Science.gov

Sample records for 5s rrna sequence

  1. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  2. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    PubMed

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  3. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  4. Phylogenetic analysis of the genera Thiobacillus and Thiomicrospira by 5S rRNA sequences.

    PubMed Central

    Lane, D J; Stahl, D A; Olsen, G J; Heller, D J; Pace, N R

    1985-01-01

    5S rRNA nucleotide sequences from Thiobacillus neapolitanus, Thiobacillus ferrooxidans, Thiobacillus thiooxidans, Thiobacillus intermedius, Thiobacillus perometabolis, Thiobacillus thioparus, Thiobacillus versutus, Thiobacillus novellus, Thiobacillus acidophilus, Thiomicrospira pelophila, Thiomicrospira sp. strain L-12, and Acidiphilium cryptum were determined. A phylogenetic tree, based upon comparison of these and other related 5S rRNA sequences, is presented. The results place the thiobacilli, Thiomicrospira spp., and Acidiphilium spp. in the "purple photosynthetic" bacterial grouping which also includes the enteric, vibrio, pseudomonad, and other familiar eubacterial groups in addition to the purple photosynthetic bacteria. The genus Thiobacillus is not an evolutionarily coherent grouping but rather spans the full breadth of the purple photosynthetic bacteria. PMID:3924899

  5. 5S rRNA sequences from four marine invertebrates and implications for base pairing models of metazoan sequences.

    PubMed

    Walker, W F; Doolittle, W F

    1983-08-11

    The nucleotide sequences of 5S rRNAs from the starfish Asterias vulgaris, the squid Illex illecebrosus, the sipunculid Phascolopsis gouldii and the jellyfish Aurelia aurita were determined. The sequence from Asterias lends support for one of two previous base pairing models for helix E in metazoan sequences. The Aurelia sequence differs by five nucleotides from that previously reported and does not violate the consensus secondary structure model for eukaryotic 5S rRNA. PMID:6136024

  6. Phylogenetic tree derived from bacterial, cytosol and organelle 5S rRNA sequences.

    PubMed Central

    Küntzel, H; Heidrich, M; Piechulla, B

    1981-01-01

    A phylogenetic tree was constructed by computer analysis of 47 completely determined 5S rRNA sequences. The wheat mitochondrial sequence is significantly more related to prokaryotic than to eukaryotic sequences, and its affinity to that of the thermophilic Gram-negative bacterium Thermus aquaticus is comparable to the affinity between Anacystis nidulans and chloroplastic sequences. This strongly supports the idea of an endosymbiotic origin of plant mitochondria. A comparison of the plant cytosol and chloroplast sub-trees suggests a similar rate of nucleotide substitution in nuclear genes and chloroplastic genes. Other features of the tree are a common precursor of protozoa and metazoa, which appears to be more related to the fungal than to the plant protosequence, and an early divergence of the archebacterial sequence (Halobacterium cutirubrum) from the prokaryotic branch. PMID:6785727

  7. Construction of the mycoplasma evolutionary tree from 5S rRNA sequence data.

    PubMed Central

    Rogers, M J; Simmons, J; Walker, R T; Weisburg, W G; Woese, C R; Tanner, R S; Robinson, I M; Stahl, D A; Olsen, G; Leach, R H

    1985-01-01

    The 5S rRNA sequences of eubacteria and mycoplasmas have been analyzed and a phylogenetic tree constructed. We determined the sequences of 5S rRNA from Clostridium innocuum, Acholeplasma laidlawii, Acholeplasma modicum, Anaeroplasma bactoclasticum, Anaeroplasma abactoclasticum, Ureaplasma urealyticum, Mycoplasma mycoides mycoides, Mycoplasma pneumoniae, and Mycoplasma gallisepticum. Analysis of these and published sequences shows that mycoplasmas form a coherent phylogenetic group that, with C. innocuum, arose as a branch of the low G+C Gram-positive tree, near the lactobacilli and streptococci. The initial event in mycoplasma phylogeny was formation of the Acholeplasma branch; hence, loss of cell wall probably occurred at the time of genome reduction to approximately to 1000 MDa. A subsequent branch produced the Spiroplasma. This branch appears to have been the origin of sterol-requiring mycoplasmas. During development of the Spiroplasma branch there were several independent genome reductions, each to approximately 500 MDa, resulting in Mycoplasma and Ureaplasma species. Mycoplasmas, particularly species with the smallest genomes, have high mutation rates, suggesting that they are in a state of rapid evolution. PMID:2579388

  8. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  9. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  10. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  11. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  12. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  13. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  14. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    PubMed

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  15. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    PubMed Central

    Durovic, P; Kutay, U; Schleper, C; Dennis, P P

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-coding sequence. This result suggests that the primary transcript of the 5S rRNA gene corresponds in length (within 1 or 2 nucleotides) to the mature 5S rRNA sequence found in 50S ribosomal subunits. Images PMID:8288546

  16. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  17. Physical and genetic maps of the Leptospira interrogans serovar icterohaemorrhagiae strain Ictero no.1 chromosome and sequencing of a 19-kb region of the genome containing the 5S rRNA gene.

    PubMed

    Takahashi, Y; Akase, K; Hirano, H; Fukunaga, M

    1998-07-17

    We report the construction of physical and genetic maps of the chromosome of Leptospira interrogans serovar icterohaemorrhagiae strain Ictero No.1 using pulsed-field gel electrophoresis of DNA fragments generated by digestion with enzymes SrfI, AscI, FseI, and NotI and using reciprocal hybridization. We also sequenced the 19-kilobase (kb) DNA segment including the one gene for 5S rRNA (rrf) of pathogenic Leptospira. The size of the chromosome of the strain Ictero No.1 was estimated to be 4673kb and was found to be similar to those of the chromosomes of the leptospira strains Verdun (serovar icterohaemorrhagiae) and RZ11 (serovar pomona). The strains Verdun and RZ11 carry a small 350-kb replicon (minichromosome), and the strain Ictero No.1 also contained the same kind of molecule together with the chromosome. The physical maps of the strains Ictero No.1 and Verdun were almost identical, as were the locations of the selected genes, except for the location of one of the 16S rRNA genes. Overall, the genetic organization appeared to be conserved within the serovar icterohaemorrhagiae strains. In the sequenced region, we identified 10 putative ORFs and one rrf sequence, and the transcription orientations were all the same. A homology search for the products deduced from the sequenced data revealed that the orf H exhibited high similarity to malic acid enzyme of Haemophilus influenzae and fumarate hydratase of Escherichia coli (orf J). The rest of the putative products encoded by ORFs in the sequenced region showed little similarity with the proteins contained in the databases and were considered to be unknown proteins. PMID:9666070

  18. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  19. Evidence for the presence of 5S rRNA in mammalian mitochondria.

    PubMed

    Magalhães, P J; Andreu, A L; Schon, E A

    1998-09-01

    Mammalian mitochondrial ribosomes contain two prokaryotic-like rRNAs, 12S and 16S, both encoded by mitochondrial DNA. As opposed to cytosolic ribosomes, however, these ribosomes are not thought to contain 5S rRNA. For this reason, it has been unclear whether 5S rRNA, which can be detected in mitochondrial preparations, is an authentic organellar species imported from the cytosol or is merely a copurifying cytosol-derived contaminant. We now show that 5S rRNA is tightly associated with highly purified mitochondrial fractions of human and rat cells and that 5S rRNA transcripts derived from a synthetic gene transfected transiently into human cells are both expressed in vivo and present in highly purified mitochondria and mitoplasts. We conclude that 5S rRNA is imported into mammalian mitochondria, but its function there still remains to be clarified. PMID:9725900

  20. Comparative structural analysis of eubacterial 5S rRNA by oxidation of adenines in the N-1 position.

    PubMed Central

    Pieler, T; Schreiber, A; Erdmann, V A

    1984-01-01

    Adenines in free 5S rRNA from Escherichia coli, Bacillus stearothermophilus and Thermus thermophilus have been oxidized at their N-1 position using monoperphthalic acid. The determination of the number of adenine 1-N-oxides was on the basis of UV spectroscopic data of the intact molecule. Identification of the most readily accessible nucleotides by sequencing gel analysis reveals that they are located in conserved positions within loops, exposed hairpin loops and single-base bulge loops. Implications for the structure and function of 5S rRNA will be discussed on the basis of this comparative analysis. Images PMID:6201825

  1. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  2. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  3. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  4. Diversity of 5S rRNA genes within individual prokaryotic genomes

    PubMed Central

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V.; Parsons, Tamasha; Yang, Liying; Gerz, Erika A.; Lee, Peng; Xiang, Charlie; Nossa, Carlos W.; Pei, Zhiheng

    2012-01-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1168 genomes from 779 unique species, 96 species exhibited >3% diversity. Twenty seven species with >10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there were tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. There is supplementary material. PMID:22765222

  5. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  6. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  7. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  8. Nucleotide sequence of 5S ribosomal RNA from Aspergillus nidulans and Neurospora crassa.

    PubMed Central

    Piechulla, B; Hahn, U; McLaughlin, L W; Küntzel, H

    1981-01-01

    The nucleotide sequences of 5S rRNA molecules isolated from the cytosol and the mitochondria of the ascomycetes A. nidulans and N. crassa were determined by partial chemical cleavage of 3'-terminally labelled RNA. The sequence identity of the cytosolic and mitochondrial RNA preparations confirms the absence of mitochondrion-specific 5S rRNA in these fungi. The sequences of the two organisms differ in 35 positions, and each sequence differs from yeast 5S rRNA in 44 positions. Both molecules contain the sequence GCUC in place of GAAC or GAUY found in all other 5S rRNAs, indicating that this region is not universally involved in base-pairing to the invariant GTpsiC sequence of tRNAs. Images PMID:6453331

  9. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  10. 5 S Rrna Is Involved in Fidelity of Translational Reading Frame

    PubMed Central

    Dinman, J. D.; Wickner, R. B.

    1995-01-01

    Chromosomal mutants (maintenance of frame = mof) in which the efficiency of -1 ribosomal frame-shifting is increased can be isolated using constructs in which lacZ expression is dependent upon a -1 shift of reading frame. We isolate a new mof mutation, mof9, in Saccharomyces cerevisiae and show that it is complemented by both single and multi-copy 5 S rDNA clones. Two independent insertion mutations in the rDNA locus (rDNA::LEU2 and rDNA::URA3) also display the Mof(-) phenotype and are also complemented by single and multi-copy 5 S rDNA clones. Mutant 5 S rRNAs expressed from a plasmid as 20-50% of total 5 S rRNA in a wild-type host also induced the Mof(-) phenotype. The increase in frameshifting is greatest when the lacZ reporter gene is expressed on a high copy, episomal vector. No differences were found in 5 S rRNA copy number or electrophoretic mobilities in mof9 strains. Both mof9 and rDNA::LEU2 increase the efficiency of +1 frameshifting as well but have no effect on readthrough of UAG or UAA termination codons, indicating that not all translational specificity is affected. These data suggest a role for 5 S rRNA in the maintenance of frame in translation. PMID:8536994

  11. Complete sequence and gene organization of the Nosema spodopterae rRNA gene.

    PubMed

    Tsai, Shu-Jen; Huang, Wei-Fone; Wang, Chung-Hsiung

    2005-01-01

    By sequencing the entire ribosomal RNA (rRNA) gene of Nosema spodopterae, we show here that its gene organization follows a pattern similar to the Nosema type species, Nosema bombycis, i.e. 5'-large subunit rRNA (2,497 bp)-internal transcribed spacer (185 bp)-small subunit rRNA (1,232 bp)-intergenic spacer (277 bp)-5S rRNA (114 bp)-3'. Gene sequences and the secondary structures of large subunit rRNA, small subunit rRNA, and 5S rRNA are compared with the known corresponding sequences and structures of closely related microsporidia. The results suggest that the Nosema genus may be heterogeneous and that the rRNA gene organization may be a useful characteristic for determining which species are closely related to the type species. PMID:15702980

  12. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    PubMed

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  13. Accurate transcription of homologous 5S rRNA and tRNA genes and splicing of tRNA in vitro by soluble extracts of Neurospora.

    PubMed Central

    Tyler, B M; Giles, N H

    1984-01-01

    We have developed soluble extracts from Neurospora crassa capable of accurately and efficiently transcribing homologous 5S rRNA and tRNA genes. The extracts also appear to quantitatively end-process and splice the primary tRNA transcripts. Although the extracts could not transcribe a heterologous (yeast) 5S rRNA gene, they did transcribe a yeast tRNALeu gene and slowly process the transcripts. In addition, we have developed a novel strategy for rapidly sequencing uniformly labelled RNAs using base-specific ribonucleases. We have used this procedure to verify the identity of the in vitro transcripts and processing products. Images PMID:6235482

  14. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana.

    PubMed

    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D

    1992-03-15

    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  15. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  16. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families. PMID:25315165

  17. Comparative analysis of the genes encoding 23S-5S rRNA intergenic spacer regions of Lactobacillus casei-related strains.

    PubMed

    Chen, H; Lim, C K; Lee, Y K; Chan, Y N

    2000-03-01

    In this study, investigations into the 23S-5S rRNA intergenic spacer regions (ISRs) of the Lactobacillus casei group were performed. A 1.6 kb fragment, from Lactobacillus paracasei strain ATCC 27092, containing part of the 5S rRNA gene (60 bp), the 5S-23S spacer region (198 bp) and part of the 23S rRNA gene (1295 bp) was cloned and sequenced (GenBank no. AF098107). This fragment was used as a probe to determine the rRNA restriction fragment length polymorphism (RFLP) patterns of nine strains belonging to the Lactobacillus casei group, along with four other non-Lactobacillus casei lactobacilli species. A pair of PCR primers, 23-Fl and 5-Ru, was designed and used for PCR amplification of the 23S-5S rRNA ISRs of these strains. The ISR length and sequence polymorphisms provided additional information for the taxonomic study of the Lactobacillus casei group. The spacer-length polymorphism of Lactobacillus rhamnosus was distinct from those of the other strains and this observation is consistent with the classification of Lactobacillus rhamnosus proposed by Mori et al. For all Lactobacillus casei and Lactobacillus paracasei strains, two major bands (approx. 250 and 170 bp in size) were obtained except in the case of Lactobacillus paracasei subsp. tolerans strain NCIMB 9709T, which yielded only one amplified product (250 bp). The sequencing data of the PCR products of seven well-characterized Lactobacillus casei and Lactobacillus paracasei strains revealed the presence of a 76/80 bp insertion/deletion with some random, single-base substitutions between the longer and shorter spacers for each respective strain. A few base variations were also detected within different strains in this group although the overall sequence similarity was very high (95.9-99.5%). The rRNA RFLP and the spacer sequence of Lactobacillus casei type strain ATCC 393T exhibited unique identities in this cluster. On the other hand, Lactobacillus casei strain ATCC 334 showed a high level of similarity

  18. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  19. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  20. Nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi and their phylogenetic positions

    PubMed Central

    Komiya, Hiroyuki; Hasegawa, Masami; Takemura, Shosuke

    1983-01-01

    The nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi were determined by chemical and enzymatic gel methods. Their phylogenetic positions among metazoans were derived from the 5S rRNA sequences by a computer analysis based on the maximum parsimony principle. It was suggested that the sponge is closely related to several invertebrates and the tunicate has affinity to vertebrates rather than invertebrates. PMID:6835845

  1. Molecular phylogenetic studies on filarial parasites based on 5S ribosomal spacer sequences.

    PubMed

    Xie, H; Bain, O; Williams, S A

    1994-06-01

    This paper is the first large-scale molecular phylogenetic study on filarial parasites (family Onchocercidae) which includes 16 species of 6 genera: Brugia beaveri Ash et Little, 1962, B. buckleyi Dissanaike et Paramananthan, 1961; B. malayi (Brug, 1927) Buckley, 1960; B. pahangi (Buckley et Edeson, 1956) Buckley, 1960; B. patei (Buckley, Nelson et Heisch, 1958) Buckley, 1960; B. timori Partono et al, 1977; Wuchereria bancrofti (Cobbold, 1877) Seurat, 1921: W. kalimantani Palmieri. Purnomo, Dennis and Marwoto, 1980: Mansonella perstans (Manson, 1891) Eberhard et Orihel, 1984; loa loc, Stiles, 1905; Onchocerca volvulus (Leuckart, 1983) Railliet er Henry, 1910; O. ochengi Bwangamoi, 1969; O. gutturosa Neumann, 1910; Dirofilaria immitis (Leidy, 1856) Railliet e Henry, 1911; Acanthocheilonema viteae (Krepkogorskaya, 1933) Bain, Baker et Chabaud, 1982 and Litomosoides sigmodontis Chandler, 1931. 5S rRNA gene spacer region sequence data were collected by PCR, cloning and dideoxy sequencing. The 5S rRNA gene spacer region sequences were aligned and analyzed by maximum parsimony algorithms, distance methods and maximum likelihood methods to construct phylogenetic trees. Bootstrap analysis was used to test the robustness of the different phylogenetic reconstructions. The data indicated that 5S spacer region sequences are highly conserved within species yet differ significantly between species. Spliced leader sequences were observed in all of the 5S rDNA spacers with no sequence variation, although flanking region sequence and length heterogeneity was observed even within species. All of the various tree-building methods gave very similar results. This study identified four clades which are strongly supported by bootstrap analysis the Brugia clade; the Wuchereria clade; the Brugia-Wuchereria clade and the Onchocerca clade. The analyses indicated that L. sigmodontis and A. viteae may be the most primitive among the 16 species studied. The data did not show any close

  2. What does the 5S rRNA multigene family tell us about the origin of the annual Triticeae (Poaceae)?

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2013-05-01

    We have investigated the complex relationships among the annual genera within the tribe Triticeae through phylogenetic analyses of the 5S rRNA multigene family. Cloned sequences were assigned to groups of orthologous sequences, called unit classes, that were subjected to several analyses including BLAST (Basic Local Alignment Search Tool) searches to assess possible ancestral relationships with perennial genera; phylogenetic analyses using parsimony (Pars), maximum likelihood (ML), and Bayesian methods; and minimum reticulation networks from the Pars, ML, and Bayesian trees. In this study, we included genera with both annual and perennial species, such as Dasypyrum, Hordeum, and Secale. BLAST pointed to Pseudoroegneria (carrier of the St genome) and possibly Thinopyrum (carrier of the J genome) as the potential next of kin. However, Thinopyrum and Pseudoroegneria have never fallen together on the individual trees with the former generally associated with Crithopsis, Aegilops, Triticum, and Dasypyrum, while the latter is usually associated with the rest of the genera within Triticeae. The "long" unit classes placed Dasypyrum breviaristatum together with Dasypyrum villosum, whereas the "short" unit classes put them far apart on the trees. None of the gene trees alone was able to summarize the complex relationships among the genera, in line with previous results in the Triticeae. However, the application of tools designed to display phylogenetic networks was able to depict the complex links among the genera based on the short and the long gene trees, including the close link between Thinopyrum and Pseudoroegneria suggested by the phylogenetic analyses. In addition, our analyses provide support for the hypothesis that at least some annual Triticeae taxa are derived from their perennial relatives. PMID:23789993

  3. Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

    PubMed Central

    Carol, P; Rozier, C; Lazaro, E; Ballesta, J P; Mache, R

    1993-01-01

    The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain. Images PMID:8441674

  4. Localization of 5S and 25S rRNA genes on somatic and meiotic chromosomes in Capsicum species of chili pepper.

    PubMed

    Kwon, Jin-Kyung; Kim, Byung-Dong

    2009-02-28

    The loci of the 5S and 45S rRNA genes were localized on chromosomes in five species of Capsicum, namely, annuum, chacoense, frutescens, baccatum, and chinense by FISH. The 5S rDNA was localized to the distal region of one chromosome in all species observed. The number of 45S rDNA loci varied among species; one in annuum, two in chacoense, frutescens, and chinense, and four in baccatum, with the exceptions that 'CM334' of annuum had three loci and 'tabasco' of frutescens had one locus. 'CM334'-derived BAC clones, 384B09 and 365P05, were screened with 5S rDNA as a probe, and BACs 278M03 and 262A23 were screened with 25S rDNA as a probe. Both ends of these BAC clones were sequenced. FISH with these BAC probes on pachytenes from 'CM334' plant showed one 5S rDNA locus and three 45S rDNA loci, consistent with the patterns on the somatic chromosomes. The 5S rDNA probe was also applied on extended DNA fibers to reveal that its coverage measured as long as 0.439 Mb in the pepper genome. FISH techniques applied on somatic and meiotic chromosomes and fibers have been established for chili to provide valuable information about the copy number variation of 45S rDNA and the actual physical size of the 5S rDNA in chili. PMID:19277503

  5. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    PubMed Central

    Leontis, N B; Westhof, E

    1998-01-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  6. 5S RNA sequence from the Philosamia silkworm: evidence for variable evolutionary rates in insect 5S RNA.

    PubMed Central

    Xian-Rong, G; Nicoghosian, K; Cedergren, R J

    1982-01-01

    The primary structure of 5S RNA isolated from the posterior silkgland of Philosamia cynthia ricini was determined using three in vitro labelling techniques. The derived sequence consists of 119 nucleotides and can be folded into the secondary structure model proposed for eukaryotic 5S RNAs. This 5S RNA differs from the Bombyx mori molecule in 9 positions and from the Drosophila melanogaster sequence in 14 positions. The comparison of evolutionary rates in insect 5S RNA with inferred rates in other eukaryotic phyla leads to the conclusion that 5S RNA evolution is not constant in different eukaryotic branches, a condition which must be taken into account in phylogenetic tree constructions. Images PMID:7145713

  7. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment. PMID:22724546

  8. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    PubMed

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. PMID:26800847

  9. The karyotype and 5S rRNA genes from Spanish individuals of the bat species Rhinolophus hipposideros (Rhinolophidae; Chiroptera).

    PubMed

    Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio

    2008-11-01

    The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair. PMID:18066670

  10. Involvement of multiple basic amino acids in yeast ribosomal protein L1 in 5S rRNA recognition.

    PubMed

    Yeh, L C; Lee, J C

    1995-01-01

    The role of basic amino acid residues located at the C-terminal region of the yeast ribosomal protein L1 in 5S rRNA binding was characterized in vitro and in vivo. Mutant proteins containing single or multiple amino acid substitutions were generated by site-directed mutagenesis of the L1 gene carried on a plasmid. In vitro RNP formation was examined by production of the mutant protein in the presence of the RNA molecule. The thermostability of the resultant RNP was also studied. Effects of these mutations on cell viability and ribosome assembly were characterized by transformation of a conditional null L1 yeast mutant with the mutated L1 gene expressed from the plasmid. Substitution of any one of the lysine or arginine residue did not affect significantly RNA binding in vitro or cell growth in vivo. However, several mutant proteins with substitutions of two of these basic amino acids bound RNA weakly and the RNPs were less stable. Cells expressing these mutant proteins were lethal. Theoretical structural prediction of these amino acids further provided information regarding their collective contributions to RNA recognition and to interaction between the RNP and other components of the 60S ribosomal subunit. PMID:8643400

  11. Mutations in TFIIIA that increase stability of the TFIIIA-5 S rRNA gene complex: unusual effects on the kinetics of complex assembly and dissociation.

    PubMed

    Brady, Kristina L; Ponnampalam, Stephen N; Bumbulis, Michael J; Setzer, David R

    2005-07-22

    We have identified four mutations in Xenopus TFIIIA that increase the stability of TFIIIA-5 S rRNA gene complexes. In each case, the mutation has a relatively modest effect on equilibrium binding affinity. In three cases, these equilibrium binding effects can be ascribed primarily to decreases in the rate constant for protein-DNA complex dissociation. In the fourth case, however, a substitution of phenylalanine for the wild-type leucine at position 148 in TFIIIA results in much larger compensating changes in the kinetics of complex assembly and dissociation. The data support a model in which a relatively unstable population of complexes with multi-component dissociation kinetics forms rapidly; complexes then undergo a slow conformational change that results in very stable, kinetically homogeneous TFIIIA-DNA complexes. The L148F mutant protein acts as a particularly potent transcriptional activator when it is fused to the VP16 activation domain and expressed in yeast cells. Substitution of L148 to tyrosine or tryptophan produces an equally strong transcriptional activator. Substitution to histidine results in genetic and biochemical effects that are more modest than, but similar to, those observed with the L148F mutation. We propose that an amino acid with a planar side chain at position 148 can intercalate between adjacent base pairs in the intermediate element of the 5 S rRNA gene. Intercalation occurs slowly but results in a very stable DNA-protein complex. These results suggest that transcriptional activation by a cis-acting sequence element is largely dependent on the kinetic, rather than the thermodynamic, stability of the complex formed with an activator protein. Thus, transcriptional activation is dependent in large part on the lifetime of the activator-DNA complex rather than on binding site occupancy at steady state. Introduction of intercalating amino acids into zinc finger proteins may be a useful tool for producing artificial transcription factors with

  12. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  13. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  14. Natural Microbial Community Compositions Compared by a Back-Propagating Neural Network and Cluster Analysis of 5S rRNA

    PubMed Central

    Noble, P. A.; Bidle, K. D.; Fletcher, M.

    1997-01-01

    The community compositions of free-living and particle-associated bacteria in the Chesapeake Bay estuary were analyzed by comparing banding patterns of stable low-molecular-weight RNA (SLMW RNA) which include 5S rRNA and tRNA molecules. By analyzing images of autoradiographs of SLMW RNAs on polyacrylamide gels, band intensities of 5S rRNA were converted to binary format for transmission to a back-propagating neural network (NN). The NN was trained to relate binary input to sample stations, collection times, positions in the water column, and sample types (e.g., particle-associated versus free-living communities). Dendrograms produced by using Euclidean distance and average and Ward's linkage methods on data of three independently trained NNs yielded the following results. (i) Community compositions of Chesapeake Bay water samples varied both seasonally and spatially. (ii) Although there was no difference in the compositions of free-living and particle-associated bacteria in the summer, these community types differed significantly in the winter. (iii) In the summer, most bay samples had a common 121-nucleotide 5S rRNA molecule. Although this band occurred in the top water of midbay samples, it did not occur in particle-associated communities of bottom-water samples. (iv) Regardless of the season, midbay samples had the greatest variety of 5S rRNA sizes. The utility of NNs for interpreting complex banding patterns in electrophoresis gels was demonstrated. PMID:16535593

  15. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    PubMed Central

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387

  16. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    PubMed

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes. PMID:26835745

  17. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    PubMed

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  18. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  19. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  20. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.

    PubMed

    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A

    2008-01-01

    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  1. Nucleotide sequences of 5S ribosomal RNA from four oomycete and chytrid water molds.

    PubMed

    Walker, W F; Doolittle, W F

    1982-09-25

    The nucleotide sequences of the 5S rRNAs of the oomycete water molds Saprolegnia ferax and Pythium hydnosporum and of the chytrid water molds Blastocladiella simplex and Phlyctochytrium irregulare were determined by chemical and enzymatic partial degradation of 3' and 5' end-labelled molecules, followed by gel sequence analysis. The two oomycete sequences differed in 24 positions and the two chytrid sequences differed in 27 positions. These pairs differed in a mean of 44 positions. The chytrid sequences clearly most resemble the sequence from the zygomycete Phycomyces, while the oomycete sequences appear to be allied with those from protozoa and slime molds. PMID:6890670

  2. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  3. mTOR associates with TFIIIC, is found at tRNA and 5S rRNA genes, and targets their repressor Maf1.

    PubMed

    Kantidakis, Theodoros; Ramsbottom, Ben A; Birch, Joanna L; Dowding, Sarah N; White, Robert J

    2010-06-29

    Synthesis of tRNA and 5S rRNA by RNA polymerase (pol) III is regulated by the mTOR pathway in mammalian cells. The mTOR kinase localizes to tRNA and 5S rRNA genes, providing an opportunity for direct control. Its presence at these sites can be explained by interaction with TFIIIC, a DNA-binding factor that recognizes the promoters of these genes. TFIIIC contains a TOR signaling motif that facilitates its association with mTOR. Maf1, a repressor that binds and inhibits pol III, is phosphorylated in a mTOR-dependent manner both in vitro and in vivo at serine 75, a site that contributes to its function as a transcriptional inhibitor. Proximity ligation assays confirm the interaction of mTOR with Maf1 and TFIIIC in nuclei. In contrast to Maf1 regulation in yeast, no evidence is found for nuclear export of Maf1 in response to mTOR signaling in HeLa cells. We conclude that mTOR associates with TFIIIC, is recruited to pol III-transcribed genes, and relieves their repression by Maf1. PMID:20543138

  4. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  5. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  6. Accurate taxonomy assignments from 16S rRNA sequences produced by highly parallel pyrosequencers

    PubMed Central

    Liu, Zongzhi; DeSantis, Todd Z.; Andersen, Gary L.; Knight, Rob

    2008-01-01

    The recent introduction of massively parallel pyrosequencers allows rapid, inexpensive analysis of microbial community composition using 16S ribosomal RNA (rRNA) sequences. However, a major challenge is to design a workflow so that taxonomic information can be accurately and rapidly assigned to each read, so that the composition of each community can be linked back to likely ecological roles played by members of each species, genus, family or phylum. Here, we use three large 16S rRNA datasets to test whether taxonomic information based on the full-length sequences can be recaptured by short reads that simulate the pyrosequencer outputs. We find that different taxonomic assignment methods vary radically in their ability to recapture the taxonomic information in full-length 16S rRNA sequences: most methods are sensitive to the region of the 16S rRNA gene that is targeted for sequencing, but many combinations of methods and rRNA regions produce consistent and accurate results. To process large datasets of partial 16S rRNA sequences obtained from surveys of various microbial communities, including those from human body habitats, we recommend the use of Greengenes or RDP classifier with fragments of at least 250 bases, starting from one of the primers R357, R534, R798, F343 or F517. PMID:18723574

  7. Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

    PubMed Central

    Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

    1996-01-01

    Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

  8. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing.

    PubMed Central

    Schmidt, T M; DeLong, E F; Pace, N R

    1991-01-01

    The phylogenetic diversity of an oligotrophic marine picoplankton community was examined by analyzing the sequences of cloned ribosomal genes. This strategy does not rely on cultivation of the resident microorganisms. Bulk genomic DNA was isolated from picoplankton collected in the north central Pacific Ocean by tangential flow filtration. The mixed-population DNA was fragmented, size fractionated, and cloned into bacteriophage lambda. Thirty-eight clones containing 16S rRNA genes were identified in a screen of 3.2 x 10(4) recombinant phage, and portions of the rRNA gene were amplified by polymerase chain reaction and sequenced. The resulting sequences were used to establish the identities of the picoplankton by comparison with an established data base of rRNA sequences. Fifteen unique eubacterial sequences were obtained, including four from cyanobacteria and eleven from proteobacteria. A single eucaryote related to dinoflagellates was identified; no archaebacterial sequences were detected. The cyanobacterial sequences are all closely related to sequences from cultivated marine Synechococcus strains and with cyanobacterial sequences obtained from the Atlantic Ocean (Sargasso Sea). Several sequences were related to common marine isolates of the gamma subdivision of proteobacteria. In addition to sequences closely related to those of described bacteria, sequences were obtained from two phylogenetic groups of organisms that are not closely related to any known rRNA sequences from cultivated organisms. Both of these novel phylogenetic clusters are proteobacteria, one group within the alpha subdivision and the other distinct from known proteobacterial subdivisions. The rRNA sequences of the alpha-related group are nearly identical to those of some Sargasso Sea picoplankton, suggesting a global distribution of these organisms. Images PMID:2066334

  9. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  10. A Neurospora crassa ribosomal protein gene, homologous to yeast CRY1, contains sequences potentially coordinating its transcription with rRNA genes.

    PubMed Central

    Tyler, B M; Harrison, K

    1990-01-01

    We have isolated and sequenced a Neurospora crassa ribosomal protein gene (designated crp-2) strongly homologous to the rp59 gene (CRY1) of yeast and the S14 ribosomal protein gene of mammals. The inferred sequence of the crp-2 protein is more homologous (83%) to the mammalian S14 sequence than to the yeast rp59 sequence (69%). The gene has three intervening sequences (IVSs) two of which are offset 7 bp from the position of IVSs in the mammalian genes. None correspond to the position of the IVS in the yeast gene. Crp-2 was mapped by RFLP analysis to the right arm of linkage group III. The 5' region of the gene contains three copies of a sequence, the Ribo box, previously shown to be required for transcription of both 5S and 40S rRNA genes. We speculate that the Ribo box may coordinate ribosomal protein and rRNA gene transcription. Images PMID:1977135

  11. Diversity of host species and strains of Pneumocystis carinii is based on rRNA sequences.

    PubMed Central

    Shah, J S; Pieciak, W; Liu, J; Buharin, A; Lane, D J

    1996-01-01

    We have amplified by PCR Pneumocystis carinii cytoplasmic small-subunit rRNA (variously referred to as 16S-like or 18S-like rRNA) genes from DNA extracted from bronchoalveolar lavage and induced sputum specimens from patients positive for P. carinii and from infected ferret lung tissue. The amplification products were cloned into pUC18, and individual clones were sequenced. Comparison of the determined sequences with each other and with published rat and partial human P.carinii small-subunit rRNA gene sequences reveals that, although all P. carinii small-subunit rRNAs are closely related (approximately 96% identity), small-subunit rRNA genes isolated from different host species (human, rat, and ferret) exhibit distinctive patterns of sequence variation. Two types of sequences were isolated from the infected ferret lung tissue, one as a predominant species and the other as a minor species. There was 96% identity between the two types. In situ hybridization of the infected ferret lung tissue with oligonucleotide probes specific for each type revealed that there were two distinct strains of P. carinii present in the ferret lung tissue. Unlike the ferret P. carinii isolates, the small-subunit rRNA gene sequences from different human P. carinii isolates have greater than 99% identity and are distinct from all rat and ferret sequences so far inspected or reported in the literature. Southern blot hybridization analysis of PCR amplification products from several additional bronchoalveolar lavage or induced sputum specimens from P. carinii-infected patients, using a 32P-labeled oligonucleotide probe specific for human P. carinii, also suggests that all of the human P. carinii isolates are identical. These findings indicate that human P. carinii isolates may represent a distinct species of P. carinii distinguishable from rat and ferret P. carinii on the basis of characterization of small-subunit rRNA gene sequences. PMID:8770515

  12. Molecular Diagnosis of Actinomadura madurae Infection by 16S rRNA Deep Sequencing

    PubMed Central

    SenGupta, Dhruba J.; Hoogestraat, Daniel R.; Cummings, Lisa A.; Bryant, Bronwyn H.; Natividad, Catherine; Thielges, Stephanie; Monsaas, Peter W.; Chau, Mimosa; Barbee, Lindley A.; Rosenthal, Christopher; Cookson, Brad T.; Hoffman, Noah G.

    2013-01-01

    Next-generation DNA sequencing can be used to catalog individual organisms within complex, polymicrobial specimens. Here, we utilized deep sequencing of 16S rRNA to implicate Actinomadura madurae as the cause of mycetoma in a diabetic patient when culture and conventional molecular methods were overwhelmed by overgrowth of other organisms. PMID:24108607

  13. Sequence and phylogenetic analysis of SSU rRNA gene of five microsporidia.

    PubMed

    Dong, ShiNan; Shen, ZhongYuan; Xu, Li; Zhu, Feng

    2010-01-01

    The complete small subunit rRNA (SSU rRNA) gene sequences of five microsporidia including Nosema heliothidis, and four novel microsporidia isolated from Pieris rapae, Phyllobrotica armta, Hemerophila atrilineata, and Bombyx mori, respectively, were obtained by PCR amplification, cloning, and sequencing. Two phylogenetic trees based on SSU rRNA sequences had been constructed by using Neighbor-Joining of Phylip software and UPGMA of MEGA4.0 software. The taxonomic status of four novel microsporidia was determined by analysis of phylogenetic relationship, length, G+C content, identity, and divergence of the SSU rRNA sequences. The results showed that the microsporidia isolated from Pieris rapae, Phyllobrotica armta, and Hemerophila atrilineata have close phylogenetic relationship with the Nosema, while another microsporidium isolated from Bombyx mori is closely related to the Endoreticulatus. So, we temporarily classify three novel species of microsporidia to genus Nosema, as Nosema sp. PR, Nosema sp. PA, Nosema sp. HA. Another is temporarily classified into genus Endoreticulatus, as Endoreticulatus sp. Zhenjiang. The result indicated as well that it is feasible and valuable to elucidate phylogenetic relationships and taxonomic status of microsporidian species by analyzing information from SSU rRNA sequences of microsporidia. PMID:19768503

  14. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  15. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  16. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy.

    PubMed

    Wang, Qiong; Garrity, George M; Tiedje, James M; Cole, James R

    2007-08-01

    The Ribosomal Database Project (RDP) Classifier, a naïve Bayesian classifier, can rapidly and accurately classify bacterial 16S rRNA sequences into the new higher-order taxonomy proposed in Bergey's Taxonomic Outline of the Prokaryotes (2nd ed., release 5.0, Springer-Verlag, New York, NY, 2004). It provides taxonomic assignments from domain to genus, with confidence estimates for each assignment. The majority of classifications (98%) were of high estimated confidence (> or = 95%) and high accuracy (98%). In addition to being tested with the corpus of 5,014 type strain sequences from Bergey's outline, the RDP Classifier was tested with a corpus of 23,095 rRNA sequences as assigned by the NCBI into their alternative higher-order taxonomy. The results from leave-one-out testing on both corpora show that the overall accuracies at all levels of confidence for near-full-length and 400-base segments were 89% or above down to the genus level, and the majority of the classification errors appear to be due to anomalies in the current taxonomies. For shorter rRNA segments, such as those that might be generated by pyrosequencing, the error rate varied greatly over the length of the 16S rRNA gene, with segments around the V2 and V4 variable regions giving the lowest error rates. The RDP Classifier is suitable both for the analysis of single rRNA sequences and for the analysis of libraries of thousands of sequences. Another related tool, RDP Library Compare, was developed to facilitate microbial-community comparison based on 16S rRNA gene sequence libraries. It combines the RDP Classifier with a statistical test to flag taxa differentially represented between samples. The RDP Classifier and RDP Library Compare are available online at http://rdp.cme.msu.edu/. PMID:17586664

  17. Phylogeny of protostome worms derived from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade. PMID:7659019

  18. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples. PMID:25343859

  19. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  20. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  1. Species Identification and Profiling of Complex Microbial Communities Using Shotgun Illumina Sequencing of 16S rRNA Amplicon Sequences

    PubMed Central

    Lay, Christophe; Ho, Eliza Xin Pei; Low, Louie; Hibberd, Martin Lloyd; Nagarajan, Niranjan

    2013-01-01

    The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequencing of the bacterial 16S rRNA gene, optimized to amplify more than 90% of sequences in the Greengenes database and with the ability to distinguish nearly twice as many species-level OTUs compared to existing protocols. Using several in silico and experimental datasets, we demonstrate that despite the presence of multiple variable and conserved regions, the resulting shotgun sequences can be used to accurately quantify the constituents of complex microbial communities. The reconstruction of a significant fraction of the 16S rRNA gene also enabled high precision (>90%) in species-level identification thereby opening up potential application of this approach for clinical microbial characterization. PMID:23579286

  2. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. PMID:25261903

  3. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central

    2012-01-01

    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  4. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system

    PubMed Central

    Jenior, Matthew L.; Koumpouras, Charles C.; Westcott, Sarah L.; Highlander, Sarah K.

    2016-01-01

    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina’s MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3–V5, V1–V3, V1–V5, V1–V6, and V1–V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1–V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina’s MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting. PMID:27069806

  5. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system.

    PubMed

    Schloss, Patrick D; Jenior, Matthew L; Koumpouras, Charles C; Westcott, Sarah L; Highlander, Sarah K

    2016-01-01

    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina's MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3-V5, V1-V3, V1-V5, V1-V6, and V1-V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1-V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina's MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting. PMID:27069806

  6. Rhizobium sp. strain BN4 (a selenium oxyanion-reducing bacterium) 16S rRNA gene complete sequence

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1482 base pair 16S rRNA gene sequence methods in conjunction with other biochemical and morphological studies to confirm the identification of a bacterium (refer to as the BN4 strain) as a Rhizobium sp. The 16S rRNA gene sequence places it with the Rhizobium clade that includes R. d...

  7. Phylogenetic analysis of complete rRNA gene sequence of Nosema philosamiae isolated from the lepidopteran Philosamia cynthia ricini.

    PubMed

    Zhu, Feng; Shen, Zhongyuan; Xu, Xiaofang; Tao, Hengping; Dong, Shinan; Tang, Xudong; Xu, Li

    2010-01-01

    ABSTRACT. The microsporidian Nosema philosamiae is a pathogen that infects the eri-silkworm Philosamia cynthia ricini. The complete sequence of rRNA gene (4,314 bp) was obtained by polymerase chain reaction amplification with specific primers and sequencing. The sequence analysis showed that the organization of the rRNA of N. philosamiae was similar to the pattern of Nosema bombycis. Phylogenetic analysis of rRNA gene sequences revealed that N. philosamiae had a close relationship with other Nosema species, confirming that N. philosamiae is correctly assigned to the genus Nosema. PMID:20384905

  8. Characterization of the genus Bifidobacterium by automated ribotyping and 16S rRNA gene sequences.

    PubMed

    Sakata, Shinji; Ryu, Chun Sun; Kitahara, Maki; Sakamoto, Mitsuo; Hayashi, Hidenori; Fukuyama, Masafumi; Benno, Yoshimi

    2006-01-01

    In order to characterize the genus Bifidobacterium, ribopatterns and approximately 500 bp (Escherichia coli positions 27 to 520) of 16S rRNA gene sequences of 28 type strains and 64 reference strains of the genus Bifidobacterium were determined. Ribopatterns obtained from Bifidobacterium strains were divided into nine clusters (clusters I-IX) with a similarity of 60%. Cluster V, containing 17 species, was further subdivided into 22 subclusters with a similarity of 90%. In the genus Bifidobacterium, four groups were shown according to Miyake et al.: (i) the Bifidobacterium longum infantis-longum-suis type group, (ii) the B. catenulatum-pseudocatenulatum group, (iii) the B. gallinarum-saeculare-pullorum group, and (iv) the B. coryneforme-indicum group, which showed higher than 97% similarity of the 16S rRNA gene sequences in each group. Using ribotyping analysis, unique ribopatterns were obtained from these species, and they could be separated by cluster analysis. Ribopatterns of six B. adolescentis strains were separated into different clusters, and also showed diversity in 16S rRNA gene sequences. B. adolescentis consisted of heterogeneous strains. The nine strains of B. pseudolongum subsp. pseudolongum were divided into five subclusters. Each type strain of B. pseudolongum subsp. pseudolongum and B. pseudolongum subsp. globosum and two intermediate groups, which were suggested by Yaeshima et al., consisted of individual clusters. B. animalis subsp. animalis and B. animalis subsp. lactis could not be separated by ribotyping using Eco RI. We conclude that ribotyping is able to provide another characteristic of Bifidobacterium strains in addition to 16S rRNA gene sequence phylogenetic analysis, and this information suggests that ribotyping analysis is a useful tool for the characterization of Bifidobacterium species in combination with other techniques for taxonomic characterization. PMID:16428867

  9. Simultaneous alignment and folding of 28S rRNA sequences uncovers phylogenetic signal in structure variation.

    PubMed

    Letsch, Harald O; Greve, Carola; Kück, Patrick; Fleck, Günther; Stocsits, Roman R; Misof, Bernhard

    2009-12-01

    Secondary structure models of mitochondrial and nuclear (r)RNA sequences are frequently applied to aid the alignment of these molecules in phylogenetic analyses. Additionally, it is often speculated that structure variation of (r)RNA sequences might profitably be used as phylogenetic markers. The benefit of these approaches depends on the reliability of structure models. We used a recently developed approach to show that reliable inference of large (r)RNA secondary structures as a prerequisite of simultaneous sequence and structure alignment is feasible. The approach iteratively establishes local structure constraints of each sequence and infers fully folded individual structures by constrained MFE optimization. A comparison of structure edit distances of individual constraints and fully folded structures showed pronounced phylogenetic signal in fully folded structures. As model sequences we characterized secondary structures of 28S rRNA sequences of selected insects and examined their phylogenetic signal according to established phylogenetic hypotheses. PMID:19654047

  10. Homology of the 3' terminal sequences of the 18S rRNA of Bombyx mori and the 16S rRNA of Escherchia coli.

    PubMed Central

    Samols, D R; Hagenbuchle, O; Gage, L P

    1979-01-01

    The terminal 220 base pairs (bp) of the gene for 18S rRNA and 18 bp of the adjoining spacer rDNA of the silkworm Bombyx mori have been sequenced. Comparison with the sequence of the 16S rRNA gene of Escherichia coli has shown that a region including 45 bp of the B. mori sequence at the 3' end is remarkably homologous with the 3' terminal E. coli sequence. Other homologies occur in the terminal regions of the 18S and 16S rRNAs, including a perfectly conserved stretch of 13 bp within a longer homology located 150--200 bp from the 3' termini. These homologies are the most extensive so far reported between prokaryotic and eukaryotic genomic DNA. Images PMID:390496

  11. Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

    NASA Technical Reports Server (NTRS)

    Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1991-01-01

    Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

  12. Origin and evolution of organisms as deduced from 5S ribosomal RNA sequences.

    PubMed

    Hori, H; Osawa, S

    1987-09-01

    A phylogenetic tree of most of the major groups of organisms has been constructed from the 352 5S ribosomal RNA sequences now available. The tree suggests that there are several major groups of eubacteria that diverged during the early stages of their evolution. Metabacteria (= archaebacteria) and eukaryotes separated after the emergence of eubacteria. Among eukaryotes, red algae emerged first; and, later, thraustochytrids (a Proctista group), ascomycetes (yeast), green plants (green algae and land plants), "yellow algae" (brown algae, diatoms, and chrysophyte algae), basidiomycetes (mushrooms and rusts), slime- and water molds, various protozoans, and animals emerged, approximately in that order. Three major types of photosynthetic eukaryotes--i.e., red algae (= Chlorophyll a group), green plants (Chl. a + b group) and yellow algae (Chl. a + c)--are remotely related to one another. Other photosynthetic unicellular protozoans--such as Cyanophora (Chl. a), Euglenophyta (Chl. a + b), Cryptophyta (Chl. a + c), and Dinophyta (Chl. a + c)--seem to have separated shortly after the emergence of the yellow algae. PMID:2452957

  13. Details of gastropod phylogeny inferred from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Steiner, G; Backeljau, T; De Wachter, R

    1998-02-01

    Some generally accepted viewpoints on the phylogenetic relationships within the molluscan class Gastropoda are reassessed by comparing complete 18S rRNA sequences. Phylogenetic analyses were performed using the neighbor-joining and maximum parsimony methods. The previously suggested basal position of Archaeogastropoda, including Neritimorpha and Vetigastropoda, in the gastropod clade is confirmed. The present study also provides new molecular evidence for the monophyly of both Caenogastropoda and Euthyneura (Pulmonata and Opisthobranchia), making Prosobranchia paraphyletic. The relationships within Caenogastropoda and Euthyneura data turn out to be very unstable on the basis of the present 18S rRNA sequences. The present 18S rRNA data question, but are insufficient to decide on, muricacean (Neogastropoda), neotaenioglossan, pulmonate, or stylommatophoran monophyly. The analyses also focus on two systellommatophoran families, namely, Veronicellidae and Onchidiidae. It is suggested that Systellommatophora are not a monophyletic unit but, due to the lack of stability in the euthyneuran clade, their affinity to either Opisthobranchia or Pulmonata could not be determined. PMID:9479694

  14. Sequences implicated in the processing of Thermus thermophilus HB8 23S rRNA.

    PubMed Central

    Hartmann, R K; Ulbrich, N; Erdmann, V A

    1987-01-01

    Nuclease S1 mapping analyses were performed in order to detect processing intermediates of pre-23S rRNA from Thermus thermophilus HB8. Two processing sites were identified downstream the start of transcription and several consecutive cleavage sites are associated with the mature 5'-end. In the 3'-flanking region one "primary" site and two cleavages which generate short-living intermediates were detected. A series of successive intermediates in the region of the mature 3'-end implies the existence of--in analogy to Escherichia coli--a 3'-exonucleolytic activity. The data were correlated with potential secondary structures within the pre-23S rRNA, which exhibit various repeated sequence elements. M13 sequencing data support the existence of one secondary structural element associated with the strong "primary" cleavage site in the 3'-flanking region. In T. thermophilus we can exclude the formation of an extended base-paired and precursor-specific stem enclosing the 23S rRNA which is inferred to mediate recognition by RNase III in E. coli. Images PMID:3313273

  15. Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

    NASA Technical Reports Server (NTRS)

    Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

    1985-01-01

    The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

  16. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

    1992-01-01

    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  17. Oligodeoxynucleotide probes for Campylobacter fetus and Campylobacter hyointestinalis based on 16S rRNA sequences.

    PubMed Central

    Wesley, I V; Wesley, R D; Cardella, M; Dewhirst, F E; Paster, B J

    1991-01-01

    Deoxyoligonucleotide probes were constructed for the identification of Campylobacter fetus and Campylobacter hyointestinalis based on 16S rRNA sequence data. Probes were targeted to hypervariable regions of 16S rRNA. Specificity of oligonucleotide probes was tested in a colony blot assay with type strains of 15 Campylobacter and Arcobacter species as well as in a slot blot format using genomic DNA extracted from field strains of C. fetus and C. hyointestinalis. Two oligonucleotides were constructed for C. fetus that hybridized with equal specificity with each of 57 biochemically confirmed isolates of C. fetus but not with any other Campylobacter species. The C. hyointestinalis probe reacted with 47 of 48 biochemically confirmed field isolates of C. hyointestinalis. In Southern blot hybridization of BglII digests of genomic DNA, the respective probes reacted within three restriction fragments of either C. hyointestinalis (7.2, 8.2, and 10.1 kb) or C. fetus (7.0, 7.7, and 9.0 kb). This suggests multiple copies of genes encoding 16S rRNA. Images PMID:1723076

  18. Preliminary study on mitochondrial 16S rRNA gene sequences and phylogeny of flatfishes (Pleuronectiformes)

    NASA Astrophysics Data System (ADS)

    You, Feng; Liu, Jing; Zhang, Peijun; Xiang, Jianhai

    2005-09-01

    A 605 bp section of mitochondrial 16S rRNA gene from Paralichthys olivaceus, Pseudorhombus cinnamomeus, Psetta maxima and Kareius bicoloratus, which represent 3 families of Order Pleuronectiformes was amplified by PCR and sequenced to show the molecular systematics of Pleuronectiformes for comparison with related gene sequences of other 6 flatfish downloaded from GenBank. Phylogenetic analysis based on genetic distance from related gene sequences of 10 flatfish showed that this method was ideal to explore the relationship between species, genera and families. Phylogenetic trees set-up is based on neighbor-joining, maximum parsimony and maximum likelihood methods that accords to the general rule of Pleuronectiformes evolution. But they also resulted in some confusion. Unlike data from morphological characters, P. olivaceus clustered with K. bicoloratus, but P. cinnamomeus did not cluster with P. olivaceus, which is worth further studying.

  19. Primer and platform effects on 16S rRNA tag sequencing

    SciTech Connect

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.

  20. Primer and platform effects on 16S rRNA tag sequencing

    PubMed Central

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-01-01

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. Beta diversity metrics are surprisingly robust to both primer and sequencing platform biases. PMID:26300854

  1. Primer and platform effects on 16S rRNA tag sequencing

    DOE PAGESBeta

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  2. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes.

    PubMed

    Soni, Dharmendra Kumar; Dubey, Suresh Kumar

    2014-12-01

    The discrimination between Listeria monocytogenes and Listeria species has been detected. The 16S rRNA and hlyA were PCR amplified with set of oligonucleotide primers with flank 1,500 and 456 bp fragments, respectively. Based on the differences in 16S rRNA and hlyA genes, a total 80 isolates from different environmental, food and clinical samples confirmed it to be L. monocytogenes. The 16S rRNA sequence similarity suggested that the isolates were similar to the previously reported ones from different habitats by others. The phylogenetic interrelationships of the genus Listeria were investigated by sequencing of 16S rRNA and hlyA gene. The 16S rRNA sequence indicated that genus Listeria is comprised of following closely related but distinct lines of descent, one is the L. monocytogenes species group (including L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) and other, the species L. grayi, L. rocourtiae and L. fleischmannii. The phylogenetic tree based on hlyA gene sequence clearly differentiates between the L. monocytogenes, L. ivanovii and L. seeligeri. In the present study, we identified 80 isolates of L. monocytogenes originating from different clinical, food and environmental samples based on 16S rRNA and hlyA gene sequence similarity. PMID:25205124

  3. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  4. Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

  5. Evaluation of 16S Rrna amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

  6. Molecular phylogeny of pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences.

    PubMed

    Li, ZiHui; Feng, XianMin; Lu, SiQi; Zhang, Fan; Wang, FengYun; Huang, Song

    2008-05-01

    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis. PMID:18785590

  7. The phylogeny of intestinal porcine spirochetes (Serpulina species) based on sequence analysis of the 16S rRNA gene.

    PubMed Central

    Pettersson, B; Fellström, C; Andersson, A; Uhlén, M; Gunnarsson, A; Johansson, K E

    1996-01-01

    Four type or reference strains and twenty-two field strains of intestinal spirochetes isolated from Swedish pig herds were subjected to phylogenetic analysis based on 16S rRNA sequences. Almost complete (>95%) 16S rRNA sequences were obtained by solid-phase DNA sequencing of in vitro-amplified rRNA genes. The genotypic patterns were compared with a previously proposed biochemical classification scheme, comprising beta-hemolysis, indole production, hippurate hydrolysis, and alpha-galactosidase, alpha-glucosidase, and beta-glucosidase activities. Comparison of the small-subunit rRNA sequences showed that the strains of the genus Serpulina were closely related. Phylogenetic trees were constructed, and three clusters were observed. This was also confirmed by signature nucleotide analysis of the serpulinas. The indole-producing strains, including the strains of S. hyodysenteriae and some weakly beta-hemolytic Serpulina strains, formed one cluster. A second cluster comprised weakly beta-hemolytic strains that showed beta-galactosidase activity but lacked indole production and hippurate-hydrolyzing capacity. The second cluster contained two subclusters with similar phenotypic profiles. A third cluster involved strains that possessed a hippurate-hydrolyzing capacity which was distinct from that of the former two clusters, because of 17 unique nucleotide positions of the 16S rRNA gene. Interestingly, the strains of this third cluster were found likely to have a 16S rRNA structure in the V2 region of the molecule different from that of the serpulinas belonging to the other clusters. As a consequence of these findings, we propose that the intestinal spirochetes of this phenotype (i.e., P43/6/78-like strains) should be regarded as a separate Serpulina species. Furthermore, this cluster was found to be by far the most homogeneous one. In conclusion, the biochemical classification of porcine intestinal spirochetes was comparable to that by phylogenetic analysis based on 16S rRNA

  8. Genetic and cytogenetic analyses of the A genome of Triticum monococcum. VIII. Localization of rDNAs and characterization of 5S rRNA genes.

    PubMed

    Kim, N S; Kuspira, J; Armstrong, K; Bhambhani, R

    1993-02-01

    In situ hybridization with [3H]dCTP labelled pScT7 (5S rDNA) and pTa80 (18S + 26S rDNA) indicated that both hybridized to the terminal regions of two pairs of chromosomes in Triticum monococcum. When the hybridization was performed with a mixture of both probes, only two pairs of chromosome arms were labelled, which suggested that the loci of both genes were located in juxtaposition to one another. Both probes labelled one pair of sites more heavily than the other. Southern analysis of 5S with BamHI-digested DNA from 12 accessions of T. monococcum (including T. urartu) produced two superimposed ladders of approximate sizes of 500 and 330 bp, which differ from T. aestivum in which 500- and 420-bp ladders were found. The 500-bp ladder is derived from chromosome 5A (5SDna-A2) and the 330-bp ladder from chromosome 1A (5SDna-A1). The recognition site for SstI was present in the long spacer region but absent in the short spacer as in T. aestivum; however, unlike T. aestivum, there were HaeIII (GGCC) and HindIII (AAGCTT) recognition sites in the short spacer region. The TaqI recognition sites (TCGA) in the long and short spacer regions are probably more highly methylated in T. monococcum than in T. aestivum. The results have implications regarding the evolutionary changes that occurred in the A genome of the hexaploid compared with the diploid. PMID:18469972

  9. Identification of Scopulariopsis species by partial 28S rRNA gene sequence analysis.

    PubMed

    Jagielski, Tomasz; Kosim, Kinga; Skóra, Magdalena; Macura, Anna Barbara; Bielecki, Jacek

    2013-01-01

    The genus Scopulariopsis contains over 30 species of mitosporic moulds, which although usually saprophytic may also act as opportunistic pathogens in humans. They have mainly been associated with onychomycosis, and only sporadically reported as a cause of deep tissue infections or systemic disease. Identification of Scopulariopsis species still largely relies on phenotype-based methods. There is a need for a molecular diagnostic approach, that would allow to reliably discriminate between different Scopulariopsis species. The aim of this study was to apply sequence analysis of partial 28S rRNA gene for species identification of Scopulariopsis clinical isolates. Although the method employed did reveal some genetic polymorphism among Scopulariopsis isolates tested, it was not enough for species delineation. For this to be achieved, other genetic loci, within and beyond the rDNA operon, need to be investigated. PMID:24459837

  10. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae.

    PubMed

    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C

    2016-09-01

    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  11. Identification of the Microbiota in Carious Dentin Lesions Using 16S rRNA Gene Sequencing

    PubMed Central

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4–76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  12. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    PubMed

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  13. Strengths and Limitations of 16S rRNA Gene Amplicon Sequencing in Revealing Temporal Microbial Community Dynamics

    PubMed Central

    Poretsky, Rachel; Rodriguez-R, Luis M.; Luo, Chengwei; Tsementzi, Despina; Konstantinidis, Konstantinos T.

    2014-01-01

    This study explored the short-term planktonic microbial community structure and resilience in Lake Lanier (GA, USA) while simultaneously evaluating the technical aspects of identifying taxa via 16S rRNA gene amplicon and metagenomic sequence data. 16S rRNA gene amplicons generated from four temporally discrete samples were sequenced with 454 GS-FLX-Ti yielding ∼40,000 rRNA gene sequences from each sample and representing ∼300 observed OTUs. Replicates obtained from the same biological sample clustered together but several biases were observed, linked to either the PCR or sequencing-preparation steps. In comparisons with companion whole-community shotgun metagenome datasets, the estimated number of OTUs at each timepoint was concordant, but 1.5 times and ∼10 times as many phyla and genera, respectively, were identified in the metagenomes. Our analyses showed that the 16S rRNA gene captures broad shifts in community diversity over time, but with limited resolution and lower sensitivity compared to metagenomic data. We also identified OTUs that showed marked shifts in abundance over four close timepoints separated by perturbations and tracked these taxa in the metagenome vs. 16S rRNA amplicon data. A strong summer storm had less of an effect on community composition than did seasonal mixing, which revealed a distinct succession of organisms. This study provides insights into freshwater microbial communities and advances the approaches for assessing community diversity and dynamics in situ. PMID:24714158

  14. CATCh, an ensemble classifier for chimera detection in 16S rRNA sequencing studies.

    PubMed

    Mysara, Mohamed; Saeys, Yvan; Leys, Natalie; Raes, Jeroen; Monsieurs, Pieter

    2015-03-01

    In ecological studies, microbial diversity is nowadays mostly assessed via the detection of phylogenetic marker genes, such as 16S rRNA. However, PCR amplification of these marker genes produces a significant amount of artificial sequences, often referred to as chimeras. Different algorithms have been developed to remove these chimeras, but efforts to combine different methodologies are limited. Therefore, two machine learning classifiers (reference-based and de novo CATCh) were developed by integrating the output of existing chimera detection tools into a new, more powerful method. When comparing our classifiers with existing tools in either the reference-based or de novo mode, a higher performance of our ensemble method was observed on a wide range of sequencing data, including simulated, 454 pyrosequencing, and Illumina MiSeq data sets. Since our algorithm combines the advantages of different individual chimera detection tools, our approach produces more robust results when challenged with chimeric sequences having a low parent divergence, short length of the chimeric range, and various numbers of parents. Additionally, it could be shown that integrating CATCh in the preprocessing pipeline has a beneficial effect on the quality of the clustering in operational taxonomic units. PMID:25527546

  15. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.

    PubMed

    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V

    2015-02-25

    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences. PMID:25523504

  16. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing.

    PubMed

    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan

    2016-01-01

    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  17. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing

    PubMed Central

    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan

    2016-01-01

    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  18. Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

    NASA Technical Reports Server (NTRS)

    Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.

    1995-01-01

    Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

  19. Sequence variation within the rRNA gene loci of 12 Drosophila species

    PubMed Central

    Stage, Deborah E.; Eickbush, Thomas H.

    2007-01-01

    Concerted evolution maintains at near identity the hundreds of tandemly arrayed ribosomal RNA (rRNA) genes and their spacers present in any eukaryote. Few comprehensive attempts have been made to directly measure the identity between the rDNA units. We used the original sequencing reads (trace archives) available through the whole-genome shotgun sequencing projects of 12 Drosophila species to locate the sequence variants within the 7.8–8.2 kb transcribed portions of the rDNA units. Three to 18 variants were identified in >3% of the total rDNA units from 11 species. Species where the rDNA units are present on multiple chromosomes exhibited only minor increases in sequence variation. Variants were 10–20 times more abundant in the noncoding compared with the coding regions of the rDNA unit. Within the coding regions, variants were three to eight times more abundant in the expansion compared with the conserved core regions. The distribution of variants was largely consistent with models of concerted evolution in which there is uniform recombination across the transcribed portion of the unit with the frequency of standing variants dependent upon the selection pressure to preserve that sequence. However, the 28S gene was found to contain fewer variants than the 18S gene despite evolving 2.5-fold faster. We postulate that the fewer variants in the 28S gene is due to localized gene conversion or DNA repair triggered by the activity of retrotransposable elements that are specialized for insertion into the 28S genes of these species. PMID:17989256

  20. EzEditor: a versatile sequence alignment editor for both rRNA- and protein-coding genes.

    PubMed

    Jeon, Yoon-Seong; Lee, Kihyun; Park, Sang-Cheol; Kim, Bong-Soo; Cho, Yong-Joon; Ha, Sung-Min; Chun, Jongsik

    2014-02-01

    EzEditor is a Java-based molecular sequence editor allowing manipulation of both DNA and protein sequence alignments for phylogenetic analysis. It has multiple features optimized to connect initial computer-generated multiple alignment and subsequent phylogenetic analysis by providing manual editing with reference to biological information specific to the genes under consideration. It provides various functionalities for editing rRNA alignments using secondary structure information. In addition, it supports simultaneous editing of both DNA sequences and their translated protein sequences for protein-coding genes. EzEditor is, to our knowledge, the first sequence editing software designed for both rRNA- and protein-coding genes with the visualization of biologically relevant information and should be useful in molecular phylogenetic studies. EzEditor is based on Java, can be run on all major computer operating systems and is freely available from http://sw.ezbiocloud.net/ezeditor/. PMID:24425826

  1. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    PubMed

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  2. A framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates.

    PubMed

    Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin

    2015-03-01

    The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific

  3. Turkey fecal microbial community structure and functional gene diversity revealed by 16S rRNA gene and metagenomic sequences.

    PubMed

    Lu, Jingrang; Domingo, Jorge Santo

    2008-10-01

    The primary goal of this study was to better understand the microbial composition and functional genetic diversity associated with turkey fecal communities. To achieve this, 16S rRNA gene and metagenomic clone libraries were sequenced from turkey fecal samples. The analysis of 382 16S rRNA gene sequences showed that the most abundant bacteria were closely related to Lactobacillales (47%), Bacillales (31%), and Clostridiales (11%). Actinomycetales, Enterobacteriales, and Bacteroidales sequences were also identified, but represented a smaller part of the community. The analysis of 379 metagenomic sequences showed that most clones were similar to bacterial protein sequences (58%). Bacteriophage (10%) and avian viruses (3%) sequences were also represented. Of all metagenomic clones potentially encoding for bacterial proteins, most were similar to low G+C Gram-positive bacterial proteins, particularly from Lactobacillales (50%), Bacillales (11%), and Clostridiales (8%). Bioinformatic analyses suggested the presence of genes encoding for membrane proteins, lipoproteins, hydrolases, and functional genes associated with the metabolism of nitrogen and sulfur containing compounds. The results from this study further confirmed the predominance of Firmicutes in the avian gut and highlight the value of coupling 16S rRNA gene and metagenomic sequencing data analysis to study the microbial composition of avian fecal microbial communities. PMID:18974945

  4. [Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences].

    PubMed

    Petrov, N B; Vladychenskaia, N S

    2005-01-01

    Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies. PMID:16083008

  5. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences.

    PubMed

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-07-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences. PMID:26943621

  6. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences

    PubMed Central

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-01-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences. PMID:26943621

  7. Species-level identification of staphylococci isolated from bovine mastitis in Brazil using partial 16S rRNA sequencing.

    PubMed

    Lange, Carla C; Brito, Maria A V P; Reis, Daniele R L; Machado, Marco A; Guimarães, Alessandro S; Azevedo, Ana L S; Salles, Érica B; Alvim, Mariana C T; Silva, Fabiana S; Meurer, Igor R

    2015-04-17

    Staphylococci isolated from bovine milk and not classified as Staphylococcus aureus represent a heterogeneous group of microorganisms that are frequently associated with bovine mastitis. The identification of these microorganisms is important, although it is difficult and relatively costly. Genotypic methods add precision in the identification of Staphylococcus species. In the present study, partial 16S rRNA sequencing was used for the species identification of coagulase-positive and coagulase-negative staphylococci isolated from bovine mastitis. Two hundred and two (95%) of the 213 isolates were successfully identified at the species level. The assigning of an isolate to a particular species was based on ≥99% identity with 16S rRNA sequences deposited in GenBank. The identified isolates belonged to 13 different Staphylococcus species; Staphylococcus chromogenes, S. aureus and Staphylococcus epidermidis were the most frequently identified species. Eight isolates could not be assigned to a single species, as the obtained sequences showed 99% or 100% similarity to sequences from two or three different Staphylococcus species. The relatedness of these isolates with the other isolates and reference strains was visualized using a cladogram. In conclusion, 16S rRNA sequencing was an objective and accurate method for the proper identification of Staphylococcus species isolated from bovine mastitis. Additional target genes could be used in non-conclusive cases for the species-level identification of these microorganisms. PMID:25704228

  8. Phylogenetic diversity of bacterial symbionts of Solemya hosts based on comparative sequence analysis of 16S rRNA genes.

    PubMed Central

    Krueger, D M; Cavanaugh, C M

    1997-01-01

    The bacterial endosymbionts of two species of the bivalve genus Solemya from the Pacific Ocean, Solemya terraeregina and Solemya pusilla, were characterized. Prokaryotic cells resembling gram-negative bacteria were observed in the gills of both host species by transmission electron microscopy. The ultrastructure of the symbiosis in both host species is remarkably similar to that of all previously described Solemya spp. By using sequence data from 16S rRNA, the identity and evolutionary origins of the S. terraeregina and S. pusilla symbionts were also determined. Direct sequencing of PCR-amplified products from host gill DNA with primers specific for Bacteria 16S rRNA genes gave a single, unambiguous sequence for each of the two symbiont species. In situ hybridization with symbiont-specific oligonucleotide probes confirmed that these gene sequences belong to the bacteria residing in the hosts gills. Phylogenetic analyses of the 16S rRNA gene sequences by both distance and parsimony methods identify the S. terraeregina and S. pusilla symbionts as members of the gamma subdivision of the Proteobacteria. In contrast to symbionts of other bivalve families, which appear to be monophyletic, the S. terraeregina and S. pusilla symbionts share a more recent common ancestry with bacteria associating endosymbiotically with bivalves of the superfamily Lucinacea than with other Solemya symbionts (host species S. velum, S. occidentalis, and S. reidi). Overall, the 16S rRNA gene sequence data suggest that the symbionts of Solemya hosts represent at least two distinct bacterial lineages within the gamma-Proteobacteria. While it is increasingly clear that all extant species of Solemya live in symbiosis with specific bacteria, the associations appear to have multiple evolutionary origins. PMID:8979342

  9. Microbial Dark Matter: Unusual intervening sequences in 16S rRNA genes of candidate phyla from the deep subsurface

    SciTech Connect

    Jarett, Jessica; Stepanauskas, Ramunas; Kieft, Thomas; Onstott, Tullis; Woyke, Tanja

    2014-03-17

    The Microbial Dark Matter project has sequenced genomes from over 200 single cells from candidate phyla, greatly expanding our knowledge of the ecology, inferred metabolism, and evolution of these widely distributed, yet poorly understood lineages. The second phase of this project aims to sequence an additional 800 single cells from known as well as potentially novel candidate phyla derived from a variety of environments. In order to identify whole genome amplified single cells, screening based on phylogenetic placement of 16S rRNA gene sequences is being conducted. Briefly, derived 16S rRNA gene sequences are aligned to a custom version of the Greengenes reference database and added to a reference tree in ARB using parsimony. In multiple samples from deep subsurface habitats but not from other habitats, a large number of sequences proved difficult to align and therefore to place in the tree. Based on comparisons to reference sequences and structural alignments using SSU-ALIGN, many of these ?difficult? sequences appear to originate from candidate phyla, and contain intervening sequences (IVSs) within the 16S rRNA genes. These IVSs are short (39 - 79 nt) and do not appear to be self-splicing or to contain open reading frames. IVSs were found in the loop regions of stem-loop structures in several different taxonomic groups. Phylogenetic placement of sequences is strongly affected by IVSs; two out of three groups investigated were classified as different phyla after their removal. Based on data from samples screened in this project, IVSs appear to be more common in microbes occurring in deep subsurface habitats, although the reasons for this remain elusive.

  10. Sequence requirements for maturation of the 5' terminus of human 18 S rRNA in vitro.

    PubMed

    Yu, Y T; Nilsen, T W

    1992-05-01

    Creation of the mature 5' terminus of human 18 S rRNA in vitro occurs via a two-step processing reaction. In the first step, an endonucleolytic activity found in HeLa cell nucleolar extract cleaves an rRNA precursor spanning the external transcribed spacer-18 S boundary at a position 3 bases upstream from the mature 18 S terminus leaving 2',3'-cyclic phosphate, 5' hydroxyl termini. In the second step, a nucleolytic activity(s) found in HeLa cell cytoplasmic extract removes the 3 extra bases and creates the authentic 5'-phosphorylated terminus of 18 S rRNA. Here we have examined the sequence requirements for the trimming reaction. The trimming activity(s), in addition to requiring a 5' hydroxyl terminus, prefers the naturally occurring adenosine as the 5'-terminal base. By a combination of deletion, site-directed mutagenesis, and chemical modification interference approaches we have also identified a region of 18 S rRNA spanning bases +6 to +25 (with respect to the mature 5' end) which comprises a critical recognition sequence for the trimming activity(s). PMID:1577760

  11. 4.5S ribonucleic acid, a novel ribosome component in the chloroplasts of flowering plants.

    PubMed Central

    Bowman, C M; Dyer, T A

    1979-01-01

    A species of low-molecular-weight ribosomal RNA, referred to as '4.5S rRNA', was found in addition to 5S rRNA in the large subunit of chloroplast ribosomes of a wide range of flowering plants. It was shown by sequence analysis that several variants of this RNA may occur in a plant. Furthermore, although in most flowering plants the predominant variant contains about 100 nucleotides, in the broad bean it has less than 80. It seems, therefore, to be much more diverse in size and sequence than the other ribosomal RNA species. Like 5S rRNA , it does not contain modified nucleotides and it is also unusual in having an unphosphorylated 5'-end. It is apparently neither a homologue of cytosol 5.8S rRNA nor a fragment of 23S rRNA. Images Fig. 1. Fig. 3. Fig. 4. PMID:540035

  12. Molecular characterization of Sarcocystis species from Polish roe deer based on ssu rRNA and cox1 sequence analysis.

    PubMed

    Kolenda, Rafał; Ugorski, Maciej; Bednarski, Michał

    2014-08-01

    Sarcocysts from four Polish roe deer were collected and examined by light microscopy, small subunit ribosomal RNA (ssu rRNA), and the subunit I of cytochrome oxidase (cox1) sequence analysis. This resulted in identification of Sarcocystis gracilis, Sarcocystis oviformis, and Sarcocystis silva. However, we were unable to detect Sarcocystis capreolicanis, the fourth Sarcocystis species found previously in Norwegian roe deer. Polish sarcocysts isolated from various tissues differed in terms of their shape and size and were larger than the respective Norwegian isolates. Analysis of ssu rRNA gene revealed the lack of differences between Sarcocystis isolates belonging to one species and a very low degree of genetic diversity between Polish and Norwegian sarcocysts, ranging from 0.1% for Sarcocystis gracilis and Sarcocystis oviformis to 0.44% for Sarcocystis silva. Contrary to the results of the ssu rRNA analysis, small intraspecies differences in cox1 sequences were found among Polish Sarcocystis gracilis and Sarcocystis silva isolates. The comparison of Polish and Norwegian cox1 sequences representing the same Sarcocystis species revealed similar degree of sequence identity, namely 99.72% for Sarcocystis gracilis, 98.76% for Sarcocystis silva, and 99.85% for Sarcocystis oviformis. Phylogenetic reconstruction and genetic population analyses showed an unexpected high degree of identity between Polish and Norwegian isolates. Moreover, cox1 gene sequences turned out to be more accurate than ssu rRNA when used to reveal phylogenetic relationships among closely related species. The results of our study revealed that the same Sarcocystis species isolated from the same hosts living in different geographic regions show a very high level of genetic similarity. PMID:24948101

  13. Analysis of the cystic fibrosis lung microbiota via serial Illumina sequencing of bacterial 16S rRNA hypervariable regions.

    PubMed

    Maughan, Heather; Wang, Pauline W; Diaz Caballero, Julio; Fung, Pauline; Gong, Yunchen; Donaldson, Sylva L; Yuan, Lijie; Keshavjee, Shaf; Zhang, Yu; Yau, Yvonne C W; Waters, Valerie J; Tullis, D Elizabeth; Hwang, David M; Guttman, David S

    2012-01-01

    The characterization of bacterial communities using DNA sequencing has revolutionized our ability to study microbes in nature and discover the ways in which microbial communities affect ecosystem functioning and human health. Here we describe Serial Illumina Sequencing (SI-Seq): a method for deep sequencing of the bacterial 16S rRNA gene using next-generation sequencing technology. SI-Seq serially sequences portions of the V5, V6 and V7 hypervariable regions from barcoded 16S rRNA amplicons using an Illumina short-read genome analyzer. SI-Seq obtains taxonomic resolution similar to 454 pyrosequencing for a fraction of the cost, and can produce hundreds of thousands of reads per sample even with very high multiplexing. We validated SI-Seq using single species and mock community controls, and via a comparison to cystic fibrosis lung microbiota sequenced using 454 FLX Titanium. Our control runs show that SI-Seq has a dynamic range of at least five orders of magnitude, can classify >96% of sequences to the genus level, and performs just as well as 454 and paired-end Illumina methods in estimation of standard microbial ecology diversity measurements. We illustrate the utility of SI-Seq in a pilot sample of central airway secretion samples from cystic fibrosis patients. PMID:23056217

  14. Comparative Studies of 5S rDNA Profiles and Cyt b Sequences in two Onychostoma Species (Cyprinidae)

    PubMed Central

    Han, Chiao-Chuan; Yen, Tsair-Bor; Chen, Nian-Cih; Tseng, Mei-Chen

    2015-01-01

    Onychostoma barbatulum and O. alticorpus, two primarily freshwater cyprinid fish, have similar morphological characters and partially overlapping ecological habitats. In order to explore the genetic differences between these two species, chromosomal characteristics and genetic variations were examined by fluorescence in situ hybridization (FISH) of 5S rDNA and cytochrome (Cyt) b gene analysis. Ten specimens of O. barbatulum and O. alticorpus were collected from the Nanzihsian Stream in southern Taiwan. FISH revealed that the 5S rDNA loci of O. barbatulum and O. alticorpus were found at a pericentromeric and subtelomeric position, respectively, in a pair of submetacentric chromosomes. Cyt b genes were amplified and sequenced from five individuals of each species. Intraspecific genetic distances ranged from 0.001–0.004 in O. barbatulum and from 0.001–0.006 in O. alticorpus. Genetic distances between these two species ranged from 0.132–0.142. The phylogenetic tree showed these two species are not sister species. In conclusion, FISH cytogenetic information and Cyt b gene analyses indicated that these two species have significantly different genetic characteristics; nevertheless, their morphological similarities may be due to environmental adaptation. PMID:26690426

  15. Sequence Variation in the Small-Subunit rRNA Gene of Plasmodium malariae and Prevalence of Isolates with the Variant Sequence in Sichuan, China

    PubMed Central

    Liu, Qing; Zhu, Shenghua; Mizuno, Sahoko; Kimura, Masatsugu; Liu, Peina; Isomura, Shin; Wang, Xingzhen; Kawamoto, Fumihiko

    1998-01-01

    By two PCR-based diagnostic methods, Plasmodium malariae infections have been rediscovered at two foci in the Sichuan province of China, a region where no cases of P. malariae have been officially reported for the last 2 decades. In addition, a variant form of P. malariae which has a deletion of 19 bp and seven substitutions of base pairs in the target sequence of the small-subunit (SSU) rRNA gene was detected with high frequency. Alignment analysis of Plasmodium sp. SSU rRNA gene sequences revealed that the 5′ region of the variant sequence is identical to that of P. vivax or P. knowlesi and its 3′ region is identical to that of P. malariae. The same sequence variations were also found in P. malariae isolates collected along the Thai-Myanmar border, suggesting a wide distribution of this variant form from southern China to Southeast Asia. PMID:9774600

  16. Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces

    PubMed Central

    Orsi, William; Biddle, Jennifer F.; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface. PMID:23418556

  17. Sulfur-oxidizing bacterial endosymbionts: analysis of phylogeny and specificity by 16S rRNA sequences.

    PubMed

    Distel, D L; Lane, D J; Olsen, G J; Giovannoni, S J; Pace, B; Pace, N R; Stahl, D A; Felbeck, H

    1988-06-01

    The 16S rRNAs from the bacterial endosymbionts of six marine invertebrates from diverse environments were isolated and partially sequenced. These symbionts included the trophosome symbiont of Riftia pachyptila, the gill symbionts of Calyptogena magnifica and Bathymodiolus thermophilus (from deep-sea hydrothermal vents), and the gill symbionts of Lucinoma annulata, Lucinoma aequizonata, and Codakia orbicularis (from relatively shallow coastal environments). Only one type of bacterial 16S rRNA was detected in each symbiosis. Using nucleotide sequence comparisons, we showed that each of the bacterial symbionts is distinct from the others and that all fall within a limited domain of the gamma subdivision of the purple bacteria (one of the major eubacterial divisions previously defined by 16S rRNA analysis [C. R. Woese, Microbiol. Rev. 51: 221-271, 1987]). Two host specimens were analyzed in five of the symbioses; in each case, identical bacterial rRNA sequences were obtained from conspecific host specimens. These data indicate that the symbioses examined are species specific and that the symbiont species are unique to and invariant within their respective host species. PMID:3286609

  18. [Antimicrobial susceptibilities of clinical Nocardia isolates identified by 16S rRNA gene sequence analysis].

    PubMed

    Uner, Mahmut Celalettin; Hasçelik, Gülşen; Müştak, Hamit Kaan

    2016-01-01

    Nocardia species are ubiquitous in the environment and responsible for various human infections such as pulmonary, cutaneous, central nervous system and disseminated nocardiosis. Since the clinical pictures and antimicrobial susceptibilities of Nocardia species exhibit variability, susceptibility testing is recommended for every Nocardia isolates. The aims of this study was to determine the antimicrobial susceptibilities of Nocardia clinical isolates and to compare the results of broth microdilution and disc diffusion susceptibility tests. A total of 45 clinical Nocardia isolates (isolated from 17 respiratory tract, 8 brain abscess, 7 pus, 3 skin, 3 conjunctiva, 2 blood, 2 tissue, 2 pleural fluid and 1 cerebrospinal fluid samples) were identified by using conventional methods and 16S rRNA gene sequence analysis. Susceptibility testing was performed for amikacin, ciprofloxacin, ceftriaxone, linezolid and trimethoprim-sulfamethoxazole (TMP-SMX) by broth microdilution method according to the Clinical and Laboratory Standards Institute (CLSI) criteria recommended in 2011 approved standard (M24-A2) and disk diffusion method used as an alternative comparative susceptibility testing method. Among the 45 Nocardia strains, N.cyriacigeorgica (n: 26, 57.8%) was the most common species, followed by N.farcinica (n: 12, 26.7%), N.otitiscaviarum (n: 4, 8.9%), N.asteroides (n: 1, 2.2%), N.neocaledoniensis (n: 1, 2.2%) and N.abscessus (n: 1, 2.2%). Amikacin and linezolid were the only two antimicrobials to which all isolates were susceptible for both broth microdilution and disk diffusion tests. In broth microdilution test, resistance rates to TMP-SMX, ceftriaxone and ciprofloxacin were found as 15.6%, 37.8% and 84.4% respectively, whereas in the disk diffusion test, the highest resistance rate was observed against ciprofloxacin (n: 33, 73.3%), followed by TMP-SMX (n: 22, 48.9%) and ceftriaxone (n: 15, 33.3%). In both of these tests, N.cyriacigeorgica was the species with the

  19. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency.

    PubMed

    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa

    2016-05-01

    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2'-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2'-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA fromPyrococcus furiosus We find that the methylation efficacy at sites D and D' differ substantially, with substrate D' turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D' is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D' sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5'-end of the product. PMID:26925607

  20. Metagenomic and near full-length 16S rRNA sequence data in support of the phylogenetic analysis of the rumen bacterial community in steers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

  1. Analysis of 18S rRNA gene sequences suggests significant molecular differences between Macrodasyida and Chaetonotida (Gastrotricha).

    PubMed

    Manylov, Oleg G; Vladychenskaya, Natalia S; Milyutina, Irina A; Kedrova, Olga S; Korokhov, Nikolai P; Dvoryanchikov, Gennady A; Aleshin, Vladimir V; Petrov, Nikolai B

    2004-03-01

    Partial 18S rRNA gene sequences of four macrodasyid and one chaetonotid gastrotrichs were obtained and compared with the available sequences of other gastrotrich species and representatives of various metazoan phyla. Contrary to the earlier molecular data, the gastrotrich sequences did not comprise a monophyletic group but formed two distinct clades, corresponding to the Macrodasyida and Chaetonotida, with the basal position occupied by the sequences of Tetranchyroderma sp. and Xenotrichula sp., respectively. Depending on the taxon sampling and methods of analysis, the two clades were separated by various combinations of clades Rotifera, Gnathostomulida, and Platyhelminthes, and never formed a clade with Nematoda. Thus, monophyly of the Gastrotricha is not confirmed by analysis of the presently available molecular data. PMID:15012964

  2. Rapid Sanger Sequencing of the 16S rRNA Gene for Identification of Some Common Pathogens

    PubMed Central

    Zhou, Guangbiao; Shi, Xiaojun; Su, Jianhui; Chen, Guanwu; Lin, Kun

    2014-01-01

    Conventional Sanger sequencing remains time-consuming and laborious. In this study, we developed a rapid improved sequencing protocol of 16S rRNA for pathogens identification by using a new combination of SYBR Green I real-time PCR and Sanger sequencing with FTA® cards. To compare the sequencing quality of this method with conventional Sanger sequencing, 12 strains, including three kinds of strains (1 reference strain and 3 clinical strains, which were previously identified by biochemical tests), which have 4 Pseudomonas aeruginosa, 4 Staphyloccocus aureus and 4 Escherichia coli, were targeted. Additionally, to validate the sequencing results and bacteria identification, expanded specimens with 90 clinical strains, also comprised of the three kinds of strains which included 30 samples respectively, were performed as just described. The results showed that although statistical differences (P<0.05) were found in sequencing quality between the two methods, their identification results were all correct and consistent. The workload, the time consumption and the cost per batch were respectively light versus heavy, 8 h versus 11 h and $420 versus $400. In the 90 clinical strains, all of the Pseudomonas aeruginosa and Staphyloccocus aureus strains were correctly identified, but only 26.7% of the Escherichia coli strains were recognized as Escherichia coli, while 33.3% as Shigella sonnei and 40% as Shigella dysenteriae. The protocol described here is a rapid, reliable, stable and convenient method for 16S rRNA sequencing, and can be used for Pseudomonas aeruginosa and Staphyloccocus aureus identification, yet it is not completely suitable for discriminating Escherichia coli and Shigella strains. PMID:24551186

  3. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  4. Sequencing and characterization of full-length sequence of 18S rRNA gene from the reniform nematode

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Variation within this gene is rare but it has been observed in few metazoan species. For the first time, we h...

  5. Pseudomonas sp. strain CA5 (a selenite-reducing bacterium) 16S rRNA gene complete sequence. National Institute of Health, National Center for Biotechnology Information, GenBank sequence. Accession FJ422810.1.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...

  6. Chimeric 16S rRNA sequence formation and detection in Sanger and 454-pyrosequenced PCR amplicons

    PubMed Central

    Haas, Brian J.; Gevers, Dirk; Earl, Ashlee M.; Feldgarden, Mike; Ward, Doyle V.; Giannoukos, Georgia; Ciulla, Dawn; Tabbaa, Diana; Highlander, Sarah K.; Sodergren, Erica; Methé, Barbara; DeSantis, Todd Z.; Petrosino, Joseph F.; Knight, Rob; Birren, Bruce W.

    2011-01-01

    Bacterial diversity among environmental samples is commonly assessed with PCR-amplified 16S rRNA gene (16S) sequences. Perceived diversity, however, can be influenced by sample preparation, primer selection, and formation of chimeric 16S amplification products. Chimeras are hybrid products between multiple parent sequences that can be falsely interpreted as novel organisms, thus inflating apparent diversity. We developed a new chimera detection tool called Chimera Slayer (CS). CS detects chimeras with greater sensitivity than previous methods, performs well on short sequences such as those produced by the 454 Life Sciences (Roche) Genome Sequencer, and can scale to large data sets. By benchmarking CS performance against sequences derived from a controlled DNA mixture of known organisms and a simulated chimera set, we provide insights into the factors that affect chimera formation such as sequence abundance, the extent of similarity between 16S genes, and PCR conditions. Chimeras were found to reproducibly form among independent amplifications and contributed to false perceptions of sample diversity and the false identification of novel taxa, with less-abundant species exhibiting chimera rates exceeding 70%. Shotgun metagenomic sequences of our mock community appear to be devoid of 16S chimeras, supporting a role for shotgun metagenomics in validating novel organisms discovered in targeted sequence surveys. PMID:21212162

  7. Massively parallel rRNA gene sequencing exacerbates the potential for biased community diversity comparisons due to variable library sizes

    SciTech Connect

    Gihring, Thomas; Green, Stefan; Schadt, Christopher Warren

    2011-01-01

    Technologies for massively parallel sequencing are revolutionizing microbial ecology and are vastly increasing the scale of ribosomal RNA (rRNA) gene studies. Although pyrosequencing has increased the breadth and depth of possible rRNA gene sampling, one drawback is that the number of reads obtained per sample is difficult to control. Pyrosequencing libraries typically vary widely in the number of sequences per sample, even within individual studies, and there is a need to revisit the behaviour of richness estimators and diversity indices with variable gene sequence library sizes. Multiple reports and review papers have demonstrated the bias in non-parametric richness estimators (e.g. Chao1 and ACE) and diversity indices when using clone libraries. However, we found that biased community comparisons are accumulating in the literature. Here we demonstrate the effects of sample size on Chao1, ACE, CatchAll, Shannon, Chao-Shen and Simpson's estimations specifically using pyrosequencing libraries. The need to equalize the number of reads being compared across libraries is reiterated, and investigators are directed towards available tools for making unbiased diversity comparisons.

  8. Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers.

    PubMed

    Myer, Phillip R; Kim, MinSeok; Freetly, Harvey C; Smith, Timothy P L

    2016-08-01

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplification primer selection, and read length, which can affect the apparent microbial community. In this study, we compared short read 16S rRNA variable regions, V1-V3, with that of near-full length 16S regions, V1-V8, using highly diverse steer rumen microbial communities, in order to examine the impact of technology selection on phylogenetic profiles. Short paired-end reads from the Illumina MiSeq platform were used to generate V1-V3 sequence, while long "circular consensus" reads from the Pacific Biosciences RSII instrument were used to generate V1-V8 data. The two platforms revealed similar microbial operational taxonomic units (OTUs), as well as similar species richness, Good's coverage, and Shannon diversity metrics. However, the V1-V8 amplified ruminal community resulted in significant increases in several orders of taxa, such as phyla Proteobacteria and Verrucomicrobia (P < 0.05). Taxonomic classification accuracy was also greater in the near full-length read. UniFrac distance matrices using jackknifed UPGMA clustering also noted differences between the communities. These data support the consensus that longer reads result in a finer phylogenetic resolution that may not be achieved by shorter 16S rRNA gene fragments. Our work on the cattle rumen bacterial community demonstrates that utilizing near full-length 16S reads may be useful in conducting a more thorough study, or for developing a niche-specific database to use in analyzing data from shorter read technologies when budgetary constraints preclude use of near-full length 16S sequencing. PMID:27282101

  9. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing

    PubMed Central

    Chan, Chia Sing; Chan, Kok-Gan; Tay, Yea-Ling; Chua, Yi-Heng; Goh, Kian Mau

    2015-01-01

    The Sungai Klah (SK) hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-m-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0–9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3-V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream) and geochemical parameters (broad temperature and pH range). It is speculated that symbiotic relationships occur between the members of the community. PMID:25798135

  10. Comparison of Traditional Phenotypic Identification Methods with Partial 5′ 16S rRNA Gene Sequencing for Species-Level Identification of Nonfermenting Gram-Negative Bacilli▿

    PubMed Central

    Cloud, Joann L.; Harmsen, Dag; Iwen, Peter C.; Dunn, James J.; Hall, Gerri; LaSala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L.; Mellmann, Alexander

    2010-01-01

    Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5′ 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB. PMID:20164273

  11. Identification and phylogeny of Arabian snakes: Comparison of venom chromatographic profiles versus 16S rRNA gene sequences.

    PubMed

    Al Asmari, Abdulrahman; Manthiri, Rajamohammed Abbas; Khan, Haseeb Ahmad

    2014-11-01

    Identification of snake species is important for various reasons including the emergency treatment of snake bite victims. We present a simple method for identification of six snake species using the gel filtration chromatographic profiles of their venoms. The venoms of Echis coloratus, Echis pyramidum, Cerastes gasperettii, Bitis arietans, Naja arabica, and Walterinnesia aegyptia were milked, lyophilized, diluted and centrifuged to separate the mucus from the venom. The clear supernatants were filtered and chromatographed on fast protein liquid chromatography (FPLC). We obtained the 16S rRNA gene sequences of the above species and performed phylogenetic analysis using the neighbor-joining method. The chromatograms of venoms from different snake species showed peculiar patterns based on the number and location of peaks. The dendrograms generated from similarity matrix based on the presence/absence of particular chromatographic peaks clearly differentiated Elapids from Viperids. Molecular cladistics using 16S rRNA gene sequences resulted in jumping clades while separating the members of these two families. These findings suggest that chromatographic profiles of snake venoms may provide a simple and reproducible chemical fingerprinting method for quick identification of snake species. However, the validation of this methodology requires further studies on large number of specimens from within and across species. PMID:25313278

  12. Large-subunit rRNA sequence of the chytridiomycete Blastocladiella emersonii, and implications for the evolution of zoosporic fungi.

    PubMed

    Van der Auwera, G; De Wachter, R

    1996-11-01

    The 5.8S and 28S ribosomal RNA sequences of the chytridiomycete Blastocladiella emersonii were determined. These data were combined with 18S rRNA sequences in order to carry out a phylogenetic analysis based on distance matrix, parsimony, and maximum likelihood methods. The new data confirmed that chytridiomycetes are true fungi and not protists, as was already suggested on the basis of biochemical, ultrastructural, and 18S rRNA data. Within the fungal clade, B. emersonii formed the first line of divergence. The position of the fungi within the eukaryotic "crown" taxa was also reassessed, and the alveolate-stramenopile cluster appeared as their sister group. The stramenopiles also comprise a number of zoosporic fungi, which resemble chytridiomycetes in so many respects, e.g., production of motile spores, thallus morphology, and absorptive nutrition, that they have been classified together with them in the past. This suggests that the possible common ancestor of the fungi, stramenopiles, and alveolates may have been a zoosporic fungus, which would mean that zoosporic fungi are paraphyletic instead of polyphyletic as previously suggested. PMID:8875862

  13. Isolation and analysis of (Gp)nXp sequences of rat liver 5S RNA by means of restricted ribonuclease T2 hydrolysis

    PubMed Central

    Willems, R.; Avdonina, T.; Lund, A.; Kisselev, L.L.

    1974-01-01

    Essentual difficulties arise when base number in oligoguanylic blocks and location of these blocks along the polynucleotide chain need to be determined in the course of determination of the nucleotide sequences in ribonucleic acids. To overcome this difficulty it is suggested to take advantage of a recently discovered resistance of phosphodiester bond between kethoxalated G and its 3′-neighbour against T2 RNase hydrolysis 1,2. The approach is illustrated by analysis of 5S RNA from rat liver. Sequences of general formula (Gp)nXp were isolated from T2 RNase hydrolysate of 5 S RNA rapidly and quantitatively. The information obtained greatly facilitates the whole procedure of sequencing. It is expected that the method proposed would be effective for analysis of 5 S and 4 S RNA and for highmolecular weight fragments of ribosomal and viral RNAs. PMID:4453523

  14. Intrageneric relationships of Enterococci as determined by reverse transcriptase sequencing of small-subunit rRNA.

    PubMed

    Williams, A M; Rodrigues, U M; Collins, M D

    1991-01-01

    The 16S ribosomal ribonucleic acid (rRNA) sequences of eleven Enterococcus species were determined by reverse transcription in an attempt to clarify their intrageneric relationships. Comparative analysis of the sequence data revealed the presence of several species groups within the genus. The species E. avium, E. malodoratus, E. pseudoavium and E. raffinosus formed a distinct group as did E. durans, E. faecium, E. hirae and E. mundtii and the pair of species E. casseliflavus and E. gallinarum. Of the remaining species, E. cecorum, E. columbae, E. faecalis and E. saccharolyticus formed distinct lines of descent within the genus, whereas E. solitarius displayed a closer affinity with Tetragenococcus halophilus than with other enterococcal species. PMID:1712504

  15. Next-Generation Sequencing of the Bacterial 16S rRNA Gene for Forensic Soil Comparison: A Feasibility Study.

    PubMed

    Jesmok, Ellen M; Hopkins, James M; Foran, David R

    2016-05-01

    Soil has the potential to be valuable forensic evidence linking a person or item to a crime scene; however, there is no established soil individualization technique. In this study, the utility of soil bacterial profiling via next-generation sequencing of the 16S rRNA gene was examined for associating soils with their place of origin. Soil samples were collected from ten diverse and nine similar habitats over time, and within three habitats at various horizontal and vertical distances. Bacterial profiles were analyzed using four methods: abundance charts and nonmetric multidimensional scaling provided simplification and visualization of the massive datasets, potentially aiding in expert testimony, while analysis of similarities and k-nearest neighbor offered objective statistical comparisons. The vast majority of soil bacterial profiles (95.4%) were classified to their location of origin, highlighting the potential of bacterial profiling via next-generation sequencing for the forensic analysis of soil samples. PMID:27122396

  16. Comparative sequence analyses of the genes coding for 16S rRNA of Lactobacillus casei-related taxa.

    PubMed

    Mori, K; Yamazaki, K; Ishiyama, T; Katsumata, M; Kobayashi, K; Kawai, Y; Inoue, N; Shinano, H

    1997-01-01

    The primary structures of the 16S rRNA genes of the type strains of Lactobacillus casei and related taxa were determined by PCR DNA-sequencing methods. The sequences of Lactobacillus casei, Lactobacillus zeae, Lactobacillus paracasei, and Lactobacillus rhamnosus were different. The Knuc values ranged from 0.0040 to 0.0126. On the basis of the Knuc values and the levels of DNA-DNA relatedness among the strains of these species, the L. casei-related taxa should be classified in the following three species: L. zeae, which includes the type strains of L. zeae and L. casei; a species that includes the strains of L. paracasei and L. casei ATCC 334; and L. rhamnosus. PMID:8995801

  17. Bacterial diversity in Adirondack mountain lakes as revealed by 16S rRNA gene sequences.

    PubMed Central

    Hiorns, W D; Methé, B A; Nierzwicki-Bauer, S A; Zehr, J P

    1997-01-01

    Bacterial communities of seven lakes in the Adirondack Mountains of New York State were characterized by amplification and sequencing of 16S ribosomal DNA. Analysis of over 100 partial sequences revealed a diverse collection of lineages, largely of the class Proteobacteria (19% alpha subdivision, 31% beta subdivision, and 9% gamma subdivision), the phylum Cytophaga-Flavobacteria-Bacteroides (15%), and the order Actinomycetales (18%). Additionally, a number of the sequences were similar to those of the order Verrucomicrobiales. However, few of the sequence types are closely related to those of characterized species. The relative contributions of the groups of sequences differed among the lakes, suggesting that bacterial population structure varies and that it may be possible to relate aquatic bacterial community structure to water chemistry. PMID:9212443

  18. Comparison of Genotypic and Phylogenetic Relationships of Environmental Enterococcus Isolates by BOX-PCR Typing and 16S rRNA Gene Sequencing

    PubMed Central

    Nayak, Bina S.; Badgley, Brian; Harwood, Valerie J.

    2011-01-01

    Environmental Enterococcus spp. were compared by BOX-PCR genotyping and 16S rRNA gene sequencing to clarify the predictive relationship of BOX-PCR fingerprints to species designation. BOX-PCR and 16S rRNA gene relationships agreed for 77% of strains. BOX-PCR provided superior intraspecies discrimination but incorrectly identified some strains to the species level and divided some species into multiple groups. PMID:21622792

  19. Detection of WWE2-related Lentisphaerae by 16S rRNA gene sequencing and fluorescence in situ hybridization in landfill leachate.

    PubMed

    Limam, Rim Driss; Bouchez, Théodore; Chouari, Rakia; Li, Tianlun; Barkallah, Insaf; Landoulsi, Ahmed; Sghir, Abdelghani

    2010-10-01

    We collected samples of anaerobic landfill leachate from municipal solid waste landfill (Vert-le-Grand, France) and constructed 16S rRNA clone libraries using primers targeting Planctomycetes and relatives (Pla46F and 1390R). Analyses of 16S rRNA gene sequences resulted in the abundant representation of WWE2-related Lentisphaerae, members of the phylum Lentisphaerae, in the clone library (98% of the retrieved sequences). Although the sequences that are phylogenetically affiliated with the cultured isolate Victivallis vadensis were identified (WWE2 subgroup II), the majority of the sequences were affiliated with an uncultured Lentisphaerae lineage (WWE2 subgroup I). We designed oligonucleotides probes targeting the specific 16S rRNA gene regions of those 2 subgroups. Fluorescence in situ hybridization confirmed the abundance of the uncultivated WWE2 subgroup I in our leachate samples. PMID:20962908

  20. The sequence of Methanospirillum hungatei 23S rRNA confirms the specific relationship between the extreme halophiles and the Methanomicrobiales

    NASA Technical Reports Server (NTRS)

    Burggraf, S.; Ching, A.; Stetter, K. O.; Woese, C. R.

    1991-01-01

    We have determined the sequence of the 23S rRNA from the methanogenic archaeon Methanospirillum hungatei. This is the first such sequence from a member of the Methanomicrobiales. Moreover, it brings additional evidence to bear on the possible specific relationship between this particular group of methanogens and the extreme halophiles. Such evidence is critical in that several new (and relatively untested) methods of phylogenetic inference have lead to the controversial conclusion that the extreme halophiles are either not related to the archaea, or are only peripherally so. Analysis of the Methanospirillum hungatei 23S rRNA sequence shows the Methanomicrobiales are indeed a sister group of the extreme halophiles, further strengthening the conclusions reached from analysis of 16S rRNA sequences.

  1. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    PubMed

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. PMID:24643007

  2. Molecular confirmation of the genomic constitution of Douglasdeweya (Triticeae: Poaceae): demonstration of the utility of the 5S rDNA sequence as a tool for haplome identification.

    PubMed

    Baum, Bernard R; Johnson, Douglas A

    2008-06-01

    A new genus Douglasdeweya containing the two species, Douglasdeweya deweyi and D. wangii was published in 2005 by Yen et al. based upon the results of cytogenetical and morphological findings. The genome constitution of Douglasdeweya-PPStSt-allowed its segregation from the genus Pseudoroegneria which contains the StSt or StStStSt genomes. Our previous work had demonstrated the utility of using 5S rDNA units, especially the non-transcribed spacer sequence variation, for the resolution of genomes (haplomes) previously established by cytology. Here, we show that sequence analysis of the 5S DNA units from these species strongly supports the proposed species relationships of Yen et al. (Can J Bot 83:413-419, 2005), i.e., the PP genome from Agropyron and the StSt genome from Pseudoroegneria. Analysis of the 5S rDNA units constitutes a powerful tool for genomic research especially in the Triticeae. PMID:18421479

  3. Prevalence of Corynebacterial 16S rRNA Sequences in Patients with Bacterial and “Nonbacterial” Prostatitis

    PubMed Central

    Tanner, Michael A.; Shoskes, Daniel; Shahed, Asha; Pace, Norman R.

    1999-01-01

    The etiology of chronic prostatitis syndromes in men is controversial, particularly when positive cultures for established uropathogens are lacking. Although identification of bacteria in prostatic fluid has relied on cultivation and microscopy, most microorganisms in the environment, including some human pathogens, are resistant to cultivation. We report here on an rRNA-based molecular phylogenetic approach to the identification of bacteria in prostate fluid from prostatitis patients. Positive bacterial signals were seen for 65% of patients with chronic prostatitis overall. Seven of 11 patients with bacterial signals but none of 6 patients without bacterial signals were cured with antibiotic-based therapy. Results indicate the occurrence in the prostate fluid of a wide spectrum of bacterial species representing several genera. Most rRNA genes were closely related to those of species belonging to the genera Corynebacterium, Staphylococcus, Peptostreptococcus, Streptococcus, and Escherichia. Unexpectedly, a wide diversity of Corynebacterium species was found in high proportion compared to the proportions of other bacterial species found. A subset of these 16S rRNA sequences represent those of undescribed species on the basis of their positions in phylogenetic trees. These uncharacterized organisms were not detected in control samples, suggesting that the organisms have a role in the disease or are the consequence of the disease. These studies show that microorganisms associated with prostatitis generally occur as complex microbial communities that differ between patients. The results also indicate that microbial communities distinct from those associated with prostatitis may occur at low levels in normal prostatic fluid. PMID:10325338

  4. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences

    PubMed Central

    Langille, Morgan G. I.; Zaneveld, Jesse; Caporaso, J. Gregory; McDonald, Daniel; Knights, Dan; Reyes, Joshua A.; Clemente, Jose C.; Burkepile, Deron E.; Vega Thurber, Rebecca L.; Knight, Rob; Beiko, Robert G.; Huttenhower, Curtis

    2013-01-01

    Profiling phylogenetic marker genes, such as the 16S rRNA gene, is a key tool for studies of microbial communities but does not provide direct evidence of a community’s functional capabilities. Here we describe PICRUSt (Phylogenetic Investigation of Communities by Reconstruction of Unobserved States), a computational approach to predict the functional composition of a metagenome using marker gene data and a database of reference genomes. PICRUSt uses an extended ancestral-state reconstruction algorithm to predict which gene families are present and then combines gene families to estimate the composite metagenome. Using 16S information, PICRUSt recaptures key findings from the Human Microbiome Project and accurately predicts the abundance of gene families in host-associated and environmental communities, with quantifiable uncertainty. Our results demonstrate that phylogeny and function are sufficiently linked that this ‘predictive metagenomic’ approach should provide useful insights into the thousands of uncultivated microbial communities for which only marker gene surveys are currently available. PMID:23975157

  5. Identification and characterization of alkaline protease producing Bacillus firmus species EMBS023 by 16S rRNA gene sequencing.

    PubMed

    Wishard, Rohan; wishard, Rohan; Jaiswal, Mahak; Parveda, Maheshwari; Amareshwari, P; Bhadoriya, Sneha Singh; Rathore, Pragya; Yadav, Mukesh; Nayarisseri, Anuraj; Nair, Achuthsankar S

    2014-12-01

    Probiotic microorganisms are those which exert a positive exect on the growth of the host, when administered as a dietary mixture in an adequate amount. They form the best alternative to the use of antibiotics for controlling enteric diseases in poultry farm animals, especially in the light of the gruesome problems of development of antibiotic resistance in enteric pathogens and the contamination of poultry products with antibiotics. 16S rDNA sequencing which has gained wide popularity amongst microbiologists for the molecular characterization and identification of newly discovered isolates provides accurate identification of isolates down to the level of sub-species (strain). It's most important advantage over the traditional biochemical characterization methods are that it can provide an accurate identification of strains with atypical phenotypic characters as well. The following work is an application of 16S rRNA gene sequencing approach to identify a novel, alkaline protease producing bacteria, from poultry farm waste. The sample was collected from a local poultry farm in the Guntur district, Andhra Pradesh, India. Subsequently the sample was serially diluted and the aliquots were incubated for a suitable time period following which the suspected colony was subjected to 16S rDNA sequencing. The results showed the isolate to be a novel, high alkaline protease producing bacteria, which was named Bacillus firmus isolate EMBS023, after characterization the sequence of isolate was deposited in GenBank with accession number JN990980. PMID:25118655

  6. Bacterial diversity assessment of pristine mangrove microbial community from Dhulibhashani, Sundarbans using 16S rRNA gene tag sequencing.

    PubMed

    Basak, Pijush; Pramanik, Arnab; Sengupta, Sohan; Nag, Sudip; Bhattacharyya, Anish; Roy, Debojyoti; Pattanayak, Rudradip; Ghosh, Abhrajyoti; Chattopadhyay, Dhrubajyoti; Bhattacharyya, Maitree

    2016-03-01

    The global knowledge of microbial diversity and function in Sundarbans ecosystem is still scarce, despite global advancement in understanding the microbial diversity. In the present study, we have analyzed the diversity and distribution of bacteria in the tropical mangrove sediments of Sundarbans using 16S rRNA gene amplicon sequencing. Metagenome is comprised of 1,53,926 sequences with 108.8 Mbp data and with 55 ± 2% G + C content. Metagenome sequence data are available at NCBI under the Bioproject database with accession no. PRJNA245459. Bacterial community metagenome sequences were analyzed by MG-RAST software representing the presence of 56,547 species belonging to 44 different phyla. The taxonomic analysis revealed the dominance of phyla Proteobacteria within our dataset. Further taxonomic analysis revealed abundance of Bacteroidetes, Acidobactreia, Firmicutes, Actinobacteria, Nitrospirae, Cyanobacteria, Planctomycetes and Fusobacteria group as the predominant bacterial assemblages in this largely pristine mangrove habitat. The distribution of different community datasets obtained from four sediment samples originated from one sampling station at two different depths providing better understanding of the sediment bacterial diversity and its relationship to the ecosystem dynamics of this pristine mangrove sediment of Dhulibhashani in, Sundarbans. PMID:26981367

  7. Bacterial diversity assessment of pristine mangrove microbial community from Dhulibhashani, Sundarbans using 16S rRNA gene tag sequencing

    PubMed Central

    Basak, Pijush; Pramanik, Arnab; Sengupta, Sohan; Nag, Sudip; Bhattacharyya, Anish; Roy, Debojyoti; Pattanayak, Rudradip; Ghosh, Abhrajyoti; Chattopadhyay, Dhrubajyoti; Bhattacharyya, Maitree

    2015-01-01

    The global knowledge of microbial diversity and function in Sundarbans ecosystem is still scarce, despite global advancement in understanding the microbial diversity. In the present study, we have analyzed the diversity and distribution of bacteria in the tropical mangrove sediments of Sundarbans using 16S rRNA gene amplicon sequencing. Metagenome is comprised of 1,53,926 sequences with 108.8 Mbp data and with 55 ± 2% G + C content. Metagenome sequence data are available at NCBI under the Bioproject database with accession no. PRJNA245459. Bacterial community metagenome sequences were analyzed by MG-RAST software representing the presence of 56,547 species belonging to 44 different phyla. The taxonomic analysis revealed the dominance of phyla Proteobacteria within our dataset. Further taxonomic analysis revealed abundance of Bacteroidetes, Acidobactreia, Firmicutes, Actinobacteria, Nitrospirae, Cyanobacteria, Planctomycetes and Fusobacteria group as the predominant bacterial assemblages in this largely pristine mangrove habitat. The distribution of different community datasets obtained from four sediment samples originated from one sampling station at two different depths providing better understanding of the sediment bacterial diversity and its relationship to the ecosystem dynamics of this pristine mangrove sediment of Dhulibhashani in, Sundarbans. PMID:26981367

  8. 16S rRNA Gene Sequencing, Multilocus Sequence Analysis, and Mass Spectrometry Identification of the Proposed New Species “Clostridium neonatale”

    PubMed Central

    Bouvet, Philippe; Ferraris, Laurent; Dauphin, Brunhilde; Popoff, Michel-Robert; Butel, Marie Jose

    2014-01-01

    In 2002, an outbreak of necrotizing enterocolitis in a Canadian neonatal intensive care unit was associated with a proposed novel species of Clostridium, “Clostridium neonatale.” To date, there are no data about the isolation, identification, or clinical significance of this species. Additionally, C. neonatale has not been formally classified as a new species, rendering its identification challenging. Indeed, the C. neonatale 16S rRNA gene sequence shows high similarity to another Clostridium species involved in neonatal necrotizing enterocolitis, Clostridium butyricum. By performing a polyphasic study combining phylogenetic analysis (16S rRNA gene sequencing and multilocus sequence analysis) and phenotypic characterization with mass spectrometry, we demonstrated that C. neonatale is a new species within the Clostridium genus sensu stricto, for which we propose the name Clostridium neonatale sp. nov. Now that the status of C. neonatale has been clarified, matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) can be used for better differential identification of C. neonatale and C. butyricum clinical isolates. This is necessary to precisely define the role and clinical significance of C. neonatale, a species that may have been misidentified and underrepresented during previous neonatal necrotizing enterocolitis studies. PMID:25232167

  9. 16S rRNA gene sequencing is a non-culture method of defining the specific bacterial etiology of ventilator-associated pneumonia

    PubMed Central

    Xia, Li-Ping; Bian, Long-Yan; Xu, Min; Liu, Ying; Tang, Ai-Ling; Ye, Wen-Qin

    2015-01-01

    Ventilator-associated pneumonia (VAP) is an acquired respiratory tract infection following tracheal intubation. The most common hospital-acquired infection among patients with acute respiratory failure, VAP is associated with a mortality rate of 20-30%. The standard bacterial culture method for identifying the etiology of VAP is not specific, timely, or accurate in identifying the bacterial pathogens. This study used 16S rRNA gene metagenomic sequencing to identify and quantify the pathogenic bacteria in lower respiratory tract and oropharyngeal samples of 55 VAP patients. Sequencing of the 16S rRNA gene has served as a valuable tool in bacterial identification, particularly when other biochemical, molecular, or phenotypic identification techniques fail. In this study, 16S rRNA gene sequencing was performed in parallel with the standard bacterial culture method to identify and quantify bacteria present in the collected patient samples. Sequence analysis showed the colonization of multidrug-resistant strains in VAP secretions. Further, this method identified Prevotella, Proteus, Aquabacter, and Sphingomonas bacterial genera that were not detected by the standard bacterial culture method. Seven categories of bacteria, Streptococcus, Neisseria, Corynebacterium, Acinetobacter, Staphylococcus, Pseudomonas and Klebsiella, were detectable by both 16S rRNA gene sequencing and standard bacterial culture methods. Further, 16S rRNA gene sequencing had a significantly higher sensitivity in detecting Streptococcus and Pseudomonas when compared to standard bacterial culture. Together, these data present 16S rRNA gene sequencing as a novel VAP diagnosis tool that will further enable pathogen-specific treatment of VAP. PMID:26770469

  10. [Cloning and sequencing of 16S rRNA gene of Phytoplasma CWB1 strain associated with cactus witches' broom].

    PubMed

    Cai, H; Li, F; Kong, B; Chen, H

    2001-12-01

    A 1.5 kb DNA fragment was amplified in DNA samples extracted from Opuntia salmiana porm showed witches'-broom symptom. The result indicates the existence of phytoplasma associated with this disease and this phytoplasma was designated as CWB1. The amplified fragment was ligated to pGEM-T easy vector and then transformed into JM109 strain of E. coli. Cloned DNA fragments were verified by PCR, restriction endonuclease (EcoRI) digestion and sequence analysis. The result revealed that the 16S rRNA gene of CWB1 consists of 1489 bp and shared 99.7% homology with Faba bean phyllody which belongs to phytoplasma 16S rII-C subgroup. So we can classify this strain into phytoplasma 16S rII-C subgroup. PMID:12552825

  11. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

    PubMed

    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina

    2016-05-15

    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. PMID:27084467

  12. Sequence Characterization of Mitochondrial 12S rRNA Gene in Mouse Deer (Moschiola indica) for PCR-RFLP Based Species Identification

    PubMed Central

    Siddappa, Chandra Mohan; Saini, Mohini; Das, Asit; Sharma, Anil K.; Gupta, Praveen K.

    2013-01-01

    Mitochondrial 12S rRNA has proven to be a useful molecular marker for better conservation and management of the endangered species. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) of the mitochondrial 12S rRNA gene has proven to be a reliable and efficient tool for the identification of different Indian deer species of family cervidae. In the present study, mitochondrial 12S rRNA gene sequence of mouse deer (Moschiola indica) belonging to the family Tragulidae was characterized and analysed in silico for its use in species identification. Genomic DNA was isolated from the hair follicles and mitochondrial 12S rRNA gene was amplified using universal primers. PCR product was cloned and sequenced for the first time. The sequence of mouse deer showed 90.04, 90.08, 90.04, 91.2, 90.04, and 90.08% identities with sika deer, sambar, hog deer, musk deer, chital, and barking deer, respectively. Restriction mapping in Lasergene (DNAstar Inc., Madison, WI, USA) revealed that mouse deer mitochondrial 12S rRNA gene sequence can be differentiated from the other deer species in PCR-RFLP using RsaI, DdeI, BsrI, and BstSFI. With the help of predicted pattern, mouse deer can be identified using genomic DNA from a variety of biomaterials, thereby providing molecular aid in wildlife forensics and conservation of the species. PMID:24455258

  13. Redescriptions of three trachelocercid ciliates (Protista, Ciliophora, Karyorelictea), with notes on their phylogeny based on small subunit rRNA gene sequences.

    PubMed

    Yan, Ying; Xu, Yuan; Yi, Zhenzhen; Warren, Alan

    2013-09-01

    Three trachelocercid ciliates, Kovalevaia sulcata (Kovaleva, 1966) Foissner, 1997, Trachelocerca sagitta (Müller, 1786) Ehrenberg, 1840 and Trachelocerca ditis (Wright, 1982) Foissner, 1996, isolated from two coastal habitats at Qingdao, China, were investigated using live observation and silver impregnation methods. Data on their infraciliature and morphology are supplied. The small subunit rRNA (SSU rRNA) genes of K. sulcata and Trachelocerca sagitta were sequenced for the first time. Phylogenetic analyses based on SSU rRNA gene sequence data indicate that both organisms, and the previously sequenced Trachelocerca ditis, are located within the trachelocercid assemblage and that K. sulcata is sister to an unidentified taxon forming a clade that is basal to the core trachelocercids. PMID:23847285

  14. Identification of bovine Neospora parasites by PCR amplification and specific small-subunit rRNA sequence probe hybridization.

    PubMed

    Ho, M S; Barr, B C; Marsh, A E; Anderson, M L; Rowe, J D; Tarantal, A F; Hendrickx, A G; Sverlow, K; Dubey, J P; Conrad, P A

    1996-05-01

    Neospora is a newly recognized genus of pathogenic coccidia, closely related to Toxoplasma gondii, that can cause abortion or congenital disease in a variety of domestic animal hosts. On the basis of the small-subunit rRNA gene sequences of Neospora spp. and other apicomplexa coccidia, oligonucleotide primers COC-1 and COC-2 were used for PCR amplification of conserved sequences of approximately 300 bp in size. A Neospora-specific chemiluminescent probe hybridized to Southern blots of amplification products from Neospora DNA but not to Southern blots with amplified DNA from the other coccidian parasites tested. A Toxoplasma-specific probe whose sequence differed from that of the probe for Neospora spp. by a single base pair was used to distinguish these parasites by specific Southern blot hybridization. The PCR system detected as few as one Neospora tachyzoite in the culture medium or five tachyzoites in samples of whole blood or amniotic fluid spiked with Neospora parasites. In addition, Neospora PCR products were successfully amplified from whole blood and amniotic fluid samples of experimentally infected bovine and rhesus macaque fetuses. These results indicate that this PCR and probe hybridization system could be a valuable adjunct to serology and immunohistochemistry for the diagnosis of Neospora infections in bovine or primate fetuses. PMID:8727903

  15. 16S rRNA gene high-throughput sequencing data mining of microbial diversity and interactions.

    PubMed

    Ju, Feng; Zhang, Tong

    2015-05-01

    The ubiquitous occurrence of microorganisms gives rise to continuous public concerns regarding their pathogenicity and threats to human environment, as well as potential engineering benefits in biotechnology. The development and wide application of environmental biotechnology, for example in bioenergy production, wastewater treatment, bioremediation, and drinking water disinfection, have been bringing us with both environmental and economic benefits. Strikingly, extensive applications of microscopic and molecular techniques since 1990s have allowed engineers to peep into the microbiology in "black box" of engineered microbial communities in biotechnological processes, providing guidelines for process design and optimization. Recently, revolutionary advances in DNA sequencing technologies and rapidly decreasing costs are altering conventional ways of microbiology and ecology research, as it launches an era of next-generation sequencing (NGS). The principal research burdens are now transforming from traditional labor-intensive wet-lab experiments to dealing with analysis of huge and informative NGS data, which is computationally expensive and bioinformatically challenging. This study discusses state-of-the-art bioinformatics and statistical analyses of 16S ribosomal RNA (rRNA) gene high-throughput sequencing (HTS) data from prevalent NGS platforms to promote its applications in exploring microbial diversity of functional and pathogenic microorganisms, as well as their interactions in biotechnological processes. PMID:25808518

  16. Microbial Diversity in Deep-sea Methane Seep Sediments Presented by SSU rRNA Gene Tag Sequencing

    PubMed Central

    Nunoura, Takuro; Takaki, Yoshihiro; Kazama, Hiromi; Hirai, Miho; Ashi, Juichiro; Imachi, Hiroyuki; Takai, Ken

    2012-01-01

    Microbial community structures in methane seep sediments in the Nankai Trough were analyzed by tag-sequencing analysis for the small subunit (SSU) rRNA gene using a newly developed primer set. The dominant members of Archaea were Deep-sea Hydrothermal Vent Euryarchaeotic Group 6 (DHVEG 6), Marine Group I (MGI) and Deep Sea Archaeal Group (DSAG), and those in Bacteria were Alpha-, Gamma-, Delta- and Epsilonproteobacteria, Chloroflexi, Bacteroidetes, Planctomycetes and Acidobacteria. Diversity and richness were examined by 8,709 and 7,690 tag-sequences from sediments at 5 and 25 cm below the seafloor (cmbsf), respectively. The estimated diversity and richness in the methane seep sediment are as high as those in soil and deep-sea hydrothermal environments, although the tag-sequences obtained in this study were not sufficient to show whole microbial diversity in this analysis. We also compared the diversity and richness of each taxon/division between the sediments from the two depths, and found that the diversity and richness of some taxa/divisions varied significantly along with the depth. PMID:22510646

  17. Phylogenetic relationships of Indian caecilians (Amphibia: Gymnophiona) inferred from mitochondrial rRNA gene sequences.

    PubMed

    Wilkinson, Mark; A Sheps, Jonathan; Oommen, Oommen V; Cohen, Bernard L

    2002-06-01

    India has a diverse caecilian fauna, including representatives of three of the six currently recognized families, the Caeciliidae, Ichthyophiidae, the endemic Uraeotyphlidae, but previous molecular phylogenetic studies of caecilians have not included sequences for any Indian caecilians. Partial 12S and 16S mitochondrial gene sequences were obtained for a single representative of each of the caecilian families found in India and aligned against previously reported sequences for 13 caecilian species. The resulting alignment (16 taxa, 1200 sites, of which 288 cannot be aligned unambiguously) was analyzed using parsimony, maximum-likelihood, and distance methods. As judged by bootstrap proportions, decay indices, and leaf stabilities, well-supported relationships of the Indian caecilians are recovered from the alignment. The data (1) corroborate the hypothesis, based on morphology, that the Uraeotyphlidae and Ichthyophiidae are sister taxa, (2) recover a monophyletic Ichthyophiidae, including Indian and South East Asian representatives, and (3) place the Indian caeciliid Gegeneophis ramaswamii as the sister group of the caeciliid caecilians of the Seychelles. Rough estimates of divergence times suggest an origin of the Uraeotyphlidae and Ichthyophiidae while India was isolated from Laurasia and Africa and are most consistent with an Indian origin of these families and subsequent dispersal of ichthyophiids into South East Asia. PMID:12099794

  18. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA. PMID:21574431

  19. Analysis of the primary sequence and secondary structure of the unusually long SSU rRNA of the soil bug, Armadillidium vulgare.

    PubMed

    Choe, C P; Hancock, J M; Hwang, U W; Kim, W

    1999-12-01

    The complete nucleotide sequence of the SSU rRNA gene from the soil bug, Armadillidium vulgare (Crustacea, Isopoda), was determined. It is 3214 bp long, with a GC content of 56.3%. It is not only the longest SSU rRNA gene among Crustacea but also longer than any other SSU rRNA gene except that of the strepsipteran insect, Xenos vesparum (3316 bp). The unusually long sequence of this species is explained by the long sequences of variable regions V4 and V7, which make up more than half of the total length. RT-PCR analysis of these two regions showed that the long sequences also exist in the mature rRNA and sequence simplicity analysis revealed the presence of slippage motifs in these two regions. The putative secondary structure of the rRNA is typical for eukaryotes except for the length and shape variations of the V2, V4, V7, and V9 regions. Each of the V2, V4, and V7 regions was elongated, while the V9 region was shortened. In V2, two bulges, located between helix 8 and helix 9 and between helix 9 and helix 10, were elongated. In V4, stem E23-3 was dramatically expanded, with several small branched stems. In V7, stem 43 was branched and expanded. Comparisons with the unusually long SSU rRNAs of other organisms imply that the increase in total length of SSU rRNA is due mainly to expansion in the V4 and V7 regions. PMID:10594181

  20. Interordinal mammalian relationships: evidence for paenungulate monophyly is provided by complete mitochondrial 12S rRNA sequences.

    PubMed

    Lavergne, A; Douzery, E; Stichler, T; Catzeflis, F M; Springer, M S

    1996-10-01

    The complete mitochondrial 12S rRNA sequences of 5 placental mammals belonging to the 3 orders Sirenia, Proboscidea, and Hyracoidea are reported together with phylogenetic analyses (distance and parsimony) of a total of 51 mammalian orthologues. This 12S rRNA database now includes the 2 extant proboscideans (the African and Asiatic elephants Loxodonta africana and Elephas maximus), 2 of the 3 extant sirenian genera (the sea cow Dugong dugon and the West Indian manatee Trichechus manatus), and 2 of the 3 extant hyracoid genera (the rock and tree hyraxes Procavia capensis and Dendrohyrax dorsalis). The monophyly of the 3 orders Sirenia, Proboscidea, and Hyracoidea is supported by all kinds of analysis. There are 23 and 3 diagnostic subsitutions shared by the 2 proboscideans and the 2 hyracoids, respectively, but none by the 2 sirenians. The 2 proboscideans exhibit the fastest rates of 12S rRNA evolution among the 11 placental orders studied. Based on various taxonomic sampling methods among eutherian orders and marsupial outgroups, the most strongly supported clade in our comparisons clusters together the 3 orders Sirenia, Proboscidea, and Hyracoidea in the superorder Paenungulata. Within paenungulates, the grouping of sirenians and proboscideans within the mirorder Tethytheria is observed. This branching pattern is supported by all analyses by high bootstrap percentages (BPs) and decay indices. When only one species is selected per order or suborder, the taxonomic sampling leads to a relative variation in bootstrap support of 53% for Tethytheria (BPs ranging from 44 to 93%) and 7% for Paernungulata (92-99%). When each order or suborder is represented by two species, this relative variation decreased to 10% for Tethytheria (78-87%) and 3% for Paenungulata (96-99%). Two nearly exclusive synapomorphies for paenungulates are identified in the form of one transitional compensatory change, but none were detected for tethytherians. Such a robust and reliable resolution of

  1. Nearly complete 28S rRNA gene sequences confirm new hypotheses of sponge evolution.

    PubMed

    Thacker, Robert W; Hill, April L; Hill, Malcolm S; Redmond, Niamh E; Collins, Allen G; Morrow, Christine C; Spicer, Lori; Carmack, Cheryl A; Zappe, Megan E; Pohlmann, Deborah; Hall, Chelsea; Diaz, Maria C; Bangalore, Purushotham V

    2013-09-01

    The highly collaborative research sponsored by the NSF-funded Assembling the Porifera Tree of Life (PorToL) project is providing insights into some of the most difficult questions in metazoan systematics. Our understanding of phylogenetic relationships within the phylum Porifera has changed considerably with increased taxon sampling and data from additional molecular markers. PorToL researchers have falsified earlier phylogenetic hypotheses, discovered novel phylogenetic alliances, found phylogenetic homes for enigmatic taxa, and provided a more precise understanding of the evolution of skeletal features, secondary metabolites, body organization, and symbioses. Some of these exciting new discoveries are shared in the papers that form this issue of Integrative and Comparative Biology. Our analyses of over 300 nearly complete 28S ribosomal subunit gene sequences provide specific case studies that illustrate how our dataset confirms new hypotheses of sponge evolution. We recovered monophyletic clades for all 4 classes of sponges, as well as the 4 major clades of Demospongiae (Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha), but our phylogeny differs in several aspects from traditional classifications. In most major clades of sponges, families within orders appear to be paraphyletic. Although additional sampling of genes and taxa are needed to establish whether this pattern results from a lack of phylogenetic resolution or from a paraphyletic classification system, many of our results are congruent with those obtained from 18S ribosomal subunit gene sequences and complete mitochondrial genomes. These data provide further support for a revision of the traditional classification of sponges. PMID:23748742

  2. Nearly Complete 28S rRNA Gene Sequences Confirm New Hypotheses of Sponge Evolution

    PubMed Central

    Thacker, Robert W.; Hill, April L.; Hill, Malcolm S.; Redmond, Niamh E.; Collins, Allen G.; Morrow, Christine C.; Spicer, Lori; Carmack, Cheryl A.; Zappe, Megan E.; Pohlmann, Deborah; Hall, Chelsea; Diaz, Maria C.; Bangalore, Purushotham V.

    2013-01-01

    The highly collaborative research sponsored by the NSF-funded Assembling the Porifera Tree of Life (PorToL) project is providing insights into some of the most difficult questions in metazoan systematics. Our understanding of phylogenetic relationships within the phylum Porifera has changed considerably with increased taxon sampling and data from additional molecular markers. PorToL researchers have falsified earlier phylogenetic hypotheses, discovered novel phylogenetic alliances, found phylogenetic homes for enigmatic taxa, and provided a more precise understanding of the evolution of skeletal features, secondary metabolites, body organization, and symbioses. Some of these exciting new discoveries are shared in the papers that form this issue of Integrative and Comparative Biology. Our analyses of over 300 nearly complete 28S ribosomal subunit gene sequences provide specific case studies that illustrate how our dataset confirms new hypotheses of sponge evolution. We recovered monophyletic clades for all 4 classes of sponges, as well as the 4 major clades of Demospongiae (Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha), but our phylogeny differs in several aspects from traditional classifications. In most major clades of sponges, families within orders appear to be paraphyletic. Although additional sampling of genes and taxa are needed to establish whether this pattern results from a lack of phylogenetic resolution or from a paraphyletic classification system, many of our results are congruent with those obtained from 18S ribosomal subunit gene sequences and complete mitochondrial genomes. These data provide further support for a revision of the traditional classification of sponges. PMID:23748742

  3. [Determination of 16S rRNA gene sequence for a new ANAMMOX bacterial species].

    PubMed

    Zu, Bo; Zhang, Dai-jun; Yan, Qing

    2008-02-01

    The anaerobic ammonium oxidation (ANAMMOX) activity of the sludge was about 9.84 x 10(-4) mg x (mg x h)(-1) by measuring the simultaneous consumption of ammonium and nitrite under anoxic conditions in the batch tests. The consumption of NO2(-) -N and NH4+ -N was 1.311 for ANAMMOX bacteria. The partial 16S rDNA sequence was obtained by using molecule biology methods. Crude DNA of the total bacteria in granular sludge from EGSB reactor was extracted and purified. Then, PCR amplification by using specific primer, clone and sequence determination was performed. ANAMMOX bacterial species(anaerobic ammonium-oxidizing Planctomycete cquenviron-1) which was enrichment cultivated from EGSB reactor were the same genera with Candidatus "Anammoxoglobus propionicus" and Candidatus "Jettenia asiatica" by analyzing phylogenetic tree. The maximum identities of anaerobic ammonium-oxidizing Planctomycete cquenviron-1 with other ANAMMOX bacterial species was about 93%. The results showed that a new ANAMMOX bacterial species which was enrichment cultivated from EGSB reactor was found and anaerobic ammonium-oxidizing Planctomycete cquenviron-1 was denominated. PMID:18613522

  4. Identification of mycobacteria from animals by restriction enzyme analysis and direct DNA cycle sequencing of polymerase chain reaction-amplified 16S rRNA gene sequences.

    PubMed Central

    Hughes, M S; Skuce, R A; Beck, L A; Neill, S D

    1993-01-01

    Two methods, based on analysis of the polymerase chain reaction-amplified 16S rRNA gene by restriction enzyme analysis (REA) or direct cycle sequencing, were developed for rapid identification of mycobacteria isolated from animals and were compared to traditional phenotypic typing. BACTEC 7H12 cultures of the specimens were examined for "cording," and specific polymerase chain reaction amplification was performed to identify the presence of tubercle complex mycobacteria. Combined results of separate REAs with HhaI, MspI, MboI, and ThaI differentiated 12 of 15 mycobacterial species tested. HhaI, MspI, and ThaI restriction enzyme profiles differentiated Actinobacillus species from mycobacterial species. Mycobacterium bovis could not be differentiated from M. bovis BCG or Mycobacterium tuberculosis. Similarly, Mycobacterium avium and Mycobacterium paratuberculosis could not be distinguished from each other by REA but were differentiated by cycle sequencing. Compared with traditional typing, both methods allowed rapid and more accurate identification of acid-fast organisms recovered from 21 specimens of bovine and badger origin. Two groups of isolates were not typed definitively by either molecular method. One group of four isolates may constitute a new species phylogenetically very closely related to Mycobacterium simiae. The remaining unidentified isolates (three badger and one bovine) had identical restriction enzyme profiles and shared 100% nucleotide identify over the sequenced signature region. This nucleotide sequence most closely resembled the data base sequence of Mycobacterium senegalense. Images PMID:7508456

  5. Comparative characterization of Santolina insularis chemotypes by essential oil composition, 5S-rRNA-NTS sequencing and EcoRV RFLP-PCR.

    PubMed

    Gnavi, Giorgio; Bertea, Cinzia M; Usai, Marianna; Maffei, Massimo E

    2010-06-01

    Santolina insularis (Genn ex Fiori) Arrig. is a medicinal plant whose essential oil shows antiviral and antibacterial activities and potent and selective cytotoxic activity against the human colon carcinoma cell line. The occurrence of several chemotypes makes the taxonomic identification of S. insularis hard to achieve. GC-MS essential oil analyses of four chemotypes (SI1, SI2, SI3 and SI4) revealed the presence of different percentages of santolina triene, beta-pinene, myrcene, beta-phellandrene, artemisia ketone and cis-chrysanthemol, allowing a chemical discrimination. Single fragments of the 5S-rRNA-NTS region of approximately 150, 170, 260 and 280bp were produced by SI1, SI2, SI3 and SI4, respectively, and the sequence alignment of the 5S-rRNA spacer region flanked by the 3'-and 5'-ends of the coding region confirmed a consistent difference between chemotypes. Furthermore, a PCR-RFLP method was applied. From the identified sequences, an EcoRV site could be found in chemotypes SI1, SI2 and SI3 in the 5S-rRNA spacer regions at 81 bp position; however, this site was absent in the chemotype SI4. This study, by showing remarkable chemical variation in the terpenoid profile and consistent genomic difference in the 5S-rRNA spacer regions, identified four chemotypes of S. insularis which could be grouped into two ecotypes, based on chemical and genomic analyses. The identification of specific gene sequences of the 5S-rRNA-NTS region and of a EcoRV site identified in this work can be used for a rapid and precise identification of the plant chemo-/ecotypes, complementing the essential oil chemical analysis. PMID:20350730

  6. Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

    PubMed Central

    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2011-01-01

    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

  7. Sequencing of 16S rRNA reveals a distinct salivary microbiome signature in Behçet's disease.

    PubMed

    Coit, Patrick; Mumcu, Gonca; Ture-Ozdemir, Filiz; Unal, Ali Ugur; Alpar, Ugur; Bostanci, Nagihan; Ergun, Tulin; Direskeneli, Haner; Sawalha, Amr H

    2016-08-01

    Behçet's disease (BD) is characterized by recurrent oro-genital ulcers, mucocutaneous lesions, and serious organ involvement. We investigated the salivary microbiome in BD using high-throughput sequencing of the 16S rRNA V4 region. Stimulated saliva samples were collected from 31 BD patients and 15 healthy controls, and in 9 BD patients, a second saliva sample was collected following dental and periodontal treatment. Sequence analysis identified a total of 908 operational taxonomic units (OTUs) present across all samples. Patients had a microbial community structure that is significantly less diverse than healthy controls. The most overabundant species in BD was Haemophilus parainfluenzae, while the most depleted included Alloprevotella rava and species in the genus Leptotrichia. Periodontal treatment improved oral health indices in BD but had no short-term effect on bacterial community structure. Neither the BD-associated genetic risk locus within the HLA-B/MICA region nor being on immunosuppressive medications explained the differences between patients and controls. PMID:27283393

  8. Metagenomic and near full-length 16S rRNA sequence data in support of the phylogenetic analysis of the rumen bacterial community in steers.

    PubMed

    Myer, Phillip R; Kim, MinSeok; Freetly, Harvey C; Smith, Timothy P L

    2016-09-01

    Amplicon sequencing utilizing next-generation platforms has significantly transformed how research is conducted, specifically microbial ecology. However, primer and sequencing platform biases can confound or change the way scientists interpret these data. The Pacific Biosciences RSII instrument may also preferentially load smaller fragments, which may also be a function of PCR product exhaustion during sequencing. To further examine theses biases, data is provided from 16S rRNA rumen community analyses. Specifically, data from the relative phylum-level abundances for the ruminal bacterial community are provided to determine between-sample variability. Direct sequencing of metagenomic DNA was conducted to circumvent primer-associated biases in 16S rRNA reads and rarefaction curves were generated to demonstrate adequate coverage of each amplicon. PCR products were also subjected to reduced amplification and pooling to reduce the likelihood of PCR product exhaustion during sequencing on the Pacific Biosciences platform. The taxonomic profiles for the relative phylum-level and genus-level abundance of rumen microbiota as a function of PCR pooling for sequencing on the Pacific Biosciences RSII platform were provided. For more information, see "Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers" P.R. Myer, M. Kim, H.C. Freetly, T.P.L. Smith (2016) [1]. PMID:27508263

  9. First report on the bacterial diversity in the distal gut of dholes (Cuon alpinus) by using 16S rRNA gene sequences analysis.

    PubMed

    Chen, Lei; Zhang, Honghai; Liu, Guangshuai; Sha, Weilai

    2016-05-01

    The aim of this study was to investigate the bacterial community in the distal gut of dholes (Cuon alpinus) based on the analysis of bacterial 16S rRNA gene sequences. Fecal samples were collected from five healthy unrelated dholes captured from Qilian Mountain in Gansu province of China. The diversity of the fecal bacteria community was investigated by constructing a polymerase chain reaction (PCR)-amplified 16S rRNA gene clone library. Bacterial 16S rRNA gene was amplified by using universal bacterial primers 27F and 1492R. A total of 275 chimera-free near full length 16S rRNA gene sequences were collected, and 78 non-redundant bacteria phylotypes (operational taxonomical units, OTUs) were identified according to the 97 % sequence similarity. Forty-two OTUs (53.8 %) showed less than 98 % sequence similarity to 16S rRNA gene sequences reported previously. Phylogenetic analysis demonstrated that dhole bacterial community comprised five different phyla, with the majority of sequences being classified within the phylum Bacteroidetes (64.7 %), followed by Firmicutes (29.8 %), Fusobacteria (4.7 %),Proteobacteria (0.4 %), and Actinobacteria (0.4 %). The only order Bacteroidales in phylum Bacteroidetes was the most abundant bacterial group in the intestinal bacterial community of dholes. Firmicutes and Bacteroidetes were the two most diverse bacterial phyla with 46.2 and 44.9 % of OTUs contained, respectively. Bacteroidales and Clostridiales were the two most diverse bacterial orders that contained 44.9 and 39.7 % of OTUs, respectively. PMID:26423781

  10. Identification of Bacillus Probiotics Isolated from Soil Rhizosphere Using 16S rRNA, recA, rpoB Gene Sequencing and RAPD-PCR.

    PubMed

    Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes

    2016-03-01

    Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products. PMID:26898909

  11. DNA polymorphism in morels: complete sequences of the internal transcribed spacer of genes coding for rRNA in Morchella esculenta (yellow morel) and Morchella conica (black morel).

    PubMed Central

    Wipf, D; Munch, J C; Botton, B; Buscot, F

    1996-01-01

    The internal transcribed spacer (ITS) of the gene coding for rRNA was sequenced in both directions with the gene walking technique in a black morel (Morchella conica) and a yellow morel (M. esculenta) to elucidate the ITS length discrepancy between the two species groups (750-bp ITS in black morels and 1,150-bp ITS in yellow morels. PMID:8795250

  12. Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

    SciTech Connect

    Tremblay, Julien

    2012-06-01

    Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

  13. Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

    ScienceCinema

    Tremblay, Julien [DOE JGI

    2013-01-25

    Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

  14. Comparison between rpoB and 16S rRNA Gene Sequencing for Molecular Identification of 168 Clinical Isolates of Corynebacterium

    PubMed Central

    Khamis, Atieh; Raoult, Didier; La Scola, Bernard

    2005-01-01

    Higher proportions (91%) of 168 corynebacterial isolates were positively identified by partial rpoB gene determination than by that based on 16S rRNA gene sequences. This method is thus a simple, molecular-analysis-based method for identification of corynebacteria, but it should be used in conjunction with other tests for definitive identification. PMID:15815024

  15. Phylogeny and evolutionary genetics of Frankia strains based on 16S rRNA and nifD-K gene sequences.

    PubMed

    Mishra, Arun Kumar; Singh, Pawan Kumar; Singh, Prashant; Singh, Anumeha; Singh, Satya Shila; Srivastava, Amrita; Srivastava, Alok Kumar; Sarma, Hridip Kumar

    2015-08-01

    16S rRNA and nifD-nifK sequences were used to study the molecular phylogeny and evolutionary genetics of Frankia strains isolated from Hippöphae salicifolia D. Don growing at different altitudes (ecologically classified as riverside and hillside isolates) of the Eastern Himalayan region of North Sikkim, India. Genetic information for the small subunit rRNA (16S rRNA) revealed that the riverside Frankia isolates markedly differed from the hillside isolates suggesting that the riverside isolates are genetically compact. Further, for enhanced resolutions, the partial sequence of nifD (3' end), nifK (5' end) and nifD-K IGS region have been investigated. The sequences obtained, failed to separate riverside isolates and hillside isolates, thus suggesting a possible role of genetic transfer events either from hillside to riverside or vice versa. The evolutionary genetic analyses using evogenomic extrapolations of gene sequence data obtained from 16S rRNA and nifD-K provided differing equations with the pace of evolution being more appropriately, intermediate. Values of recombination frequency (R), nucleotide diversity per site (Pi), and DNA divergence estimates supported the existence of an intermixed zone where spatial isolations occurred in sync with the temporal estimates. J. Basic Microbiol. 2015, 54, 1-9. PMID:25871924

  16. Bacterial Community Shift in Treated Periodontitis Patients Revealed by Ion Torrent 16S rRNA Gene Amplicon Sequencing

    PubMed Central

    Jünemann, Sebastian; Prior, Karola; Szczepanowski, Rafael; Harks, Inga; Ehmke, Benjamin; Goesmann, Alexander; Stoye, Jens; Harmsen, Dag

    2012-01-01

    Periodontitis, one of the most common diseases in the world, is caused by a mixture of pathogenic bacteria and inflammatory host responses and often treated by antimicrobials as an adjunct to scaling and root planing (SRP). Our study aims to elucidate explorative and descriptive temporal shifts in bacterial communities between patients treated by SRP alone versus SRP plus antibiotics. This is the first metagenomic study using an Ion Torrent Personal Genome Machine (PGM). Eight subgingival plaque samples from four patients with chronic periodontitis, taken before and two months after intervention were analyzed. Amplicons from the V6 hypervariable region of the 16S rRNA gene were generated and sequenced each on a 314 chip. Sequencing reads were clustered into operational taxonomic units (OTUs, 3% distance), described by community metrics, and taxonomically classified. Reads ranging from 599,933 to 650,416 per sample were clustered into 1,648 to 2,659 non-singleton OTUs, respectively. Increased diversity (Shannon and Simpson) in all samples after therapy was observed regardless of the treatment type whereas richness (ACE) showed no correlation. Taxonomic analysis revealed different microbial shifts between both therapy approaches at all taxonomic levels. Most remarkably, the genera Porphyromonas, Tannerella, Treponema, and Filifactor all harboring periodontal pathogenic species were removed almost only in the group treated with SPR and antibiotics. For the species T. forsythia and P. gingivalis results were corroborated by real-time PCR analysis. In the future, hypothesis free metagenomic analysis could be the key in understanding polymicrobial diseases and be used for therapy monitoring. Therefore, as read length continues to increase and cost to decrease, rapid benchtop sequencers like the PGM might finally be used in routine diagnostic. PMID:22870235

  17. Relationships between parasitoid wasps (Hymenoptera: Braconidae: Opiinae), fruit flies (Diptera: Tephritidae) and their host plants based on 16S rRNA, 12S rRNA, and ND1 gene sequences

    NASA Astrophysics Data System (ADS)

    Ibrahim, N. J.; Md-Zain, B. M.; Yaakop, S.

    2013-11-01

    Opiinae is among the l0 largest subfamilies under the family Braconidae. Opiines species have great potential as natural enemies against fruit fly pests. Before using them as a biological control agent, construction of the phylogenetic trees could facilitate in the molecular identification of individual species and their relationships among members of the Opiines, as well as between Opiines and their host plants. Larval specimens of tephritids were collected from four crop species at five localities throughout the Peninsular Malaysia. A total of 44 specimens of opiines had successfully emerged from the hosts, fruit fly larvae. The DNA sequences of 12S and 16S rRNA were obtained for the braconids while the mitochondrial ND1 sequences were obtained for the tephritids species through polymerase chain reaction. Maximum Parsimony and Bayesian trees were constructed by using PAUP 4.0b10 and MrBayes 3.1.2 to identify the relationships among the taxa. This study illustrates the phylogenetic relationships among parasitoid opiines collected and reared from parasitized fruit flies. The phylogenetic trees constructed based on the mitochondrial 12S and 16S rRNA sequences exhibited similar topology and sequence divergence. The opiines were divided into several clades and subclades according to the genus and species. Each clade also was supported by the similar host plants with high support values. However, their pests were not specific, except for Bactrocera cucurbitae. This study has reconfirmed the associations between Opiinae, tephritids, and host plants based on molecular data.

  18. Comparison of bacterial communities in the Solimões and Negro River tributaries of the Amazon River based on small subunit rRNA gene sequences.

    PubMed

    Peixoto, J C C; Leomil, L; Souza, J V; Peixoto, F B S; Astolfi-Filho, S

    2011-01-01

    The microbiota of the Amazon River basin has been little studied. We compared the structure of bacterial communities of the Solimões and Negro Rivers, the main Amazon River tributaries, based on analysis of 16S rRNA gene sequences. Water was sampled with a 3-L Van Dorn collection bottle; samples were collected at nine different points/depths totaling 27 L of water from each river. Total DNA was extracted from biomass retained by a 0.22-μm filter after sequential filtration of the water through 0.8- and 0.22-μm filters. The 16S rRNA gene was amplified by PCR, cloned and sequenced, and the sequences were analyzed with the PHYLIP and DOTUR programs to obtain the operational taxonomic units (OTUs) and to calculate the diversity and richness indices using the SPADE program. Taxonomic affiliation was determined using the naive Bayesian rRNA Classifier of the RDP II (Ribosomal Database Project). We recovered 158 sequences from the Solimões River grouped into 103 OTUs, and 197 sequences from the Negro River library grouped into 90 OTUs by the DOTUR program. The Solimões River was found to have a greater diversity of bacterial genera, and greater estimated richness of 446 OTUs, compared with 242 OTUs from the Negro River, as calculated by ACE estimator. The Negro River has less bacterial diversity, but more 16S rRNA gene sequences belonging to the bacterial genus Polynucleobacter were detected; 56 sequences from this genus were found (about 30% of the total sequences). We suggest that a more in-depth investigation be made to elucidate the role played by these bacteria in the river environment. These differences in bacterial diversity between Solimões and Negro Rivers could be explained by differences in organic matter content and pH of the rivers. PMID:22183948

  19. Extremely Acidophilic Protists from Acid Mine Drainage Host Rickettsiales-Lineage Endosymbionts That Have Intervening Sequences in Their 16S rRNA Genes

    PubMed Central

    Baker, Brett J.; Hugenholtz, Philip; Dawson, Scott C.; Banfield, Jillian F.

    2003-01-01

    During a molecular phylogenetic survey of extremely acidic (pH < 1), metal-rich acid mine drainage habitats in the Richmond Mine at Iron Mountain, Calif., we detected 16S rRNA gene sequences of a novel bacterial group belonging to the order Rickettsiales in the Alphaproteobacteria. The closest known relatives of this group (92% 16S rRNA gene sequence identity) are endosymbionts of the protist Acanthamoeba. Oligonucleotide 16S rRNA probes were designed and used to observe members of this group within acidophilic protists. To improve visualization of eukaryotic populations in the acid mine drainage samples, broad-specificity probes for eukaryotes were redesigned and combined to highlight this component of the acid mine drainage community. Approximately 4% of protists in the acid mine drainage samples contained endosymbionts. Measurements of internal pH of the protists showed that their cytosol is close to neutral, indicating that the endosymbionts may be neutrophilic. The endosymbionts had a conserved 273-nucleotide intervening sequence (IVS) in variable region V1 of their 16S rRNA genes. The IVS does not match any sequence in current databases, but the predicted secondary structure forms well-defined stem loops. IVSs are uncommon in rRNA genes and appear to be confined to bacteria living in close association with eukaryotes. Based on the phylogenetic novelty of the endosymbiont sequences and initial culture-independent characterization, we propose the name “Candidatus Captivus acidiprotistae.” To our knowledge, this is the first report of an endosymbiotic relationship in an extremely acidic habitat. PMID:12957940

  20. Bacterial communities in two Antarctic ice cores analyzed by 16S rRNA gene sequencing analysis

    NASA Astrophysics Data System (ADS)

    Segawa, Takahiro; Ushida, Kazunari; Narita, Hideki; Kanda, Hiroshi; Kohshima, Shiro

    2010-08-01

    Antarctic ice cores could preserve ancient airborne microorganisms. We examined bacteria in two Antarctic ice core samples, an interglacial age sample from Mizuho Base and a glacial age sample from the Yamato Mountains, by 16S rRNA gene sequencing analysis. Bacterial density, the number of bacterial OTUs and Simpson’s diversity index was larger in the Mizuho sample than in the Yamato sample. The 16S rDNA clone library from the Mizuho sample was dominated by the phylum Firmicutes, while the large part of that from the Yamato sample was composed of the Gamma proteobacteria group. Major sources of these identified bacteria estimated from their database records also differed between the samples: in the Mizuho sample bacterial species recorded from animals were higher than that of the Yamato sample, while in the Yamato sample bacteria from aquatic and snow-ice environments were higher than that of the Mizuho sample. The results suggest that these bacteria were past airborne bacteria that would vary in density, diversity and species composition depending on global environmental change. Our results imply that bacteria in Antarctic ice cores could be used as new environmental markers for past environmental studies.

  1. Potential applications of next generation DNA sequencing of 16S rRNA gene amplicons in microbial water quality monitoring.

    PubMed

    Vierheilig, J; Savio, D; Ley, R E; Mach, R L; Farnleitner, A H; Reischer, G H

    2015-01-01

    The applicability of next generation DNA sequencing (NGS) methods for water quality assessment has so far not been broadly investigated. This study set out to evaluate the potential of an NGS-based approach in a complex catchment with importance for drinking water abstraction. In this multi-compartment investigation, total bacterial communities in water, faeces, soil, and sediment samples were investigated by 454 pyrosequencing of bacterial 16S rRNA gene amplicons to assess the capabilities of this NGS method for (i) the development and evaluation of environmental molecular diagnostics, (ii) direct screening of the bulk bacterial communities, and (iii) the detection of faecal pollution in water. Results indicate that NGS methods can highlight potential target populations for diagnostics and will prove useful for the evaluation of existing and the development of novel DNA-based detection methods in the field of water microbiology. The used approach allowed unveiling of dominant bacterial populations but failed to detect populations with low abundances such as faecal indicators in surface waters. In combination with metadata, NGS data will also allow the identification of drivers of bacterial community composition during water treatment and distribution, highlighting the power of this approach for monitoring of bacterial regrowth and contamination in technical systems. PMID:26606090

  2. Genetic variation and identification of cultivated Fallopia multiflora and its wild relatives by using chloroplast matK and 18S rRNA gene sequences.

    PubMed

    Yan, Ping; Pang, Qi-Hua; Jiao, Xu-Wen; Zhao, Xuan; Shen, Yan-Jing; Zhao, Shu-Jin

    2008-10-01

    FALLOPIA MULTIFLORA (Thunb.) Harald . has been widely and discriminatingly used in China for the study and treatment of anemia, swirl, deobstruent, pyrosis, insomnia, amnesia, atheroma and also for regulating immune functions. However, there is still confusion about the herbal drug's botanical origins and the phylogenetic relationship between the cultivars and the wild relatives. In order to develop an efficient method for identification, a molecular analysis was performed based on 18 S rRNA gene and partial MATK gene sequences. The 18 S rRNA gene sequences of F. MULTIFLORA were 1809 bp in length and were highly conserved, indicating that the cultivars and the wild F. MULTIFLORA have the same botanical origin. Based on our 18 S rRNA gene sequences analysis, F. MULTIFLORA could be easily distinguished at the DNA level from adulterants and some herbs with similar components. The MATK gene partial sequences were found to span 1271 bp. The phylogenetic relation of F. MULTIFLORA based on the MATK gene showed that all samples in this paper were divided into four clades. The sequences of the partial MATK gene had many permutations, which were related to the geographical distributions of the samples. MATK gene sequences provided valuable information for the identification of F. MULTIFLORA. New taxonomic information could be obtained to authenticate the botanical origin of the F. MULTIFLORA, the species and the medicines made of it. PMID:18759218

  3. Pulmonate phylogeny based on 28S rRNA gene sequences: a framework for discussing habitat transitions and character transformation.

    PubMed

    Holznagel, W E; Colgan, D J; Lydeard, C

    2010-12-01

    Pulmonate snails occupy a wide range of marine, estuarine, freshwater and terrestrial environments. Non-terrestrial forms are supposed to be basal in pulmonate evolution but the group's phylogeny is not well resolved either morphologically or on the basis of available DNA sequence data. The lack of a robust phylogeny makes it difficult to understand character polarization and habitat transformation in pulmonates. We have investigated pulmonate relationships using 27 new sequences of 28S rRNA from pulmonates and outgroups, augmented with data from GenBank. The complete alignments comprised about 3.8kb. Maximum parsimony, maximum likelihood and Bayesian analyses of alignments generated under different assumptions are reported. Complete alignments appear to have a degree of substitution saturation so where there is conflict between hypothesised relationships more weight is given to analyses where regions of random similarity are excluded and which are not affected by this complication. Monophyly of the five main pulmonate groups was robustly supported in almost all analyses. The marine group Amphiboloidea and the freshwater Glacidorbidae are the most basal. The remaining pulmonates (Siphonariidae, Hygrophila and Eupulmonata) form a moderately-supported monophyletic group in all analyses bar one probably affected by saturation of substitutions. Siphonariidae, a predominantly marine and intertidal family, and Eupulmonata (mainly terrestrial with marine, estuarine and freshwater species) form a strongly supported clade that is the sister group to Hygrophila (freshwater). Multiple colonizations of freshwater and terrestrial habitats by pulmonate snails are suggested. No analyses strongly support the possibility of habitat reversions. The colonizations of freshwater by Hygrophila and of land by Stylommatophora were apparently phylogenetically independent although it cannot yet be excluded that there were transient terrestrial phases in the history of the former group or

  4. Phylogeny of All Recognized Species of Ammonia Oxidizers Based on Comparative 16S rRNA and amoA Sequence Analysis: Implications for Molecular Diversity Surveys

    PubMed Central

    Purkhold, Ulrike; Pommerening-Röser, Andreas; Juretschko, Stefan; Schmid, Markus C.; Koops, Hans-Peter; Wagner, Michael

    2000-01-01

    The current perception of evolutionary relationships and the natural diversity of ammonia-oxidizing bacteria (AOB) is mainly based on comparative sequence analyses of their genes encoding the 16S rRNA and the active site polypeptide of the ammonia monooxygenase (AmoA). However, only partial 16S rRNA sequences are available for many AOB species and most AOB have not yet been analyzed on the amoA level. In this study, the 16S rDNA sequence data of 10 Nitrosomonas species and Nitrosococcus mobilis were completed. Furthermore, previously unavailable 16S rRNA sequences were determined for three Nitrosomonas sp. isolates and for the gamma-subclass proteobacterium Nitrosococcus halophilus. These data were used to revaluate the specificities of published oligonucleotide primers and probes for AOB. In addition, partial amoA sequences of 17 AOB, including the above-mentioned 15 AOB, were obtained. Comparative phylogenetic analyses suggested similar but not identical evolutionary relationships of AOB by using 16S rRNA and AmoA as marker molecules, respectively. The presented 16S rRNA and amoA and AmoA sequence data from all recognized AOB species significantly extend the currently used molecular classification schemes for AOB and now provide a more robust phylogenetic framework for molecular diversity inventories of AOB. For 16S rRNA-independent evaluation of AOB species-level diversity in environmental samples, amoA and AmoA sequence similarity threshold values were determined which can be used to tentatively identify novel species based on cloned amoA sequences. Subsequently, 122 amoA sequences were obtained from 11 nitrifying wastewater treatment plants. Phylogenetic analyses of the molecular isolates showed that in all but two plants only nitrosomonads could be detected. Although several of the obtained amoA sequences were only relatively distantly related to known AOB, none of these sequences unequivocally suggested the existence of previously unrecognized species in the

  5. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.

    PubMed

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S

    2015-01-01

    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  6. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling

    PubMed Central

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.

    2015-01-01

    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  7. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene.

    PubMed

    Coêlho, Mariza M; Ferreira-Nozawa, Monica S; Nozawa, Sérgio R; Santos, André L W

    2011-10-01

    Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla), were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species. PMID:22215973

  8. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene

    PubMed Central

    Coêlho, Mariza M.; Ferreira-Nozawa, Monica S.; Nozawa, Sérgio R.; Santos, André L.W.

    2011-01-01

    Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla), were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species. PMID:22215973

  9. A phylogenetic comparison of the 16S rRNA sequence of the fish pathogen, Renibacterium salmoninarum, to gram-positive bacteria.

    PubMed

    Gutenberger, S K; Giovannoni, S J; Field, K G; Fryer, J L; Rohovec, J S

    1991-01-15

    The 16S rRNA of Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonids, was sequenced by reverse transcriptase to produce a nearly complete sequence (97%) of 1475 nucleotides. Phylogenetic comparisons to seventeen genera and signature sequence analysis indicated that R. salmoninarum was a member of the high G + C Gram-positive eubacterial subdivision although the reported G + C value is only 53%. A phylogenetic tree details the relationship of R. salmoninarum to ten actinomycetes from diverse environments. PMID:1709893

  10. Uncultured bacterial diversity in a seawater recirculating aquaculture system revealed by 16S rRNA gene amplicon sequencing.

    PubMed

    Lee, Da-Eun; Lee, Jinhwan; Kim, Young-Mog; Myeong, Jeong-In; Kim, Kyoung-Ho

    2016-04-01

    Bacterial diversity in a seawater recirculating aquaculture system (RAS) was investigated using 16S rRNA amplicon sequencing to understand the roles of bacterial communities in the system. The RAS was operated at nine different combinations of temperature (15°C, 20°C, and 25°C) and salinity (20‰, 25‰, and 32.5‰). Samples were collected from five or six RAS tanks (biofilters) for each condition. Fifty samples were analyzed. Proteobacteria and Bacteroidetes were most common (sum of both phyla: 67.2% to 99.4%) and were inversely proportional to each other. Bacteria that were present at an average of ≥ 1% included Actinobacteria (2.9%) Planctomycetes (2.0%), Nitrospirae (1.5%), and Acidobacteria (1.0%); they were preferentially present in packed bed biofilters, mesh biofilters, and maturation biofilters. The three biofilters showed higher diversity than other RAS tanks (aerated biofilters, floating bed biofilters, and fish tanks) from phylum to operational taxonomic unit (OTU) level. Samples were clustered into several groups based on the bacterial communities. Major taxonomic groups related to family Rhodobacteraceae and Flavobacteriaceae were distributed widely in the samples. Several taxonomic groups like [Saprospiraceae], Cytophagaceae, Octadecabacter, and Marivita showed a cluster-oriented distribution. Phaeobacter and Sediminicola-related reads were detected frequently and abundantly at low temperature. Nitrifying bacteria were detected frequently and abundantly in the three biofilters. Phylogenetic analysis of the nitrifying bacteria showed several similar OTUs were observed widely through the biofilters. The diverse bacterial communities and the minor taxonomic groups, except for Proteobacteria and Bacteroidetes, seemed to play important roles and seemed necessary for nitrifying activity in the RAS, especially in packed bed biofilters, mesh biofilters, and maturation biofilters. PMID:27033205

  11. Molecular Phylogenetics and Systematics of the Bivalve Family Ostreidae Based on rRNA Sequence-Structure Models and Multilocus Species Tree

    PubMed Central

    Salvi, Daniele; Macali, Armando; Mariottini, Paolo

    2014-01-01

    The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassotreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics. PMID:25250663

  12. 16S rRNA Gene Sequence-Based Identification of Bacteria in Automatically Incubated Blood Culture Materials from Tropical Sub-Saharan Africa

    PubMed Central

    Schwarz, Norbert Georg; Hahn, Andreas; Boahen, Kennedy; Sarpong, Nimako; Adu-Sarkodie, Yaw; Halbgewachs, Eva; Marks, Florian; von Kalckreuth, Vera; Poppert, Sven; Loderstaedt, Ulrike; May, Jürgen; Hagen, Ralf Matthias

    2015-01-01

    Background The quality of microbiological diagnostic procedures depends on pre-analytic conditions. We compared the results of 16S rRNA gene PCR and sequencing from automatically incubated blood culture materials from tropical Ghana with the results of cultural growth after automated incubation. Methods Real-time 16S rRNA gene PCR and subsequent sequencing were applied to 1500 retained blood culture samples of Ghanaian patients admitted to a hospital with an unknown febrile illness after enrichment by automated culture. Results Out of all 1500 samples, 191 were culture-positive and 98 isolates were considered etiologically relevant. Out of the 191 culture-positive samples, 16S rRNA gene PCR and sequencing led to concordant results in 65 cases at species level and an additional 62 cases at genus level. PCR was positive in further 360 out of 1309 culture-negative samples, sequencing results of which suggested etiologically relevant pathogen detections in 62 instances, detections of uncertain relevance in 50 instances, and DNA contamination due to sample preparation in 248 instances. In two instances, PCR failed to detect contaminants from the skin flora that were culturally detectable. Pre-analytical errors caused many Enterobacteriaceae to be missed by culture. Conclusions Potentially correctable pre-analytical conditions and not the fastidious nature of the bacteria caused most of the discrepancies. Although 16S rRNA gene PCR and sequencing in addition to culture led to an increase in detections of presumably etiologically relevant blood culture pathogens, the application of this procedure to samples from the tropics was hampered by a high contamination rate. Careful interpretation of diagnostic results is required. PMID:26270631

  13. Phylogenetic affinities of Diplonema within the Euglenozoa as inferred from the SSU rRNA gene and partial COI protein sequences.

    PubMed

    Maslov, D A; Yasuhira, S; Simpson, L

    1999-03-01

    In order to shed light on the phylogenetic position of diplonemids within the phylum Euglenozoa, we have sequenced small subunit rRNA (SSU rRNA) genes from Diplonema (syn. Isonema) papillatum and Diplonema sp. We have also analyzed a partial sequence of the mitochondrial gene for cytochrome c oxidase subunit I from D. papillatum. With both markers, the maximum likelihood method favored a closer grouping of diplonemids with kinetoplastids, while the parsimony and distance suggested a closer relationship of diplonemids with euglenoids. In each case, the differences between the best tree and the alternative trees were small. The frequency of codon usage in the partial D. papillatum COI was different from both related groups; however, as is the case in kinetoplastids but not in Euglena, both the non-canonical UGA codon and the canonical UGG codon were used to encode tryptophan in Diplonema. PMID:10724517

  14. Application of 16S rRNA, cytochrome b and control region sequences for understanding the phylogenetic relationships in Oryx species.

    PubMed

    Khan, H A; Arif, I A; Al Homaidan, A A; Al Farhan, A H

    2008-01-01

    The present study reports the application of mitochondrial markers for the molecular phylogeny of Oryx species, including the Arabian oryx (AO), scimitar-horned oryx (SHO) and plains oryx (PO), using the Addax as an outgroup. Sequences of three molecular markers, 16S rRNA, cytochrome b and a control region, for the above four taxa were aligned and the topologies of respective phylogenetic trees were compared. All these markers clearly differentiated the genus Addax from Oryx. However, for species-level grouping, while 16S rRNA and cytochrome b produced similar phylogeny (SHO grouped with PO), the control region grouped SHO with AO. Further studies are warranted to generate more sequencing data, apply multiple bioinformatics tools and to include relevant nuclear markers for phylogenetic analysis of Oryx species. PMID:19224456

  15. Phylogeny and Taxonomy of Archaea: A Comparison of the Whole-Genome-Based CVTree Approach with 16S rRNA Sequence Analysis

    PubMed Central

    Zuo, Guanghong; Xu, Zhao; Hao, Bailin

    2015-01-01

    A tripartite comparison of Archaea phylogeny and taxonomy at and above the rank order is reported: (1) the whole-genome-based and alignment-free CVTree using 179 genomes; (2) the 16S rRNA analysis exemplified by the All-Species Living Tree with 366 archaeal sequences; and (3) the Second Edition of Bergey’s Manual of Systematic Bacteriology complemented by some current literature. A high degree of agreement is reached at these ranks. From the newly proposed archaeal phyla, Korarchaeota, Thaumarchaeota, Nanoarchaeota and Aigarchaeota, to the recent suggestion to divide the class Halobacteria into three orders, all gain substantial support from CVTree. In addition, the CVTree helped to determine the taxonomic position of some newly sequenced genomes without proper lineage information. A few discrepancies between the CVTree and the 16S rRNA approaches call for further investigation. PMID:25789552

  16. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing.

    PubMed

    Mehetre, Gajanan T; Paranjpe, Aditi; Dastager, Syed G; Dharne, Mahesh S

    2016-01-01

    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. PMID:26950332

  17. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing

    PubMed Central

    Mehetre, Gajanan T.; Paranjpe, Aditi; Dastager, Syed G.

    2016-01-01

    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. PMID:26950332

  18. Phylogenetic reconstruction of the wolf spiders (Araneae: Lycosidae) using sequences from the 12S rRNA, 28S rRNA, and NADH1 genes: implications for classification, biogeography, and the evolution of web building behavior.

    PubMed

    Murphy, Nicholas P; Framenau, Volker W; Donnellan, Stephen C; Harvey, Mark S; Park, Yung-Chul; Austin, Andrew D

    2006-03-01

    Current knowledge of the evolutionary relationships amongst the wolf spiders (Araneae: Lycosidae) is based on assessment of morphological similarity or phylogenetic analysis of a small number of taxa. In order to enhance the current understanding of lycosid relationships, phylogenies of 70 lycosid species were reconstructed by parsimony and Bayesian methods using three molecular markers; the mitochondrial genes 12S rRNA, NADH1, and the nuclear gene 28S rRNA. The resultant trees from the mitochondrial markers were used to assess the current taxonomic status of the Lycosidae and to assess the evolutionary history of sheet-web construction in the group. The results suggest that a number of genera are not monophyletic, including Lycosa, Arctosa, Alopecosa, and Artoria. At the subfamilial level, the status of Pardosinae needs to be re-assessed, and the position of a number of genera within their respective subfamilies is in doubt (e.g., Hippasa and Arctosa in Lycosinae and Xerolycosa, Aulonia and Hygrolycosa in Venoniinae). In addition, a major clade of strictly Australasian taxa may require the creation of a new subfamily. The analysis of sheet-web building in Lycosidae revealed that the interpretation of this trait as an ancestral state relies on two factors: (1) an asymmetrical model favoring the loss of sheet-webs and (2) that the suspended silken tube of Pirata is directly descended from sheet-web building. Paralogous copies of the nuclear 28S rRNA gene were sequenced, confounding the interpretation of the phylogenetic analysis and suggesting that a cautionary approach should be taken to the further use of this gene for lycosid phylogenetic analysis. PMID:16503280

  19. Sulfur-oxidizing bacterial endosymbionts: analysis of phylogeny and specificity by 16S rRNA sequences. [Calyptogena magnifica; Bathymodiolus thermophilus; Lucinoma annulata; Lucinoma aequizonata; Codakia orbicularis

    SciTech Connect

    Distel, D.L.; Lane, D.J.; Olsen, G.J.; Giovannoni, S.J.; Pace, B.; Pace, N.R.; Stahl, D.A.; Felbeck, H.

    1988-06-01

    The 16S rRNAs from the bacterial endosymbionts of six marine invertebrates from diverse environments were isolated and partially sequenced. These symbionts included the trophosome symbiont of Riftia pachyptila, the gill symbionts of Calyptogena magnifica and Bathymodiolus thermophilus (from deep-sea hydrothermal vents), and the gill symbionts of Lucinoma annulata, Lucinoma aequizonata, and Codakia orbicularis (from relatively shallow coastal environments). Only one type of bacterial 16S rRNA was detected in each symbiosis. Using nucleotide sequence comparisons, we showed that each of the bacterial symbionts is distinct from the others and that all fall within a limited domain of the gamma subdivision of the purple bacteria (one of the major eubacterial divisions previously defined by 16S rRNA analysis. Two host specimens were analyzed in five of the symbioses; in each case, identical bacterial rRNA sequences were obtained from conspecific host specimens. These data indicate that the symbioses examined are species specific and that the symbiont species are unique to and invariant within their respective host species.

  20. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  1. Differentiation of Phylogenetically Related Slowly Growing Mycobacteria Based on 16S-23S rRNA Gene Internal Transcribed Spacer Sequences

    PubMed Central

    Roth, Andreas; Fischer, Marga; Hamid, Mohamed E.; Michalke, Sabine; Ludwig, Wolfgang; Mauch, Harald

    1998-01-01

    Interspecific polymorphisms of the 16S rRNA gene (rDNA) are widely used for species identification of mycobacteria. 16S rDNA sequences, however, do not vary greatly within a species, and they are either indistinguishable in some species, for example, in Mycobacterium kansasii and M. gastri, or highly similar, for example, in M. malmoense and M. szulgai. We determined 16S-23S rDNA internal transcribed spacer (ITS) sequences of 60 strains in the genus Mycobacterium representing 13 species (M. avium, M. conspicuum, M. gastri, M. genavense, M. kansasii, M. malmoense, M. marinum, M. shimoidei, M. simiae, M. szulgai, M. triplex, M. ulcerans, and M. xenopi). An alignment of these sequences together with additional sequences available in the EMBL database (for M. intracellulare, M. phlei, M. smegmatis, and M. tuberculosis) was established according to primary- and secondary-structure similarities. Comparative sequence analysis applying different treeing methods grouped the strains into species-specific clusters with low sequence divergence between strains belonging to the same species (0 to 2%). The ITS-based tree topology only partially correlated to that based on 16S rDNA, but the main branching orders were preserved, notably, the division of fast-growing from slowly growing mycobacteria, separate branching for M. simiae, M. genavense, and M. triplex, and distinct branches for M. xenopi and M. shimoidei. Comparisons of M. gastri with M. kansasii and M. malmoense with M. szulgai revealed ITS sequence similarities of 93 and 88%, respectively. M. marinum and M. ulcerans possessed identical ITS sequences. Our results show that ITS sequencing represents a supplement to 16S rRNA gene sequences for the differentiation of closely related species. Slowly growing mycobacteria show a high sequence variation in the ITS; this variation has the potential to be used for the development of probes as a rapid approach to mycobacterial identification. PMID:9431937

  2. Characterization of diatom-cyanobacteria symbioses on the basis of nifH, hetR and 16S rRNA sequences.

    PubMed

    Foster, Rachel A; Zehr, Jonathan P

    2006-11-01

    Richelia intracellularis is a symbiotic heterocystous cyanobacterium that is capable of forming associations with several genera of diatoms. nifH, 16S rRNA and hetR sequences were amplified and cloned from field populations of Richelia associated with Hemiaulus hauckii (N. Atlantic), with Rhizosolenia clevei (N. Pacific), and from a cultivated isolate of Calothrix associated with Chaetoceros from station ALOHA (N. Pacific). Sequence identity was highest (98.2%) among the 16S rRNA sequences, and more divergent for the hetR (83.8%) and nifH (91.1%) sequences. The hetR and nifH DNA and amino acid sequences obtained from the symbionts associated with the three different diatom genera diverged into three separate lineages supported by high bootstrap values. The data indicate that symbionts in the different hosts are distinct species or strains. Furthermore, three previously unidentified heterocystous-like nifH sequence groups recently reported from station ALOHA in the subtropical Pacific, het-1, het-2 and het-3, were linked to Richelia associated with R. clevei, H. hauckii and the Calothrix symbiont of Chaetoceros sp. respectively. PMID:17014491

  3. Western immunoblot analysis of Haemobartonella muris and comparison of 16S rRNA gene sequences of H. muris, H. felis, and Eperythrozoon suis.

    PubMed Central

    Rikihisa, Y; Kawahara, M; Wen, B; Kociba, G; Fuerst, P; Kawamori, F; Suto, C; Shibata, S; Futohashi, M

    1997-01-01

    Infectious agents were isolated from the spleens of three wild mice (Apodemus argenteus) by intraperitoneal inoculation of the spleen homogenate into laboratory mice. The laboratory mice developed clinical signs and splenomegaly, and three isolates were maintained by passage in mice. Tetracyclines were effective in preventing infection of mice with these agents, but streptomycin and penicillin were ineffective. The agents did not grow in bacterial growth media or chicken embryos. In smears of blood from infected mice stained by the Giemsa or the indirect immunofluorescence method, numerous organisms were found on the surfaces of erythrocytes. Electron microscopy revealed cell wall-less pleomorphic cocci of 350 to 700 nm in diameter. On the basis of these results, the isolates were identified as Haemobartonella muris. There was no antigenic cross-reactivity with Rickettsia or Ehrlichia spp. or other related organisms. Western immunoblot analysis of three strains of H. muris with mouse antisera to H. muris revealed identical major antigens of 118, 65, 53, 45, and 40 kDa. By heteroduplex analysis of the three PCR-amplified segments of the 16S rRNA genes, the three strains of H. muris were found to be identical. The 16S rRNA genes of one of the H. muris strains, four strains of H. felis, and two strains of Eperythrozoon suis were sequenced and compared. The sequences of two strains of H. felis from cats in California were identical, as were the sequences of a strain from a cat in Ohio and a strain from a cat in Florida, but the similarity of sequences between the California and the Ohio-Florida strains was only 85%. The sequence of an H. muris strain was unique and was more closely related to that of the Ohio-Florida strain of H. felis (89%) than to that of the California strain of H. felis (84%). The sequence of E. suis from a pig in Illinois was identical to that from another pig from Taiwan. The similarity of the 16S rRNA gene sequence of E. suis with those of three

  4. Molecular diversity of soil and marine 16S rRNA gene sequences related to beta-subgroup ammonia-oxidizing bacteria.

    PubMed Central

    Stephen, J R; McCaig, A E; Smith, Z; Prosser, J I; Embley, T M

    1996-01-01

    We have conducted a preliminary phylogenetic survey of ammonia-oxidizing beta-proteobacteria, using 16S rRNA gene libraries prepared by selective PCR and DNA from acid and neutral soils and polluted and nonpolluted marine sediments. Enrichment cultures were established from samples and analyzed by PCR. Analysis of 111 partial sequences of c. 300 bases revealed that the environmental sequences formed seven clusters, four of which are novel, within the phylogenetic radiation defined by cultured autotrophic ammonia oxidizers. Longer sequences from 13 cluster representatives support their phylogenetic positions relative to cultured taxa. These data suggest that known taxa may not be representative of the ammonia-oxidizing beta-proteobacteria in our samples. Our data provide further evidence that molecular and culture-based enrichment methods can select for different community members. Most enrichments contained novel Nitrosomonas-like sequences whereas novel Nitrosospira-like sequences were more common from gene libraries of soils and marine sediments. This is the first evidence for the occurrence of Nitrosospira-like strains in marine samples. Clear differences between the sequences of soil and marine sediment libraries were detected. Comparison of 16S rRNA sequences from polluted and nonpolluted sediments provided no strong evidence that the community composition was determined by the degree of pollution. Soil clone sequences fell into four clusters, each containing sequences from acid and neutral soils in varying proportions. Our data suggest that some related strains may be present in both samples, but further work is needed to resolve whether there is selection due to pH for particular sequence types. PMID:8900005

  5. Phylogenetic Analysis of Bacteroidales 16S rRNA Genes Unveils Sequences Specific to Diverse Swine Fecal Sources

    EPA Science Inventory

    Two of the currently available methods to assess swine fecal pollution (Bac1 and PF163) target Bacteroidales 16S rRNA genes. However, these assays have been shown to exhibit poor host-specificity and low detection limits in environmental waters, in part due to the limited number...

  6. The phylogeny of Aerococcus and Pediococcus as determined by 16S rRNA sequence analysis: description of Tetragenococcus gen. nov.

    PubMed

    Collins, M D; Williams, A M; Wallbanks, S

    1990-08-01

    The phylogenetic interrelationships of the genera Pediococcus and Aerococcus were investigated using reverse transcriptase sequencing of 16S rRNA. The genus Pediococcus was found to be phylogenetically heterogeneous. The four species P. acidilactici, P. damnosus, P. parvulus and P. pentosaceus formed a phylogenetically distinct group. Within this pediococcal cluster, P. acidilactici was closely related to P. pentosaceus whereas P. damnosus showed a specific relationship with P. parvulus. The species P. dextrinicus, although showing significant sequence relatedness with these pediococcal species, was peripheral to the genus. Pediococcus halophilus exhibited low sequence homology with all of the species examined and formed a distinct line of descent. Pediococcus halophilus exhibited a closer affinity with enterococci and carnobacteria than with the other lactic acid bacteria. Pediococcus urinae-equi was phylogenetically very closely related to Aerococcus viridans. The 16S rRNA sequences of the type strains of these species differed by only two nucleotides (99.9% sequence homology) and clearly demonstrate that P. urinae-equi is a member of the genus Aerococcus. PMID:2227360

  7. A systematic computational analysis of the rRNA-3' UTR sequence complementarity suggests a regulatory mechanism influencing post-termination events in metazoan translation.

    PubMed

    Pánek, Josef; Kolář, Michal; Herrmannová, Anna; Valášek, Leoš Shivaya

    2016-07-01

    Nucleic acid sequence complementarity underlies many fundamental biological processes. Although first noticed a long time ago, sequence complementarity between mRNAs and ribosomal RNAs still lacks a meaningful biological interpretation. Here we used statistical analysis of large-scale sequence data sets and high-throughput computing to explore complementarity between 18S and 28S rRNAs and mRNA 3' UTR sequences. By the analysis of 27,646 full-length 3' UTR sequences from 14 species covering both protozoans and metazoans, we show that the computed 18S rRNA complementarity creates an evolutionarily conserved localization pattern centered around the ribosomal mRNA entry channel, suggesting its biological relevance and functionality. Based on this specific pattern and earlier data showing that post-termination 80S ribosomes are not stably anchored at the stop codon and can migrate in both directions to codons that are cognate to the P-site deacylated tRNA, we propose that the 18S rRNA-mRNA complementarity selectively stabilizes post-termination ribosomal complexes to facilitate ribosome recycling. We thus demonstrate that the complementarity between 18S rRNA and 3' UTRs has a non-random nature and very likely carries information with a regulatory potential for translational control. PMID:27190231

  8. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment

    PubMed Central

    Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

    2016-01-01

    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in

  9. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.

    PubMed

    Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

    2016-01-01

    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA

  10. Comparison of Sanger and next generation sequencing performance for genotyping Cryptosporidium isolates at the 18S rRNA and actin loci.

    PubMed

    Paparini, Andrea; Gofton, Alexander; Yang, Rongchang; White, Nicole; Bunce, Michael; Ryan, Una M

    2015-01-01

    Cryptosporidium is an important enteric pathogen that infects a wide range of humans and animals. Rapid and reliable detection and characterisation methods are essential for understanding the transmission dynamics of the parasite. Sanger sequencing, and high-throughput sequencing (HTS) on an Ion Torrent platform, were compared with each other for their sensitivity and accuracy in detecting and characterising 25 Cryptosporidium-positive human and animal faecal samples. Ion Torrent reads (n = 123,857) were obtained at both 18S rRNA and actin loci for 21 of the 25 samples. Of these, one isolate at the actin locus (Cattle 05) and three at the 18S rRNA locus (HTS 10, HTS 11 and HTS 12), suffered PCR drop-out (i.e. PCR failures) when using fusion-tagged PCR. Sanger sequences were obtained for both loci for 23 of the 25 samples and showed good agreement with Ion Torrent-based genotyping. Two samples both from pythons (SK 02 and SK 05) produced mixed 18S and actin chromatograms by Sanger sequencing but were clearly identified by Ion Torrent sequencing as C. muris. One isolate (SK 03) was typed as C. muris by Sanger sequencing but was identified as a mixed C. muris and C. tyzzeri infection by HTS. 18S rRNA Type B sequences were identified in 4/6 C. parvum isolates when deep sequenced but were undetected in Sanger sequencing. Sanger was cheaper than Ion Torrent when sequencing a small numbers of samples, but when larger numbers of samples are considered (n = 60), the costs were comparative. Fusion-tagged amplicon based approaches are a powerful way of approaching mixtures, the only draw-back being the loss of PCR efficiency on low-template samples when using primers coupled to MID tags and adaptors. Taken together these data show that HTS has excellent potential for revealing the "true" composition of species/types in a Cryptosporidium infection, but that HTS workflows need to be carefully developed to ensure sensitivity, accuracy and contamination are

  11. Comparison of rpoB gene sequencing, 16S rRNA gene sequencing, gyrB multiplex PCR, and the VITEK2 system for identification of Acinetobacter clinical isolates.

    PubMed

    Lee, Min Jung; Jang, Sook Jin; Li, Xue Min; Park, Geon; Kook, Joong-Ki; Kim, Min Jung; Chang, Young-Hyo; Shin, Jong Hee; Kim, Soo Hyun; Kim, Dong-Min; Kang, Seong-Ho; Moon, Dae-Soo

    2014-01-01

    Since accurate identification of species is necessary for proper treatment of Acinetobacter infections, we compared the performances of 4 bacterial identification methods using 167 Acinetobacter clinical isolates to identify the best identification method. To secure more non-baumannii Acinetobacter (NBA) strains as target strains, we first identified Acinetobacter baumannii in a total of 495 Acinetobacter clinical isolates identified using the VITEK 2 system. Because 371 of 495 strains were identified as A. baumannii using gyrB multiplex 1 PCR and blaOXA51-like PCR, we performed rpoB gene sequencing and 16S rRNA gene sequencing on remaining 124 strains belonging to NBA and 52 strains of A. baumannii. For identification of Acinetobacter at the species level, the accuracy rates of rpoB gene sequencing, 16S rRNA gene sequencing, gyrB multiplex PCR, and the VITEK 2 were 98.2%, 93.4%, 77.2%, and 35.9%, respectively. The gyrB multiplex PCR seems to be very useful for the detection of ACB complex because its concordance rates to the final identification of strains of ACB complex were 100%. Both the rpoB gene sequencing and the 16S rRNA gene sequencing may be useful in identifying Acinetobacter. PMID:24157058

  12. The genetic diversity of genus Bacillus and the related genera revealed by 16s rRNA gene sequences and ardra analyses isolated from geothermal regions of turkey

    PubMed Central

    Cihan, Arzu Coleri; Tekin, Nilgun; Ozcan, Birgul; Cokmus, Cumhur

    2012-01-01

    Previously isolated 115 endospore-forming bacilli were basically grouped according to their temperature requirements for growth: the thermophiles (74%), the facultative thermophiles (14%) and the mesophiles (12%). These isolates were taken into 16S rRNA gene sequence analyses, and they were clustered among the 7 genera: Anoxybacillus, Aeribacillus, Bacillus, Brevibacillus, Geobacillus, Paenibacillus, and Thermoactinomycetes. Of these bacilli, only the thirty two isolates belonging to genera Bacillus (16), Brevibacillus (13), Paenibacillus (1) and Thermoactinomycetes (2) were selected and presented in this paper. The comparative sequence analyses revealed that the similarity values were ranged as 91.4–100 %, 91.8- 99.2 %, 92.6- 99.8 % and 90.7 - 99.8 % between the isolates and the related type strains from these four genera, respectively. Twenty nine of them were found to be related with the validly published type strains. The most abundant species was B. thermoruber with 9 isolates followed by B. pumilus (6), B. lichenformis (3), B. subtilis (3), B. agri (3), B. smithii (2), T. vulgaris (2) and finally P. barengoltzii (1). In addition, isolates of A391a, B51a and D295 were proposed as novel species as their 16S rRNA gene sequences displayed similarities ≤ 97% to their closely related type strains. The AluI-, HaeIII- and TaqI-ARDRA results were in congruence with the 16S rRNA gene sequence analyses. The ARDRA results allowed us to differentiate these isolates, and their discriminative restriction fragments were able to be determined. Some of their phenotypic characters and their amylase, chitinase and protease production were also studied and biotechnologically valuable enzyme producing isolates were introduced in order to use in further studies. PMID:24031834

  13. Genetic diversity of Datisca cannabina-compatible Frankia strains as determined by sequence analysis of the PCR-amplified 16S rRNA gene.

    PubMed Central

    Mirza, M S; Hameed, S; Akkermans, A D

    1994-01-01

    The presence of Frankia strains in soil samples collected from northern areas of Pakistan was detected by inoculating Coriaria nepalensis and Datisca cannabina plants. The abundance of compatible Frankia strains in some areas was indicated by profuse nodulation of the host plants, whereas soil samples from other localities failed to result in nodulation. An oligonucleotide probe (COR/DAT) directed against the 16S rRNA gene of the endophytes of Coriaria and Datisca spp. that did not cross-react with the RNA gene of Frankia strains isolated from other hosts was developed. Genetic diversity among Frankia strains nodulating D. cannabina was determined by sequence analysis of the partial 16S rRNA gene amplified from nodules induced by soil samples from different localities by PCR. Four types of Frankia sequences and one non-Frankia sequence were detected by hybridization with a Frankia genus probe and the COR/DAT probe as well as by sequence analysis of the cloned PCR products. Images PMID:7521157

  14. Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry as an Alternative to 16S rRNA Gene Sequencing for Identification of Difficult-To-Identify Bacterial Strains▿†

    PubMed Central

    Bizzini, A.; Jaton, K.; Romo, D.; Bille, J.; Prod'hom, G.; Greub, G.

    2011-01-01

    Conventional methods are sometimes insufficient to identify human bacterial pathogens, and alternative techniques, often molecular, are required. Matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) identified with a valid score 45.9% of 410 clinical isolates from 207 different difficult-to-identify species having required 16S rRNA gene sequencing. MALDI-TOF MS might represent an alternative to 16S rRNA gene sequencing. PMID:21106794

  15. Investigating microbial eukaryotic diversity from a global census: insights from a comparison of pyrotag and full-length sequences of 18S rRNA genes.

    PubMed

    Lie, Alle A Y; Liu, Zhenfeng; Hu, Sarah K; Jones, Adriane C; Kim, Diane Y; Countway, Peter D; Amaral-Zettler, Linda A; Cary, S Craig; Sherr, Evelyn B; Sherr, Barry F; Gast, Rebecca J; Caron, David A

    2014-07-01

    Next-generation DNA sequencing (NGS) approaches are rapidly surpassing Sanger sequencing for characterizing the diversity of natural microbial communities. Despite this rapid transition, few comparisons exist between Sanger sequences and the generally much shorter reads of NGS. Operational taxonomic units (OTUs) derived from full-length (Sanger sequencing) and pyrotag (454 sequencing of the V9 hypervariable region) sequences of 18S rRNA genes from 10 global samples were analyzed in order to compare the resulting protistan community structures and species richness. Pyrotag OTUs called at 98% sequence similarity yielded numbers of OTUs that were similar overall to those for full-length sequences when the latter were called at 97% similarity. Singleton OTUs strongly influenced estimates of species richness but not the higher-level taxonomic composition of the community. The pyrotag and full-length sequence data sets had slightly different taxonomic compositions of rhizarians, stramenopiles, cryptophytes, and haptophytes, but the two data sets had similarly high compositions of alveolates. Pyrotag-based OTUs were often derived from sequences that mapped to multiple full-length OTUs at 100% similarity. Thus, pyrotags sequenced from a single hypervariable region might not be appropriate for establishing protistan species-level OTUs. However, nonmetric multidimensional scaling plots constructed with the two data sets yielded similar clusters, indicating that beta diversity analysis results were similar for the Sanger and NGS sequences. Short pyrotag sequences can provide holistic assessments of protistan communities, although care must be taken in interpreting the results. The longer reads (>500 bp) that are now becoming available through NGS should provide powerful tools for assessing the diversity of microbial eukaryotic assemblages. PMID:24814788

  16. Comparative analyses of phenotypic methods and 16S rRNA, khe, rpoB genes sequencing for identification of clinical isolates of Klebsiella pneumoniae.

    PubMed

    He, Yanxia; Guo, Xianguang; Xiang, Shifei; Li, Jiao; Li, Xiaoqin; Xiang, Hui; He, Jinlei; Chen, Dali; Chen, Jianping

    2016-07-01

    The present work aimed to evaluate 16S rRNA, khe and rpoB gene sequencing for the identification of Klebsiella pneumoniae in comparison with phenotypic methods. Fifteen clinical isolates were examined, which were initially identified as K. pneumoniae subsp. pneumoniae using the automated VITEK 32 system in two hospitals in Enshi City, China. Their identity was further supported by conventional phenotypic methods on the basis of morphological and biochemical characteristics. Using Bayesian phylogenetic analyses and haplotypes network reconstruction, 13 isolates were identified as K. pneumoniae, whereas the other two isolates (K19, K24) were classified as Shigella sp. and Enterobacter sp., respectively. Of the three genes, 16S rRNA and khe gene could discriminate the clinical isolates at the genus level, whereas rpoB could discriminate Klebsiella at the species and even subspecies level. Overall, the gene tree based on rpoB is more compatible with the currently accepted classification of Klebsiella than those based on 16S rRNA and khe genes, showing that rpoB can be a powerful tool for identification of K. pneumoniae isolates. Above all, our study challenges the utility of khe as a species-specific marker for identification of K. pneumoniae. PMID:27147066

  17. Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

    PubMed Central

    Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

  18. Phylogeny of a novel "Helicobacter heilmannii" organism from a Japanese patient with chronic gastritis based on DNA sequence analysis of 16S rRNA and urease genes.

    PubMed

    Matsumoto, Takehisa; Kawakubo, Masatomo; Shiohara, Mayumi; Kumagai, Toshiko; Hidaka, Eiko; Yamauchi, Kazuyoshi; Oana, Kozue; Matsuzawa, Kenji; Ota, Hiroyoshi; Kawakami, Yoshiyuki

    2009-04-01

    "Helicobacter heilmannii" is an uncultivable spiral-shaped bacterium inhabiting the human gastric mucosa. It is larger and more tightly-coiled than H. pylori. We encountered a patient with chronic gastritis infected a "H. heilmannii"-like organism (HHLO), designated as SH6. Gastric mucosa derived from the patient was orally ingested by specific pathogen free mice. Colonization of the mice by SH6 was confirmed by electron microscopy of gastric tissue specimens. In an attempt to characterize SH6, 16S rRNA and urease genes were sequenced. The 16S rRNA gene sequence was most similar (99.4%; 1,437/1,445 bp) to HHLO C4E from a cheetah. However, the urease gene sequence displayed low similarity (81.7%; 1,240/1,516 bp) with HHLO C4E. Taxonomic analysis disclosed that SH6 represents a novel strain and should constitute a novel taxon in the phylogenetic trees, being discriminated from any other taxon, with the ability of infecting human gastric mucosa. PMID:19412605

  19. Efficacy of a 3rd generation high-throughput sequencing platform for analyses of 16S rRNA genes from environmental samples.

    PubMed

    Mosher, Jennifer J; Bernberg, Erin L; Shevchenko, Olga; Kan, Jinjun; Kaplan, Louis A

    2013-11-01

    Longer sequences of the bacterial 16S rRNA gene could provide greater phylogenetic and taxonomic resolutions and advance knowledge of population dynamics within complex natural communities. We assessed the accuracy of a Pacific Biosciences (PacBio) single molecule, real time (SMRT) sequencing based on DNA polymerization, a promising 3rd generation high-throughput technique, and compared this to the 2nd generation Roche 454 pyrosequencing platform. Amplicons of the 16S rRNA gene from a known isolate, Shewanella oneidensis MR1, and environmental samples from two streambed habitats, rocks and sediments, and a riparian zone soil, were analyzed. On the PacBio we analyzed ~500 bp amplicons that covered the V1-V3 regions and the full 1500 bp amplicons of the V1-V9 regions. On the Roche 454 we analyzed the ~500 bp amplicons. Error rates associated with the isolate were lowest with the Roche 454 method (2%), increased by more than 2-fold for the 500 bp amplicons with the PacBio SMRT chip (4-5%), and by more than 8-fold for the full gene with the PacBio SMRT chip (17-18%). Higher error rates with the PacBio SMRT chip artificially inflated estimates of richness and lowered estimates of coverage for environmental samples. The 3rd generation sequencing technology we evaluated does not provide greater phylogenetic and taxonomic resolutions for studies of microbial ecology. PMID:23999276

  20. Microbial Diversity of the Brine-Seawater Interface of the Kebrit Deep, Red Sea, Studied via 16S rRNA Gene Sequences and Cultivation Methods

    PubMed Central

    Eder, Wolfgang; Jahnke, Linda L.; Schmidt, Mark; Huber, Robert

    2001-01-01

    The brine-seawater interface of the Kebrit Deep, northern Red Sea, was investigated for the presence of microorganisms using phylogenetic analysis combined with cultivation methods. Under strictly anaerobic culture conditions, novel halophiles were isolated. The new rod-shaped isolates belong to the halophilic genus Halanaerobium and are the first representatives of the genus obtained from deep-sea, anaerobic brine pools. Within the genus Halanaerobium, they represent new species which grow chemoorganotrophically at NaCl concentrations ranging from 5 to 34%. The cellular fatty acid compositions are consistent with those of other Halanaerobium representatives, showing unusually large amounts of Δ7 and Δ11 16:1 fatty acids. Phylogenetic analysis of the brine-seawater interface sample revealed the presence of various bacterial 16S rRNA gene sequences dominated by cultivated members of the bacterial domain, with the majority affiliated with the genus Halanaerobium. The new Halanaerobium 16S rRNA clone sequences showed the highest similarity (99.9%) to the sequence of isolate KT-8-13 from the Kebrit Deep brine. In this initial survey, our polyphasic approach demonstrates that novel halophiles thrive in the anaerobic, deep-sea brine pool of the Kebrit Deep, Red Sea. They may contribute significantly to the anaerobic degradation of organic matter enriched at the brine-seawater interface. PMID:11425725

  1. The utility of diversity profiling using Illumina 18S rRNA gene amplicon deep sequencing to detect and discriminate Toxoplasma gondii among the cyst-forming coccidia.

    PubMed

    Cooper, Madalyn K; Phalen, David N; Donahoe, Shannon L; Rose, Karrie; Šlapeta, Jan

    2016-01-30

    Next-generation sequencing (NGS) has the capacity to screen a single DNA sample and detect pathogen DNA from thousands of host DNA sequence reads, making it a versatile and informative tool for investigation of pathogens in diseased animals. The technique is effective and labor saving in the initial identification of pathogens, and will complement conventional diagnostic tests to associate the candidate pathogen with a disease process. In this report, we investigated the utility of the diversity profiling NGS approach using Illumina small subunit ribosomal RNA (18S rRNA) gene amplicon deep sequencing to detect Toxoplasma gondii in previously confirmed cases of toxoplasmosis. We then tested the diagnostic approach with species-specific PCR genotyping, histopathology and immunohistochemistry of toxoplasmosis in a Risso's dolphin (Grampus griseus) to systematically characterise the disease and associate causality. We show that the Euk7A/Euk570R primer set targeting the V1-V3 hypervariable region of the 18S rRNA gene can be used as a species-specific assay for cyst-forming coccidia and discriminate T. gondii. Overall, the approach is cost-effective and improves diagnostic decision support by narrowing the differential diagnosis list with more certainty than was previously possible. Furthermore, it supplements the limitations of cryptic protozoan morphology and surpasses the need for species-specific PCR primer combinations. PMID:26801593

  2. Identification by 16S rRNA Gene Sequencing of Negativicoccus succinicivorans Recovered from the Blood of a Patient with Hemochromatosis and Pancreatitis ▿

    PubMed Central

    Church, D. L.; Simmon, K. E.; Sporina, Jan; Lloyd, T.; Gregson, D. B.

    2011-01-01

    We describe a case of Negativicoccus succinicivorans bacteremia in an adult man with hemochromatosis and acute pancreatitis. Conventional phenotypic tests and commercial identification systems failed to definitively identify the tiny anaerobic Gram-negative coccus isolated from two sets of blood cultures. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software. This is the first published report of the recovery of this organism from a patient with invasive infection. PMID:21653773

  3. Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonid fish, detected by nested reverse transcription-PCR of 16S rRNA sequences.

    PubMed Central

    Magnússon, H B; Fridjónsson, O H; Andrésson, O S; Benediktsdóttir, E; Gudmundsdóttir, S; Andrésdóttir, V

    1994-01-01

    An assay based on reverse transcription and nested PCR amplification of hypervariable regions within the 16S rRNA sequence was used to specifically detect Renibacterium salmoninarum, the slowly growing causative agent of bacterial kidney disease in salmonid fish. This assay detected 1 to 10 bacteria per sample and took 1 to 2 days to perform. The assay was used to detect R. salmoninarum in ovarian fluid obtained from naturally infected fish. The assay was unreliable when it was used to examine kidney tissue. Images PMID:7529017

  4. Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonid fish, detected by nested reverse transcription-PCR of 16S rRNA sequences.

    PubMed

    Magnússon, H B; Fridjónsson, O H; Andrésson, O S; Benediktsdóttir, E; Gudmundsdóttir, S; Andrésdóttir, V

    1994-12-01

    An assay based on reverse transcription and nested PCR amplification of hypervariable regions within the 16S rRNA sequence was used to specifically detect Renibacterium salmoninarum, the slowly growing causative agent of bacterial kidney disease in salmonid fish. This assay detected 1 to 10 bacteria per sample and took 1 to 2 days to perform. The assay was used to detect R. salmoninarum in ovarian fluid obtained from naturally infected fish. The assay was unreliable when it was used to examine kidney tissue. PMID:7529017

  5. Assessment of a 16S rRNA amplicon Illumina sequencing procedure for studying the microbiome of a symbiont-rich aphid genus.

    PubMed

    Jousselin, E; Clamens, A-L; Galan, M; Bernard, M; Maman, S; Gschloessl, B; Duport, G; Meseguer, A S; Calevro, F; Coeur d'acier, A

    2016-05-01

    The bacterial communities inhabiting arthropods are generally dominated by a few endosymbionts that play an important role in the ecology of their hosts. Rather than comparing bacterial species richness across samples, ecological studies on arthropod endosymbionts often seek to identify the main bacterial strains associated with each specimen studied. The filtering out of contaminants from the results and the accurate taxonomic assignment of sequences are therefore crucial in arthropod microbiome studies. We aimed here to validate an Illumina 16S rRNA gene sequencing protocol and analytical pipeline for investigating endosymbiotic bacteria associated with aphids. Using replicate DNA samples from 12 species (Aphididae: Lachninae, Cinara) and several controls, we removed individual sequences not meeting a minimum threshold number of reads in each sample and carried out taxonomic assignment for the remaining sequences. With this approach, we show that (i) contaminants accounted for a negligible proportion of the bacteria identified in our samples; (ii) the taxonomic composition of our samples and the relative abundance of reads assigned to a taxon were very similar across PCR and DNA replicates for each aphid sample; in particular, bacterial DNA concentration had no impact on the results. Furthermore, by analysing the distribution of unique sequences across samples rather than aggregating them into operational taxonomic units (OTUs), we gained insight into the specificity of endosymbionts for their hosts. Our results confirm that Serratia symbiotica is often present in Cinara species, in addition to the primary symbiont, Buchnera aphidicola. Furthermore, our findings reveal new symbiotic associations with Erwinia- and Sodalis-related bacteria. We conclude with suggestions for generating and analysing 16S rRNA gene sequences for arthropod-endosymbiont studies. PMID:26458227

  6. Effect of condensed tannins on bovine rumen protist diversity based on 18S rRNA gene sequences.

    PubMed

    Tan, Hui Yin; Sieo, Chin Chin; Abdullah, Norhani; Liang, Juan Boo; Huang, Xiao Dan; Ho, Yin Wan

    2013-01-01

    Molecular diversity of protists from bovine rumen fluid incubated with condensed tannins of Leucaena leucocephala hybrid-Rendang at 20 mg/500 mg dry matter (treatment) or without condensed tannins (control) was investigated using 18S rRNA gene library. Clones from the control library were distributed within nine genera, but clones from the condensed tannin treatment clone library were related to only six genera. Diversity estimators such as abundance-based coverage estimation and Chao1 showed significant differences between the two libraries, although no differences were found based on Shannon-Weaver index and Libshuff. PMID:23205499

  7. Soil Acidobacterial 16S rRNA Gene Sequences Reveal Subgroup Level Differences between Savanna-Like Cerrado and Atlantic Forest Brazilian Biomes

    PubMed Central

    Catão, Elisa C. P.; Lopes, Fabyano A. C.; Araújo, Janaína F.; de Castro, Alinne P.; Barreto, Cristine C.; Bustamante, Mercedes M. C.; Quirino, Betania F.; Krüger, Ricardo H.

    2014-01-01

    16S rRNA sequences from the phylum Acidobacteria have been commonly reported from soil microbial communities, including those from the Brazilian Savanna (Cerrado) and the Atlantic Forest biomes, two biomes that present contrasting characteristics of soil and vegetation. Using 16S rRNA sequences, the present work aimed to study acidobacterial diversity and distribution in soils of Cerrado savanna and two Atlantic forest sites. PCA and phylogenetic reconstruction showed that the acidobacterial communities found in “Mata de galeria” forest soil samples from the Cerrado biome have a tendency to separate from the other Cerrado vegetation microbial communities in the direction of those found in the Atlantic Forest, which is correlated with a high abundance of Acidobacteria subgroup 2 (GP2). Environmental conditions seem to promote a negative correlation between GP2 and subgroup 1 (GP1) abundance. Also GP2 is negatively correlated to pH, but positively correlated to high Al3+ concentrations. The Cerrado soil showed the lowest Acidobacteria richness and diversity indexes of OTUs at the species and subgroups levels when compared to Atlantic Forest soils. These results suggest specificity of acidobacterial subgroups to soils of different biomes and are a starting point to understand their ecological roles, a topic that needs to be further explored. PMID:25309599

  8. Molecular characterisation of Mycoplasma hyorhinis isolated from pigs using pulsed-field gel electrophoresis and 16S rRNA sequencing

    PubMed Central

    Yamaguti, Maurício; Oliveira, Rosângela C; Marques, Lucas M; Buzinhani, Melissa; Buim, Marcos R; Neto, Renata L; Guimarães, Ana Márcia S; Timenetsky, Jorge

    2015-01-01

    Economic loss in pig breeding is common due to respiratory disorders, and Mycoplasma hyopneumoniae and Mycoplasma hyorhinis, namely, are the most common infectious agents. The aim of this study is to recover these mollicutes and detect their genotypic variations by pulsed-field gel electrophoresis (PFGE) and sequencing the 16 s rRNA gene. One hundred and twenty-six swabs from tonsil and nasal mucus of pigs with respiratory disorders were analysed. A total of 78 lungs were sampled, as well as two trachea and two tonsils obtained from animals with respiratory disorder. A total of 59 isolates were obtained: 1 (1.70 per cent) of M hyopneumoniae, 2 (3.40 per cent) of Mycoplasma flocculare and 56 (94.90 per cent) of M hyorhinis. The PFGE for M hyorhinis showed 10 profiles with enzyme AvaI and 9 profiles with XhoI. A low polymorphism of the 16sRNS gene was detected in M hyorhinis isolates compared with the type strain in the GenBank. M hyorhinis isolates of different herds showed a large heterogenicity with enzymes AvaI and XhoI. The sequencing of the 16S rRNA gene allowed for analysing the interspecific and intraspecific variations of isolated mycoplasmas. PMID:26688737

  9. Molecular characterisation of Mycoplasma hyorhinis isolated from pigs using pulsed-field gel electrophoresis and 16S rRNA sequencing.

    PubMed

    Yamaguti, Maurício; Oliveira, Rosângela C; Marques, Lucas M; Buzinhani, Melissa; Buim, Marcos R; Neto, Renata L; Guimarães, Ana Márcia S; Timenetsky, Jorge

    2015-01-01

    Economic loss in pig breeding is common due to respiratory disorders, and Mycoplasma hyopneumoniae and Mycoplasma hyorhinis, namely, are the most common infectious agents. The aim of this study is to recover these mollicutes and detect their genotypic variations by pulsed-field gel electrophoresis (PFGE) and sequencing the 16 s rRNA gene. One hundred and twenty-six swabs from tonsil and nasal mucus of pigs with respiratory disorders were analysed. A total of 78 lungs were sampled, as well as two trachea and two tonsils obtained from animals with respiratory disorder. A total of 59 isolates were obtained: 1 (1.70 per cent) of M hyopneumoniae, 2 (3.40 per cent) of Mycoplasma flocculare and 56 (94.90 per cent) of M hyorhinis. The PFGE for M hyorhinis showed 10 profiles with enzyme AvaI and 9 profiles with XhoI. A low polymorphism of the 16sRNS gene was detected in M hyorhinis isolates compared with the type strain in the GenBank. M hyorhinis isolates of different herds showed a large heterogenicity with enzymes AvaI and XhoI. The sequencing of the 16S rRNA gene allowed for analysing the interspecific and intraspecific variations of isolated mycoplasmas. PMID:26688737

  10. Design and evaluation of universal 16S rRNA gene primers for high-throughput sequencing to simultaneously detect DAMO microbes and anammox bacteria.

    PubMed

    Lu, Yong-Ze; Ding, Zhao-Wei; Ding, Jing; Fu, Liang; Zeng, Raymond J

    2015-12-15

    To develop universal 16S rRNA gene primers for high-throughput sequencing for the simultaneous detection of denitrifying anaerobic methane oxidation (DAMO) archaea, DAMO bacteria, and anaerobic ammonium oxidation (anammox) bacteria, four published primer sets (PS2-PS5) were modified. The overall coverage of the four primer pairs was evaluated in silico with the Silva SSU r119 dataset. Based on the virtual evaluation, the two best primer pairs (PS4 and PS5) were selected for further verification. Illumina MiSeq sequencing of a freshwater sediment and a culture from a DAMO-anammox reactor using these two primer pairs revealed that PS5 (341b4F-806R) was the most promising universal primer pair. This pair of primers detected both archaea and bacteria with less bias than PS4. Furthermore, an anaerobic fermentation culture and a wastewater treatment plant culture were used to verify the accuracy of PS5. More importantly, it detected DAMO archaea, DAMO bacteria, and anammox bacteria simultaneously with no false positives appeared. This universal 16S rRNA gene primer pair extends the existing molecular tools for studying the community structures and distributions of DAMO microbes and their potential interactions with anammox bacteria in different environments. PMID:26454634

  11. Molecular phylogenetic analysis of the coccidian cephalopod parasites Aggregata octopiana and Aggregata eberthi (Apicomplexa: Aggregatidae) from the NE Atlantic coast using 18S rRNA sequences.

    PubMed

    Castellanos-Martínez, Sheila; Pérez-Losada, Marcos; Gestal, Camino

    2013-08-01

    The coccidia genus Aggregata is responsible for intestinal coccidiosis in wild and cultivated cephalopods. Two coccidia species, Aggregata octopiana, (infecting the common octopus Octopus vulgaris), and A. eberthi, (infecting the cuttlefish Sepia officinalis), are identified in European waters. Extensive investigation of their morphology resulted in a redescription of A. octopiana in octopuses from the NE Atlantic Coast (NW Spain) thus clarifying confusing descriptions recorded in the past. The present study sequenced the 18S rRNA gene in A. octopiana and A. eberthi from the NE Atlantic coast in order to assess their taxonomic and phylogenetic status. Phylogenetic analyses revealed conspecific genetic differences (2.5%) in 18S rRNA sequences between A. eberthi from the Ria of Vigo (NW Spain) and the Adriatic Sea. Larger congeneric differences (15.9%) were observed between A. octopiana samples from the same two areas, which suggest the existence of two species. Based on previous morphological evidence, host specificity data, and new molecular phylogenetic analyses, we suggest that A. octopiana from the Ria of Vigo is the valid type species. PMID:23498588

  12. 16S rRNA Amplicon Sequencing Demonstrates that Indoor-Reared Bumblebees (Bombus terrestris) Harbor a Core Subset of Bacteria Normally Associated with the Wild Host

    PubMed Central

    Meeus, Ivan; Parmentier, Laurian; Billiet, Annelies; Maebe, Kevin; Van Nieuwerburgh, Filip; Deforce, Dieter; Wäckers, Felix; Vandamme, Peter; Smagghe, Guy

    2015-01-01

    A MiSeq multiplexed 16S rRNA amplicon sequencing of the gut microbiota of wild and indoor-reared Bombus terrestris (bumblebees) confirmed the presence of a core set of bacteria, which consisted of Neisseriaceae (Snodgrassella), Orbaceae (Gilliamella), Lactobacillaceae (Lactobacillus), and Bifidobacteriaceae (Bifidobacterium). In wild B. terrestris we detected several non-core bacteria having a more variable prevalence. Although Enterobacteriaceae are unreported by non next-generation sequencing studies, it can become a dominant gut resident. Furthermore the presence of some non-core lactobacilli were associated with the relative abundance of bifidobacteria. This association was not observed in indoor-reared bumblebees lacking the non-core bacteria, but having a more standardized microbiota compared to their wild counterparts. The impact of the bottleneck microbiota of indoor-reared bumblebees when they are used in the field for pollination purpose is discussed. PMID:25923917

  13. Identification of Raoultella terrigena as a Rare Causative Agent of Subungual Abscess Based on 16S rRNA and Housekeeping Gene Sequencing

    PubMed Central

    Wang, Yu; Jiang, Xiawei; Xu, Zemin; Ying, Chaoqun; Yu, Wei; Xiao, Yonghong

    2016-01-01

    A 63-year-old-man was admitted to our hospital with severe subungual abscess. Bacteria were isolated from pus samples, and an inconsistent identification was shown by VITEK 2 system and MALDI-TOF mass spectrometry as Raoultella planticola and Raoultella terrigena, respectively. Molecular identification by 16S rRNA sequencing suggested that the isolate is R. terrigena, and this was further demonstrated by sequencing three housekeeping genes (rpoB, gyrA, and parC) with phylogenetic analysis. To our knowledge, this is the first report of subungual abscess caused by R. terrigena, a rare case of human infection due to soil bacterium. Our study highlights the technique importance on this pathogen identification. PMID:27379169

  14. Report of an immunocompetent case with disseminated infection due to Nocardia otitidiscaviarum: Identification by 16S rRNA gene sequencing.

    PubMed

    Eren, Esma; Ulu-Kilic, Aysegul; Atalay, Altay; Demiraslan, Hayati; Parkan, Omur; Koc, Nedret

    2016-03-01

    Nocardia otitidiscaviarum belongs to the agents of opportunistic infections seen in immunocompromised patients, but may occur rarely in immunocompetent patients. In this report we described a case of a previously healthy 69-year-old woman with cerebral and retroperitoneal abscess due to Nocardia otitidiscaviarum. The patient was admitted to hospital because of loss of strength in her right arm and leg. Nocardia spp. was isolated from the abscess material. The intracranial lesions were drained by stereotactic craniotomy. The large abscess located around the left kidney was drained and microscopic examination of aspirated material showed Nocardia spp. For species identification, 16S rRNA gene sequencing was carried out and was 100% concordant with Nocardia otitidiscaviarum. Use of 16S rDNA gene sequencing for identification permits detection of rare aetiologic agents that cause brain abscesses. PMID:27031902

  15. High-throughput 16S rRNA gene sequencing reveals alterations of intestinal microbiota in myalgic encephalomyelitis/chronic fatigue syndrome patients.

    PubMed

    Frémont, Marc; Coomans, Danny; Massart, Sebastien; De Meirleir, Kenny

    2013-08-01

    Human intestinal microbiota plays an important role in the maintenance of host health by providing energy, nutrients, and immunological protection. Intestinal dysfunction is a frequent complaint in myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) patients, and previous reports suggest that dysbiosis, i.e. the overgrowth of abnormal populations of bacteria in the gut, is linked to the pathogenesis of the disease. We used high-throughput 16S rRNA gene sequencing to investigate the presence of specific alterations in the gut microbiota of ME/CFS patients from Belgium and Norway. 43 ME/CFS patients and 36 healthy controls were included in the study. Bacterial DNA was extracted from stool samples, PCR amplification was performed on 16S rRNA gene regions, and PCR amplicons were sequenced using Roche FLX 454 sequencer. The composition of the gut microbiota was found to differ between Belgian controls and Norwegian controls: Norwegians showed higher percentages of specific Firmicutes populations (Roseburia, Holdemania) and lower proportions of most Bacteroidetes genera. A highly significant separation could be achieved between Norwegian controls and Norwegian patients: patients presented increased proportions of Lactonifactor and Alistipes, as well as a decrease in several Firmicutes populations. In Belgian subjects the patient/control separation was less pronounced, however some abnormalities observed in Norwegian patients were also found in Belgian patients. These results show that intestinal microbiota is altered in ME/CFS. High-throughput sequencing is a useful tool to diagnose dysbiosis in patients and could help designing treatments based on gut microbiota modulation (antibiotics, pre and probiotics supplementation). PMID:23791918

  16. Phylogenetic relationships of marine bacteria, mainly members of the family Vibrionaceae, determined on the basis of 16S rRNA sequences.

    PubMed

    Kita-Tsukamoto, K; Oyaizu, H; Nanba, K; Simidu, U

    1993-01-01

    The phylogenetic relationships of 50 reference strains, mostly marine bacteria which require Na+ for growth, were determined on the basis of 600 16S rRNA nucleotides by using reverse transcriptase sequencing. Strains belonging to 10 genera were included (four genera of the family Vibrionaceae, the genus Aeromonas of the family Aeromonadaceae, and the genera Alteromonas, Marinomonas, Shewanella, Pseudomonas, and Deleya). The sequences were aligned, the similarity values and evolutionary distance values were determined, and a phylogenetic tree was constructed by using the neighbor-joining method. On the basis of our results, the family Vibrionaceae was separated into at least seven groups (genera and families). Vibrio marinus clearly was on a line of descent that was remote from other vibrios. As determined by the similarity and evolutionary distance values, V. marinus is more distantly related to the family Vibrionaceae than the members of the Aeromonadaceae are. Also, Vibrio cholerae strains formed a separate group with Vibrio mimicus at the genus level. Of 30 species of the Vibrionaceae, 17 formed a large phylogenetic cluster. The genus Listonella was found to be a heterogeneous group, and the species were distributed in various subgroups of the Vibrionaceae. The separation of the family Aeromonadaceae from the family Vibrionaceae and the separation of the genera Marinomonas and Shewanella from the genus Alteromonas were confirmed in this phylogenetic study. However, a marine Pseudomonas species, Pseudomonas nautica, was clearly separated from two terrestrial Pseudomonas species. Each group that was separated by the phylogenetic analysis had characteristic 16S rRNA sequence patterns that were common only to species in that group. Therefore, the characteristic sequences described in this paper may be useful for identification purposes. PMID:8427811

  17. Intracellular Diversity of the V4 and V9 Regions of the 18S rRNA in Marine Protists (Radiolarians) Assessed by High-Throughput Sequencing

    PubMed Central

    Decelle, Johan; Romac, Sarah; Sasaki, Eriko; Not, Fabrice; Mahé, Frédéric

    2014-01-01

    Metabarcoding is a powerful tool for exploring microbial diversity in the environment, but its accurate interpretation is impeded by diverse technical (e.g. PCR and sequencing errors) and biological biases (e.g. intra-individual polymorphism) that remain poorly understood. To help interpret environmental metabarcoding datasets, we investigated the intracellular diversity of the V4 and V9 regions of the 18S rRNA gene from Acantharia and Nassellaria (radiolarians) using 454 pyrosequencing. Individual cells of radiolarians were isolated, and PCRs were performed with generalist primers to amplify the V4 and V9 regions. Different denoising procedures were employed to filter the pyrosequenced raw amplicons (Acacia, AmpliconNoise, Linkage method). For each of the six isolated cells, an average of 541 V4 and 562 V9 amplicons assigned to radiolarians were obtained, from which one numerically dominant sequence and several minor variants were found. At the 97% identity, a diversity metrics commonly used in environmental surveys, up to 5 distinct OTUs were detected in a single cell. However, most amplicons grouped within a single OTU whereas other OTUs contained very few amplicons. Different analytical methods provided evidence that most minor variants forming different OTUs correspond to PCR and sequencing artifacts. Duplicate PCR and sequencing from the same DNA extract of a single cell had only 9 to 16% of unique amplicons in common, and alignment visualization of V4 and V9 amplicons showed that most minor variants contained substitutions in highly-conserved regions. We conclude that intracellular variability of the 18S rRNA in radiolarians is very limited despite its multi-copy nature and the existence of multiple nuclei in these protists. Our study recommends some technical guidelines to conservatively discard artificial amplicons from metabarcoding datasets, and thus properly assess the diversity and richness of protists in the environment. PMID:25090095

  18. Molecular Methods for Identification of Acinetobacter Species by Partial Sequencing of the rpoB and 16S rRNA Genes

    PubMed Central

    Khosravi, Azar Dokht; Shahraki, Abdolrazagh Hashemi; Heidarieh, Parvin; Sheikhi, Nasrin

    2015-01-01

    Background Acinetobacter spp. is a diverse group of Gram-negative bacteria which are ubiquitous in soil and water, and an important cause of nosocomial infections. The purpose of this study was to identify a collection of Acinetobacter spp. clinical isolates accurately and to investigate their antibiotic susceptibility patterns. Materials and Methods A total of 197 non-duplicate clinical isolates of Acinetobacter spp. isolates identified using conventional biochemical tests. The molecular technique of PCR-RFLP and sequence analysis of rpoB and 16S rRNA genes was applied for species identification. Antimicrobial susceptibility test was performed with a disk diffusion assay. Results Based on 16S rRNA and rpoB genes analysis separately, most of clinical isolates can be identified with high bootstrap values. However, the identity of the isolate 555T was uncertain due to high similarity of A. grimontii and A. junii. Identification by concatenation of 16S rRNA and rpoB confirmed the identity of clinical isolates of Acenitobacer to species level confidently. Accordingly, the isolate 555T assigned as A. grimontii due to 100% similarity to A. grimontii. Moreover, this isolate showed 98.64% to A. junii. Besides, the identity of the isolates 218T and 364T was confirmed as Genomic species 3 and A. calcoaceticus respectively. So, the majority of Acinetobacter spp. isolates, were identified as: A. baumannii (131 isolates, 66%), A. calcoaceticus (9 isolates, 4.5%), and A. genomosp 16 (8 isolates, 4%). The rest of identified species showed the lower frequencies. In susceptibility test, 105 isolates (53%), presented high antibiotic resistance of 90% to ceftriaxone, piperacillin, piperacillin tazobactam, amikacin, and 81% to ciprofloxacin. Conclusion Sequence analysis of the 16S rRNA and rpoB spacer simultaneously was able to do identification of Acinetobacter spp. to species level. A.baumannii was identified as the most prevalent species with high antibiotic resistance. Other

  19. 18S rRNA gene sequencing identifies a novel species of Henneguya parasitizing the gills of the channel catfish (Ictaluridae).

    PubMed

    Rosser, Thomas G; Griffin, Matt J; Quiniou, Sylvie M A; Khoo, Lester H; Pote, Linda M

    2014-12-01

    In the southeastern USA, the channel catfish Ictalurus punctatus is a host to at least eight different species of myxozoan parasites belonging to the genus Henneguya, four of which have been characterized molecularly using sequencing of the small subunit ribosomal RNA (SSU rRNA) gene. However, only two of these have confirmed life cycles that involve the oligochaete Dero digitata as the definitive host. During a health screening of farm-raised channel catfish, several fish presented with deformed primary lamellae. Lamellae harbored large, nodular, white pseudocysts 1.25 mm in diameter, and upon rupturing, these pseudocysts released Henneguya myxospores, with a typical lanceolate-shaped spore body, measuring 17.1 ± 1.0 μm (mean ± SD; range = 15.0-19.3 μm) in length and 4.8 ± 0.4 μm (3.7-5.6 μm) in width. Pyriform-shaped polar capsules were 5.8 ± 0.3 μm in length (5.1-6.4 μm) and 1.7 ± 0.1 μm (1.4-1.9 μm) in width. The two caudal processes were 40.0 ± 5.1 μm in length (29.5-50.0 μm) with a spore length of 57.2 ± 4.7 (46.8-66.8 μm). The contiguous SSU rRNA gene sequence obtained from myxospores of five excised cysts did not match any Henneguya sp. in GenBank. The greatest sequence homology (91% over 1,900 bp) was with Henneguya pellis, associated with blister-like lesions on the skin of blue catfish Ictalurus furcatus. Based on the unique combination of pseudocyst and myxospore morphology, tissue location, host, and SSU rRNA gene sequence data, we report this isolate to be a previously unreported species, Henneguya bulbosus sp. nov. PMID:25270236

  20. Introducing EzTaxon-e: a prokaryotic 16S rRNA gene sequence database with phylotypes that represent uncultured species.

    PubMed

    Kim, Ok-Sun; Cho, Yong-Joon; Lee, Kihyun; Yoon, Seok-Hwan; Kim, Mincheol; Na, Hyunsoo; Park, Sang-Cheol; Jeon, Yoon Seong; Lee, Jae-Hak; Yi, Hana; Won, Sungho; Chun, Jongsik

    2012-03-01

    Despite recent advances in commercially optimized identification systems, bacterial identification remains a challenging task in many routine microbiological laboratories, especially in situations where taxonomically novel isolates are involved. The 16S rRNA gene has been used extensively for this task when coupled with a well-curated database, such as EzTaxon, containing sequences of type strains of prokaryotic species with validly published names. Although the EzTaxon database has been widely used for routine identification of prokaryotic isolates, sequences from uncultured prokaryotes have not been considered. Here, the next generation database, named EzTaxon-e, is formally introduced. This new database covers not only species within the formal nomenclatural system but also phylotypes that may represent species in nature. In addition to an identification function based on Basic Local Alignment Search Tool (blast) searches and pairwise global sequence alignments, a new objective method of assessing the degree of completeness in sequencing is proposed. All sequences that are held in the EzTaxon-e database have been subjected to phylogenetic analysis and this has resulted in a complete hierarchical classification system. It is concluded that the EzTaxon-e database provides a useful taxonomic backbone for the identification of cultured and uncultured prokaryotes and offers a valuable means of communication among microbiologists who routinely encounter taxonomically novel isolates. The database and its analytical functions can be found at http://eztaxon-e.ezbiocloud.net/. PMID:22140171

  1. Trichopodiella faurei n. sp. (Ciliophora, Phyllopharyngea, Cyrtophoria): morphological description and phylogenetic analyses based on SSU rRNA and group I intron sequences.

    PubMed

    Gong, Jun; Gao, Shan; Roberts, David McL; Al-Rasheid, Khaled A S; Song, Weibo

    2008-01-01

    A new marine cyrtophorian ciliate Trichopodiella faurei n. sp., which belongs to the order Dysteriida, family Hartmannulidae, was investigated at the morphological and molecular levels. A combination of morphological features of the organism including the oval body shape, 2-3 contractile vacuoles, 22-28 nematodesmal rods in the cytopharyngeal basket, and 31-39 somatic kineties, distinguishes it from all other known congeners. In reconstructed small subunit (SSU) rRNA phylogenies, T. faurei groups with Isochona, a representative genus of the subclass Chonotrichia. The similarity of the infraciliature between hartmannulids and several chonotrichian examples also suggests that these taxa should be closely related. A new S943 intron belonging to group IC1 was identified in the SSU rRNA gene of this species. This intron is phylogenetically related to the S891 introns previously found in the suctorians Acineta sp. and Tokophrya lemnarum, and their internal guide sequences share four nucleotides, indicating that these introns were vertically inherited from a common phyllopharyngean ancestor and that reverse splicing might have been involved in the transposition. PMID:19120794

  2. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes.

    PubMed

    Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu

    2015-10-01

    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future. PMID:26404329

  3. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes

    PubMed Central

    Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu

    2015-01-01

    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future. PMID:26404329

  4. DNA extraction protocols cause differences in 16S rRNA amplicon sequencing efficiency but not in community profile composition or structure

    DOE PAGESBeta

    None

    2014-12-01

    The recent development of methods applying next-generation sequencing to microbial community characterization has led to the proliferation of these studies in a wide variety of sample types. Yet, variation in the physical properties of environmental samples demands that optimal DNA extraction techniques be explored for each new environment. The microbiota associated with many species of insects offer an extraction challenge as they are frequently surrounded by an armored exoskeleton, inhibiting disruption of the tissues within. In this study, we examine the efficacy of several commonly used protocols for extracting bacterial DNA from ants. While bacterial community composition recovered using Illuminamore » 16S rRNA amplicon sequencing was not detectably biased by any method, the quantity of bacterial DNA varied drastically, reducing the number of samples that could be amplified and sequenced. These results indicate that the concentration necessary for dependable sequencing is around 10,000 copies of target DNA per microliter. Exoskeletal pulverization and tissue digestion increased the reliability of extractions, suggesting that these steps should be included in any study of insect-associated microorganisms that relies on obtaining microbial DNA from intact body segments. Although laboratory and analysis techniques should be standardized across diverse sample types as much as possible, minimal modifications such as these will increase the number of environments in which bacterial communities can be successfully studied.« less

  5. Phylogenetic analyses of some extremely halophilic archaea isolated from Dead Sea water, determined on the basis of their 16S rRNA sequences.

    PubMed

    Arahal, D R; Dewhirst, F E; Paster, B J; Volcani, B E; Ventosa, A

    1996-10-01

    Twenty-two extremely halophilic aerobic archaeal strains were isolated from enrichments prepared from Dead Sea water samples collected 57 years ago. The isolates were phenotypically clustered into five different groups, and a representative from each group was chosen for further study. Almost the entire sequences of the 16S rRNA genes of these representatives, and of Haloarcula hispanica ATCC 33960, were determined to establish their phylogenetic positions. The sequences of these strains were compared to previously published sequences of 27 reference halophilic archaea (members of the family Halobacteriaceae) and two other archaea, Methanobacterium formicicum DSM 1312 and Methanospirillum hungatei DSM 864. Phylogenetic analysis using approximately 1,400 base comparisons of 16S rRNA-encoding gene sequences demonstrated that the five isolates clustered closely to species belonging to three different genera--Haloferax, Halobacterium, and Haloarcula. Strains E1 and E8 were closely related and identified as members of the species Haloferax volcanii, and strain E12 was closely related and identified as a member of the species Halobacterium salinarum. However, strains E2 and E11 clustered in the Haloarcula branch with Haloarcula hispanica as the closest relative at 98.9 and 98.8% similarity, respectively. Strains E2 and E11 could represent two new species of the genus Haloarcula. However, because strains of these two new species were isolated from a single source, they will not be named until additional strains are isolated from other sources and fully characterized. PMID:8837434

  6. DNA extraction protocols cause differences in 16S rRNA amplicon sequencing efficiency but not in community profile composition or structure

    SciTech Connect

    2014-12-01

    The recent development of methods applying next-generation sequencing to microbial community characterization has led to the proliferation of these studies in a wide variety of sample types. Yet, variation in the physical properties of environmental samples demands that optimal DNA extraction techniques be explored for each new environment. The microbiota associated with many species of insects offer an extraction challenge as they are frequently surrounded by an armored exoskeleton, inhibiting disruption of the tissues within. In this study, we examine the efficacy of several commonly used protocols for extracting bacterial DNA from ants. While bacterial community composition recovered using Illumina 16S rRNA amplicon sequencing was not detectably biased by any method, the quantity of bacterial DNA varied drastically, reducing the number of samples that could be amplified and sequenced. These results indicate that the concentration necessary for dependable sequencing is around 10,000 copies of target DNA per microliter. Exoskeletal pulverization and tissue digestion increased the reliability of extractions, suggesting that these steps should be included in any study of insect-associated microorganisms that relies on obtaining microbial DNA from intact body segments. Although laboratory and analysis techniques should be standardized across diverse sample types as much as possible, minimal modifications such as these will increase the number of environments in which bacterial communities can be successfully studied.

  7. Identification of Clinical Coryneform Bacterial Isolates: Comparison of Biochemical Methods and Sequence Analysis of 16S rRNA and rpoB Genes▿

    PubMed Central

    Adderson, Elisabeth E.; Boudreaux, Jan W.; Cummings, Jessica R.; Pounds, Stanley; Wilson, Deborah A.; Procop, Gary W.; Hayden, Randall T.

    2008-01-01

    We compared the relative levels of effectiveness of three commercial identification kits and three nucleic acid amplification tests for the identification of coryneform bacteria by testing 50 diverse isolates, including 12 well-characterized control strains and 38 organisms obtained from pediatric oncology patients at our institution. Between 33.3 and 75.0% of control strains were correctly identified to the species level by phenotypic systems or nucleic acid amplification assays. The most sensitive tests were the API Coryne system and amplification and sequencing of the 16S rRNA gene using primers optimized for coryneform bacteria, which correctly identified 9 of 12 control isolates to the species level, and all strains with a high-confidence call were correctly identified. Organisms not correctly identified were species not included in the test kit databases or not producing a pattern of reactions included in kit databases or which could not be differentiated among several genospecies based on reaction patterns. Nucleic acid amplification assays had limited abilities to identify some bacteria to the species level, and comparison of sequence homologies was complicated by the inclusion of allele sequences obtained from uncultivated and uncharacterized strains in databases. The utility of rpoB genotyping was limited by the small number of representative gene sequences that are currently available for comparison. The correlation between identifications produced by different classification systems was poor, particularly for clinical isolates. PMID:18160450

  8. Detection of Renibacterium salmoninarum in tissue samples by sequence capture and fluorescent PCR based on the 16S rRNA gene.

    PubMed

    Königsson, Malin Heldtander; Ballagi, Andras; Jansson, Eva; Johansson, Karl-Erik

    2005-02-25

    The 16S rRNA genes from eight isolates of Renibacterium salmoninarum with different origins and dates of isolation were sequenced to evaluate the possibility to construct a diagnostic PCR system with target sites within this gene. The sequences were found to be identical but for one single position in one of the isolates, and two regions with an adequate number of nucleotide differences as compared to closely related species were identified. Species-specific fluorescent PCR primers complementary to these regions were constructed as well as oligonucleotides for DNA preparation by sequence capture. A mimic molecule was constructed to be used as an internal control. The PCR was specific and allowed the detection of DNA equivalent to 1-10 R. salmoninarum genomes per reaction. The DNA preparation with sequence capture and analysis by PCR with a mimic was found to be a reliable method for analysis of kidneys from fish with BKD. The amount of PCR inhibiting substances present in the tissue was reduced, and the relevant DNA was concentrated in the capture step. Furthermore, the use of the mimic molecule in the system assured that false negative results could be identified. PMID:15708821

  9. DNA extraction protocols cause differences in 16S rRNA amplicon sequencing efficiency but not in community profile composition or structure

    PubMed Central

    Rubin, Benjamin E R; Sanders, Jon G; Hampton-Marcell, Jarrad; Owens, Sarah M; Gilbert, Jack A; Moreau, Corrie S

    2014-01-01

    The recent development of methods applying next-generation sequencing to microbial community characterization has led to the proliferation of these studies in a wide variety of sample types. Yet, variation in the physical properties of environmental samples demands that optimal DNA extraction techniques be explored for each new environment. The microbiota associated with many species of insects offer an extraction challenge as they are frequently surrounded by an armored exoskeleton, inhibiting disruption of the tissues within. In this study, we examine the efficacy of several commonly used protocols for extracting bacterial DNA from ants. While bacterial community composition recovered using Illumina 16S rRNA amplicon sequencing was not detectably biased by any method, the quantity of bacterial DNA varied drastically, reducing the number of samples that could be amplified and sequenced. These results indicate that the concentration necessary for dependable sequencing is around 10,000 copies of target DNA per microliter. Exoskeletal pulverization and tissue digestion increased the reliability of extractions, suggesting that these steps should be included in any study of insect-associated microorganisms that relies on obtaining microbial DNA from intact body segments. Although laboratory and analysis techniques should be standardized across diverse sample types as much as possible, minimal modifications such as these will increase the number of environments in which bacterial communities can be successfully studied. PMID:25257543

  10. Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

    PubMed Central

    Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

    2015-01-01

    RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

  11. Phylogenetic analyses of Chlamydia psittaci strains from birds based on 16S rRNA gene sequence.

    PubMed Central

    Takahashi, T; Masuda, M; Tsuruno, T; Mori, Y; Takashima, I; Hiramune, T; Kikuchi, N

    1997-01-01

    The nucleotide sequences of 16S ribosomal DNA (rDNA) were determined for 39 strains of Chlamydia psittaci (34 from birds and 5 from mammals) and for 4 Chlamydia pecorum strains. The sequences were compared phylogenetically with the gene sequences of nine Chlamydia strains (covering four species of the genus) retrieved from nucleotide databases. In the neighbor-joining tree, C. psittaci strains were more closely related to each other than to the other Chlamydia species, although a feline pneumonitis strain was distinct (983 to 98.6% similarity to other strains) and appeared to form the deepest subline within the species of C. psittaci (bootstrap value, 99%). The other strains of C. psittaci exhibiting similarity values of more than 99% were branched into several subgroups. Two pigeon strains and one turkey strain formed a distinct clade recovered in 97% of the bootstrapped trees. The other pigeon strains seemed to be distinct from the strains from psittacine birds, with 88% of bootstrap value. In the cluster of psittacine strains, three parakeet strains and an ovine abortion strain exhibited a specific association (level of sequence similarity, 99.9% or more; bootstrap value, 95%). These suggest that at least four groups of strains exist within the species C. psittaci. The 16S rDNA sequence is a valuable phylogenetic marker for the taxonomy of chlamydiae, and its analysis is a reliable tool for identification of the organisms. PMID:9350757

  12. Diversity of endophytic bacteria in Malaysian plants as revealed by 16S rRNA encoding gene sequence based method of bacterial identification☆

    PubMed Central

    Loh, Chye Ying; Tan, Yin Yin; Rohani, Rahim; Weber, Jean-Frédéric F.; Bhore, Subhash Janardhan

    2013-01-01

    Bacterial endophytes do have several potential applications in pharmacy, medicine and agricultural biotech industry. The main objective of this study was to understand types of bacterial endophytes associated with dicotyledonous (dicot) and monocotyledonous (monocot) plant species. Isolation of the endophytic bacteria was performed using surface-sterilized various tissue samples, and identification of the endophytic bacterial isolates (EBIs) was completed using 16S rRNA encoding gene sequence similarity based method. In total, 996 EBIs were isolated and identified from 1055 samples of 31 monocot and 65 dicot plant species from Peninsular Malaysia. The 996 EBIs represented 71 different types of bacterial species. Twelve (12) out of 71 species are reported as endophytes for the first time. We conclude that diverse types of bacterial endophytes are associated with dicot and monocot plants, and could be useful in pharmacy, medicine and agricultural biotechnology for various potential applications. PMID:24396249

  13. Genus Tetrastemma Ehrenberg, 1831 (Phylum Nemertea)--a natural group? Phylogenetic relationships inferred from partial 18S rRNA sequences.

    PubMed

    Strand, Malin; Sundberg, Per

    2005-10-01

    We investigated the monophyletic status of the hoplonemertean taxon Tetrastemma by reconstructing the phylogeny for 22 specimens assigned to this genus, together with another 25 specimens from closely related hoplonemertean genera. The phylogeny was based on partial 18S rRNA sequences using Bayesian and maximum likelihood analyses. The included Tetrastemma-species formed a well-supported clade, although the within-taxon relationships were unsettled. We conclude that the name Tetrastemma refers to a monophyletic taxon, but that it cannot be defined by morphological synapomorphies, and our results do not imply that all the over 100 species assigned to this genus belong to it. The results furthermore indicate that the genera Amphiporus and Emplectonema are non-monophyletic. PMID:16182152

  14. Isolation and characterization of a novel chlorpyrifos degrading flavobacterium species EMBS0145 by 16S rRNA gene sequencing.

    PubMed

    Amareshwari, P; Bhatia, Mayuri; Venkatesh, K; Roja Rani, A; Ravi, G V; Bhakt, Priyanka; Bandaru, Srinivas; Yadav, Mukesh; Nayarisseri, Anuraj; Nair, Achuthsankar S

    2015-03-01

    Indiscriminate application of pesticides like chlorpyrifos, diazinon, or malathion contaminate the soil in addition has being unsafe often it has raised severe health concerns. Conversely, microorganisms like Trichoderma, Aspergillus and Bacteria like Rhizobium Bacillus, Azotobacter, Flavobacterium etc have evolved that are endowed with degradation of pesticides aforementioned to non-toxic products. The current study pitches into identification of a novel species of Flavobacterium bacteria capable to degrade the Organophosphorous pesticides. The bacterium was isolated from agricultural soil collected from Guntur District, Andhra Pradesh, India. The samples were serially diluted and the aliquots were incubated for a suitable time following which the suspected colony was subjected to 16S rDNA sequencing. The sequence thus obtained was aligned pairwise against Flavobacterium species, which resulted in identification of novel specie of Flavobacterium later named as EMBS0145, the sequence of which was deposited in in GenBank with accession number JN794045. PMID:25248957

  15. Dasytricha dominance in Surti buffalo rumen revealed by 18S rRNA sequences and real-time PCR assay.

    PubMed

    Singh, K M; Tripathi, A K; Pandya, P R; Rank, D N; Kothari, R K; Joshi, C G

    2011-09-01

    The genetic diversity of protozoa in Surti buffalo rumen was studied by amplified ribosomal DNA restriction analysis, 18S rDNA sequence homology and phylogenetic and Real-time PCR analysis methods. Three animals were fed diet comprised green fodder Napier bajra 21 (Pennisetum purpureum), mature pasture grass (Dicanthium annulatum) and concentrate mixture (20% crude protein, 65% total digestible nutrients). A protozoa-specific primer (P-SSU-342f) and a eukarya-specific primer (Medlin B) were used to amplify a 1,360 bp fragment of DNA encoding protozoal small subunit (SSU) ribosomal RNA from rumen fluid. A total of 91 clones were examined and identified 14 different 18S RNA sequences based on PCR-RFLP pattern. These 14 phylotypes were distributed into four genera-based 18S rDNA database sequences and identified as Dasytricha (57 clones), Isotricha (14 clones), Ostracodinium (11 clones) and Polyplastron (9 clones). Phylogenetic analyses were also used to infer the makeup of protozoa communities in the rumen of Surti buffalo. Out of 14 sequences, 8 sequences (69 clones) clustered with the Dasytricha ruminantium-like clone and 4 sequences (13 clones) were also phylogenetically placed with the Isotricha prostoma-like clone. Moreover, 2 phylotypes (9 clones) were related to Polyplastron multivesiculatum-like clone. In addition, the number of 18S rDNA gene copies of Dasytricha ruminantium (0.05% to ciliate protozoa) was higher than Entodinium sp. (2.0 × 10(5) vs. 1.3 × 10(4)) in per ml ruminal fluid. PMID:21744288

  16. A comprehensive benchmarking study of protocols and sequencing platforms for 16S rRNA community profiling

    DOE PAGESBeta

    Podar, Mircea; Shakya, Migun; D'Amore, Rosalinda; Ijaz, Umer Zeeshan; Schirmer, Melanie; Kenny, John G.; Gregory, Richard; Darby, Alistair C.; Quince, Christopher; Hall, Neil

    2016-01-14

    In the last 5 years, the rapid pace of innovations and improvements in sequencing technologies has completely changed the landscape of metagenomic and metagenetic experiments. Therefore, it is critical to benchmark the various methodologies for interrogating the composition of microbial communities, so that we can assess their strengths and limitations. Here, the most common phylogenetic marker for microbial community diversity studies is the 16S ribosomal RNA gene and in the last 10 years the field has moved from sequencing a small number of amplicons and samples to more complex studies where thousands of samples and multiple different gene regions aremore » interrogated.« less

  17. Evaluation of composition and individual variability of rumen microbiota in yaks by 16S rRNA high-throughput sequencing technology.

    PubMed

    Guo, Wei; Li, Ying; Wang, Lizhi; Wang, Jiwen; Xu, Qin; Yan, Tianhai; Xue, Bai

    2015-08-01

    The Yak (Bos grunniens) is a unique species of ruminant animals that is important to agriculture of the Tibetan plateau, and has a complex intestinal microbial community. The objective of the present study was to characterize the composition and individual variability of microbiota in the rumen of yaks using 16S rRNA gene high-throughput sequencing technique. Rumen samples used in the present study were obtained from grazing adult male yaks (n = 6) in a commercial farm in Ganzi Autonomous Prefecture of Sichuan Province, China. Universal prokaryote primers were used to target the V4-V5 hypervariable region of 16S rRNA gene. A total of 7200 operational taxonomic units (OTUs) were obtained after sequence filtering and chimera removal. Within these OTUs, 0.56% belonged to Archaea (40 OTUs), 7.19% to unassigned species (518 OTUs), and the remaining OTUs (6642) in all samples were of bacterial origin. When examining the community structure of bacteria, we identified 23 phyla within 159 families after taxonomic summarization. Bacteroidetes and Firmicutes were the predominant phyla accounting for 39.68% (SD = 0.05) and 45.90% (SD = 0.06), respectively. Moreover, 3764 OTUs were identified as shared OTUs (i.e. represented in all yaks) and belonged to 35 genera, exhibiting highly variable abundance across individual samples. Phylogenetic placement of these genera across individual samples was examined. In addition, we evaluated the distance among the 6 rumen samples by adding taxon phylogeny using UniFrac, representing 24.1% of average distance. In summary, the current study reveals a shared rumen microbiome and phylogenetic lineage and presents novel information on composition and individual variability of the bacterial community in the rumen of yaks. PMID:25911445

  18. Microdiversity of Deep-Sea Bacillales Isolated from Tyrrhenian Sea Sediments as Revealed by ARISA, 16S rRNA Gene Sequencing and BOX-PCR Fingerprinting

    PubMed Central

    Ettoumi, Besma; Guesmi, Amel; Brusetti, Lorenzo; Borin, Sara; Najjari, Afef; Boudabous, Abdellatif; Cherif, Ameur

    2013-01-01

    With respect to their terrestrial relatives, marine Bacillales have not been sufficiently investigated. In this report, the diversity of deep-sea Bacillales, isolated from seamount and non-seamount stations at 3,425 to 3,580 m depth in the Tyrrhenian Sea, was investigated using PCR fingerprinting and 16S rRNA sequence analysis. The isolate collection (n=120) was de-replicated by automated ribosomal intergenic spacer analysis (ARISA), and phylogenetic diversity was analyzed by 16S rRNA gene sequencing of representatives of each ARISA haplotype (n=37). Phylogenetic analysis of isolates showed their affiliation to six different genera of low G+C% content Gram-positive Bacillales: Bacillus, Staphylococcus, Exiguobacterium, Paenibacillus, Lysinibacillus and Terribacillus. Bacillus was the dominant genus represented by the species B. licheniformis, B. pumilus, B. subtilis, B. amyloliquefaciens and B. firmus, typically isolated from marine sediments. The most abundant species in the collection was B. licheniformis (n=85), which showed seven distinct ARISA haplotypes with haplotype H8 being the most dominant since it was identified by 63 isolates. The application of BOX-PCR fingerprinting to the B. licheniformis sub-collection allowed their separation into five distinct BOX genotypes, suggesting a high level of intraspecies diversity among marine B. licheniformis strains. This species also exhibited distinct strain distribution between seamount and non-seamount stations and was shown to be highly prevalent in non-seamount stations. This study revealed the great microdiversity of marine Bacillales and contributes to understanding the biogeographic distribution of marine bacteria in deep-sea sediments. PMID:24005887

  19. Microdiversity of deep-sea Bacillales isolated from Tyrrhenian sea sediments as revealed by ARISA, 16S rRNA gene sequencing and BOX-PCR fingerprinting.

    PubMed

    Ettoumi, Besma; Guesmi, Amel; Brusetti, Lorenzo; Borin, Sara; Najjari, Afef; Boudabous, Abdellatif; Cherif, Ameur

    2013-01-01

    With respect to their terrestrial relatives, marine Bacillales have not been sufficiently investigated. In this report, the diversity of deep-sea Bacillales, isolated from seamount and non-seamount stations at 3,425 to 3,580 m depth in the Tyrrhenian Sea, was investigated using PCR fingerprinting and 16S rRNA sequence analysis. The isolate collection (n=120) was de-replicated by automated ribosomal intergenic spacer analysis (ARISA), and phylogenetic diversity was analyzed by 16S rRNA gene sequencing of representatives of each ARISA haplotype (n=37). Phylogenetic analysis of isolates showed their affiliation to six different genera of low G+C% content Gram-positive Bacillales: Bacillus, Staphylococcus, Exiguobacterium, Paenibacillus, Lysinibacillus and Terribacillus. Bacillus was the dominant genus represented by the species B. licheniformis, B. pumilus, B. subtilis, B. amyloliquefaciens and B. firmus, typically isolated from marine sediments. The most abundant species in the collection was B. licheniformis (n=85), which showed seven distinct ARISA haplotypes with haplotype H8 being the most dominant since it was identified by 63 isolates. The application of BOX-PCR fingerprinting to the B. licheniformis sub-collection allowed their separation into five distinct BOX genotypes, suggesting a high level of intraspecies diversity among marine B. licheniformis strains. This species also exhibited distinct strain distribution between seamount and non-seamount stations and was shown to be highly prevalent in non-seamount stations. This study revealed the great microdiversity of marine Bacillales and contributes to understanding the biogeographic distribution of marine bacteria in deep-sea sediments. PMID:24005887

  20. bioOTU: An Improved Method for Simultaneous Taxonomic Assignments and Operational Taxonomic Units Clustering of 16s rRNA Gene Sequences.

    PubMed

    Chen, Shi-Yi; Deng, Feilong; Huang, Ying; Jia, Xianbo; Liu, Yi-Ping; Lai, Song-Jia

    2016-04-01

    Clustering of 16s rRNA amplicon sequences into operational taxonomic units (OTUs) is the most common bioinformatics pipeline for investigating microbial community by high-throughput sequencing technologies. However, the existing algorithms of OTUs clustering still remain to be improved at reliability. Here we propose an improved method (bioOTU) that first assigns taxonomy to unique tags at genus level for separating the error-free sequences of known species in reference database from artifacts, and then cluster them into OTUs by different strategies. The remaining tags, which fail to be clustered in the previous step, are further subjected to independent OTUs clustering by the optimized algorithm of heuristic clustering. The performance tests on both mock and real communities revealed that bioOTU is powerful for recovering the underlying profiles at both microbial composition and abundance, and it also produces comparable or less number of OTUs in comparison with the prevailing tools of Mothur and UPARSE. The bioOTU is implemented in C and Python languages with source codes freely available on the GitHub repository. PMID:26950196

  1. Design and Validation of Four New Primers for Next-Generation Sequencing To Target the 18S rRNA Genes of Gastrointestinal Ciliate Protozoa

    PubMed Central

    Wright, André-Denis G.

    2014-01-01

    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen. PMID:24973070

  2. Comparative 16S rRNA signatures and multilocus sequence analysis for the genus Salinicola and description of Salinicola acroporae sp. nov., isolated from coral Acropora digitifera.

    PubMed

    Lepcha, Rinchen T; Poddar, Abhijit; Schumann, Peter; Das, Subrata K

    2015-07-01

    A novel Gram-negative, aerobic, motile marine bacterium, strain S4-41(T), was isolated from mucus of the coral Acropora digitifera from the Andaman Sea. Heterotrophic growth was observed in 0-25 % NaCl, at 15-45 °C and pH 4.5-9. In phylogenetic trees, strain S4-41(T) was grouped within the genus Salinicola but formed a separate branch distant from a cluster composed of Salinicola salarius M27(T) and Salinicola socius SMB35(T). DNA-DNA relatedness between strain S4-41(T) and these reference strains were well below 70 %. Q-9 was the sole respiratory quinone. The DNA G+C content was determined to be 63.6 mol%. Based on a polyphasic analysis, strain S4-41(T) is concluded to represent a novel species in the genus Salinicola for which the name Salinicola acroporae sp. nov. is proposed. The type strain is S4-41(T) (=JCM 30412(T) = LMG 28587(T)). Comparative 16S rRNA analysis of the genera Salinicola, Kushneria, Chromohalobacter and Cobetia revealed the presence of genus specific sequence signatures. Multilocus sequence analysis based on concatenated sequences of rRNAs (16S and 23S) and four protein coding housekeeping genes (atpA, gyrB, secA, rpoD) was found to be unnecessary for phylogenetic studies of the genus Salinicola. PMID:25944083

  3. Molecular Identification of Mycobacterium Species of Public Health Importance in Cattle in Zimbabwe by 16S rRNA Gene Sequencing

    PubMed Central

    Padya, Leah; Chin'ombe, Nyasha; Magwenzi, Marcelyn; Mbanga, Joshua; Ruhanya, Vurayai; Nziramasanga, Pasipanodya

    2015-01-01

    Mycobacterium species are naturally found in the environment as well as in domestic animals such as cattle. So far, more than 150 species of Mycobacterium, some of which are pathogenic, have been identified. Laboratory isolation, detection and identification of Mycobacterium species are therefore critical if human and animal infections are to be controlled. The objective of this study was to identify Mycobacterium species isolated in cattle in Zimbabwe using 16S ribosomal RNA gene amplification and sequencing. A total of 134 cow dung samples were collected throughout Zimbabwe and mycobacteria were isolated by culture. Only 49 culture isolates that were found to be acid-fast bacilli positive by Ziehl-Neelsen staining. The 16S rRNA gene was successfully amplified by PCR in 41 (84%) of the samples. There was no amplification in 8 (16%) of the samples. Out of the 41 samples that showed amplification, 26 (63%) had strong PCR bands and were selected for DNA sequencing. Analysis of the DNA sequences showed that 7 (27%) belonged to Mycobacterium neoaurum, 6 (23%) belonged to Mycobacterium fortuitum, 3 (12%) to Mycobacterium goodii, 2 (1%) to Mycobacterium arupense, 2 (1%) to Mycobacterium peregrinum or M. septicum and 1 isolate (0.04%) to Mycobacterium elephantis. There were 5 (19%) isolates that were non-mycobacteria and identified as Gordonia terrae, a close relative of Mycobacterium. The study therefore provided a molecular basis for detection and identification of Mycobacterium species in animals and humans. PMID:26668660

  4. The small subunit rRNA gene sequence of the chonotrich Chilodochona carcini Jankowski, 1973 confirms chonotrichs as a dysteriid-derived clade (Phyllopharyngea, Ciliophora).

    PubMed

    Lynn, Denis H

    2016-08-01

    The chonotrichs are sessile ciliated protozoa that are ectosymbiotic on the body parts of a variety of crustaceans. They have long been considered a separate group because their sessile habit has resulted in the evolution of a very divergent body form and reproductive strategy compared to free-living ciliates. In the mid-20th Century, the free-living dysteriid cyrtophorian ciliates were proposed as a potential sister clade because the chonotrich bud or daughter cell showed similarities during division morphogenesis (i.e. ontogeny) to these free-living dysteriids. A single small subunit (SSU) rRNA gene sequence is available for the chonotrich Isochona sp. However, its authenticity has recently been questioned, and the placement of this sequence within the dysteriid clade has added to this controversy. In this report, the SSUrRNA gene sequence of the chonotrich Chilodochona carcini, ectosymbiotic on the green crab Carcinus maenas, is provided. Topology testing of the SSUrRNA gene phylogeny, constructed by Bayesian Inference, robustly supports the sister-group relationship of Isochona sp. and Chilodochona carcini, the monophyly of these two chonotrichs, and the divergence of the chonotrich clade within the dysteriid clade. PMID:27151876

  5. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA

    PubMed Central

    Medina, Mónica; Collins, Allen G.; Silberman, Jeffrey D.; Sogin, Mitchell L.

    2001-01-01

    We studied the evolutionary relationships among basal metazoan lineages by using complete large subunit (LSU) and small subunit (SSU) ribosomal RNA sequences for 23 taxa. After identifying competing hypotheses, we performed maximum likelihood searches for trees conforming to each hypothesis. Kishino–Hasegawa tests were used to determine whether the data (LSU, SSU, and combined) reject any of the competing hypotheses. We also conducted unconstrained tree searches, compared the resulting topologies, and calculated bootstrap indices. Shimodaira–Hasegawa tests were applied to determine whether the data reject any of the topologies resulting from the constrained and unconstrained tree searches. LSU, SSU, and the combined data strongly contradict two assertions pertaining to sponge phylogeny. Hexactinellid sponges are not likely to be the basal lineage of a monophyletic Porifera or the sister group to all other animals. Instead, Hexactinellida and Demospongia form a well-supported clade of siliceous sponges, Silicea. It remains unclear, on the basis of these data alone, whether the calcarean sponges are more closely related to Silicea or to nonsponge animals. The SSU and combined data reject the hypothesis that Bilateria is more closely related to Ctenophora than it is to Cnidaria, whereas LSU data alone do not refute either hypothesis. LSU and SSU data agree in supporting the monophyly of Bilateria, Cnidaria, Ctenophora, and Metazoa. LSU sequence data reveal phylogenetic structure in a data set with limited taxon sampling. Continued accumulation of LSU sequences should increase our understanding of animal phylogeny. PMID:11504944

  6. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA

    SciTech Connect

    Medina, Monica; Collins, Allen G.; Silberman, Jeffrey; Sogin, Mitchell L.

    2001-06-21

    We studied the evolutionary relationships among basal metazoan lineages by using complete large subunit (LSU) and small subunit (SSU) ribosomal RNA sequences for 23 taxa. After identifying competing hypotheses, we performed maximum likelihood searches for trees conforming to each hypothesis. Kishino-Hasegawa tests were used to determine whether the data (LSU, SSU, and combined) reject any of the competing hypotheses. We also conducted unconstrained tree searches, compared the resulting topologies, and calculated bootstrap indices. Shimodaira-Hasegawa tests were applied to determine whether the data reject any of the topologies resulting from the constrained and unconstrained tree searches. LSU, SSU, and the combined data strongly contradict two assertions pertaining to sponge phylogeny. Hexactinellid sponges are not likely to be the basal lineage of amonophyletic Porifera or the sister group to all other animals. Instead, Hexactinellida and Demospongia form a well-supported clade of siliceous sponges, Silicea. It remains unclear, on the basis of these data alone, whether the calcarean sponges are more closely related to Silicea or to nonsponge animals. The SSU and combined data reject the hypothesis that Bilateria is more closely related to Ctenophora than it is to Cnidaria, whereas LSU data alone do not refute either hypothesis. LSU and SSU data agree in supporting the monophyly of Bilateria, Cnidaria, Ctenophora, and Metazoa. LSU sequence data reveal phylogenetic structure in a data set with limited taxon sampling. Continued accumulation of LSU sequences should increase our understanding of animal phylogeny.

  7. Anterior Foregut Microbiota of the Glassy-Winged Sharpshooter Explored Using Deep 16S rRNA Gene Sequencing from Individual Insects

    PubMed Central

    Rogers, Elizabeth E.; Backus, Elaine A.

    2014-01-01

    The glassy-winged sharpshooter (GWSS) is an invasive insect species that transmits Xylella fastidiosa, the bacterium causing Pierce's disease of grapevine and other leaf scorch diseases. X. fastidiosa has been shown to colonize the anterior foregut (cibarium and precibarium) of sharpshooters, where it may interact with other naturally-occurring bacterial species. To evaluate such interactions, a comprehensive list of bacterial species associated with the sharpshooter cibarium and precibarium is needed. Here, a survey of microbiota associated with the GWSS anterior foregut was conducted. Ninety-six individual GWSS, 24 from each of 4 locations (Bakersfield, CA; Ojai, CA; Quincy, FL; and a laboratory colony), were characterized for bacteria in dissected sharpshooter cibaria and precibaria by amplification and sequencing of a portion of the 16S rRNA gene using Illumina MiSeq technology. An average of approximately 150,000 sequence reads were obtained per insect. The most common genus detected was Wolbachia; sequencing of the Wolbachia ftsZ gene placed this strain in supergroup B, one of two Wolbachia supergroups most commonly associated with arthropods. X. fastidiosa was detected in all 96 individuals examined. By multilocus sequence typing, both X. fastidiosa subspecies fastidiosa and subspecies sandyi were present in GWSS from California and the colony; only subspecies fastidiosa was detected in GWSS from Florida. In addition to Wolbachia and X. fastidiosa, 23 other bacterial genera were detected at or above an average incidence of 0.1%; these included plant-associated microbes (Methylobacterium, Sphingomonas, Agrobacterium, and Ralstonia) and soil- or water-associated microbes (Anoxybacillus, Novosphingobium, Caulobacter, and Luteimonas). Sequences belonging to species of the family Enterobacteriaceae also were detected but it was not possible to assign these to individual genera. Many of these species likely interact with X. fastidiosa in the cibarium and

  8. Anterior foregut microbiota of the glassy-winged sharpshooter explored using deep 16S rRNA gene sequencing from individual insects.

    PubMed

    Rogers, Elizabeth E; Backus, Elaine A

    2014-01-01

    The glassy-winged sharpshooter (GWSS) is an invasive insect species that transmits Xylella fastidiosa, the bacterium causing Pierce's disease of grapevine and other leaf scorch diseases. X. fastidiosa has been shown to colonize the anterior foregut (cibarium and precibarium) of sharpshooters, where it may interact with other naturally-occurring bacterial species. To evaluate such interactions, a comprehensive list of bacterial species associated with the sharpshooter cibarium and precibarium is needed. Here, a survey of microbiota associated with the GWSS anterior foregut was conducted. Ninety-six individual GWSS, 24 from each of 4 locations (Bakersfield, CA; Ojai, CA; Quincy, FL; and a laboratory colony), were characterized for bacteria in dissected sharpshooter cibaria and precibaria by amplification and sequencing of a portion of the 16S rRNA gene using Illumina MiSeq technology. An average of approximately 150,000 sequence reads were obtained per insect. The most common genus detected was Wolbachia; sequencing of the Wolbachia ftsZ gene placed this strain in supergroup B, one of two Wolbachia supergroups most commonly associated with arthropods. X. fastidiosa was detected in all 96 individuals examined. By multilocus sequence typing, both X. fastidiosa subspecies fastidiosa and subspecies sandyi were present in GWSS from California and the colony; only subspecies fastidiosa was detected in GWSS from Florida. In addition to Wolbachia and X. fastidiosa, 23 other bacterial genera were detected at or above an average incidence of 0.1%; these included plant-associated microbes (Methylobacterium, Sphingomonas, Agrobacterium, and Ralstonia) and soil- or water-associated microbes (Anoxybacillus, Novosphingobium, Caulobacter, and Luteimonas). Sequences belonging to species of the family Enterobacteriaceae also were detected but it was not possible to assign these to individual genera. Many of these species likely interact with X. fastidiosa in the cibarium and

  9. Melioidosis presenting as a mycotic aneurysm in a Korean patient, diagnosed by 16S rRNA sequencing and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    PubMed

    Jang, Hee Ryeong; Lee, Chung Won; Ok, Soon Jung; Kim, Min Ji; Bae, Mi Ju; Song, Seunghwan; Yi, Jongyoun; Kim, Kye-Hyung

    2015-09-01

    A case of melioidosis with a mycotic aneurysm is reported. The blood and tissue isolates were identified as three different species of Burkholderia using the automated identification systems, VITEK 2 and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). The isolate was confirmed as Burkholderia pseudomallei by 16S rRNA sequencing. The typical features of the Gram staining of colonies and 16S rRNA sequencing can be useful to identify B. pseudomallei. PMID:26216763

  10. Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.

    PubMed

    Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A

    2016-07-01

    Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. PMID:27084674

  11. Rumen Bacterial Diversity of 80 to 110-Day-Old Goats Using 16S rRNA Sequencing

    PubMed Central

    Han, Xufeng; Yang, Yuxin; Yan, Hailong; Wang, Xiaolong; Qu, Lei; Chen, Yulin

    2015-01-01

    The ability of rumen microorganisms to use fibrous plant matter plays an important role in ruminant animals; however, little information about rumen colonization by microbial populations after weaning has been reported. In this study, high-throughput sequencing was used to investigate the establishment of this microbial population in 80 to 110-day-old goats. Illumina sequencing of goat rumen samples yielded 101,356,610 nucleotides that were assembled into 256,868 reads with an average read length of 394 nucleotides. Taxonomic analysis of metagenomic reads indicated that the predominant phyla were distinct at different growth stages. The phyla Firmicutes and Synergistetes were predominant in samples taken from 80 to 100-day-old goats, but Bacteroidetes and Firmicutes became the most abundant phyla in samples from 110-day-old animals. There was a remarkable variation in the microbial populations with age; Firmicutes and Synergistetes decreased after weaning, but Bacteroidetes and Proteobacteria increased from 80 to 110 day of age. These findings suggested that colonization of the rumen by microorganisms is related to their function in the rumen digestive system. These results give a better understanding of the role of rumen microbes and the establishment of the microbial population, which help to maintain the host’s health and improve animal performance. PMID:25700157

  12. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  13. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  14. Sulfur-inhibited Thermosphaera aggregans sp. nov., a new genus of hyperthermophilic archaea isolated after its prediction from environmentally derived 16S rRNA sequences.

    PubMed

    Huber, R; Dyba, D; Huber, H; Burggraf, S; Rachel, R

    1998-01-01

    Recently, a new procedure was developed which allowed for the first time the isolation of a hyperthermophilic archaeum tracked by 165 rRNA analysis from a terrestrial hot solfataric spring ('Obsidian Pool', Yellowstone National Park, WY, USA). This novel isolate is characterized here. Cells are round cocci with a diameter of 0.2-0.8 micron, occurring singly, in pairs, short chains and in grape-like aggregates. The aggregates exhibit a weak bluish-green fluorescence under UV radiation at 420 nm. The new isolate is an anaerobic obligate heterotroph, using preferentially yeast extract for growth. The metabolic products include CO2, H2, acetate and isovalerate. Growth is observed between 65 and 90 degrees C (optimum: 85 degrees C), from pH 5.0 to 7.0 (optimum: 6.5) and up to 0.7% NaCl. The apparent activation energy for growth is about 149 kJ mol-1. Elemental sulfur or hydrogen inhibits growth. The core lipids consist mainly of acyclic and cyclic glycerol diphytanyl tetraethers. The cell envelope contains a cytoplasmic membrane covered by an amorphous layer of unknown composition; there is no evidence for a regularly arrayed surface-layer protein. The G + C content is 46 mol%. On the basis of 165 rRNA sequence comparisons in combination with morphological, physiological and biochemical properties, the isolate represents a new genus within the Desulfurococcaceae, which has been named Thermosphaera. The type species is Thermosphaera aggregans, the type strain is isolate M11TLT (= DSM 11486T). PMID:9542073

  15. The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3; end of 16S rRNA

    SciTech Connect

    Tu, Chao; Zhou, Xiaomei; Tarasov, Sergey G.; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua

    2012-03-26

    Era, composed of a GTPase domain and a K homology domain, is essential for bacterial cell viability. It is required for the maturation of 16S rRNA and assembly of the 30S ribosomal subunit. We showed previously that the protein recognizes nine nucleotides (1531{sup AUCACCUCC}1539) near the 3{prime} end of 16S rRNA, and that this recognition stimulates GTP-hydrolyzing activity of Era. In all three kingdoms of life, the 1530{sup GAUCA}1534 sequence and helix 45 (h45) (nucleotides 1506-1529) are highly conserved. It has been shown that the 1530{sup GA}1531 to 1530{sup AG}1531 double mutation severely affects the viability of bacteria. However, whether Era interacts with G1530 and/or h45 and whether such interactions (if any) contribute to the stimulation of Era's GTPase activity were not known. Here, we report two RNA structures that contain nucleotides 1506-1542 (RNA301), one in complex with Era and GDPNP (GNP), a nonhydrolysable GTP-analogue, and the other in complex with Era, GNP, and the KsgA methyltransferase. The structures show that Era recognizes 10 nucleotides, including G1530, and that Era also binds h45. Moreover, GTPase assay experiments show that G1530 does not stimulate Era's GTPase activity. Rather, A1531 and A1534 are most important for stimulation and h45 further contributes to the stimulation. Although G1530 does not contribute to the intrinsic GTPase activity of Era, its interaction with Era is important for binding and is essential for the protein to function, leading to the discovery of a new cold-sensitive phenotype of Era.

  16. Phylogeny of 54 representative strains of species in the family Pasteurellaceae as determined by comparison of 16S rRNA sequences.

    PubMed Central

    Dewhirst, F E; Paster, B J; Olsen, I; Fraser, G J

    1992-01-01

    Virtually complete 16S rRNA sequences were determined for 54 representative strains of species in the family Pasteurellaceae. Of these strains, 15 were Pasteurella, 16 were Actinobacillus, and 23 were Haemophilus. A phylogenetic tree was constructed based on sequence similarity, using the Neighbor-Joining method. Fifty-three of the strains fell within four large clusters. The first cluster included the type strains of Haemophilus influenzae, H. aegyptius, H. aphrophilus, H. haemolyticus, H. paraphrophilus, H. segnis, and Actinobacillus actinomycetemcomitans. This cluster also contained A. actinomycetemcomitans FDC Y4, ATCC 29522, ATCC 29523, and ATCC 29524 and H. aphrophilus NCTC 7901. The second cluster included the type strains of A. seminis and Pasteurella aerogenes and H. somnus OVCG 43826. The third cluster was composed of the type strains of Pasteurella multocida, P. anatis, P. avium, P. canis, P. dagmatis, P. gallinarum, P. langaa, P. stomatis, P. volantium, H. haemoglobinophilus, H. parasuis, H. paracuniculus, H. paragallinarum, and A. capsulatus. This cluster also contained Pasteurella species A CCUG 18782, Pasteurella species B CCUG 19974, Haemophilus taxon C CAPM 5111, H. parasuis type 5 Nagasaki, P. volantium (H. parainfluenzae) NCTC 4101, and P. trehalosi NCTC 10624. The fourth cluster included the type strains of Actinobacillus lignieresii, A. equuli, A. pleuropneumoniae, A. suis, A. ureae, H. parahaemolyticus, H. parainfluenzae, H. paraphrohaemolyticus, H. ducreyi, and P. haemolytica. This cluster also contained Actinobacillus species strain CCUG 19799 (Bisgaard taxon 11), A. suis ATCC 15557, H. ducreyi ATCC 27722 and HD 35000, Haemophilus minor group strain 202, and H. parainfluenzae ATCC 29242. The type strain of P. pneumotropica branched alone to form a fifth group. The branching of the Pasteurellaceae family tree was quite complex. The four major clusters contained multiple subclusters. The clusters contained both rapidly and slowly evolving

  17. Molecular characterization and phylogenetic relationships among microsporidian isolates infecting silkworm, Bombyx mori using small subunit rRNA (SSU-rRNA) gene sequence analysis.

    PubMed

    Nath, B Surendra; Gupta, S K; Bajpai, A K

    2012-12-01

    The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect. PMID:23129193

  18. Assignment of fatty acid-beta-oxidizing syntrophic bacteria to Syntrophomonadaceae fam. nov. on the basis of 16S rRNA sequence analyses

    NASA Technical Reports Server (NTRS)

    Zhao, H.; Yang, D.; Woese, C. R.; Bryant, M. P.

    1993-01-01

    After enrichment from Chinese rural anaerobic digestor sludge, anaerobic, sporing and nonsporing, saturated fatty acid-beta-oxidizing syntrophic bacteria were isolated as cocultures with H2- and formate-utilizing Methanospirillum hungatei or Desulfovibrio sp. strain G-11. The syntrophs degraded C4 to C8 saturated fatty acids, including isobutyrate and 2-methylbutyrate. They were adapted to grow on crotonate and were isolated as pure cultures. The crotonate-grown pure cultures alone did not grow on butyrate in either the presence or the absence of some common electron acceptors. However, when they were reconstituted with M. hungatei, growth on butyrate again occurred. In contrast, crotonate-grown Clostridium kluyveri and Clostridium sticklandii, as well as Clostridium sporogenes, failed to grow on butyrate when these organisms were cocultured with M. hungatei. The crotonate-grown pure subcultures of the syntrophs described above were subjected to 16S rRNA sequence analysis. Several previously documented fatty acid-beta-oxidizing syntrophs grown in pure cultures with crotonate were also subjected to comparative sequence analyses. The sequence analyses revealed that the new sporing and nonsporing isolates and other syntrophs that we sequenced, which had either gram-negative or gram-positive cell wall ultrastructure, all belonged to the phylogenetically gram-positive phylum. They were not closely related to any of the previously known subdivisions in the gram-positive phylum with which they were compared, but were closely related to each other, forming a new subdivision in the phylum. We recommend that this group be designated Syntrophomonadaceae fam. nov.; a description is given.

  19. Comparative Phylogenetic Assignment of Environmental Sequences of Genes Encoding 16S rRNA and Numerically Abundant Culturable Bacteria from an Anoxic Rice Paddy Soil

    PubMed Central

    Hengstmann, Ulf; Chin, Kuk-Jeong; Janssen, Peter H.; Liesack, Werner

    1999-01-01

    We used both cultivation and direct recovery of bacterial 16S rRNA gene (rDNA) sequences to investigate the structure of the bacterial community in anoxic rice paddy soil. Isolation and phenotypic characterization of 19 saccharolytic and cellulolytic strains are described in the accompanying paper (K.-J. Chin, D. Hahn, U. Hengstmann, W. Liesack, and P. H. Janssen, Appl. Environ. Microbiol. 65:5042–5049, 1999). Here we describe the phylogenetic positions of these strains in relation to 57 environmental 16S rDNA clone sequences. Close matches between the two data sets were obtained for isolates from the culturable populations determined by the most-probable-number counting method to be large (3 × 107 to 2.5 × 108 cells per g [dry weight] of soil). This included matches with 16S rDNA similarity values greater than 98% within distinct lineages of the division Verrucomicrobia (strain PB90-1) and the Cytophaga-Flavobacterium-Bacteroides group (strains XB45 and PB90-2), as well as matches with similarity values greater than 95% within distinct lines of descent of clostridial cluster XIVa (strain XB90) and the family Bacillaceae (strain SB45). In addition, close matches with similarity values greater than 95% were obtained for cloned 16S rDNA sequences and bacteria (strains DR1/8 and RPec1) isolated from the same type of rice paddy soil during previous investigations. The correspondence between culture methods and direct recovery of environmental 16S rDNA suggests that the isolates obtained are representative geno- and phenotypes of predominant bacterial groups which account for 5 to 52% of the total cells in the anoxic rice paddy soil. Furthermore, our findings clearly indicate that a dual approach results in a more objective view of the structural and functional composition of a soil bacterial community than either cultivation or direct recovery of 16S rDNA sequences alone. PMID:10543822

  20. A heritability-based comparison of methods used to cluster 16S rRNA gene sequences into operational taxonomic units

    PubMed Central

    Bell, Jordana T.; Spector, Tim D.; Steves, Claire J.

    2016-01-01

    A variety of methods are available to collapse 16S rRNA gene sequencing reads to the operational taxonomic units (OTUs) used in microbiome analyses. A number of studies have aimed to compare the quality of the resulting OTUs. However, in the absence of a standard method to define and enumerate the different taxa within a microbial community, existing comparisons have been unable to compare the ability of clustering methods to generate units that accurately represent functional taxonomic segregation. We have previously demonstrated heritability of the microbiome and we propose this as a measure of each methods’ ability to generate OTUs representing biologically relevant units. Our approach assumes that OTUs that best represent the functional units interacting with the hosts’ properties will produce the highest heritability estimates. Using 1,750 unselected individuals from the TwinsUK cohort, we compared 11 approaches to OTU clustering in heritability analyses. We find that de novo clustering methods produce more heritable OTUs than reference based approaches, with VSEARCH and SUMACLUST performing well. We also show that differences resulting from each clustering method are minimal once reads are collapsed by taxonomic assignment, although sample diversity estimates are clearly influenced by OTU clustering approach. These results should help the selection of sequence clustering methods in future microbiome studies, particularly for studies of human host-microbiome interactions.

  1. Phylogeny and classification of bacteria in the genera Clavibacter and Rathayibacter on the basis of 16s rRNA gene sequence analyses.

    PubMed Central

    Lee, I M; Bartoszyk, I M; Gundersen-Rindal, D E; Davis, R E

    1997-01-01

    A phylogenetic analysis by parsimony of 16S rRNA gene sequences (16S rDNA) revealed that species and subspecies of Clavibacter and Rathayibacter form a discrete monophyletic clade, paraphyletic to Corynebacterium species. Within the Clavibacter-Rathayibacter clade, four major phylogenetic groups (subclades) with a total of 10 distinct taxa were recognized: (I) species C. michiganensis; (II) species C. xyli; (III) species R. iranicus and R. tritici; and (IV) species R. rathayi. The first three groups form a monophyletic cluster, paraphyletic to R. rathayi. On the basis of the phylogeny inferred, reclassification of members of Clavibacter-Rathayibacter group is proposed. A system for classification of taxa in Clavibacter and Rathayibacter was developed based on restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified 16S rDNA sequences. The groups delineated on the basis of RFLP patterns of 16S rDNA coincided well with the subclades delineated on the basis of phylogeny. In contrast to previous classification systems, which are based primarily on phenotypic properties and are laborious, the RFLP analyses allow for rapid differentiation among species and subspecies in the two genera. PMID:9212413

  2. Application of Sequence-Specific Labeled 16S rRNA Gene Oligonucleotide Probes for Genetic Profiling of Cyanobacterial Abundance and Diversity by Array Hybridization

    PubMed Central

    Rudi, Knut; Skulberg, Olav M.; Skulberg, Randi; Jakobsen, Kjetill S.

    2000-01-01

    DNA sequence information for the small-subunit rRNA gene (16S rDNA) obtained from cyanobacterial cultures was used to investigate the presence of cyanobacteria and their abundance in natural habitats. Eight planktonic communities developing in lakes characterized by relatively low algal biomass (mesotrophic) and in lakes with correspondingly high biomass (eutrophic) were selected for the study. The organismal compositions of the water samples were analyzed genetically, using multiplex sequence-specific labeling of oligonucleotide probes targeted to 16S rDNA and subsequent hybridization of the labeled probes to their respective complements spotted onto a solid support (DNA array). Ten probes were established to determine the relative abundances of the discernible cyanobacteria encountered in the selected lakes. The probes were generally specific for their targets, as determined through analyses of clone cultures. Reproducible abundance profiles were established for the lakes investigated in the subsequent analyses of natural cyanobacterial communities. The results from the genetic analyses were then compared with information obtained from standard hydrobiological and hydrochemical analyses. Qualitatively, there were relatively good correlations among the groups of organisms (Nostoc, Microcystis, and Planktothrix species) found in the different lakes. The levels of correlation were lower for the quantitative data. This may, however, be due to differences in sample processing technique. The conclusions from these comparisons are that the genetic abundance profiles may provide a foundation for separating and quantifying genetically distinct groups of cyanobacteria in their natural habitats. PMID:10966421

  3. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  4. 5SRNAdb: an information resource for 5S ribosomal RNAs

    PubMed Central

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A.; Karlowski, Wojciech M.

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA–protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  5. Effects of Cr(III) and CR(VI) on nitrification inhibition as determined by SOUR, function-specific gene expression and 16S rRNA sequence analysis of wastewater nitrifying enrichments

    EPA Science Inventory

    The effect of Cr(III) and Cr(VI) on ammonia oxidation, the transcriptional responses of functional genes involved in nitrification and changes in 16S rRNA level sequences were examined in nitrifying enrichment cultures. The nitrifying bioreactor was operated as a continuous react...

  6. Analysis of bacterial and archaeal diversity in coastal microbial mats using massive parallel 16S rRNA gene tag sequencing

    PubMed Central

    Bolhuis, Henk; Stal, Lucas J

    2011-01-01

    Coastal microbial mats are small-scale and largely closed ecosystems in which a plethora of different functional groups of microorganisms are responsible for the biogeochemical cycling of the elements. Coastal microbial mats play an important role in coastal protection and morphodynamics through stabilization of the sediments and by initiating the development of salt-marshes. Little is known about the bacterial and especially archaeal diversity and how it contributes to the ecological functioning of coastal microbial mats. Here, we analyzed three different types of coastal microbial mats that are located along a tidal gradient and can be characterized as marine (ST2), brackish (ST3) and freshwater (ST3) systems. The mats were sampled during three different seasons and subjected to massive parallel tag sequencing of the V6 region of the 16S rRNA genes of Bacteria and Archaea. Sequence analysis revealed that the mats are among the most diverse marine ecosystems studied so far and consist of several novel taxonomic levels ranging from classes to species. The diversity between the different mat types was far more pronounced than the changes between the different seasons at one location. The archaeal community for these mats have not been studied before and revealed a strong reaction on a short period of draught during summer resulting in a massive increase in halobacterial sequences, whereas the bacterial community was barely affected. We concluded that the community composition and the microbial diversity were intrinsic of the mat type and depend on the location along the tidal gradient indicating a relation with salinity. PMID:21544102

  7. Genome sequencing and annotation of Proteus sp. SAS71

    PubMed Central

    Selim, Samy; Hassan, Sherif; Hagagy, Nashwa

    2015-01-01

    We report draft genome sequence of Proteus sp. strain SAS71, isolated from water spring in Aljouf region, Saudi Arabia. The draft genome size is 3,037,704 bp with a G + C content of 39.3% and contains 6 rRNA sequence (single copies of 5S, 16S & 23S rRNA). The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession no. LDIU00000000. PMID:26697338

  8. Characterization and phylogenetic relationships among microsporidia infecting silkworm, Bombyx mori, using inter simple sequence repeat (ISSR) and small subunit rRNA (SSU-rRNA) sequence analysis.

    PubMed

    Rao, S Nageswara; Nath, B Surendra; Saratchandra, B

    2005-06-01

    This study is the first report on the genetic characterization and relationships among different microsporidia infecting the silkworm, Bombyx mori, using inter simple sequence repeat PCR (ISSR-PCR) analysis. Six different microsporidians were distinguished through molecular DNA typing using ISSR-PCR. Thus, ISSR-PCR analysis can be a powerful tool to detect polymorphisms and identify microsporidians, which are difficult to study with microscopy because of their extremely small size. Of the 100 ISSR primers tested, only 28 primers had reproducibility and high polymorphism (93%). A total of 24 ISSR primers produced 55 unique genetic markers, which could be used to differentiate the microsporidians from each other. Among the 28 SSRs tested, the most abundant were (CA)n, (GA)n, and (GT)n repeats. The degree of band sharing was used to evaluate genetic similarity between different microsporidian isolates and to construct a phylogenetic tree using Jaccard's similarity coefficient. The results indicate that the DNA profiles based on ISSR markers can be used as diagnostic tools to identify different microsporidia with considerable accuracy. In addition, the small subunit ribosomal RNA (SSU-rRNA) sequence gene was amplified, cloned, and sequenced from each of the 6 microsporidian isolates. These sequences were compared with 20 other microsporidian SSU-rRNA sequences to develop a phylogenetic tree for the microsporidia isolated from the silkworms. This method was found to be useful in establishing the phylogenetic relationships among the different microsporidians isolated from silkworms. Of the 6 microsporidian isolates, NIK-1s revealed an SSU-rRNA gene sequence similar to Nosema bombycis, indicating that NIK-1s is similar to N. bombycis; the remaining 5 isolates, which differed from each other and from N. bombycis, were considered to be different variants belonging to the species N. bombycis. PMID:16121233

  9. CHARACTERIZATION OF BACTERIAL BIOMASS IN MARINE SEDIMENTS BENEATH THE ROSS ICE SHEET, ANTARCTICA BY PHOSPHOLIPIDS ANALYSIS AND 16S RRNA GENE SEQUENCING

    NASA Astrophysics Data System (ADS)

    Carr, S. A.; Glossner, A. W.; Dunbar, R. B.; Vogel, S. W.; Brandes, J.; Sahl, J. W.; Pepe-Ranney, C.; Spear, J. R.; Naish, T.; Powell, R. D.; Mandernack, K. W.

    2009-12-01

    heterotrophic organisms dominate these sediments, with the implication that primary productivity is derived from above. Integrating structural analyses and δ13C values of phospholipids, porewater chemistry, δ13CDIC and δ13CDIC values with 16S rRNA gene sequences provides a more comprehensive understanding of the biogeochemical influences of microbial carbon cycling that occur beneath marine sediments of Antarctica and elsewhere.

  10. Size Matters: Assessing Optimum Soil Sample Size for Fungal and Bacterial Community Structure Analyses Using High Throughput Sequencing of rRNA Gene Amplicons

    PubMed Central

    Penton, C. Ryan; Gupta, Vadakattu V. S. R.; Yu, Julian; Tiedje, James M.

    2016-01-01

    We examined the effect of different soil sample sizes obtained from an agricultural field, under a single cropping system uniform in soil properties and aboveground crop responses, on bacterial and fungal community structure and microbial diversity indices. DNA extracted from soil sample sizes of 0.25, 1, 5, and 10 g using MoBIO kits and from 10 and 100 g sizes using a bead-beating method (SARDI) were used as templates for high-throughput sequencing of 16S and 28S rRNA gene amplicons for bacteria and fungi, respectively, on the Illumina MiSeq and Roche 454 platforms. Sample size significantly affected overall bacterial and fungal community structure, replicate dispersion and the number of operational taxonomic units (OTUs) retrieved. Richness, evenness and diversity were also significantly affected. The largest diversity estimates were always associated with the 10 g MoBIO extractions with a corresponding reduction in replicate dispersion. For the fungal data, smaller MoBIO extractions identified more unclassified Eukaryota incertae sedis and unclassified glomeromycota while the SARDI method retrieved more abundant OTUs containing unclassified Pleosporales and the fungal genera Alternaria and Cercophora. Overall, these findings indicate that a 10 g soil DNA extraction is most suitable for both soil bacterial and fungal communities for retrieving optimal diversity while still capturing rarer taxa in concert with decreasing replicate variation. PMID:27313569

  11. High protists diversity in the plankton of sulfurous lakes and lagoons examined by 18s rRNA gene sequence analyses.

    PubMed

    Triadó-Margarit, Xavier; Casamayor, Emilio O

    2015-12-01

    Diversity of small protists was studied in sulfidic and anoxic (euxinic) stratified karstic lakes and coastal lagoons by 18S rRNA gene analyses. We hypothesized a major sulfide effect, reducing protist diversity and richness with only a few specialized populations adapted to deal with low-redox conditions and high-sulfide concentrations. However, genetic fingerprinting suggested similar ecological diversity in anoxic and sulfurous than in upper oxygen rich water compartments with specific populations inhabiting euxinic waters. Many of them agreed with genera previously identified by microscopic observations, but also new and unexpected groups were detected. Most of the sequences matched a rich assemblage of Ciliophora (i.e., Coleps, Prorodon, Plagiopyla, Strombidium, Metopus, Vorticella and Caenomorpha, among others) and algae (mainly Cryptomonadales). Unidentified Cercozoa, Fungi, Stramenopiles and Discoba were recurrently found. The lack of GenBank counterparts was higher in deep hypolimnetic waters and appeared differentially allocated in the different taxa, being higher within Discoba and lower in Cryptophyceae. A larger number of populations than expected were specifically detected in the deep sulfurous waters, with unknown ecological interactions and metabolic capabilities. PMID:26224512

  12. Use of 16S rRNA sequencing and quantitative PCR to correlate venous leg ulcer bacterial bioburden dynamics with wound expansion, antibiotic therapy, and healing

    PubMed Central

    Sprockett, Daniel D.; Ammons, Christine G.; Tuttle, Marie S.

    2016-01-01

    Clinical diagnosis of infection in chronic wounds is currently limited to subjective clinical signs and culture-based methods that underestimate the complexity of wound microbial bioburden as revealed by DNA-based microbial identification methods. Here, we use 16S rRNA next generation sequencing and quantitative polymerase chain reaction to characterize weekly changes in bacterial load, community structure, and diversity associated with a chronic venous leg ulcer over the 15-week course of treatment and healing. Our DNA-based methods and detailed sampling scheme reveal that the bacterial bioburden of the wound is unexpectedly dynamic, including changes in the bacterial load and community structure that correlate with wound expansion, antibiotic therapy, and healing. We demonstrate that these multidimensional changes in bacterial bioburden can be summarized using swabs taken prior to debridement, and therefore, can be more easily collected serially than debridement or biopsy samples. Overall, this case illustrates the importance of detailed clinical indicators and longitudinal sampling to determine the pathogenic significance of chronic wound microbial dynamics and guide best use of antimicrobials for improvement of healing outcomes. PMID:25902876

  13. Size Matters: Assessing Optimum Soil Sample Size for Fungal and Bacterial Community Structure Analyses Using High Throughput Sequencing of rRNA Gene Amplicons

    DOE PAGESBeta

    Penton, C. Ryan; Gupta, Vadakattu V. S. R.; Yu, Julian; Tiedje, James M.

    2016-06-02

    We examined the effect of different soil sample sizes obtained from an agricultural field, under a single cropping system uniform in soil properties and aboveground crop responses, on bacterial and fungal community structure and microbial diversity indices. DNA extracted from soil sample sizes of 0.25, 1, 5, and 10 g using MoBIO kits and from 10 and 100 g sizes using a bead-beating method (SARDI) were used as templates for high-throughput sequencing of 16S and 28S rRNA gene amplicons for bacteria and fungi, respectively, on the Illumina MiSeq and Roche 454 platforms. Sample size significantly affected overall bacterial and fungalmore » community structure, replicate dispersion and the number of operational taxonomic units (OTUs) retrieved. Richness, evenness and diversity were also significantly affected. The largest diversity estimates were always associated with the 10 g MoBIO extractions with a corresponding reduction in replicate dispersion. For the fungal data, smaller MoBIO extractions identified more unclassified Eukaryota incertae sedis and unclassified glomeromycota while the SARDI method retrieved more abundant OTUs containing unclassified Pleosporales and the fungal genera Alternaria and Cercophora. Overall, these findings indicate that a 10 g soil DNA extraction is most suitable for both soil bacterial and fungal communities for retrieving optimal diversity while still capturing rarer taxa in concert with decreasing replicate variation.« less

  14. An interlaboratory comparison of 16S rRNA gene-based terminal restriction fragment length polymorphism and sequencing methods for assessing microbial diversity of seafloor basalts

    PubMed Central

    Orcutt, Beth; Bailey, Brad; Staudigel, Hubert; Tebo, Bradley M; Edwards, Katrina J

    2009-01-01

    We present an interlaboratory comparison between full-length 16S rRNA gene sequence analysis and terminal restriction fragment length polymorphism (TRFLP) for microbial communities hosted on seafloor basaltic lavas, with the goal of evaluating how similarly these two different DNA-based methods used in two independent labs would estimate the microbial diversity of the same basalt samples. Two samples were selected for these analyses based on differences detected in the overall levels of microbial diversity between them. Richness estimators indicate that TRFLP analysis significantly underestimates the richness of the relatively high-diversity seafloor basalt microbial community: at least 50% of species from the high-diversity site are missed by TRFLP. However, both methods reveal similar dominant species from the samples, and they predict similar levels of relative diversity between the two samples. Importantly, these results suggest that DNA-extraction or PCR-related bias between the two laboratories is minimal. We conclude that TRFLP may be useful for relative comparisons of diversity between basalt samples, for identifying dominant species, and for estimating the richness and evenness of low-diversity, skewed populations of seafloor basalt microbial communities, but that TRFLP may miss a majority of species in relatively highly diverse samples. PMID:19508561

  15. Isolation and identification of lactic acid bacteria from Tarag in Eastern Inner Mongolia of China by 16S rRNA sequences and DGGE analysis.

    PubMed

    Liu, Wenjun; Bao, Qiuhua; Jirimutu; Qing, Manjun; Siriguleng; Chen, Xia; Sun, Ting; Li, Meihua; Zhang, Jiachao; Yu, Jie; Bilige, Menghe; Sun, Tiansong; Zhang, Heping

    2012-01-20

    Tarag is a characteristic fermented dairy product with rich microflora (especially lactic acid bacteria), developed by the people of Mongolian nationality in Inner Mongolia of China and Mongolia throughout history. One hundred and ninety-eight samples of Tarag were collected from scattered households in Eastern Inner Mongolia, and total of 790 isolates of lactic acid bacteria (LAB) were isolated by traditional pure culture method. To identify these isolates and analyze their biodiversity, 16S rRNA gene sequences analysis and PCR-DGGE were performed respectively. The results showed that 790 isolates could be classified as 31 species and subspecies. Among these isolates, Lactobacillus helveticus (153 strains, about 19.4%), Lactococcus lactis subsp. lactis (132 strains, about 16.7%) and Lactobacillus casei (106 strains, about 11.0%) were considered as the predominated species in the traditional fermented dairy products (Tarag) in Eastern Inner Mongolia. It was shown that the biodiversity of LAB in Tarag in Inner Mongolia was very abundant, and this traditional fermented dairy product could be considered as valuable resources for LAB isolation and probiotic selection. PMID:21689912

  16. Characterization and potential of three temperature ranges for hydrogen fermentation of cellulose by means of activity test and 16s rRNA sequence analysis.

    PubMed

    Gadow, Samir I; Jiang, Hongyu; Li, Yu-You

    2016-06-01

    A series of standardized activity experiments were performed to characterize three different temperature ranges of hydrogen fermentation from different carbon sources. 16S rRNA sequences analysis showed that the bacteria were close to Enterobacter genus in the mesophilic mixed culture (MMC) and Thermoanaerobacterium genus in the thermophilic and hyper-thermophilic mixed cultures (TMC and HMC). The MMC was able to utilize the glucose and cellulose to produce methane gas within a temperature range between 25 and 45 °C and hydrogen gas from 35 to 60°C. While, the TMC and HMC produced only hydrogen gas at all temperature ranges and the highest activity of 521.4mlH2/gVSSd was obtained by TMC. The thermodynamic analysis showed that more energy is consumed by hydrogen production from cellulose than from glucose. The experimental results could help to improve the economic feasibility of cellulosic biomass energy using three-phase technology to produce hythane. PMID:26954308

  17. Fine-scale analysis of 16S rRNA sequences reveals a high level of taxonomic diversity among vaginal Atopobium spp.

    PubMed Central

    Mendes-Soares, Helena; Krishnan, Vandhana; Settles, Matthew L.; Ravel, Jacques; Brown, Celeste J.; Forney, Larry J.

    2015-01-01

    Although vaginal microbial communities of some healthy women have high proportions of Atopobium vaginae, the genus Atopobium is more commonly associated with bacterial vaginosis, a syndrome associated with an increased risk of adverse pregnancy outcomes and the transmission of sexually transmitted diseases. Genetic differences within Atopobium species may explain why single species can be associated with both health and disease. We used 16S rRNA gene sequences from previously published studies to explore the taxonomic diversity of the genus Atopobium in vaginal microbial communities of healthy women. Although A. vaginae was the species most commonly found, we also observed three other Atopobium species in the vaginal microbiota, one of which, A. parvulum, was not previously known to reside in the human vagina. Furthermore, we found several potential novel species of the genus Atopobium and multiple phylogenetic clades of A. vaginae. The diversity of Atopobium found in our study, which focused only on samples from healthy women, is greater than previously recognized, suggesting that analysis of samples from women with BV would yield even more diversity. Classification of microbes only to the genus level may thus obfuscate differences that might be important to better understand health or disease. PMID:25778779

  18. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.

    2016-01-01

    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  19. Comparison of Fecal Microbiota of Mongolian and Thoroughbred Horses by High-throughput Sequencing of the V4 Region of the 16S rRNA Gene.

    PubMed

    Zhao, Yiping; Li, Bei; Bai, Dongyi; Huang, Jinlong; Shiraigo, Wunierfu; Yang, Lihua; Zhao, Qinan; Ren, Xiujuan; Wu, Jing; Bao, Wuyundalai; Dugarjaviin, Manglai

    2016-09-01

    The hindgut of horses is an anaerobic fermentative chamber for a complex and dynamic microbial population, which plays a critical role in health and energy requirements. Research on the gut microbiota of Mongolian horses has not been reported until now as far as we know. Mongolian horse is a major local breed in China. We performed high-throughput sequencing of the 16S rRNA genes V4 hypervariable regions from gut fecal material to characterize the gut microbiota of Mongolian horses and compare them to the microbiota in Thoroughbred horses. Fourteen Mongolian and 19 Thoroughbred horses were used in the study. A total of 593,678 sequence reads were obtained from 33 samples analyzed, which were found to belong to 16 phyla and 75 genera. The bacterial community compositions were similar for the two breeds. Firmicutes (56% in Mongolian horses and 53% in Thoroughbred horses) and Bacteroidetes (33% and 32% respectively) were the most abundant and predominant phyla followed by Spirochaete, Verrucomicrobia, Proteobacteria, and Fibrobacteres. Of these 16 phyla, five (Synergistetes, Planctomycetes, Proteobacteria, TM7, and Chloroflexi) were significantly different (p<0.05) between the two breeds. At the genus level, Treponema was the most abundant genus (43% in Mongolian horses vs 29% in Thoroughbred horses), followed by Ruminococcus, Roseburia, Pseudobutyrivibrio, and Anaeroplasma, which were detected in higher distribution proportion in Mongolian horses than in Thoroughbred horses. In contrast, Oscillibacter, Fibrobacter, Methanocorpusculum, and Succinivibrio levels were lower in Mongolian horses. Among 75 genera, 30 genera were significantly different (p<0.05) between the two breeds. We found that the environment was one of very important factors that influenced horse gut microbiota. These findings provide novel information about the gut microbiota of Mongolian horses and a foundation for future investigations of gut bacterial factors that may influence the development and

  20. Comparison of Fecal Microbiota of Mongolian and Thoroughbred Horses by High-throughput Sequencing of the V4 Region of the 16S rRNA Gene

    PubMed Central

    Zhao, Yiping; Li, Bei; Bai, Dongyi; Huang, Jinlong; Shiraigo, Wunierfu; Yang, Lihua; Zhao, Qinan; Ren, Xiujuan; Wu, Jing; Bao, Wuyundalai; Dugarjaviin, Manglai

    2016-01-01

    The hindgut of horses is an anaerobic fermentative chamber for a complex and dynamic microbial population, which plays a critical role in health and energy requirements. Research on the gut microbiota of Mongolian horses has not been reported until now as far as we know. Mongolian horse is a major local breed in China. We performed high-throughput sequencing of the 16S rRNA genes V4 hypervariable regions from gut fecal material to characterize the gut microbiota of Mongolian horses and compare them to the microbiota in Thoroughbred horses. Fourteen Mongolian and 19 Thoroughbred horses were used in the study. A total of 593,678 sequence reads were obtained from 33 samples analyzed, which were found to belong to 16 phyla and 75 genera. The bacterial community compositions were similar for the two breeds. Firmicutes (56% in Mongolian horses and 53% in Thoroughbred horses) and Bacteroidetes (33% and 32% respectively) were the most abundant and predominant phyla followed by Spirochaete, Verrucomicrobia, Proteobacteria, and Fibrobacteres. Of these 16 phyla, five (Synergistetes, Planctomycetes, Proteobacteria, TM7, and Chloroflexi) were significantly different (p<0.05) between the two breeds. At the genus level, Treponema was the most abundant genus (43% in Mongolian horses vs 29% in Thoroughbred horses), followed by Ruminococcus, Roseburia, Pseudobutyrivibrio, and Anaeroplasma, which were detected in higher distribution proportion in Mongolian horses than in Thoroughbred horses. In contrast, Oscillibacter, Fibrobacter, Methanocorpusculum, and Succinivibrio levels were lower in Mongolian horses. Among 75 genera, 30 genera were significantly different (p<0.05) between the two breeds. We found that the environment was one of very important factors that influenced horse gut microbiota. These findings provide novel information about the gut microbiota of Mongolian horses and a foundation for future investigations of gut bacterial factors that may influence the development and

  1. The Impact of Different DNA Extraction Kits and Laboratories upon the Assessment of Human Gut Microbiota Composition by 16S rRNA Gene Sequencing

    PubMed Central

    Kennedy, Nicholas A.; Walker, Alan W.; Berry, Susan H.; Duncan, Sylvia H.; Farquarson, Freda M.; Louis, Petra; Thomson, John M.; Ahmad, T; Anderson, CA; Barrett, JC; Drummond, H; Edwards, C; Hart, A; Hawkey, C; Henderson, P; Khan, M; Lamb, CA; Lee, JC; Mansfield, JC; Mathew, CG; Mowat, C; Newman, WG; Prescott, NJ; Simmons, A; Simpson, P; Taylor, K; Taylor, K; Wilson, DC; Satsangi, Jack; Flint, Harry J.; Parkhill, Julian

    2014-01-01

    Introduction Determining bacterial community structure in fecal samples through DNA sequencing is an important facet of intestinal health research. The impact of different commercially available DNA extraction kits upon bacterial community structures has received relatively little attention. The aim of this study was to analyze bacterial communities in volunteer and inflammatory bowel disease (IBD) patient fecal samples extracted using widely used DNA extraction kits in established gastrointestinal research laboratories. Methods Fecal samples from two healthy volunteers (H3 and H4) and two relapsing IBD patients (I1 and I2) were investigated. DNA extraction was undertaken using MoBio Powersoil and MP Biomedicals FastDNA SPIN Kit for Soil DNA extraction kits. PCR amplification for pyrosequencing of bacterial 16S rRNA genes was performed in both laboratories on all samples. Hierarchical clustering of sequencing data was done using the Yue and Clayton similarity coefficient. Results DNA extracted using the FastDNA kit and the MoBio kit gave median DNA concentrations of 475 (interquartile range 228-561) and 22 (IQR 9-36) ng/µL respectively (p<0.0001). Hierarchical clustering of sequence data by Yue and Clayton coefficient revealed four clusters. Samples from individuals H3 and I2 clustered by patient; however, samples from patient I1 extracted with the MoBio kit clustered with samples from patient H4 rather than the other I1 samples. Linear modelling on relative abundance of common bacterial families revealed significant differences between kits; samples extracted with MoBio Powersoil showed significantly increased Bacteroidaceae, Ruminococcaceae and Porphyromonadaceae, and lower Enterobacteriaceae, Lachnospiraceae, Clostridiaceae, and Erysipelotrichaceae (p<0.05). Conclusion This study demonstrates significant differences in DNA yield and bacterial DNA composition when comparing DNA extracted from the same fecal sample with different extraction kits. This highlights

  2. Bacterial diversity in typical Italian salami at different ripening stages as revealed by high-throughput sequencing of 16S rRNA amplicons.

    PubMed

    Połka, Justyna; Rebecchi, Annalisa; Pisacane, Vincenza; Morelli, Lorenzo; Puglisi, Edoardo

    2015-04-01

    The bacterial diversity involved in food fermentations is one of the most important factors shaping the final characteristics of traditional foods. Knowledge about this diversity can be greatly improved by the application of high-throughput sequencing technologies (HTS) coupled to the PCR amplification of the 16S rRNA subunit. Here we investigated the bacterial diversity in batches of Salame Piacentino PDO (Protected Designation of Origin), a dry fermented sausage that is typical of a regional area of Northern Italy. Salami samples from 6 different local factories were analysed at 0, 21, 49 and 63 days of ripening; raw meat at time 0 and casing samples at 21 days of ripening where also analysed, and the effect of starter addition was included in the experimental set-up. Culture-based microbiological analyses and PCR-DGGE were carried out in order to be compared with HTS results. A total of 722,196 high quality sequences were obtained after trimming, paired-reads assembly and quality screening of raw reads obtained by Illumina MiSeq sequencing of the two bacterial 16S hypervariable regions V3 and V4; manual curation of 16S database allowed a correct taxonomical classification at the species for 99.5% of these reads. Results confirmed the presence of main bacterial species involved in the fermentation of salami as assessed by PCR-DGGE, but with a greater extent of resolution and quantitative assessments that are not possible by the mere analyses of gel banding patterns. Thirty-two different Staphylococcus and 33 Lactobacillus species where identified in the salami from different producers, while the whole data set obtained accounted for 13 main families and 98 rare ones, 23 of which were present in at least 10% of the investigated samples, with casings being the major sources of the observed diversity. Multivariate analyses also showed that batches from 6 local producers tend to cluster altogether after 21 days of ripening, thus indicating that HTS has the potential

  3. Noma Affected Children from Niger Have Distinct Oral Microbial Communities Based on High-Throughput Sequencing of 16S rRNA Gene Fragments

    PubMed Central

    Whiteson, Katrine L.; Lazarevic, Vladimir; Tangomo-Bento, Manuela; Girard, Myriam; Maughan, Heather; Pittet, Didier; Francois, Patrice; Schrenzel, Jacques

    2014-01-01

    We aim to understand the microbial ecology of noma (cancrum oris), a devastating ancient illness which causes severe facial disfigurement in>140,000 malnourished children every year. The cause of noma is still elusive. A chaotic mix of microbial infection, oral hygiene and weakened immune system likely contribute to the development of oral lesions. These lesions are a plausible entry point for unidentified microorganisms that trigger gangrenous facial infections. To catalog bacteria present in noma lesions and identify candidate noma-triggering organisms, we performed a cross-sectional sequencing study of 16S rRNA gene amplicons from sixty samples of gingival fluid from twelve healthy children, twelve children suffering from noma (lesion and healthy sites), and twelve children suffering from Acute Necrotizing Gingivitis (ANG) (lesion and healthy sites). Relative to healthy individuals, samples taken from lesions in diseased mouths were enriched with Spirochaetes and depleted for Proteobacteria. Samples taken from healthy sites of diseased mouths had proportions of Spirochaetes and Proteobacteria that were similar to healthy control individuals. Samples from noma mouths did not have a higher abundance of Fusobacterium, casting doubt on its role as a causative agent of noma. Microbial communities sampled from noma and ANG lesions were dominated by the same Prevotella intermedia OTU, which was much less abundant in healthy sites sampled from the same mouths. Multivariate analysis confirmed that bacterial communities in healthy and lesion sites were significantly different. Several OTUs in the Orders Erysipelotrichales, Clostridiales, Bacteroidales, and Spirochaetales were identified as indicators of noma, suggesting that one or more microbes within these Orders is associated with the development of noma lesions. Future studies should include longitudinal sampling of viral and microbial components of this community, before and early in noma lesion development. PMID

  4. Isolation and identification by 16S rRNA sequence analysis of plant growth-promoting azospirilla from the rhizosphere of wheat.

    PubMed

    Ayyaz, Khadija; Zaheer, Ahmad; Rasul, Ghulam; Mirza, Muhammad Sajjad

    2016-01-01

    The main objective of the present study was to isolate phytohormone-producing, phosphate-solubilizing strains of Azospirillum from wheat to be used as inoculants for plant growth promotion. Five Azospirillum strains were isolated from the rhizosphere of field-grown wheat (Triticum aestivum L.), and it was confirmed by BOX-polymerase chain reaction (PCR) that the isolates were different and not re-isolates of the same strain. Sequence analysis of the PCR-amplified 16S rRNA gene indicated that four isolates showed maximum similarity to Azospirillum brasilense and one isolate showed maximum similarity to Azospirillum zeae. This is the first report indicating the presence of an A. zeae like isolate in the wheat rhizosphere in Pakistan. The bacterial isolates were characterized for their plant growth-promoting traits, phosphate solubilization, and indole-3-acetic acid (IAA) production. None of the isolates showed phosphate solubilization activity in the commonly used Pikovskaya medium. However, all strains (except AzoK4) exhibited ability to solubilize tricalcium phosphate (TCP) in modified Pikovskaya medium in which sucrose was replaced by Na-malate, as well as in TCP-supplemented Luria-Bertani (LB) medium. Organic acids, such as acetic, citric, lactic, malic, and succinic acids, were detected in culture supernatants of the tested Azospirillum strains. All strains exhibited ability to produce IAA in the growth medium, except Azospirillum sp. AzoK1. Among the strains tested, the maximum IAA production (30.49±1.04mgL(-1)) and phosphate solubilization (105.50±4.93mgL(-1)) were shown by a pure culture of Azospirillum sp. AzoK2. In pot experiments, single-strain inocula of Azospirillum sp. AzoK1 and AzoK2 improved wheat plant growth. PMID:27133558

  5. Survey of Culture, GoldenGate Assay, Universal Biosensor Assay, and 16S rRNA Gene Sequencing as Alternative Methods of Bacterial Pathogen Detection

    PubMed Central

    Pop, Mihai; Antonio, Martin; Walker, Alan W.; Mai, Volker; Ahmed, Dilruba; Oundo, Joseph; Tamboura, Boubou; Panchalingam, Sandra; Levine, Myron M.; Kotloff, Karen; Li, Shan; Magder, Laurence S.; Paulson, Joseph N.; Liu, Bo; Ikumapayi, Usman; Ebruke, Chinelo; Dione, Michel; Adeyemi, Mitchell; Rance, Richard; Stares, Mark D.; Ukhanova, Maria; Barnes, Bret; Lewis, Ian; Ahmed, Firoz; Alam, Meer Taifur; Amin, Ruhul; Siddiqui, Sabbir; Ochieng, John B.; Ouma, Emmanuel; Juma, Jane; Mailu, Eunice; Omore, Richard; O'Reilly, Ciara E.; Hannis, James; Manalili, Sheri; DeLeon, Jonna; Yasuda, Irene; Blyn, Lawrence; Ranken, Raymond; Li, Feng; Housley, Roberta; Ecker, David J.; Hossain, M. Anowar; Breiman, Robert F.; Morris, J. Glenn; McDaniel, Timothy K.; Parkhill, Julian; Saha, Debasish; Sampath, Rangarajan; Stine, O. Colin; Nataro, James P.

    2013-01-01

    Cultivation-based assays combined with PCR or enzyme-linked immunosorbent assay (ELISA)-based methods for finding virulence factors are standard methods for detecting bacterial pathogens in stools; however, with emerging molecular technologies, new methods have become available. The aim of this study was to compare four distinct detection technologies for the identification of pathogens in stools from children under 5 years of age in The Gambia, Mali, Kenya, and Bangladesh. The children were identified, using currently accepted clinical protocols, as either controls or cases with moderate to severe diarrhea. A total of 3,610 stool samples were tested by established clinical culture techniques: 3,179 DNA samples by the Universal Biosensor assay (Ibis Biosciences, Inc.), 1,466 DNA samples by the GoldenGate assay (Illumina), and 1,006 DNA samples by sequencing of 16S rRNA genes. Each method detected different proportions of samples testing positive for each of seven enteric pathogens, enteroaggregative Escherichia coli (EAEC), enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), Shigella spp., Campylobacter jejuni, Salmonella enterica, and Aeromonas spp. The comparisons among detection methods included the frequency of positive stool samples and kappa values for making pairwise comparisons. Overall, the standard culture methods detected Shigella spp., EPEC, ETEC, and EAEC in smaller proportions of the samples than either of the methods based on detection of the virulence genes from DNA in whole stools. The GoldenGate method revealed the greatest agreement with the other methods. The agreement among methods was higher in cases than in controls. The new molecular technologies have a high potential for highly sensitive identification of bacterial diarrheal pathogens. PMID:23884998

  6. Survey of culture, goldengate assay, universal biosensor assay, and 16S rRNA Gene sequencing as alternative methods of bacterial pathogen detection.

    PubMed

    Lindsay, Brianna; Pop, Mihai; Antonio, Martin; Walker, Alan W; Mai, Volker; Ahmed, Dilruba; Oundo, Joseph; Tamboura, Boubou; Panchalingam, Sandra; Levine, Myron M; Kotloff, Karen; Li, Shan; Magder, Laurence S; Paulson, Joseph N; Liu, Bo; Ikumapayi, Usman; Ebruke, Chinelo; Dione, Michel; Adeyemi, Mitchell; Rance, Richard; Stares, Mark D; Ukhanova, Maria; Barnes, Bret; Lewis, Ian; Ahmed, Firoz; Alam, Meer Taifur; Amin, Ruhul; Siddiqui, Sabbir; Ochieng, John B; Ouma, Emmanuel; Juma, Jane; Mailu, Eunice; Omore, Richard; O'Reilly, Ciara E; Hannis, James; Manalili, Sheri; Deleon, Jonna; Yasuda, Irene; Blyn, Lawrence; Ranken, Raymond; Li, Feng; Housley, Roberta; Ecker, David J; Hossain, M Anowar; Breiman, Robert F; Morris, J Glenn; McDaniel, Timothy K; Parkhill, Julian; Saha, Debasish; Sampath, Rangarajan; Stine, O Colin; Nataro, James P

    2013-10-01

    Cultivation-based assays combined with PCR or enzyme-linked immunosorbent assay (ELISA)-based methods for finding virulence factors are standard methods for detecting bacterial pathogens in stools; however, with emerging molecular technologies, new methods have become available. The aim of this study was to compare four distinct detection technologies for the identification of pathogens in stools from children under 5 years of age in The Gambia, Mali, Kenya, and Bangladesh. The children were identified, using currently accepted clinical protocols, as either controls or cases with moderate to severe diarrhea. A total of 3,610 stool samples were tested by established clinical culture techniques: 3,179 DNA samples by the Universal Biosensor assay (Ibis Biosciences, Inc.), 1,466 DNA samples by the GoldenGate assay (Illumina), and 1,006 DNA samples by sequencing of 16S rRNA genes. Each method detected different proportions of samples testing positive for each of seven enteric pathogens, enteroaggregative Escherichia coli (EAEC), enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), Shigella spp., Campylobacter jejuni, Salmonella enterica, and Aeromonas spp. The comparisons among detection methods included the frequency of positive stool samples and kappa values for making pairwise comparisons. Overall, the standard culture methods detected Shigella spp., EPEC, ETEC, and EAEC in smaller proportions of the samples than either of the methods based on detection of the virulence genes from DNA in whole stools. The GoldenGate method revealed the greatest agreement with the other methods. The agreement among methods was higher in cases than in controls. The new molecular technologies have a high potential for highly sensitive identification of bacterial diarrheal pathogens. PMID:23884998

  7. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.

    PubMed

    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto

    2015-01-01

    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group. PMID:26329975

  8. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. PMID:11779838

  9. Phylogenetic Relationships among the Cryptophyta: Analyses of Nuclear-Encoded SSU rRNA Sequences Support the Monophyly of Extant Plastid-Containing Lineages.

    PubMed

    Marin, B; Klingberg, M; Melkonian, M

    1998-09-01

    The Cryptophyta comprise photoautotrophic protists with complex plastids which harbor a remnant eukaryotic nucleus (nucleomorph) and a few heterotrophic taxa which either lack a plastid (Goniomonas) or contain a complex plastid devoid of pigments (Ieucoplast; Chilomonas). To resolve the phylogenetic relationships between photosynthetic, leucoplast-containing and aplastidial taxa, we determined complete nuclear-encoded SSU rRNA-sequences from 12 cryptophyte taxa representing the genera Cryptomonas, Chilomonas, Rhodomonas, Chroomonas, Hemiselmis, Proteomonas and Teleaulax and, as an outgroup taxon, Cyanoptyche gloeocystis (Glaucocystophyta). Phylogenetic analyses of SSU rRNA sequences from a total of 24 cryptophyte taxa rooted with 4 glaucocystophyte taxa using distance, parsimony and likelihood methods as well as LogDet transformations invariably position the aplastidial genus Goniomonas as a sister taxon to a monophyletic lineage consisting of all plastid containing cryptophytes including Chilomonas. Among the plastid-containing taxa, we identify six major clades each supported by high bootstrap values: clade I (Cryptomonas and Chilomonas), clade II (Rhodomonas, Pyrenomonas, Rhinomonas and Storeatula), clade III (Guillardia and the 'unidentified cryptophyte' strain CCMP 325), clade IV (Teleaulax and Geminigera), clade V (Proteomonas) and clade VI (Hemiselmis, Chroomonas and Komma). Clade I (Cryptomonas and Chilomonas) represents a sister group to clades II-VI which together form a monophyletic lineage; the phylogenetic relationships between clades II-VI remain largely unresolved. Chilomonas is positioned within the Cryptomonas clade and thus presumably evolved from a photosynthetic taxon of this genus. In our analysis the characters blue and red pigmentation do not correspond with a basal subdivision of the phylum, thus rejecting this character for higher-level classification of cryptophytes. However, different spectroscopic subtypes of phycoerythrin (PE I-III) and

  10. Worldwide distribution of Nitrosococcus oceani, a marine ammonia-oxidizing gamma-proteobacterium, detected by PCR and sequencing of 16S rRNA and amoA genes.

    PubMed

    Ward, Bess B; O'Mullan, Gregory D

    2002-08-01

    Diversity of cultured ammonia-oxidizing bacteria in the gamma-subdivision of the Proteobacteria was investigated by using strains isolated from various parts of the world ocean. All the strains were very similar to each other on the basis of the sequences of both the 16S rRNA and ammonia monooxygenase genes and could be characterized as a single species. Sequences were also cloned directly from environmental DNA from coastal Pacific and Atlantic sites, and these sequences represented the first Nitrosococcus oceani-like sequences obtained directly from the ocean. Most of the environmental sequences clustered tightly with those of the cultivated strains, but some sequences could represent new species of NITROSOCOCCUS: These findings imply that organisms similar to the cultivated N. oceani strains have a worldwide distribution. PMID:12147525

  11. Pedological and mineralogical investigations on a soil-paleosoil sequence within Andosols in the Western Cordillera of the Peruvian Andes (region Laramate, 14.5S)

    NASA Astrophysics Data System (ADS)

    Leceta Gobitz, Fernando; Mächtle, Bertil; Schukraft, Gerd; Meyer, Hans-Peter; Eitel, Bernhard

    2016-04-01

    An integrated research project of environmental sciences focuses on a group of four Andosol profiles in Western flank of the Peruvian southern Andes. Aim of this study is to contribute to the reconstruction of the paleo environmental conditions in the Western Cordillera of the Peruvian Andes. Standard pedological and sedimentological analysis has been conducted in order to identify morphological and geochemical features generated by climatic variations during the middle and late Holocene. Though a provenance analysis of sediments, all potential lithological sources around the town of Laramate are being examined under the scanning electron microscope, in order to find significant mineralogical associations downward the soil-profile. Preliminary results reveal two edaphic cycles within a soil-paleo soil-sequence: a relative poor developed "Ah" topsoil, mostly composed by fine grain sediments, is underlain by a well preserved "2Ah" paleo soil; a "2Bwt" subsoil exhibits signs of alteration and clay translocation; parent material in slight weathered statement at "2C" culminates the sequence. Mineralogical analytical data supports the premise, that materials in the uppermost horizons are relatable to distal geological units of the Western and Eastern Cordillera, therefore also related to other described aeolian archives from the region: "Desert Margin Loess" at the Andean foot-zone and "Mixed Loess" in the Puna grassland. The amphibole varieties Actinolite, Mg-Hornblende and Edenite could be only distinguished within the soil sediments. The fluvial transport to its current position is excluded, insofar mentioned varieties stem from the granodiorites of Coastal Batholite (downstream the study area), and the vulcanites of the Anta und Andahuaylas Formation (eastward the continental divide). References: Eitel, B., et al. (2005). "Geoarchaeological evidence from desert loess in the Nazca-Palpa region, southern Peru : Palaeoenvironmental changes and their impact on Pre

  12. Clinical and microbiological features of a cystic fibrosis patient chronically colonized with Pandoraea sputorum identified by combining 16S rRNA sequencing and matrix-assisted laser desorption ionization-time of flight mass spectrometry.

    PubMed

    Fernández-Olmos, A; Morosini, M I; Lamas, A; García-Castillo, M; García-García, L; Cantón, R; Máiz, L

    2012-03-01

    Clonal isolates identified as various nonfermentative Gram-negative bacilli over a 5-year period from sputum cultures of a 30-year-old cystic fibrosis patient were successfully reidentified as Pandoraea sputorum by combining 16S rRNA sequencing and matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). Decreased lung function improved after 1 year of azithromycin and inhaled 7%-hypertonic saline treatment. PMID:22170922

  13. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  14. Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

    NASA Technical Reports Server (NTRS)

    Viscogliosi, E.; Edgcomb, V. P.; Gerbod, D.; Noel, C.; Delgado-Viscogliosi, P.; Sogin, M. L. (Principal Investigator)

    1999-01-01

    The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

  15. Enhanced microbial diversity in the saliva microbiome induced by short-term probiotic intake revealed by 16S rRNA sequencing on the IonTorrent PGM platform.

    PubMed

    Dassi, Erik; Ballarini, Annalisa; Covello, Giuseppina; Quattrone, Alessandro; Jousson, Olivier; De Sanctis, Veronica; Bertorelli, Roberto; Denti, Michela Alessandra; Segata, Nicola

    2014-11-20

    Microbial communities populating several human body habitats are important determinants of human health. Cultivation-free community-wide approaches like bacterial 16S rRNA sequencing recently revolutionized the study of such human-associated microbial diversity, and the continuously decreasing cost/throughput ratio of current sequencing platforms is further enhancing the availability and effectiveness of microbiome research. The IonTorrent PGM platform is among the latest available commercial high-throughput sequencing tools, but it is just starting to be used for 16S rRNA surveys with only episodic assessments of its performance. We present here the first IonTorrent profiling of the human saliva microbiome collected from 12 healthy individuals. In this cohort, a subset of the volunteers was asked to assume a probiotic product, in order to investigate its impact on the composition and the structure of the saliva microbiome. Analysis of the generated dataset suggests the suitability of the IonTorrent platform for 16S rRNA surveys, even though some platform-specific choices are required to optimize the consistency of the obtained bacterial profiles. Interestingly, we found a marked and statistically significant increase of the overall bacterial diversity in the saliva of individuals who received the probiotic product compared to the control group, suggesting a short-term effect of probiotic product administration on oral microbiome composition. PMID:24670254

  16. Comparative sequence analyses on the 16S rRNA (rDNA) of Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus and proposal for creation of a new genus, Alicyclobacillus gen. nov

    NASA Technical Reports Server (NTRS)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.; Deinhard, G.; Poralla, K.

    1992-01-01

    Comparative 16S rRNA (rDNA) sequence analyses performed on the thermophilic Bacillus species Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus revealed that these organisms are sufficiently different from the traditional Bacillus species to warrant reclassification in a new genus, Alicyclobacillus gen. nov. An analysis of 16S rRNA sequences established that these three thermoacidophiles cluster in a group that differs markedly from both the obligately thermophilic organisms Bacillus stearothermophilus and the facultatively thermophilic organism Bacillus coagulans, as well as many other common mesophilic and thermophilic Bacillus species. The thermoacidophilic Bacillus species B. acidocaldarius, B. acidoterrestris, and B. cycloheptanicus also are unique in that they possess omega-alicylic fatty acid as the major natural membranous lipid component, which is a rare phenotype that has not been found in any other Bacillus species characterized to date. This phenotype, along with the 16S rRNA sequence data, suggests that these thermoacidophiles are biochemically and genetically unique and supports the proposal that they should be reclassified in the new genus Alicyclobacillus.

  17. Mitochondrial Enzyme Rhodanese Is Essential for 5 S Ribosomal RNA Import into Human Mitochondria*

    PubMed Central

    Smirnov, Alexandre; Comte, Caroline; Mager-Heckel, Anne-Marie; Addis, Vanessa; Krasheninnikov, Igor A.; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan

    2010-01-01

    5 S rRNA is an essential component of ribosomes. In eukaryotic cells, it is distinguished by particularly complex intracellular traffic, including nuclear export and re-import. The finding that in mammalian cells 5 S rRNA can eventually escape its usual circuit toward nascent ribosomes to get imported into mitochondria has made the scheme more complex, and it has raised questions about both the mechanism of 5 S rRNA mitochondrial targeting and its function inside the organelle. Previously, we showed that import of 5 S rRNA into mitochondria requires unknown cytosolic proteins. Here, one of them was identified as mitochondrial thiosulfate sulfurtransferase, rhodanese. Rhodanese in its misfolded form was found to possess a strong and specific 5 S rRNA binding activity, exploiting sites found earlier to function as signals of 5 S rRNA mitochondrial localization. The interaction with 5 S rRNA occurs cotranslationally and results in formation of a stable complex in which rhodanese is preserved in a compact enzymatically inactive conformation. Human 5 S rRNA in a branched Mg2+-free form, upon its interaction with misfolded rhodanese, demonstrates characteristic functional traits of Hsp40 cochaperones implicated in mitochondrial precursor protein targeting, suggesting that it may use this mechanism to ensure its own mitochondrial localization. Finally, silencing of the rhodanese gene caused not only a proportional decrease of 5 S rRNA import but also a general inhibition of mitochondrial translation, indicating the functional importance of the imported 5 S rRNA inside the organelle. PMID:20663881

  18. Renibacterium salmoninarum isolates from different sources possess two highly conserved copies of the rRNA operon .

    PubMed

    Grayson, T H; Alexander, S M; Cooper, L F; Gilpin, M L

    2000-07-01

    The nucleotide sequences of the rRNA genes and the 5' flanking region were determined for R. salmoninarum ATCC 33209T from overlapping products generated by PCR amplification from the genomic DNA. Comparison of the sequences with rRNA genes from a variety of bacteria demonstrated the close relatedness between R. salmoninarum and the high G+C group of the actinobacteria, in particular, Arthrobacter species. A regulatory element within the 5' leader of the rRNA operon was identical to an element, CL2, described for mycobacteria. PCR, DNA sequence analysis, and DNA hybridisation were performed to examine variation between isolates from diverse sources which represented the four 16S-23S rRNA intergenic spacer sequevars previously described for R. salmoninarum. Two 23S-5S rRNA intergenic spacer sequevars of identical length were found. DNA hybridisation using probes complementary to 23S rDNA and 16S rDNA identified two rRNA operons which were identical or nearly identical amongst 40 isolates sourced from a variety of countries. PMID:11016696

  19. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  20. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

    EPA Science Inventory

    The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

  1. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

    EPA Science Inventory

    We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). Phylogenetic analysis of 1234 and 1117 ...

  2. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development - Poster

    EPA Science Inventory

    We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). Phylogenetic analysis of 1234 and 1117 ...

  3. Bacterial diversity analysis of Huanglongbing pathogen-infected citrus, using PhyloChip and 16S rRNA gene clone library sequencing

    SciTech Connect

    Shankar Sagaram, U.; DeAngelis, K.M.; Trivedi, P.; Andersen, G.L.; Lu, S.-E.; Wang, N.

    2009-03-01

    The bacterial diversity associated with citrus leaf midribs was characterized 1 from citrus groves that contained the Huanglongbing (HLB) pathogen, which has yet to be cultivated in vitro. We employed a combination of high-density phylogenetic 16S rDNA microarray and 16S rDNA clone library sequencing to determine the microbial community composition of symptomatic and asymptomatic citrus midribs. Our results revealed that citrus leaf midribs can support a diversity of microbes. PhyloChip analysis indicated that 47 orders of bacteria from 15 phyla were present in the citrus leaf midribs while 20 orders from phyla were observed with the cloning and sequencing method. PhyloChip arrays indicated that nine taxa were significantly more abundant in symptomatic midribs compared to asymptomatic midribs. Candidatus Liberibacter asiaticus (Las) was detected at a very low level in asymptomatic plants, but was over 200 times more abundant in symptomatic plants. The PhyloChip analysis was further verified by sequencing 16S rDNA clone libraries, which indicated the dominance of Las in symptomatic leaves. These data implicate Las as the pathogen responsible for HLB disease. Citrus is the most important commercial fruit crop in Florida. In recent years, citrus Huanglongbing (HLB), also called citrus greening, has severely affected Florida's citrus production and hence has drawn an enormous amount of attention. HLB is one of the most devastating diseases of citrus (6,13), characterized by blotchy mottling with green islands on leaves, as well as stunting, fruit decline, and small, lopsided fruits with poor coloration. The disease tends to be associated with a phloem-limited fastidious {alpha}-proteobacterium given a provisional Candidatus status (Candidatus Liberobacter spp. later changed to Candidatus Liberibacter spp.) in nomenclature (18,25,34). Previous studies indicate that HLB infection causes disorder in the phloem and severely impairs the translocation of assimilates in host

  4. Genetic classification and distinguishing of Staphylococcus species based on different partial gap, 16S rRNA, hsp60, rpoB, sodA, and tuf gene sequences.

    PubMed

    Ghebremedhin, B; Layer, F; König, W; König, B

    2008-03-01

    The analysis of 16S rRNA gene sequences has been the technique generally used to study the evolution and taxonomy of staphylococci. However, the results of this method do not correspond to the results of polyphasic taxonomy, and the related species cannot always be distinguished from each other. Thus, new phylogenetic markers for Staphylococcus spp. are needed. We partially sequenced the gap gene (approximately 931 bp), which encodes the glyceraldehyde-3-phosphate dehydrogenase, for 27 Staphylococcus species. The partial sequences had 24.3 to 96% interspecies homology and were useful in the identification of staphylococcal species (F. Layer, B. Ghebremedhin, W. König, and B. König, J. Microbiol. Methods 70:542-549, 2007). The DNA sequence similarities of the partial staphylococcal gap sequences were found to be lower than those of 16S rRNA (approximately 97%), rpoB (approximately 86%), hsp60 (approximately 82%), and sodA (approximately 78%). Phylogenetically derived trees revealed four statistically supported groups: S. hyicus/S. intermedius, S. sciuri, S. haemolyticus/S. simulans, and S. aureus/epidermidis. The branching of S. auricularis, S. cohnii subsp. cohnii, and the heterogeneous S. saprophyticus group, comprising S. saprophyticus subsp. saprophyticus and S. equorum subsp. equorum, was not reliable. Thus, the phylogenetic analysis based on the gap gene sequences revealed similarities between the dendrograms based on other gene sequences (e.g., the S. hyicus/S. intermedius and S. sciuri groups) as well as differences, e.g., the grouping of S. arlettae and S. kloosii in the gap-based tree. From our results, we propose the partial sequencing of the gap gene as an alternative molecular tool for the taxonomical analysis of Staphylococcus species and for decreasing the possibility of misidentification. PMID:18174295

  5. Variable rRNA gene copies in extreme halobacteria

    SciTech Connect

    Sanz, J.L.; Marin, I.; Ramirez, L.; Amils, R. ); Abad, J.P.; Smith, C.L. )

    1988-08-25

    Using PFG electrophoresis techniques, the authors have examined the organization of rRNA gene in halobacterium species. The results show that the organization of rRNA genes among closely related halobacteria is quite heterogeneous. This contrasts with the high degree of conservation of rRNA sequence. The possible mechanism of such rRNA gene amplification and its evolutionary implications are discussed.

  6. Secondary structure of Tetrahymena thermophilia 5S ribosomal RNA as revealed by enzymatic digestion and microdensitometric analysis.

    PubMed Central

    Sneath, B; Vary, C; Pavlakis, G; Vournakis, J

    1986-01-01

    The secondary structure of [32P] end-labeled 5S rRNA from Tetrahymena thermophilia (strain B) has been investigated using the enzymes S1 nuclease, cobra venom ribonuclease and T2 ribonuclease. The results, analyzed by scanning microdensitometry and illustrated by three-dimensional computer graphics, support the secondary structure model of Curtiss and Vournakis for 5S rRNA. Aberrent mobility of certain RNA fragments on sequencing gels was observed as regions of band compression. These regions are postulated to be caused by stable internal base-pairing. The molecule was probed with T2 RNase in neutral (pH 7.5) and acidic (pH 4.5) buffers and only minor structural differences were revealed. One of the helices was found to be susceptible to enzymatic attack by both the single-strand and double-strand specific enzymes. These observations are evidence for the existence of dynamic structural equilibria in 5S rRNA. Images PMID:3005972

  7. Clone-based comparative sequence analysis of 16S rRNA genes retrieved from biodeteriorating brick buildings of the former Auschwitz II-Birkenau concentration and extermination camp.

    PubMed

    Otlewska, Anna; Adamiak, Justyna; Gutarowska, Beata

    2015-02-01

    The aim of this work was to analyze the bacterial communities in four samples of historical materials (plaster, brick, and wood) derived from buildings located in the former Auschwitz II-Birkenau concentration and extermination camp in Brzezinka, Poland. For this purpose a molecular strategy based on the construction of 16S rRNA clone libraries was used. In total, 138 partial 16S rRNA gene sequences (∼600bp) were obtained and compared. The clones belonged to phyla Proteobacteria (classes: Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria), Actinobacteria, Firmicutes, and Bacteroidetes. The plaster samples predominantly contained clones closely related to Actinobacteria and Alphaproteobacteria, brick samples contained Gammaproteobacteria, while wood samples had Actinobacteria clones. Interestingly, the historic plaster and brick samples contained the following bacteria with known and described biodeterioration potential: chemoorganotrophic Streptomyces sp. and Pseudonocardia sp., halotolerant or halophilic Rubrobacter sp., Salinisphaera sp. and Halomonas sp. Principal component analysis (PCA) showed that amongst the bacterial species detected and identified none occurred on all the tested historical materials. The 16S rRNA clone library construction method was successfully used for the detection and diversity determination of bacterial communities inhabiting brick barracks located in the former Auschwitz II-Birkenau concentration and extermination camp in Brzezinka. PMID:25458608

  8. Comparison of the nucleotide sequences of 16S rRNA, 444 Ep-ank, and groESL heat shock operon genes in naturally occurring Ehrlichia equi and human granulocytic ehrlichiosis agent isolates from Northern California.

    PubMed

    Chae, J S; Foley, J E; Dumler, J S; Madigan, J E

    2000-04-01

    We examined 11 naturally occurring isolates of Ehrlichia equi in horses and two human granulocytic ehrlichiosis agent isolates in California for sequence diversity in three genes. Ehrlichia equi isolates were from Sierra (n = 6), Mendocino (n = 3), Sonoma (n = 1), and Marin (n = 1) counties, and human granulocytic ehrlichiosis (HGE) agent isolates were obtained from Humboldt county. PCR with specific primers for 16S rRNA, 444 Ep-ank and groESL heat shock operon genes successfully produced amplicons for all 13 clinical samples. The 444 Ep-ank gene of the HGE agent and E. equi isolates from northern California is different from the eastern U.S. isolates BDS and USG3. The translated amino acid sequence of the groESL heat shock operon gene fragment is identical among E. equi, the HGE agent, and E. phagocytophila, with the exception of the northern Californian equine CASOLJ isolate. Microheterogeneity was observed in the 16S rRNA gene sequences of HGE agent and E. equi isolates from northern California. These results suggest that E. equi and the HGE agent found in California are similar or identical but may differ from the isolates of equine and human origin found in the eastern United States. PMID:10747108

  9. Composition and Metabolic Activities of the Bacterial Community in Shrimp Sauce at the Flavor-Forming Stage of Fermentation As Revealed by Metatranscriptome and 16S rRNA Gene Sequencings.

    PubMed

    Duan, Shan; Hu, Xiaoxi; Li, Mengru; Miao, Jianyin; Du, Jinghe; Wu, Rongli

    2016-03-30

    The bacterial community and the metabolic activities involved at the flavor-forming stage during the fermentation of shrimp sauce were investigated using metatranscriptome and 16S rRNA gene sequencings. Results showed that the abundance of Tetragenococcus was 95.1%. Tetragenococcus halophilus was identified in 520 of 588 transcripts annotated in the Nr database. Activation of the citrate cycle and oxidative phosphorylation, along with the absence of lactate dehydrogenase gene expression, in T. halophilus suggests that T. halophilus probably underwent aerobic metabolism during shrimp sauce fermentation. The metabolism of amino acids, production of peptidase, and degradation of limonene and pinene were very active in T. halophilus. Carnobacterium, Pseudomonas, Escherichia, Staphylococcus, Bacillus, and Clostridium were also metabolically active, although present in very small populations. Enterococcus, Abiotrophia, Streptococcus, and Lactobacillus were detected in metatranscriptome sequencing, but not in 16S rRNA gene sequencing. Many minor taxa showed no gene expression, suggesting that they were in dormant status. PMID:26978261

  10. Loop-mediated isothermal amplification assay for detection of Histomonas meleagridis infection in chickens targeting the 18S rRNA sequences.

    PubMed

    Xu, Jinjun; Qu, Chanbao; Tao, Jianping

    2014-01-01

    Histomonas meleagridis is the causative agent of histomonosis, a disease of gallinaceous fowl characterized by necrotic typhlitis, hepatitis, and high mortality. To develop a rapid and sensitive method for specific detection of H. meleagridis, an assay based on loop-mediated isothermal amplification (LAMP) targeting the 18S rRNA gene was established. The detection limit of the LAMP assay was 10 copies for standard plasmids containing an 18S rRNA gene fragment, which was superior to that of a classical PCR method. Specificity tests revealed that there was no cross-reaction with other protozoa such as Trichomonas gallinae, Blastocytis sp, Tetratrichomonas gallinarum, Plasmodium gallinaceum, Toxoplasma gondii, Eimeria tenella, Leucocytozoon caulleryi and Leucocytozoon sabrazesi. The assay was evaluated for its diagnostic utility using liver and caeca samples collected from suspected field cases, the detection rate was 100 and 97.92%, respectively. These results indicate that the LAMP assay may be a useful tool for rapid detection and identification of H. meleagridis in poultry. PMID:24320623

  11. Genetic diversity among Pasteurella multocida strains of avian, bovine, ovine and porcine origin from England and Wales by comparative sequence analysis of the 16S rRNA gene.

    PubMed

    Davies, Robert L

    2004-12-01

    Genetic diversity among 86 Pasteurella multocida isolates was investigated by comparative sequence analysis of a 1468 bp fragment of the 16S rRNA gene. The strains included 79 field isolates recovered from birds (poultry) (22), cattle (21), pigs (26) and sheep (10) within England and Wales, four Asian isolates associated with bovine haemorrhagic septicaemia, and the type strains of the three subspecies of P. multocida. Dulcitol and sorbitol fermentation patterns were also determined to establish correlations between subspecies status and phylogenetic relatedness. Nineteen 16S rRNA types were identified, but these were clustered into two distinct phylogenetic lineages, A and B. Sequences within lineages A and B had a mean number of nucleotide differences of 21.12+/-3.90. Isolates within lineage A were associated with birds, cattle, pigs and sheep, whereas those belonging to lineage B were recovered from birds and a cat. Eighty-seven per cent of the isolates were classified as P. multocida subsp. multocida by dulcitol and sorbitol fermentation patterns, but these have diverse 16S rRNA gene sequences that were represented in both lineages A and B. Avian P. multocida subsp. septica isolates were associated exclusively with lineage B, but bovine P. multocida subsp. septica isolates were present in lineage A. P. multocida subsp. gallicida isolates of avian, bovine and porcine origin represent a homogeneous group within lineage A, but they have the same 16S rRNA type as certain P. multocida subsp. multocida isolates. These findings provide strong support for the view that dulcitol and sorbitol fermentation patterns are inaccurate indicators of genetic relatedness among P. multocida strains. Avian capsular type B isolates and capsular type B and E isolates associated with haemorrhagic septicaemia of cattle and water buffaloes are closely related and form a distinct cluster within lineage A. The current subspecies nomenclature of P. multocida neither accurately reflects the

  12. Using Matrix-Assisted Laser Desorption Ionization-Time of Flight (MALDI-TOF) Complemented with Selected 16S rRNA and gyrB Genes Sequencing to Practically Identify Clinical Important Viridans Group Streptococci (VGS).

    PubMed

    Zhou, Menglan; Yang, Qiwen; Kudinha, Timothy; Zhang, Li; Xiao, Meng; Kong, Fanrong; Zhao, Yupei; Xu, Ying-Chun

    2016-01-01

    There are challenges in viridans group streptococci (VGS) identification especially for the mitis group. Few studies have investigated the performance of MALDI-TOF MS system in VGS identification. Using 16S rRNA gene and gyrB gene sequencing as a gold standard, the performance of two MALDI-TOF MS instruments in the identification of 181 VGS clinical isolates was studied. The Bruker Biotyper and Vitek MS IVD systems correctly identified 88.4% and 98.9% of the 181 isolates, respectively. The Vitek MS RUO system was the least reliable, only correctly identifying 38.7% of the isolates to species level with several misidentifications and invalid results. The Bruker Biotyper system was very unreliable in the identification of species within the mitis group. Among 22 non-pneumococci isolates (S. mitis/S. oralis/S. pseudopneumoniae), Biotyper misidentified 21 of them as S. pneumoniae leading to a low sensitivity and low positive predictive value in these species. In contrast, the Vitek MS IVD demonstrated a better resolution for pneumococci and non-pneumococci despite the inability to distinguish between S. mitis/S. oralis. For more accurate species-level identification, further improvements in the VGS spectra databases are needed. Based on MALDI-TOF analysis and selected 16S rRNA gene plus gyrB genes sequencing, we designed a practical VGS identification algorithm. PMID:27617008

  13. Comparison of the MicroScan, VITEK 2, and Crystal GP with 16S rRNA sequencing and MicroSeq 500 v2.0 analysis for coagulase-negative Staphylococci

    PubMed Central

    Kim, Miyoung; Heo, Se Ran; Choi, Soon Hee; Kwon, Hyelin; Park, Jeong Su; Seong, Moon-Woo; Lee, Do-Hoon; Park, Kyoung Un; Song, Junghan; Kim, Eui-Chong

    2008-01-01

    Background Three phenotypic identification systems (MicroScan, VITEK 2, and Crystal GP) were evaluated for their accuracy to identify coagulase-negative staphylococci (CNS). A total of 120 clinical isolates confirmed to be CNS via 16S rRNA sequencing and analysis with the MicroSeq 500 v2.0 database were assessed. Results The MicroScan, VITEK 2, and Crystal GP systems correctly identified 82.5%, 87.5%, and 67.5% of the isolates, respectively. Misidentification was the main problem in MicroScan (10.8%) and Crystal GP (23.3%) systems, whereas the main problem of VITEK 2 was low-level discrimination (7.5%). Conclusion None of the 3 phenotypic systems tested could accurately and reliably identify CNS at the species level. Further verifications such as biochemical testing or 16S rRNA sequencing together with analysis using a comparable database might be helpful in this regard. PMID:19105808

  14. Using Matrix-Assisted Laser Desorption Ionization-Time of Flight (MALDI-TOF) Complemented with Selected 16S rRNA and gyrB Genes Sequencing to Practically Identify Clinical Important Viridans Group Streptococci (VGS)

    PubMed Central

    Zhou, Menglan; Yang, Qiwen; Kudinha, Timothy; Zhang, Li; Xiao, Meng; Kong, Fanrong; Zhao, Yupei; Xu, Ying-Chun

    2016-01-01

    There are challenges in viridans group streptococci (VGS) identification especially for the mitis group. Few studies have investigated the performance of MALDI-TOF MS system in VGS identification. Using 16S rRNA gene and gyrB gene sequencing as a gold standard, the performance of two MALDI-TOF MS instruments in the identification of 181 VGS clinical isolates was studied. The Bruker Biotyper and Vitek MS IVD systems correctly identified 88.4% and 98.9% of the 181 isolates, respectively. The Vitek MS RUO system was the least reliable, only correctly identifying 38.7% of the isolates to species level with several misidentifications and invalid results. The Bruker Biotyper system was very unreliable in the identification of species within the mitis group. Among 22 non-pneumococci isolates (S. mitis/S. oralis/S. pseudopneumoniae), Biotyper misidentified 21 of them as S. pneumoniae leading to a low sensitivity and low positive predictive value in these species. In contrast, the Vitek MS IVD demonstrated a better resolution for pneumococci and non-pneumococci despite the inability to distinguish between S. mitis/S. oralis. For more accurate species-level identification, further improvements in the VGS spectra databases are needed. Based on MALDI-TOF analysis and selected 16S rRNA gene plus gyrB genes sequencing, we designed a practical VGS identification algorithm. PMID:27617008

  15. Equally parsimonious pathways through an RNA sequence space are not equally likely

    NASA Technical Reports Server (NTRS)

    Lee, Y. H.; DSouza, L. M.; Fox, G. E.

    1997-01-01

    An experimental system for determining the potential ability of sequences resembling 5S ribosomal RNA (rRNA) to perform as functional 5S rRNAs in vivo in the Escherichia coli cellular environment was devised previously. Presumably, the only 5S rRNA sequences that would have been fixed by ancestral populations are ones that were functionally valid, and hence the actual historical paths taken through RNA sequence space during 5S rRNA evolution would have most likely utilized valid sequences. Herein, we examine the potential validity of all sequence intermediates along alternative equally parsimonious trajectories through RNA sequence space which connect two pairs of sequences that had previously been shown to behave as valid 5S rRNAs in E. coli. The first trajectory requires a total of four changes. The 14 sequence intermediates provide 24 apparently equally parsimonious paths by which the transition could occur. The second trajectory involves three changes, six intermediate sequences, and six potentially equally parsimonious paths. In total, only eight of the 20 sequence intermediates were found to be clearly invalid. As a consequence of the position of these invalid intermediates in the sequence space, seven of the 30 possible paths consisted of exclusively valid sequences. In several cases, the apparent validity/invalidity of the intermediate sequences could not be anticipated on the basis of current knowledge of the 5S rRNA structure. This suggests that the interdependencies in RNA sequence space may be more complex than currently appreciated. If ancestral sequences predicted by parsimony are to be regarded as actual historical sequences, then the present results would suggest that they should also satisfy a validity requirement and that, in at least limited cases, this conjecture can be tested experimentally.

  16. Phylogenetic relationships of the marine Haplosclerida (Phylum Porifera) employing ribosomal (28S rRNA) and mitochondrial (cox1, nad1) gene sequence data.

    PubMed

    Redmond, Niamh E; Raleigh, Jean; van Soest, Rob W M; Kelly, Michelle; Travers, Simon A A; Bradshaw, Brian; Vartia, Salla; Stephens, Kelly M; McCormack, Grace P

    2011-01-01

    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, are highly congruent and suggest the presence of four clades. Clade A is comprised primarily of species of Haliclona and Callyspongia, and clade B is comprised of H. simulans and H. vansoesti (Family Chalinidae), Amphimedon queenslandica (Family Niphatidae) and Tabulocalyx (Family Phloeodictyidae), Clade C is comprised primarily of members of the Families Petrosiidae and Niphatidae, while Clade D is comprised of Aka species. The polyphletic nature of the suborders, families and genera described in other studies is also found here. PMID:21931685

  17. Phylogenetic Relationships of the Marine Haplosclerida (Phylum Porifera) Employing Ribosomal (28S rRNA) and Mitochondrial (cox1, nad1) Gene Sequence Data

    PubMed Central

    Redmond, Niamh E.; Raleigh, Jean; van Soest, Rob W. M.; Kelly, Michelle; Travers, Simon A. A.; Bradshaw, Brian; Vartia, Salla; Stephens, Kelly M.; McCormack, Grace P.

    2011-01-01

    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, are highly congruent and suggest the presence of four clades. Clade A is comprised primarily of species of Haliclona and Callyspongia, and clade B is comprised of H. simulans and H. vansoesti (Family Chalinidae), Amphimedon queenslandica (Family Niphatidae) and Tabulocalyx (Family Phloeodictyidae), Clade C is comprised primarily of members of the Families Petrosiidae and Niphatidae, while Clade D is comprised of Aka species. The polyphletic nature of the suborders, families and genera described in other studies is also found here. PMID:21931685

  18. Protist 18S rRNA gene Sequence Analysis Reveals Multiple Sources of Organic Matter Contributing to Turbidity Maxima of the Columbia River Estuary

    SciTech Connect

    Herfort, Lydie; Peterson, Tawnya D.; McCue, Lee Ann; Zuber, Peter A.

    2011-10-05

    The Columbia River estuary is traditionally considered a detritus-based ecosystem fueled in summer by organic matter (OM) from expired freshwater diatoms. Since Estuarine Turbidity Maxima (ETM) are sites of accumulation and transformation of this phytoplankton-derived OM, to further characterize the ETM protist assemblage, we collected in August 2007 bottom waters throughout an ETM event, as well as surface water during the peak of bottom turbidity, and performed biogeochemical, microscopic and molecular (18S rRNA gene clone libraries) analyses. These data confirmed that the majority of the particulate OM in ETMs is derived from chlorophyll a-poor particulate organic carbon tagged by DNA too damaged to be detected by molecular analysis.

  19. Characterization of the Relative Abundance of the Citrus Pathogen Ca. Liberibacter Asiaticus in the Microbiome of Its Insect Vector, Diaphorina citri, using High Throughput 16S rRNA Sequencing

    PubMed Central

    Fagen, Jennie R; Giongo, Adriana; Brown, Christopher T; Davis-Richardson, Austin G; Gano, Kelsey A; Triplett, Eric W

    2012-01-01

    The relationship between the causal agent of Huanglongbing (HLB), Ca. Liberibacter asiaticus(Las), and the naturally occurring endosymbiotic community of its insect vector, the Asian citrus psyllid (ACP), Diaphorina citri, was studied. Variation was observed in the titer of Las within an ACP population feeding on the same material. The cause of this disparity is unknown, and has implications for Las transmission and the spread of HLB. This study utilizes culture independent methods to establish the relationship between the ACP’s microbial community and Las acquisition. DNA from 21 psyllids was amplified using universal 16S rRNA primers with Illumina adaptor regions and a sample-specific 7- base identifier. These amplicons were then batch-sequenced on the Illumina platform. The resulting sequences were separated by the identifier, and compared to known sequences in a 16S rRNA database. The microbial communities of each psyllid were compared to determine whether a correlation exists between the ACP’s endosymbionts and level of Las acquisition. ACPs were dominated by the same four bacterialgenera regardless of the abundance of Ca.Liberibacter. A combination of qPCR and Illumina sequencing was used to establish an infection gradient among the sampled ACPs. The Ca. Liberibacter titer within the insect was found to have a strong negative relationship with an endosymbiont residing in the syncytium of the mycetocyte and a positive relationship with Wolbachia. These correlations have implications in the acquisition of Las by the ACP as well as the activities of Las within this vector. PMID:22529882

  20. Organization of rRNA structural genes in the archaebacterium Thermoplasma acidophilum.

    PubMed Central

    Tu, J; Zillig, W

    1982-01-01

    In the archaebacterium Thermoplasma acidophilum, each of the structural genes for 5S, 16S and 23S rRNA occur once per genome. In contrast to those of eubacteria and eukaryotes, they appear unlinked. The distance between the 16S and the 23S rDNA is at least 7.5 Kb, that between 23S and 5S rDNA at least 6 Kb and that between 16S and 5S rDNA at least 1.5 Kb. No linkage between those genes has been found by the analysis of recombinant plasmids carrying Bam HI and Hind III rDNA fragments as by hybridizing those plasmids to fragments of Thermoplasma DNA generated by 6 individual restriction endonucleases, recognizing hexanucleotide sequences. Images PMID:7155894

  1. Molecular characterization of Mycobacterium avium complex isolates giving discordant results in AccuProbe tests by PCR-restriction enzyme analysis, 16S rRNA gene sequencing, and DT1-DT6 PCR.

    PubMed Central

    Devallois, A; Picardeau, M; Paramasivan, C N; Vincent, V; Rastogi, N

    1997-01-01

    Based on cultural and biochemical tests, a total of 84 strains (72 clinical and 12 environmental isolates from the Caribbean Isles, Europe, and the Indian subcontinent) were identified as members of the Mycobacterium avium complex (MAC). They were further characterized with MAC, M. avium, and M. intracellulare probes of the AccuProbe system, and this was followed by selective amplification of DT6 and DT1 sequences. Seventy isolates gave concordant results; 63 were identified as M. avium, 5 were identified as M. intracellulare, and 24 remained untypeable by both methods. Fourteen isolates gave discrepant results, as they were DT1 positive but gave negative results by the M. intracellulare AccuProbe test. Consequently, a detailed molecular analysis of all DT1-positive isolates (14 discrepant strains plus 5 M. intracellulare strains) was performed by PCR-restriction analysis (PRA) of the hsp65 gene and 16S rRNA gene sequencing. The results confirmed the reported heterogeneity of M. intracellulare, as only 6 of 19 isolates (32%) gave PRA results compatible with published M. intracellulare profiles while the rest of the isolates were grouped in four previously unpublished profiles. 16S rRNA gene sequencing showed that only 8 of 19 isolates (42%) were related to M. intracellulare IWGMT 90247 (EMBL accession no. X88917), the rest being related to MCRO19 (EMBL accession no. X93030) and MIWGTMR10 (EMBL accession no. X88915). In conclusion, we have characterized a significant number of MAC isolates which were not identified by the AccuProbe test, PRA, or 16S rRNA sequencing. However, all of them were identifiable by DT1-DT6 PCR (they were DT6 negative and DT1 positive) and could be tentatively identified as M. intracellulare based on previously published observations. It is noteworthy that the majority of such isolates (14 of 19) were from the Indian subcontinent, with 12 of 14 being environmental isolates. Our study confirms the marked heterogeneity of M. intracellulare

  2. Characterisation of the human uterine microbiome in non-pregnant women through deep sequencing of the V1-2 region of the 16S rRNA gene

    PubMed Central

    Vilchez-Vargas, Ramiro; Desimpel, Fabian; Jauregui, Ruy; Vankeirsbilck, Nele; Weyers, Steven; Verhelst, Rita; De Sutter, Petra; Pieper, Dietmar H.; Van De Wiele, Tom

    2016-01-01

    Background. It is widely assumed that the uterine cavity in non-pregnant women is physiologically sterile, also as a premise to the long-held view that human infants develop in a sterile uterine environment, though likely reflecting under-appraisal of the extent of the human bacterial metacommunity. In an exploratory study, we aimed to investigate the putative presence of a uterine microbiome in a selected series of non-pregnant women through deep sequencing of the V1-2 hypervariable region of the 16S ribosomal RNA (rRNA) gene. Methods. Nineteen women with various reproductive conditions, including subfertility, scheduled for hysteroscopy and not showing uterine anomalies were recruited. Subjects were highly diverse with regard to demographic and medical history and included nulliparous and parous women. Endometrial tissue and mucus harvesting was performed by use of a transcervical device designed to obtain endometrial biopsy, while avoiding cervicovaginal contamination. Bacteria were targeted by use of a barcoded Illumina MiSeq paired-end sequencing method targeting the 16S rRNA gene V1-2 region, yielding an average of 41,194 reads per sample after quality filtering. Taxonomic annotation was pursued by comparison with sequences available through the Ribosomal Database Project and the NCBI database. Results. Out of 183 unique 16S rRNA gene amplicon sequences, 15 phylotypes were present in all samples. In some 90% of the women included, community architecture was fairly similar inasmuch B. xylanisolvens, B. thetaiotaomicron, B. fragilis and an undetermined Pelomonas taxon constituted over one third of the endometrial bacterial community. On the singular phylotype level, six women showed predominance of L. crispatus or L. iners in the presence of the Bacteroides core. Two endometrial communities were highly dissimilar, largely lacking the Bacteroides core, one dominated by L. crispatus and another consisting of a highly diverse community, including Prevotella spp

  3. Characterisation of the human uterine microbiome in non-pregnant women through deep sequencing of the V1-2 region of the 16S rRNA gene.

    PubMed

    Verstraelen, Hans; Vilchez-Vargas, Ramiro; Desimpel, Fabian; Jauregui, Ruy; Vankeirsbilck, Nele; Weyers, Steven; Verhelst, Rita; De Sutter, Petra; Pieper, Dietmar H; Van De Wiele, Tom

    2016-01-01

    Background. It is widely assumed that the uterine cavity in non-pregnant women is physiologically sterile, also as a premise to the long-held view that human infants develop in a sterile uterine environment, though likely reflecting under-appraisal of the extent of the human bacterial metacommunity. In an exploratory study, we aimed to investigate the putative presence of a uterine microbiome in a selected series of non-pregnant women through deep sequencing of the V1-2 hypervariable region of the 16S ribosomal RNA (rRNA) gene. Methods. Nineteen women with various reproductive conditions, including subfertility, scheduled for hysteroscopy and not showing uterine anomalies were recruited. Subjects were highly diverse with regard to demographic and medical history and included nulliparous and parous women. Endometrial tissue and mucus harvesting was performed by use of a transcervical device designed to obtain endometrial biopsy, while avoiding cervicovaginal contamination. Bacteria were targeted by use of a barcoded Illumina MiSeq paired-end sequencing method targeting the 16S rRNA gene V1-2 region, yielding an average of 41,194 reads per sample after quality filtering. Taxonomic annotation was pursued by comparison with sequences available through the Ribosomal Database Project and the NCBI database. Results. Out of 183 unique 16S rRNA gene amplicon sequences, 15 phylotypes were present in all samples. In some 90% of the women included, community architecture was fairly similar inasmuch B. xylanisolvens, B. thetaiotaomicron, B. fragilis and an undetermined Pelomonas taxon constituted over one third of the endometrial bacterial community. On the singular phylotype level, six women showed predominance of L. crispatus or L. iners in the presence of the Bacteroides core. Two endometrial communities were highly dissimilar, largely lacking the Bacteroides core, one dominated by L. crispatus and another consisting of a highly diverse community, including Prevotella spp

  4. Microsporidian Encephalitozoon cuniculi, a unicellular eukaryote with an unusual chromosomal dispersion of ribosomal genes and a LSU rRNA reduced to the universal core.

    PubMed Central

    Peyretaillade, E; Biderre, C; Peyret, P; Duffieux, F; Méténier, G; Gouy, M; Michot, B; Vivarès, C P

    1998-01-01

    Microsporidia are eukaryotic parasites lacking mitochondria, the ribosomes of which present prokaryote-like features. In order to better understand the structural evolution of rRNA molecules in microsporidia, the 5S and rDNA genes were investigated in Encephalitozoon cuniculi . The genes are not in close proximity. Non-tandemly arranged rDNA units are on every one of the 11 chromosomes. Such a dispersion is also shown in two other Encephalitozoon species. Sequencing of the 5S rRNA coding region reveals a 120 nt long RNA which folds according to the eukaryotic consensus structural shape. In contrast, the LSU rRNA molecule is greatly reduced in length (2487 nt). This dramatic shortening is essentially due to truncation of divergent domains, most of them being removed. Most variable stems of the conserved core are also deleted, reducing the LSU rRNA to only those structural features preserved in all living cells. This suggests that the E.cuniculi LSU rRNA performs only the basic mechanisms of translation. LSU rRNA phylogenetic analysis with the BASEML program favours a relatively recent origin of the fast evolving microsporidian lineage. Therefore, the prokaryote-like ribosomal features, such as the absence of ITS2, may be derived rather than primitive characters. PMID:9671812

  5. Microbial diversity and activity in the Nematostella vectensis holobiont: insights from 16S rRNA gene sequencing, isolate genomes, and a pilot-scale survey of gene expression

    PubMed Central

    Har, Jia Y.; Helbig, Tim; Lim, Ju H.; Fernando, Samodha C.; Reitzel, Adam M.; Penn, Kevin; Thompson, Janelle R.

    2015-01-01

    We have characterized the molecular and genomic diversity of the microbiota of the starlet sea anemone Nematostella vectensis, a cnidarian model for comparative developmental and functional biology and a year-round inhabitant of temperate salt marshes. Molecular phylogenetic analysis of 16S rRNA gene clone libraries revealed four ribotypes associated with N. vectensis at multiple locations and times. These associates include two novel ribotypes within the ε-Proteobacterial order Campylobacterales and the Spirochetes, respectively, each sharing <85% identity with cultivated strains, and two γ-Proteobacterial ribotypes sharing >99% 16S rRNA identity with Endozoicomonas elysicola and Pseudomonas oleovorans, respectively. Species-specific PCR revealed that these populations persisted in N. vectensis asexually propagated under laboratory conditions. cDNA indicated expression of the Campylobacterales and Endozoicomonas 16S rRNA in anemones from Sippewissett Marsh, MA. A collection of bacteria from laboratory raised N. vectensis was dominated by isolates from P. oleovorans and Rhizobium radiobacter. Isolates from field-collected anemones revealed an association with Limnobacter and Stappia isolates. Genomic DNA sequencing was carried out on 10 cultured bacterial isolates representing field- and laboratory-associates, i.e., Limnobacter spp., Stappia spp., P. oleovorans and R. radiobacter. Genomes contained multiple genes identified as virulence (host-association) factors while S. stellulata and L. thiooxidans genomes revealed pathways for mixotrophic sulfur oxidation. A pilot metatranscriptome of laboratory-raised N. vectensis was compared to the isolate genomes and indicated expression of ORFs from L. thiooxidans with predicted functions of motility, nutrient scavenging (Fe and P), polyhydroxyalkanoate synthesis for carbon storage, and selective permeability (porins). We hypothesize that such activities may mediate acclimation and persistence of bacteria in a N

  6. Microbial diversity and activity in the Nematostella vectensis holobiont: insights from 16S rRNA gene sequencing, isolate genomes, and a pilot-scale survey of gene expression.

    PubMed

    Har, Jia Y; Helbig, Tim; Lim, Ju H; Fernando, Samodha C; Reitzel, Adam M; Penn, Kevin; Thompson, Janelle R

    2015-01-01

    We have characterized the molecular and genomic diversity of the microbiota of the starlet sea anemone Nematostella vectensis, a cnidarian model for comparative developmental and functional biology and a year-round inhabitant of temperate salt marshes. Molecular phylogenetic analysis of 16S rRNA gene clone libraries revealed four ribotypes associated with N. vectensis at multiple locations and times. These associates include two novel ribotypes within the ε-Proteobacterial order Campylobacterales and the Spirochetes, respectively, each sharing <85% identity with cultivated strains, and two γ-Proteobacterial ribotypes sharing >99% 16S rRNA identity with Endozoicomonas elysicola and Pseudomonas oleovorans, respectively. Species-specific PCR revealed that these populations persisted in N. vectensis asexually propagated under laboratory conditions. cDNA indicated expression of the Campylobacterales and Endozoicomonas 16S rRNA in anemones from Sippewissett Marsh, MA. A collection of bacteria from laboratory raised N. vectensis was dominated by isolates from P. oleovorans and Rhizobium radiobacter. Isolates from field-collected anemones revealed an association with Limnobacter and Stappia isolates. Genomic DNA sequencing was carried out on 10 cultured bacterial isolates representing field- and laboratory-associates, i.e., Limnobacter spp., Stappia spp., P. oleovorans and R. radiobacter. Genomes contained multiple genes identified as virulence (host-association) factors while S. stellulata and L. thiooxidans genomes revealed pathways for mixotrophic sulfur oxidation. A pilot metatranscriptome of laboratory-raised N. vectensis was compared to the isolate genomes and indicated expression of ORFs from L. thiooxidans with predicted functions of motility, nutrient scavenging (Fe and P), polyhydroxyalkanoate synthesis for carbon storage, and selective permeability (porins). We hypothesize that such activities may mediate acclimation and persistence of bacteria in a N

  7. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-04-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  8. Cellular identification of a novel uncultured marine stramenopile (MAST-12 Clade) small-subunit rRNA gene sequence from a norwegian estuary by use of fluorescence in situ hybridization-scanning electron microscopy.

    PubMed

    Kolodziej, Karolina; Stoeck, Thorsten

    2007-04-01

    Revealing the cellular identity of organisms behind environmental eukaryote rRNA gene sequences is a major objective in microbial diversity research. We sampled an estuarine oxygen-depleted microbial mat in southwestern Norway and retrieved an 18S rRNA gene signature that branches in the MAST-12 clade, an environmental marine stramenopile clade. Detailed phylogenetic analyses revealed that MAST-12 branches among the heterotrophic stramenopiles as a sister of the free-living Bicosoecida and the parasitic genus Blastocystis. Specific sequence signatures confirmed a relationship to these two groups while excluding direct assignment. We designed a specific oligonucleotide probe for the target sequence and detected the corresponding organism in incubation samples using fluorescence in situ hybridization (FISH). Using the combined FISH-scanning electron microscopy approach (T. Stoeck, W. H. Fowle, and S. S. Epstein, Appl. Environ. Microbiol. 69:6856-6863, 2003), we determined the morphotype of the target organism among the very diverse possible morphologies of the heterotrophic stramenopiles. The unpigmented cell is spherical and about 5 mum in diameter and possesses a short flagellum and a long flagellum, both emanating anteriorly. The long flagellum bears mastigonemes in a characteristic arrangement, and its length (30 mum) distinguishes the target organism from other recognized heterotrophic stramenopiles. The short flagellum is naked and often directed posteriorly. The organism possesses neither a lorica nor a stalk. The morphological characteristics that we discovered should help isolate a representative of a novel stramenopile group, possibly at a high taxonomic level, in order to study its ultrastructure, physiological capabilities, and ecological role in the environment. PMID:17293516

  9. Analysis of ammonia-oxidizing bacteria from hypersaline Mono Lake, California, on the basis of 16S rRNA sequences.

    PubMed

    Ward, B B; Martino, D P; Diaz, M C; Joye, S B

    2000-07-01

    Ammonia-oxidizing bacteria were detected by PCR amplification of DNA extracted from filtered water samples throughout the water column of Mono Lake, California. Ammonia-oxidizing members of the beta subdivision of the division Proteobacteria (beta-subdivision Proteobacteria) were detected using previously characterized PCR primers; target sequences were detected by direct amplification in both surface water and below the chemocline. Denaturing gradient gel electrophoresis analysis indicated the presence of at least four different beta-subdivision ammonia oxidizers in some samples. Subsequent sequencing of amplified 16S rDNA fragments verified the presence of sequences very similar to those of cultured Nitrosomonas strains. Two separate analyses, carried out under different conditions (different reagents, locations, PCR machines, sequencers, etc.), 2 years apart, detected similar ranges of sequence diversity in these samples. It seems likely that the physiological diversity of nitrifiers exceeds the diversity of their ribosomal sequences and that these sequences represent members of the Nitrosomonas europaea group that are acclimated to alkaline, high-salinity environments. Primers specific for Nitrosococcus oceanus, a marine ammonia-oxidizing bacterium in the gamma subdivision of the Proteobacteria, did not amplify target from any samples. PMID:10877781

  10. Analysis of the 5S RNA Pool in Arabidopsis thaliana: RNAs Are Heterogeneous and Only Two of the Genomic 5S Loci Produce Mature 5S RNA

    PubMed Central

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5′- and 3′-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. [EMBL accession nos: AF330825-AF331032; AF335777-AF335873.] PMID:11779838

  11. PHYLOGENETIC ANALYSIS OF 16S RRNA GENE SEQUENCES REVEALS THE PREVALENCE OF MYCOBACTERIA SP., ALPHA-PROTEOBACTERIA, AND UNCULTURED BACTERIA IN DRINKING WATER MICROBIAL COMMUNITIES

    EPA Science Inventory

    Previous studies have shown that culture-based methods tend to underestimate the densities and diversity of bacterial populations inhabiting water distribution systems (WDS). In this study, the phylogenetic diversity of drinking water bacteria was assessed using sequence analysis...

  12. Topoisomerase I has a strong binding preference for a conserved hexadecameric sequence in the promoter region of the rRNA gene from Tetrahymena pyriformis.

    PubMed Central

    Andersen, A H; Gocke, E; Bonven, B J; Nielsen, O F; Westergaard, O

    1985-01-01

    Topoisomerase I is in situ associated with DNaseI hypersensitive sites located in the promotor and terminator regions of the extrachromosomal rDNA in Tetrahymena thermophila at sites with sequences fitting the motif (sequence in text) Reconstitution experiments with purified topoisomerase I and cloned fragments of rDNA demonstrate that the enzyme exhibits the same binding and cleavage properties on naked DNA. These observations are striking as topoisomerase I previously has been found to exhibit low sequence specificity. The specific binding of the enzyme has an absolute requirement for divalent cations with a preference for Ca2+. The strong binding to the hexadecamer has been characterized by competition experiments, and it has been used to determine the molecular weight of the enzyme. Images PMID:2987828

  13. Effects of Cr(III) and Cr(VI) on nitrification inhibition as determined by SOUR, function-specific gene expression and 16S rRNA sequence analysis of wastewater nitrifying enrichments.

    PubMed

    Kapoor, Vikram; Elk, Michael; Li, Xuan; Impellitteri, Christopher A; Santo Domingo, Jorge W

    2016-03-01

    The effect of Cr(III) and Cr(VI) on nitrification was examined with samples from nitrifying enrichment cultures using three different approaches: by measuring substrate (ammonia) specific oxygen uptake rates (SOUR), by using RT-qPCR to quantify the transcripts of functional genes involved in nitrification, and by analysis of 16S rRNA sequences to determine changes in structure and activity of the microbial communities. The nitrifying bioreactor was operated as a continuous reactor with a 24 h hydraulic retention time. The samples were exposed in batch vessels to Cr(III) (10-300 mg/L) and Cr(VI) (1-30 mg/L) for a period of 12 h. There was considerable decrease in SOUR with increasing dosages for both Cr(III) and Cr(VI), however Cr(VI) was more inhibitory than Cr(III). Based on the RT-qPCR data, there was reduction in the transcript levels of amoA and hao for increasing Cr(III) dosage, which corresponded well with the ammonia oxidation activity measured via SOUR. For Cr(VI) exposure, there was comparatively little reduction in amoA expression while hao expression decreased for 1-3 mg/L Cr(VI) and increased at 30 mg/L Cr(VI). While Nitrosomonas spp. were the dominant bacteria in the bioreactor, based on 16S rRNA sequencing, there was a considerable reduction in Nitrosomonas activity upon exposure to 300 mg/L Cr(III). In contrast, a relatively small reduction in activity was observed at 30 mg/L Cr(VI) loading. Our data that suggest that both Cr(III) and Cr(VI) were inhibitory to nitrification at concentrations near the high end of industrial effluent concentrations. PMID:26774300

  14. Caryotricha minuta (Xu et al., 2008) nov. comb., a unique marine ciliate (Protista, Ciliophora, Spirotrichea), with phylogenetic analysis of the ambiguous genus Caryotricha inferred from the small-subunit rRNA gene sequence.

    PubMed

    Miao, Miao; Shao, Chen; Jiang, Jiamei; Li, Liqiong; Stoeck, Thorsten; Song, Weibo

    2009-02-01

    A population of Kiitricha minuta Xu et al., 2008, a small kiitrichid ciliate, was isolated from a brackish water sample in Jiaozhou Bay, Qingdao, northern China. After comparison of its morphology and infraciliature, it is believed that this morphotype should be assigned to the genus Caryotricha; hence, a new combination is suggested, Caryotricha minuta (Xu et al., 2008) nov. comb. The small-subunit (SSU) rRNA gene sequence was determined in order to elucidate the phylogenetic position of this poorly known, ambiguous genus. The organism can be clearly separated from its congener, Caryotricha convexa Kahl, 1932, by the extremely shortened ventral cirral rows in the posterior ends. Based on the data available, an improved diagnosis is given for the genus: marine Kiitrichidae with prominent buccal field; two highly developed undulating membranes; non-grouped, uniform cirral rows on both ventral and dorsal sides; enlarged transverse cirri present, which are the only differentiated cirri; marginal cirri not present; one short migratory row located posterior to buccal field; structure of dorsal kineties generally in Kiitricha pattern. The sequence of the SSU rRNA gene of C. minuta differs by 13 % from that of Kiitricha marina. Molecular phylogenetic analyses (Bayesian inference, least squares, neighbour joining, maximum parsimony) indicate that Caryotricha, together with Kiitricha, diverges at a deep level from all other spirotrichs. Its branching position is between Phacodiniidia and Licnophoridia. The results strongly support the distinct separation of the Kiitricha-Caryotricha clade, which always branches basal to the Stichotrichia-Hypotrichia-Oligotrichia-Choreotrichia assemblage. These results also confirm the previous hypothesis that the Kiitricha-Caryotricha group, long assumed to be a close relation to the euplotids, represents a taxon at subclass level within the spirotrichs. PMID:19196791

  15. Determining RNA quality for NextGen sequencing: some exceptions to the gold standard rule of 23S to 16S rRNA ratio

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Using next-generation-sequencing technology to assess entire transcriptomes requires high quality starting RNA. Currently, RNA quality is routinely judged using automated microfluidic gel electrophoresis platforms and associated algorithms. Here we report that such automated methods generate false-n...

  16. Internal Transcribed Spacer 2 (nu ITS2 rRNA) Sequence-Structure Phylogenetics: Towards an Automated Reconstruction of the Green Algal Tree of Life

    PubMed Central

    Buchheim, Mark A.; Keller, Alexander; Koetschan, Christian; Förster, Frank; Merget, Benjamin; Wolf, Matthias

    2011-01-01

    Background Chloroplast-encoded genes (matK and rbcL) have been formally proposed for use in DNA barcoding efforts targeting embryophytes. Extending such a protocol to chlorophytan green algae, though, is fraught with problems including non homology (matK) and heterogeneity that prevents the creation of a universal PCR toolkit (rbcL). Some have advocated the use of the nuclear-encoded, internal transcribed spacer two (ITS2) as an alternative to the traditional chloroplast markers. However, the ITS2 is broadly perceived to be insufficiently conserved or to be confounded by introgression or biparental inheritance patterns, precluding its broad use in phylogenetic reconstruction or as a DNA barcode. A growing body of evidence has shown that simultaneous analysis of nucleotide data with secondary structure information can overcome at least some of the limitations of ITS2. The goal of this investigation was to assess the feasibility of an automated, sequence-structure approach for analysis of IT2 data from a large sampling of phylum Chlorophyta. Methodology/Principal Findings Sequences and secondary structures from 591 chlorophycean, 741 trebouxiophycean and 938 ulvophycean algae, all obtained from the ITS2 Database, were aligned using a sequence structure-specific scoring matrix. Phylogenetic relationships were reconstructed by Profile Neighbor-Joining coupled with a sequence structure-specific, general time reversible substitution model. Results from analyses of the ITS2 data were robust at multiple nodes and showed considerable congruence with results from published phylogenetic analyses. Conclusions/Significance Our observations on the power of automated, sequence-structure analyses of ITS2 to reconstruct phylum-level phylogenies of the green algae validate this approach to assessing diversity for large sets of chlorophytan taxa. Moreover, our results indicate that objections to the use of ITS2 for DNA barcoding should be weighed against the utility of an automated

  17. The effect of the macrolide antibiotic tylosin on microbial diversity in the canine small intestine as demonstrated by massive parallel 16S rRNA gene sequencing

    PubMed Central

    2009-01-01

    Background Recent studies have shown that the fecal microbiota is generally resilient to short-term antibiotic administration, but some bacterial taxa may remain depressed for several months. Limited information is available about the effect of antimicrobials on small intestinal microbiota, an important contributor to gastrointestinal health. The antibiotic tylosin is often successfully used for the treatment of chronic diarrhea in dogs, but its exact mode of action and its effect on the intestinal microbiota remain unknown. The aim of this study was to evaluate the effect of tylosin on canine jejunal microbiota. Tylosin was administered at 20 to 22 mg/kg q 24 hr for 14 days to five healthy dogs, each with a pre-existing jejunal fistula. Jejunal brush samples were collected through the fistula on days 0, 14, and 28 (14 days after withdrawal of tylosin). Bacterial diversity was characterized using massive parallel 16S rRNA gene pyrosequencing. Results Pyrosequencing revealed a previously unrecognized species richness in the canine small intestine. Ten bacterial phyla were identified. Microbial populations were phylogenetically more similar during tylosin treatment. However, a remarkable inter-individual response was observed for specific taxa. Fusobacteria, Bacteroidales, and Moraxella tended to decrease. The proportions of Enterococcus-like organisms, Pasteurella spp., and Dietzia spp. increased significantly during tylosin administration (p < 0.05). The proportion of Escherichia coli-like organisms increased by day 28 (p = 0.04). These changes were not accompanied by any obvious clinical effects. On day 28, the phylogenetic composition of the microbiota was similar to day 0 in only 2 of 5 dogs. Bacterial diversity resembled the pre-treatment state in 3 of 5 dogs. Several bacterial taxa such as Spirochaetes, Streptomycetaceae, and Prevotellaceae failed to recover at day 28 (p < 0.05). Several bacterial groups considered to be sensitive to tylosin increased in their

  18. Karyotypic diversification in Mytilus mussels (Bivalvia: Mytilidae) inferred from chromosomal mapping of rRNA and histone gene clusters

    PubMed Central

    2014-01-01

    Background Mussels of the genus Mytilus present morphologically similar karyotypes that are presumably conserved. The absence of chromosome painting probes in bivalves makes difficult verifying this hypothesis. In this context, we comparatively mapped ribosomal RNA and histone gene families on the chromosomes of Mytilus edulis, M. galloprovincialis, M. trossulus and M. californianus by fluorescent in situ hybridization (FISH). Results Major rRNA, core and linker histone gene clusters mapped to different chromosome pairs in the four taxa. In contrast, minor rRNA gene clusters showed a different behavior. In all Mytilus two of the 5S rDNA clusters mapped to the same chromosome pair and one of them showed overlapping signals with those corresponding to one of the histone H1 gene clusters. The overlapping signals on mitotic chromosomes became a pattern of alternate 5S rRNA and linker histone gene signals on extended chromatin fibers. Additionally, M. trossulus showed minor and major rDNA clusters on the same chromosome pair. Conclusion The results obtained suggest that at least some of the chromosomes bearing these sequences are orthologous and that chromosomal mapping of rRNA and histone gene clusters could be a good tool to help deciphering some of the many unsolved questions in the systematic classification of Mytilidae. PMID:25023072

  19. Complete sequence and gene organization of the Nosema heliothidis ribosomal RNA gene region.

    PubMed

    Dong, Shinan; Shen, Zhongyuan; Zhu, Feng; Tang, Xudong; Xu, Li

    2011-01-01

    By sequencing the entire ribosomal RNA (rRNA) gene region of Nosema heliothidis isolated from cotton bollworm (Helicoverpa armigera), we showed that its gene organization is similar to the type species, Nosema bombycis: the 5'-large subunit rRNA (2,490 bp)-internal transcribed spacer (192 bp)-small subunit rRNA (1,232 bp)-intergenic spacer (274 bp)-5S rRNA (115 bp)-3'. We constructed two phylogenetic trees, analyzed phylogenetic relationships, examined rRNA organization of microsporidia, and compared the secondary structure of small subunit rRNA with closely related microsporidia. The latter two features may provide important information for the classification and phylogenetic analysis of microsporidia. PMID:21895841

  20. Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

  1. Co-conservation of rRNA tetraloop sequences and helix length suggests involvement of the tetraloops in higher-order interactions

    NASA Technical Reports Server (NTRS)

    Hedenstierna, K. O.; Siefert, J. L.; Fox, G. E.; Murgola, E. J.

    2000-01-01

    Terminal loops containing four nucleotides (tetraloops) are common in structural RNAs, and they frequently conform to one of three sequence motifs, GNRA, UNCG, or CUUG. Here we compare available sequences and secondary structures for rRNAs from bacteria, and we show that helices capped by phylogenetically conserved GNRA loops display a strong tendency to be of conserved length. The simplest interpretation of this correlation is that the conserved GNRA loops are involved in higher-order interactions, intramolecular or intermolecular, resulting in a selective pressure for maintaining the lengths of these helices. A small number of conserved UNCG loops were also found to be associated with conserved length helices, consistent with the possibility that this type of tetraloop also takes part in higher-order interactions.

  2. A combination of morphology and 28S rRNA gene sequences provide grouping and ranking criteria to merge eight into three Ambispora species (Ambisporaceae, Glomeromycota).

    PubMed

    Bills, Robert J; Morton, Joseph B

    2015-08-01

    Ambispora, the only genus in Ambisporaceae and one of three deeply rooted families in Archaeosporales, Glomeromycetes, is amended. Analysis of the morphology of specimens from types and living cultures and 28S ribosomal DNA (rDNA; LSU) sequences resulted in two major changes that redefined Ambispora to include only species with the potential for spore dimorphism (acaulosporoid and glomoid). First, species described as producing only glomoid spores (Ambispora leptoticha, Ambispora fecundispora, and Ambispora callosa), only acaulosporoid spores (Ambispora jimgerdemannii), or both spore morphotypes (Ambispora appendicula) were synonymized with a redefined dimorphic species, A. leptoticha. LSU sequences and more conserved SSU gene data indicated little divergence between genotypes formerly classified as separate species. Second, Ambispora fennica was synonymized with Ambispora gerdemannii based on morphological and LSU sequence variation equivalent to that measured in the sister clade A. leptoticha. With this analysis, Ambispora was reduced to three species: A. leptoticha, A. gerdemannii, and Ambispora granatensis. Morphological and molecular characters were given equal treatment in this study, as each data set informed and clarified grouping and ranking decisions. The two inner layers of the acaulosporoid spore wall were the only structural characters uniquely defining each of these three species; all other characters were shared. Phenotypes of glomoid spores were indistinguishable between species, and thus were informative only at the genus level. Distinct subclade structure of the LSU gene tree suggests fixation of discrete variants typical of clonal reproduction and possible retention of polymorphisms in rDNA repeats, so that not all discrete genetic variants are indicative of speciation. PMID:25638691

  3. Morphology and small subunit rRNA gene sequence of Uronemita parabinucleata n. sp. (Ciliophora, Uronematidae), with an improved generic diagnosis.

    PubMed

    Liu, Mingjian; Gao, Feng; Al-Farraj, Saleh A; Hu, Xiaozhong

    2016-06-01

    The morphology and infraciliature of a new species, Uronemita parabinucleata n. sp., isolated from intertidal sediments in a coastal region in northern China, were investigated using live observation and silver impregnation methods. The new species is characterized by an in vivo body size of about 20-50×10-25μm, 22 or 23 somatic kineties, two macronuclear nodules, and one caudal cilium. Its small subunit ribosomal RNA gene (SSU rDNA) was sequenced and compared with those of other Uronemita species to reveal nucleotide differences. Phylogenetic analyses indicated that Uronemita is monophyletic and that the new species clusters with its congener Uronemita filificum, with full support provided by both Bayesian inference and maximum likelihood algorithms. Based on previous studies and the present study, an improved diagnosis of the genus Uronemita is supplied, which has been absent since the establishment of this genus. A key to the Uronemita species is also provided. PMID:26999559

  4. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    PubMed Central

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  5. Further consideration of the phylogeny of some "traditional" heterotrichs (Protista, Ciliophora) of uncertain affinities, based on new sequences of the small subunit rRNA gene.

    PubMed

    Miao, Miao; Song, Weibo; Clamp, John C; Al-Rasheid, Khaled A S; Al-Khedhairy, Abdulaziz A; Al-Arifi, Saud

    2009-01-01

    The systematic relationships and taxonomic positions of the traditional heterotrich genera Condylostentor, Climacostomum, Fabrea, Folliculina, Peritromus, and Condylostoma, as well as the licnophorid genus Licnophora, were re-examined using new data from sequences of the gene coding for small subunit ribosomal RNA. Trees constructed using distance-matrix, Bayesian inference, and maximum-parsimony methods all showed the following relationships: (1) the "traditional" heterotrichs consist of several paraphyletic groups, including the current classes Heterotrichea, Armophorea and part of the Spirotrichea; (2) the class Heterotrichea was confirmed as a monophyletic assemblage based on our analyses of 31 taxa, and the genus Peritromus was demonstrated to be a peripheral group; (3) the genus Licnophora occupied an isolated branch on one side of the deepest divergence in the subphylum Intramacronucleata and was closely affiliated with spirotrichs, armophoreans, and clevelandellids; (4) Condylostentor, a recently defined genus with several truly unique morphological features, is more closely related to Condylostoma than to Stentor; (5) Folliculina, Eufolliculina, and Maristentor always clustered together with high bootstrap support; and (6) Climacostomum occupied a paraphyletic position distant from Fabrea, showing a close relationship with Condylostomatidae and Chattonidiidae despite of modest support. PMID:19527351

  6. The intestinal microbiota of piglets fed with wheat bran variants as characterised by 16S rRNA next-generation amplicon sequencing.

    PubMed

    Kraler, Manuel; Ghanbari, Mahdi; Domig, Konrad J; Schedle, Karl; Kneifel, Wolfgang

    2016-06-01

    The intestinal microbiota of piglets fed with a Control diet low in dietary fibre and modified wheat bran variants as an additional source of insoluble dietary fibre was characterised. In this context, variances in the microbiota of three different gut segments were assessed. Wheat bran was either included in its native form or modified by fermentation and extrusion before added at 150 g/kg to a basal diet for 48 piglets (12 animals per treatment). Total DNA was extracted from digesta samples from the jejunum, the end of the ileum and the colon ascendens. Samples were prepared accordingly for subsequent sequencing with the Illumina MiSeq. The obtained results revealed distinct location-specific differences in microbial composition. While Firmicutes were most predominant in all three gut segments, Bacteroidetes were additionally found in the colon at high abundance. The parameters of alpha and beta diversity analysis showed significant differences (p < 0.01) between the colon and the other two gut segments. Specialised bacterial groups like Prevotella and Ruminococcaceae were among the most predominant ones found in the colon, as they possess cellulolytic properties to degrade (at least partially) non-starch polysaccharides, while their abundance was negligible in the jejunum and the ileum. Conversely, the genera Lactobacillus, Bifidobacterium and Veillonella, for example, were among the most predominant groups in the jejunum and ileum, while in the colon they were hardly found. Although statistical taxonomical evaluation, following p-value correction, did not reveal pronounced differences in abundance related to bran modification, alpha and beta diversity analysis showed an influence regarding the various feeding strategies applied. Based on these findings, a more in-depth view on intestinal microbial composition within the gastrointestinal tract of young pigs fed with low- and high-fibre diets was generated. PMID:27032029

  7. Gordonia Species as Emerging Causes of Continuous-Ambulatory-Peritoneal-Dialysis-Related Peritonitis Identified by 16S rRNA and secA1 Gene Sequencing and Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry (MALDI-TOF MS)

    PubMed Central

    Lam, Jimmy Y. W.; Leung, Wai-Shing; Cheung, Ingrid; Chan, Jasper F. W.; Tse, Cindy W. S.; Lee, Rodney A.; Lau, Susanna K. P.

    2014-01-01

    We report here four cases of continuous ambulatory peritoneal dialysis-related peritonitis caused by three different species of Gordonia. The portal of entry was likely through Tenckhoff catheters. 16S rRNA and secA1 gene sequencing are so far the most reliable methods for the accurate identification of Gordonia species. PMID:25428146

  8. Description of Eurystomatella sinica n. gen., n. sp., with establishment of a new family Eurystomatellidae n. fam. (Protista, Ciliophora, Scuticociliatia) and analyses of its phylogeny inferred from sequences of the small-subunit rRNA gene.

    PubMed

    Miao, Miao; Wang, Yangang; Song, Weibo; Clamp, John C; Al-Rasheid, Khaled A S

    2010-02-01

    Recently, an undescribed marine ciliate was isolated from China. Investigation of its morphology and infraciliature revealed it as an undescribed species representing a new genus, Eurystomatella n. gen., the type of the new family Eurystomatellidae n. fam. The new family is defined by close-set, apically positioned oral membranelles and a dominant buccal field that is surrounded by an almost completely circular paroral membrane. The new genus is defined by having a small oral membranelle 1 (M1), bipartite M2 and well-developed M3, a body surface faintly sculptured with a silverline system in a quadrangular, reticulate pattern and a cytostome located at the anterior third of a large buccal field. The type species of the new genus, Eurystomatella sinica n. sp., is a morphologically unique form that is defined mainly by the combination of a conspicuously flattened body, several caudal cilia, extremely long cilia associated with the buccal apparatus and a contractile vacuole located subcaudally. According to phylogenetic analyses of small-subunit (SSU) rRNA gene sequences, Eurystomatella clusters with the genus Cyclidium, as a sister group to the family Pleuronematidae. The great divergence in both buccal and somatic ciliature between Eurystomatella and all other known scuticociliates supports the establishment of a new family for Eurystomatella. PMID:19651734

  9. Illumina sequencing of the V4 hypervariable region 16S rRNA gene reveals extensive changes in bacterial communities in the cecum following carbohydrate oral infusion and development of early-stage acute laminitis in the horse.

    PubMed

    Moreau, Michael M; Eades, Susan C; Reinemeyer, Craig R; Fugaro, Michael N; Onishi, Janet C

    2014-01-31

    In the equine carbohydrate overload model of acute laminitis, disease progression is associated with changes in bacteria found in the cecum. To date, research has focused on changes in specific Gram-positive bacteria in this portion of the intestinal tract. Metagenomic methods are now available making it possible to interrogate microbial communities using animal protocols that sufficiently power a study. In this study, the microbiota in cecal fluid collected from control, non-laminitic horses (n=8) and from horses with early-stage acute laminitis induced with either oligofructan (n=6) or cornstarch (n=6) were profiled. The microbiota were identified based on sequencing the V4 hypervariable region of the 16S rRNA gene. The results of the study show that the relative abundance of Lactobacillus sp. and Streptococcus sp. increased significantly (p<0.05) following OF and CS infusion. Other significant changes included an increase (p<0.05) in relative abundance of Veillonella sp. and Serratia sp., two potentially pathogenic, Gram-negative bacteria. Significant decreases in the relative abundance of presumptive normal flora were detected as well. Although changes in cecal microbiota described in this communication are from a pilot study, it is hypothesized that an overgrowth of pathogenic Gram-negative bacteria develops and contributes to enterocolitis, pyrexia and lameness in the carbohydrate overload model of acute laminitis. PMID:24355533

  10. Morphology and small-subunit rRNA gene sequences of two novel marine ciliates, Metanophrys orientalis spec. nov. and Uronemella sinensis spec. nov. (Protista, Ciliophora, Scuticociliatia), with an improved diagnosis of the genus Uronemella.

    PubMed

    Pan, Xuming; Zhu, Mingzhuang; Ma, Honggang; Al-Rasheid, Khaled A S; Hu, Xiaozhong

    2013-09-01

    The morphology and infraciliature of two novel marine scuticociliates, Metanophrys orientalis spec. nov. and Uronemella sinensis spec. nov., collected from sandy beaches at Qingdao, China, were investigated using live observation and protargol-staining methods. Metanophrys orientalis spec. nov. is distinguished by the following characteristics: marine habitat and a slender to elongate oval body with pointed anterior end and rounded caudal end, in vivo about 25-50 µm long; buccal field about a quarter to a third of body length; nine or ten somatic kineties with dikinetids approximately in anterior half of body, monokinetids in posterior half; membranelles 1 and 2 almost equal in length and composed of two and three longitudinal rows of kinetids respectively; paroral membrane with zigzag structure extending anteriorly to middle portion of membranelle 2; contractile vacuole pore located at posterior end of somatic kinety 1. The genus Uronemella is redefined as follows: marine form with an elongate-elliptical or inverted pear-shaped body; apical plate conspicuous; buccal field about two-thirds of body length, cytostome subequatorially located; oral apparatus Uronema-like; somatic kineties comprising a mixture of dikinetids and monokinetids. Uronemella sinensis spec. nov. is recognized by having an elongate-elliptical body with truncated apical frontal plate, size in vivo about 25-35 × 15-20 µm, nine or ten somatic kineties, membranelle 1 consisting of two or three basal bodies, contractile vacuole pore at posterior end of somatic kinety 1. This study also compared the small-subunit rRNA gene sequences of these two species with other closely related species to show the sequence divergence, which ranged from 3.53 to 9.60%. Phylogenetic analyses support the contention that the genus Uronemella is monophyletic, while Metanophrys is non-monophyletic. PMID:23859947

  11. 5S RRNA GENE DELETIONS CAUSE AN UNEXPECTEDLY HIGH FITNESS LOSS IN ESCHERICHIA COLI. (R825354)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  12. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    PubMed Central

    2010-01-01

    Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s) occurring in 39.6% of the analyzed individuals (both male and female) were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH) was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs) enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement. PMID:20051104

  13. Genetic Diversity among Arthrobacter Species Collected across a Heterogeneous Series of Terrestrial Deep-Subsurface Sediments as Determined on the Basis of 16S rRNA and recA Gene Sequences

    PubMed Central

    van Waasbergen, Lorraine G.; Balkwill, David L.; Crocker, Fiona H.; Bjornstad, Bruce N.; Miller, Robert V.

    2000-01-01

    This study was undertaken in an effort to understand how the population structure of bacteria within terrestrial deep-subsurface environments correlates with the physical and chemical structure of their environment. Phylogenetic analysis was performed on strains of Arthrobacter that were collected from various depths, which included a number of different sedimentary units from the Yakima Barricade borehole at the U.S. Department of Energy's Hanford site, Washington, in August 1992. At the same time that bacteria were isolated, detailed information on the physical, chemical, and microbiological characteristics of the sediments was collected. Phylogenetic trees were prepared from the 39 deep-subsurface Arthrobacter isolates (as well as 17 related type strains) based on 16S rRNA and recA gene sequences. Analyses based on each gene independently were in general agreement. These analyses showed that, for all but one of the strata (sedimentary layers characterized by their own unifying lithologic composition), the deep-subsurface isolates from the same stratum are largely monophyletic. Notably, the layers for which this is true were composed of impermeable sediments. This suggests that the populations within each of these strata have remained isolated under constant, uniform conditions, which have selected for a particular dominant genotype in each stratum. Conversely, the few strains isolated from a gravel-rich layer appeared along several lineages. This suggests that the higher-permeability gravel decreases the degree of isolation of this population (through greater groundwater flow), creating fluctuations in environmental conditions or allowing migration, such that a dominant population has not been established. No correlation was seen between the relationship of the strains and any particular chemical or physical characteristics of the sediments. Thus, this work suggests that within sedimentary deep-subsurface environments, permeability of the deposits plays a major

  14. The Dark Side of the Mushroom Spring Microbial Mat: Life in the Shadow of Chlorophototrophs. I. Microbial Diversity Based on 16S rRNA Gene Amplicons and Metagenomic Sequencing

    PubMed Central

    Thiel, Vera; Wood, Jason M.; Olsen, Millie T.; Tank, Marcus; Klatt, Christian G.; Ward, David M.; Bryant, Donald A.

    2016-01-01

    Microbial-mat communities in the effluent channels of Octopus and Mushroom Springs within the Lower Geyser Basin at Yellowstone National Park have been studied for nearly 50 years. The emphasis has mostly focused on the chlorophototrophic bacterial organisms of the phyla Cyanobacteria and Chloroflexi. In contrast, the diversity and metabolic functions of the heterotrophic community in the microoxic/anoxic region of the mat are not well understood. In this study we analyzed the orange-colored undermat of the microbial community of Mushroom Spring using metagenomic and rRNA-amplicon (iTag) analyses. Our analyses disclosed a highly diverse community exhibiting a high degree of unevenness, strongly dominated by a single taxon, the filamentous anoxygenic phototroph, Roseiflexus spp. The second most abundant organisms belonged to the Thermotogae, which have been hypothesized to be a major source of H2 from fermentation that could enable photomixotrophic metabolism by Chloroflexus and Roseiflexus spp. Other abundant organisms include two members of the Armatimonadetes (OP10); Thermocrinis sp.; and phototrophic and heterotrophic members of the Chloroflexi. Further, an Atribacteria (OP9/JS1) member; a sulfate-reducing Thermodesulfovibrio sp.; a Planctomycetes member; a member of the EM3 group tentatively affiliated with the Thermotogae, as well as a putative member of the Arminicenantes (OP8) represented ≥1% of the reads. Archaea were not abundant in the iTag analysis, and no metagenomic bin representing an archaeon was identified. A high microdiversity of 16S rRNA gene sequences was identified for the dominant taxon, Roseiflexus spp. Previous studies demonstrated that highly similar Synechococcus variants in the upper layer of the mats represent ecological species populations with specific ecological adaptations. This study suggests that similar putative ecotypes specifically adapted to different niches occur within the undermat community, particularly for Roseiflexus

  15. The Dark Side of the Mushroom Spring Microbial Mat: Life in the Shadow of Chlorophototrophs. I. Microbial Diversity Based on 16S rRNA Gene Amplicons and Metagenomic Sequencing

    DOE PAGESBeta

    Thiel, Vera; Wood, Jason M.; Olsen, Millie T.; Tank, Marcus; Klatt, Christian G.; Ward, David M.; Bryant, Donald A.

    2016-06-17

    Microbial-mat communities in the effluent channels of Octopus and Mushroom Springs within the Lower Geyser Basin at Yellowstone National Park have been studied for nearly 50 years. The emphasis has mostly focused on the chlorophototrophic bacterial organisms of the phyla Cyanobacteria and Chloroflexi. In contrast, the diversity and metabolic functions of the heterotrophic community in the microoxic/anoxic region of the mat are not well understood. In this study we analyzed the orange-colored undermat of the microbial community of Mushroom Spring using metagenomic and rRNA-amplicon (iTag) analyses. Our analyses disclosed a highly diverse community exhibiting a high degree of unevenness, stronglymore » dominated by a single taxon, the filamentous anoxygenic phototroph, Roseiflexus spp. The second most abundant organisms belonged to the Thermotogae, which have been hypothesized to be a major source of H-2 from fermentation that could enable photomixotrophic metabolism by Chloroflexus and Roseiflexus spp. Other abundant organisms include two members of the Armatimonadetes (OP10); Thermocrinis sp.; and phototrophic and heterotrophic members of the Chloroflexi. Further, an Atribacteria (OP9/JS1) member; a sulfate-reducing Therrnodesulfovibrio sp.; a Planctomycetes member; a member of the EM3 group tentatively affiliated with the Thermotogae, as well as a putative member of the Arrninicenantes (OP8) represented ≥ 1% of the reads. Archaea were not abundant in the iTag analysis, and no metagenomic bin representing an archaeon was identified. A high microdiversity of 16S rRNA gene sequences was identified for the dominant taxon, Roseiflexus spp. Previous studies demonstrated that highly similar Synechococcus variants in the upper layer of the mats represent ecological species populations with specific ecological adaptations. In conclusion, this study suggests that similar putative ecotypes specifically adapted to different niches occur within the undermat community

  16. Evaluation of the NucliSens Basic Kit for Detection of Chlamydia trachomatis and Neisseria gonorrhoeae in Genital Tract Specimens Using Nucleic Acid Sequence-Based Amplification of 16S rRNA

    PubMed Central

    Mahony, J. B.; Song, X.; Chong, S.; Faught, M.; Salonga, T.; Kapala, J.

    2001-01-01

    We evaluated a new RNA amplification and detection kit, the NucliSens Basic Kit (Organon Teknika), for the detection of Chlamydia trachomatis and Neisseria gonorrhoeae in genitourinary specimens. The Basic Kit provides an open platform for RNA amplification and detection and contains isolation reagents for nucleic acid extraction, nucleic acid sequence-based amplification (NASBA) reagents (enzymes and buffers), and a generic ruthenium-labeled probe for electrochemiluminescent (ECL) detection of amplified product. Using freshly purified and titrated stocks of C. trachomatis and N. gonorrhoeae and in vitro-generated RNA transcripts for sensitivity determinations, the Basic Kit detected 1 inclusion-forming unit of C. trachomatis, 1 CFU of N. gonorrhoeae, and 100 RNA molecules of 16S rRNA for both bacteria. The clinical performance of the Basic Kit was evaluated by testing a total of 250 specimens for N. gonorrhoeae by culture and NASBA and a total of 96 specimens for C. trachomatis by PCR and NASBA. The Basic Kit detected 139 of 142 N. gonorrhoeae culture-positive specimens and gave a negative result for 73 of 74 culture-negative specimens, for a sensitivity and specificity of 97.9 and 98.7%, respectively. For C. trachomatis, the Basic Kit detected 24 of 24 PCR-positive specimens and gave a negative result for 71 of 72 PCR-negative specimens, for a sensitivity and specificity of 100 and 98.6%, respectively. The Basic Kit also detected specimens containing both N. gonorrhoeae and C. trachomatis, using a multiplex NASBA assay using primers for both bacteria. The NucliSens Basic Kit offers a versatile platform for the development of sensitive RNA detection assays for sexually transmitted diseases. PMID:11283067

  17. The Dark Side of the Mushroom Spring Microbial Mat: Life in the Shadow of Chlorophototrophs. I. Microbial Diversity Based on 16S rRNA Gene Amplicons and Metagenomic Sequencing.

    PubMed

    Thiel, Vera; Wood, Jason M; Olsen, Millie T; Tank, Marcus; Klatt, Christian G; Ward, David M; Bryant, Donald A

    2016-01-01

    Microbial-mat communities in the effluent channels of Octopus and Mushroom Springs within the Lower Geyser Basin at Yellowstone National Park have been studied for nearly 50 years. The emphasis has mostly focused on the chlorophototrophic bacterial organisms of the phyla Cyanobacteria and Chloroflexi. In contrast, the diversity and metabolic functions of the heterotrophic community in the microoxic/anoxic region of the mat are not well understood. In this study we analyzed the orange-colored undermat of the microbial community of Mushroom Spring using metagenomic and rRNA-amplicon (iTag) analyses. Our analyses disclosed a highly diverse community exhibiting a high degree of unevenness, strongly dominated by a single taxon, the filamentous anoxygenic phototroph, Roseiflexus spp. The second most abundant organisms belonged to the Thermotogae, which have been hypothesized to be a major source of H2 from fermentation that could enable photomixotrophic metabolism by Chloroflexus and Roseiflexus spp. Other abundant organisms include two members of the Armatimonadetes (OP10); Thermocrinis sp.; and phototrophic and heterotrophic members of the Chloroflexi. Further, an Atribacteria (OP9/JS1) member; a sulfate-reducing Thermodesulfovibrio sp.; a Planctomycetes member; a member of the EM3 group tentatively affiliated with the Thermotogae, as well as a putative member of the Arminicenantes (OP8) represented ≥1% of the reads. Archaea were not abundant in the iTag analysis, and no metagenomic bin representing an archaeon was identified. A high microdiversity of 16S rRNA gene sequences was identified for the dominant taxon, Roseiflexus spp. Previous studies demonstrated that highly similar Synechococcus variants in the upper layer of the mats represent ecological species populations with specific ecological adaptations. This study suggests that similar putative ecotypes specifically adapted to different niches occur within the undermat community, particularly for Roseiflexus

  18. The specific isolation of complete 5S rDNA units from chromosome 1A of hexaploid, tetraploid, and diploid wheat species using PCR with head-to-head oriented primers.

    PubMed

    Van Campenhout, S; Stappen, J V; Volckaert, G

    2001-08-01

    The presence of 5S rDNA units on chromosome 1A of Triticum aestivum was shown by the development of a specific PCR test, using head-to-head oriented primers. This primer set allowed the amplification of complete 5S DNA units and was used to isolate SS-Rrna-A1 sequences from polyploid and diploid wheat species. Multiple-alignment and parsimony analyses of the 132 sequences divided the sequences into four types. The isolates from T. aestivum and the tetraploid species (T. dicoccoides, T. dicoccum, T durum, T. araraticum, and T timopheevi) were all of one type, which was shown to be closely related to the type mainly characteristic for T. urartu. The other two types were isolated exclusively from the diploid species T. monococcum, T aegilopoides, T. thaoudar, and T. sinskajae and the hexaploid species T. zhukovski. Triticum monococcum was the only species for which representatives of each of the four sequence types were found to be present. Further, we discuss the possible multicluster arrangement of the 5S-Rrna-A1 array. PMID:11550886

  19. Secondary structure and domain architecture of the 23S and 5S rRNAs

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hershkovits, Eli; Xue, Yuzhen; Waterbury, Chris C.; Hsiao, Chiaolong; Stepanov, Victor G.; Gaucher, Eric A.; Grover, Martha A.; Harvey, Stephen C.; Hud, Nicholas V.; Wartell, Roger M.; Fox, George E.; Williams, Loren Dean

    2013-01-01

    We present a de novo re-determination of the secondary (2°) structure and domain architecture of the 23S and 5S rRNAs, using 3D structures, determined by X-ray diffraction, as input. In the traditional 2° structure, the center of the 23S rRNA is an extended single strand, which in 3D is seen to be compact and double helical. Accurately assigning nucleotides to helices compels a revision of the 23S rRNA 2° structure. Unlike the traditional 2° structure, the revised 2° structure of the 23S rRNA shows architectural similarity with the 16S rRNA. The revised 2° structure also reveals a clear relationship with the 3D structure and is generalizable to rRNAs of other species from all three domains of life. The 2° structure revision required us to reconsider the domain architecture. We partitioned the 23S rRNA into domains through analysis of molecular interactions, calculations of 2D folding propensities and compactness. The best domain model for the 23S rRNA contains seven domains, not six as previously ascribed. Domain 0 forms the core of the 23S rRNA, to which the other six domains are rooted. Editable 2° structures mapped with various data are provided (http://apollo.chemistry.gatech.edu/RibosomeGallery). PMID:23771137

  20. Simple detection of the 5S ribosomal RNA of Pneumocystis carinii using in situ hybridisation.

    PubMed Central

    Kobayashi, M; Urata, T; Ikezoe, T; Hakoda, E; Uemura, Y; Sonobe, H; Ohtsuki, Y; Manabe, T; Miyagi, S; Miyoshi, I

    1996-01-01

    AIMS: To investigate the effectiveness of digoxigenin incorporated double stranded DNA probes produced by the polymerase chain reaction (PCR), for the detection of Pneumocystis carinii, using in situ hybridisation (ISH). METHODS: Formalin fixed, paraffin wax embedded sections of 26 human lung samples from 11 patients with P carinii pneumonia (PCP), and 15 with various types of fungal and viral pneumonia, were obtained during necropsy or transbronchial lung biopsy. Three additional PCP induced rat lung samples were also tested. PCR probes were prepared using the digoxigenin labelling mixture, and they were amplified from the DNA of a PCP induced rat lung after administration of dexamethasone, on the basis that 5S ribosomal RNA sequences are identical in human and rat P carinii. ISH was performed using this probe, and visualised using the digoxigenin nucleic acid detection kit. An immunohistochemical study using anti-human Pneumocystis monoclonal antibody was also carried out in parallel. RESULTS: ISH positively stained eight (of eight) lung necropsy specimens from patients with PCP, three (of three) transbronchial lung biopsy specimens from patients with PCP, and none of the three PCP induced rat lung specimens. In contrast, none of the specimens from patients with pneumonia caused by Aspergillus sp (n = 5), Candida sp (n = 4), Cryptococcus sp (n = 2), mucormycosis (n = 2), or cytomegalovirus (n = 2) were positive on ISH or immunohistochemistry. CONCLUSIONS: Using a digoxigenin labelled PCR probe for the entire 5S rRNA sequence in conjunction with conventional staining, ISH is highly reactive and specific for the diagnosis of PCP. Images PMID:9038753

  1. Ribotoxic stress response: activation of the stress-activated protein kinase JNK1 by inhibitors of the peptidyl transferase reaction and by sequence-specific RNA damage to the alpha-sarcin/ricin loop in the 28S rRNA.

    PubMed Central

    Iordanov, M S; Pribnow, D; Magun, J L; Dinh, T H; Pearson, J A; Chen, S L; Magun, B E

    1997-01-01

    Inhibition of protein synthesis per se does not potentiate the stress-activated protein kinases (SAPKs; also known as cJun NH2-terminal kinases [JNKs]). The protein synthesis inhibitor anisomycin, however, is a potent activator of SAPKs/JNKs. The mechanism of this activation is unknown. We provide evidence that in order to activate SAPK/JNK1, anisomycin requires ribosomes that are translationally active at the time of contact with the drug, suggesting a ribosomal origin of the anisomycin-induced signaling to SAPK/JNK1. In support of this notion, we have found that aminohexose pyrimidine nucleoside antibiotics, which bind to the same region in the 28S rRNA that is the target site for anisomycin, are also potent activators of SAPK/JNK1. Binding of an antibiotic to the 28S rRNA interferes with the functioning of the molecule by altering the structural interactions of critical regions. We hypothesized, therefore, that such alterations in the 28S rRNA may act as recognition signals to activate SAPK/JNK1. To test this hypothesis, we made use of two ribotoxic enzymes, ricin A chain and alpha-sarcin, both of which catalyze sequence-specific RNA damage in the 28S rRNA. Consistent with our hypothesis, ricin A chain and alpha-sarcin were strong agonists of SAPK/JNK1 and of its activator SEK1/MKK4 and induced the expression of the immediate-early genes c-fos and c-jun. As in the case of anisomycin, ribosomes that were active at the time of exposure to ricin A chain or alpha-sarcin were able to initiate signal transduction from the damaged 28S rRNA to SAPK/JNK1 while inactive ribosomes were not. PMID:9154836

  2. Promoter of the Mycoplasma pneumoniae rRNA operon.

    PubMed Central

    Hyman, H C; Gafny, R; Glaser, G; Razin, S

    1988-01-01

    RNA transcripts starting from the 5' end of the single Mycoplasma pneumoniae rRNA operon were analyzed by several methods. By primer extension analysis a start site was found 62 nucleotides upstream from the start site of the 16S rRNA. This site was preceded by a putative Pribnow box; however, a defined -35 recognition region was absent. The cloned rRNA operon was transcribed in vitro by using purified RNA polymerase of Escherichia coli. A single start site could be demonstrated within a few nucleotides of the start site found by primer extension analysis of M. pneumoniae transcripts. When fragments from the cloned operon were used as hybridization probes, S1 nuclease mapping yielded a single transcript extending approximately 193 nucleotides upstream from the 16S rRNA start site. The region surrounding this endpoint did not resemble any known promoter sequence. Dot blot hybridization of M. pneumoniae RNA to three oligonucleotides consisting of nucleotides -5 to -21, -38 to -54, and -112 to -132 (from the start of the 16S rRNA gene) indicated that most rRNA transcripts were processed at the stem site preceding the 16S rRNA gene. The majority of the longer precursor transcripts, extending beyond this point, did not extend further upstream to an oligonucleotide consisting of nucleotides -112 to -132. It was concluded that transcription of the rRNA operon of M. pneumoniae is initiated by a single promoter. The nucleotide sequence of the region is presented. Images PMID:2838465

  3. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    PubMed Central

    2010-01-01

    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  4. Divergent effects of oxidatively induced modification to the C8 of 2'-deoxyadenosine on transcription factor binding: 8,5'(S)-cyclo-2'-deoxyadenosine inhibits the binding of multiple sequence specific transcription factors, while 8-oxo-2'-deoxyadenosine increases binding of CREB and NF-kappa B to DNA.

    PubMed

    Abraham, Jessy; Brooks, Philip J

    2011-05-01

    DNA is exposed to endogenous and environmental factors that can form stable lesions. If not repaired, these lesions can lead to transcription/replication blocking or mutagenic bypass. Our previous work has focused on 8,5'-cyclopurine 2'-deoxyribonucleosides, a unique class of oxidatively induced DNA lesions that are specifically repaired by the NER pathway (see Brooks PJ [2008]: DNA Repair 7:1168-1179). Here we used EMSA to monitor the ability of sequence-specific transcription factors, HSF1, CREB, and NF-kappaB and "architectural" transcription factor, HMGA, to bind to their target sequences when 8, 5'(S)-cyclo-2'-deoxyadenosine (cyclo-dAdo) is present within their recognition sequences. For comparison, we also tested the effect of 8-oxo-7,8-dihydro-2'-deoxyadenosine (8-oxo-dAdo) in the same recognition sequences. The presence of a cyclo-dAdo lesion in the target sequence essentially eliminated the binding activity of HSF1, CREB, and NF-kappa B whereas HMGA retained some of its binding activity. In contrast, 8-oxo-dAdo had no obvious effect on the binding activity of HSF1 and HMGA in comparison to lesion-free DNA. Notably, though, CREB and NFκB binding increased when an 8-oxo-dAdo lesion was present in their target sequence. Competition EMSA showed about 2-3-fold increased affinity of both proteins for the 8-oxo-dAdo containing target sequence compared to lesion-free DNA. Molecular modeling of the lesions in the NF-kappaB sequence indicated that 8-oxo-dAdo may form an additional hydrogen bond with the protein, thereby strengthening the binding of NF-kappa B to its DNA target. The cyclo-dAdo lesion, in contrast, distorted the DNA structure, providing an explanation for the inhibition of NF-kappaB binding. PMID:20872830

  5. Experimental investigation of an RNA sequence space

    NASA Technical Reports Server (NTRS)

    Lee, Youn-Hyung; Dsouza, Lisa; Fox, George E.

    1993-01-01

    Modern rRNAs are the historic consequence of an ongoing evolutionary exploration of a sequence space. These extant sequences belong to a special subset of the sequence space that is comprised only of those primary sequences that can validly perform the biological function(s) required of the particular RNA. If it were possible to readily identify all such valid sequences, stochastic predictions could be made about the relative likelihood of various evolutionary pathways available to an RNA. Herein an experimental system which can assess whether a particular sequence is likely to have validity as a eubacterial 5S rRNA is described. A total of ten naturally occurring, and hence known to be valid, sequences and two point mutants of unknown validity were used to test the usefulness of the approach. Nine of the ten valid sequences tested positive whereas both mutants tested as clearly defective. The tenth valid sequence gave results that would be interpreted as reflecting a borderline status were the answer not known. These results demonstrate that it is possible to experimentally determine which sequences in local regions of the sequence space are potentially valid 5S rRNAs.

  6. Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

    PubMed

    Schnare, M N; Gray, M W

    1982-03-25

    In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. PMID:7079176

  7. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    PubMed

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. PMID:27071492

  8. Secondary structure of mouse 28S rRNA and general model for the folding of the large rRNA in eukaryotes.

    PubMed Central

    Michot, B; Hassouna, N; Bachellerie, J P

    1984-01-01

    We present a secondary structure model for the entire sequence of mouse 28S rRNA (1) which is based on an extensive comparative analysis of the available eukaryotic sequences, i.e. yeast (2, 3), Physarum polycephalum (4), Xenopus laevis (5) and rat (6). It has been derived with close reference to the models previously proposed for yeast 26S rRNA (2) and for prokaryotic 23S rRNA (7-9). Examination of the recently published eukaryotic sequences confirms that all pro- and eukaryotic large rRNAs share a largely conserved secondary structure core, as already apparent from the previous analysis of yeast 26S rRNA (2). These new comparative data confirm most features of the yeast model (2). They also provide the basis for a few modifications and for new proposals which extend the boundaries of the common structural core (now representing about 85% of E. coli 23S rRNA length) and bring new insights for tracing the structural evolution, in higher eukaryotes, of the domains which have no prokaryotic equivalent and are inserted at specific locations within the common structural core of the large subunit rRNA. PMID:6374617

  9. Novel Approach to Quantitative Detection of Specific rRNA in a Microbial Community, Using Catalytic DNA

    PubMed Central

    Suenaga, Hikaru; Liu, Rui; Shiramasa, Yuko; Kanagawa, Takahiro

    2005-01-01

    We developed a novel method for the quantitative detection of the 16S rRNA of a specific bacterial species in the microbial community by using deoxyribozyme (DNAzyme), which possesses the catalytic function to cleave RNA in a sequence-specific manner. A mixture of heterogeneous 16S rRNA containing the target 16S rRNA was incubated with a species-specific DNAzyme. The cleaved target 16S rRNA was separated from the intact 16S rRNA by electrophoresis, and then their amounts were compared for the quantitative detection of target 16S rRNA. This method was used to determine the abundance of the 16S rRNA of a filamentous bacterium, Sphaerotilus natans, in activated sludge, which is a microbial mixture used in wastewater treatment systems. The result indicated that this DNAzyme-based approach would be applicable to actual microbial communities. PMID:16085888

  10. Chromosome-specific NOR inactivation explains selective rRNA gene silencing and dosage control in Arabidopsis

    PubMed Central

    Chandrasekhara, Chinmayi; Mohannath, Gireesha; Blevins, Todd; Pontvianne, Frederic; Pikaard, Craig S.

    2016-01-01

    In eukaryotes, scores of excess ribosomal RNA (rRNA) genes are silenced by repressive chromatin modifications. Given the near sequence identity of rRNA genes within a species, it is unclear how specific rRNA genes are reproducibly chosen for silencing. Using Arabidopsis thaliana ecotype (strain) Col-0, a systematic search identified sequence polymorphisms that differ between active and developmentally silenced rRNA gene subtypes. Recombinant inbred mapping populations derived from three different ecotype crosses were then used to map the chromosomal locations of silenced and active RNA gene subtypes. Importantly, silenced and active rRNA gene subtypes are not intermingled. All silenced rRNA gene subtypes mapped to the nucleolus organizer region (NOR) on chromosome 2 (NOR2). All active rRNA gene subtypes mapped to NOR4. Using an engineered A. thaliana line in which a portion of Col-0 chromosome 4 was replaced by sequences of another ecotype, we show that a major rRNA gene subtype silenced at NOR2 is active when introgressed into the genome at NOR4. Collectively, these results reveal that selective rRNA gene silencing is not regulated gene by gene based on mechanisms dependent on subtle gene sequence variation. Instead, we propose that a subchromosomal silencing mechanism operates on a multimegabase scale to inactivate NOR2. PMID:26744421

  11. Localization in the Tomato Genome of DNA Restriction Fragments Containing Sequences Homologous to the rRNA (45s), the Major Chlorophyll a/b Binding Polypeptide and the Ribulose Bisphosphate Carboxylase Genes

    PubMed Central

    Vallejos, C. E.; Tanksley, S. D.; Bernatzky, R.

    1986-01-01

    DNA restriction fragments containing sequences homologous to the ribosomal RNA (45s), the major chlorophyll a/b binding polypeptide (CAB) and the small subunit of ribulose bisphosphate carboxylase (RBCS) genes have been localized and mapped in the tomato nuclear genome by linkage analysis. Ribosomal RNA genes map to a single locus, R45s, which resides in a terminal position on the short arm of chromosome 2 and corresponds to the Nucleolar Organizer Region. The size of the 45s repeating unit is estimated to be approximately 9 kb in Lycopersicon esculentum and 11 kb in Lycopersicon pennellii. Five loci were found to contain CAB sequences. Two of the loci, Cab-1 (chromosome 2) and Cab-3 (chromosome 8), together accounted for more than 80% of the hybridization signal. These loci contain more than one CAB structural gene. The other three loci, Cab-2 (chromosome 8), Cab-4 (chromosome 7) and Cab-5 (chromosome 12), each account for <10% of the total signal and may contain only a single copy of the CAB structural sequence. Three loci were found to contain RBCS sequences. Rbcs-2 (chromosome 3) and Rbcs-3 (chromosome 2) were responsible for >80% of the signal, with the remainder being associated with Rbcs-1 (chromosome 2). Rbcs-2 and Rbcs-3 may contain more than one copy of the gene. PMID:17246311

  12. Reconsideration of systematic relationships within the order Euplotida (Protista, Ciliophora) using new sequences of the gene coding for small-subunit rRNA and testing the use of combined data sets to construct phylogenies of the Diophrys-complex.

    PubMed

    Yi, Zhenzhen; Song, Weibo; Clamp, John C; Chen, Zigui; Gao, Shan; Zhang, Qianqian

    2009-03-01

    Comprehensive molecular analyses of phylogenetic relationships within euplotid ciliates are relatively rare, and the relationships among some families remain questionable. We performed phylogenetic analyses of the order Euplotida based on new sequences of the gene coding for small-subunit RNA (SSrRNA) from a variety of taxa across the entire order as well as sequences from some of these taxa of other genes (ITS1-5.8S-ITS2 region and histone H4) that have not been included in previous analyses. Phylogenetic trees based on SSrRNA gene sequences constructed with four different methods had a consistent branching pattern that included the following features: (1) the "typical" euplotids comprised a paraphyletic assemblage composed of two divergent clades (family Uronychiidae and families Euplotidae-Certesiidae-Aspidiscidae-Gastrocirrhidae), (2) in the family Uronychiidae, the genera Uronychia and Paradiophrys formed a clearly outlined, well-supported clade that seemed to be rather divergent from Diophrys and Diophryopsis, suggesting that the Diophrys-complex may have had a longer and more separate evolutionary history than previously supposed, (3) inclusion of 12 new SSrRNA sequences in analyses of Euplotidae revealed two new clades of species within the family and cast additional doubt on the present classification of genera within the family, and (4) the intraspecific divergence among five species of Aspidisca was far greater than those of closely related genera. The ITS1-5.8S-ITS2 coding regions and partial histone H4 genes of six morphospecies in the Diophrys-complex were sequenced along with their SSrRNA genes and used to compare phylogenies constructed from single data sets to those constructed from combined sets. Results indicated that combined analyses could be used to construct more reliable, less ambiguous phylogenies of complex groups like the order Euplotida, because they provide a greater amount and diversity of information. PMID:19121402

  13. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  14. Subnuclear partitioning of rRNA genes between the nucleolus and nucleoplasm reflects alternative epiallelic states

    PubMed Central

    Pontvianne, Frederic; Blevins, Todd; Chandrasekhara, Chinmayi; Mozgová, Iva; Hassel, Christiane; Pontes, Olga M.F.; Tucker, Sarah; Mokroš, Petr; Muchová, Veronika; Fajkus, Jiří; Pikaard, Craig S.

    2013-01-01

    Eukaryotes can have thousands of 45S ribosomal RNA (rRNA) genes, many of which are silenced during development. Using fluorescence-activated sorting techniques, we show that active rRNA genes in Arabidopsis thaliana are present within sorted nucleoli, whereas silenced rRNA genes are excluded. DNA methyltransferase (met1), histone deacetylase (hda6), or chromatin assembly (caf1) mutants that disrupt silencing abrogate this nucleoplasmic–nucleolar partitioning. Bisulfite sequencing data indicate that active nucleolar rRNA genes are nearly completely demethylated at promoter CGs, whereas silenced genes are nearly fully methylated. Collectively, the data reveal that rRNA genes occupy distinct but changeable nuclear territories according to their epigenetic state. PMID:23873938

  15. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  16. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    PubMed Central

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding. PMID:11350033

  17. Characterization of polybacterial clinical samples using a set of group-specific broad-range primers targeting the 16S rRNA gene followed by DNA sequencing and RipSeq analysis

    PubMed Central

    Lekang, Katrine; Langeland, Nina; Wiker, Harald G.

    2011-01-01

    The standard use of a single universal broad-range PCR in direct 16S rDNA sequencing from polybacterial samples leaves the minor constituents at risk of remaining undetected because all bacterial DNA will be competing for the same reagents. In this article we introduce a set of three broad-range group-specific 16S rDNA PCRs that together cover the clinically relevant bacteria and apply them in the investigation of 25 polybacterial clinical samples. Mixed DNA chromatograms from samples containing more than one species per primer group were analysed using RipSeq Mixed (iSentio, Norway), a web-based application for the interpretation of chromatograms containing up to three different species. The group-specific PCRs reduced complexity in the resulting DNA chromatograms and made the assay more sensitive in situations with unequal species concentrations. Together this allowed for identification of a significantly higher number of bacterial species than did standard direct sequencing with a single universal primer pair and RipSeq analysis (95 vs 51). The method could improve microbiological diagnostics for important groups of patients and can be established in any laboratory with experience in direct 16S rDNA sequencing. PMID:21436365

  18. Noncontiguous finished genome sequence and description of Bacillus testis strain SIT10 sp. nov.

    PubMed

    Cimmino, T; Traore, S I; Valentini, C; le Page, S; Sokhna, C; Diallo, A; Raoult, D; Rolain, J M

    2016-07-01

    Bacillus testis strain SIT10 (= CSUR P1492 = DSMZ 101190) is the new type strain collected from stool from a 2-year-old boy from Senegal during a culturomics study. This Gram-positive bacterium is a facultative anaerobic rod and a member of the Bacillaceae family. We describe here the features of this bacterium, together with the complete genome sequence and annotation. The 3 987 349 bp long genome (one chromosome but no plasmid) with 42.8% GC content contains 4005 protein-coding and 171 sRNA genes, including 19 5S rRNA gene, 15 16S rRNA genes and ten 23S rRNA genes. PMID:27222713

  19. Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes

    NASA Technical Reports Server (NTRS)

    Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.

    1987-01-01

    A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

  20. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.

    PubMed

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G

    2005-09-01

    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  1. Tax4Fun: predicting functional profiles from metagenomic 16S rRNA data

    PubMed Central

    Aßhauer, Kathrin P.; Wemheuer, Bernd; Daniel, Rolf; Meinicke, Peter

    2015-01-01

    Motivation: The characterization of phylogenetic and functional diversity is a key element in the analysis of microbial communities. Amplicon-based sequencing of marker genes, such as 16S rRNA, is a powerful tool for assessing and comparing the structure of microbial communities at a high phylogenetic resolution. Because 16S rRNA sequencing is more cost-effective than whole metagenome shotgun sequencing, marker gene analysis is frequently used for broad studies that involve a large number of different samples. However, in comparison to shotgun sequencing approaches, insights into the functional capabilities of the community get lost when restricting the analysis to taxonomic assignment of 16S rRNA data. Results: Tax4Fun is a software package that predicts the functional capabilities of microbial communities based on 16S rRNA datasets. We evaluated Tax4Fun on a range of paired metagenome/16S rRNA datasets to assess its performance. Our results indicate that Tax4Fun provides a good approximation to functional profiles obtained from metagenomic shotgun sequencing approaches. Availability and implementation: Tax4Fun is an open-source R package and applicable to output as obtained from the SILVAngs web server or the application of QIIME with a SILVA database extension. Tax4Fun is freely available for download at http://tax4fun.gobics.de/. Contact: kasshau@gwdg.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25957349

  2. Phylogenetic Differences in Attached and Free-Living Bacterial Communities in a Temperate Coastal Lagoon during Summer, Revealed via High-Throughput 16S rRNA Gene Sequencing

    PubMed Central

    Mohit, Vani; Archambault, Philippe; Toupoint, Nicolas

    2014-01-01

    Most of what is known about coastal free-living and attached bacterial diversity is based on open coasts, with high particulate and nutrient riverine supply, terrestrial runoffs, and anthropogenic activities. The Magdalen Islands in the Gulf of St. Lawrence (Canada) are dominated by shallow lagoons with small, relatively pristine catchments and no freshwater input apart from rain. Such conditions provided an opportunity to investigate coastal free-living and attached marine bacterial diversity in the absence of confounding effects of steep freshwater gradients. We found significant differences between the two communities and marked temporal patterns in both. Taxonomic richness and diversity were greater in the attached than in the free-living community, increasing over summer, especially within the least abundant bacterial phyla. The highest number of reads fell within the SAR 11 clade (Pelagibacter, Alphaproteobacteria), which dominated free-living communities. The attached communities had deeper phylum-level diversity than the free-living fraction. Distance-based redundancy analysis indicated that the particulate organic matter (POM) concentration was the main variable separating early and late summer samples with salinity and temperature changes also significantly correlated to bacterial community structure. Our approach using high-throughput sequencing detected differences in free-living versus attached bacteria in the absence of riverine input, in keeping with the concept that marine attached communities are distinct from cooccurring free-living taxa. This diversity likely reflects the diverse microhabitats of available particles, implying that the total bacterial diversity in coastal systems is linked to particle supply and variability, with implications for understanding microbial biodiversity in marine systems. PMID:24463966

  3. Illumina Amplicon Sequencing of 16S rRNA Tag Reveals Bacterial Community Development in the Rhizosphere of Apple Nurseries at a Replant Disease Site and a New Planting Site

    PubMed Central

    Sun, Jian; Zhang, Qiang; Zhou, Jia; Wei, Qinping

    2014-01-01

    We used a next-generation, Illumina-based sequencing approach to characterize the bacterial community development of apple rhizosphere soil in a replant site (RePlant) and a new planting site (NewPlant) in Beijing. Dwarfing apple nurseries of ‘Fuji’/SH6/Pingyitiancha trees were planted in the spring of 2013. Before planting, soil from the apple rhizosphere of the replant site (ReSoil) and from the new planting site (NewSoil) was sampled for analysis on the Illumina MiSeq platform. In late September, the rhizosphere soil from both sites was resampled (RePlant and NewPlant). More than 16,000 valid reads were obtained for each replicate, and the community was composed of five dominant groups (Proteobacteria, Acidobacteria, Bacteroidetes, Gemmatimonadetes and Actinobacteria). The bacterial diversity decreased after apple planting. Principal component analyses revealed that the rhizosphere samples were significantly different among treatments. Apple nursery planting showed a large impact on the soil bacterial community, and the community development was significantly different between the replanted and newly planted soils. Verrucomicrobia were less abundant in RePlant soil, while Pseudomonas and Lysobacter were increased in RePlant compared with ReSoil and NewPlant. Both RePlant and ReSoil showed relatively higher invertase and cellulase activities than NewPlant and NewSoil, but only NewPlant soil showed higher urease activity, and this soil also had the higher plant growth. Our experimental results suggest that planting apple nurseries has a significant impact on soil bacterial community development at both replant and new planting sites, and planting on new site resulted in significantly higher soil urease activity and a different bacterial community composition. PMID:25360786

  4. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. PMID:23933480

  5. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  6. Trans-splicing and RNA editing of LSU rRNA in Diplonema mitochondria

    PubMed Central

    Valach, Matus; Moreira, Sandrine; Kiethega, Georgette N.; Burger, Gertraud

    2014-01-01

    Mitochondrial ribosomal RNAs (rRNAs) often display reduced size and deviant secondary structure, and sometimes are fragmented, as are their corresponding genes. Here we report a mitochondrial large subunit rRNA (mt-LSU rRNA) with unprecedented features. In the protist Diplonema, the rnl gene is split into two pieces (modules 1 and 2, 534- and 352-nt long) that are encoded by distinct mitochondrial chromosomes, yet the rRNA is continuous. To reconstruct the post-transcriptional maturation pathway of this rRNA, we have catalogued transcript intermediates by deep RNA sequencing and RT-PCR. Gene modules are transcribed separately. Subsequently, transcripts are end-processed, the module-1 transcript is polyuridylated and the module-2 transcript is polyadenylated. The two modules are joined via trans-splicing that retains at the junction ∼26 uridines, resulting in an extent of insertion RNA editing not observed before in any system. The A-tail of trans-spliced molecules is shorter than that of mono-module 2, and completely absent from mitoribosome-associated mt-LSU rRNA. We also characterize putative antisense transcripts. Antisense-mono-modules corroborate bi-directional transcription of chromosomes. Antisense-mt-LSU rRNA, if functional, has the potential of guiding concomitantly trans-splicing and editing of this rRNA. Together, these findings open a window on the investigation of complex regulatory networks that orchestrate multiple and biochemically diverse post-transcriptional events. PMID:24259427

  7. Robust Computational Analysis of rRNA Hypervariable Tag Datasets

    PubMed Central

    Sipos, Maksim; Jeraldo, Patricio; Chia, Nicholas; Qu, Ani; Dhillon, A. Singh; Konkel, Michael E.; Nelson, Karen E.; White, Bryan A.; Goldenfeld, Nigel

    2010-01-01

    Next-generation DNA sequencing is increasingly being utilized to probe microbial communities, such as gastrointestinal microbiomes, where it is important to be able to quantify measures of abundance and diversity. The fragmented nature of the 16S rRNA datasets obtained, coupled with their unprecedented size, has led to the recognition that the results of such analyses are potentially contaminated by a variety of artifacts, both experimental and computational. Here we quantify how multiple alignment and clustering errors contribute to overestimates of abundance and diversity, reflected by incorrect OTU assignment, corrupted phylogenies, inaccurate species diversity estimators, and rank abundance distribution functions. We show that straightforward procedural optimizations, combining preexisting tools, are effective in handling large () 16S rRNA datasets, and we describe metrics to measure the effectiveness and quality of the estimators obtained. We introduce two metrics to ascertain the quality of clustering of pyrosequenced rRNA data, and show that complete linkage clustering greatly outperforms other widely used methods. PMID:21217830

  8. Whole genome sequences and annotation of Micrococcus luteus SUBG006, a novel phytopathogen of mango

    PubMed Central

    Rakhashiya, Purvi M.; Patel, Pooja P.; Thaker, Vrinda S.

    2015-01-01

    Actinobaceria, Micrococcus luteus SUBG006 was isolated from infected leaves of Mangifera indica L. vr. Nylon in Rajkot, (22.30°N, 70.78°E), Gujarat, India. The genome size is 3.86 Mb with G + C content of 69.80% and contains 112 rRNA sequences (5S, 16S and 23S). The whole genome sequencing has been deposited in DDBJ/EMBL/GenBank under the accession number JOKP00000000. PMID:26697318

  9. Whole genome sequences and annotation of Micrococcus luteus SUBG006, a novel phytopathogen of mango.

    PubMed

    Rakhashiya, Purvi M; Patel, Pooja P; Thaker, Vrinda S

    2015-12-01

    Actinobaceria, Micrococcus luteus SUBG006 was isolated from infected leaves of Mangifera indica L. vr. Nylon in Rajkot, (22.30°N, 70.78°E), Gujarat, India. The genome size is 3.86 Mb with G + C content of 69.80% and contains 112 rRNA sequences (5S, 16S and 23S). The whole genome sequencing has been deposited in DDBJ/EMBL/GenBank under the accession number JOKP00000000. PMID:26697318

  10. Higher-order structure of rRNA

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  11. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    PubMed Central

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  12. 16S rRNA Phylogenetic Investigation of the Candidate Division “Korarchaeota”

    PubMed Central

    Auchtung, Thomas A.; Takacs-Vesbach, Cristina D.; Cavanaugh, Colleen M.

    2006-01-01

    The environmental distribution and phylogeny of “Korarchaeota,” a proposed ancient archaeal division, was investigated by using the 16S rRNA gene framework. Korarchaeota-specific primers were designed based on previously published sequences and used to screen a variety of environments. Korarchaeota 16S rRNA genes were amplified exclusively from high temperature Yellowstone National Park hot springs and a 9°N East Pacific Rise deep-sea hydrothermal vent. Phylogenetic analyses of these and all available sequences suggest that Korarchaeota exhibit a high level of endemicity. PMID:16820509

  13. Primary and secondary structure of 5.8S rRNA from the silkgland of Bombyx mori.

    PubMed Central

    Fujiwara, H; Kawata, Y; Ishikawa, H

    1982-01-01

    Nucleotide sequence of 5.8S rRNA of the silkworm, Bombyx mori has been determined by gel sequencing methods. The 5.8S rRNA was the longest so far reported, with the 5'-terminal sequence several nucleotides longer than those of the other organisms. Upon constructing the secondary structure in accordance with the "burp gun" model (12), the Bombyx 5.8S rRNA formed a wide-open "muzzle" due to several unpaired bases at the ends. The overall structure also appeared less stable with less G . C pairs and more unpaired bases than that of the HeLa 5.8S rRNA. These structural features may be essential for those 5.8S rRNAs which interact with 28S rRNAs containing the hidden break to form a stable complex. PMID:7088713

  14. Intragenomic heterogeneity of the 16S rRNA gene in strain UFO1 caused by a 100-bp insertion in helix 6

    SciTech Connect

    Allison E. Ray; Stephanie A. Connon; Peter P. Sheridan; Jeremy Gilbreath; Malcolm S. Shields; Deborah T. Newby; Yoshiko Fujita; Timothy S. Magnuson

    2010-06-01

    The determination of variation in 16S rRNA gene sequences is perhaps the most common method for assessing microbial community diversity. However, the occurrence of multiple copies of 16S rRNA genes within some organisms can bias estimates of microbial diversity. During phylogenetic characterization of a metal-transforming, fermentative bacterium (strain UFO1) isolated from the Field Research Center (FRC) in Oak Ridge, TN, we detected an apparent 16S rRNA pseudogene. The putative 16S rRNA pseudogene was first detected in clone libraries constructed with 16S rRNA genes amplified from UFO1 genomic DNA. Sequencing revealed two distinct 16S rRNA genes, with one differing from the other by a 100 bp insert near the 5’ end. Ribosomal RNA was extracted from strain UFO1 and analyzed by RT-qPCR with insert and non-insert specific primers; however, only the non-insert 16S rRNA sequence was expressed. Reverse-transcribed rRNA from strain UFO1 was also used to construct a cDNA library. Of 190 clones screened by PCR, none contained the 16S rRNA gene with the 100 bp insert. Examination of GenBank 16S rRNA gene sequences revealed that the same insert sequence was present in other clones, including those from an environmental library constructed from FRC enrichments. These findings demonstrate the existence of widely disparate copies of the 16S rRNA gene in the same species and a putative 16S rRNA pseudogene, which may confound 16S rRNA-based methods for assessments of microbial diversity in environmental samples.

  15. Genomic organization and evolution of the 5S ribosomal DNA in Tilapiini fishes.

    PubMed

    Alves-Costa, F A; Wasko, A P; Oliveira, C; Foresti, F; Martins, C

    2006-05-01

    5S rDNA sequences present an intense dynamism and have proved to be valuable as genetic markers to distinguish closed related species and also in the understanding of the evolutionary dynamic of repetitive sequences in the genomes. In order to identify patterns of 5S rDNA organization and their evolution in the genome of fish species, such genomic segment was investigated in the tilapias Oreochromis niloticus and Tilapia rendalli, and in the hybrid O. urolepis hornorum x O. mossambicus. A dual 5S rDNA system was identified in the three analyzed tilapia samples. Although each 5S rDNA class was conserved among the three samples, a distinct 5S rDNA genome organization pattern could be evidenced for each sample. The presence of a dual 5S rDNA system seems to be a general trait among non-related teleost fish orders, suggesting that evolutionary events of duplication have occurred before the divergence of the main groups of teleost fishes. PMID:16850228

  16. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  17. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  18. Complete genome sequence of Microbacterium sp. CGR1, bacterium tolerant to wide abiotic conditions isolated from the Atacama Desert.

    PubMed

    Mandakovic, Dinka; Cabrera, Pablo; Pulgar, Rodrigo; Maldonado, Jonathan; Aravena, Pamela; Latorre, Mauricio; Cambiazo, Verónica; González, Mauricio

    2015-12-20

    Microbacterium sp. CGR1 (RGM2230) is an isolate from the Atacama Desert that displays a wide pH, salinity and temperature tolerance. This strain exhibits riboflavin overproducer features and traits for developing an environmental arsenic biosensor. Here, we report the complete genome sequence of this strain, which represents the first genome of the genus Microbacterium sequenced and assembled in a single contig. The genome contains 3,634,864bp, 3299 protein-coding genes, 45 tRNAs, six copies of 5S-16S-23S rRNA and a high genome average GC-content of 68.04%. PMID:26521698

  19. Fine mapping of 28S rRNA sites specifically cleaved in cells undergoing apoptosis.

    PubMed Central

    Houge, G; Robaye, B; Eikhom, T S; Golstein, J; Mellgren, G; Gjertsen, B T; Lanotte, M; Døskeland, S O

    1995-01-01

    Bona fide apoptosis in rat and human leukemia cells, rat thymocytes, and bovine endothelial cells was accompanied by limited and specific cleavage of polysome-associated and monosome-associated 28S rRNA, with 18S rRNA being spared. Specific 28S rRNA cleavage was observed in all instances of apoptotic death accompanied by internucleosomal DNA fragmentation, with cleavage of 28S rRNA and of DNA being linked temporally. This indicates that 28S rRNA fragmentation may be as general a feature of apoptosis as internucleosomal DNA fragmentation and that concerted specific cleavage of intra- and extranuclear polynucleotides occurs in apoptosis. Apoptosis-associated cleavage sites were mapped to the 28S rRNA divergent domains D2, D6 (endothelial cells), and D8. The D2 cuts occurred in hairpin loop junctions considered to be buried in the intact ribosome, suggesting that this rRNA region becomes a target for RNase attack in apoptotic cells. D8 was cleaved in two exposed UU(U) sequences in bulge loops. Treatment with agents causing necrotic cell death or aging of cell lysates failed to produce any detectable limited D2 cleavage but did produce a more generalized cleavage in the D8 region. Of potential functional interest was the finding that the primary cuts in D2 exactly flanked a 0.3-kb hypervariable subdomain (D2c), allowing excision of the latter. The implication of hypervariable rRNA domains in apoptosis represents the first association of any functional process with these enigmatic parts of the ribosomes. PMID:7891700

  20. Molecular Evolution of Mycoplasma capricolum subsp. capripneumoniae Strains, Based on Polymorphisms in the 16S rRNA Genes

    PubMed Central

    Pettersson, Bertil; Bölske, Göran; Thiaucourt, François; Uhlén, Mathias; Johansson, Karl-Erik

    1998-01-01

    Mycoplasma capricolum subsp. capripneumoniae belongs to the so-called Mycoplasma mycoides cluster and is the causal agent of contagious caprine pleuropneumonia (CCPP). All members of the M. mycoides cluster have two rRNA operons. The sequences of the 16S rRNA genes of both rRNA operons from 20 strains of M. capricolum subsp. capripneumoniae of different geographical origins in Africa and Asia were determined. Nucleotide differences which were present in only one of the two operons (polymorphisms) were detected in 24 positions. The polymorphisms were not randomly distributed in the 16S rRNA genes, and some of them were found in regions of low evolutionary variability. Interestingly, 11 polymorphisms were found in all the M. capricolum subsp. capripneumoniae strains, thus defining a putative ancestor. A sequence length difference between the 16S rRNA genes in a poly(A) region and 12 additional polymorphisms were found in only one or some of the strains. A phylogenetic tree was constructed by comparative analysis of the polymorphisms, and this tree revealed two distinct lines of descent. The nucleotide substitution rate of strains within line II was up to 50% higher than within line I. A tree was also constructed from individual operonal 16S rRNA sequences, and the sequences of the two operons were found to form two distinct clades. The topologies of both clades were strikingly similar, which supports the use of 16S rRNA sequence data from homologous operons for phylogenetic studies. The strain-specific polymorphism patterns of the 16S rRNA genes of M. capricolum subsp. capripneumoniae may be used as epidemiological markers for CCPP. PMID:9573185

  1. Automated Identification of Nucleotide Sequences

    NASA Technical Reports Server (NTRS)

    Osman, Shariff; Venkateswaran, Kasthuri; Fox, George; Zhu, Dian-Hui

    2007-01-01

    STITCH is a computer program that processes raw nucleotide-sequence data to automatically remove unwanted vector information, perform reverse-complement comparison, stitch shorter sequences together to make longer ones to which the shorter ones presumably belong, and search against the user s choice of private and Internet-accessible public 16S rRNA databases. ["16S rRNA" denotes a ribosomal ribonucleic acid (rRNA) sequence that is common to all organisms.] In STITCH, a template 16S rRNA sequence is used to position forward and reverse reads. STITCH then automatically searches known 16S rRNA sequences in the user s chosen database(s) to find the sequence most similar to (the sequence that lies at the smallest edit distance from) each spliced sequence. The result of processing by STITCH is the identification of the most similar well-described bacterium. Whereas previously commercially available software for analyzing genetic sequences operates on one sequence at a time, STITCH can manipulate multiple sequences simultaneously to perform the aforementioned operations. A typical analysis of several dozen sequences (length of the order of 103 base pairs) by use of STITCH is completed in a few minutes, whereas such an analysis performed by use of prior software takes hours or days.

  2. Ribosomal Database Project: data and tools for high throughput rRNA analysis

    PubMed Central

    Cole, James R.; Wang, Qiong; Fish, Jordan A.; Chai, Benli; McGarrell, Donna M.; Sun, Yanni; Brown, C. Titus; Porras-Alfaro, Andrea; Kuske, Cheryl R.; Tiedje, James M.

    2014-01-01

    Ribosomal Database Project (RDP; http://rdp.cme.msu.edu/) provides the research community with aligned and annotated rRNA gene sequence data, along with tools to allow researchers to analyze their own rRNA gene sequences in the RDP framework. RDP data and tools are utilized in fields as diverse as human health, microbial ecology, environmental microbiology, nucleic acid chemistry, taxonomy and phylogenetics. In addition to aligned and annotated collections of bacterial and archaeal small subunit rRNA genes, RDP now includes a collection of fungal large subunit rRNA genes. RDP tools, including Classifier and Aligner, have been updated to work with this new fungal collection. The use of high-throughput sequencing to characterize environmental microbial populations has exploded in the past several years, and as sequence technologies have improved, the sizes of environmental datasets have increased. With release 11, RDP is providing an expanded set of tools to facilitate analysis of high-throughput data, including both single-stranded and paired-end reads. In addition, most tools are now available as open source packages for download and local use by researchers with high-volume needs or who would like to develop custom analysis pipelines. PMID:24288368

  3. 16S rRNA region based PCR protocol for identification and subtyping of Parvimonas micra

    PubMed Central

    Ota-Tsuzuki, C.; Brunheira, A.T.P.; Mayer, M.P.A.

    2008-01-01

    The present study established a PCR protocol in order to identify Parvimonas micra and to evaluate the intra-species diversity by PCR-RFLP of 16S rRNA partial sequence. The data indicated that the protocol was able to identify this species which could be clustered in five genotypes. PMID:24031274

  4. Complete genome sequence of Dehalogenimonas lykanthroporepellens type strain (BL-DC-9T) and comparison to “Dehalococcoides” strains

    PubMed Central

    Siddaramappa, Shivakumara; Challacombe, Jean F.; Delano, Susana F.; Green, Lance D.; Daligault, Hajnalka; Bruce, David; Detter, Chris; Tapia, Roxanne; Han, Shunsheng; Goodwin, Lynne; Han, James; Woyke, Tanja; Pitluck, Sam; Pennacchio, Len; Nolan, Matt; Land, Miriam; Chang, Yun-Juan; Kyrpides, Nikos C.; Ovchinnikova, Galina; Hauser, Loren; Lapidus, Alla; Yan, Jun; Bowman, Kimberly S.; da Costa, Milton S.; Rainey, Fred A.

    2012-01-01

    Dehalogenimonas lykanthroporepellens is the type species of the genus Dehalogenimonas, which belongs to a deeply branching lineage within the phylum Chloroflexi. This strictly anaerobic, mesophilic, non spore-forming, Gram-negative staining bacterium was first isolated from chlorinated solvent contaminated groundwater at a Superfund site located near Baton Rouge, Louisiana, USA. D. lykanthroporepellens was of interest for genome sequencing for two reasons: (a) an unusual ability to couple growth with reductive dechlorination of environmentally important polychlorinated aliphatic alkanes and (b) a phylogenetic position that is distant from previously sequenced bacteria. The 1,686,510 bp circular chromosome of strain BL-DC-9T contains 1,720 predicted protein coding genes, 47 tRNA genes, a single large subunit rRNA (23S-5S) locus, and a single, orphan, small subunit rRNA (16S) locus. PMID:22768368

  5. Complete genome sequence of Dehalogenimonas lykanthroporepellens type strain (BL-DC-9T) and comparison to Dehalococcoides strains

    SciTech Connect

    Siddaramappa, Shivakumara; Delano, Susana; Green, Lance D.; Daligault, Hajnalka E.; Bruce, David; Detter, J. Chris; Tapia, Roxanne; Han, Cliff; Goodwin, Lynne A.; Han, James; Woyke, Tanja; Pitluck, Sam; Pennacchio, Len; Nolan, Matt; Land, Miriam L; Chang, Yun-Juan; Kyrpides, Nikos C; Ovchinnikova, Galina; Hauser, Loren John; Lapidus, Alla L.; Yan, Jun; Bowman, Kimberly; Da Costa, Milton S,; Rainey, Fred A.; Moe, William M.

    2012-01-01

    Dehalogenimonas lykanthroporepellens is the type species of the genus Dehalogenimonas, which belongs to a deeply branching lineage within the phylum Chloroflexi. This strictly anaerobic, mesophilic, non spore forming, Gram negative staining bacterium was first isolated from chlorinated solvent contaminated groundwater at a Superfund site located near Baton Rouge, Louisiana, USA. D. lykanthroporepellens was of interest for genome sequencing for two reasons: (a) its unusual ability to couple growth with reductive dechlorination of environmentally important polychlorinated aliphatic alkanes and (b) its phylogenetic position distant from previously sequenced bacteria. The 1,686,510 bp circular chromosome of strain BL-DC-9{sup T} contains 1,720 predicted protein coding genes, 47 tRNA genes, a single large subunit rRNA (23S-5S) locus, and a single, orphan, small unit rRNA (16S) locus.

  6. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    SciTech Connect

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  7. Mouse Oocytes Transcribe Injected Xenopus 5S RNA Gene

    PubMed Central

    Brinster, Ralph L.; Chen, Howard Y.; Trumbauer, Myrna E.

    2016-01-01

    Transcripts produced after injection of the Xenopus 5S RNA gene into oocyte germinal vesicles of mice migrate electrophoretically with the 5S RNA marker, an indication that the gene is transcribed and processed with considerable accuracy, Approximately two 5S RNA molecules are transcribed per gene per hour. This system may be useful in studying DNA processing and gene regulation by the mammalian ovum and might be modified to allow permanent incorporation of specific genes into mice. PMID:7194505

  8. Chromosomal Organization of Rrna Operons in Bacillus Subtilis

    PubMed Central

    Jarvis, E. D.; Widom, R. L.; LaFauci, G.; Setoguchi, Y.; Richter, I. R.; Rudner, R.

    1988-01-01

    Integrative mapping with vectors containing ribosomal DNA sequences were used to complete the mapping of the 10 rRNA gene sets in the endospore forming bacterium Bacillus subtilis. Southern hybridizations allowed the assignment of nine operons to distinct BclI restriction fragments and their genetic locus identified by transductional crosses. Nine of the ten rRNA gene sets are located between 0 and 70° on the genomic map. In the region surrounding cysA14, two sets of closely spaced tandem clusters are present. The first (rrnJ and rrnW) is located between purA16 and cysA14 closely linked to the latter; the second (rrnI, rrnH and rrnG) previously mapped within this area is located between attSPO2 and glpT6. The operons at or near the origin of replication (rrnO,rrnA and rrnJ,rrnW) represent ``hot spots'' of plasmid insertion. PMID:2465199

  9. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    PubMed Central

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  10. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  11. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  12. Analysis, Optimization and Verification of Illumina-Generated 16S rRNA Gene Amplicon Surveys

    PubMed Central

    Nelson, Michael C.; Morrison, Hilary G.; Benjamino, Jacquelynn; Grim, Sharon L.; Graf, Joerg

    2014-01-01

    The exploration of microbial communities by sequencing 16S rRNA genes has expanded with low-cost, high-throughput sequencing instruments. Illumina-based 16S rRNA gene sequencing has recently gained popularity over 454 pyrosequencing due to its lower costs, higher accuracy and greater throughput. Although recent reports suggest that Illumina and 454 pyrosequencing provide similar beta diversity measures, it remains to be demonstrated that pre-existing 454 pyrosequencing workflows can transfer directly from 454 to Illumina MiSeq sequencing by simply changing the sequencing adapters of the primers. In this study, we modified 454 pyrosequencing primers targeting the V4-V5 hyper-variable regions of the 16S rRNA gene to be compatible with Illumina sequencers. Microbial communities from cows, humans, leeches, mice, sewage, and termites and a mock community were analyzed by 454 and MiSeq sequencing of the V4-V5 region and MiSeq sequencing of the V4 region. Our analysis revealed that reference-based OTU clustering alone introduced biases compared to de novo clustering, preventing certain taxa from being observed in some samples. Based on this we devised and recommend an analysis pipeline that includes read merging, contaminant filtering, and reference-based clustering followed by de novo OTU clustering, which produces diversity measures consistent with de novo OTU clustering analysis. Low levels of dataset contamination with Illumina sequencing were discovered that could affect analyses that require highly sensitive approaches. While moving to Illumina-based sequencing platforms promises to provide deeper insights into the breadth and function of microbial diversity, our results show that care must be taken to ensure that sequencing and processing artifacts do not obscure true microbial diversity. PMID:24722003

  13. Mutations of mitochondrial 12S rRNA in gastric carcinoma and their significance

    PubMed Central

    Han, Cheng-Bo; Ma, Jia-Ming; Xin, Yan; Mao, Xiao-Yun; Zhao, Yu-Jie; Wu, Dong-Ying; Zhang, Su-Min; Zhang, Yu-Kui

    2005-01-01

    AIM: To detect the variations of mitochondrial 12S rRNA in patients with gastric carcinoma, and to study their significance and the relationship between these variations and the genesis of gastric carcinoma. METHODS: PCR amplified mitochondrial 12S rRNA of 44 samples including 22 from gastric carcinoma tissues and 22 from adjacent normal tissues, was detected by direct DNA sequencing. Then laser capture microdissection technique (LCM) was used to separate the cancerous cells and dysplasia cells with specific mutations. Denaturing high performance liquid chromatography (DHPLC) plus allele-specific PCR (AS-PCR), nest-PCR and polyacrylamide gel electrophoresis (PAGE) were used to further evaluate this mutant property and quantitative difference of mutant type between cancerous and dysplasia cells. Finally, RNAdraw biosoft was used to analyze the RNA secondary structure of mutant-type 12S rRNA. RESULTS: Compared with Mitomap database, some new variations were found, among which np652 G insertion and np716 T-G transversion were found only in cancerous tissues. There was a statistic difference in the frequency of 12S rRNA variation between intestinal type (12/17, 70.59%) and diffusive type (5/17, 29.41%) of gastric carcinoma (P<0.05). DHPLC analysis showed that 12S rRNA np652 G insertion and np716 T-G transversion were heteroplasmic mutations. The frequency of 12S rRNA variation in cancerous cells was higher than that in dysplasia cells (P<0.01). 12S rRNA np652 G insertion showed obviously negative effects on the stability of 12S rRNA secondary structure, while others such as T-G transversion did not. CONCLUSION: The mutations of mitochondrial 12S rRNA may be associated with the occurrence of intestinal-type gastric carcinoma. Most variations exist both in gastric carcinomas and in normal tissues, and they might not be the characteristics of tumors. However, np652 G insertion and np716 T-G transversion may possess some molecular significance in gastric carcinogenesis

  14. Chromosome mapping of 18S rDNA and 5S rDNA by dual-color fluorescence in situ hybridization in the half-smooth tongue sole (Cynoglossus semilaevis).

    PubMed

    Jiang, L; Jiang, J; Liu, J; Yuan, J; Chen, Y; Zhang, Q; Wang, X

    2014-01-01

    Half-smooth tongue sole (Cynoglossus semilaevis) is an important aquaculture flatfish in China. Cytogenetic analysis has revealed that its sex determination system is female heterogametic (ZZ/ZW). The W chromosome is morphologically larger and has been considered evolutionarily younger than any other chromosome in the set. However, the genetic origin and evolution process of this neo-chromosome remains unclear. In this study, 2 tandem arrays of rRNA genes were chosen to address this question. Both the major rDNA (18S rDNA) and the minor rDNA (5S rDNA) were located on the C. semilaevis chromosomes by fluorescence in situ hybridization (FISH). Six 18S rDNA signals were observed on the centromeric regions of 3 pairs of autosomes in both males and females. In females, there was an additional 18S rDNA signal mapping to the telomeric region of the W chromosome long arm. With respect to the 5S rDNA, 12 signals were mapped to the centromeric regions of six pairs of autosomes. Two-color FISH further confirmed that the two pairs of the 5S rDNA signals were correspondingly located at the same positions of the same autosomes as those of the 18S rDNA signals. These results allowed us to speculate about the evolution process of the W chromosome. Chromosome fusions and repetitive sequence accumulations might have occurred in C. semilaevis. The synteny and non-synteny of C. semilaevis 18S rDNA and 5S rDNA might imply the original and evolutionary characteristics of this species. These findings will facilitate studies on karyotype evolution of the order Pleuronectiformes. PMID:25526196

  15. Genome sequence of the organohalide-respiring Dehalogenimonas alkenigignens type strain (IP3-3(T)).

    PubMed

    Key, Trent A; Richmond, Dray P; Bowman, Kimberly S; Cho, Yong-Joon; Chun, Jongsik; da Costa, Milton S; Rainey, Fred A; Moe, William M

    2016-01-01

    Dehalogenimonas alkenigignens IP3-3(T) is a strictly anaerobic, mesophilic, Gram negative staining bacterium that grows by organohalide respiration, coupling the oxidation of H2 to the reductive dehalogenation of polychlorinated alkanes. Growth has not been observed with any non-polyhalogenated alkane electron acceptors. Here we describe the features of strain IP3-3(T) together with genome sequence information and its annotation. The 1,849,792 bp high-quality-draft genome contains 1936 predicted protein coding genes, 47 tRNA genes, a single large subunit rRNA (23S-5S) locus, and a single, orphan, small unit rRNA (16S) locus. The genome contains 29 predicted reductive dehalogenase genes, a large majority of which lack cognate genes encoding membrane anchoring proteins. PMID:27340512

  16. Effects of base change mutations within an Escherichia coli ribosomal RNA leader region on rRNA maturation and ribosome formation

    PubMed Central

    Schäferkordt, Jan; Wagner, Rolf

    2001-01-01

    The effects of base change mutations in a highly conserved sequence (boxC) within the leader of bacterial ribosomal RNAs (rRNAs) was studied. The boxC sequence preceding the 16S rRNA structural gene constitutes part of the RNase III processing site, one of the first cleavage sites on the pathway to mature 16S rRNA. Moreover, rRNA leader sequences facilitate correct 16S rRNA folding, thereby assisting ribosomal subunit formation. Mutations in boxC cause cold sensitivity and result in 16S rRNA and 30S subunit deficiency. Strains in which all rRNA operons are replaced by mutant transcription units are viable. Thermodynamic studies by temperature gradient gel electrophoresis reveal that mutant transcripts have a different, less ordered structure. In addition, RNA secondary structure differences between mutant and wild-type transcripts were determined by chemical and enzymatic probing. Differences are found in the leader RNA sequence itself but also in structurally important regions of the mature 16S rRNA. A minor fraction of the rRNA transcripts from mutant operons is not processed by RNase III, resulting in a significantly extended precursor half-life compared to the wild-type. The boxC mutations also give rise to a new aberrant degradation product of 16S rRNA. This intermediate cannot be detected in strains lacking RNase III. Together the results indicate that the boxC sequence, although important for RNase III processing, is likely to serve additional functions by facilitating correct formation of the mature 16S rRNA structure. They also suggest that quality control steps are acting during ribosome biogenesis. PMID:11504877

  17. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  18. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae

    PubMed Central

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-01-01

    Methylation of ribose sugars at the 2′-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2′-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5′ central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D′ box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  19. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae.

    PubMed

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-02-27

    Methylation of ribose sugars at the 2'-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2'-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5' central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D' box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  20. Decreases in average bacterial community rRNA operon copy number during succession.

    PubMed

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  1. The impact of transcriptional tuning on in vitro integrated rRNA transcription and ribosome construction

    PubMed Central

    Fritz, Brian R.; Jewett, Michael C.

    2014-01-01

    In vitro ribosome construction could enable studies of ribosome assembly and function, provide a route toward constructing minimal cells for synthetic biology, and permit the construction of ribosome variants with new functions. Toward these long-term goals, we recently reported on an integrated, one-pot ribosomal RNA synthesis (rRNA), ribosome assembly, and translation technology (termed iSAT) for the construction of Escherichia coli ribosomes in crude ribosome-free S150 extracts. Here, we aimed to improve the activity of iSAT through transcriptional tuning. Specifically, we increased transcriptional efficiency through 3′ modifications to the rRNA gene sequences, optimized plasmid and polymerase concentrations, and demonstrated the use of a T7-promoted rRNA operon for stoichiometrically balanced rRNA synthesis and native rRNA processing. Our modifications produced a 45-fold improvement in iSAT protein synthesis activity, enabling synthesis of 429 ± 15 nmol/l green fluorescent protein in 6 h batch reactions. Further, we show that the translational activity of ribosomes purified from iSAT reactions is about 20% the activity of native ribosomes purified directly from E. coli cells. Looking forward, we believe iSAT will enable unique studies to unravel the systems biology of ribosome biogenesis and open the way to new methods for making and studying ribosomal variants. PMID:24792158

  2. Rapid identification of Renibacterium salmoninarum using an oligonucleotide probe complementary to 16S rRNA.

    PubMed

    Mattsson, J G; Gersdorf, H; Jansson, E; Hongslo, T; Göbel, U B; Johansson, K E

    1993-02-01

    Bacterial kidney disease in salmonid fish is caused by the slow-growing Gram-positive rod, Renibacterium salmoninarum. The partial sequence of 16S rRNA from R. salmoninarum was determined and compared with published bacterial 16S rRNA sequences. From this sequence information, a 30-bases-long oligonucleotide was designed and used as a specific probe for identification of R. salmoninarum in filter hybridization experiments. Strong specific hybridization signals were observed for all strains of R. salmoninarum tested. Furthermore, no cross-hybridization could be seen against 22 other bacterial species, among them other salmonid fish pathogens. The detection limit for the probe in direct filter hybridization by the dot-blot technique was 2.5 x 10(4) bacteria. It was also possible to detect R. salmoninarum in clinical samples by direct filter hybridization. PMID:8455640

  3. Analysis of 5S rDNA arrays in Arabidopsis thaliana: physical mapping and chromosome-specific polymorphisms.

    PubMed

    Cloix, C; Tutois, S; Mathieu, O; Cuvillier, C; Espagnol, M C; Picard, G; Tourmente, S

    2000-05-01

    A physical map of a pericentromeric region of chromosome 5 containing a 5S rDNA locus and spanning approximately 1000 kb was established using the CIC YAC clones. Three 5S rDNA arrays were resolved in this YAC contig by PFGE analysis and we have mapped different types of sequences between these three blocks. 5S rDNA units from each of these three arrays of chromosome 5, and from chromosomes 3 and 4, were isolated by PCR. A total of 38 new DNA sequences were obtained. Two types of 5S rDNA repeated units exist: the major variant with 0.5-kb repeats and one with short repeats (251 bp) only detected on YAC 11A3 from chromosome 3. Although the 38 sequences displayed noticeable heterogeneity, we were able to group them according to their 5S array origin. The presence of 5S array-specific variants was confirmed with the restriction polymorphism study of all the YACs carrying 5S units. PMID:10810091

  4. Sequence analysis of a cluster of twenty-one tRNA genes in Bacillus subtilis.

    PubMed Central

    Green, C J; Vold, B S

    1983-01-01

    The DNA sequence of a cluster of twenty-one tRNA genes distal to a rRNA gene set in B. subtilis was determined. None of the tRNA genes are repeated in the sequence. The only classes of tRNAs that are not represented are those for cysteine, glutamine, tryptophan, and tyrosine. Three of the tRNA genes in this cluster do not have the 3'-CCA sequence encoded in the gene. There is no RNA polymerase terminator sequence in the region between the 5S gene and the first tRNA gene or within the tRNA gene cluster. A terminator sequence was found directly after th