symmetric karyotypes, they were clearly differentiated on chromosomal rDNA distribution patterns. The sequence data indicated that ITS was almost homogeneous in all taxa in which two or four 45S rDNA arrays were frequently found at distal regions of chromosomes in the somatic karyotype. ITS homogenization could have been prompted by relatively distal 45S rDNA positions. In contrast, 2-12 5S rDNA arrays were mapped onto proximal/interstitial regions of chromosomes, and some paralogous 5S-NTS were found in the genomes harboring 4 or more arrays. 5S-NTS sequence type-specific FISH analysis showed sequence heterogeneity within and between some 5S rDNA arrays. Interlocus homogenization may have been hampered by their proximal location on chromosomes. Chromosomal location may have affected the contrasting evolutionary dynamics of rDNAs in the B. liniflora complex.

  12. Scalar resonance contributions to the dipion transition rates of {upsilon}(4S,5S) in the rescattering model

    SciTech Connect

    Meng Ce; Chao, K.-T.

    2008-04-01

    In order to explain the observed unusually large dipion transition rates of {upsilon}(10870), the scalar resonance contributions in the rescattering model to the dipion transitions of {upsilon}(4S) and {upsilon}(5S) are studied. Since the imaginary part of the rescattering amplitude is expected to be dominant, the large ratios of the transition rates of {upsilon}(10870), which is identified with {upsilon}(5S), to that of {upsilon}(4S) can be understood as mainly coming from the difference between the p values in their decays into open bottom channels, and the ratios are estimated numerically to be about 200-600 with reasonable choices of parameters. The absolute and relative rates of {upsilon}(5S){yields}{upsilon}(1S,2S,3S){pi}{sup +}{pi}{sup -} and {upsilon}(5S){yields}{upsilon}(1S)K{sup +}K{sup -} are roughly consistent with data. We emphasize that the dipion transitions observed for some of the newly discovered Y states associated with charmonia may have similar features to the dipion transitions of {upsilon}(5S). Measurements on the dipion transitions of {upsilon}(6S) could provide further tests for this mechanism.

  13. Performance of 18S rRNA in littorinid phylogeny (Gastropoda: Caenogastropoda).

    PubMed

    Winnepenninckx, B M; Reid, D G; Backeljau, T

    1998-11-01

    In the past, 18S rRNA sequences have proved to be very useful for tracing ancient divergences but were rarely used for resolving more recent ones. Moreover, it was suggested that the molecule does not contain useful information to resolve divergences which took place during less than 40 Myr. The present paper takes littorinid phylogeny as a case study to reevaluate the utility of the molecule for resolving recent divergences. Two data sets for nine species of the snail family Littorinidae were analyzed, both separately and combined. One data set comprised 7 new complete 18S rRNA sequences aligned with 2 published littorinid sequences; the other comprised 12 morphological, 1 biochemical, and 2 18S rRNA secondary structure characters. On the basis of its ability to confirm generally accepted relationships and the congruence of results derived from the different data sets, it is concluded that 18S rRNA sequences do contain information to resolve "rapid" cladogenetic events, provided that they occurred in the not too distant past. 18S rRNA sequences yielded support for (1) the branching order (L. littorea, (L. obtusata, (L. saxatilis, L. compressa))) and (2) the basal position of L. striata in the Littorina clade. PMID:9797409

  14. Decreases in average bacterial community rRNA operon copy number during succession

    PubMed Central

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-01-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  15. 18S rRNA secondary structure and phylogenetic position of Peloridiidae (Insecta, hemiptera).

    PubMed

    Ouvrard, D; Campbell, B C; Bourgoin, T; Chan, K L

    2000-09-01

    A secondary structure model for 18S rRNA of peloridiids, relict insects with a present-day circumantarctic distribution, is constructed using comparative sequence analysis, thermodynamic folding, a consensus method using 18S rRNA models of other taxa, and support of helices based on compensatory substitutions. Results show that probable in vivo configuration of 18S rRNA is not predictable using current free-energy models to fold the entire molecule concurrently. This suggests that refinements in free-energy minimization algorithms are needed. Molecular phylogenetic datasets were created using 18S rRNA nucleotide alignments produced by CLUSTAL and rigorous interpretation of homologous position based on certain secondary substructures. Phylogenetic analysis of a hemipteran data matrix of 18S rDNA sequences placed peloridiids sister to Heteroptera. Resolution of affiliations between the three main euhemipteran lineages was unresolved. The peloridiid 18S RNA model presented here provides the most accurate template to date for aligning homologous nucleotides of hemipteran taxa. Using folded 18S rRNA to infer homology of character as morpho-molecular structures or nucleotides and scoring particular sites or substructures is discussed. PMID:10991793

  16. Decreases in average bacterial community rRNA operon copy number during succession.

    PubMed

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  17. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    PubMed

    Orsi, William; Biddle, Jennifer F; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  18. Novel essential gene Involved in 16S rRNA processing in Escherichia coli.

    PubMed

    Kurata, Tatsuaki; Nakanishi, Shinobu; Hashimoto, Masayuki; Taoka, Masato; Yamazaki, Yukiko; Isobe, Toshiaki; Kato, Jun-ichi

    2015-02-27

    Biogenesis of ribosomes is a complex process mediated by many factors. While its transcription proceeds, ribosomal RNA (rRNA) folds itself into a characteristic three-dimensional structure through interaction with ribosomal proteins, during which its ends are processed. Here, we show that the essential protein YqgF, a RuvC family protein with an RNase-H-like motif, is involved in the processing of pre-16S rRNA during ribosome maturation. Indeed, pre-16S rRNA accumulated in cells of a temperature-sensitive yqgF mutant (yqgF(ts)) cultured at a non-permissive temperature. In addition, purified YqgF was shown to process the 5' end of pre-16S rRNA within 70S ribosomes in vitro. Mass spectrometry analysis of the total proteins in the yqgF(ts) mutant cells showed that the expression of genes containing multiple Shine-Dalgarno-like sequences was observed to be lower than in wild type. These results are interpreted to indicate that YqgF is involved in a novel enzymic activity necessary for the processing of pre-16S rRNA, thereby affecting elongation of translation.

  19. Sequence and phylogenetic analysis of SSU rRNA gene of five microsporidia.

    PubMed

    Dong, ShiNan; Shen, ZhongYuan; Xu, Li; Zhu, Feng

    2010-01-01

    The complete small subunit rRNA (SSU rRNA) gene sequences of five microsporidia including Nosema heliothidis, and four novel microsporidia isolated from Pieris rapae, Phyllobrotica armta, Hemerophila atrilineata, and Bombyx mori, respectively, were obtained by PCR amplification, cloning, and sequencing. Two phylogenetic trees based on SSU rRNA sequences had been constructed by using Neighbor-Joining of Phylip software and UPGMA of MEGA4.0 software. The taxonomic status of four novel microsporidia was determined by analysis of phylogenetic relationship, length, G+C content, identity, and divergence of the SSU rRNA sequences. The results showed that the microsporidia isolated from Pieris rapae, Phyllobrotica armta, and Hemerophila atrilineata have close phylogenetic relationship with the Nosema, while another microsporidium isolated from Bombyx mori is closely related to the Endoreticulatus. So, we temporarily classify three novel species of microsporidia to genus Nosema, as Nosema sp. PR, Nosema sp. PA, Nosema sp. HA. Another is temporarily classified into genus Endoreticulatus, as Endoreticulatus sp. Zhenjiang. The result indicated as well that it is feasible and valuable to elucidate phylogenetic relationships and taxonomic status of microsporidian species by analyzing information from SSU rRNA sequences of microsporidia. PMID:19768503

  20. Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces

    PubMed Central

    Orsi, William; Biddle, Jennifer F.; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface. PMID:23418556

  1. Detection and discovery of crustacean parasites in blue crabs (Callinectes sapidus) by using 18S rRNA gene-targeted denaturing high-performance liquid chromatography.

    PubMed

    Troedsson, Christofer; Lee, Richard F; Walters, Tina; Stokes, Vivica; Brinkley, Karrie; Naegele, Verena; Frischer, Marc E

    2008-07-01

    Recently, we described a novel denaturing high-performance liquid chromatography (DHPLC) approach useful for initial detection and identification of crustacean parasites. Because this approach utilizes general primers targeted to conserved regions of the 18S rRNA gene, a priori genetic sequence information on eukaryotic parasites is not required. This distinction provides a significant advantage over specifically targeted PCR assays that do not allow for the detection of unknown or unsuspected parasites. However, initial field evaluations of the DHPLC assay suggested that because of PCR-biased amplification of dominant host genes it was not possible to detect relatively rare parasite genes in infected crab tissue. Here, we describe the use of a peptide nucleic acid (PNA) PCR hybridization blocking probe in association with DHPLC (PNA-PCR DHPLC) to overcome inherent PCR bias associated with amplification of rare target genes by use of generic primers. This approach was utilized to detect infection of blue crabs (Callinectes sapidus) by the parasitic dinoflagellate Hematodinium sp. Evaluation of 76 crabs caught in Wassaw Sound, GA, indicated a 97% correspondence between detection of the parasite by use of a specific PCR diagnostic assay and that by use of PNA-PCR DHPLC. During these studies, we discovered one crab with an association with a previously undescribed protist symbiont. Phylogenetic analysis of the amplified symbiont 18S rRNA gene indicated that it is most closely related to the free-living kinetoplastid parasite Procryptobia sorokini. To our knowledge, this is the first report of this parasite group in a decapod crab and of this organism exhibiting a presumably parasitic life history.

  2. Real-time PCR assay for rapid qualitative and quantitative detection of Entamoeba histolytica.

    PubMed

    Orosz, Erika; Perkátai, Katalin; Kapusinszky, Beatrix; Farkas, Agnes; Kucsera, István

    2012-12-01

    Simple real-time PCR assay with one set of primer and probe for rapid, sensitive qualitative and quantitative detection of Entamoeba histolytica has been used. Consensus sequences were used to amplify a species-specific region of the 16S rRNA gene, and fluorescence resonance energy transfer hybridization probes were used for detection in a LightCycler platform (Roche). The anchor probe sequence was designed to be a perfect match for the 16S rRNA gene of Entamoeba species, while the acceptor probe sequence was designed for Entamoeba histolytica, which allowed differentiation. The performed characteristics of the real-time PCR assay were compared with ELISA antigen and microscopical detection from 77 samples of individuals with suspected clinical diagnosis of imported E. histolytica infection. Stool and liver abscess pus samples were examined with analytical sensitivity of 5 parasites per PCR reaction. The melting curve means Tms (standard deviation) in clinical isolates were 54°C. The real-time assay was 100% sensitive and specific for differentiation of Entamoeba histolytica, compared with conventional ELISA or microscopy. This real-time PCR assay with melting curve analysis is rapid, and specific for the detection and differentiation of Entamoeba histolytica. The suitability for routine use of this assay in clinical diagnostic laboratories is discussed.

  3. C. elegans chemotaxis assay.

    PubMed

    Margie, Olivia; Palmer, Chris; Chin-Sang, Ian

    2013-01-01

    Many organisms use chemotaxis to seek out food sources, avoid noxious substances, and find mates. Caenorhabditis elegans has impressive chemotaxis behavior. The premise behind testing the response of the worms to an odorant is to place them in an area and observe the movement evoked in response to an odorant. Even with the many available assays, optimizing worm starting location relative to both the control and test areas, while minimizing the interaction of worms with each other, while maintaining a significant sample size remains a work in progress (1-10). The method described here aims to address these issues by modifying the assay developed by Bargmann et al.(1). A Petri dish is divided into four quadrants, two opposite quadrants marked "Test" and two are designated "Control". Anesthetic is placed in all test and control sites. The worms are placed in the center of the plate with a circle marked around the origin to ensure that non-motile worms will be ignored. Utilizing a four-quadrant system rather than one 2 or two 1 eliminates bias in the movement of the worms, as they are equidistant from test and control samples, regardless of which side of the origin they began. This circumvents the problem of worms being forced to travel through a cluster of other worms to respond to an odorant, which can delay worms or force them to take a more circuitous route, yielding an incorrect interpretation of their intended path. This method also shows practical advantages by having a larger sample size and allowing the researcher to run the assay unattended and score the worms once the allotted time has expired. PMID:23644543

  4. Radon assay for SNO+

    SciTech Connect

    Rumleskie, Janet

    2015-12-31

    The SNO+ experiment will study neutrinos while located 6,800 feet below the surface of the earth at SNOLAB. Though shielded from surface backgrounds, emanation of radon radioisotopes from the surrounding rock leads to back-grounds. The characteristic decay of radon and its daughters allows for an alpha detection technique to count the amount of Rn-222 atoms collected. Traps can collect Rn-222 from various positions and materials, including an assay skid that will collect Rn-222 from the organic liquid scintillator used to detect interactions within SNO+.

  5. Growth cone collapse assay.

    PubMed

    Cook, Geoffrey M W; Jareonsettasin, Prem; Keynes, Roger J

    2014-01-01

    The growth cone collapse assay has proved invaluable in detecting and purifying axonal repellents. Glycoproteins/proteins present in detergent extracts of biological tissues are incorporated into liposomes, added to growth cones in culture and changes in morphology are then assessed. Alternatively purified or recombinant molecules in aqueous solution may be added directly to the cultures. In both cases after a defined period of time (up to 1 h), the cultures are fixed and then assessed by inverted phase contrast microscopy for the percentage of growth cones showing a collapsed profile with loss of flattened morphology, filopodia, and lamellipodia.

  6. Radon assay for SNO+

    NASA Astrophysics Data System (ADS)

    Rumleskie, Janet

    2015-12-01

    The SNO+ experiment will study neutrinos while located 6,800 feet below the surface of the earth at SNOLAB. Though shielded from surface backgrounds, emanation of radon radioisotopes from the surrounding rock leads to back-grounds. The characteristic decay of radon and its daughters allows for an alpha detection technique to count the amount of Rn-222 atoms collected. Traps can collect Rn-222 from various positions and materials, including an assay skid that will collect Rn-222 from the organic liquid scintillator used to detect interactions within SNO+.

  7. Application of PRECEDE-PROCEED model to tackle problems identified with diarrhoea burden among under-5s in Botswana.

    PubMed

    Popoola, Tosin; Mchunu, Gugu

    2015-05-01

    Diarrhoea has been identified as the second leading cause of mortality among under-5s and also claims more life than HIV, measles and malaria combined together in the same category of population. This article is a combination of literature review and personal experience of lessons learnt from past diarrhoea outbreaks in Botswana that caused significant rate of mortality among under-5s. The paper used literature review to identify contributory factors to diarrhoea burden among under-5s in Botswana and applied a community health nursing framework (PRECEDE-PROCEED) to tackle the problems identified. The study revealed that Botswana mothers are lacking in knowledge related to exclusive breastfeeding, prevention and treatment of diarrhoea disease. The paper recommends that health-care workers in Botswana be sensitized on current diarrhoea management to tailor their health education methods appropriately. PMID:26125574

  8. Xe 5s,5p correlation satellites in the region of strong interchannel interactions, 28--75 eV

    SciTech Connect

    Fahlman, A.; Krause, M.O.; Carlson, T.A.; Svensson, A.

    1984-08-01

    The Xe 5s,5p photoelectron satellite spectrum has been studied in the photon-energy range from 28 to 75 eV with the aid of synchrotron radiation. This range includes the Xe 5s Cooper minimum, and the cross sections and angular distribution data demonstrate the importance of the strong two-electron channels in the region where the 5s cross section is small. Although the behavior of the satellites was not recorded over the 4d maximum, the data near 75 eV show an enhancement in the cross section in that region. The data underline the need of including the two-electron channels explicitly in the theory over a wide photon-energy range.

  9. Application of PRECEDE-PROCEED model to tackle problems identified with diarrhoea burden among under-5s in Botswana.

    PubMed

    Popoola, Tosin; Mchunu, Gugu

    2015-05-01

    Diarrhoea has been identified as the second leading cause of mortality among under-5s and also claims more life than HIV, measles and malaria combined together in the same category of population. This article is a combination of literature review and personal experience of lessons learnt from past diarrhoea outbreaks in Botswana that caused significant rate of mortality among under-5s. The paper used literature review to identify contributory factors to diarrhoea burden among under-5s in Botswana and applied a community health nursing framework (PRECEDE-PROCEED) to tackle the problems identified. The study revealed that Botswana mothers are lacking in knowledge related to exclusive breastfeeding, prevention and treatment of diarrhoea disease. The paper recommends that health-care workers in Botswana be sensitized on current diarrhoea management to tailor their health education methods appropriately.

  10. Dissociative excitation of the N(+)(5S) state by electron impact on N2 - Excitation function and quenching

    NASA Technical Reports Server (NTRS)

    Erdman, P. W.; Zipf, E. C.

    1986-01-01

    Metastable N(+)(5S) ions were produced in the laboratory by dissociative excitation of N2 with energetic electrons. The resulting radiative decay of the N(+)(5S) state was observed with sufficient resolution to completely resolve the doublet from the nearby N2 molecular radiation. The excitation function was measured from threshold to 500 eV. The cross section peaks at a high electron energy and also exhibits a high threshold energy both of which are typical of dissociative excitation-ionization processes. This finding complicates the explanation of electron impact on N2 as the mechanism for the source of the 2145 A 'auroral mystery feature' by further increasing the required peak cross section. It is suggested that the apparent N(+)(5S) quenching in auroras may be an artifact due to the softening of the electron energy spectrum in the auroral E region.

  11. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location. PMID:27334092

  12. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.

    PubMed

    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B

    2016-07-01

    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex.

  13. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

  14. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.

    PubMed

    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B

    2016-07-01

    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex. PMID:26974236

  15. RAS - Screens & Assays - Drug Discovery

    Cancer.gov

    The RAS Drug Discovery group aims to develop assays that will reveal aspects of RAS biology upon which cancer cells depend. Successful assay formats are made available for high-throughput screening programs to yield potentially effective drug compounds.

  16. Biosensors: Viruses for ultrasensitive assays

    NASA Astrophysics Data System (ADS)

    Donath, Edwin

    2009-04-01

    A three-dimensional assay based on genetically engineered viral nanoparticles and nickel nanohairs can detect much lower levels of protein markers associated with heart attacks than conventional assays.

  17. The human 18S rRNA base methyltransferases DIMT1L and WBSCR22-TRMT112 but not rRNA modification are required for ribosome biogenesis

    PubMed Central

    Zorbas, Christiane; Nicolas, Emilien; Wacheul, Ludivine; Huvelle, Emmeline; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2015-01-01

    At the heart of the ribosome lie rRNAs, whose catalytic function in translation is subtly modulated by posttranscriptional modifications. In the small ribosomal subunit of budding yeast, on the 18S rRNA, two adjacent adenosines (A1781/A1782) are N6-dimethylated by Dim1 near the decoding site, and one guanosine (G1575) is N7-methylated by Bud23-Trm112 at a ridge between the P- and E-site tRNAs. Here we establish human DIMT1L and WBSCR22-TRMT112 as the functional homologues of yeast Dim1 and Bud23-Trm112. We report that these enzymes are required for distinct pre-rRNA processing reactions leading to synthesis of 18S rRNA, and we demonstrate that in human cells, as in budding yeast, ribosome biogenesis requires the presence of the modification enzyme rather than its RNA-modifying catalytic activity. We conclude that a quality control mechanism has been conserved from yeast to human by which binding of a methyltransferase to nascent pre-rRNAs is a prerequisite to processing, so that all cleaved RNAs are committed to faithful modification. We further report that 18S rRNA dimethylation is nuclear in human cells, in contrast to yeast, where it is cytoplasmic. Yeast and human ribosome biogenesis thus have both conserved and distinctive features. PMID:25851604

  18. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  19. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    PubMed

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  20. BactQuant: An enhanced broad-coverage bacterial quantitative real-time PCR assay

    PubMed Central

    2012-01-01

    Background Bacterial load quantification is a critical component of bacterial community analysis, but a culture-independent method capable of detecting and quantifying diverse bacteria is needed. Based on our analysis of a diverse collection of 16 S rRNA gene sequences, we designed a broad-coverage quantitative real-time PCR (qPCR) assay—BactQuant—for quantifying 16 S rRNA gene copy number and estimating bacterial load. We further utilized in silico evaluation to complement laboratory-based qPCR characterization to validate BactQuant. Methods The aligned core set of 4,938 16 S rRNA gene sequences in the Greengenes database were analyzed for assay design. Cloned plasmid standards were generated and quantified using a qPCR-based approach. Coverage analysis was performed computationally using >670,000 sequences and further evaluated following the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines. Results A bacterial TaqMan® qPCR assay targeting a 466 bp region in V3-V4 was designed. Coverage analysis showed that 91% of the phyla, 96% of the genera, and >80% of the 89,537 species analyzed contained at least one perfect sequence match to the BactQuant assay. Of the 106 bacterial species evaluated, amplification efficiencies ranged from 81 to 120%, with r2-value of >0.99, including species with sequence mismatches. Inter- and intra-run coefficient of variance was <3% and <16% for Ct and copy number, respectively. Conclusions The BactQuant assay offers significantly broader coverage than a previously reported universal bacterial quantification assay BactQuant in vitro performance was better than the in silico predictions. PMID:22510143

  1. TOTAL CULTURABLE VIRUS QUANTAL ASSAY

    EPA Science Inventory

    This chapter describes a quantal method for assaying culturable human enteric viruses from water matrices. The assay differs from the plaque assay described in Chapter 10 (December 1987 Revision) in that it is based upon the direct microscopic viewing of cells for virus-induced ...

  2. 16S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects.

    PubMed

    O'Neill, S L; Giordano, R; Colbert, A M; Karr, T L; Robertson, H M

    1992-04-01

    Bacterial endosymbionts of insects have long been implicated in the phenomenon of cytoplasmic incompatibility, in which certain crosses between symbiont-infected individuals lead to embryonic death or sex ratio distortion. The taxonomic position of these bacteria has, however, not been known with any certainty. Similarly, the relatedness of the bacteria infecting various insect hosts has been unclear. The inability to grow these bacteria on defined cell-free medium has been the major factor underlying these uncertainties. We circumvented this problem by selective PCR amplification and subsequent sequencing of the symbiont 16S rRNA genes directly from infected insect tissue. Maximum parsimony analysis of these sequences indicates that the symbionts belong in the alpha-subdivision of the Proteobacteria, where they are most closely related to the Rickettsia and their relatives. They are all closely related to each other and are assigned to the type species Wolbachia pipientis. Lack of congruence between the phylogeny of the symbionts and their insect hosts suggest that horizontal transfer of symbionts between insect species may occur. Comparison of the sequences for W. pipientis and for Wolbachia persica, an endosymbiont of ticks, shows that the genus Wolbachia is polyphyletic. A PCR assay based on 16S primers was designed for the detection of W. pipientis in insect tissue, and initial screening of insects indicates that cytoplasmic incompatibility may be a more general phenomenon in insects than is currently recognized. PMID:1557375

  3. Lactobacillus species identification by amplified ribosomal 16S-23S rRNA restriction fragment length polymorphism analysis.

    PubMed

    Sandes, S H C; Alvin, L B; Silva, B C; Zanirati, D F; Jung, L R C; Nicoli, J R; Neumann, E; Nunes, A C

    2014-12-01

    Lactic acid bacteria strains are commonly used for animal and human consumption due to their probiotic properties. One of the major genera used is Lactobacillus, a highly diverse genus comprised of several closely related species. The selection of new strains for probiotic use, especially strains of Lactobacillus, is the focus of several research groups. Accurate identification to species level is fundamental for research on new strains, as well as for safety assessment and quality assurance. The 16S-23S internal transcribed spacer (ITS-1) is a deeply homologous region among prokaryotes that is commonly used for identification to the species level because it is able to acquire and accumulate mutations without compromising general bacterial metabolism. In the present study, 16S-23S ITS regions of 45 Lactobacillus species (48 strains) were amplified and subjected to independent enzymatic digestions, using 12 restriction enzymes that recognise six-base sequences. Twenty-nine species showed unique restriction patterns, and could therefore be precisely identified solely by this assay (64%). This approach proved to be reproducible, allowing us to establish simplified restriction patterns for each evaluated species. The restriction patterns of each species were similar among homologous strains, and to a large extent reflected phylogenetic relationships based on 16S rRNA sequences, demonstrating the promising nature of this region for evolutionary studies.

  4. Chromosomal mapping of rRNA genes, core histone genes and telomeric sequences in Brachidontes puniceus and Brachidontes rodriguezi (Bivalvia, Mytilidae)

    PubMed Central

    2010-01-01

    Background Chromosome rearrangements are an important part of the speciation process in many taxa. The study of chromosome evolution in bivalves is hampered by the absence of clear chromosomal banding patterns and the similarity in both chromosome size and morphology. For this reason, obtaining good chromosome markers is essential for reliable karyotypic comparisons. To begin this task, the chromosomes of the mussels Brachidontes puniceus and B. rodriguezi were studied by means of fluorochrome staining and fluorescent in situ hybridization (FISH). Results Brachidontes puniceus and B. rodriguezi both have 2n = 32 chromosomes but differing karyotype composition. Vertebrate-type telomeric sequences appear at both ends of every single chromosome. B. puniceus presents a single terminal major rRNA gene cluster on a chromosome pair while B. rodriguezi shows two. Both mussels present two 5S rDNA and two core histone gene clusters intercalary located on the long arms of two chromosome pairs. Double and triple-FISH experiments demonstrated that one of the 5S rDNA and one of the major rDNA clusters appear on the same chromosome pair in B. rodriguezi but not in B. puniceus. On the other hand, the second 5S rDNA cluster is located in one of the chromosome pairs also bearing one of the core histone gene clusters in the two mussel species. Conclusion Knowledge of the chromosomal distribution of these sequences in the two species of Brachidontes is a first step in the understanding of the role of chromosome changes on bivalve evolution. PMID:21143946

  5. Nuclear modifier MTO2 modulates the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    PubMed

    He, Xiangyu; Zhu, Xiaoyu; Wang, Xuexiang; Wang, Wei; Dai, Yu; Yan, Qingfeng

    2013-01-01

    The phenotypic manifestations of mitochondrial DNA (mtDNA) mutations are modulated by mitochondrial DNA haplotypes, nuclear modifier genes and environmental factors. The yeast mitochondrial 15S rRNA C1477G (P(R) or P(R) 454) mutation corresponds to the human 12S rRNA C1494T and A1555G mutations, which are well known as primary factors for aminoglycoside-induced nonsyndromic deafness. Here we report that the deletion of the nuclear modifier gene MTO2 suppressed the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae. First, the strain with a single mtDNA C1477G mutation exhibited hypersensitivity to neomycin. Functional assays indicated that the steady-state transcription level of mitochondrial DNA, the mitochondrial respiratory rate, and the membrane potential decreased significantly after neomycin treatment. The impaired mitochondria could not produce sufficient energy to maintain cell viability. Second, when the mto2 null and the mitochondrial C1477G mutations co-existed (mto2(P(R))), the oxygen consumption rate in the double mutant decreased markedly compared to that of the control strains (MTO2(P(S)), mto2(P(S)) and MTO2(P(R))). The expression levels of the key glycolytic genes HXK2, PFK1 and PYK1 in the mto2(P(R)) strain were stimulated by neomycin and up-regulated by 89%, 112% and 55%, respectively. The enhanced glycolysis compensated for the respiratory energy deficits, and could be inhibited by the glycolytic enzyme inhibitor. Our findings in yeast will provide a new insight into the pathogenesis of human deafness.

  6. Phylogeny of protostome worms derived from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade.

  7. rRNA sequence comparison of Beauveria bassiana, Tolypocladium cylindrosporum, and Tolypocladium extinguens.

    PubMed

    Rakotonirainy, M S; Dutertre, M; Brygoo, Y; Riba, G

    1991-01-01

    Five strains of Tolypocladium cylindrosporum, one strain of Tolypocladium extinguens, and nine strains of Beauveria bassiana were analyzed using a rapid rRNA sequencing technique. The sequences of two highly variable domains (D1 and D2) located at the 5' end of the 28S-like rRNA molecule were determined. The phylogenetic tree computed from the absolute number of nucleotide differences shows the separation between the genus Beauveria and the genus Tolypocladium and points out that T. cylindrosporum and T. extinguens probably do not belong to the same genus.

  8. Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.

    PubMed

    Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A

    2016-07-01

    Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene.

  9. Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.

    PubMed

    Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A

    2016-07-01

    Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. PMID:27084674

  10. Chromosome-specific NOR inactivation explains selective rRNA gene silencing and dosage control in Arabidopsis

    PubMed Central

    Chandrasekhara, Chinmayi; Mohannath, Gireesha; Blevins, Todd; Pontvianne, Frederic; Pikaard, Craig S.

    2016-01-01

    In eukaryotes, scores of excess ribosomal RNA (rRNA) genes are silenced by repressive chromatin modifications. Given the near sequence identity of rRNA genes within a species, it is unclear how specific rRNA genes are reproducibly chosen for silencing. Using Arabidopsis thaliana ecotype (strain) Col-0, a systematic search identified sequence polymorphisms that differ between active and developmentally silenced rRNA gene subtypes. Recombinant inbred mapping populations derived from three different ecotype crosses were then used to map the chromosomal locations of silenced and active RNA gene subtypes. Importantly, silenced and active rRNA gene subtypes are not intermingled. All silenced rRNA gene subtypes mapped to the nucleolus organizer region (NOR) on chromosome 2 (NOR2). All active rRNA gene subtypes mapped to NOR4. Using an engineered A. thaliana line in which a portion of Col-0 chromosome 4 was replaced by sequences of another ecotype, we show that a major rRNA gene subtype silenced at NOR2 is active when introgressed into the genome at NOR4. Collectively, these results reveal that selective rRNA gene silencing is not regulated gene by gene based on mechanisms dependent on subtle gene sequence variation. Instead, we propose that a subchromosomal silencing mechanism operates on a multimegabase scale to inactivate NOR2. PMID:26744421

  11. Chemotaxis: Under Agarose Assay.

    PubMed

    Brazill, Derrick

    2016-01-01

    The unicellular eukaryote Dictyostelium discoideum represents a superb model for examining chemotaxis. Under vegetative conditions, the amoebae are chemotactically responsive to pterins, such as folate. Under starved conditions, they lose their sensitivity to pterins, and become chemotactically responsive to cAMP. As an NIH model system, Dictyostelium offers a variety of advantages in studying chemotaxis, including its conservation of mammalian signaling pathways, its ease of growth, and its genetic tractability. In this chapter, we describe the use of the under agarose chemotaxis assay to identify proteins involved in controlling motility and directional sensing in Dictyostelium discoideum. Given the similarities between Dictyostelium and mammalian cells, this allows us to dissect the conserved pathways involved in eukaryotic chemotaxis.

  12. Adipose tissue angiogenesis assay.

    PubMed

    Rojas-Rodriguez, Raziel; Gealekman, Olga; Kruse, Maxwell E; Rosenthal, Brittany; Rao, Kishore; Min, Soyun; Bellve, Karl D; Lifshitz, Lawrence M; Corvera, Silvia

    2014-01-01

    Changes in adipose tissue mass must be accompanied by parallel changes in microcirculation. Investigating the mechanisms that regulate adipose tissue angiogenesis could lead to better understanding of adipose tissue function and reveal new potential therapeutic strategies. Angiogenesis is defined as the formation of new capillaries from existing microvessels. This process can be recapitulated in vitro, by incubation of tissue in extracellular matrix components in the presence of pro-angiogenic factors. Here, we describe a method to study angiogenesis from adipose tissue fragments obtained from mouse and human tissue. This assay can be used to define effects of diverse factors added in vitro, as well as the role of endogenously produced factors on angiogenesis. We also describe approaches to quantify angiogenic potential for the purpose of enabling comparisons between subjects, thus providing information on the role of physiological conditions of the donor on adipose tissue angiogenic potential.

  13. snoU6 and 5S RNAs are not reliable miRNA reference genes in neuronal differentiation.

    PubMed

    Lim, Q E; Zhou, L; Ho, Y K; Wan, G; Too, H P

    2011-12-29

    Accurate profiling of microRNAs (miRNAs) is an essential step for understanding the functional significance of these small RNAs in both physiological and pathological processes. Quantitative real-time PCR (qPCR) has gained acceptance as a robust and reliable transcriptomic method to profile subtle changes in miRNA levels and requires reference genes for accurate normalization of gene expression. 5S and snoU6 RNAs are commonly used as reference genes in microRNA quantification. It is currently unknown if these small RNAs are stably expressed during neuronal differentiation. Panels of miRNAs have been suggested as alternative reference genes to 5S and snoU6 in various physiological contexts. To test the hypothesis that miRNAs may serve as stable references during neuronal differentiation, the expressions of eight miRNAs, 5S and snoU6 RNAs in five differentiating neuronal cell types were analyzed using qPCR. The stabilities of the expressions were evaluated using two complementary statistical approaches (geNorm and Normfinder). Expressions of 5S and snoU6 RNAs were stable under some but not all conditions of neuronal differentiation and thus are not suitable reference genes. In contrast, a combination of three miRNAs (miR-103, miR-106b and miR-26b) allowed accurate expression normalization across different models of neuronal differentiation.

  14. Peak shifts due to B{sup (*)}-B{sup (*)} rescattering in {upsilon}(5S) dipion transitions

    SciTech Connect

    Meng Ce; Chao Kuangta

    2008-08-01

    We study the energy distributions of dipion transitions {upsilon}(5S) to {upsilon}(1S,2S,3S){pi}{sup +}{pi}{sup -} in the final-state rescattering model. Since the {upsilon}(5S) is well above the open bottom thresholds, the dipion transitions are expected to mainly proceed through the real processes {upsilon}(5S){yields}B{sup (*)}B{sup (*)} and B{sup (*)}B{sup (*)}{yields}{upsilon}(1S,2S,3S){pi}{sup +}{pi}{sup -}. We find that the energy distributions of {upsilon}(1S,2S,3S){pi}{sup +}{pi}{sup -} markedly differ from that of {upsilon}(5S){yields}B{sup (*)}B{sup (*)}. In particular, the resonance peak will be pushed up by about 7-20 MeV for these dipion transitions relative to the main hadronic decay modes. These predictions can be used to test the final-state rescattering mechanism in hadronic transitions for heavy quarkonia above the open flavor thresholds.

  15. Contralateral interlaminar approach for intraforaminal lumbar degenerative disease with special emphasis on L5-S1 level: A technical note

    PubMed Central

    Zekaj, Edvin; Menghetti, Claudia; Saleh, Christian; Isidori, Alessandra; Bona, Alberto R.; Aimar, Enrico; Servello, Domenico

    2016-01-01

    Background: Intraforaminal disc herniations at the L5-S1 level are extremely surgically challenging lesions. Intracanal approaches frequently require partial or total facetectomy, which may lead to instability. Solely extraforaminal approaches may offer limited visualization of the more medial superiorly exiting and inferiorly exiting nerve roots; this approach is also more complicated at L5-S1 due to the often large L5 transverse process and the iliac wing. Methods: Nine patients with intraforaminal L5-S1 disc herniations, foraminal stenosis, or synovial cysts underwent contralateral interlaminar approaches for lesion resection. Preoperative and postoperative visual analog scale scores were evaluated, and complications were reviewed. Results: All 9 patients demonstrated immediate postoperative clinical improvement. None of the patients exhibited complications and none developed instability or neuropathic disorders. Conclusions: Although the number of cases in our sample was very small (9 in total), the contralateral interlaminar approach appeared to effectively address multiple degenerative L5-S1 foraminal pathologies. Large studies are needed to further evaluate the pros and cons of this approach. PMID:27713854

  16. Atypical processing in domain III of 23S rRNA of Rhizobium leguminosarum ATCC 10004(T) at a position homologous to an rRNA fragmentation site in protozoa.

    PubMed

    Klein, Franziska; Samorski, Regina; Klug, Gabriele; Evguenieva-Hackenberg, Elena

    2002-06-01

    For still unknown reasons, the 23S rRNA of many alpha-Proteobacteria shows a unique fragmentation pattern compared to other bacteria. The 23S rRNA processing involves RNase III and additional, yet unidentified enzymes. The alpha-proteobacterium Rhizobium leguminosarum ATCC 10004(T) possesses two fragmentation sites in its 23S rRNA. The first one harbors an intervening sequence in helix 9 which is cleaved by RNase III. We demonstrate that the mature 5' end of the resulting 2.6-kb rRNA fragment is generated by additional removal of helix 10. A fraction of the 2.6-kb rRNA is further processed in domain III, giving rise to two 1.3-kb rRNA fragments. We mapped the domain III fragmentation site and found it to be at a position which has only been reported for trypanosomatid protozoa. This fragmentation site is also unique in that it lacks an intervening sequence. We found that the simultaneous occurrence of 2.6-kb and 1.3-kb rRNA fragments is not due to interoperonal sequence differences but rather reflects slow processing. The different characteristics of the two fragmentation sites in the 23S rRNA suggest that they are processed by different mechanisms. Interestingly, the amount of 2.6-kb rRNA varies during culture growth. We observed a transient increase in the relative amount of 2.6-kb rRNA fragments during the first hours after inoculation, which points to changes in the ratio of rRNA synthesis rate to domain III processing rate during the growth of a culture.

  17. E sub 1 BF is an essential RNA polymerase I transcription factor with an intrinsic protein kinase activity that can modulate rRNA gene transcription

    SciTech Connect

    Ji Zhang; Huifeng Niu; Jacob, S.T. )

    1991-10-01

    The authors previously described the purification and characterization of E{sub 1}BF, a rat rRNA gene core promoter-binding factor that consists of two polypeptides of 89 and 79 kDa. When this factor was incubated in the absence of any exogenous protein kinase under conditions optimal for protein phosphorylation, the 79-kDa polypeptide of E{sub 1}BF was selectively phosphorylated. The labeled phosphate could be removed from the E{sub 1}BF polypeptide by treatment with calf intestinal alkaline phosphatase or potato acid phosphatase. Elution of the protein from the E{sub 1}BF-promoter complex formed in an electrophoretic mobility-shift assay followed by incubation of the concentrated eluent with ({gamma}-{sup 32}P)ATP resulted in the selective labeling o the 79-kDa band. The E{sub 1}BF-associated protein kinase did not phosphorylate casein or histone H1. These data demonstrate that (1) polymerase I promoter-binding factor E{sub 1}BF contains an intrinsic substrate-specific protein kinase and (2) E{sub 1}BF is an essential polymerase I transcription factor that can modulate rRNA gene transcription by protein phosphorylation. Further, these studies have provided a direct means to identify a protein kinase or any other enzyme that can interact with a specific DNA sequence.

  18. Source Bioaerosol Concentration and rRNA Gene-Based Identification of Microorganisms Aerosolized at a Flood Irrigation Wastewater Reuse Site

    PubMed Central

    Paez-Rubio, Tania; Viau, Emily; Romero-Hernandez, Socorro; Peccia, Jordan

    2005-01-01

    Reuse of partially treated domestic wastewater for agricultural irrigation is a growing practice in arid regions throughout the world. A field sampling campaign to determine bioaerosol concentration, culturability, and identity at various wind speeds was conducted at a flooded wastewater irrigation site in Mexicali, Baja California, Mexico. Direct fluorescent microscopy measurements for total microorganisms, culture-based assays for heterotrophs and gram-negative enteric bacteria, and small-subunit rRNA gene-based cloning were used for microbial characterizations of aerosols and effluent wastewater samples. Bioaerosol results were divided into two wind speed regimens: (i) below 1.9 m/s, average speed 0.5 m/s, and (ii) above 1.9 m/s, average speed 4.5 m/s. Average air-borne concentration of total microorganisms, culturable heterotrophs, and gram-negative enteric bacteria were, respectively, 1.1, 4.2, and 6.2 orders of magnitude greater during the high-wind-speed regimen. Small-subunit rRNA gene clone libraries processed from samples from air and the irrigation effluent wastewater during a high-wind sampling event indicate that the majority of air clone sequences were more than 98% similar to clone sequences retrieved from the effluent wastewater sample. Overall results indicate that wind is a potential aerosolization mechanism of viable wastewater microorganisms at flood irrigation sites. PMID:15691934

  19. Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    PubMed

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

  20. 23S rRNA gene-based enterococci community signatures in Lake Pontchartrain, Louisiana, USA, following urban runoff inputs after Hurricane Katrina.

    PubMed

    Bae, Hee-Sung; Hou, Aixin

    2013-02-01

    Little is known about the impacts of fecal polluted urban runoff inputs on the structure of enterococci communities in estuarine waters. This study employed a 23S rRNA gene-based polymerase chain reaction (PCR) assay with newly designed genus-specific primers, Ent127F-Ent907R, to determine the possible impacts of Hurricane Katrina floodwaters via the 17th Street Canal discharge on the community structure of enterococci in Lake Pontchartrain. A total of 94 phylotypes were identified through the restriction fragment length polymorphism (RFLP) screening of 494 clones while only 8 phylotypes occurred among 88 cultivated isolates. Sequence analyses of representative phylotypes and their temporal and spatial distribution in the lake and the canal indicated the Katrina floodwater input introduced a large portion of Enterococcus flavescens, Enterococcus casseliflavus, and Enterococcus dispar into the lake; typical fecal groups Enterococcus faecium, Enterococcus durans, Enterococcus hirae, and Enterococcus mundtii were detected primarily in the floodwater-impacted waters. This study provides a global picture of enterococci in estuarine waters impacted by Hurricane Katrina-derived urban runoff. It also demonstrates the culture-independent PCR approach using 23S rRNA gene as a molecular marker could be a good alternative in ecological studies of enterococci in natural environments to overcome the limitation of conventional cultivation methods.

  1. Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR.

    PubMed

    Tatti, Enrico; McKew, Boyd A; Whitby, Corrine; Smith, Cindy J

    2016-01-01

    Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with 'end-point' PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included. PMID:27341629

  2. Mechanistic Study on the Nuclear Modifier Gene MSS1 Mutation Suppressing Neomycin Sensitivity of the Mitochondrial 15S rRNA C1477G Mutation in Saccharomyces cerevisiae

    PubMed Central

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations. PMID:24595024

  3. 23S rRNA gene-based enterococci community signatures in Lake Pontchartrain, Louisiana, USA, following urban runoff inputs after Hurricane Katrina.

    PubMed

    Bae, Hee-Sung; Hou, Aixin

    2013-02-01

    Little is known about the impacts of fecal polluted urban runoff inputs on the structure of enterococci communities in estuarine waters. This study employed a 23S rRNA gene-based polymerase chain reaction (PCR) assay with newly designed genus-specific primers, Ent127F-Ent907R, to determine the possible impacts of Hurricane Katrina floodwaters via the 17th Street Canal discharge on the community structure of enterococci in Lake Pontchartrain. A total of 94 phylotypes were identified through the restriction fragment length polymorphism (RFLP) screening of 494 clones while only 8 phylotypes occurred among 88 cultivated isolates. Sequence analyses of representative phylotypes and their temporal and spatial distribution in the lake and the canal indicated the Katrina floodwater input introduced a large portion of Enterococcus flavescens, Enterococcus casseliflavus, and Enterococcus dispar into the lake; typical fecal groups Enterococcus faecium, Enterococcus durans, Enterococcus hirae, and Enterococcus mundtii were detected primarily in the floodwater-impacted waters. This study provides a global picture of enterococci in estuarine waters impacted by Hurricane Katrina-derived urban runoff. It also demonstrates the culture-independent PCR approach using 23S rRNA gene as a molecular marker could be a good alternative in ecological studies of enterococci in natural environments to overcome the limitation of conventional cultivation methods. PMID:23269456

  4. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    NASA Astrophysics Data System (ADS)

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

    2013-11-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  5. Modified nucleotides m(2)G966/m(5)C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon.

    PubMed

    Prokhorova, Irina V; Osterman, Ilya A; Burakovsky, Dmitry E; Serebryakova, Marina V; Galyamina, Maria A; Pobeguts, Olga V; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G; Govorun, Vadim M; Bogdanov, Alexey A; Sergiev, Petr V; Dontsova, Olga A

    2013-01-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show--using proteomic analysis and dual fluorescence reporter in vivo assays--that m(2)G966 and m(5)C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m(2)G966 and m(5)C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon. PMID:24241179

  6. Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

    PubMed Central

    Tatti, Enrico; McKew, Boyd A.; Whitby, Corrine; Smith, Cindy J.

    2016-01-01

    Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with 'end-point' PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included. PMID:27341629

  7. The utility of diversity profiling using Illumina 18S rRNA gene amplicon deep sequencing to detect and discriminate Toxoplasma gondii among the cyst-forming coccidia.

    PubMed

    Cooper, Madalyn K; Phalen, David N; Donahoe, Shannon L; Rose, Karrie; Šlapeta, Jan

    2016-01-30

    Next-generation sequencing (NGS) has the capacity to screen a single DNA sample and detect pathogen DNA from thousands of host DNA sequence reads, making it a versatile and informative tool for investigation of pathogens in diseased animals. The technique is effective and labor saving in the initial identification of pathogens, and will complement conventional diagnostic tests to associate the candidate pathogen with a disease process. In this report, we investigated the utility of the diversity profiling NGS approach using Illumina small subunit ribosomal RNA (18S rRNA) gene amplicon deep sequencing to detect Toxoplasma gondii in previously confirmed cases of toxoplasmosis. We then tested the diagnostic approach with species-specific PCR genotyping, histopathology and immunohistochemistry of toxoplasmosis in a Risso's dolphin (Grampus griseus) to systematically characterise the disease and associate causality. We show that the Euk7A/Euk570R primer set targeting the V1-V3 hypervariable region of the 18S rRNA gene can be used as a species-specific assay for cyst-forming coccidia and discriminate T. gondii. Overall, the approach is cost-effective and improves diagnostic decision support by narrowing the differential diagnosis list with more certainty than was previously possible. Furthermore, it supplements the limitations of cryptic protozoan morphology and surpasses the need for species-specific PCR primer combinations.

  8. Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR.

    PubMed

    Tatti, Enrico; McKew, Boyd A; Whitby, Corrine; Smith, Cindy J

    2016-06-11

    Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with 'end-point' PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included.

  9. Yeast DEL assay detects clastogens.

    PubMed

    Kirpnick, Zhanna; Homiski, Michael; Rubitski, Elizabeth; Repnevskaya, Marina; Howlett, Niall; Aubrecht, Jiri; Schiestl, Robert H

    2005-04-01

    Chromosomal rearrangements, including DNA deletions are involved in carcinogenesis. The deletion (DEL) assay scoring for DNA deletions in the yeast Saccharomyces cerevisiae is able to detect a wide range of carcinogens. Among approximately 60 compounds of known carcinogenic activity, the DEL assay detected 86% correctly whereas the Ames Salmonella assay detected only 30% correctly [R.J. Brennan, R.H. Schiestl, Detecting carcinogens with the yeast DEL assay, Methods Mol. Biol. 262 (2004) 111-124]. Since the DEL assay is highly inducible by DNA double strand breaks, this study examined the utility of the DEL assay for detecting clastogens. Ten model compounds, with varied mechanisms of genotoxicity, were examined for their effect on the frequency of DNA deletions with the DEL assay. The compounds tested were: actinomycin D, camptothecin, methotrexate and 5-fluorodeoxyuridine, which are anticancer agents, noscapine and furosemide are therapeutics, acridine, methyl acrylate and resorcinol are industrial chemicals and diazinon is an insecticide. The in vitro micronucleus assay (IVMN) in CHO cells, a commonly used tool for detection of clastogens, was performed on the same compounds and the results of the two assays were compared. The results of our study show that there is 70% concordance in the presence of metabolic activation (rat liver S9) and 80% concordance in the absence of metabolic activation between the DEL assay and the standard in vitro micronucleus assay. The lack of cytotoxicity observed for four of the ten compounds examined indicates limited diffusion of lipophilic compounds across the yeast cell wall. Thus, the development of a more permeable yeast tester strain is expected to greatly improve concordance of the DEL assay with the IVMN assay. The yeast DEL assay is inexpensive, amenable to automation and requires less expertise to perform than the IVMN. Thus, it has a strong potential as a robust, fast and economical screen for detecting clastogens in

  10. Unexpected Accumulation of ncm5U and ncm5s2U in a trm9 Mutant Suggests an Additional Step in the Synthesis of mcm5U and mcm5s2U

    PubMed Central

    Chen, Changchun; Huang, Bo; Anderson, James T.; Byström, Anders S.

    2011-01-01

    Background Transfer RNAs are synthesized as a primary transcript that is processed to produce a mature tRNA. As part of the maturation process, a subset of the nucleosides are modified. Modifications in the anticodon region often modulate the decoding ability of the tRNA. At position 34, the majority of yeast cytosolic tRNA species that have a uridine are modified to 5-carbamoylmethyluridine (ncm5U), 5-carbamoylmethyl-2′-O-methyluridine (ncm5Um), 5-methoxycarbonylmethyl-uridine (mcm5U) or 5-methoxycarbonylmethyl-2-thiouridine (mcm5s2U). The formation of mcm5 and ncm5 side chains involves a complex pathway, where the last step in formation of mcm5 is a methyl esterification of cm5 dependent on the Trm9 and Trm112 proteins. Methodology and Principal Findings Both Trm9 and Trm112 are required for the last step in formation of mcm5 side chains at wobble uridines. By co-expressing a histidine-tagged Trm9p together with a native Trm112p in E. coli, these two proteins purified as a complex. The presence of Trm112p dramatically improves the methyltransferase activity of Trm9p in vitro. Single tRNA species that normally contain mcm5U or mcm5s2U nucleosides were isolated from trm9Δ or trm112Δ mutants and the presence of modified nucleosides was analyzed by HPLC. In both mutants, mcm5U and mcm5s2U nucleosides are absent in tRNAs and the major intermediates accumulating were ncm5U and ncm5s2U, not the expected cm5U and cm5s2U. Conclusions Trm9p and Trm112p function together at the final step in formation of mcm5U in tRNA by using the intermediate cm5U as a substrate. In tRNA isolated from trm9Δ and trm112Δ strains, ncm5U and ncm5s2U nucleosides accumulate, questioning the order of nucleoside intermediate formation of the mcm5 side chain. We propose two alternative explanations for this observation. One is that the intermediate cm5U is generated from ncm5U by a yet unknown mechanism and the other is that cm5U is formed before ncm5U and mcm5U. PMID:21687733

  11. Sandwich hybridisation assay for quantitative detection of yeast RNAs in crude cell lysates

    PubMed Central

    Rautio, Jari; Barken, Kim Bundvig; Lahdenperä, Juhani; Breitenstein, Antje; Molin, Søren; Neubauer, Peter

    2003-01-01

    Background A rapid microtiter plate based sandwich hybridization assay was developed for detection and quantification of single RNA species using magnetic beads. Following solution hybridization target RNA molecules were collected by biotin-streptavidin affinity binding and detected by fluorescence signal generated by alkaline phosphatase. The 18S rRNA and SUC2 mRNA of Saccharomyces cerevisiae were used as model RNA target molecules. Results The sensitivity of the assay was approximately 1.2 × 109 (2 fmol) molecules of target RNA. The developed method was feasible with crude cell lysates of S. cerevisiae carlsbergensis and was evaluated by measuring the levels of 18S rRNA during cell growth and SUC2 mRNA under repressive and inductive conditions. The 18S rRNA expression level followed the changes in the specific growth rate. SUC2 mRNA levels were in good correlation with the measured invertase enzyme activities. Conclusions The here presented sandwich hybridisation method was succefully applied for monitoring the amounts of ribosomal RNA and mRNA with high expression level in shake flask cultivation conditions. Sandwich hybridisation method offers a fast and convenient tool for following single key RNA species of interest in the production conditions. PMID:12780940

  12. Molecular Diagnosis of Actinomadura madurae Infection by 16S rRNA Deep Sequencing

    PubMed Central

    SenGupta, Dhruba J.; Hoogestraat, Daniel R.; Cummings, Lisa A.; Bryant, Bronwyn H.; Natividad, Catherine; Thielges, Stephanie; Monsaas, Peter W.; Chau, Mimosa; Barbee, Lindley A.; Rosenthal, Christopher; Cookson, Brad T.; Hoffman, Noah G.

    2013-01-01

    Next-generation DNA sequencing can be used to catalog individual organisms within complex, polymicrobial specimens. Here, we utilized deep sequencing of 16S rRNA to implicate Actinomadura madurae as the cause of mycetoma in a diabetic patient when culture and conventional molecular methods were overwhelmed by overgrowth of other organisms. PMID:24108607

  13. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples. PMID:25343859

  14. Duplex-specific nuclease efficiently removes rRNA for prokaryotic RNA-seq.

    PubMed

    Yi, Hana; Cho, Yong-Joon; Won, Sungho; Lee, Jong-Eun; Jin Yu, Hyung; Kim, Sujin; Schroth, Gary P; Luo, Shujun; Chun, Jongsik

    2011-11-01

    Next-generation sequencing has great potential for application in bacterial transcriptomics. However, unlike eukaryotes, bacteria have no clear mechanism to select mRNAs over rRNAs; therefore, rRNA removal is a critical step in sequencing-based transcriptomics. Duplex-specific nuclease (DSN) is an enzyme that, at high temperatures, degrades duplex DNA in preference to single-stranded DNA. DSN treatment has been successfully used to normalize the relative transcript abundance in mRNA-enriched cDNA libraries from eukaryotic organisms. In this study, we demonstrate the utility of this method to remove rRNA from prokaryotic total RNA. We evaluated the efficacy of DSN to remove rRNA by comparing it with the conventional subtractive hybridization (Hyb) method. Illumina deep sequencing was performed to obtain transcriptomes from Escherichia coli grown under four growth conditions. The results clearly showed that our DSN treatment was more efficient at removing rRNA than the Hyb method was, while preserving the original relative abundance of mRNA species in bacterial cells. Therefore, we propose that, for bacterial mRNA-seq experiments, DSN treatment should be preferred to Hyb-based methods.

  15. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin

    PubMed Central

    Chahine, Sarah; Okafor, Darius; Ong, Ana C.; Maybank, Rosslyn; Kwak, Yoon I.; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2015-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  16. Occurrence of fragmented 16S rRNA in an obligate bacterial endosymbiont of Paramecium caudatum.

    PubMed Central

    Springer, N; Ludwig, W; Amann, R; Schmidt, H J; Görtz, H D; Schleifer, K H

    1993-01-01

    The phylogenetic position of Caedibacter caryophila, a so far noncultured killer symbiont of Paramecium caudatum, was elucidated by comparative sequence analysis of in vitro amplified 16S rRNA genes (rDNA). C. caryophila is a member of the alpha subclass of the Proteobacteria phylum. Within this subclass C. caryophila is moderately related to Holospora obtusa, which is another obligate endosymbiont of Paramecium caudatum, and to Rickettsia. A 16S rRNA targeted specific hybridization probe was designed and used for in situ detection of C. caryophila within its host cell. Comparison of the 16S rDNA primary structure of C. caryophila with homologous sequences from other bacteria revealed an unusual insertion of 194 base pairs within the 5'-terminal part of the corresponding gene. The intervening sequence is not present in mature 16S rRNA of C. caryophila. It was demonstrated that C. caryophila contained fragmented 16S rRNA. Images Fig. 5 Fig. 6 PMID:8234331

  17. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples.

  18. Unequal Crossing over at the Rrna Tandon as a Source of Quantitative Genetic Variation in Drosophila

    PubMed Central

    Frankham, R.; Briscoe, D. A.; Nurthen, R. K.

    1980-01-01

    Abdominal bristle selection lines (three high and three low) and controls were founded from a marked homozygous line to measure the contribution of sex-linked "mutations" to selection response. Two of the low lines exhibited a period of rapid response to selection in females, but not in males. There were corresponding changes in female variance, in heritabilities in females, in the sex ratio (a deficiency of females) and in fitness, as well as the appearance of a mutant phenotype in females of one line. All of these changes were due to bb alleles (partial deficiencies for the rRNA tandon) in the X chromosomes of these lines, while the Y chromosomes remained wild-type bb+. We argue that the bb alleles arose by unequal crossing over in the rRNA tandon.—A prediction of this hypothesis is that further changes can occur in the rRNA tandon as selection is continued. This has now been shown to occur.—Our minimum estimate of the rate of occurrence of changes at the rRNA tandon is 3 x 10-4. As this is substantially higher than conventional mutation rates, the questions of the mechanisms and rates of origin of new quantitative genetic variation require careful re-examination. PMID:7439683

  19. Quantitative Analysis of rRNA Modifications Using Stable Isotope Labeling and Mass Spectrometry

    PubMed Central

    2015-01-01

    Post-transcriptional RNA modifications that are introduced during the multistep ribosome biogenesis process are essential for protein synthesis. The current lack of a comprehensive method for a fast quantitative analysis of rRNA modifications significantly limits our understanding of how individual modification steps are coordinated during biogenesis inside the cell. Here, an LC-MS approach has been developed and successfully applied for quantitative monitoring of 29 out of 36 modified residues in the 16S and 23S rRNA from Escherichia coli. An isotope labeling strategy is described for efficient identification of ribose and base methylations, and a novel metabolic labeling approach is presented to allow identification of MS-silent pseudouridine modifications. The method was used to measure relative abundances of modified residues in incomplete ribosomal subunits compared to a mature 15N-labeled rRNA standard, and a number of modifications in both 16S and 23S rRNA were present in substoichiometric amounts in the preribosomal particles. The RNA modification levels correlate well with previously obtained profiles for the ribosomal proteins, suggesting that RNA is modified in a schedule comparable to the association of the ribosomal proteins. Importantly, this study establishes an efficient workflow for a global monitoring of ribosomal modifications that will contribute to a better understanding of mechanisms of RNA modifications and their impact on intracellular processes in the future. PMID:24422502

  20. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing.

    PubMed

    Dhawan, B; Sebastian, S; Malhotra, R; Kapil, A; Gautam, D

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  1. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin.

    PubMed

    McGann, Patrick; Chahine, Sarah; Okafor, Darius; Ong, Ana C; Maybank, Rosslyn; Kwak, Yoon I; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2016-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  2. Ribosome origins: The relative age of 23S rRNA Domains

    NASA Astrophysics Data System (ADS)

    Hury, James; Nagaswamy, Uma; Larios-Sanz, Maia; Fox, George E.

    2006-08-01

    The modern ribosome and its component RNAs are quite large and it is likely that at an earlier time they were much smaller. Hence, not all regions of the modern ribosomal RNAs (rRNA) are likely to be equally old. In the work described here, it is hypothesized that the oldest regions of the RNAs will usually be highly integrated into the machinery. When this is the case, an examination of the interconnectivity between local RNA regions can provide insight to the relative age of the various regions. Herein, we describe an analysis of all known long-range RNA/RNA interactions within the 23S rRNA and between the 23S rRNA and the 16S rRNA in order to assess the interconnectivity between the usual Domains as defined by secondary structure. Domain V, which contains the peptidyl transferase center is centrally located, extensively connected, and therefore likely to be the oldest region. Domain IV and Domain II are extensively interconnected with both themselves and Domain V. A portion of Domain IV is also extensively connected with the 30S subunit and hence Domain IV may be older than Domain II. These results are consistent with other evidence relating to the relative age of RNA regions. Although the relative time of addition of the GTPase center can not be reliably deduced it is pointed out that the development of this may have dramatically affected the progenotes that preceded the last common ancestor.

  3. Distribution of rRNA introns in the three-dimensional structure of the ribosome.

    PubMed

    Jackson, Scott; Cannone, Jamie; Lee, Jung; Gutell, Robin; Woodson, Sarah

    2002-10-11

    More than 1200 introns have been documented at over 150 unique sites in the small and large subunit ribosomal RNA genes (as of February 2002). Nearly all of these introns are assigned to one of four main types: group I, group II, archaeal and spliceosomal. This sequence information has been organized into a relational database that is accessible through the Comparative RNA Web Site (http://www.rna.icmb.utexas.edu/) While the rRNA introns are distributed across the entire tree of life, the majority of introns occur within a few phylogenetic groups. We analyzed the distributions of rRNA introns within the three-dimensional structures of the 30S and 50S ribosomes. Most sites in rRNA genes that contain introns contain only one type of intron. While the intron insertion sites occur at many different coordinates, the majority are clustered near conserved residues that form tRNA binding sites and the subunit interface. Contrary to our expectations, many of these positions are not accessible to solvent in the mature ribosome. The correlation between the frequency of intron insertions and proximity of the insertion site to functionally important residues suggests an association between intron evolution and rRNA function.

  4. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    PubMed

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  5. Detection of fecal bacteria and source tracking identifiers in environmental waters using rRNA-based RT-qPCR and rDNA-based qPCR assays.

    PubMed

    Pitkänen, Tarja; Ryu, Hodon; Elk, Michael; Hokajärvi, Anna-Maria; Siponen, Sallamaari; Vepsäläinen, Asko; Räsänen, Pia; Santo Domingo, Jorge W

    2013-01-01

    In this study, we evaluated the use of RT-qPCR assays targeting rRNA gene sequences for the detection of fecal bacteria in water samples. We challenged the RT-qPCR assays against RNA extracted from sewage effluent (n = 14), surface water (n = 30), and treated source water (n = 15) samples. Additionally, we applied the same assays using DNA as the qPCR template. The targeted fecal bacteria were present in most of the samples tested, although in several cases, the detection frequency increased when RNA was used as the template. For example, the majority of samples that tested positive for E. coli and Campylobacter spp. in surface waters, and for human-specific Bacteroidales, E. coli, and Enterococcus spp. in treated source waters were only detected when rRNA was used as the original template. The difference in detection frequency using rRNA or rDNA (rRNA gene) was sample- and assay-dependent, suggesting that the abundance of active and nonactive populations differed between samples. Statistical analyses for each population exhibiting multiple quantifiable results showed that the rRNA copy numbers were significantly higher than the rDNA counterparts (p < 0.05). Moreover, the detection frequency of rRNA-based assays were in better agreement with the culture-based results of E. coli, intestinal enterococci, and thermotolerant Campylobacter spp. in surface waters than that of rDNA-based assays, suggesting that rRNA signals were associated to active bacterial populations. Our data show that using rRNA-based approaches significantly increases detection sensitivity for common fecal bacteria in environmental waters. These findings have important implications for microbial water quality monitoring and public health risk assessments.

  6. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing.

    PubMed Central

    Schmidt, T M; DeLong, E F; Pace, N R

    1991-01-01

    The phylogenetic diversity of an oligotrophic marine picoplankton community was examined by analyzing the sequences of cloned ribosomal genes. This strategy does not rely on cultivation of the resident microorganisms. Bulk genomic DNA was isolated from picoplankton collected in the north central Pacific Ocean by tangential flow filtration. The mixed-population DNA was fragmented, size fractionated, and cloned into bacteriophage lambda. Thirty-eight clones containing 16S rRNA genes were identified in a screen of 3.2 x 10(4) recombinant phage, and portions of the rRNA gene were amplified by polymerase chain reaction and sequenced. The resulting sequences were used to establish the identities of the picoplankton by comparison with an established data base of rRNA sequences. Fifteen unique eubacterial sequences were obtained, including four from cyanobacteria and eleven from proteobacteria. A single eucaryote related to dinoflagellates was identified; no archaebacterial sequences were detected. The cyanobacterial sequences are all closely related to sequences from cultivated marine Synechococcus strains and with cyanobacterial sequences obtained from the Atlantic Ocean (Sargasso Sea). Several sequences were related to common marine isolates of the gamma subdivision of proteobacteria. In addition to sequences closely related to those of described bacteria, sequences were obtained from two phylogenetic groups of organisms that are not closely related to any known rRNA sequences from cultivated organisms. Both of these novel phylogenetic clusters are proteobacteria, one group within the alpha subdivision and the other distinct from known proteobacterial subdivisions. The rRNA sequences of the alpha-related group are nearly identical to those of some Sargasso Sea picoplankton, suggesting a global distribution of these organisms. Images PMID:2066334

  7. Evidence for autophagy-dependent pathways of rRNA turnover in Arabidopsis.

    PubMed

    Floyd, Brice E; Morriss, Stephanie C; MacIntosh, Gustavo C; Bassham, Diane C

    2015-01-01

    Ribosomes account for a majority of the cell's RNA and much of its protein and represent a significant investment of cellular resources. The turnover and degradation of ribosomes has been proposed to play a role in homeostasis and during stress conditions. Mechanisms for the turnover of rRNA and ribosomal proteins have not been fully elucidated. We show here that the RNS2 ribonuclease and autophagy participate in RNA turnover in Arabidopsis thaliana under normal growth conditions. An increase in autophagosome formation was seen in an rns2-2 mutant, and this increase was dependent on the core autophagy genes ATG9 and ATG5. Autophagosomes and autophagic bodies in rns2-2 mutants contain RNA and ribosomes, suggesting that autophagy is activated as an attempt to compensate for loss of rRNA degradation. Total RNA accumulates in rns2-2, atg9-4, atg5-1, rns2-2 atg9-4, and rns2-2 atg5-1 mutants, suggesting a parallel role for autophagy and RNS2 in RNA turnover. rRNA accumulates in the vacuole in rns2-2 mutants. Vacuolar accumulation of rRNA was blocked by disrupting autophagy via an rns2-2 atg5-1 double mutant but not by an rns2-2 atg9-4 double mutant, indicating that ATG5 and ATG9 function differently in this process. Our results suggest that autophagy and RNS2 are both involved in homeostatic degradation of rRNA in the vacuole.

  8. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection

    PubMed Central

    2011-01-01

    Background The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. Results The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. Conclusions These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection. PMID:22004418

  9. An assay for adjuvanticity

    PubMed Central

    Dresser, D. W.

    1968-01-01

    Adult mice injected with an adequate amount of a non-immunogenic antigen progress to a specific state of immunological paralysis, unless a substance with `extrinsic' adjuvanticity is injected before the induction of paralysis is completed. Consequently incipiently paralysed mice can be used to assay substances for adjuvanticity. Conventional adjuvants such as Freund's adjuvant and pertussis possess adjuvanticity; other substances with varying degrees of adjuvanticity are listed in the tables. It has been shown that the adjuvanticity effect of an injection of pertussis lasts for only a few days, although the effect of such an injection of pertussis on phagocytosis of carbon particles does not reach a maximum until 2 weeks after the injection. The dose-effectiveness of alum precipitated (highly phagocytosable) bovine γ-globulin was greatly increased by the intraperitoneal injection of pertussis. The evidence is considered to be incompatible with increased phagocytosis being either an essential factor in the role of pertussis as a conventional adjuvant, or in the adjuvanticity effect of pertussis. PMID:4179956

  10. Fitness cost due to mutations in the 16S rRNA associated with spectinomycin resistance in Chlamydia psittaci 6BC.

    PubMed

    Binet, Rachel; Maurelli, Anthony T

    2005-11-01

    The fitness cost of a resistance determinant is the primary parameter that determines its frequency in vivo. As a model for analysis of the impact of drug resistance mutations on the intracellular life cycle of Chlamydia spp., we studied the growth of four genetically defined spectinomycin-resistant (Spc(r)) clonal variants of Chlamydia psittaci 6BC isolated in the plaque assay. The development of each variant was monitored over 46 h postinfection in the absence of drug, either in pure culture or in 1:1 competition with the parent strain. Spc(r) mutations in the 16S rRNA gene at positions 1191 and 1193 were associated with a marked impairment of C.psittaci biological fitness, and the bacteria were severely out-competed by the wild-type parent. In contrast, mutations at position 1192 had minor effects on the bacterial life cycle, allowing the resistant isolates to compete more efficiently with the wild-type strain. Thus, mutations with a wide range of fitness costs can be selected in the plaque assay, providing a new strategy for prediction and monitoring of the emergence of antibiotic resistance in chlamydiae. So far, drug resistance has not been a serious threat for the treatment of chlamydial infections. Tetracycline is an effective antichlamydial drug that targets 16S rRNA. Attempts to isolate spontaneous tetracycline-resistant mutants of C. psittaci 6BC revealed a frequency <3 x 10(-9). We suggest that the rarity of genotypic antibiotic resistance among chlamydial clinical isolates reflects the deleterious effects of such mutations on the fitness of these obligate intracellular bacteria in the host.

  11. Nucleolin Is Required for DNA Methylation State and the Expression of rRNA Gene Variants in Arabidopsis thaliana

    PubMed Central

    Pontvianne, Frédéric; Abou-Ellail, Mohamed; Douet, Julien; Comella, Pascale; Matia, Isabel; Chandrasekhara, Chinmayi; DeBures, Anne; Blevins, Todd; Cooke, Richard; Medina, Francisco J.; Tourmente, Sylvette; Pikaard, Craig S.; Sáez-Vásquez, Julio

    2010-01-01

    In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1). Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre–rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis. PMID:21124873

  12. Rapid detection and monitoring therapeutic efficacy of Mycobacterium tuberculosis complex using a novel real-time assay.

    PubMed

    Jiang, Li Juan; Wu, Wen Juan; Wu, Hai; Ryang, Son Sik; Zhou, Jian; Wu, Wei; Li, Tao; Guo, Jian; Wang, Hong Hai; Lu, Shui Hua; Li, Yao

    2012-09-01

    We combined real-time RT-PCR and real-time PCR (R/P) assays using a hydrolysis probe to detect Mycobacterium tuberculosis complex (MTBC)-specific 16S rRNA and its rRNA gene (rDNA). The assay was applied to 28 nonrespiratory and 207 respiratory specimens from 218 patients. Total nucleic acids (including RNA and DNA) were extracted from samples, and results were considered positive if the repeat RT-PCR threshold cycle was < or =35 and the ratio of real-time RT-PCR and real-time PCR load was > or =1.51. The results were compared with those from existing methods, including smear, culture, and real-time PCR. Following resolution of the discrepant results between R/P assay and culture, the overall sensitivity, specificity, positive predictive values (PPV), and negative predictive values (NPV) of all samples (including nonrespiratory and respiratory specimens) were 98.2%, 97.2%, 91.7%, and 99.4%, respectively, for R/P assay, and 83.9%, 89.9%, 72.3%, and 94.7%, respectively, for real-time PCR. Furthermore, the R/P assay of four patient samples showed a higher ratio before treatment than after several days of treatment. We conclude that the R/P assay is a rapid and accurate method for direct detection of MTBC, which can distinguish viable and nonviable MTBC, and thus may guide patient therapy and public health decisions.

  13. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  14. Theoretical study on the adsorption of carbon dioxide on individual and alkali-metal doped MOF-5s

    NASA Astrophysics Data System (ADS)

    Ha, Nguyen Thi Thu; Lefedova, O. V.; Ha, Nguyen Ngoc

    2016-01-01

    Density functional theory (DFT) calculations were performed to investigate the adsorption of carbon dioxide (CO2) on metal-organic framework (MOF-5) and alkali-metal (Li, K, Na) doped MOF-5s. The adsorption energy calculation showed that metal atom adsorption is exothermic in MOF-5 system. Moreover, alkali-metal doping can significantly improve the adsorption ability of carbon dioxide on MOF-5. The best influence is observed for Li-doping.

  15. A Tale of Two Lines: Searching for the 5s - 5p Resonance Lines in Pm-like Ion Spectra

    SciTech Connect

    Trabert, E; Vilkas, M J; Ishikawa, Y

    2008-10-24

    Highly charged ions in the promethium sequence have been suggested to show spectral features resembling the alkali sequence ions. Guided by calculations, the 5s-5p resonance lines have been sought in a variety of experiments. In the light of the most extensive calculations of Pm-like ions yet, applying relativistic multi-reference Moeller-Plesset second-order perturbation theory, the experimental evidence is reviewed and the line identification problem assessed.

  16. Foraminoplastic transfacet epidural endoscopic approach for removal of intraforaminal disc herniation at the L5-S1 level

    PubMed Central

    Kaczmarczyk, Jacek; Nowakowski, Andrzej; Sulewski, Adam

    2014-01-01

    Transforaminal endoscopic disc removal in the L5-S1 motion segment of the lumbar spine creates a technical challenge due to anatomical reasons and individual variability. The majority of surgeons prefer a posterior classical or minimally invasive approach. There is only one foraminoplastic modification of the technique in the literature so far. In this paper we present a new technique with a foraminoplastic transfacet approach that may be suitable in older patients with advanced degenerative disease of the spine. PMID:24729817

  17. The nuclear 5S RNAs from chicken, rat and man. U5 RNAs are encoded by multiple genes.

    PubMed

    Krol, A; Gallinaro, H; Lazar, E; Jacob, M; Branlant, C

    1981-02-25

    Preparations of chicken, rat and human nuclear 5S RNA contain two sets of molecules. The set with the lowest electrophoretic mobility (5Sa) contains RNAs identical or closely related to ribosomal 5S RNA from the corresponding animal species. In HeLa cells and rat brain, we only detected an RNA identical to the ribosomal 5S RNA. In hen brain and liver, we found other species differing by a limited number of substitutions. The results suggest that mutated 5S genes may be expressed differently according to the cell type. The set with the highest mobility corresponds to U5 RNA. In both rat brain and HeLa cells, U5 RNA was found to be composed of 4 and 5 different molecules respectively (U5A, U5B1-4) differing by a small number of substitutions or insertions. In hen brain, no U5B was detected but U5A' differing from U5A by the absence of the 3'-terminal adenosine. All the U5 RNAs contain the same set of modified nucleotides. They also have the same secondary structure which consists of two hairpins joined together by a 17 nucleotide long single-stranded region. The 3' half of the molecule has a compact conformation. Together, the results suggest that U5 RNAs are transcribed from a multigene family and that mutated genes may be expressed as far as secondary structure is conserved. The conformation of U5 RNA is likely to be related to its function and it is of interest to mention that several similarities of structure are found between U5 and U1A RNA.

  18. Describing a new syndrome in L5-S1 disc herniation: Sexual and sphincter dysfunction without pain and muscle weakness

    PubMed Central

    Akca, Nezih; Ozdemir, Bulent; Kanat, Ayhan; Batcik, Osman Ersagun; Yazar, Ugur; Zorba, Orhan Unal

    2014-01-01

    Context: Little seems to be known about the sexual dysfunction (SD) in lumbar intervertebral disc herniation. Aims: Investigation of sexual and sphincter dysfunction in patient with lumbar disc hernitions. Settings and Design: A retrospective analysis. Materials and Methods: Sexual and sphincter dysfunction in patients admitted with lumbar disc herniations between September 2012-March 2014. Statistical Analysis Used: Statistical analysis was performed using the Predictive Analytics SoftWare (PASW) Statistics 18.0 for Windows (Statistical Package for the Social Sciences, SPSS Inc., Chicago, Illinois). The statistical significance was set at P < 0.05. The Wilcoxon signed ranks test was used to evaluate the difference between patients. Results: Four patients with sexual and sphincter dysfunction were found, including two women and two men, aged between 20 and 52 years. All of them admitted without low back pain. In addition, on neurological examination, reflex and motor deficit were not found. However, almost all patients had perianal sensory deficit and sexual and sphincter dysfunction. Magnetic resonance imaging (MRI) of three patients displayed a large extruded disc fragment at L5-S1 level on the left side. In fourth patient, there were not prominent disc herniations. There was not statistically significant difference between pre-operative and post-operative sexual function, anal-urethral sphincter function, and perianal sensation score. A syndrome in L5-S1 disc herniation with sexual and sphincter dysfunction without pain and muscle weakness was noted. We think that it is crucial for neurosurgeons to early realise that paralysis of the sphincter and sexual dysfunction are possible in patients with lumbar L5-S1 disc disease. Conclusion: A syndrome with perianal sensory deficit, paralysis of the sphincter, and sexual dysfunction may occur in patients with lumbar L5-S1 disc disease. The improvement of perianal sensory deficit after surgery was counteracted by a trend

  19. Minimally Invasive Transforaminal Lumbar Interbody Fusion at L5-S1 through a Unilateral Approach: Technical Feasibility and Outcomes.

    PubMed

    Choi, Won-Suh; Kim, Jin-Sung; Ryu, Kyeong-Sik; Hur, Jung-Woo; Seong, Ji-Hoon

    2016-01-01

    Background. Minimally invasive spinal transforaminal lumbar interbody fusion (MIS-TLIF) at L5-S1 is technically more demanding than it is at other levels because of the anatomical and biomechanical traits. Objective. To determine the clinical and radiological outcomes of MIS-TLIF for treatment of single-level spinal stenosis low-grade isthmic or degenerative spondylolisthesis at L5-S1. Methods. Radiological data and electronic medical records of patients who underwent MIS-TLIF between May 2012 and December 2014 were reviewed. Fusion rate, cage position, disc height (DH), disc angle (DA), disc slope angle, segmental lordotic angle (SLA), lumbar lordotic angle (LLA), and pelvic parameters were assessed. For functional assessment, the visual analogue scale (VAS), Oswestry disability index (ODI), and patient satisfaction rate (PSR) were utilized. Results. A total of 21 levels in 21 patients were studied. DH, DA, SLA, and LLA had increased from their preoperative measures at the final follow-up. Fusion rate was 86.7% (18/21) at 12 months' follow-up. The most common cage position was anteromedial (15/21). The mean VAS scores for back and leg pain mean ODI scores improved significantly at the final follow-up. PSR was 88%. Cage subsidence was observed in 33.3% (7/21). Conclusions. The clinical and radiologic outcomes after MIS-TLIF at L5-S1 in patients with spinal stenosis or spondylolisthesis are generally favorable. PMID:27433472

  20. Minimally Invasive Transforaminal Lumbar Interbody Fusion at L5-S1 through a Unilateral Approach: Technical Feasibility and Outcomes

    PubMed Central

    Choi, Won-Suh; Kim, Jin-Sung; Ryu, Kyeong-Sik; Hur, Jung-Woo; Seong, Ji-Hoon

    2016-01-01

    Background. Minimally invasive spinal transforaminal lumbar interbody fusion (MIS-TLIF) at L5-S1 is technically more demanding than it is at other levels because of the anatomical and biomechanical traits. Objective. To determine the clinical and radiological outcomes of MIS-TLIF for treatment of single-level spinal stenosis low-grade isthmic or degenerative spondylolisthesis at L5-S1. Methods. Radiological data and electronic medical records of patients who underwent MIS-TLIF between May 2012 and December 2014 were reviewed. Fusion rate, cage position, disc height (DH), disc angle (DA), disc slope angle, segmental lordotic angle (SLA), lumbar lordotic angle (LLA), and pelvic parameters were assessed. For functional assessment, the visual analogue scale (VAS), Oswestry disability index (ODI), and patient satisfaction rate (PSR) were utilized. Results. A total of 21 levels in 21 patients were studied. DH, DA, SLA, and LLA had increased from their preoperative measures at the final follow-up. Fusion rate was 86.7% (18/21) at 12 months' follow-up. The most common cage position was anteromedial (15/21). The mean VAS scores for back and leg pain mean ODI scores improved significantly at the final follow-up. PSR was 88%. Cage subsidence was observed in 33.3% (7/21). Conclusions. The clinical and radiologic outcomes after MIS-TLIF at L5-S1 in patients with spinal stenosis or spondylolisthesis are generally favorable. PMID:27433472

  1. Characterization and physical mapping of 18S and 5S ribosomal genes in Indian major carps (Pisces, Cyprinidae).

    PubMed

    Ravindra Kumar; Kushwaha, Basdeo; Nagpure, Naresh S

    2013-06-01

    Characterization of the major (18S) and minor (5S) ribosomal RNA genes were carried out in three commercially important Indian major carp (IMC) species, viz. Catla catla, Labeo rohita and Cirrhinus mrigala along with their physical localizations using dual colour fluorescence in situ hybridization. The diploid chromosome number in the above carps was confirmed to be 50 with inter-species karyo-morphological variations. The 18S rDNA signals were observed on 3 pair of chromosomes in C. catla and L. rohita, and two pairs in C. mrigala. The 5S rDNA signal was found on single pair of chromosome in all the species with variation in their position on chromosomes. The sequencing of 18S rDNA generated 1804, 1805 and 1805 bp long fragments, respectively, in C. catla, L. rohita and C. mrigala with more than 98% sequence identity among them. Similarly, sequencing of 5S rDNA generated 191 bp long fragments in the three species with 100% identity in coding region and 23.2% overall variability in non-transcribed spacer region. Thus, these molecular markers could be used as species-specific markers for taxonomic identification and might help in understanding the genetic diversity, genome organization and karyotype evolution of these species.

  2. Quantitative detection of the nosZ gene, encoding nitrous oxide reductase, and comparison of the abundances of 16S rRNA, narG, nirK, and nosZ genes in soils.

    PubMed

    Henry, S; Bru, D; Stres, B; Hallet, S; Philippot, L

    2006-08-01

    Nitrous oxide (N2O) is an important greenhouse gas in the troposphere controlling ozone concentration in the stratosphere through nitric oxide production. In order to quantify bacteria capable of N2O reduction, we developed a SYBR green quantitative real-time PCR assay targeting the nosZ gene encoding the catalytic subunit of the nitrous oxide reductase. Two independent sets of nosZ primers flanking the nosZ fragment previously used in diversity studies were designed and tested (K. Kloos, A. Mergel, C. Rösch, and H. Bothe, Aust. J. Plant Physiol. 28:991-998, 2001). The utility of these real-time PCR assays was demonstrated by quantifying the nosZ gene present in six different soils. Detection limits were between 10(1) and 10(2) target molecules per reaction for all assays. Sequence analysis of 128 cloned quantitative PCR products confirmed the specificity of the designed primers. The abundance of nosZ genes ranged from 10(5) to 10(7) target copies g(-1) of dry soil, whereas genes for 16S rRNA were found at 10(8) to 10(9) target copies g(-1) of dry soil. The abundance of narG and nirK genes was within the upper and lower limits of the 16S rRNA and nosZ gene copy numbers. The two sets of nosZ primers gave similar gene copy numbers for all tested soils. The maximum abundance of nosZ and nirK relative to 16S rRNA was 5 to 6%, confirming the low proportion of denitrifiers to total bacteria in soils.

  3. Active community profiling via capillary electrophoresis single-strand conformation polymorphism analysis of amplified 16S rRNA and 16S rRNA genes.

    PubMed

    Hiibel, Sage R; Pruden, Amy; Crimi, Barbara; Reardon, Kenneth F

    2010-12-01

    Here, we report the validation and advancement of a high-throughput method for fingerprinting the active members of a microbial community. This method, termed active community profiling (ACP), provides information about both the composition and the activity of mixed microbial cultures via comparative measurements of amplified 16S rRNA (RNA) and 16S rRNA genes (DNA). Capillary electrophoresis is used to resolve single-strand conformation polymorphisms of polymerase chain reaction (PCR) and reverse transcription PCR (RT-PCR) products, producing electropherograms representative of the community structure. Active members of the community are distinguished by elevated RNA:DNA peak area ratios. Chemostat experiments with defined populations were conducted to validate the ACP approach. Using a pure culture of Escherichia coli, a direct correlation was found between the growth rate and the RNA:DNA peak ratio. In a second validation experiment, a binary culture of E. coli and Pseudomonas putida was subjected to a controlled environmental change consisting of a shift to anaerobic conditions. ACP revealed the expected cessation of growth of P. putida, an obligate aerobe, while the corresponding DNA-only analysis indicated no change in the culture. Finally, ACP was applied to a complex microbial community, and a novel binning approach was demonstrated for integrating the RNA and DNA electropherograms. ACP thus represents a significant advance from traditional DNA-based profiling techniques, which do not distinguish active from inactive or dead cells, and is well suited for high-throughput community analysis.

  4. Identification of meats from red deer (Cervus elaphus), fallow deer (Dama dama), and roe deer (Capreolus capreolus) using polymerase chain reaction targeting specific sequences from the mitochondrial 12S rRNA gene.

    PubMed

    Fajardo, V; González, I; López-Calleja, I; Martín, I; Rojas, M; Hernández, P E; García, T; Martín, Rosario

    2007-06-01

    Polymerase chain reaction (PCR) based on oligonucleotide primers targeting the mitochondrial 12S rRNA gene was applied to the specific identification of meats from red deer (Cervus elaphus), fallow deer (Dama dama), and roe deer (Capreolus capreolus). The use of a common reverse primer, together with forward specific primers for red deer, fallow deer, and roe deer, allowed the selective amplification of the desired cervid sequences. The specificity of each primer pair was verified by PCR analysis of DNA from various game and domestic meats. The assay can be useful for the accurate identification of meats from cervid species, avoiding mislabeling or fraudulent species substitution in meat products.

  5. Performance evaluation of canine-associated Bacteroidales assays in a multi-laboratory comparison study.

    PubMed

    Schriewer, Alexander; Goodwin, Kelly D; Sinigalliano, Christopher D; Cox, Annie M; Wanless, David; Bartkowiak, Jakob; Ebentier, Darcy L; Hanley, Kaitlyn T; Ervin, Jared; Deering, Louise A; Shanks, Orin C; Peed, Lindsay A; Meijer, Wim G; Griffith, John F; SantoDomingo, Jorge; Jay, Jennifer A; Holden, Patricia A; Wuertz, Stefan

    2013-11-15

    The contribution of fecal pollution from dogs in urbanized areas can be significant and is an often underestimated problem. Microbial source tracking methods (MST) utilizing quantitative PCR of dog-associated gene sequences encoding 16S rRNA of Bacteroidales are a useful tool to estimate these contributions. However, data about the performance of available assays are scarce. The results of a multi-laboratory study testing two assays for the determination of dog-associated Bacteroidales (DogBact and BacCan-UCD) on 64 single and mixed fecal source samples created from pooled fecal samples collected in California are presented here. Standardization of qPCR data treatment lowered inter-laboratory variability of sensitivity and specificity results. Both assays exhibited 100% sensitivity. Normalization methods are presented that eliminated random and confirmed non-target responses. The combination of standardized qPCR data treatment, use of normalization via a non-target specific Bacteroidales assay (GenBac3), and application of threshold criteria improved the calculated specificity significantly for both assays. Such measures would reasonably improve MST data interpretation not only for canine-associated assays, but for all qPCR assays used in identifying and monitoring fecal pollution in the environment. PMID:23916711

  6. Performance evaluation of canine-associated Bacteroidales assays in a multi-laboratory comparison study.

    PubMed

    Schriewer, Alexander; Goodwin, Kelly D; Sinigalliano, Christopher D; Cox, Annie M; Wanless, David; Bartkowiak, Jakob; Ebentier, Darcy L; Hanley, Kaitlyn T; Ervin, Jared; Deering, Louise A; Shanks, Orin C; Peed, Lindsay A; Meijer, Wim G; Griffith, John F; SantoDomingo, Jorge; Jay, Jennifer A; Holden, Patricia A; Wuertz, Stefan

    2013-11-15

    The contribution of fecal pollution from dogs in urbanized areas can be significant and is an often underestimated problem. Microbial source tracking methods (MST) utilizing quantitative PCR of dog-associated gene sequences encoding 16S rRNA of Bacteroidales are a useful tool to estimate these contributions. However, data about the performance of available assays are scarce. The results of a multi-laboratory study testing two assays for the determination of dog-associated Bacteroidales (DogBact and BacCan-UCD) on 64 single and mixed fecal source samples created from pooled fecal samples collected in California are presented here. Standardization of qPCR data treatment lowered inter-laboratory variability of sensitivity and specificity results. Both assays exhibited 100% sensitivity. Normalization methods are presented that eliminated random and confirmed non-target responses. The combination of standardized qPCR data treatment, use of normalization via a non-target specific Bacteroidales assay (GenBac3), and application of threshold criteria improved the calculated specificity significantly for both assays. Such measures would reasonably improve MST data interpretation not only for canine-associated assays, but for all qPCR assays used in identifying and monitoring fecal pollution in the environment.

  7. Practical assay issues with the PERT/PBRT assay: a highly sensitive reverse transcriptase assay.

    PubMed

    Chang, A; Dusing, S

    2006-01-01

    Product safety testing for retroviruses can be achieved by a panel of screening assays, including electron microscopy, viral gene specific PCRs, virus propagation, and detection of reverse transciptase activity. The application of PCR-based reverse transcriptase assays (PERT) that are approximately a million-fold more sensitive than conventional nucleotide incorporation assays in the testing of biologicals is described. Use of PERT assays can be applied to three areas: (i) screening for adventitious retrovirus contamination; (ii) detecting and quantifying endogenous viral particle load and (iii) monitoring levels of infectious retrovirus generation in cell lines that contain endogenous retroviruses.

  8. A short fragment of 23S rRNA containing the binding sites for two ribosomal proteins, L24 and L4, is a key element for rRNA folding during early assembly.

    PubMed Central

    Stelzl, U; Nierhaus, K H

    2001-01-01

    Previously we described an in vitro selection variant abbreviated SERF (in vitro selection from random rRNA fragments) that identifies protein binding sites within large RNAs. With this method, a small rRNA fragment derived from the 23S rRNA was isolated that binds simultaneously and independently the ribosomal proteins L4 and L24 from Escherichia coli. Until now the rRNA structure within the ternary complex L24-rRNA-L4 could not be studied due to the lack of an appropriate experimental strategy. Here we tackle the issue by separating the various complexes via native gel-electrophoresis and analyzing the rRNA structure by in-gel iodine cleavage of phosphorothioated RNA. The results demonstrate that during the transition from either the L4 or L24 binary complex to the ternary complex the structure of the rRNA fragment changes significantly. The identified protein binding sites are in excellent agreement with the recently reported crystal structure of the 50S subunit. Because both proteins play a prominent role in early assembly of the large subunit, the results suggest that the identified rRNA fragment is a key element for the folding of the 23S RNA during early assembly. The introduced in-gel cleavage method should be useful when an RNA structure within mixed populations of different but related complexes should be studied. PMID:11345438

  9. A short fragment of 23S rRNA containing the binding sites for two ribosomal proteins, L24 and L4, is a key element for rRNA folding during early assembly.

    PubMed

    Stelzl, U; Nierhaus, K H

    2001-04-01

    Previously we described an in vitro selection variant abbreviated SERF (in vitro selection from random rRNA fragments) that identifies protein binding sites within large RNAs. With this method, a small rRNA fragment derived from the 23S rRNA was isolated that binds simultaneously and independently the ribosomal proteins L4 and L24 from Escherichia coli. Until now the rRNA structure within the ternary complex L24-rRNA-L4 could not be studied due to the lack of an appropriate experimental strategy. Here we tackle the issue by separating the various complexes via native gel-electrophoresis and analyzing the rRNA structure by in-gel iodine cleavage of phosphorothioated RNA. The results demonstrate that during the transition from either the L4 or L24 binary complex to the ternary complex the structure of the rRNA fragment changes significantly. The identified protein binding sites are in excellent agreement with the recently reported crystal structure of the 50S subunit. Because both proteins play a prominent role in early assembly of the large subunit, the results suggest that the identified rRNA fragment is a key element for the folding of the 23S RNA during early assembly. The introduced in-gel cleavage method should be useful when an RNA structure within mixed populations of different but related complexes should be studied.

  10. Two linear regression models predicting cumulative dynamic L5/S1 joint moment during a range of lifting tasks based on static postures.

    PubMed

    Xu, Xu; Chang, Chien-Chi; Lu, Ming-Lun

    2012-01-01

    Previous studies have indicated that cumulative L5/S1 joint load is a potential risk factor for low back pain. The assessment of cumulative L5/S1 joint load during a field study is challenging due to the difficulty of continuously monitoring the dynamic joint load. This study proposes two regression models predicting cumulative dynamic L5/S1 joint moment based on the static L5/S1 joint moment of a lifting task at lift-off and set-down and the lift duration. Twelve men performed lifting tasks at varying lifting ranges and asymmetric angles in a laboratory environment. The cumulative L5/S1 joint moment was calculated from continuous dynamic L5/S1 moments as the reference for comparison. The static L5/S1 joint moments at lift-off and set-down were measured for the two regression models. The prediction error of the cumulative L5/S1 joint moment was 21 ± 14 Nm × s (12% of the measured cumulative L5/S1 joint moment) and 14 ± 9 Nm × s (8%) for the first and the second models, respectively. Practitioner Summary: The proposed regression models may provide a practical approach for predicting the cumulative dynamic L5/S1 joint loading of a lifting task for field studies since it requires only the lifting duration and the static moments at the lift-off and/or set-down instants of the lift.

  11. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples.

    PubMed

    Dollive, Serena; Peterfreund, Gregory L; Sherrill-Mix, Scott; Bittinger, Kyle; Sinha, Rohini; Hoffmann, Christian; Nabel, Christopher S; Hill, David A; Artis, David; Bachman, Michael A; Custers-Allen, Rebecca; Grunberg, Stephanie; Wu, Gary D; Lewis, James D; Bushman, Frederic D

    2012-07-03

    Eukaryotic microorganisms are important but understudied components of the human microbiome. Here we present a pipeline for analysis of deep sequencing data on single cell eukaryotes. We designed a new 18S rRNA gene-specific PCR primer set and compared a published rRNA gene internal transcribed spacer (ITS) gene primer set. Amplicons were tested against 24 specimens from defined eukaryotes and eight well-characterized human stool samples. A software pipeline https://sourceforge.net/projects/brocc/ was developed for taxonomic attribution, validated against simulated data, and tested on pyrosequence data. This study provides a well-characterized tool kit for sequence-based enumeration of eukaryotic organisms in human microbiome samples.

  12. A renaissance for the pioneering 16S rRNA gene

    SciTech Connect

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  13. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment

    PubMed Central

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  14. Methodology of protistan discovery: from rRNA detection to quality scanning electron microscope images.

    PubMed

    Stoeck, Thorsten; Fowle, William H; Epstein, Slava S

    2003-11-01

    Each year, thousands of new protistan 18S rRNA sequences are detected in environmental samples. Many of these sequences are molecular signatures of new protistan species, classes, and/or kingdoms that have never been seen before. The main goal of this study was to enable visualization of these novel organisms and to conduct quality ultrastructural examination. We achieved this goal by modifying standard procedures for cell fixation, fluorescence in situ hybridization, and scanning electron microscopy (SEM) and by making these methodologies work in concert. As a result, the same individual cell can now be detected by 18S rRNA-targeted fluorochrome-labeled probes and then viewed by SEM to reveal its diagnostic morphological characteristics. The method was successfully tested on a wide range of protists (alveolates, stramenopiles, kinetoplastids, and cryptomonads). The new methodology thus opens a way for fine microscopy studies of many organisms previously known exclusively by their 18S rRNA sequences.

  15. Properties of small rRNA methyltransferase RsmD: Mutational and kinetic study

    PubMed Central

    Sergeeva, Olga V.; Prokhorova, Irina V.; Ordabaev, Yerdos; Tsvetkov, Philipp O.; Sergiev, Petr V.; Bogdanov, Alexey A.; Makarov, Alexander A.; Dontsova, Olga A.

    2012-01-01

    Ribosomal RNA modification is accomplished by a variety of enzymes acting on all stages of ribosome assembly. Among rRNA methyltransferases of Escherichia coli, RsmD deserves special attention. Despite its minimalistic domain architecture, it is able to recognize a single target nucleotide G966 of the 16S rRNA. RsmD acts late in the assembly process and is able to modify a completely assembled 30S subunit. Here, we show that it possesses superior binding properties toward the unmodified 30S subunit but is unable to bind a 30S subunit modified at G966. RsmD is unusual in its ability to withstand multiple amino acid substitutions of the active site. Such efficiency of RsmD may be useful to complete the modification of a 30S subunit ahead of the 30S subunit’s involvement in translation. PMID:22535590

  16. From Antenna to Assay

    PubMed Central

    Moore, Evan G.; Samuel, Amanda P. S.; Raymond, Kenneth N.

    2009-01-01

    Conspectus Ligand-sensitized, luminescent lanthanide(III) complexes are of considerable importance because their unique photophysical properties (microsecond to millisecond lifetimes, characteristic and narrow emission bands, and large Stokes shifts) make them well suited as labels in fluorescence-based bioassays. The long-lived emission of lanthanide(III) cations can be temporally resolved from scattered light and background fluorescence to vastly enhance measurement sensitivity. One challenge in this field is the design of sensitizing ligands that provide highly emissive complexes with sufficient stability and aqueous solubility for practical applications. In this Account, we give an overview of some of the general properties of the trivalent lanthanides and follow with a summary of advances made in our laboratory in the development of highly luminescent Tb(III) and Eu(III) complexes for applications in biotechnology. A focus of our research has been the optimization of these compounds as potential commercial agents for use in Homogeneous Time-Resolved Fluorescence (HTRF) technology. Our approach involves developing high-stability octadentate Tb(III) and Eu(III) complexes that rely on all-oxygen donor atoms and using multi-chromophore chelates to increase molar absorptivity; earlier examples utilized a single pendant chromophore (that is, a single “antenna”). Ligands based on 2-hydroxyisophthalamide (IAM) provide exceptionally emissive Tb(III) complexes with quantum yield values up to ∼60% that are stable at the nanomolar concentrations required for commercial assays. Through synthetic modification of the IAM chromophore and time-dependent density functional theory (TD-DFT) calculations, we have developed a met