Science.gov

Sample records for 5s rrna species

  1. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    PubMed

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  2. The karyotype and 5S rRNA genes from Spanish individuals of the bat species Rhinolophus hipposideros (Rhinolophidae; Chiroptera).

    PubMed

    Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio

    2008-11-01

    The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair. PMID:18066670

  3. Localization of 5S and 25S rRNA genes on somatic and meiotic chromosomes in Capsicum species of chili pepper.

    PubMed

    Kwon, Jin-Kyung; Kim, Byung-Dong

    2009-02-28

    The loci of the 5S and 45S rRNA genes were localized on chromosomes in five species of Capsicum, namely, annuum, chacoense, frutescens, baccatum, and chinense by FISH. The 5S rDNA was localized to the distal region of one chromosome in all species observed. The number of 45S rDNA loci varied among species; one in annuum, two in chacoense, frutescens, and chinense, and four in baccatum, with the exceptions that 'CM334' of annuum had three loci and 'tabasco' of frutescens had one locus. 'CM334'-derived BAC clones, 384B09 and 365P05, were screened with 5S rDNA as a probe, and BACs 278M03 and 262A23 were screened with 25S rDNA as a probe. Both ends of these BAC clones were sequenced. FISH with these BAC probes on pachytenes from 'CM334' plant showed one 5S rDNA locus and three 45S rDNA loci, consistent with the patterns on the somatic chromosomes. The 5S rDNA probe was also applied on extended DNA fibers to reveal that its coverage measured as long as 0.439 Mb in the pepper genome. FISH techniques applied on somatic and meiotic chromosomes and fibers have been established for chili to provide valuable information about the copy number variation of 45S rDNA and the actual physical size of the 5S rDNA in chili. PMID:19277503

  4. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  5. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    PubMed

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  6. Evidence for the presence of 5S rRNA in mammalian mitochondria.

    PubMed

    Magalhães, P J; Andreu, A L; Schon, E A

    1998-09-01

    Mammalian mitochondrial ribosomes contain two prokaryotic-like rRNAs, 12S and 16S, both encoded by mitochondrial DNA. As opposed to cytosolic ribosomes, however, these ribosomes are not thought to contain 5S rRNA. For this reason, it has been unclear whether 5S rRNA, which can be detected in mitochondrial preparations, is an authentic organellar species imported from the cytosol or is merely a copurifying cytosol-derived contaminant. We now show that 5S rRNA is tightly associated with highly purified mitochondrial fractions of human and rat cells and that 5S rRNA transcripts derived from a synthetic gene transfected transiently into human cells are both expressed in vivo and present in highly purified mitochondria and mitoplasts. We conclude that 5S rRNA is imported into mammalian mitochondria, but its function there still remains to be clarified. PMID:9725900

  7. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  8. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    PubMed

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes. PMID:26835745

  9. Diversity of 5S rRNA genes within individual prokaryotic genomes

    PubMed Central

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V.; Parsons, Tamasha; Yang, Liying; Gerz, Erika A.; Lee, Peng; Xiang, Charlie; Nossa, Carlos W.; Pei, Zhiheng

    2012-01-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1168 genomes from 779 unique species, 96 species exhibited >3% diversity. Twenty seven species with >10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there were tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. There is supplementary material. PMID:22765222

  10. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  11. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  12. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  13. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    PubMed Central

    Durovic, P; Kutay, U; Schleper, C; Dennis, P P

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-coding sequence. This result suggests that the primary transcript of the 5S rRNA gene corresponds in length (within 1 or 2 nucleotides) to the mature 5S rRNA sequence found in 50S ribosomal subunits. Images PMID:8288546

  14. Construction of the mycoplasma evolutionary tree from 5S rRNA sequence data.

    PubMed Central

    Rogers, M J; Simmons, J; Walker, R T; Weisburg, W G; Woese, C R; Tanner, R S; Robinson, I M; Stahl, D A; Olsen, G; Leach, R H

    1985-01-01

    The 5S rRNA sequences of eubacteria and mycoplasmas have been analyzed and a phylogenetic tree constructed. We determined the sequences of 5S rRNA from Clostridium innocuum, Acholeplasma laidlawii, Acholeplasma modicum, Anaeroplasma bactoclasticum, Anaeroplasma abactoclasticum, Ureaplasma urealyticum, Mycoplasma mycoides mycoides, Mycoplasma pneumoniae, and Mycoplasma gallisepticum. Analysis of these and published sequences shows that mycoplasmas form a coherent phylogenetic group that, with C. innocuum, arose as a branch of the low G+C Gram-positive tree, near the lactobacilli and streptococci. The initial event in mycoplasma phylogeny was formation of the Acholeplasma branch; hence, loss of cell wall probably occurred at the time of genome reduction to approximately to 1000 MDa. A subsequent branch produced the Spiroplasma. This branch appears to have been the origin of sterol-requiring mycoplasmas. During development of the Spiroplasma branch there were several independent genome reductions, each to approximately 500 MDa, resulting in Mycoplasma and Ureaplasma species. Mycoplasmas, particularly species with the smallest genomes, have high mutation rates, suggesting that they are in a state of rapid evolution. PMID:2579388

  15. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  16. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  17. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  18. 5 S Rrna Is Involved in Fidelity of Translational Reading Frame

    PubMed Central

    Dinman, J. D.; Wickner, R. B.

    1995-01-01

    Chromosomal mutants (maintenance of frame = mof) in which the efficiency of -1 ribosomal frame-shifting is increased can be isolated using constructs in which lacZ expression is dependent upon a -1 shift of reading frame. We isolate a new mof mutation, mof9, in Saccharomyces cerevisiae and show that it is complemented by both single and multi-copy 5 S rDNA clones. Two independent insertion mutations in the rDNA locus (rDNA::LEU2 and rDNA::URA3) also display the Mof(-) phenotype and are also complemented by single and multi-copy 5 S rDNA clones. Mutant 5 S rRNAs expressed from a plasmid as 20-50% of total 5 S rRNA in a wild-type host also induced the Mof(-) phenotype. The increase in frameshifting is greatest when the lacZ reporter gene is expressed on a high copy, episomal vector. No differences were found in 5 S rRNA copy number or electrophoretic mobilities in mof9 strains. Both mof9 and rDNA::LEU2 increase the efficiency of +1 frameshifting as well but have no effect on readthrough of UAG or UAA termination codons, indicating that not all translational specificity is affected. These data suggest a role for 5 S rRNA in the maintenance of frame in translation. PMID:8536994

  19. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  20. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  1. Phylogenetic analysis of the genera Thiobacillus and Thiomicrospira by 5S rRNA sequences.

    PubMed Central

    Lane, D J; Stahl, D A; Olsen, G J; Heller, D J; Pace, N R

    1985-01-01

    5S rRNA nucleotide sequences from Thiobacillus neapolitanus, Thiobacillus ferrooxidans, Thiobacillus thiooxidans, Thiobacillus intermedius, Thiobacillus perometabolis, Thiobacillus thioparus, Thiobacillus versutus, Thiobacillus novellus, Thiobacillus acidophilus, Thiomicrospira pelophila, Thiomicrospira sp. strain L-12, and Acidiphilium cryptum were determined. A phylogenetic tree, based upon comparison of these and other related 5S rRNA sequences, is presented. The results place the thiobacilli, Thiomicrospira spp., and Acidiphilium spp. in the "purple photosynthetic" bacterial grouping which also includes the enteric, vibrio, pseudomonad, and other familiar eubacterial groups in addition to the purple photosynthetic bacteria. The genus Thiobacillus is not an evolutionarily coherent grouping but rather spans the full breadth of the purple photosynthetic bacteria. PMID:3924899

  2. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    PubMed

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  3. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  4. Phylogenetic tree derived from bacterial, cytosol and organelle 5S rRNA sequences.

    PubMed Central

    Küntzel, H; Heidrich, M; Piechulla, B

    1981-01-01

    A phylogenetic tree was constructed by computer analysis of 47 completely determined 5S rRNA sequences. The wheat mitochondrial sequence is significantly more related to prokaryotic than to eukaryotic sequences, and its affinity to that of the thermophilic Gram-negative bacterium Thermus aquaticus is comparable to the affinity between Anacystis nidulans and chloroplastic sequences. This strongly supports the idea of an endosymbiotic origin of plant mitochondria. A comparison of the plant cytosol and chloroplast sub-trees suggests a similar rate of nucleotide substitution in nuclear genes and chloroplastic genes. Other features of the tree are a common precursor of protozoa and metazoa, which appears to be more related to the fungal than to the plant protosequence, and an early divergence of the archebacterial sequence (Halobacterium cutirubrum) from the prokaryotic branch. PMID:6785727

  5. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  6. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  7. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  8. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  9. Comparative structural analysis of eubacterial 5S rRNA by oxidation of adenines in the N-1 position.

    PubMed Central

    Pieler, T; Schreiber, A; Erdmann, V A

    1984-01-01

    Adenines in free 5S rRNA from Escherichia coli, Bacillus stearothermophilus and Thermus thermophilus have been oxidized at their N-1 position using monoperphthalic acid. The determination of the number of adenine 1-N-oxides was on the basis of UV spectroscopic data of the intact molecule. Identification of the most readily accessible nucleotides by sequencing gel analysis reveals that they are located in conserved positions within loops, exposed hairpin loops and single-base bulge loops. Implications for the structure and function of 5S rRNA will be discussed on the basis of this comparative analysis. Images PMID:6201825

  10. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families. PMID:25315165

  11. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  12. 5S rRNA sequences from four marine invertebrates and implications for base pairing models of metazoan sequences.

    PubMed

    Walker, W F; Doolittle, W F

    1983-08-11

    The nucleotide sequences of 5S rRNAs from the starfish Asterias vulgaris, the squid Illex illecebrosus, the sipunculid Phascolopsis gouldii and the jellyfish Aurelia aurita were determined. The sequence from Asterias lends support for one of two previous base pairing models for helix E in metazoan sequences. The Aurelia sequence differs by five nucleotides from that previously reported and does not violate the consensus secondary structure model for eukaryotic 5S rRNA. PMID:6136024

  13. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  14. Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

    PubMed Central

    Carol, P; Rozier, C; Lazaro, E; Ballesta, J P; Mache, R

    1993-01-01

    The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain. Images PMID:8441674

  15. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  16. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  17. Comparative analysis of the genes encoding 23S-5S rRNA intergenic spacer regions of Lactobacillus casei-related strains.

    PubMed

    Chen, H; Lim, C K; Lee, Y K; Chan, Y N

    2000-03-01

    In this study, investigations into the 23S-5S rRNA intergenic spacer regions (ISRs) of the Lactobacillus casei group were performed. A 1.6 kb fragment, from Lactobacillus paracasei strain ATCC 27092, containing part of the 5S rRNA gene (60 bp), the 5S-23S spacer region (198 bp) and part of the 23S rRNA gene (1295 bp) was cloned and sequenced (GenBank no. AF098107). This fragment was used as a probe to determine the rRNA restriction fragment length polymorphism (RFLP) patterns of nine strains belonging to the Lactobacillus casei group, along with four other non-Lactobacillus casei lactobacilli species. A pair of PCR primers, 23-Fl and 5-Ru, was designed and used for PCR amplification of the 23S-5S rRNA ISRs of these strains. The ISR length and sequence polymorphisms provided additional information for the taxonomic study of the Lactobacillus casei group. The spacer-length polymorphism of Lactobacillus rhamnosus was distinct from those of the other strains and this observation is consistent with the classification of Lactobacillus rhamnosus proposed by Mori et al. For all Lactobacillus casei and Lactobacillus paracasei strains, two major bands (approx. 250 and 170 bp in size) were obtained except in the case of Lactobacillus paracasei subsp. tolerans strain NCIMB 9709T, which yielded only one amplified product (250 bp). The sequencing data of the PCR products of seven well-characterized Lactobacillus casei and Lactobacillus paracasei strains revealed the presence of a 76/80 bp insertion/deletion with some random, single-base substitutions between the longer and shorter spacers for each respective strain. A few base variations were also detected within different strains in this group although the overall sequence similarity was very high (95.9-99.5%). The rRNA RFLP and the spacer sequence of Lactobacillus casei type strain ATCC 393T exhibited unique identities in this cluster. On the other hand, Lactobacillus casei strain ATCC 334 showed a high level of similarity

  18. What does the 5S rRNA multigene family tell us about the origin of the annual Triticeae (Poaceae)?

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2013-05-01

    We have investigated the complex relationships among the annual genera within the tribe Triticeae through phylogenetic analyses of the 5S rRNA multigene family. Cloned sequences were assigned to groups of orthologous sequences, called unit classes, that were subjected to several analyses including BLAST (Basic Local Alignment Search Tool) searches to assess possible ancestral relationships with perennial genera; phylogenetic analyses using parsimony (Pars), maximum likelihood (ML), and Bayesian methods; and minimum reticulation networks from the Pars, ML, and Bayesian trees. In this study, we included genera with both annual and perennial species, such as Dasypyrum, Hordeum, and Secale. BLAST pointed to Pseudoroegneria (carrier of the St genome) and possibly Thinopyrum (carrier of the J genome) as the potential next of kin. However, Thinopyrum and Pseudoroegneria have never fallen together on the individual trees with the former generally associated with Crithopsis, Aegilops, Triticum, and Dasypyrum, while the latter is usually associated with the rest of the genera within Triticeae. The "long" unit classes placed Dasypyrum breviaristatum together with Dasypyrum villosum, whereas the "short" unit classes put them far apart on the trees. None of the gene trees alone was able to summarize the complex relationships among the genera, in line with previous results in the Triticeae. However, the application of tools designed to display phylogenetic networks was able to depict the complex links among the genera based on the short and the long gene trees, including the close link between Thinopyrum and Pseudoroegneria suggested by the phylogenetic analyses. In addition, our analyses provide support for the hypothesis that at least some annual Triticeae taxa are derived from their perennial relatives. PMID:23789993

  19. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    PubMed Central

    Leontis, N B; Westhof, E

    1998-01-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  20. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment. PMID:22724546

  1. Involvement of multiple basic amino acids in yeast ribosomal protein L1 in 5S rRNA recognition.

    PubMed

    Yeh, L C; Lee, J C

    1995-01-01

    The role of basic amino acid residues located at the C-terminal region of the yeast ribosomal protein L1 in 5S rRNA binding was characterized in vitro and in vivo. Mutant proteins containing single or multiple amino acid substitutions were generated by site-directed mutagenesis of the L1 gene carried on a plasmid. In vitro RNP formation was examined by production of the mutant protein in the presence of the RNA molecule. The thermostability of the resultant RNP was also studied. Effects of these mutations on cell viability and ribosome assembly were characterized by transformation of a conditional null L1 yeast mutant with the mutated L1 gene expressed from the plasmid. Substitution of any one of the lysine or arginine residue did not affect significantly RNA binding in vitro or cell growth in vivo. However, several mutant proteins with substitutions of two of these basic amino acids bound RNA weakly and the RNPs were less stable. Cells expressing these mutant proteins were lethal. Theoretical structural prediction of these amino acids further provided information regarding their collective contributions to RNA recognition and to interaction between the RNP and other components of the 60S ribosomal subunit. PMID:8643400

  2. Accurate transcription of homologous 5S rRNA and tRNA genes and splicing of tRNA in vitro by soluble extracts of Neurospora.

    PubMed Central

    Tyler, B M; Giles, N H

    1984-01-01

    We have developed soluble extracts from Neurospora crassa capable of accurately and efficiently transcribing homologous 5S rRNA and tRNA genes. The extracts also appear to quantitatively end-process and splice the primary tRNA transcripts. Although the extracts could not transcribe a heterologous (yeast) 5S rRNA gene, they did transcribe a yeast tRNALeu gene and slowly process the transcripts. In addition, we have developed a novel strategy for rapidly sequencing uniformly labelled RNAs using base-specific ribonucleases. We have used this procedure to verify the identity of the in vitro transcripts and processing products. Images PMID:6235482

  3. Natural Microbial Community Compositions Compared by a Back-Propagating Neural Network and Cluster Analysis of 5S rRNA

    PubMed Central

    Noble, P. A.; Bidle, K. D.; Fletcher, M.

    1997-01-01

    The community compositions of free-living and particle-associated bacteria in the Chesapeake Bay estuary were analyzed by comparing banding patterns of stable low-molecular-weight RNA (SLMW RNA) which include 5S rRNA and tRNA molecules. By analyzing images of autoradiographs of SLMW RNAs on polyacrylamide gels, band intensities of 5S rRNA were converted to binary format for transmission to a back-propagating neural network (NN). The NN was trained to relate binary input to sample stations, collection times, positions in the water column, and sample types (e.g., particle-associated versus free-living communities). Dendrograms produced by using Euclidean distance and average and Ward's linkage methods on data of three independently trained NNs yielded the following results. (i) Community compositions of Chesapeake Bay water samples varied both seasonally and spatially. (ii) Although there was no difference in the compositions of free-living and particle-associated bacteria in the summer, these community types differed significantly in the winter. (iii) In the summer, most bay samples had a common 121-nucleotide 5S rRNA molecule. Although this band occurred in the top water of midbay samples, it did not occur in particle-associated communities of bottom-water samples. (iv) Regardless of the season, midbay samples had the greatest variety of 5S rRNA sizes. The utility of NNs for interpreting complex banding patterns in electrophoresis gels was demonstrated. PMID:16535593

  4. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    PubMed Central

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387

  5. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.

    PubMed

    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A

    2008-01-01

    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  6. mTOR associates with TFIIIC, is found at tRNA and 5S rRNA genes, and targets their repressor Maf1.

    PubMed

    Kantidakis, Theodoros; Ramsbottom, Ben A; Birch, Joanna L; Dowding, Sarah N; White, Robert J

    2010-06-29

    Synthesis of tRNA and 5S rRNA by RNA polymerase (pol) III is regulated by the mTOR pathway in mammalian cells. The mTOR kinase localizes to tRNA and 5S rRNA genes, providing an opportunity for direct control. Its presence at these sites can be explained by interaction with TFIIIC, a DNA-binding factor that recognizes the promoters of these genes. TFIIIC contains a TOR signaling motif that facilitates its association with mTOR. Maf1, a repressor that binds and inhibits pol III, is phosphorylated in a mTOR-dependent manner both in vitro and in vivo at serine 75, a site that contributes to its function as a transcriptional inhibitor. Proximity ligation assays confirm the interaction of mTOR with Maf1 and TFIIIC in nuclei. In contrast to Maf1 regulation in yeast, no evidence is found for nuclear export of Maf1 in response to mTOR signaling in HeLa cells. We conclude that mTOR associates with TFIIIC, is recruited to pol III-transcribed genes, and relieves their repression by Maf1. PMID:20543138

  7. Mutations in TFIIIA that increase stability of the TFIIIA-5 S rRNA gene complex: unusual effects on the kinetics of complex assembly and dissociation.

    PubMed

    Brady, Kristina L; Ponnampalam, Stephen N; Bumbulis, Michael J; Setzer, David R

    2005-07-22

    We have identified four mutations in Xenopus TFIIIA that increase the stability of TFIIIA-5 S rRNA gene complexes. In each case, the mutation has a relatively modest effect on equilibrium binding affinity. In three cases, these equilibrium binding effects can be ascribed primarily to decreases in the rate constant for protein-DNA complex dissociation. In the fourth case, however, a substitution of phenylalanine for the wild-type leucine at position 148 in TFIIIA results in much larger compensating changes in the kinetics of complex assembly and dissociation. The data support a model in which a relatively unstable population of complexes with multi-component dissociation kinetics forms rapidly; complexes then undergo a slow conformational change that results in very stable, kinetically homogeneous TFIIIA-DNA complexes. The L148F mutant protein acts as a particularly potent transcriptional activator when it is fused to the VP16 activation domain and expressed in yeast cells. Substitution of L148 to tyrosine or tryptophan produces an equally strong transcriptional activator. Substitution to histidine results in genetic and biochemical effects that are more modest than, but similar to, those observed with the L148F mutation. We propose that an amino acid with a planar side chain at position 148 can intercalate between adjacent base pairs in the intermediate element of the 5 S rRNA gene. Intercalation occurs slowly but results in a very stable DNA-protein complex. These results suggest that transcriptional activation by a cis-acting sequence element is largely dependent on the kinetic, rather than the thermodynamic, stability of the complex formed with an activator protein. Thus, transcriptional activation is dependent in large part on the lifetime of the activator-DNA complex rather than on binding site occupancy at steady state. Introduction of intercalating amino acids into zinc finger proteins may be a useful tool for producing artificial transcription factors with

  8. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    PubMed

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. PMID:26800847

  9. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central

    2012-01-01

    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  10. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. PMID:25261903

  11. Diversity of host species and strains of Pneumocystis carinii is based on rRNA sequences.

    PubMed Central

    Shah, J S; Pieciak, W; Liu, J; Buharin, A; Lane, D J

    1996-01-01

    We have amplified by PCR Pneumocystis carinii cytoplasmic small-subunit rRNA (variously referred to as 16S-like or 18S-like rRNA) genes from DNA extracted from bronchoalveolar lavage and induced sputum specimens from patients positive for P. carinii and from infected ferret lung tissue. The amplification products were cloned into pUC18, and individual clones were sequenced. Comparison of the determined sequences with each other and with published rat and partial human P.carinii small-subunit rRNA gene sequences reveals that, although all P. carinii small-subunit rRNAs are closely related (approximately 96% identity), small-subunit rRNA genes isolated from different host species (human, rat, and ferret) exhibit distinctive patterns of sequence variation. Two types of sequences were isolated from the infected ferret lung tissue, one as a predominant species and the other as a minor species. There was 96% identity between the two types. In situ hybridization of the infected ferret lung tissue with oligonucleotide probes specific for each type revealed that there were two distinct strains of P. carinii present in the ferret lung tissue. Unlike the ferret P. carinii isolates, the small-subunit rRNA gene sequences from different human P. carinii isolates have greater than 99% identity and are distinct from all rat and ferret sequences so far inspected or reported in the literature. Southern blot hybridization analysis of PCR amplification products from several additional bronchoalveolar lavage or induced sputum specimens from P. carinii-infected patients, using a 32P-labeled oligonucleotide probe specific for human P. carinii, also suggests that all of the human P. carinii isolates are identical. These findings indicate that human P. carinii isolates may represent a distinct species of P. carinii distinguishable from rat and ferret P. carinii on the basis of characterization of small-subunit rRNA gene sequences. PMID:8770515

  12. Identification of Scopulariopsis species by partial 28S rRNA gene sequence analysis.

    PubMed

    Jagielski, Tomasz; Kosim, Kinga; Skóra, Magdalena; Macura, Anna Barbara; Bielecki, Jacek

    2013-01-01

    The genus Scopulariopsis contains over 30 species of mitosporic moulds, which although usually saprophytic may also act as opportunistic pathogens in humans. They have mainly been associated with onychomycosis, and only sporadically reported as a cause of deep tissue infections or systemic disease. Identification of Scopulariopsis species still largely relies on phenotype-based methods. There is a need for a molecular diagnostic approach, that would allow to reliably discriminate between different Scopulariopsis species. The aim of this study was to apply sequence analysis of partial 28S rRNA gene for species identification of Scopulariopsis clinical isolates. Although the method employed did reveal some genetic polymorphism among Scopulariopsis isolates tested, it was not enough for species delineation. For this to be achieved, other genetic loci, within and beyond the rDNA operon, need to be investigated. PMID:24459837

  13. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

    1992-01-01

    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  14. Genetic and cytogenetic analyses of the A genome of Triticum monococcum. VIII. Localization of rDNAs and characterization of 5S rRNA genes.

    PubMed

    Kim, N S; Kuspira, J; Armstrong, K; Bhambhani, R

    1993-02-01

    In situ hybridization with [3H]dCTP labelled pScT7 (5S rDNA) and pTa80 (18S + 26S rDNA) indicated that both hybridized to the terminal regions of two pairs of chromosomes in Triticum monococcum. When the hybridization was performed with a mixture of both probes, only two pairs of chromosome arms were labelled, which suggested that the loci of both genes were located in juxtaposition to one another. Both probes labelled one pair of sites more heavily than the other. Southern analysis of 5S with BamHI-digested DNA from 12 accessions of T. monococcum (including T. urartu) produced two superimposed ladders of approximate sizes of 500 and 330 bp, which differ from T. aestivum in which 500- and 420-bp ladders were found. The 500-bp ladder is derived from chromosome 5A (5SDna-A2) and the 330-bp ladder from chromosome 1A (5SDna-A1). The recognition site for SstI was present in the long spacer region but absent in the short spacer as in T. aestivum; however, unlike T. aestivum, there were HaeIII (GGCC) and HindIII (AAGCTT) recognition sites in the short spacer region. The TaqI recognition sites (TCGA) in the long and short spacer regions are probably more highly methylated in T. monococcum than in T. aestivum. The results have implications regarding the evolutionary changes that occurred in the A genome of the hexaploid compared with the diploid. PMID:18469972

  15. The specific isolation of complete 5S rDNA units from chromosome 1A of hexaploid, tetraploid, and diploid wheat species using PCR with head-to-head oriented primers.

    PubMed

    Van Campenhout, S; Stappen, J V; Volckaert, G

    2001-08-01

    The presence of 5S rDNA units on chromosome 1A of Triticum aestivum was shown by the development of a specific PCR test, using head-to-head oriented primers. This primer set allowed the amplification of complete 5S DNA units and was used to isolate SS-Rrna-A1 sequences from polyploid and diploid wheat species. Multiple-alignment and parsimony analyses of the 132 sequences divided the sequences into four types. The isolates from T. aestivum and the tetraploid species (T. dicoccoides, T. dicoccum, T durum, T. araraticum, and T timopheevi) were all of one type, which was shown to be closely related to the type mainly characteristic for T. urartu. The other two types were isolated exclusively from the diploid species T. monococcum, T aegilopoides, T. thaoudar, and T. sinskajae and the hexaploid species T. zhukovski. Triticum monococcum was the only species for which representatives of each of the four sequence types were found to be present. Further, we discuss the possible multicluster arrangement of the 5S-Rrna-A1 array. PMID:11550886

  16. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  17. Species identification of oral viridans streptococci by restriction fragment polymorphism analysis of rRNA genes.

    PubMed Central

    Rudney, J D; Larson, C J

    1993-01-01

    Oral streptococci formerly classified as Streptococcus sanguis have been divided into six genetic groups. Methods to identify those species by genotype are needed. This study compared restriction fragment polymorphisms of rRNA genes (ribotypes) for seven S. gordonii, three S. sanguis, four S. oralis, three S. mitis, one S. crista, and seven S. parasanguis strains classified in previous DNA hybridization studies, as well as one clinical isolate. DNA was digested with HindIII, PvuII, HindIII and PvuII combined, EcoRI, BamHI, AatII, AlwNI, and DraII. DNA fragments were hybridized with a digoxigenin-labeled cDNA probe obtained by reverse transcription of Escherichia coli 16S and 23S rRNA. S. oralis, S. mitis, and S. parasanguis all showed an isolated 2,290-bp band in AatII ribotypes that was absent from S. gordonii, S. sanguis, and S. crista. The last three groups showed species-specific bands with AatII and also with PvuII. S. oralis could be distinguished from S. mitis and S. parasanguis in AlwNI and DraII ribotypes. S. mitis and S. parasanguis could not be distinguished, since they shared multiple bands in PvuII, AlwNI, and EcoRI patterns. The clinical isolate in the panel was very similar to S. sanguis by all enzymes used. Our findings suggest that ribotyping may be useful for genotypic identification of oral viridans streptococci. Initial digests of clinical isolates might be made with AatII, followed by PvuII or AlwNI. Isolates then could be identified by comparing ribotype patterns with those of reference strains. This approach could facilitate clinical studies of these newly defined species. Images PMID:7691875

  18. The inconstant gut microbiota of Drosophila species revealed by 16S rRNA gene analysis

    PubMed Central

    Wong, Adam C-N; Chaston, John M; Douglas, Angela E

    2013-01-01

    The gut microorganisms in some animals are reported to include a core microbiota of consistently associated bacteria that is ecologically distinctive and may have coevolved with the host. The core microbiota is promoted by positive interactions among bacteria, favoring shared persistence; its retention over evolutionary timescales is evident as congruence between host phylogeny and bacterial community composition. This study applied multiple analyses to investigate variation in the composition of gut microbiota in drosophilid flies. First, the prevalence of five previously described gut bacteria (Acetobacter and Lactobacillus species) in individual flies of 21 strains (10 Drosophila species) were determined. Most bacteria were not present in all individuals of most strains, and bacterial species pairs co-occurred in individual flies less frequently than predicted by chance, contrary to expectations of a core microbiota. A complementary pyrosequencing analysis of 16S rRNA gene amplicons from the gut microbiota of 11 Drosophila species identified 209 bacterial operational taxonomic units (OTUs), with near-saturating sampling of sequences, but none of the OTUs was common to all host species. Furthermore, in both of two independent sets of Drosophila species, the gut bacterial community composition was not congruent with host phylogeny. The final analysis identified no common OTUs across three wild and four laboratory samples of D. melanogaster. Our results yielded no consistent evidence for a core microbiota in Drosophila. We conclude that the taxonomic composition of gut microbiota varies widely within and among Drosophila populations and species. This is reminiscent of the patterns of bacterial composition in guts of some other animals, including humans. PMID:23719154

  19. The inconstant gut microbiota of Drosophila species revealed by 16S rRNA gene analysis.

    PubMed

    Wong, Adam C-N; Chaston, John M; Douglas, Angela E

    2013-10-01

    The gut microorganisms in some animals are reported to include a core microbiota of consistently associated bacteria that is ecologically distinctive and may have coevolved with the host. The core microbiota is promoted by positive interactions among bacteria, favoring shared persistence; its retention over evolutionary timescales is evident as congruence between host phylogeny and bacterial community composition. This study applied multiple analyses to investigate variation in the composition of gut microbiota in drosophilid flies. First, the prevalence of five previously described gut bacteria (Acetobacter and Lactobacillus species) in individual flies of 21 strains (10 Drosophila species) were determined. Most bacteria were not present in all individuals of most strains, and bacterial species pairs co-occurred in individual flies less frequently than predicted by chance, contrary to expectations of a core microbiota. A complementary pyrosequencing analysis of 16S rRNA gene amplicons from the gut microbiota of 11 Drosophila species identified 209 bacterial operational taxonomic units (OTUs), with near-saturating sampling of sequences, but none of the OTUs was common to all host species. Furthermore, in both of two independent sets of Drosophila species, the gut bacterial community composition was not congruent with host phylogeny. The final analysis identified no common OTUs across three wild and four laboratory samples of D. melanogaster. Our results yielded no consistent evidence for a core microbiota in Drosophila. We conclude that the taxonomic composition of gut microbiota varies widely within and among Drosophila populations and species. This is reminiscent of the patterns of bacterial composition in guts of some other animals, including humans. PMID:23719154

  20. Comparative Studies of 5S rDNA Profiles and Cyt b Sequences in two Onychostoma Species (Cyprinidae)

    PubMed Central

    Han, Chiao-Chuan; Yen, Tsair-Bor; Chen, Nian-Cih; Tseng, Mei-Chen

    2015-01-01

    Onychostoma barbatulum and O. alticorpus, two primarily freshwater cyprinid fish, have similar morphological characters and partially overlapping ecological habitats. In order to explore the genetic differences between these two species, chromosomal characteristics and genetic variations were examined by fluorescence in situ hybridization (FISH) of 5S rDNA and cytochrome (Cyt) b gene analysis. Ten specimens of O. barbatulum and O. alticorpus were collected from the Nanzihsian Stream in southern Taiwan. FISH revealed that the 5S rDNA loci of O. barbatulum and O. alticorpus were found at a pericentromeric and subtelomeric position, respectively, in a pair of submetacentric chromosomes. Cyt b genes were amplified and sequenced from five individuals of each species. Intraspecific genetic distances ranged from 0.001–0.004 in O. barbatulum and from 0.001–0.006 in O. alticorpus. Genetic distances between these two species ranged from 0.132–0.142. The phylogenetic tree showed these two species are not sister species. In conclusion, FISH cytogenetic information and Cyt b gene analyses indicated that these two species have significantly different genetic characteristics; nevertheless, their morphological similarities may be due to environmental adaptation. PMID:26690426

  1. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  2. Complete sequence and gene organization of the Nosema spodopterae rRNA gene.

    PubMed

    Tsai, Shu-Jen; Huang, Wei-Fone; Wang, Chung-Hsiung

    2005-01-01

    By sequencing the entire ribosomal RNA (rRNA) gene of Nosema spodopterae, we show here that its gene organization follows a pattern similar to the Nosema type species, Nosema bombycis, i.e. 5'-large subunit rRNA (2,497 bp)-internal transcribed spacer (185 bp)-small subunit rRNA (1,232 bp)-intergenic spacer (277 bp)-5S rRNA (114 bp)-3'. Gene sequences and the secondary structures of large subunit rRNA, small subunit rRNA, and 5S rRNA are compared with the known corresponding sequences and structures of closely related microsporidia. The results suggest that the Nosema genus may be heterogeneous and that the rRNA gene organization may be a useful characteristic for determining which species are closely related to the type species. PMID:15702980

  3. Species-level identification of staphylococci isolated from bovine mastitis in Brazil using partial 16S rRNA sequencing.

    PubMed

    Lange, Carla C; Brito, Maria A V P; Reis, Daniele R L; Machado, Marco A; Guimarães, Alessandro S; Azevedo, Ana L S; Salles, Érica B; Alvim, Mariana C T; Silva, Fabiana S; Meurer, Igor R

    2015-04-17

    Staphylococci isolated from bovine milk and not classified as Staphylococcus aureus represent a heterogeneous group of microorganisms that are frequently associated with bovine mastitis. The identification of these microorganisms is important, although it is difficult and relatively costly. Genotypic methods add precision in the identification of Staphylococcus species. In the present study, partial 16S rRNA sequencing was used for the species identification of coagulase-positive and coagulase-negative staphylococci isolated from bovine mastitis. Two hundred and two (95%) of the 213 isolates were successfully identified at the species level. The assigning of an isolate to a particular species was based on ≥99% identity with 16S rRNA sequences deposited in GenBank. The identified isolates belonged to 13 different Staphylococcus species; Staphylococcus chromogenes, S. aureus and Staphylococcus epidermidis were the most frequently identified species. Eight isolates could not be assigned to a single species, as the obtained sequences showed 99% or 100% similarity to sequences from two or three different Staphylococcus species. The relatedness of these isolates with the other isolates and reference strains was visualized using a cladogram. In conclusion, 16S rRNA sequencing was an objective and accurate method for the proper identification of Staphylococcus species isolated from bovine mastitis. Additional target genes could be used in non-conclusive cases for the species-level identification of these microorganisms. PMID:25704228

  4. Sequence variation within the rRNA gene loci of 12 Drosophila species

    PubMed Central

    Stage, Deborah E.; Eickbush, Thomas H.

    2007-01-01

    Concerted evolution maintains at near identity the hundreds of tandemly arrayed ribosomal RNA (rRNA) genes and their spacers present in any eukaryote. Few comprehensive attempts have been made to directly measure the identity between the rDNA units. We used the original sequencing reads (trace archives) available through the whole-genome shotgun sequencing projects of 12 Drosophila species to locate the sequence variants within the 7.8–8.2 kb transcribed portions of the rDNA units. Three to 18 variants were identified in >3% of the total rDNA units from 11 species. Species where the rDNA units are present on multiple chromosomes exhibited only minor increases in sequence variation. Variants were 10–20 times more abundant in the noncoding compared with the coding regions of the rDNA unit. Within the coding regions, variants were three to eight times more abundant in the expansion compared with the conserved core regions. The distribution of variants was largely consistent with models of concerted evolution in which there is uniform recombination across the transcribed portion of the unit with the frequency of standing variants dependent upon the selection pressure to preserve that sequence. However, the 28S gene was found to contain fewer variants than the 18S gene despite evolving 2.5-fold faster. We postulate that the fewer variants in the 28S gene is due to localized gene conversion or DNA repair triggered by the activity of retrotransposable elements that are specialized for insertion into the 28S genes of these species. PMID:17989256

  5. Physical and genetic maps of the Leptospira interrogans serovar icterohaemorrhagiae strain Ictero no.1 chromosome and sequencing of a 19-kb region of the genome containing the 5S rRNA gene.

    PubMed

    Takahashi, Y; Akase, K; Hirano, H; Fukunaga, M

    1998-07-17

    We report the construction of physical and genetic maps of the chromosome of Leptospira interrogans serovar icterohaemorrhagiae strain Ictero No.1 using pulsed-field gel electrophoresis of DNA fragments generated by digestion with enzymes SrfI, AscI, FseI, and NotI and using reciprocal hybridization. We also sequenced the 19-kilobase (kb) DNA segment including the one gene for 5S rRNA (rrf) of pathogenic Leptospira. The size of the chromosome of the strain Ictero No.1 was estimated to be 4673kb and was found to be similar to those of the chromosomes of the leptospira strains Verdun (serovar icterohaemorrhagiae) and RZ11 (serovar pomona). The strains Verdun and RZ11 carry a small 350-kb replicon (minichromosome), and the strain Ictero No.1 also contained the same kind of molecule together with the chromosome. The physical maps of the strains Ictero No.1 and Verdun were almost identical, as were the locations of the selected genes, except for the location of one of the 16S rRNA genes. Overall, the genetic organization appeared to be conserved within the serovar icterohaemorrhagiae strains. In the sequenced region, we identified 10 putative ORFs and one rrf sequence, and the transcription orientations were all the same. A homology search for the products deduced from the sequenced data revealed that the orf H exhibited high similarity to malic acid enzyme of Haemophilus influenzae and fumarate hydratase of Escherichia coli (orf J). The rest of the putative products encoded by ORFs in the sequenced region showed little similarity with the proteins contained in the databases and were considered to be unknown proteins. PMID:9666070

  6. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).

    PubMed

    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F

    2014-01-01

    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera. PMID:25501173

  7. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    PubMed Central

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  8. The phylogeny of intestinal porcine spirochetes (Serpulina species) based on sequence analysis of the 16S rRNA gene.

    PubMed Central

    Pettersson, B; Fellström, C; Andersson, A; Uhlén, M; Gunnarsson, A; Johansson, K E

    1996-01-01

    Four type or reference strains and twenty-two field strains of intestinal spirochetes isolated from Swedish pig herds were subjected to phylogenetic analysis based on 16S rRNA sequences. Almost complete (>95%) 16S rRNA sequences were obtained by solid-phase DNA sequencing of in vitro-amplified rRNA genes. The genotypic patterns were compared with a previously proposed biochemical classification scheme, comprising beta-hemolysis, indole production, hippurate hydrolysis, and alpha-galactosidase, alpha-glucosidase, and beta-glucosidase activities. Comparison of the small-subunit rRNA sequences showed that the strains of the genus Serpulina were closely related. Phylogenetic trees were constructed, and three clusters were observed. This was also confirmed by signature nucleotide analysis of the serpulinas. The indole-producing strains, including the strains of S. hyodysenteriae and some weakly beta-hemolytic Serpulina strains, formed one cluster. A second cluster comprised weakly beta-hemolytic strains that showed beta-galactosidase activity but lacked indole production and hippurate-hydrolyzing capacity. The second cluster contained two subclusters with similar phenotypic profiles. A third cluster involved strains that possessed a hippurate-hydrolyzing capacity which was distinct from that of the former two clusters, because of 17 unique nucleotide positions of the 16S rRNA gene. Interestingly, the strains of this third cluster were found likely to have a 16S rRNA structure in the V2 region of the molecule different from that of the serpulinas belonging to the other clusters. As a consequence of these findings, we propose that the intestinal spirochetes of this phenotype (i.e., P43/6/78-like strains) should be regarded as a separate Serpulina species. Furthermore, this cluster was found to be by far the most homogeneous one. In conclusion, the biochemical classification of porcine intestinal spirochetes was comparable to that by phylogenetic analysis based on 16S rRNA

  9. 4.5S ribonucleic acid, a novel ribosome component in the chloroplasts of flowering plants.

    PubMed Central

    Bowman, C M; Dyer, T A

    1979-01-01

    A species of low-molecular-weight ribosomal RNA, referred to as '4.5S rRNA', was found in addition to 5S rRNA in the large subunit of chloroplast ribosomes of a wide range of flowering plants. It was shown by sequence analysis that several variants of this RNA may occur in a plant. Furthermore, although in most flowering plants the predominant variant contains about 100 nucleotides, in the broad bean it has less than 80. It seems, therefore, to be much more diverse in size and sequence than the other ribosomal RNA species. Like 5S rRNA , it does not contain modified nucleotides and it is also unusual in having an unphosphorylated 5'-end. It is apparently neither a homologue of cytosol 5.8S rRNA nor a fragment of 23S rRNA. Images Fig. 1. Fig. 3. Fig. 4. PMID:540035

  10. Species Identification and Profiling of Complex Microbial Communities Using Shotgun Illumina Sequencing of 16S rRNA Amplicon Sequences

    PubMed Central

    Lay, Christophe; Ho, Eliza Xin Pei; Low, Louie; Hibberd, Martin Lloyd; Nagarajan, Niranjan

    2013-01-01

    The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequencing of the bacterial 16S rRNA gene, optimized to amplify more than 90% of sequences in the Greengenes database and with the ability to distinguish nearly twice as many species-level OTUs compared to existing protocols. Using several in silico and experimental datasets, we demonstrate that despite the presence of multiple variable and conserved regions, the resulting shotgun sequences can be used to accurately quantify the constituents of complex microbial communities. The reconstruction of a significant fraction of the 16S rRNA gene also enabled high precision (>90%) in species-level identification thereby opening up potential application of this approach for clinical microbial characterization. PMID:23579286

  11. Molecular characterization of Sarcocystis species from Polish roe deer based on ssu rRNA and cox1 sequence analysis.

    PubMed

    Kolenda, Rafał; Ugorski, Maciej; Bednarski, Michał

    2014-08-01

    Sarcocysts from four Polish roe deer were collected and examined by light microscopy, small subunit ribosomal RNA (ssu rRNA), and the subunit I of cytochrome oxidase (cox1) sequence analysis. This resulted in identification of Sarcocystis gracilis, Sarcocystis oviformis, and Sarcocystis silva. However, we were unable to detect Sarcocystis capreolicanis, the fourth Sarcocystis species found previously in Norwegian roe deer. Polish sarcocysts isolated from various tissues differed in terms of their shape and size and were larger than the respective Norwegian isolates. Analysis of ssu rRNA gene revealed the lack of differences between Sarcocystis isolates belonging to one species and a very low degree of genetic diversity between Polish and Norwegian sarcocysts, ranging from 0.1% for Sarcocystis gracilis and Sarcocystis oviformis to 0.44% for Sarcocystis silva. Contrary to the results of the ssu rRNA analysis, small intraspecies differences in cox1 sequences were found among Polish Sarcocystis gracilis and Sarcocystis silva isolates. The comparison of Polish and Norwegian cox1 sequences representing the same Sarcocystis species revealed similar degree of sequence identity, namely 99.72% for Sarcocystis gracilis, 98.76% for Sarcocystis silva, and 99.85% for Sarcocystis oviformis. Phylogenetic reconstruction and genetic population analyses showed an unexpected high degree of identity between Polish and Norwegian isolates. Moreover, cox1 gene sequences turned out to be more accurate than ssu rRNA when used to reveal phylogenetic relationships among closely related species. The results of our study revealed that the same Sarcocystis species isolated from the same hosts living in different geographic regions show a very high level of genetic similarity. PMID:24948101

  12. Discrimination among thermophilic Campylobacter species by polymerase chain reaction amplification of 23S rRNA gene fragments.

    PubMed Central

    Eyers, M; Chapelle, S; Van Camp, G; Goossens, H; De Wachter, R

    1993-01-01

    By comparing nucleic acid sequences determined for one of the most variable areas of 23S rRNA genes of 23 Campylobacter strains, we were able to identify regions specific for thermophilic Campylobacter strains. Oligonucleotide primers corresponding to these unique regions were synthesized and used in the polymerase chain reaction. One primer pair selectively detected all thermophilic Campylobacter species, while four other primer pairs allowed discrimination among the thermophilic species Campylobacter coli, Campylobacter jejuni subsp. jejuni, Campylobacter lari, and Campylobacter upsaliensis. All primer sets were tested successfully on a large number of clinical isolates. Images PMID:7508460

  13. Structural and functional exchangeability of 5 S RNA species from the eubacterium E.coli and the thermoacidophilic archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Teixidò, J; Altamura, S; Londei, P; Amils, R

    1989-01-01

    The role of 5 S RNA within the large ribosomal subunit of the extremely thermophilic archaebacterium Sulfolobus solfataricus has been analysed by means of in vitro reconstitution procedures. It is shown that Sulfolobus 50 S subunits reconstituted in the absence of 5 S RNA are inactive in protein synthesis and lack 2-3 ribosomal proteins. Furthermore, it has been determined that in the course of the in vitro assembly process Sulfolobus 5 S RNA can be replaced by the correspondent RNA species of E.coli; Sulfolobus reconstituted particles containing the eubacterial 5 S molecule are stable and active in polypeptide synthesis at high temperatures. Images PMID:2493632

  14. Phylogenetic analysis of encapsulated and non-encapsulated Trichinella species by studying the 5S rDNA tandemly repeated intergenic region.

    PubMed

    van der Giessen, J W B; Fonville, M; Briels, I; Pozio, E

    2005-09-01

    The identification of sequence regions in the genomes of pathogens which can be useful to distinguish among species and genotypes, is of great importance for epidemiological, molecular, and phylogenetic studies. The 5S ribosomal DNA intergenic spacer region has been identified as a good target to distinguish among eight Trichinella species and genotypes. The recent discovery of two non-encapsulated species in this genus, Trichinella papuae and Trichinella zimbabwensis, which can infect both mammals and reptiles, has suggested analyzing their 5S rDNA. Amplification of the tandem repeats of the 5S rDNA intergenic region of encapsulated species of Trichinella shows a 751bp fragment, whereas the three non-encapsulated species show a fragment of 800bp with T. pseudospiralis showing an additional fragment of 522bp. Although the size of the 800bp PCR fragments of T. papuae and T. zimbabwensis are similar to that of T. pseudospiralis, there are differences in the 5S rDNA intergenic regions among the three non-encapsulated species. Phylogenetic analysis of the 5S rDNA intergenic regions shows a clustering together of the three non-encapsulated Trichinella species that is well separated from the encapsulated ones. In addition, a single PCR-based method allows distinguishing non-encapsulated and encapsulated species. PMID:16076532

  15. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    PubMed

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. PMID:24643007

  16. Comparison of Bacteroides-Prevotella 16S rRNA genetic markers for fecal samples from different animal species

    USGS Publications Warehouse

    Fogarty, L.R.; Voytek, M.A.

    2005-01-01

    To effectively manage surface and ground waters it is necessary to improve our ability to detect and identify sources of fecal contamination. We evaluated the use of the anaerobic bacterial group Bacteroides-Prevotella as a potential fecal indicator. Terminal restriction length polymorphism (T-RFLP) of the 16S rRNA genes from this group was used to determine differences in populations and to identify any unique populations in chickens, cows, deer, dogs, geese, horses, humans, pigs, and seagulls. The group appears to be a good potential fecal indicator in all groups tested except for avians. Cluster analysis of Bacteroides-Prevotella community T-RFLP profiles indicates that Bacteroides-Prevotella populations from samples of the same host species are much more similar to each other than to samples from different source species. We were unable to identify unique peaks that were exclusive to any source species; however, for most host species, at least one T-RFLP peak was identified to be more commonly found in that species, and a combination of peaks could be used to identify the source. T-RFLP profiles obtained from water spiked with known-source feces contained the expected diagnostic peaks from the source. These results indicate that the approach of identifying Bacteroides-Prevotella molecular markers associated with host species might be useful in identifying sources of fecal contamination in the environment.

  17. Comparison of bacteroides-prevotella 16S rRNA genetic markers for fecal samples from different animal species.

    PubMed

    Fogarty, Lisa R; Voytek, Mary A

    2005-10-01

    To effectively manage surface and ground waters it is necessary to improve our ability to detect and identify sources of fecal contamination. We evaluated the use of the anaerobic bacterial group Bacteroides-Prevotella as a potential fecal indicator. Terminal restriction length polymorphism (T-RFLP) of the 16S rRNA genes from this group was used to determine differences in populations and to identify any unique populations in chickens, cows, deer, dogs, geese, horses, humans, pigs, and seagulls. The group appears to be a good potential fecal indicator in all groups tested except for avians. Cluster analysis of Bacteroides-Prevotella community T-RFLP profiles indicates that Bacteroides-Prevotella populations from samples of the same host species are much more similar to each other than to samples from different source species. We were unable to identify unique peaks that were exclusive to any source species; however, for most host species, at least one T-RFLP peak was identified to be more commonly found in that species, and a combination of peaks could be used to identify the source. T-RFLP profiles obtained from water spiked with known-source feces contained the expected diagnostic peaks from the source. These results indicate that the approach of identifying Bacteroides-Prevotella molecular markers associated with host species might be useful in identifying sources of fecal contamination in the environment. PMID:16204514

  18. Emergence of Multidrug-Resistant Campylobacter Species Isolates with a Horizontally Acquired rRNA Methylase

    PubMed Central

    Wang, Yang; Zhang, Maojun; Deng, Fengru; Shen, Zhangqi; Wu, Congming; Zhang, Jianzhong

    2014-01-01

    Antibiotic-resistant Campylobacter constitutes a serious threat to public health, and resistance to macrolides is of particular concern, as this class of antibiotics is the drug of choice for clinical therapy of campylobacteriosis. Very recently, a horizontally transferrable macrolide resistance mediated by the rRNA methylase gene erm(B) was reported in a Campylobacter coli isolate, but little is known about the dissemination of erm(B) among Campylobacter isolates and the association of erm(B)-carrying isolates with clinical disease. To address this question and facilitate the control of antibiotic-resistant Campylobacter, we determined the distribution of erm(B) in 1,554 C. coli and Campylobacter jejuni isolates derived from food-producing animals and clinically confirmed human diarrheal cases. The results revealed that 58 of the examined isolates harbored erm(B) and exhibited high-level resistance to macrolides, and most were recent isolates, derived in 2011-2012. In addition, the erm(B)-positive isolates were all resistant to fluoroquinolones, another clinically important antibiotic used for treating campylobacteriosis. The erm(B) gene is found to be associated with chromosomal multidrug resistance genomic islands (MDRGIs) of Gram-positive origin or with plasmids of various sizes. All MDRGIs were transferrable to macrolide-susceptible C. jejuni by natural transformation under laboratory conditions. Molecular typing of the erm(B)-carrying isolates by pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) identified diverse genotypes and outbreak-associated diarrheal isolates. Molecular typing also suggested zoonotic transmission of erm(B)-positive Campylobacter. These findings reveal an emerging and alarming trend of dissemination of erm(B) and MDRGIs in Campylobacter and underscore the need for heightened efforts to control their further spread. PMID:24982085

  19. Sequence Characterization of Mitochondrial 12S rRNA Gene in Mouse Deer (Moschiola indica) for PCR-RFLP Based Species Identification

    PubMed Central

    Siddappa, Chandra Mohan; Saini, Mohini; Das, Asit; Sharma, Anil K.; Gupta, Praveen K.

    2013-01-01

    Mitochondrial 12S rRNA has proven to be a useful molecular marker for better conservation and management of the endangered species. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) of the mitochondrial 12S rRNA gene has proven to be a reliable and efficient tool for the identification of different Indian deer species of family cervidae. In the present study, mitochondrial 12S rRNA gene sequence of mouse deer (Moschiola indica) belonging to the family Tragulidae was characterized and analysed in silico for its use in species identification. Genomic DNA was isolated from the hair follicles and mitochondrial 12S rRNA gene was amplified using universal primers. PCR product was cloned and sequenced for the first time. The sequence of mouse deer showed 90.04, 90.08, 90.04, 91.2, 90.04, and 90.08% identities with sika deer, sambar, hog deer, musk deer, chital, and barking deer, respectively. Restriction mapping in Lasergene (DNAstar Inc., Madison, WI, USA) revealed that mouse deer mitochondrial 12S rRNA gene sequence can be differentiated from the other deer species in PCR-RFLP using RsaI, DdeI, BsrI, and BstSFI. With the help of predicted pattern, mouse deer can be identified using genomic DNA from a variety of biomaterials, thereby providing molecular aid in wildlife forensics and conservation of the species. PMID:24455258

  20. 18S rRNA V9 metabarcoding for diet characterization: a critical evaluation with two sympatric zooplanktivorous fish species.

    PubMed

    Albaina, Aitor; Aguirre, Mikel; Abad, David; Santos, María; Estonba, Andone

    2016-03-01

    The potential of the 18S rRNA V9 metabarcoding approach for diet assessment was explored using MiSeq paired-end (PE; 2 × 150 bp) technology. To critically evaluate the method's performance with degraded/digested DNA, the diets of two zooplanktivorous fish species from the Bay of Biscay, European sardine (Sardina pilchardus) and European sprat (Sprattus sprattus), were analysed. The taxonomic resolution and quantitative potential of the 18S V9 metabarcoding was first assessed both in silico and with mock and field plankton samples. Our method was capable of discriminating species within the reference database in a reliable way providing there was at least one variable position in the 18S V9 region. Furthermore, it successfully discriminated diet between both fish species, including habitat and diel differences among sardines, overcoming some of the limitations of traditional visual-based diet analysis methods. The high sensitivity and semi-quantitative nature of the 18S V9 metabarcoding approach was supported by both visual microscopy and qPCR-based results. This molecular approach provides an alternative cost and time effective tool for food-web analysis. PMID:27087935

  1. [Determination of 16S rRNA gene sequence for a new ANAMMOX bacterial species].

    PubMed

    Zu, Bo; Zhang, Dai-jun; Yan, Qing

    2008-02-01

    The anaerobic ammonium oxidation (ANAMMOX) activity of the sludge was about 9.84 x 10(-4) mg x (mg x h)(-1) by measuring the simultaneous consumption of ammonium and nitrite under anoxic conditions in the batch tests. The consumption of NO2(-) -N and NH4+ -N was 1.311 for ANAMMOX bacteria. The partial 16S rDNA sequence was obtained by using molecule biology methods. Crude DNA of the total bacteria in granular sludge from EGSB reactor was extracted and purified. Then, PCR amplification by using specific primer, clone and sequence determination was performed. ANAMMOX bacterial species(anaerobic ammonium-oxidizing Planctomycete cquenviron-1) which was enrichment cultivated from EGSB reactor were the same genera with Candidatus "Anammoxoglobus propionicus" and Candidatus "Jettenia asiatica" by analyzing phylogenetic tree. The maximum identities of anaerobic ammonium-oxidizing Planctomycete cquenviron-1 with other ANAMMOX bacterial species was about 93%. The results showed that a new ANAMMOX bacterial species which was enrichment cultivated from EGSB reactor was found and anaerobic ammonium-oxidizing Planctomycete cquenviron-1 was denominated. PMID:18613522

  2. Evolution of small putative group I introns in the SSU rRNA gene locus of Phialophora species

    PubMed Central

    2011-01-01

    Background Group I introns (specifically subgroup IC1) are common in the nuclear ribosomal RNA genes of fungi. While most range in length from more than 200 to nearly 1800 nucleotides (nt) in length, several small putative (or degenerate) group I introns have been described that are between 56 and 81 nt. Although small, previously we demonstrated that the PaSSU intron in the rRNA small subunit gene of Phialophora americana isolate Wang 1046 is capable of in vitro splicing using a standard group I intron pathway, thus qualifying it as a functional ribozyme. Findings Here, we describe eight short putative group I introns, ranging in length from 63 to 75 nt, in the rRNA small subunit genes of Phialophora isolates, a fungal genus that ranges from saprobic to pathogenic on plants and animals. All contain putative pairing regions P1, P7, and P10, as well as a pairing region formed between the middle of the intron and part of the 3' exon. The other pairing regions common in the core of standard group I introns are absent. However, parts of the 3' exon may aid in the stabilization of these small introns. Although the eight putative group I introns were from at least three species of Phialophora, phylogenetic analysis indicated that the eight are monophyletic. They are also monophyletic with the small introns of two lichen-forming fungi, Porpidia crustulata and Arthonia lapidicola. Conclusions The small putative group I introns in Phialophora have common features that may represent group I introns at their minima. They appear to have a single origin as indicated by their monophyly in phylogenetic analyses. PMID:21781325

  3. Development of genome-specific 5S rDNA markers in Brassica and related species for hybrid testing.

    PubMed

    La Mura, Maurizio; Norris, Carol; Sporle, Sue; Jayaweera, Dasuni; Greenland, Andy; Lee, David

    2010-08-01

    The Brassicaceae are targets for DNA manipulation to modify oil content and composition. However, any strategy for creating novel products using genetic modification or traditional breeding must take into account the potential for hybridization with other Brassica species, many of which are important sources of edible oils. In this study we have tested Brassica carinata, a possible target for oil modification, to establish whether it can cross with other Brassica species and related genera, and we have developed molecular DNA assays to confirm hybridization. PMID:20725152

  4. Evaluation of the 16S and 12S rRNA genes as universal markers for the identification of commercial fish species in South Africa.

    PubMed

    Cawthorn, Donna-Mareè; Steinman, Harris Andrew; Witthuhn, R Corli

    2012-01-01

    The development of DNA-based methods for the identification of fish species is important for fisheries research and control, as well as for the detection of unintentional or fraudulent species substitutions in the marketplace. The aim of this study was to generate a comprehensive reference database of DNA sequences from the mitochondrial 16S and 12S ribosomal RNA (rRNA) genes for 53 commercial fish species in South Africa and to evaluate the applicability of these genetic markers for the identification of fish at the species level. The DNA extracted from all target species was readily amplified using universal primers targeting both rRNA gene regions. Sequences from the 16S and 12S rRNA genes were submitted to GenBank for the first time for 34% and 53% of the fish species, respectively. Cumulative analysis of the 16S rRNA gene sequences revealed mean conspecific, congeneric and confamilial Kimura two parameter (K2P) distances of 0.03%, 0.70% and 5.10% and the corresponding values at the 12S level were 0.03%, 1.00% and 5.57%. K2P neighbour-joining trees based on both sequence datasets generally clustered species in accordance with their taxonomic classifications. The nucleotide variation in both the 16S and 12S sequences was suitable for identifying the large majority of the examined fish specimens to at least the level of genus, but was found to be less useful for the explicit differentiation of certain congeneric fish species. It is recommended that one or more faster-evolving DNA regions be analysed to confirm the identities of closely-related fish species in South Africa. PMID:21963445

  5. Identification and characterization of alkaline protease producing Bacillus firmus species EMBS023 by 16S rRNA gene sequencing.

    PubMed

    Wishard, Rohan; wishard, Rohan; Jaiswal, Mahak; Parveda, Maheshwari; Amareshwari, P; Bhadoriya, Sneha Singh; Rathore, Pragya; Yadav, Mukesh; Nayarisseri, Anuraj; Nair, Achuthsankar S

    2014-12-01

    Probiotic microorganisms are those which exert a positive exect on the growth of the host, when administered as a dietary mixture in an adequate amount. They form the best alternative to the use of antibiotics for controlling enteric diseases in poultry farm animals, especially in the light of the gruesome problems of development of antibiotic resistance in enteric pathogens and the contamination of poultry products with antibiotics. 16S rDNA sequencing which has gained wide popularity amongst microbiologists for the molecular characterization and identification of newly discovered isolates provides accurate identification of isolates down to the level of sub-species (strain). It's most important advantage over the traditional biochemical characterization methods are that it can provide an accurate identification of strains with atypical phenotypic characters as well. The following work is an application of 16S rRNA gene sequencing approach to identify a novel, alkaline protease producing bacteria, from poultry farm waste. The sample was collected from a local poultry farm in the Guntur district, Andhra Pradesh, India. Subsequently the sample was serially diluted and the aliquots were incubated for a suitable time period following which the suspected colony was subjected to 16S rDNA sequencing. The results showed the isolate to be a novel, high alkaline protease producing bacteria, which was named Bacillus firmus isolate EMBS023, after characterization the sequence of isolate was deposited in GenBank with accession number JN990980. PMID:25118655

  6. Diversity within the genus Elymus (Poaceae: Triticeae) as investigated by the analysis of the nr5S rDNA variation in species with St and H haplomes.

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2015-02-01

    The genus Elymus ("Ryegrass") is a repository for a range of species with a variety of haplome contents; hence the pejorative name "dustbin" genus. We have analyzed 1,059 sequences from 128 accessions representing 24 species to investigate the relationships among the StH haplomes-containing species described by Yen and Yang (Genus Elymus Beijing 5:58-362, 2013). Sequences were assigned to "unit classes" of orthologous sequences and subjected to a suite of analyses including BLAST (Basic Local Alignment Search Tool) searches, phylogenetic analysis and population genetic analysis to estimate species diversity. Our results support the genome analyses in Yen and Yang (Genus Elymus Beijing 5:58-362, 2013), i.e., genomic constitution StStHH including variants restricted to Elymus. Population genetic analysis of the 5S nrDNA sequence data revealed that the within-species variance component is roughly ±89 %; thus, we were unable to identify molecular markers capable to separate the 24 species analyzed. Separate phylogenetic analyses of the two unit classes and of all the data exhibit a trend only of the species to cluster on the phylograms. Finally, the analysis provides evidence for the multiple origins of American and Eurasian species. PMID:25248636

  7. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  8. PCR-Independent Detection of Bacterial Species-Specific 16S rRNA at 10 fM by a Pore-Blockage Sensor.

    PubMed

    Esfandiari, Leyla; Wang, Siqing; Wang, Siqi; Banda, Anisha; Lorenzini, Michael; Kocharyan, Gayane; Monbouquette, Harold G; Schmidt, Jacob J

    2016-01-01

    A PCR-free, optics-free device is used for the detection of Escherichia coli (E. coli) 16S rRNA at 10 fM, which corresponds to ~100-1000 colony forming units/mL (CFU/mL) depending on cellular rRNA levels. The development of a rapid, sensitive, and cost-effective nucleic acid detection platform is sought for the detection of pathogenic microbes in food, water and body fluids. Since 16S rRNA sequences are species specific and are present at high copy number in viable cells, these nucleic acids offer an attractive target for microbial pathogen detection schemes. Here, target 16S rRNA of E. coli at 10 fM concentration was detected against a total RNA background using a conceptually simple approach based on electromechanical signal transduction, whereby a step change reduction in ionic current through a pore indicates blockage by an electrophoretically mobilized bead-peptide nucleic acid probe conjugate hybridized to target nucleic acid. We investigated the concentration detection limit for bacterial species-specific 16S rRNA at 1 pM to 1 fM and found a limit of detection of 10 fM for our device, which is consistent with our previous finding with single-stranded DNA of similar length. In addition, no false positive responses were obtained with control RNA and no false negatives with target 16S rRNA present down to the limit of detection (LOD) of 10 fM. Thus, this detection scheme shows promise for integration into portable, low-cost systems for rapid detection of pathogenic microbes in food, water and body fluids. PMID:27455337

  9. Contrasting evolutionary patterns of 28S and ITS rRNA genes reveal high intragenomic variation in Cephalenchus (Nematoda): Implications for species delimitation.

    PubMed

    Pereira, Tiago José; Baldwin, James Gordon

    2016-05-01

    Concerted evolution is often assumed to be the evolutionary force driving multi-family genes, including those from ribosomal DNA (rDNA) repeat, to complete homogenization within a species, although cases of non-concerted evolution have been also documented. In this study, sequence variation of 28S and ITS ribosomal RNA (rRNA) genes in the genus Cephalenchus is assessed at three different levels, intragenomic, intraspecific, and interspecific. The findings suggest that not all Cephalenchus species undergo concerted evolution. High levels of intraspecific polymorphism, mostly due to intragenomic variation, are found in Cephalenchus sp1 (BRA-01). Secondary structure analyses of both rRNA genes and across different species show a similar substitution pattern, including mostly compensatory (CBC) and semi-compensatory (SBC) base changes, thus suggesting the functionality of these rRNA copies despite the variation found in some species. This view is also supported by low sequence variation in the 5.8S gene in relation to the flanking ITS-1 and ITS-2 as well as by the existence of conserved motifs in the former gene. It is suggested that potential cross-fertilization in some Cephalenchus species, based on inspection of female reproductive system, might contribute to both intragenomic and intraspecific polymorphism of their rRNA genes. These results reinforce the potential implications of intragenomic and intraspecific genetic diversity on species delimitation, especially in biodiversity studies based solely on metagenetic approaches. Knowledge of sequence variation will be crucial for accurate species diversity estimation using molecular methods. PMID:26926945

  10. Application of 16S rRNA, cytochrome b and control region sequences for understanding the phylogenetic relationships in Oryx species.

    PubMed

    Khan, H A; Arif, I A; Al Homaidan, A A; Al Farhan, A H

    2008-01-01

    The present study reports the application of mitochondrial markers for the molecular phylogeny of Oryx species, including the Arabian oryx (AO), scimitar-horned oryx (SHO) and plains oryx (PO), using the Addax as an outgroup. Sequences of three molecular markers, 16S rRNA, cytochrome b and a control region, for the above four taxa were aligned and the topologies of respective phylogenetic trees were compared. All these markers clearly differentiated the genus Addax from Oryx. However, for species-level grouping, while 16S rRNA and cytochrome b produced similar phylogeny (SHO grouped with PO), the control region grouped SHO with AO. Further studies are warranted to generate more sequencing data, apply multiple bioinformatics tools and to include relevant nuclear markers for phylogenetic analysis of Oryx species. PMID:19224456

  11. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).

    PubMed

    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C

    2015-01-01

    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition. PMID:26634462

  12. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene.

    PubMed

    Coêlho, Mariza M; Ferreira-Nozawa, Monica S; Nozawa, Sérgio R; Santos, André L W

    2011-10-01

    Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla), were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species. PMID:22215973

  13. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene

    PubMed Central

    Coêlho, Mariza M.; Ferreira-Nozawa, Monica S.; Nozawa, Sérgio R.; Santos, André L.W.

    2011-01-01

    Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla), were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species. PMID:22215973

  14. Comparison of Traditional Phenotypic Identification Methods with Partial 5′ 16S rRNA Gene Sequencing for Species-Level Identification of Nonfermenting Gram-Negative Bacilli▿

    PubMed Central

    Cloud, Joann L.; Harmsen, Dag; Iwen, Peter C.; Dunn, James J.; Hall, Gerri; LaSala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L.; Mellmann, Alexander

    2010-01-01

    Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5′ 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB. PMID:20164273

  15. Phylogeny of All Recognized Species of Ammonia Oxidizers Based on Comparative 16S rRNA and amoA Sequence Analysis: Implications for Molecular Diversity Surveys

    PubMed Central

    Purkhold, Ulrike; Pommerening-Röser, Andreas; Juretschko, Stefan; Schmid, Markus C.; Koops, Hans-Peter; Wagner, Michael

    2000-01-01

    The current perception of evolutionary relationships and the natural diversity of ammonia-oxidizing bacteria (AOB) is mainly based on comparative sequence analyses of their genes encoding the 16S rRNA and the active site polypeptide of the ammonia monooxygenase (AmoA). However, only partial 16S rRNA sequences are available for many AOB species and most AOB have not yet been analyzed on the amoA level. In this study, the 16S rDNA sequence data of 10 Nitrosomonas species and Nitrosococcus mobilis were completed. Furthermore, previously unavailable 16S rRNA sequences were determined for three Nitrosomonas sp. isolates and for the gamma-subclass proteobacterium Nitrosococcus halophilus. These data were used to revaluate the specificities of published oligonucleotide primers and probes for AOB. In addition, partial amoA sequences of 17 AOB, including the above-mentioned 15 AOB, were obtained. Comparative phylogenetic analyses suggested similar but not identical evolutionary relationships of AOB by using 16S rRNA and AmoA as marker molecules, respectively. The presented 16S rRNA and amoA and AmoA sequence data from all recognized AOB species significantly extend the currently used molecular classification schemes for AOB and now provide a more robust phylogenetic framework for molecular diversity inventories of AOB. For 16S rRNA-independent evaluation of AOB species-level diversity in environmental samples, amoA and AmoA sequence similarity threshold values were determined which can be used to tentatively identify novel species based on cloned amoA sequences. Subsequently, 122 amoA sequences were obtained from 11 nitrifying wastewater treatment plants. Phylogenetic analyses of the molecular isolates showed that in all but two plants only nitrosomonads could be detected. Although several of the obtained amoA sequences were only relatively distantly related to known AOB, none of these sequences unequivocally suggested the existence of previously unrecognized species in the

  16. 16S rRNA Gene Sequencing, Multilocus Sequence Analysis, and Mass Spectrometry Identification of the Proposed New Species “Clostridium neonatale”

    PubMed Central

    Bouvet, Philippe; Ferraris, Laurent; Dauphin, Brunhilde; Popoff, Michel-Robert; Butel, Marie Jose

    2014-01-01

    In 2002, an outbreak of necrotizing enterocolitis in a Canadian neonatal intensive care unit was associated with a proposed novel species of Clostridium, “Clostridium neonatale.” To date, there are no data about the isolation, identification, or clinical significance of this species. Additionally, C. neonatale has not been formally classified as a new species, rendering its identification challenging. Indeed, the C. neonatale 16S rRNA gene sequence shows high similarity to another Clostridium species involved in neonatal necrotizing enterocolitis, Clostridium butyricum. By performing a polyphasic study combining phylogenetic analysis (16S rRNA gene sequencing and multilocus sequence analysis) and phenotypic characterization with mass spectrometry, we demonstrated that C. neonatale is a new species within the Clostridium genus sensu stricto, for which we propose the name Clostridium neonatale sp. nov. Now that the status of C. neonatale has been clarified, matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) can be used for better differential identification of C. neonatale and C. butyricum clinical isolates. This is necessary to precisely define the role and clinical significance of C. neonatale, a species that may have been misidentified and underrepresented during previous neonatal necrotizing enterocolitis studies. PMID:25232167

  17. Targeting single-nucleotide polymorphisms in the 16S rRNA gene to detect and differentiate Legionella pneumophila and non-Legionella pneumophila species.

    PubMed

    Zhan, Xiao-Yong; Hu, Chao-Hui; Zhu, Qing-Yi

    2016-08-01

    A PCR-based method targeting single-nucleotide polymorphisms (SNPs) in the 16S rRNA gene was developed for differential identification of Legionella pneumophila and non-Legionella pneumophila. Based on the bioinformatics analysis for 176 Legionella 16S rRNA gene fragments of 56 different Legionella species, a set of SNPs, A(628)C(629) was found to be highly specific to L. pneumophila strains. A multiplex assay was designed that was able to distinguish sites with limited sequence heterogeneity between L. pneumophila and non-L. pneumophila in the targeted 16S rRNA gene. The assay amplified a 261-bp amplicon for Legionella spp. and a set of 203- and 97-bp amplicons only specific to L. pneumophila species. Among 49 ATCC strains and 284 Legionella isolates from environmental water and clinical samples, 100 % of L. pneumophila and non-L. pneumophila strains were correctly identified and differentiated by this assay. The assay presents a more rapid, sensitive and alternative method to the currently available PCR-sequencing detection and differentiation method. PMID:27112927

  18. Molecular Methods for Identification of Acinetobacter Species by Partial Sequencing of the rpoB and 16S rRNA Genes

    PubMed Central

    Khosravi, Azar Dokht; Shahraki, Abdolrazagh Hashemi; Heidarieh, Parvin; Sheikhi, Nasrin

    2015-01-01

    Background Acinetobacter spp. is a diverse group of Gram-negative bacteria which are ubiquitous in soil and water, and an important cause of nosocomial infections. The purpose of this study was to identify a collection of Acinetobacter spp. clinical isolates accurately and to investigate their antibiotic susceptibility patterns. Materials and Methods A total of 197 non-duplicate clinical isolates of Acinetobacter spp. isolates identified using conventional biochemical tests. The molecular technique of PCR-RFLP and sequence analysis of rpoB and 16S rRNA genes was applied for species identification. Antimicrobial susceptibility test was performed with a disk diffusion assay. Results Based on 16S rRNA and rpoB genes analysis separately, most of clinical isolates can be identified with high bootstrap values. However, the identity of the isolate 555T was uncertain due to high similarity of A. grimontii and A. junii. Identification by concatenation of 16S rRNA and rpoB confirmed the identity of clinical isolates of Acenitobacer to species level confidently. Accordingly, the isolate 555T assigned as A. grimontii due to 100% similarity to A. grimontii. Moreover, this isolate showed 98.64% to A. junii. Besides, the identity of the isolates 218T and 364T was confirmed as Genomic species 3 and A. calcoaceticus respectively. So, the majority of Acinetobacter spp. isolates, were identified as: A. baumannii (131 isolates, 66%), A. calcoaceticus (9 isolates, 4.5%), and A. genomosp 16 (8 isolates, 4%). The rest of identified species showed the lower frequencies. In susceptibility test, 105 isolates (53%), presented high antibiotic resistance of 90% to ceftriaxone, piperacillin, piperacillin tazobactam, amikacin, and 81% to ciprofloxacin. Conclusion Sequence analysis of the 16S rRNA and rpoB spacer simultaneously was able to do identification of Acinetobacter spp. to species level. A.baumannii was identified as the most prevalent species with high antibiotic resistance. Other

  19. Molecular Phylogenetics and Systematics of the Bivalve Family Ostreidae Based on rRNA Sequence-Structure Models and Multilocus Species Tree

    PubMed Central

    Salvi, Daniele; Macali, Armando; Mariottini, Paolo

    2014-01-01

    The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassotreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics. PMID:25250663

  20. Identification of Mushroom Species by Automated rRNA Intergenic Spacer Analysis (ARISA) and Its Application to a Suspected Case of Food Poisoning with Tricholoma ustale.

    PubMed

    Sugawara, Ryota; Yamada, Sayumi; Tu, Zhihao; Sugawara, Akiko; Hoshiba, Toshihiro; Eisaka, Sadao; Yamaguchi, Akihiro

    2016-01-01

    Automated rRNA intergenic spacer analysis (ARISA), a method of microbiome analysis, was evaluated for species identification of mushrooms based on the specific fragment sizes. We used 51 wild mushroom-fruiting bodies collected in the centre of Hokkaido and two cultivated mushrooms. Samples were hot-air-dried and DNA were extracted by a beads beating procedure. Sequencing analysis of portions of the rRNA gene (rDNA) provided 33 identifications of mushrooms by genus or species. The results of ARISA identification based on the combination of the fragment sizes corresponding to two inter spacer regions (ITS2 and ITS1) of rDNA within±0.1% accuracy showed that 27 out of the 33 species had specific fragment sizes differentiated from other species. The remaining 6 species formed 3 pairs that showed overlapping fragment sizes. In addition, within-species polymorphisms were observed as 1 bp differences among 32 samples of 13 species. ARISA was applied to investigate a case of suspected food poisoning in which the mushroom was thought to be a toxic Kakishimeji. The morphological identification of the mushroom was ambiguous since the remaining sample lacked a part of the fruiting body. Further, yeast colonies had grown on the surface of the fruiting body during storage. The ARISA fragment size of the mushroom showed 7 bp difference from that of the candidate toxic mushroom. Although ARISA could be a useful tools for estimation of mushroom species, especially in case where the fruiting bodies have deteriorated or been processed, further studies are necessary for reliable identification. For example, it may be necessary to adopt more informative genes which could provide clearer species-specific polymorphisms than the ITS regions. PMID:27211917

  1. Secondary structure and domain architecture of the 23S and 5S rRNAs

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hershkovits, Eli; Xue, Yuzhen; Waterbury, Chris C.; Hsiao, Chiaolong; Stepanov, Victor G.; Gaucher, Eric A.; Grover, Martha A.; Harvey, Stephen C.; Hud, Nicholas V.; Wartell, Roger M.; Fox, George E.; Williams, Loren Dean

    2013-01-01

    We present a de novo re-determination of the secondary (2°) structure and domain architecture of the 23S and 5S rRNAs, using 3D structures, determined by X-ray diffraction, as input. In the traditional 2° structure, the center of the 23S rRNA is an extended single strand, which in 3D is seen to be compact and double helical. Accurately assigning nucleotides to helices compels a revision of the 23S rRNA 2° structure. Unlike the traditional 2° structure, the revised 2° structure of the 23S rRNA shows architectural similarity with the 16S rRNA. The revised 2° structure also reveals a clear relationship with the 3D structure and is generalizable to rRNAs of other species from all three domains of life. The 2° structure revision required us to reconsider the domain architecture. We partitioned the 23S rRNA into domains through analysis of molecular interactions, calculations of 2D folding propensities and compactness. The best domain model for the 23S rRNA contains seven domains, not six as previously ascribed. Domain 0 forms the core of the 23S rRNA, to which the other six domains are rooted. Editable 2° structures mapped with various data are provided (http://apollo.chemistry.gatech.edu/RibosomeGallery). PMID:23771137

  2. Targeting Species-Specific Low-Affinity 16S rRNA Binding Sites by Using Peptide Nucleic Acids for Detection of Legionellae in Biofilms

    PubMed Central

    Wilks, Sandra A.; Keevil, C. William

    2006-01-01

    Using fluorescence in situ hybridization to detect bacterial groups has several inherent limitations. DNA probes are generally used, targeting sites on the 16S rRNA. However, much of the 16S rRNA is highly conserved, with variable regions often located in inaccessible areas where secondary structures can restrict probe access. Here, we describe the use of peptide nucleic acid (PNA) probes as a superior alternative to DNA probes, especially when used for environmental samples. A complex bacterial genus (Legionella) was studied, and two probes were designed, one to detect all species and one targeted to Legionella pneumophila. These probes were developed from existing sequences and are targeted to low-binding-affinity sites on the 16S rRNA. In total, 47 strains of Legionella were tested. In all cases, the Legionella spp. PNA probe labeled cells strongly but did not bind to any non-Legionella species. Likewise, the specific L. pneumophila PNA probe labeled only strains of L. pneumophila. By contrast, the equivalent DNA probes performed poorly. To assess the applicability of this method for use on environmental samples, drinking-water biofilms were spiked with a known concentration of L. pneumophila bacteria. Quantifications of the L. pneumophila bacteria were compared using PNA hybridization and standard culture methods. The culture method quantified only 10% of the number of L. pneumophila bacteria found by PNA hybridization. This illustrates the value of this method for use on complex environmental samples, especially where cells may be in a viable but noncultivable state. PMID:16885298

  3. Development and application of small-subunit rRNA probes for assessment of selected Thiobacillus species and members of the genus Acidiphilium.

    PubMed

    Peccia, J; Marchand, E A; Silverstein, J; Hernandez, M

    2000-07-01

    Culture-dependent studies have implicated sulfur-oxidizing bacteria as the causative agents of acid mine drainage and concrete corrosion in sewers. Thiobacillus species are considered the major representatives of the acid-producing bacteria in these environments. Small-subunit rRNA genes from all of the Thiobacillus and Acidiphilium species catalogued by the Ribosomal Database Project were identified and used to design oligonucleotide DNA probes. Two oligonucleotide probes were synthesized to complement variable regions of 16S rRNA in the following acidophilic bacteria: Thiobacillus ferrooxidans and T. thiooxidans (probe Thio820) and members of the genus Acidiphilium (probe Acdp821). Using (32)P radiolabels, probe specificity was characterized by hybridization dissociation temperature (T(d)) with membrane-immobilized RNA extracted from a suite of 21 strains representing three groups of bacteria. Fluorochrome-conjugated probes were evaluated for use with fluorescent in situ hybridization (FISH) at the experimentally determined T(d)s. FISH was used to identify and enumerate bacteria in laboratory reactors and environmental samples. Probing of laboratory reactors inoculated with a mixed culture of acidophilic bacteria validated the ability of the oligonucleotide probes to track specific cell numbers with time. Additionally, probing of sediments from an active acid mine drainage site in Colorado demonstrated the ability to identify numbers of active bacteria in natural environments that contain high concentrations of metals, associated precipitates, and other mineral debris. PMID:10877807

  4. Molecular Identification of Mycobacterium Species of Public Health Importance in Cattle in Zimbabwe by 16S rRNA Gene Sequencing

    PubMed Central

    Padya, Leah; Chin'ombe, Nyasha; Magwenzi, Marcelyn; Mbanga, Joshua; Ruhanya, Vurayai; Nziramasanga, Pasipanodya

    2015-01-01

    Mycobacterium species are naturally found in the environment as well as in domestic animals such as cattle. So far, more than 150 species of Mycobacterium, some of which are pathogenic, have been identified. Laboratory isolation, detection and identification of Mycobacterium species are therefore critical if human and animal infections are to be controlled. The objective of this study was to identify Mycobacterium species isolated in cattle in Zimbabwe using 16S ribosomal RNA gene amplification and sequencing. A total of 134 cow dung samples were collected throughout Zimbabwe and mycobacteria were isolated by culture. Only 49 culture isolates that were found to be acid-fast bacilli positive by Ziehl-Neelsen staining. The 16S rRNA gene was successfully amplified by PCR in 41 (84%) of the samples. There was no amplification in 8 (16%) of the samples. Out of the 41 samples that showed amplification, 26 (63%) had strong PCR bands and were selected for DNA sequencing. Analysis of the DNA sequences showed that 7 (27%) belonged to Mycobacterium neoaurum, 6 (23%) belonged to Mycobacterium fortuitum, 3 (12%) to Mycobacterium goodii, 2 (1%) to Mycobacterium arupense, 2 (1%) to Mycobacterium peregrinum or M. septicum and 1 isolate (0.04%) to Mycobacterium elephantis. There were 5 (19%) isolates that were non-mycobacteria and identified as Gordonia terrae, a close relative of Mycobacterium. The study therefore provided a molecular basis for detection and identification of Mycobacterium species in animals and humans. PMID:26668660

  5. IDENTIFICATION OF CRYPTOSPORIDIUM SPECIES AND SOURCES IN RAW WASTEWATER USING A SMALL SUBUNIT RRNA-BASED PCR-RFLP TOOL

    EPA Science Inventory

    The species composition and source of Cryptosporidium oocysts in wastewater have never been determined, even though it is widely assumed that these oocysts are from human sewage. Recent molecular characterizations of Cryptosporidium parasites make it possible to differentiate hum...

  6. Species-level core oral bacteriome identified by 16S rRNA pyrosequencing in a healthy young Arab population

    PubMed Central

    Al-hebshi, Nezar Noor; Abdulhaq, Ahmed; Albarrag, Ahmed; Basode, Vinod Kumar; Chen, Tsute

    2016-01-01

    Background Reports on the composition of oral bacteriome in Arabs are lacking. In addition, the majority of previous studies on other ethnic groups have been limited by low-resolution taxonomic assignment of next-generation sequencing reads. Furthermore, there has been a conflict about the existence of a ‘core’ bacteriome. Objective The objective of this study was to characterize the healthy core oral bacteriome in a young Arab population at the species level. Methods Oral rinse DNA samples obtained from 12 stringently selected healthy young subjects of Arab origin were pyrosequenced (454's FLX chemistry) for the bacterial 16S V1–V3 hypervariable region at an average depth of 11,500 reads. High-quality, non-chimeric reads ≥380 bp were classified to the species level using the recently described, prioritized, multistage assignment algorithm. A core bacteriome was defined as taxa present in at least 11 samples. The Chao2, abundance-based coverage estimator (ACE), and Shannon indices were computed to assess species richness and diversity. Results Overall, 557 species-level taxa (211±42 per subject) were identified, representing 122 genera and 13 phyla. The core bacteriome comprised 55 species-level taxa belonging to 30 genera and 7 phyla, namely Firmicutes, Proteobacteria, Actinobacteria, Bacteroidetes, Fusobacteria, Saccharibacteria, and SR1. The core species constituted between 67 and 87% of the individual bacteriomes. However, the abundances differed by up to three orders of magnitude among the study subjects. On average, Streptococcus mitis, Rothia mucilaginosa, Haemophilus parainfluenzae, Neisseria flavescence/subflava group, Prevotella melaninogenica, and Veillonella parvula group were the most abundant. Streptococcus sp. C300, a taxon never reported in the oral cavity, was identified as a core species. Species richness was estimated at 586 (Chao2) and 614 (ACE) species, whereas diversity (Shannon index) averaged at 3.99. Conclusions A species

  7. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  8. 5SRNAdb: an information resource for 5S ribosomal RNAs

    PubMed Central

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A.; Karlowski, Wojciech M.

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA–protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  9. PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid.

    PubMed Central

    Greisen, K; Loeffelholz, M; Purohit, A; Leong, D

    1994-01-01

    A set of broad-range PCR primers for the 16S rRNA gene in bacteria were tested, along with three series of oligonucleotide probes to detect the PCR product. The first series of probes is broad in range and consists of a universal bacterial probe, a gram-positive probe, a Bacteroides-Flavobacterium probe, and two probes for other gram-negative species. The second series was designed to detect PCR products from seven major bacterial species or groups frequently causing meningitis: Neisseria meningitidis, Haemophilus influenzae, Streptococcus pneumoniae, S. agalactiae, Escherichia coli and other enteric bacteria, Listeria monocytogenes, and Staphylococcus aureus. The third series was designed for the detection of DNA from species or genera commonly considered potential contaminants of clinical samples, including cerebrospinal fluid (CSF): Bacillus, Corynebacterium, Propionibacterium, and coagulase-negative Staphylococcus spp. The primers amplified DNA from all 124 different species of bacteria tested. Southern hybridization testing of the broad-range probes with washes containing 3 M tetramethylammonium chloride indicated that this set of probes correctly identified all but two of the 102 bacterial species tested, the exceptions being Deinococcus radiopugnans and Gardnerella vaginalis. The gram-negative and gram-positive probes hybridized to isolates of two newly characterized bacteria, Alloiococcus otitis and Rochalimaea henselii, as predicted by Gram stain characteristics. The CSF pathogen and contaminant probe sequences were compared with available sequence information and with sequencing data for 32 different species. Testing of the CSF pathogen and contaminant probes against DNA from over 60 different strains indicated that, with the exception of the coagulase-negative Staphylococcus probes, these probes provided the correct identification of bacterial species known to be found in CSF. Images PMID:7512093

  10. 18S rRNA gene sequencing identifies a novel species of Henneguya parasitizing the gills of the channel catfish (Ictaluridae).

    PubMed

    Rosser, Thomas G; Griffin, Matt J; Quiniou, Sylvie M A; Khoo, Lester H; Pote, Linda M

    2014-12-01

    In the southeastern USA, the channel catfish Ictalurus punctatus is a host to at least eight different species of myxozoan parasites belonging to the genus Henneguya, four of which have been characterized molecularly using sequencing of the small subunit ribosomal RNA (SSU rRNA) gene. However, only two of these have confirmed life cycles that involve the oligochaete Dero digitata as the definitive host. During a health screening of farm-raised channel catfish, several fish presented with deformed primary lamellae. Lamellae harbored large, nodular, white pseudocysts 1.25 mm in diameter, and upon rupturing, these pseudocysts released Henneguya myxospores, with a typical lanceolate-shaped spore body, measuring 17.1 ± 1.0 μm (mean ± SD; range = 15.0-19.3 μm) in length and 4.8 ± 0.4 μm (3.7-5.6 μm) in width. Pyriform-shaped polar capsules were 5.8 ± 0.3 μm in length (5.1-6.4 μm) and 1.7 ± 0.1 μm (1.4-1.9 μm) in width. The two caudal processes were 40.0 ± 5.1 μm in length (29.5-50.0 μm) with a spore length of 57.2 ± 4.7 (46.8-66.8 μm). The contiguous SSU rRNA gene sequence obtained from myxospores of five excised cysts did not match any Henneguya sp. in GenBank. The greatest sequence homology (91% over 1,900 bp) was with Henneguya pellis, associated with blister-like lesions on the skin of blue catfish Ictalurus furcatus. Based on the unique combination of pseudocyst and myxospore morphology, tissue location, host, and SSU rRNA gene sequence data, we report this isolate to be a previously unreported species, Henneguya bulbosus sp. nov. PMID:25270236

  11. Isolation and characterization of a novel chlorpyrifos degrading flavobacterium species EMBS0145 by 16S rRNA gene sequencing.

    PubMed

    Amareshwari, P; Bhatia, Mayuri; Venkatesh, K; Roja Rani, A; Ravi, G V; Bhakt, Priyanka; Bandaru, Srinivas; Yadav, Mukesh; Nayarisseri, Anuraj; Nair, Achuthsankar S

    2015-03-01

    Indiscriminate application of pesticides like chlorpyrifos, diazinon, or malathion contaminate the soil in addition has being unsafe often it has raised severe health concerns. Conversely, microorganisms like Trichoderma, Aspergillus and Bacteria like Rhizobium Bacillus, Azotobacter, Flavobacterium etc have evolved that are endowed with degradation of pesticides aforementioned to non-toxic products. The current study pitches into identification of a novel species of Flavobacterium bacteria capable to degrade the Organophosphorous pesticides. The bacterium was isolated from agricultural soil collected from Guntur District, Andhra Pradesh, India. The samples were serially diluted and the aliquots were incubated for a suitable time following which the suspected colony was subjected to 16S rDNA sequencing. The sequence thus obtained was aligned pairwise against Flavobacterium species, which resulted in identification of novel specie of Flavobacterium later named as EMBS0145, the sequence of which was deposited in in GenBank with accession number JN794045. PMID:25248957

  12. Robust species taxonomy assignment algorithm for 16S rRNA NGS reads: application to oral carcinoma samples

    PubMed Central

    Al-Hebshi, Nezar Noor; Nasher, Akram Thabet; Idris, Ali Mohamed; Chen, Tsute

    2015-01-01

    Background Usefulness of next-generation sequencing (NGS) in assessing bacteria associated with oral squamous cell carcinoma (OSCC) has been undermined by inability to classify reads to the species level. Objective The purpose of this study was to develop a robust algorithm for species-level classification of NGS reads from oral samples and to pilot test it for profiling bacteria within OSCC tissues. Methods Bacterial 16S V1-V3 libraries were prepared from three OSCC DNA samples and sequenced using 454's FLX chemistry. High-quality, well-aligned, and non-chimeric reads ≥350 bp were classified using a novel, multi-stage algorithm that involves matching reads to reference sequences in revised versions of the Human Oral Microbiome Database (HOMD), HOMD extended (HOMDEXT), and Greengene Gold (GGG) at alignment coverage and percentage identity ≥98%, followed by assignment to species level based on top hit reference sequences. Priority was given to hits in HOMD, then HOMDEXT and finally GGG. Unmatched reads were subject to operational taxonomic unit analysis. Results Nearly, 92.8% of the reads were matched to updated-HOMD 13.2, 1.83% to trusted-HOMDEXT, and 1.36% to modified-GGG. Of all matched reads, 99.6% were classified to species level. A total of 228 species-level taxa were identified, representing 11 phyla; the most abundant were Proteobacteria, Bacteroidetes, Firmicutes, Fusobacteria, and Actinobacteria. Thirty-five species-level taxa were detected in all samples. On average, Prevotella oris, Neisseria flava, Neisseria flavescens/subflava, Fusobacterium nucleatum ss polymorphum, Aggregatibacter segnis, Streptococcus mitis, and Fusobacterium periodontium were the most abundant. Bacteroides fragilis, a species rarely isolated from the oral cavity, was detected in two samples. Conclusion This multi-stage algorithm maximizes the fraction of reads classified to the species level while ensuring reliable classification by giving priority to the human, oral reference

  13. Development and evaluation of 16S rRNA gene targeting Enterococcus genus- and species-specific assays

    EPA Science Inventory

    Enterococci have been widely used as indicators of fecal pollution in recreational waters. Most studies enumerate enterococci using culture-based techniques that are time consuming and do not provide information on the identity of enterococci species within a given sample. Althou...

  14. Physical Mapping of the 5S and 18S rDNA in Ten Species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): Evolutionary Tendencies in the Genus

    PubMed Central

    César Venere, Paulo; Thums Konerat, Jocicléia; Henrique Zawadzki, Cláudio; Ricardo Vicari, Marcelo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus. PMID:25405240

  15. Introducing EzTaxon-e: a prokaryotic 16S rRNA gene sequence database with phylotypes that represent uncultured species.

    PubMed

    Kim, Ok-Sun; Cho, Yong-Joon; Lee, Kihyun; Yoon, Seok-Hwan; Kim, Mincheol; Na, Hyunsoo; Park, Sang-Cheol; Jeon, Yoon Seong; Lee, Jae-Hak; Yi, Hana; Won, Sungho; Chun, Jongsik

    2012-03-01

    Despite recent advances in commercially optimized identification systems, bacterial identification remains a challenging task in many routine microbiological laboratories, especially in situations where taxonomically novel isolates are involved. The 16S rRNA gene has been used extensively for this task when coupled with a well-curated database, such as EzTaxon, containing sequences of type strains of prokaryotic species with validly published names. Although the EzTaxon database has been widely used for routine identification of prokaryotic isolates, sequences from uncultured prokaryotes have not been considered. Here, the next generation database, named EzTaxon-e, is formally introduced. This new database covers not only species within the formal nomenclatural system but also phylotypes that may represent species in nature. In addition to an identification function based on Basic Local Alignment Search Tool (blast) searches and pairwise global sequence alignments, a new objective method of assessing the degree of completeness in sequencing is proposed. All sequences that are held in the EzTaxon-e database have been subjected to phylogenetic analysis and this has resulted in a complete hierarchical classification system. It is concluded that the EzTaxon-e database provides a useful taxonomic backbone for the identification of cultured and uncultured prokaryotes and offers a valuable means of communication among microbiologists who routinely encounter taxonomically novel isolates. The database and its analytical functions can be found at http://eztaxon-e.ezbiocloud.net/. PMID:22140171

  16. Direct Analysis of Genes Encoding 16S rRNA from Complex Communities Reveals Many Novel Molecular Species within the Human Gut

    PubMed Central

    Suau, Antonia; Bonnet, Régis; Sutren, Malène; Godon, Jean-Jacques; Gibson, Glenn R.; Collins, Matthew D.; Doré, Joel

    1999-01-01

    The human intestinal tract harbors a complex microbial ecosystem which plays a key role in nutrition and health. Although this microbiota has been studied in great detail by culture techniques, microscopic counts on human feces suggest that 60 to 80% of the observable bacteria cannot be cultivated. Using comparative analysis of cloned 16S rRNA gene (rDNA) sequences, we have investigated the bacterial diversity (both cultivated and noncultivated bacteria) within an adult-male fecal sample. The 284 clones obtained from 10-cycle PCR were classified into 82 molecular species (at least 98% similarity). Three phylogenetic groups contained 95% of the clones: the Bacteroides group, the Clostridium coccoides group, and the Clostridium leptum subgroup. The remaining clones were distributed among a variety of phylogenetic clusters. Only 24% of the molecular species recovered corresponded to described organisms (those whose sequences were available in public databases), and all of these were established members of the dominant human fecal flora (e.g., Bacteroides thetaiotaomicron, Fusobacterium prausnitzii, and Eubacterium rectale). However, the majority of generated rDNA sequences (76%) did not correspond to known organisms and clearly derived from hitherto unknown species within this human gut microflora. PMID:10543789

  17. Species authentication of commercial beef jerky based on PCR-RFLP analysis of the mitochondrial 12S rRNA gene.

    PubMed

    Chen, Shi-Yi; Liu, Yi-Ping; Yao, Yong-Gang

    2010-11-01

    In this study, we determined species-specific variations by analyzing the mitochondrial 12S rRNA gene sequence variation (∼440 bp) in 17 newly obtained sequences and 90 published cattle, yak, buffalo, goat, and pig sequences, which represent 62 breeds and 17 geographic regions. Based on the defined species-specific variations, two endonucleases, Alu I and Bfa I, were selected for species authentication using raw meat/tissue samples and the PCR-RFLP method. Goat and pig were identified using the Alu I enzyme, while cattle, yak, and buffalo were identified by digestion with Bfa I. Our approach had relatively high detection sensitivity of cattle DNA in mixed cattle and yak products, with the lowest detectable threshold equaling 20% of cattle DNA in a mixed cattle/yak sample. This method was successfully used to type commercial beef jerky products, which were produced by different companies utilizing various processing technologies. Our results show that several yak jerky products might be implicated in commercial fraud by using cattle meat instead of yak meat. PMID:21115170

  18. Phylogeny of 54 representative strains of species in the family Pasteurellaceae as determined by comparison of 16S rRNA sequences.

    PubMed Central

    Dewhirst, F E; Paster, B J; Olsen, I; Fraser, G J

    1992-01-01

    Virtually complete 16S rRNA sequences were determined for 54 representative strains of species in the family Pasteurellaceae. Of these strains, 15 were Pasteurella, 16 were Actinobacillus, and 23 were Haemophilus. A phylogenetic tree was constructed based on sequence similarity, using the Neighbor-Joining method. Fifty-three of the strains fell within four large clusters. The first cluster included the type strains of Haemophilus influenzae, H. aegyptius, H. aphrophilus, H. haemolyticus, H. paraphrophilus, H. segnis, and Actinobacillus actinomycetemcomitans. This cluster also contained A. actinomycetemcomitans FDC Y4, ATCC 29522, ATCC 29523, and ATCC 29524 and H. aphrophilus NCTC 7901. The second cluster included the type strains of A. seminis and Pasteurella aerogenes and H. somnus OVCG 43826. The third cluster was composed of the type strains of Pasteurella multocida, P. anatis, P. avium, P. canis, P. dagmatis, P. gallinarum, P. langaa, P. stomatis, P. volantium, H. haemoglobinophilus, H. parasuis, H. paracuniculus, H. paragallinarum, and A. capsulatus. This cluster also contained Pasteurella species A CCUG 18782, Pasteurella species B CCUG 19974, Haemophilus taxon C CAPM 5111, H. parasuis type 5 Nagasaki, P. volantium (H. parainfluenzae) NCTC 4101, and P. trehalosi NCTC 10624. The fourth cluster included the type strains of Actinobacillus lignieresii, A. equuli, A. pleuropneumoniae, A. suis, A. ureae, H. parahaemolyticus, H. parainfluenzae, H. paraphrohaemolyticus, H. ducreyi, and P. haemolytica. This cluster also contained Actinobacillus species strain CCUG 19799 (Bisgaard taxon 11), A. suis ATCC 15557, H. ducreyi ATCC 27722 and HD 35000, Haemophilus minor group strain 202, and H. parainfluenzae ATCC 29242. The type strain of P. pneumotropica branched alone to form a fifth group. The branching of the Pasteurellaceae family tree was quite complex. The four major clusters contained multiple subclusters. The clusters contained both rapidly and slowly evolving

  19. Identification to the species level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling

    PubMed Central

    Moreira, João Luiz S; Mota, Rodrigo M; Horta, Maria F; Teixeira, Santuza MR; Neumann, Elisabeth; Nicoli, Jacques R; Nunes, Álvaro C

    2005-01-01

    Background The accurate identification of Lactobacillus and other co-isolated bacteria during microbial ecological studies of ecosystems such as the human or animal intestinal tracts and food products is a hard task by phenotypic methods requiring additional tests such as protein and/or lipids profiling. Results Bacteria isolated in different probiotic prospecting studies, using de Man, Rogosa and Sharpe medium (MRS), were typed at species level by PCR amplification of 16S-23S rRNA intergenic spacers using universal primers that anneal within 16S and 23S genes, followed by restriction digestion analyses of PCR products. The set of enzymes chosen differentiates most species of Lactobacillus genus and also co-isolated bacteria such as Enterococcus, Streptococcus, Weissella, Staphylococcus, and Escherichia species. The in silico predictions of restriction patterns generated by the Lactobacillus shorter spacers digested with 11 restriction enzymes with 6 bp specificities allowed us to distinguish almost all isolates at the species level but not at the subspecies one. Simultaneous theoretical digestions of the three spacers (long, medium and short) with the same set of enzymes provided more complex patterns and allowed us to distinguish the species without purifying and cloning of PCR products. Conclusion Lactobacillus isolates and several other strains of bacteria co-isolated on MRS medium from gastrointestinal ecosystem and fermented food products could be identified using DNA fingerprints generated by restriction endonucleases. The methodology based on amplified ribosomal DNA restriction analysis (ARDRA) is easier, faster and more accurate than the current methodologies based on fermentation profiles, used in most laboratories for the purpose of identification of these bacteria in different prospecting studies. PMID:15788104

  20. Sensitive Detection and Serovar Differentiation of Typhoidal and Nontyphoidal Salmonella enterica Species Using 16S rRNA Gene PCR Coupled with High-Resolution Melt Analysis

    PubMed Central

    Masek, Billie J.; Hardick, Justin; Won, Helen; Yang, Samuel; Hsieh, Yu-Hsiang; Rothman, Richard E.; Gaydos, Charlotte A.

    2015-01-01

    Salmonella enterica species infections are a significant public health problem causing high morbidity rates worldwide and high mortality rates in the developing world. These infections are not always rapidly diagnosed as a cause of bloodstream infections because of the limitations of blood culture, which greatly affects clinical care as a result of treatment delays. A molecular diagnostic assay that could rapidly detect and identify S. enterica species infections as a cause of sepsis is needed. Nine typhoidal and nontyphoidal S. enterica serovars were used to establish the limit of detection (LOD) of a previously published 16S rRNA gene PCR (16S PCR) in mock whole blood specimens. In addition, 16 typhoidal and nontyphoidal S. enterica serovars were used to evaluate the serovar differentiation capability of 16S PCR coupled with high-resolution melt analysis. The overall LOD of 16S PCR for the nine typhoidal and nontyphoidal S. enterica serovars analyzed was <10 colony-forming units per milliliter (CFU/mL) in mock whole blood specimens, with the lowest and highest LOD at <1 CFU/mL and 9 CFU/mL, respectively. By high-resolution melt analysis, the typhoidal and nontyphoidal S. enterica serovar groups analyzed each generated a unique grouping code, allowing for serovar-level identification. 16S PCR coupled with high-resolution melt analysis could be a useful molecular diagnostic that could enhance the current diagnostic, treatment, and surveillance methods of S. enterica bloodstream infections. PMID:24365382

  1. Improved Multiplex PCR Using Conserved and Species-Specific 16S rRNA Gene Primers for Simultaneous Detection of Actinobacillus actinomycetemcomitans, Bacteroides forsythus, and Porphyromonas gingivalis

    PubMed Central

    Tran, Simon Dangtuan; Rudney, Joel D.

    1999-01-01

    Among putative periodontal pathogens, Actinobacillus actinomycetemcomitans, Bacteroides forsythus, and Porphyromonas gingivalis are most convincingly implicated as etiological agents in periodontitis. Therefore, techniques for detection of those three species would be of value. We previously published a description of a multiplex PCR that detects A. actinomycetemcomitans and P. gingivalis. The present paper presents an improvement on that technique, which now allows more sensitive detection of all three periodontal pathogens. Sensitivity was determined by testing serial dilutions of A. actinomycetemcomitans, B. forsythus, and P. gingivalis cells. Primer specificity was tested against (i) all gene sequences from the GenBank-EMBL database, (ii) six A. actinomycetemcomitans, one B. forsythus, and four P. gingivalis strains, (iii) eight different species of oral bacteria, and (iv) supra- and subgingival plaque samples from 20 healthy subjects and subgingival plaque samples from 10 patients with periodontitis. The multiplex PCR had a detection limit of 10 A. actinomycetemcomitans, 10 P. gingivalis, and 100 B. forsythus cells. Specificity was confirmed by the fact that (i) none of our forward primers were homologous to the 16S rRNA genes of other oral species, (ii) amplicons of predicted size were detected for all A. actinomycetemcomitans, B. forsythus, and P. gingivalis strains tested, and (iii) no amplicons were detected for the eight other bacterial species. A. actinomycetemcomitans, B. forsythus, and P. gingivalis were detected in 6 of 20, 1 of 20, and 11 of 20 of supragingival plaque samples, respectively, and 4 of 20, 7 of 20, and 13 of 20 of subgingival plaque samples, respectively, from periodontally healthy subjects. Among patients with periodontitis, the organisms were detected in 7 of 10, 10 of 10, and 7 of 10 samples, respectively. The simultaneous detection of three periodontal pathogens is an advantage of this technique over conventional PCR assays. PMID

  2. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.

    PubMed

    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto

    2015-01-01

    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group. PMID:26329975

  3. Comparison of potential diatom 'barcode' genes (the 18S rRNA gene and ITS, COI, rbcL) and their effectiveness in discriminating and determining species taxonomy in the Bacillariophyta.

    PubMed

    Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan

    2015-04-01

    Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode. PMID:25604341

  4. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  5. Molecular phylogenetic studies on filarial parasites based on 5S ribosomal spacer sequences.

    PubMed

    Xie, H; Bain, O; Williams, S A

    1994-06-01

    This paper is the first large-scale molecular phylogenetic study on filarial parasites (family Onchocercidae) which includes 16 species of 6 genera: Brugia beaveri Ash et Little, 1962, B. buckleyi Dissanaike et Paramananthan, 1961; B. malayi (Brug, 1927) Buckley, 1960; B. pahangi (Buckley et Edeson, 1956) Buckley, 1960; B. patei (Buckley, Nelson et Heisch, 1958) Buckley, 1960; B. timori Partono et al, 1977; Wuchereria bancrofti (Cobbold, 1877) Seurat, 1921: W. kalimantani Palmieri. Purnomo, Dennis and Marwoto, 1980: Mansonella perstans (Manson, 1891) Eberhard et Orihel, 1984; loa loc, Stiles, 1905; Onchocerca volvulus (Leuckart, 1983) Railliet er Henry, 1910; O. ochengi Bwangamoi, 1969; O. gutturosa Neumann, 1910; Dirofilaria immitis (Leidy, 1856) Railliet e Henry, 1911; Acanthocheilonema viteae (Krepkogorskaya, 1933) Bain, Baker et Chabaud, 1982 and Litomosoides sigmodontis Chandler, 1931. 5S rRNA gene spacer region sequence data were collected by PCR, cloning and dideoxy sequencing. The 5S rRNA gene spacer region sequences were aligned and analyzed by maximum parsimony algorithms, distance methods and maximum likelihood methods to construct phylogenetic trees. Bootstrap analysis was used to test the robustness of the different phylogenetic reconstructions. The data indicated that 5S spacer region sequences are highly conserved within species yet differ significantly between species. Spliced leader sequences were observed in all of the 5S rDNA spacers with no sequence variation, although flanking region sequence and length heterogeneity was observed even within species. All of the various tree-building methods gave very similar results. This study identified four clades which are strongly supported by bootstrap analysis the Brugia clade; the Wuchereria clade; the Brugia-Wuchereria clade and the Onchocerca clade. The analyses indicated that L. sigmodontis and A. viteae may be the most primitive among the 16 species studied. The data did not show any close

  6. Mitochondrial Enzyme Rhodanese Is Essential for 5 S Ribosomal RNA Import into Human Mitochondria*

    PubMed Central

    Smirnov, Alexandre; Comte, Caroline; Mager-Heckel, Anne-Marie; Addis, Vanessa; Krasheninnikov, Igor A.; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan

    2010-01-01

    5 S rRNA is an essential component of ribosomes. In eukaryotic cells, it is distinguished by particularly complex intracellular traffic, including nuclear export and re-import. The finding that in mammalian cells 5 S rRNA can eventually escape its usual circuit toward nascent ribosomes to get imported into mitochondria has made the scheme more complex, and it has raised questions about both the mechanism of 5 S rRNA mitochondrial targeting and its function inside the organelle. Previously, we showed that import of 5 S rRNA into mitochondria requires unknown cytosolic proteins. Here, one of them was identified as mitochondrial thiosulfate sulfurtransferase, rhodanese. Rhodanese in its misfolded form was found to possess a strong and specific 5 S rRNA binding activity, exploiting sites found earlier to function as signals of 5 S rRNA mitochondrial localization. The interaction with 5 S rRNA occurs cotranslationally and results in formation of a stable complex in which rhodanese is preserved in a compact enzymatically inactive conformation. Human 5 S rRNA in a branched Mg2+-free form, upon its interaction with misfolded rhodanese, demonstrates characteristic functional traits of Hsp40 cochaperones implicated in mitochondrial precursor protein targeting, suggesting that it may use this mechanism to ensure its own mitochondrial localization. Finally, silencing of the rhodanese gene caused not only a proportional decrease of 5 S rRNA import but also a general inhibition of mitochondrial translation, indicating the functional importance of the imported 5 S rRNA inside the organelle. PMID:20663881

  7. Deconvoluting Mixtures ofEmissions Sources to Investigate PM2.5's Ability to Generate Reactive Oxygen Species and its Associations with Cardiorespiratory Effects

    NASA Astrophysics Data System (ADS)

    Weber, R. J.; Bates, J.; Abrams, J.; Verma, V.; Fang, T.; Klein, M.; Strickland, M. J.; Sarnat, S. E.; Chang, H. H.; Mulholland, J. A.; Tolbert, P. E.; Russell, A. G.

    2015-12-01

    It is hypothesized that fine particulate matter (PM2.5) inhalation can catalytically generate reactive oxygen species (ROS) in excess of the body's antioxidant capacity, leading to oxidative stress and ultimately adverse health. PM2.5 emissions from different sources vary widely in chemical composition, with varied effects on the body. Here, the ability of mixtures of different sources of PM2.5 to generate ROS and associations of this capability with acute health effects were investigated. A dithiothreitol (DTT) assay that integrates over different sources was used to quantify ROS generation potential of ambient water-soluble PM2.5 in Atlanta from June 2012 - June 2013. PM2.5 source impacts, estimated using the Chemical Mass Balance method with ensemble-averaged source impact profiles, were related to DTT activity using a linear regression model, which provided information on intrinsic DTT activity (i.e., toxicity) of each source. The model was then used to develop a time series of daily DTT activity over a ten-year period (1998-2010) for use in an epidemiologic study. Light-duty gasoline vehicles exhibited the highest intrinsic DTT activity, followed by biomass burning and heavy-duty diesel vehicles. Biomass burning contributed the largest fraction to total DTT activity, followed by gasoline and diesel vehicles (45%, 20% and 14%, respectively). These results suggest the importance of aged oxygenated organic aerosols and metals in ROS generation. Epidemiologic analyses found significant associations between estimated DTT activity and emergency department visits for congestive heart failure and asthma/wheezing attacks in the 5-county Atlanta area. Estimated DTT activity was the only pollutant measure out of PM2.5, O3, and PM2.5 constituents elemental carbon and organic carbon) that exhibited a significant link to congestive heart failure. In two-pollutant models, DTT activity was significantly associated with asthma/wheeze and congestive heart failure while PM2

  8. Complexities of bloom dynamics in the toxic dinoflagellate Alexandrium fundyense revealed through DNA measurements by imaging flow cytometry coupled with species-specific rRNA probes

    NASA Astrophysics Data System (ADS)

    Brosnahan, Michael L.; Farzan, Shahla; Keafer, Bruce A.; Sosik, Heidi M.; Olson, Robert J.; Anderson, Donald M.

    2014-05-01

    Measurements of the DNA content of different protist populations can shed light on a variety of processes, including cell division, sex, prey ingestion, and parasite invasion. Here, we modified an Imaging FlowCytobot (IFCB), a custom-built flow cytometer that records images of microplankton, to measure the DNA content of large dinoflagellates and other high-DNA content species. The IFCB was also configured to measure fluorescence from Cy3-labeled rRNA probes, aiding the identification of Alexandrium fundyense (syn. A. tamarense Group I), a photosynthetic dinoflagellate that causes paralytic shellfish poisoning (PSP). The modified IFCB was used to analyze samples from the development, peak and termination phases of an inshore A. fundyense bloom (Salt Pond, Eastham, MA, USA), and from a rare A. fundyense ‘red tide’ that occurred in the western Gulf of Maine, offshore of Portsmouth, NH (USA). Diploid or G2 phase (‘2C’) A. fundyense cells were frequently enriched at the near-surface, suggesting an important role for aggregation at the air-sea interface during sexual events. Also, our analysis showed that large proportions of A. fundyense cells in both the Salt Pond and red tide blooms were planozygotes during bloom decline, highlighting the importance of sexual fusion to bloom termination. At Salt Pond, bloom decline also coincided with a dramatic rise in infections by the parasite genus Amoebophrya. The samples that were most heavily infected contained many large cells with higher DNA-associated fluorescence than 2C vegetative cells, but these cells' nuclei were also frequently consumed by Amoebophrya trophonts. Neither large cell size nor increased DNA-associated fluorescence could be replicated by infecting an A. fundyense culture of vegetative cells. Therefore, we attribute these characteristics of the large Salt Pond cells to planozygote maturation rather than Amoebophrya infection, though an interaction between infection and planozygote maturation may

  9. Complexities of bloom dynamics in the toxic dinoflagellate Alexandrium fundyense revealed through DNA measurements by imaging flow cytometry coupled with species-specific rRNA probes

    PubMed Central

    Brosnahan, Michael L.; Farzan, Shahla; Keafer, Bruce A.; Sosik, Heidi M.; Olson, Robert J.; Anderson, Donald M.

    2013-01-01

    Measurements of the DNA content of different protist populations can shed light on a variety of processes, including cell division, sex, prey ingestion, and parasite invasion. Here, we modified an Imaging FlowCytobot (IFCB), a custom-built flow cytometer that records images of microplankton, to measure the DNA content of large dinoflagellates and other high-DNA content species. The IFCB was also configured to measure fluorescence from Cy3-labeled rRNA probes, aiding the identification of Alexandrium fundyense (syn. A. tamarense Group I), a photosynthetic dinoflagellate that causes paralytic shellfish poisoning (PSP). The modified IFCB was used to analyze samples from the development, peak and termination phases of an inshore A. fundyense bloom (Salt Pond, Eastham, MA USA), and from a rare A. fundyense ‘red tide’ that occurred in the western Gulf of Maine, offshore of Portsmouth, NH (USA). Diploid or G2 phase (‘2C’) A. fundyense cells were frequently enriched at the near-surface, suggesting an important role for aggregation at the air-sea interface during sexual events. Also, our analysis showed that large proportions of A. fundyense cells in both the Salt Pond and red tide blooms were planozygotes during bloom decline, highlighting the importance of sexual fusion to bloom termination. At Salt Pond, bloom decline also coincided with a dramatic rise in infections by the parasite genus Amoebophrya. The samples that were most heavily infected contained many large cells with higher DNA-associated fluorescence than 2C vegetative cells, but these cells’ nuclei were also frequently consumed by Amoebophrya trophonts. Neither large cell size nor increased DNA-associated fluorescence could be replicated by infecting an A. fundyense culture of vegetative cells. Therefore we attribute these characteristics of the large Salt Pond cells to planozygote maturation rather than Amoebophrya infection, though an interaction between infection and planozygote maturation may

  10. Complexities of bloom dynamics in the toxic dinoflagellate Alexandrium fundyense revealed through DNA measurements by imaging flow cytometry coupled with species-specific rRNA probes.

    PubMed

    Brosnahan, Michael L; Farzan, Shahla; Keafer, Bruce A; Sosik, Heidi M; Olson, Robert J; Anderson, Donald M

    2014-05-01

    Measurements of the DNA content of different protist populations can shed light on a variety of processes, including cell division, sex, prey ingestion, and parasite invasion. Here, we modified an Imaging FlowCytobot (IFCB), a custom-built flow cytometer that records images of microplankton, to measure the DNA content of large dinoflagellates and other high-DNA content species. The IFCB was also configured to measure fluorescence from Cy3-labeled rRNA probes, aiding the identification of Alexandrium fundyense (syn. A. tamarense Group I), a photosynthetic dinoflagellate that causes paralytic shellfish poisoning (PSP). The modified IFCB was used to analyze samples from the development, peak and termination phases of an inshore A. fundyense bloom (Salt Pond, Eastham, MA USA), and from a rare A. fundyense 'red tide' that occurred in the western Gulf of Maine, offshore of Portsmouth, NH (USA). Diploid or G2 phase ('2C') A. fundyense cells were frequently enriched at the near-surface, suggesting an important role for aggregation at the air-sea interface during sexual events. Also, our analysis showed that large proportions of A. fundyense cells in both the Salt Pond and red tide blooms were planozygotes during bloom decline, highlighting the importance of sexual fusion to bloom termination. At Salt Pond, bloom decline also coincided with a dramatic rise in infections by the parasite genus Amoebophrya. The samples that were most heavily infected contained many large cells with higher DNA-associated fluorescence than 2C vegetative cells, but these cells' nuclei were also frequently consumed by Amoebophrya trophonts. Neither large cell size nor increased DNA-associated fluorescence could be replicated by infecting an A. fundyense culture of vegetative cells. Therefore we attribute these characteristics of the large Salt Pond cells to planozygote maturation rather than Amoebophrya infection, though an interaction between infection and planozygote maturation may also have

  11. Genus- and Species-Specific PCR-Based Detection of Dairy Propionibacteria in Environmental Samples by Using Primers Targeted to the Genes Encoding 16S rRNA

    PubMed Central

    Rossi, Franca; Torriani, Sandra; Dellaglio, Franco

    1999-01-01

    PCR assays with primers targeted to the genes encoding 16S rRNA were developed for detection of dairy propionibacteria. Propionibacterium thoenii specific oligonucleotide PT3 was selected after partial resequencing. Tests allowed the detection of less than 10 cells per reaction from milk and cheese and 102 cells per reaction from forage and soil. PMID:10473444

  12. Distribution of 16S rRNA methylases among different species of Gram-negative bacilli with high-level resistance to aminoglycosides.

    PubMed

    Zhou, Y; Yu, H; Guo, Q; Xu, X; Ye, X; Wu, S; Guo, Y; Wang, M

    2010-11-01

    16S rRNA methylases confer high-level resistance to most aminoglycosides in Gram-negative bacteria. Seven 16S rRNA methylase genes, armA, rmtA, rmtB, rmtC, rmtD, rmtE and npmA, have been identified since 2003. We studied the distribution of methylase genes in more than 200 aminoglycoside-resistant Gram-negative clinical isolates collected in 2007 at our hospital in Shanghai, China. 16S rRNA methylase genes were amplified by polymerase chain reaction (PCR) among 217 consecutive clinical isolates of Gram-negative bacilli resistant to gentamicin and amikacin by a disk diffusion method. 16S rRNA methylase genes were present in 97.5% (193/198) of clinical isolates highly resistant to amikacin (≥512 μg/ml), with armA and rmtB detected in 67.2 and 30.3% of strains, respectively, while no 16S rRNA methylase genes were detected in 19 strains with amikacin minimum inhibitory concentration (MIC) ≤256 μg/ml. armA or rmtB genes were detected in 100% of 104 strains of Enterobacteriaceae, and these two genes were equally represented (49 vs. 55 strains). Genes for armA or rmtB were detected in 94.7% (89/94) of Acinetobacter baumannii and Pseudomonas aeruginosa strains, and armA was predominant (84 vs. 5 strains with rmtB). No rmtA, rmtC, rmtD or npmA genes were found. Enterobacterial repetitive intergenic consensus sequence (ERIC-PCR) indicated that armA and rmtB genes were spread by both horizontal transfer and clonal dissemination. PMID:20614151

  13. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  14. Variable rRNA gene copies in extreme halobacteria

    SciTech Connect

    Sanz, J.L.; Marin, I.; Ramirez, L.; Amils, R. ); Abad, J.P.; Smith, C.L. )

    1988-08-25

    Using PFG electrophoresis techniques, the authors have examined the organization of rRNA gene in halobacterium species. The results show that the organization of rRNA genes among closely related halobacteria is quite heterogeneous. This contrasts with the high degree of conservation of rRNA sequence. The possible mechanism of such rRNA gene amplification and its evolutionary implications are discussed.

  15. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  16. Phylogenetic Analysis Using the 28S rRNA Gene Reveals That the Genus Paracreptotrema (Digenea: Allocreadiidae) Is Not Monophyletic; Description of Two New Genera and One New Species.

    PubMed

    de León, Gerardo Pérez-Ponce; Pinacho-Pinacho, Carlos D; Mendoza-Garfias, Berenit; Choudhury, Anindo; García-Varela, Martín

    2016-02-01

    This study investigates the systematics of Paracreptotrema Choudhury, Pérez-Ponce de León, Brooks and Daverdin, 2006 using morphological data (stained whole mounts and scanning electron microscopy) and partial sequences of the 28S ribosomal rRNA gene, obtained from freshly collected material. In total, 484 specimens representing 4 species, i.e., Paracreptotrema blancoi (157), Paracreptotrema profundulusi (12), Paracreptotrema rosenthali (8), and Paracreptotrema blancoi sensu Salgado-Maldonado et al. (2011) (307) were collected. Existing museum depositions were also studied. The 28S rRNA gene sequences of these Paracreptotrema spp. were aligned, along with sequences from 22 other allocreadiids and 4 other non-allocreadiid xiphidiatan species. Bayesian inference and maximum likelihood analyses indicated a paraphyletic Paracreptotrema split into 3 clades: 1 comprising P. blancoi and P. rosenthali that was sister to a clade formed by 3 other species of allocreadiids (species of Wallinia, Creptotrematina, and Auriculostoma) typically found in characid fishes, a second clade formed solely by Paracreptotrema heterandriae as the sister taxon of the aforementioned species, and a third by P. profundulusi and specimens erroneously identified as P. blancoi. Two new taxa were erected to reflect these results: Paracreptotrematoides for Paracreptotrema heterandriae, and Pseudoparacreptotrema for Paracreptotrema profundulusi and P. macroacetabulata (the species erroneously identified as P. blancoi from profundulids across Middle America). Closer consideration of the morphology corroborates these findings. The revised systematics also indicated that Paracreptotrema spp. are found in poeciliids, whereas Pseudoparacreptotrema spp. parasitize profundulids. The study demonstrates the value of an integrative taxonomy approach to address the apparently complicated systematics of the allocreadiids. PMID:26561039

  17. Renibacterium salmoninarum isolates from different sources possess two highly conserved copies of the rRNA operon .

    PubMed

    Grayson, T H; Alexander, S M; Cooper, L F; Gilpin, M L

    2000-07-01

    The nucleotide sequences of the rRNA genes and the 5' flanking region were determined for R. salmoninarum ATCC 33209T from overlapping products generated by PCR amplification from the genomic DNA. Comparison of the sequences with rRNA genes from a variety of bacteria demonstrated the close relatedness between R. salmoninarum and the high G+C group of the actinobacteria, in particular, Arthrobacter species. A regulatory element within the 5' leader of the rRNA operon was identical to an element, CL2, described for mycobacteria. PCR, DNA sequence analysis, and DNA hybridisation were performed to examine variation between isolates from diverse sources which represented the four 16S-23S rRNA intergenic spacer sequevars previously described for R. salmoninarum. Two 23S-5S rRNA intergenic spacer sequevars of identical length were found. DNA hybridisation using probes complementary to 23S rDNA and 16S rDNA identified two rRNA operons which were identical or nearly identical amongst 40 isolates sourced from a variety of countries. PMID:11016696

  18. Microsporidian Encephalitozoon cuniculi, a unicellular eukaryote with an unusual chromosomal dispersion of ribosomal genes and a LSU rRNA reduced to the universal core.

    PubMed Central

    Peyretaillade, E; Biderre, C; Peyret, P; Duffieux, F; Méténier, G; Gouy, M; Michot, B; Vivarès, C P

    1998-01-01

    Microsporidia are eukaryotic parasites lacking mitochondria, the ribosomes of which present prokaryote-like features. In order to better understand the structural evolution of rRNA molecules in microsporidia, the 5S and rDNA genes were investigated in Encephalitozoon cuniculi . The genes are not in close proximity. Non-tandemly arranged rDNA units are on every one of the 11 chromosomes. Such a dispersion is also shown in two other Encephalitozoon species. Sequencing of the 5S rRNA coding region reveals a 120 nt long RNA which folds according to the eukaryotic consensus structural shape. In contrast, the LSU rRNA molecule is greatly reduced in length (2487 nt). This dramatic shortening is essentially due to truncation of divergent domains, most of them being removed. Most variable stems of the conserved core are also deleted, reducing the LSU rRNA to only those structural features preserved in all living cells. This suggests that the E.cuniculi LSU rRNA performs only the basic mechanisms of translation. LSU rRNA phylogenetic analysis with the BASEML program favours a relatively recent origin of the fast evolving microsporidian lineage. Therefore, the prokaryote-like ribosomal features, such as the absence of ITS2, may be derived rather than primitive characters. PMID:9671812

  19. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA. PMID:21574431

  20. Genetic classification and distinguishing of Staphylococcus species based on different partial gap, 16S rRNA, hsp60, rpoB, sodA, and tuf gene sequences.

    PubMed

    Ghebremedhin, B; Layer, F; König, W; König, B

    2008-03-01

    The analysis of 16S rRNA gene sequences has been the technique generally used to study the evolution and taxonomy of staphylococci. However, the results of this method do not correspond to the results of polyphasic taxonomy, and the related species cannot always be distinguished from each other. Thus, new phylogenetic markers for Staphylococcus spp. are needed. We partially sequenced the gap gene (approximately 931 bp), which encodes the glyceraldehyde-3-phosphate dehydrogenase, for 27 Staphylococcus species. The partial sequences had 24.3 to 96% interspecies homology and were useful in the identification of staphylococcal species (F. Layer, B. Ghebremedhin, W. König, and B. König, J. Microbiol. Methods 70:542-549, 2007). The DNA sequence similarities of the partial staphylococcal gap sequences were found to be lower than those of 16S rRNA (approximately 97%), rpoB (approximately 86%), hsp60 (approximately 82%), and sodA (approximately 78%). Phylogenetically derived trees revealed four statistically supported groups: S. hyicus/S. intermedius, S. sciuri, S. haemolyticus/S. simulans, and S. aureus/epidermidis. The branching of S. auricularis, S. cohnii subsp. cohnii, and the heterogeneous S. saprophyticus group, comprising S. saprophyticus subsp. saprophyticus and S. equorum subsp. equorum, was not reliable. Thus, the phylogenetic analysis based on the gap gene sequences revealed similarities between the dendrograms based on other gene sequences (e.g., the S. hyicus/S. intermedius and S. sciuri groups) as well as differences, e.g., the grouping of S. arlettae and S. kloosii in the gap-based tree. From our results, we propose the partial sequencing of the gap gene as an alternative molecular tool for the taxonomical analysis of Staphylococcus species and for decreasing the possibility of misidentification. PMID:18174295

  1. Genetic Classification and Distinguishing of Staphylococcus Species Based on Different Partial gap, 16S rRNA, hsp60, rpoB, sodA, and tuf Gene Sequences▿

    PubMed Central

    Ghebremedhin, B.; Layer, F.; König, W.; König, B.

    2008-01-01

    The analysis of 16S rRNA gene sequences has been the technique generally used to study the evolution and taxonomy of staphylococci. However, the results of this method do not correspond to the results of polyphasic taxonomy, and the related species cannot always be distinguished from each other. Thus, new phylogenetic markers for Staphylococcus spp. are needed. We partially sequenced the gap gene (∼931 bp), which encodes the glyceraldehyde-3-phosphate dehydrogenase, for 27 Staphylococcus species. The partial sequences had 24.3 to 96% interspecies homology and were useful in the identification of staphylococcal species (F. Layer, B. Ghebremedhin, W. König, and B. König, J. Microbiol. Methods 70:542-549, 2007). The DNA sequence similarities of the partial staphylococcal gap sequences were found to be lower than those of 16S rRNA (∼97%), rpoB (∼86%), hsp60 (∼82%), and sodA (∼78%). Phylogenetically derived trees revealed four statistically supported groups: S. hyicus/S. intermedius, S. sciuri, S. haemolyticus/S. simulans, and S. aureus/epidermidis. The branching of S. auricularis, S. cohnii subsp. cohnii, and the heterogeneous S. saprophyticus group, comprising S. saprophyticus subsp. saprophyticus and S. equorum subsp. equorum, was not reliable. Thus, the phylogenetic analysis based on the gap gene sequences revealed similarities between the dendrograms based on other gene sequences (e.g., the S. hyicus/S. intermedius and S. sciuri groups) as well as differences, e.g., the grouping of S. arlettae and S. kloosii in the gap-based tree. From our results, we propose the partial sequencing of the gap gene as an alternative molecular tool for the taxonomical analysis of Staphylococcus species and for decreasing the possibility of misidentification. PMID:18174295

  2. Usefulness of the ID32 staph system and a method based on rRNA gene restriction site polymorphism analysis for species and subspecies identification of staphylococcal clinical isolates.

    PubMed Central

    Chesneau, O; Aubert, S; Morvan, A; Guesdon, J L; el Solh, N

    1992-01-01

    The usefulness of the ID32 Staph System and a method based on rRNA gene restriction site polymorphism was evaluated by the study of 42 staphylococcal clinical isolates phenotypically difficult to identify. The ID32 Staph micromethod and the genomic method are adapted for recognition of 27 and 31 staphylococcal taxa, respectively. The genomic method is based on a Dice analysis of the hybridization patterns obtained by cutting the cellular DNA either with EcoRI or with HindIII and by probing with pBA2, containing the Bacillus subtilis gene encoding 16S rRNA, labeled either with [alpha-32P]dCTP or with acetylaminofluorene. This study showed that the nonradioactive labeling provided a better resolution of the hybridizing bands than radioactive labeling. Of the 42 isolates selected, only 22 could be assigned to a staphylococcal species by the ID32 Staph System, whereas 35 could be identified by the genomic method. This latter method also enabled the screening of three unclassified isolates having hybridization patterns more closely related to each other than to any of the 31 staphylococcal taxa investigated. These three isolates could belong to a staphylococcal taxon not yet described. Images PMID:1357001

  3. IDENTIFICATION OF SPECIES AND SOURCES OF CRYPTOSPORIDIUM OOCYSTS IN STORM WATERS BY A SMALL SUBUNIT RRNA-BASED DIAGNOSTIC AND GENOTYPING TOOL

    EPA Science Inventory

    The identification of Cryptosporidium oocysts in environmental samples is largely made by the use of immunofluorescent assay (IFA). because IFA detects oocysts from all Cryptosporidium parasites, the species distribution and source of Cryptosporidium parasites in environmental sa...

  4. IDENTIFICATION OF CRYPTOSPORIDIUM SPECIES AND THE SOURCES IN RAW WASTEWATER USING A SMALL SUBUNIT RRNA-BASED PCR-RFLP TOOL

    EPA Science Inventory

    The species composition and source of Cryptosporidium oocysts in wastewater have never been determined, even though it is widely assumed that these oocysts are from human sewage. Recent molecular characterizations of Cryptosporidium parasites make it possible to differentiate hum...

  5. Nucleotide sequence of 5S ribosomal RNA from Aspergillus nidulans and Neurospora crassa.

    PubMed Central

    Piechulla, B; Hahn, U; McLaughlin, L W; Küntzel, H

    1981-01-01

    The nucleotide sequences of 5S rRNA molecules isolated from the cytosol and the mitochondria of the ascomycetes A. nidulans and N. crassa were determined by partial chemical cleavage of 3'-terminally labelled RNA. The sequence identity of the cytosolic and mitochondrial RNA preparations confirms the absence of mitochondrion-specific 5S rRNA in these fungi. The sequences of the two organisms differ in 35 positions, and each sequence differs from yeast 5S rRNA in 44 positions. Both molecules contain the sequence GCUC in place of GAAC or GAUY found in all other 5S rRNAs, indicating that this region is not universally involved in base-pairing to the invariant GTpsiC sequence of tRNAs. Images PMID:6453331

  6. Molecular analysis of biofilms on the surface of neonatal endotracheal tubes based on 16S rRNA PCR-DGGE and species-specific PCR.

    PubMed

    Li, Hongdong; Song, Chao; Liu, Dong; Ai, Qing; Yu, Jialin

    2015-01-01

    Ventilator-associated pneumonia (VAP) results in considerable morbidity and mortality in neonatal intensive care units. VAP is associated with polymicrobial biofilms that form on endotracheal tubes (ETTs). We aimed to evaluate the diversity and the bacterial community in biofilms on ETTs extubated from mechanically ventilated newborns. ETTs (N = 29) and aerobic sputum cultures were obtained from 20 mechanically ventilated newborns. Denaturing gradient gel electrophoresis (DGGE) was used to characterize the bacterial species in the biofilms on the ETTs. Species-specific PCR was used to detect common oropharyngeal Streptococcus species and known ETT-associated pathogens. DGGE profiling of ETT biofilms showed multiple banding patterns indicating a diverse bacterial community. The dominant bacterial species were Klebsiella spp. (29/29), Streptococcus spp. (27/29), and Pseudomonas spp. (24/29). The most frequently occurring Streptococcus species was Streptococcus mitis (N = 18). Oropharyngeal bacteria were present in 25 of 29 ETT specimens. Streptococcus spp. often co-existed with K. pneumoniae and/or P. aeruginosa. In contrast, only one bacterial species was isolated from each sputum culture, K. pneumoniae or Acinetobacter baumannii. Our results demonstrated that Klebsiella spp., Streptococcus spp., and Pseudomonas spp. were the most frequent microbes on the surface of neonatal ETTs. The co-existence of oral commensals and pathogenic bacteria on the same tubes may play a crucial role for biofilm formation. PMID:26379907

  7. A combination of morphology and 28S rRNA gene sequences provide grouping and ranking criteria to merge eight into three Ambispora species (Ambisporaceae, Glomeromycota).

    PubMed

    Bills, Robert J; Morton, Joseph B

    2015-08-01

    Ambispora, the only genus in Ambisporaceae and one of three deeply rooted families in Archaeosporales, Glomeromycetes, is amended. Analysis of the morphology of specimens from types and living cultures and 28S ribosomal DNA (rDNA; LSU) sequences resulted in two major changes that redefined Ambispora to include only species with the potential for spore dimorphism (acaulosporoid and glomoid). First, species described as producing only glomoid spores (Ambispora leptoticha, Ambispora fecundispora, and Ambispora callosa), only acaulosporoid spores (Ambispora jimgerdemannii), or both spore morphotypes (Ambispora appendicula) were synonymized with a redefined dimorphic species, A. leptoticha. LSU sequences and more conserved SSU gene data indicated little divergence between genotypes formerly classified as separate species. Second, Ambispora fennica was synonymized with Ambispora gerdemannii based on morphological and LSU sequence variation equivalent to that measured in the sister clade A. leptoticha. With this analysis, Ambispora was reduced to three species: A. leptoticha, A. gerdemannii, and Ambispora granatensis. Morphological and molecular characters were given equal treatment in this study, as each data set informed and clarified grouping and ranking decisions. The two inner layers of the acaulosporoid spore wall were the only structural characters uniquely defining each of these three species; all other characters were shared. Phenotypes of glomoid spores were indistinguishable between species, and thus were informative only at the genus level. Distinct subclade structure of the LSU gene tree suggests fixation of discrete variants typical of clonal reproduction and possible retention of polymorphisms in rDNA repeats, so that not all discrete genetic variants are indicative of speciation. PMID:25638691

  8. Gordonia Species as Emerging Causes of Continuous-Ambulatory-Peritoneal-Dialysis-Related Peritonitis Identified by 16S rRNA and secA1 Gene Sequencing and Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry (MALDI-TOF MS)

    PubMed Central

    Lam, Jimmy Y. W.; Leung, Wai-Shing; Cheung, Ingrid; Chan, Jasper F. W.; Tse, Cindy W. S.; Lee, Rodney A.; Lau, Susanna K. P.

    2014-01-01

    We report here four cases of continuous ambulatory peritoneal dialysis-related peritonitis caused by three different species of Gordonia. The portal of entry was likely through Tenckhoff catheters. 16S rRNA and secA1 gene sequencing are so far the most reliable methods for the accurate identification of Gordonia species. PMID:25428146

  9. Identification of cultured isolates of clinically important yeast species using fluorescent fragment length analysis of the amplified internally transcribed rRNA spacer 2 region

    PubMed Central

    De Baere, Thierry; Claeys, Geert; Swinne, Danielle; Massonet, Caroline; Verschraegen, Gerda; Muylaert, An; Vaneechoutte, Mario

    2002-01-01

    Background The number of patients with yeast infection has increased during the last years. Also the variety of species of clinical importance has increased. Correct species identification is often important for efficient therapy, but is currently mostly based on phenotypic features and is sometimes time-consuming and depends largely on the expertise of technicians. Therefore, we evaluated the feasibility of PCR-based amplification of the internally transcribed spacer region 2 (ITS2), followed by fragment size analysis on the ABI Prism 310 for the identification of clinically important yeasts. Results A rapid DNA-extraction method, based on simple boiling-freezing was introduced. Of the 26 species tested, 22 could be identified unambiguously by scoring the length of the ITS2-region. No distinction could be made between the species Trichosporon asteroides and T. inkin or between T. mucoides and T. ovoides. The two varieties of Cryptococcus neoformans (var. neoformans and var. gattii) could be differentiated from each other due to a one bp length difference of the ITS2 fragment. The three Cryptococcus laurentii isolates were split into two groups according to their ITS2-fragment lengths, in correspondence with the phylogenetic groups described previously. Since the obtained fragment lengths compare well to those described previously and could be exchanged between two laboratories, an internationally usable library of ITS2 fragment lengths can be constructed. Conclusions The existing ITS2 size based library enables identification of most of the clinically important yeast species within 6 hours starting from a single colony and can be easily updated when new species are described. Data can be exchanged between laboratories. PMID:12139769

  10. Development of quantitative PCR assays targeting 16S rRNA gene of Enterococcus spp. and their application to the identification of Enterococcus species in environmental samples

    EPA Science Inventory

    The detection of environmental enterococci has primarily been determined using culture-based techniques that might exclude some enterococci species as well as those that are nonculturable. To address this, the relative abundance of enterococci was examined by challenging fecal an...

  11. 5S RRNA GENE DELETIONS CAUSE AN UNEXPECTEDLY HIGH FITNESS LOSS IN ESCHERICHIA COLI. (R825354)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  12. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    PubMed Central

    2010-01-01

    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  13. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana.

    PubMed

    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D

    1992-03-15

    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  14. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  15. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  16. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    PubMed Central

    2010-01-01

    Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s) occurring in 39.6% of the analyzed individuals (both male and female) were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH) was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs) enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement. PMID:20051104

  17. Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

    PubMed Central

    Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

    2015-01-01

    RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

  18. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  19. Identification of Sex and Female's Reproductive Stage in Commercial Fish Species through the Quantification of Ribosomal Transcripts in Gonads.

    PubMed

    Rojo-Bartolomé, Iratxe; Diaz de Cerio, Oihane; Diez, Guzman; Cancio, Ibon

    2016-01-01

    The estimation of maturity and sex of fish stocks in European waters is a requirement of the EU Data Collection Framework as part of the policy to improve fisheries management. On the other hand, research on fish biology is increasingly focused in molecular approaches, researchers needing correct identification of fish sex and reproductive stage without necessarily having in house the histological know-how necessary for the task. Taking advantage of the differential gene transcription occurring during fish sex differentiation and gametogenesis, the utility of 5S ribosomal RNA (5S rRNA) and General transcription factor IIIA (gtf3a) in the molecular identification of sex and gametogenic stage was tested in different economically-relevant fish species from the Bay of Biscay. Gonads of 9 fish species (, Atlantic, Atlantic-chub and horse mackerel, blue whiting, bogue, European anchovy, hake and pilchard and megrim), collected from local commercial fishing vessels were histologically sexed and 5S and 18S rRNA concentrations were quantified by capillary electrophoresis to calculate a 5S/18S rRNA index. Degenerate primers permitted cloning and sequencing of gtf3a fragments in 7 of the studied species. 5S rRNA and gtf3a transcript levels, together with 5S/18S rRNA index, distinguished clearly ovaries from testis in all of the studied species. The values were always higher in females than in males. 5S/18S rRNA index values in females were always highest when fish were captured in early phases of ovary development whilst, in later vitellogenic stages, the values decreased significantly. In megrim and European anchovy, where gonads in different oogenesis stages were obtained, the 5S/18S rRNA index identified clearly gametogenic stage. This approach, to the sexing and the quantitative non-subjective identification of the maturity stage of female fish, could have multiple applications in the study of fish stock dynamics, fish reproduction and fecundity and fish biology in

  20. Nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi and their phylogenetic positions

    PubMed Central

    Komiya, Hiroyuki; Hasegawa, Masami; Takemura, Shosuke

    1983-01-01

    The nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi were determined by chemical and enzymatic gel methods. Their phylogenetic positions among metazoans were derived from the 5S rRNA sequences by a computer analysis based on the maximum parsimony principle. It was suggested that the sponge is closely related to several invertebrates and the tunicate has affinity to vertebrates rather than invertebrates. PMID:6835845

  1. Novel Approach to Quantitative Detection of Specific rRNA in a Microbial Community, Using Catalytic DNA

    PubMed Central

    Suenaga, Hikaru; Liu, Rui; Shiramasa, Yuko; Kanagawa, Takahiro

    2005-01-01

    We developed a novel method for the quantitative detection of the 16S rRNA of a specific bacterial species in the microbial community by using deoxyribozyme (DNAzyme), which possesses the catalytic function to cleave RNA in a sequence-specific manner. A mixture of heterogeneous 16S rRNA containing the target 16S rRNA was incubated with a species-specific DNAzyme. The cleaved target 16S rRNA was separated from the intact 16S rRNA by electrophoresis, and then their amounts were compared for the quantitative detection of target 16S rRNA. This method was used to determine the abundance of the 16S rRNA of a filamentous bacterium, Sphaerotilus natans, in activated sludge, which is a microbial mixture used in wastewater treatment systems. The result indicated that this DNAzyme-based approach would be applicable to actual microbial communities. PMID:16085888

  2. Identification of Sex and Female’s Reproductive Stage in Commercial Fish Species through the Quantification of Ribosomal Transcripts in Gonads

    PubMed Central

    Rojo-Bartolomé, Iratxe; Diaz de Cerio, Oihane; Diez, Guzman; Cancio, Ibon

    2016-01-01

    The estimation of maturity and sex of fish stocks in European waters is a requirement of the EU Data Collection Framework as part of the policy to improve fisheries management. On the other hand, research on fish biology is increasingly focused in molecular approaches, researchers needing correct identification of fish sex and reproductive stage without necessarily having in house the histological know-how necessary for the task. Taking advantage of the differential gene transcription occurring during fish sex differentiation and gametogenesis, the utility of 5S ribosomal RNA (5S rRNA) and General transcription factor IIIA (gtf3a) in the molecular identification of sex and gametogenic stage was tested in different economically-relevant fish species from the Bay of Biscay. Gonads of 9 fish species (, Atlantic, Atlantic-chub and horse mackerel, blue whiting, bogue, European anchovy, hake and pilchard and megrim), collected from local commercial fishing vessels were histologically sexed and 5S and 18S rRNA concentrations were quantified by capillary electrophoresis to calculate a 5S/18S rRNA index. Degenerate primers permitted cloning and sequencing of gtf3a fragments in 7 of the studied species. 5S rRNA and gtf3a transcript levels, together with 5S/18S rRNA index, distinguished clearly ovaries from testis in all of the studied species. The values were always higher in females than in males. 5S/18S rRNA index values in females were always highest when fish were captured in early phases of ovary development whilst, in later vitellogenic stages, the values decreased significantly. In megrim and European anchovy, where gonads in different oogenesis stages were obtained, the 5S/18S rRNA index identified clearly gametogenic stage. This approach, to the sexing and the quantitative non-subjective identification of the maturity stage of female fish, could have multiple applications in the study of fish stock dynamics, fish reproduction and fecundity and fish biology in

  3. Physical mapping of 5S and 18S-5.8S-26S RNA gene families in polyploid series of Cenchrus ciliaris Linnaeus, 1771 (Poaceae)

    PubMed Central

    Kharrat-Souissi, Amina; Siljak-Yakovlev, Sonja; Pustahija, Fatima; Chaieb, Mohamed

    2012-01-01

    Abstract The Buffelgrass (Cenchrus ciliaris L., Poaceae) is one of the most important pasturage grasses due to its high productivity and good forage qualities. This species possess a high adaptability to bioclimatic constraints of arid zones and may be used for the restoration of degraded arid ecosystems. Tunisian populations present three ploidy levels (4x, 5x and 6x) with a basic chromosome number x=9. This study reported for the first time the distribution of the ribosomal genes (rRNA) for pentaploid and hexaploid cytotypes of Cenchrus ciliaris. Molecular cytogenetic study using double fluorescence in situ hybridization has shown that the two rDNA families, 5S and 18S-5.8S-26S (18S), displayed intraspecific variation in number of loci among different ploidy levels. Each ploidy level was characterized by specific number of both 5S and 18S rDNA loci (two loci in tetraploid, five in pentaploid and six in hexaploid level). For three studied cytotypes (4x, 5x and 6x) all 5S rDNA loci were localized on the subcentromeric region of chromosomes, while 18S loci were situated on the telomeric region of short chromosome arms. Data of the FISH experiments show proportional increase of ribosomal loci number during polyploidization processes. PMID:24260668

  4. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. PMID:11779838

  5. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.

    2016-01-01

    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  6. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  7. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  8. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    PubMed Central

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding. PMID:11350033

  9. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  10. Genetic Diversity among Arthrobacter Species Collected across a Heterogeneous Series of Terrestrial Deep-Subsurface Sediments as Determined on the Basis of 16S rRNA and recA Gene Sequences

    PubMed Central

    van Waasbergen, Lorraine G.; Balkwill, David L.; Crocker, Fiona H.; Bjornstad, Bruce N.; Miller, Robert V.

    2000-01-01

    This study was undertaken in an effort to understand how the population structure of bacteria within terrestrial deep-subsurface environments correlates with the physical and chemical structure of their environment. Phylogenetic analysis was performed on strains of Arthrobacter that were collected from various depths, which included a number of different sedimentary units from the Yakima Barricade borehole at the U.S. Department of Energy's Hanford site, Washington, in August 1992. At the same time that bacteria were isolated, detailed information on the physical, chemical, and microbiological characteristics of the sediments was collected. Phylogenetic trees were prepared from the 39 deep-subsurface Arthrobacter isolates (as well as 17 related type strains) based on 16S rRNA and recA gene sequences. Analyses based on each gene independently were in general agreement. These analyses showed that, for all but one of the strata (sedimentary layers characterized by their own unifying lithologic composition), the deep-subsurface isolates from the same stratum are largely monophyletic. Notably, the layers for which this is true were composed of impermeable sediments. This suggests that the populations within each of these strata have remained isolated under constant, uniform conditions, which have selected for a particular dominant genotype in each stratum. Conversely, the few strains isolated from a gravel-rich layer appeared along several lineages. This suggests that the higher-permeability gravel decreases the degree of isolation of this population (through greater groundwater flow), creating fluctuations in environmental conditions or allowing migration, such that a dominant population has not been established. No correlation was seen between the relationship of the strains and any particular chemical or physical characteristics of the sediments. Thus, this work suggests that within sedimentary deep-subsurface environments, permeability of the deposits plays a major

  11. Evaluation of genetic markers from the 16S rRNA gene V2 region for use in quantitative detection of selected Bacteroidales species and human fecal waste by real time PCR

    EPA Science Inventory

    Molecular methods for rapidly quantifying defined Bacteroidales species from the human gastrointestinal tract may have important clinical and environmental applications, ranging from diagnosis of infections to fecal source tracking in surface waters. In this study, sequences from...

  12. Chromosomal organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the evolutionary dynamics of multigene families and heterochromatin

    PubMed Central

    2011-01-01

    Background Scarabaeinae beetles show a high level of macro-chromosomal variability, although the karyotypic organization of heterochromatin and multigene families (rDNAs and histone genes) is poorly understood in this group. To better understand the chromosomal organization and evolution in this group, we analyzed the karyotypes, heterochromatin distribution and chromosomal locations of the rRNAs and histone H3 genes in beetles belonging to eight tribes from the Scarabaeinae subfamily (Coleoptera, Scarabaeidae). Results The number of 18S rRNA gene (a member of the 45S rDNA unit) sites varied from one to 16 and were located on the autosomes, sex chromosomes or both, although two clusters were most common. Comparison of the 45S rDNA cluster number and the diploid numbers revealed a low correlation value. However, a comparison between the number of 45S rDNA sites per genome and the quantity of heterochromatin revealed (i) species presenting heterochromatin restricted to the centromeric/pericentromeric region that contained few rDNA sites and (ii) species with a high quantity of heterochromatin and a higher number of rDNA sites. In contrast to the high variability for heterochromatin and 45S rDNA cluster, the presence of two clusters (one bivalent cluster) co-located on autosomal chromosomes with the 5S rRNA and histone H3 genes was highly conserved. Conclusions Our results indicate that the variability of the 45S rDNA chromosomal clusters is not associated with macro-chromosomal rearrangements but are instead related to the spread of heterochromatin. The data obtained also indicate that both heterochromatin and the 45S rDNA loci could be constrained by similar evolutionary forces regulating spreading in the distinct Scarabaeinae subfamily lineages. For the 5S rRNA and the histone H3 genes, a similar chromosomal organization could be attributed to their association/co-localization in the Scarabaeinae karyotypes. These data provide evidence that different evolutionary

  13. Direct detection of 16S rRNA in soil extracts by using oligonucleotide microarrays.

    PubMed

    Small, J; Call, D R; Brockman, F J; Straub, T M; Chandler, D P

    2001-10-01

    We report on the development and validation of a simple microarray method for the direct detection of intact 16S rRNA from unpurified soil extracts. Total RNAs from Geobacter chapellei and Desulfovibrio desulfuricans were hybridized to an oligonucleotide array consisting of universal and species-specific 16S rRNA probes. PCR-amplified products from Geobacter and Desulfovibrio were easily and specifically detected under a range of hybridization times, temperatures, and buffers. However, reproducible, specific hybridization and detection of intact rRNA could be accomplished only by using a chaperone-detector probe strategy. With this knowledge, assay conditions were developed for rRNA detection using a 2-h hybridization time at room temperature. Hybridization specificity and signal intensity were enhanced using fragmented RNA. Formamide was required in the hybridization buffer in order to achieve species-specific detection of intact rRNA. With the chaperone detection strategy, we were able to specifically hybridize and detect G. chapellei 16S rRNA directly from a total-RNA soil extract, without further purification or removal of soluble soil constituents. The detection sensitivity for G. chapellei 16S rRNA in soil extracts was at least 0.5 microg of total RNA, representing approximately 7.5 x 10(6) Geobacter cell equivalents of RNA. These results suggest that it is now possible to apply microarray technology to the direct detection of microorganisms in environmental samples, without using PCR. PMID:11571176

  14. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. PMID:23933480

  15. Analysis of the 5S RNA Pool in Arabidopsis thaliana: RNAs Are Heterogeneous and Only Two of the Genomic 5S Loci Produce Mature 5S RNA

    PubMed Central

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5′- and 3′-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. [EMBL accession nos: AF330825-AF331032; AF335777-AF335873.] PMID:11779838

  16. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  17. Higher-order structure of rRNA

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  18. Secondary structure of Tetrahymena thermophilia 5S ribosomal RNA as revealed by enzymatic digestion and microdensitometric analysis.

    PubMed Central

    Sneath, B; Vary, C; Pavlakis, G; Vournakis, J

    1986-01-01

    The secondary structure of [32P] end-labeled 5S rRNA from Tetrahymena thermophilia (strain B) has been investigated using the enzymes S1 nuclease, cobra venom ribonuclease and T2 ribonuclease. The results, analyzed by scanning microdensitometry and illustrated by three-dimensional computer graphics, support the secondary structure model of Curtiss and Vournakis for 5S rRNA. Aberrent mobility of certain RNA fragments on sequencing gels was observed as regions of band compression. These regions are postulated to be caused by stable internal base-pairing. The molecule was probed with T2 RNase in neutral (pH 7.5) and acidic (pH 4.5) buffers and only minor structural differences were revealed. One of the helices was found to be susceptible to enzymatic attack by both the single-strand and double-strand specific enzymes. These observations are evidence for the existence of dynamic structural equilibria in 5S rRNA. Images PMID:3005972

  19. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-04-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  20. Robust Computational Analysis of rRNA Hypervariable Tag Datasets

    PubMed Central

    Sipos, Maksim; Jeraldo, Patricio; Chia, Nicholas; Qu, Ani; Dhillon, A. Singh; Konkel, Michael E.; Nelson, Karen E.; White, Bryan A.; Goldenfeld, Nigel

    2010-01-01

    Next-generation DNA sequencing is increasingly being utilized to probe microbial communities, such as gastrointestinal microbiomes, where it is important to be able to quantify measures of abundance and diversity. The fragmented nature of the 16S rRNA datasets obtained, coupled with their unprecedented size, has led to the recognition that the results of such analyses are potentially contaminated by a variety of artifacts, both experimental and computational. Here we quantify how multiple alignment and clustering errors contribute to overestimates of abundance and diversity, reflected by incorrect OTU assignment, corrupted phylogenies, inaccurate species diversity estimators, and rank abundance distribution functions. We show that straightforward procedural optimizations, combining preexisting tools, are effective in handling large () 16S rRNA datasets, and we describe metrics to measure the effectiveness and quality of the estimators obtained. We introduce two metrics to ascertain the quality of clustering of pyrosequenced rRNA data, and show that complete linkage clustering greatly outperforms other widely used methods. PMID:21217830

  1. 16S rRNA region based PCR protocol for identification and subtyping of Parvimonas micra

    PubMed Central

    Ota-Tsuzuki, C.; Brunheira, A.T.P.; Mayer, M.P.A.

    2008-01-01

    The present study established a PCR protocol in order to identify Parvimonas micra and to evaluate the intra-species diversity by PCR-RFLP of 16S rRNA partial sequence. The data indicated that the protocol was able to identify this species which could be clustered in five genotypes. PMID:24031274

  2. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  3. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    PubMed

    Cangelosi, G A; Brabant, W H

    1997-07-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA probes to measure steady-state cellular pre-16S rRNA pools during growth state transitions in Escherichia coli. Pre-16S rRNA became undetectable when cells entered the stationary phase on rich medium and was replenished upon restoration of favorable growth conditions. These fluctuations were of much greater magnitude than concurrent fluctuations in the mature 16S rRNA pool. The extent of pre-16S rRNA depletion depended upon the circumstances limiting growth. It was significantly more pronounced in carbon-energy-starved cells than in nitrogen-starved cells or in cells treated with energy uncouplers. In the presence of the transcriptional inhibitor rifampin, rates of pre-16S rRNA depletion in carbon-energy-starved cells and nitrogen-starved cells were similar, suggesting that the difference between these conditions resides primarily at the level of pre-rRNA synthesis. Chloramphenicol, which inhibits the final steps in rRNA maturation, halted pre-16S rRNA depletion under all conditions. The data show that E. coli cells continue to process pre-rRNA after growth and rrn operon transcription cease, leading to drainage of the pre-rRNA pool. This supports the feasibility of using pre-rRNA-targeted probes to monitor bacterial growth in natural systems, with the caveat that patterns of pre-rRNA depletion vary with the conditions limiting growth. PMID:9226253

  4. Chromosome-specific NOR inactivation explains selective rRNA gene silencing and dosage control in Arabidopsis

    PubMed Central

    Chandrasekhara, Chinmayi; Mohannath, Gireesha; Blevins, Todd; Pontvianne, Frederic; Pikaard, Craig S.

    2016-01-01

    In eukaryotes, scores of excess ribosomal RNA (rRNA) genes are silenced by repressive chromatin modifications. Given the near sequence identity of rRNA genes within a species, it is unclear how specific rRNA genes are reproducibly chosen for silencing. Using Arabidopsis thaliana ecotype (strain) Col-0, a systematic search identified sequence polymorphisms that differ between active and developmentally silenced rRNA gene subtypes. Recombinant inbred mapping populations derived from three different ecotype crosses were then used to map the chromosomal locations of silenced and active RNA gene subtypes. Importantly, silenced and active rRNA gene subtypes are not intermingled. All silenced rRNA gene subtypes mapped to the nucleolus organizer region (NOR) on chromosome 2 (NOR2). All active rRNA gene subtypes mapped to NOR4. Using an engineered A. thaliana line in which a portion of Col-0 chromosome 4 was replaced by sequences of another ecotype, we show that a major rRNA gene subtype silenced at NOR2 is active when introgressed into the genome at NOR4. Collectively, these results reveal that selective rRNA gene silencing is not regulated gene by gene based on mechanisms dependent on subtle gene sequence variation. Instead, we propose that a subchromosomal silencing mechanism operates on a multimegabase scale to inactivate NOR2. PMID:26744421

  5. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  6. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  7. Accurate taxonomy assignments from 16S rRNA sequences produced by highly parallel pyrosequencers

    PubMed Central

    Liu, Zongzhi; DeSantis, Todd Z.; Andersen, Gary L.; Knight, Rob

    2008-01-01

    The recent introduction of massively parallel pyrosequencers allows rapid, inexpensive analysis of microbial community composition using 16S ribosomal RNA (rRNA) sequences. However, a major challenge is to design a workflow so that taxonomic information can be accurately and rapidly assigned to each read, so that the composition of each community can be linked back to likely ecological roles played by members of each species, genus, family or phylum. Here, we use three large 16S rRNA datasets to test whether taxonomic information based on the full-length sequences can be recaptured by short reads that simulate the pyrosequencer outputs. We find that different taxonomic assignment methods vary radically in their ability to recapture the taxonomic information in full-length 16S rRNA sequences: most methods are sensitive to the region of the 16S rRNA gene that is targeted for sequencing, but many combinations of methods and rRNA regions produce consistent and accurate results. To process large datasets of partial 16S rRNA sequences obtained from surveys of various microbial communities, including those from human body habitats, we recommend the use of Greengenes or RDP classifier with fragments of at least 250 bases, starting from one of the primers R357, R534, R798, F343 or F517. PMID:18723574

  8. Genomic organization and evolution of the 5S ribosomal DNA in Tilapiini fishes.

    PubMed

    Alves-Costa, F A; Wasko, A P; Oliveira, C; Foresti, F; Martins, C

    2006-05-01

    5S rDNA sequences present an intense dynamism and have proved to be valuable as genetic markers to distinguish closed related species and also in the understanding of the evolutionary dynamic of repetitive sequences in the genomes. In order to identify patterns of 5S rDNA organization and their evolution in the genome of fish species, such genomic segment was investigated in the tilapias Oreochromis niloticus and Tilapia rendalli, and in the hybrid O. urolepis hornorum x O. mossambicus. A dual 5S rDNA system was identified in the three analyzed tilapia samples. Although each 5S rDNA class was conserved among the three samples, a distinct 5S rDNA genome organization pattern could be evidenced for each sample. The presence of a dual 5S rDNA system seems to be a general trait among non-related teleost fish orders, suggesting that evolutionary events of duplication have occurred before the divergence of the main groups of teleost fishes. PMID:16850228

  9. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    PubMed

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  10. Organization of rRNA structural genes in the archaebacterium Thermoplasma acidophilum.

    PubMed Central

    Tu, J; Zillig, W

    1982-01-01

    In the archaebacterium Thermoplasma acidophilum, each of the structural genes for 5S, 16S and 23S rRNA occur once per genome. In contrast to those of eubacteria and eukaryotes, they appear unlinked. The distance between the 16S and the 23S rDNA is at least 7.5 Kb, that between 23S and 5S rDNA at least 6 Kb and that between 16S and 5S rDNA at least 1.5 Kb. No linkage between those genes has been found by the analysis of recombinant plasmids carrying Bam HI and Hind III rDNA fragments as by hybridizing those plasmids to fragments of Thermoplasma DNA generated by 6 individual restriction endonucleases, recognizing hexanucleotide sequences. Images PMID:7155894

  11. Molecular phylogeny of pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences.

    PubMed

    Li, ZiHui; Feng, XianMin; Lu, SiQi; Zhang, Fan; Wang, FengYun; Huang, Song

    2008-05-01

    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis. PMID:18785590

  12. Mouse Oocytes Transcribe Injected Xenopus 5S RNA Gene

    PubMed Central

    Brinster, Ralph L.; Chen, Howard Y.; Trumbauer, Myrna E.

    2016-01-01

    Transcripts produced after injection of the Xenopus 5S RNA gene into oocyte germinal vesicles of mice migrate electrophoretically with the 5S RNA marker, an indication that the gene is transcribed and processed with considerable accuracy, Approximately two 5S RNA molecules are transcribed per gene per hour. This system may be useful in studying DNA processing and gene regulation by the mammalian ovum and might be modified to allow permanent incorporation of specific genes into mice. PMID:7194505

  13. Sequence and phylogenetic analysis of SSU rRNA gene of five microsporidia.

    PubMed

    Dong, ShiNan; Shen, ZhongYuan; Xu, Li; Zhu, Feng

    2010-01-01

    The complete small subunit rRNA (SSU rRNA) gene sequences of five microsporidia including Nosema heliothidis, and four novel microsporidia isolated from Pieris rapae, Phyllobrotica armta, Hemerophila atrilineata, and Bombyx mori, respectively, were obtained by PCR amplification, cloning, and sequencing. Two phylogenetic trees based on SSU rRNA sequences had been constructed by using Neighbor-Joining of Phylip software and UPGMA of MEGA4.0 software. The taxonomic status of four novel microsporidia was determined by analysis of phylogenetic relationship, length, G+C content, identity, and divergence of the SSU rRNA sequences. The results showed that the microsporidia isolated from Pieris rapae, Phyllobrotica armta, and Hemerophila atrilineata have close phylogenetic relationship with the Nosema, while another microsporidium isolated from Bombyx mori is closely related to the Endoreticulatus. So, we temporarily classify three novel species of microsporidia to genus Nosema, as Nosema sp. PR, Nosema sp. PA, Nosema sp. HA. Another is temporarily classified into genus Endoreticulatus, as Endoreticulatus sp. Zhenjiang. The result indicated as well that it is feasible and valuable to elucidate phylogenetic relationships and taxonomic status of microsporidian species by analyzing information from SSU rRNA sequences of microsporidia. PMID:19768503

  14. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples. PMID:25343859

  15. Molecular relationships between closely related strains and species of nematodes

    NASA Technical Reports Server (NTRS)

    Butler, M. H.; Wall, S. M.; Luehrsen, K. R.; Fox, G. E.; Hecht, R. M.

    1981-01-01

    Electrophoretic comparisons have been made for 24 enzymes in the Bergerac and Bristol strains of Caenorhabditis elegans and the related species, Caenorhabditis briggsae. No variation was detected between the two strains of C. elegans. In contrast, the two species, C. elegans and C. briggsae exhibited electrophoretic differences in 22 of 24 enzymes. A consensus 5S rRNA sequence was determined for C. elegans and found to be identical to that from C. briggsae. By analogy with other species with relatively well established fossil records it can be inferred that the time of divergence between the two nematode species is probably in the tens of millions of years. The limited anatomical evolution during a time period in which proteins undergo extensive changes supports the hypothesis that anatomical evolution is not dependent on overall protein changes.

  16. Phylogenetic analysis of complete rRNA gene sequence of Nosema philosamiae isolated from the lepidopteran Philosamia cynthia ricini.

    PubMed

    Zhu, Feng; Shen, Zhongyuan; Xu, Xiaofang; Tao, Hengping; Dong, Shinan; Tang, Xudong; Xu, Li

    2010-01-01

    ABSTRACT. The microsporidian Nosema philosamiae is a pathogen that infects the eri-silkworm Philosamia cynthia ricini. The complete sequence of rRNA gene (4,314 bp) was obtained by polymerase chain reaction amplification with specific primers and sequencing. The sequence analysis showed that the organization of the rRNA of N. philosamiae was similar to the pattern of Nosema bombycis. Phylogenetic analysis of rRNA gene sequences revealed that N. philosamiae had a close relationship with other Nosema species, confirming that N. philosamiae is correctly assigned to the genus Nosema. PMID:20384905

  17. Comparison of Genotypic and Phylogenetic Relationships of Environmental Enterococcus Isolates by BOX-PCR Typing and 16S rRNA Gene Sequencing ▿

    PubMed Central

    Nayak, Bina S.; Badgley, Brian; Harwood, Valerie J.

    2011-01-01

    Environmental Enterococcus spp. were compared by BOX-PCR genotyping and 16S rRNA gene sequencing to clarify the predictive relationship of BOX-PCR fingerprints to species designation. BOX-PCR and 16S rRNA gene relationships agreed for 77% of strains. BOX-PCR provided superior intraspecies discrimination but incorrectly identified some strains to the species level and divided some species into multiple groups. PMID:21622792

  18. Application of 12S rRNA gene for the identification of animal-derived drugs.

    PubMed

    Luo, Jiaoyang; Yan, Dan; Zhang, Da; Han, Yumei; Dong, Xiaoping; Yang, Yong; Deng, Kejun; Xiao, Xiaohe

    2011-01-01

    PURPOSE. Animal-derived drugs are the major source of biological products and traditional medicine, but they are often difficult to identify, causing confusion in the clinical application. Among these medicinal animals, a number of animal species are endangered, leading to the destruction of biodiversity. The identification of animal-derived drugs and their alternatives would be a first step toward biodiversity conservation and safe medication. Until now, no effective method for identifying animal-derived drugs has been demonstrated; DNA-based species identification presents a brand-new technique. METHODS. We designed primers to amplify a 523-bp fragment of 12S rRNA and generated sequences for 13 individuals within six medicinal animal species. We examined the efficiency of species recognition based on this sequence, and we also tested the taxonomic affiliations against the GenBank database. RESULTS. All the tested drugs were identified successfully, and a visible gap was found between the inter-specific and intra-specific variation. We further demonstrated the importance of data exploration in DNA-based species identification practice by examining the sequence characteristics of relative genera in GenBank. This region of the 12S rRNA gene had a 100% success rate of species recognition within the six medicinal animal species. CONCLUSIONS. We propose that the 12S rRNA locus might be universal for identifying animal-derived drugs and their adulterants. The development of 12S rRNA for indentifying animal-derived drugs that share a common gene target would contribute significantly to the clinical application of animal-derived drugs and the conservation of medicinal animal species. This article is open to POST-PUBLICATION REVIEW. Registered readers (see "For Readers") may comment by clicking on ABSTRACT on the issue's contents page. PMID:21906480

  19. 5S RNA sequence from the Philosamia silkworm: evidence for variable evolutionary rates in insect 5S RNA.

    PubMed Central

    Xian-Rong, G; Nicoghosian, K; Cedergren, R J

    1982-01-01

    The primary structure of 5S RNA isolated from the posterior silkgland of Philosamia cynthia ricini was determined using three in vitro labelling techniques. The derived sequence consists of 119 nucleotides and can be folded into the secondary structure model proposed for eukaryotic 5S RNAs. This 5S RNA differs from the Bombyx mori molecule in 9 positions and from the Drosophila melanogaster sequence in 14 positions. The comparison of evolutionary rates in insect 5S RNA with inferred rates in other eukaryotic phyla leads to the conclusion that 5S RNA evolution is not constant in different eukaryotic branches, a condition which must be taken into account in phylogenetic tree constructions. Images PMID:7145713

  20. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  1. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes.

    PubMed

    Soni, Dharmendra Kumar; Dubey, Suresh Kumar

    2014-12-01

    The discrimination between Listeria monocytogenes and Listeria species has been detected. The 16S rRNA and hlyA were PCR amplified with set of oligonucleotide primers with flank 1,500 and 456 bp fragments, respectively. Based on the differences in 16S rRNA and hlyA genes, a total 80 isolates from different environmental, food and clinical samples confirmed it to be L. monocytogenes. The 16S rRNA sequence similarity suggested that the isolates were similar to the previously reported ones from different habitats by others. The phylogenetic interrelationships of the genus Listeria were investigated by sequencing of 16S rRNA and hlyA gene. The 16S rRNA sequence indicated that genus Listeria is comprised of following closely related but distinct lines of descent, one is the L. monocytogenes species group (including L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) and other, the species L. grayi, L. rocourtiae and L. fleischmannii. The phylogenetic tree based on hlyA gene sequence clearly differentiates between the L. monocytogenes, L. ivanovii and L. seeligeri. In the present study, we identified 80 isolates of L. monocytogenes originating from different clinical, food and environmental samples based on 16S rRNA and hlyA gene sequence similarity. PMID:25205124

  2. Chromosome mapping of 18S rDNA and 5S rDNA by dual-color fluorescence in situ hybridization in the half-smooth tongue sole (Cynoglossus semilaevis).

    PubMed

    Jiang, L; Jiang, J; Liu, J; Yuan, J; Chen, Y; Zhang, Q; Wang, X

    2014-01-01

    Half-smooth tongue sole (Cynoglossus semilaevis) is an important aquaculture flatfish in China. Cytogenetic analysis has revealed that its sex determination system is female heterogametic (ZZ/ZW). The W chromosome is morphologically larger and has been considered evolutionarily younger than any other chromosome in the set. However, the genetic origin and evolution process of this neo-chromosome remains unclear. In this study, 2 tandem arrays of rRNA genes were chosen to address this question. Both the major rDNA (18S rDNA) and the minor rDNA (5S rDNA) were located on the C. semilaevis chromosomes by fluorescence in situ hybridization (FISH). Six 18S rDNA signals were observed on the centromeric regions of 3 pairs of autosomes in both males and females. In females, there was an additional 18S rDNA signal mapping to the telomeric region of the W chromosome long arm. With respect to the 5S rDNA, 12 signals were mapped to the centromeric regions of six pairs of autosomes. Two-color FISH further confirmed that the two pairs of the 5S rDNA signals were correspondingly located at the same positions of the same autosomes as those of the 18S rDNA signals. These results allowed us to speculate about the evolution process of the W chromosome. Chromosome fusions and repetitive sequence accumulations might have occurred in C. semilaevis. The synteny and non-synteny of C. semilaevis 18S rDNA and 5S rDNA might imply the original and evolutionary characteristics of this species. These findings will facilitate studies on karyotype evolution of the order Pleuronectiformes. PMID:25526196

  3. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.

    PubMed

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G

    2005-09-01

    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  4. PCR amplification of the 3' external transcribed and intergenic spacers of the ribosomal DNA repeat unit in three species of Saccharomyces.

    PubMed

    Molina, F I; Jong, S C; Huffman, J L

    1993-04-15

    Two spacer regions outside the ribosomal DNA (rDNA) transcriptional unit in three species of Saccharomyces, S. cerevisiae, S. carlsbergensis and S. pastorianus, were amplified using the polymerase chain reaction. These regions were composed of the 3' external transcribed spacer (ETS) and the intergenic spacer (IGS). Primers were developed from sequence alignments and by taking the reverse complement of a previously described sequence. The region amplified spanned base position 3110 on the 26S rRNA to base position 27 on the 5S rRNA of S. cerevisiae. Nine of the twelve strains used in this study exhibited different restriction profiles, showing that the spacers are highly variable between species. The results suggest that PCR fingerprinting of the non-coding spacer regions can be used to distinguish between closely related Saccharomyces species and may have potential in DNA profiling of other yeasts. PMID:8099889

  5. Karyotypic diversification in Mytilus mussels (Bivalvia: Mytilidae) inferred from chromosomal mapping of rRNA and histone gene clusters

    PubMed Central

    2014-01-01

    Background Mussels of the genus Mytilus present morphologically similar karyotypes that are presumably conserved. The absence of chromosome painting probes in bivalves makes difficult verifying this hypothesis. In this context, we comparatively mapped ribosomal RNA and histone gene families on the chromosomes of Mytilus edulis, M. galloprovincialis, M. trossulus and M. californianus by fluorescent in situ hybridization (FISH). Results Major rRNA, core and linker histone gene clusters mapped to different chromosome pairs in the four taxa. In contrast, minor rRNA gene clusters showed a different behavior. In all Mytilus two of the 5S rDNA clusters mapped to the same chromosome pair and one of them showed overlapping signals with those corresponding to one of the histone H1 gene clusters. The overlapping signals on mitotic chromosomes became a pattern of alternate 5S rRNA and linker histone gene signals on extended chromatin fibers. Additionally, M. trossulus showed minor and major rDNA clusters on the same chromosome pair. Conclusion The results obtained suggest that at least some of the chromosomes bearing these sequences are orthologous and that chromosomal mapping of rRNA and histone gene clusters could be a good tool to help deciphering some of the many unsolved questions in the systematic classification of Mytilidae. PMID:25023072

  6. [Analysis of 5S rDNA changes in synthetic allopolyploids Triticum x Aegilops].

    PubMed

    Shcherban', A B; Sergeeva, E M; Badaeva, E D; Salina, E A

    2008-01-01

    By the example of three synthetic allopolyploids: Aegilops sharonensis x Ae. umbellulata (2n =28), Triticum urartu x Ae. tauschii (2n =28), T. dicoccoides x Ae. tauschii (2n =42) the 5S rDNA changes at the early stage of allopolyploidization were investigated. Using fluorescent in situ hybridization (FISH), the quantitative changes affecting the separate loci of one of the parental genomes were revealed in plants of S3 generation of each hybrid combination. Souther hybridization with genomic DNA of allopolyploid T. urartu x Ae. tauschii (TMU38 x TQ27) revealed lower intensity of the fragments from Ae. tauschii compared with the T. urartu fragments. It may be confirmation of the reduction of signal on 1D chromosome that was revealed in this hybrid using FISH. Both appearance of a new 5S rDNA fragments and full disappearance of fragments from parental species were not showed by Southern hybridization, as well as PCR-analysis of 5-15 plants of S2-S3 generations. The changes were not found under comparison of primary structure of nine 5S rDNA sequences of allopolyploid TMU38 x TQ27 with analogous sequences from parental species genomes. The observable similarity by FISH results of one of the studied synthetic allopolyploids with natural allopolyploid of similar genome composition indicates the early formation of unique for each allopolyploid 5S rDNA organization. PMID:18856060

  7. Intragenomic heterogeneity of the 16S rRNA gene in strain UFO1 caused by a 100-bp insertion in helix 6

    SciTech Connect

    Allison E. Ray; Stephanie A. Connon; Peter P. Sheridan; Jeremy Gilbreath; Malcolm S. Shields; Deborah T. Newby; Yoshiko Fujita; Timothy S. Magnuson

    2010-06-01

    The determination of variation in 16S rRNA gene sequences is perhaps the most common method for assessing microbial community diversity. However, the occurrence of multiple copies of 16S rRNA genes within some organisms can bias estimates of microbial diversity. During phylogenetic characterization of a metal-transforming, fermentative bacterium (strain UFO1) isolated from the Field Research Center (FRC) in Oak Ridge, TN, we detected an apparent 16S rRNA pseudogene. The putative 16S rRNA pseudogene was first detected in clone libraries constructed with 16S rRNA genes amplified from UFO1 genomic DNA. Sequencing revealed two distinct 16S rRNA genes, with one differing from the other by a 100 bp insert near the 5’ end. Ribosomal RNA was extracted from strain UFO1 and analyzed by RT-qPCR with insert and non-insert specific primers; however, only the non-insert 16S rRNA sequence was expressed. Reverse-transcribed rRNA from strain UFO1 was also used to construct a cDNA library. Of 190 clones screened by PCR, none contained the 16S rRNA gene with the 100 bp insert. Examination of GenBank 16S rRNA gene sequences revealed that the same insert sequence was present in other clones, including those from an environmental library constructed from FRC enrichments. These findings demonstrate the existence of widely disparate copies of the 16S rRNA gene in the same species and a putative 16S rRNA pseudogene, which may confound 16S rRNA-based methods for assessments of microbial diversity in environmental samples.

  8. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  9. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  10. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  11. Intraspecific and Interspecific Variation in 5s RNA Genes Are Decoupled in Diploid Wheat Relatives

    PubMed Central

    Kellogg, E. A.; Appels, R.

    1995-01-01

    5S RNAs form part of the ribosome in most organisms. In some, e.g., prokaryotes and some fungi, the genes are part of the ribosomal operon, but in most eukaryotes they are in tandem arrays of hundreds to thousands of copies separate from the main ribosomal array. 5S RNA genes can be aligned across kingdoms. We were therefore surprised to find that, for 28 diploid species of the wheat tribe (Triticeae), nucleotide diversity within an array is up to 6.2% in the genes, not significantly different from that of the nontranscribed spacers. Rates of concerted evolution must therefore be insufficient to homogenize the entire array. Between species, there are significantly fewer fixed differences in the gene than would be expected, given the high within-species variation. In contrast, the amount of variation between species in the spacer is the same as or greater than that within individuals. This leads to a paradox. High variation within an individual suggests that there is little selection on any particular gene within an array. But conservation of the gene across species implies that polymorphisms are periodically eliminated at a rate approximately equal to or greater than that of speciation. Levels of intraspecific polymorphism and interspecific divergence are thus decoupled. This implies that selective mechanisms exist to eliminate mutations in the gene without also affecting the spacer. PMID:7635297

  12. Simple detection of the 5S ribosomal RNA of Pneumocystis carinii using in situ hybridisation.

    PubMed Central

    Kobayashi, M; Urata, T; Ikezoe, T; Hakoda, E; Uemura, Y; Sonobe, H; Ohtsuki, Y; Manabe, T; Miyagi, S; Miyoshi, I

    1996-01-01

    AIMS: To investigate the effectiveness of digoxigenin incorporated double stranded DNA probes produced by the polymerase chain reaction (PCR), for the detection of Pneumocystis carinii, using in situ hybridisation (ISH). METHODS: Formalin fixed, paraffin wax embedded sections of 26 human lung samples from 11 patients with P carinii pneumonia (PCP), and 15 with various types of fungal and viral pneumonia, were obtained during necropsy or transbronchial lung biopsy. Three additional PCP induced rat lung samples were also tested. PCR probes were prepared using the digoxigenin labelling mixture, and they were amplified from the DNA of a PCP induced rat lung after administration of dexamethasone, on the basis that 5S ribosomal RNA sequences are identical in human and rat P carinii. ISH was performed using this probe, and visualised using the digoxigenin nucleic acid detection kit. An immunohistochemical study using anti-human Pneumocystis monoclonal antibody was also carried out in parallel. RESULTS: ISH positively stained eight (of eight) lung necropsy specimens from patients with PCP, three (of three) transbronchial lung biopsy specimens from patients with PCP, and none of the three PCP induced rat lung specimens. In contrast, none of the specimens from patients with pneumonia caused by Aspergillus sp (n = 5), Candida sp (n = 4), Cryptococcus sp (n = 2), mucormycosis (n = 2), or cytomegalovirus (n = 2) were positive on ISH or immunohistochemistry. CONCLUSIONS: Using a digoxigenin labelled PCR probe for the entire 5S rRNA sequence in conjunction with conventional staining, ISH is highly reactive and specific for the diagnosis of PCP. Images PMID:9038753

  13. Analysis of the Precursor rRNA Fractions of Rapidly Growing Mycobacteria: Quantification by Methods That Include the Use of a Promoter (rrnA P1) as a Novel Standard†

    PubMed Central

    Menéndez, María del Carmen; Rebollo, María José; Núñez, María del Carmen; Cox, Robert A.; García, María Jesús

    2005-01-01

    Mycobacterial species are able to control rRNA production through variations in the number and strength of promoters controlling their rrn operons. Mycobacterium chelonae and M. fortuitum are members of the rapidly growing mycobacterial group. They carry a total of five promoters each, encoded, respectively, by one and two rrn operons per genome. Quantification of precursor rrn transcriptional products (pre-rrn) has allowed detection of different promoter usage during cell growth. Bacteria growing in several culture media with different nutrient contents were compared. Balanced to stationary phases were analyzed. Most promoters were found to be used at different levels depending on the stage of bacterial growth and the nutrient content of the culture medium. Some biological implications are discussed. Sequences of the several promoters showed motifs that could be correlated to their particular level of usage. A product corresponding to the first rrnA promoter in both species, namely, rrnA P1, was found to contribute at a low and near-constant level to pre-rRNA synthesis, regardless of the culture medium used and the stage of growth analyzed. This product was used as a standard to quantitate rRNA gene expression by real-time PCR when M. fortuitum infected macrophages. It was shown that this bacterium actively synthesizes rRNA during the course of infection and that one of its rrn operons is preferentially used under such conditions. PMID:15629925

  14. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells

    PubMed Central

    Cao, Weibiao

    2016-01-01

    Mechanisms of the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA. PMID:26901778

  15. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  16. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    PubMed Central

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  17. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  18. Species relations among wild Arachis species with the A genome as revealed by FISH mapping of rDNA loci and heterochromatin detection.

    PubMed

    Robledo, G; Lavia, G I; Seijo, G

    2009-05-01

    Section Arachis of the homonymous genus includes 29 wild diploid species and two allotetraploids (A. monticola and the domesticated peanut, A. hypogaea L.). Although, three different genomes (A, B and D) have been proposed for diploid species with x = 10, they are still not well characterized. Moreover, neither the relationships among species within each genome group nor between diploids and tetraploids (AABB) are completely resolved. To tackle these issues, particularly within the A genome, in this study the rRNA genes (5S and 18S-26S) and heterochromatic bands were physically mapped using fluorescent in situ hybridization (FISH) in 13 species of Arachis. These molecular cytogenetic landmarks have allowed individual identification of a set of chromosomes and were used to construct detailed FISH-based karyotypes for each species. The bulk of the chromosome markers mapped revealed that, although the A genome species have a common karyotype structure, the species can be arranged in three groups (La Plata River Basin, Chiquitano, and Pantanal) on the basis of the variability observed in the heterochromatin and 18S-26S rRNA loci. Notably, these groups are consistent with the geographical co-distribution of the species. This coincidence is discussed on the basis of the particular reproductive traits of the species such as autogamy and geocarpy. Combined with geographic distribution of the taxa, the cytogenetic data provide evidence that A. duranensis is the most probable A genome ancestor of tetraploid species. It is expected that the groups of diploid species established, and their relation with the cultigen, may aid to rationally select wild species with agronomic traits desirable for peanut breeding programs. PMID:19234686

  19. Characterization of the genus Bifidobacterium by automated ribotyping and 16S rRNA gene sequences.

    PubMed

    Sakata, Shinji; Ryu, Chun Sun; Kitahara, Maki; Sakamoto, Mitsuo; Hayashi, Hidenori; Fukuyama, Masafumi; Benno, Yoshimi

    2006-01-01

    In order to characterize the genus Bifidobacterium, ribopatterns and approximately 500 bp (Escherichia coli positions 27 to 520) of 16S rRNA gene sequences of 28 type strains and 64 reference strains of the genus Bifidobacterium were determined. Ribopatterns obtained from Bifidobacterium strains were divided into nine clusters (clusters I-IX) with a similarity of 60%. Cluster V, containing 17 species, was further subdivided into 22 subclusters with a similarity of 90%. In the genus Bifidobacterium, four groups were shown according to Miyake et al.: (i) the Bifidobacterium longum infantis-longum-suis type group, (ii) the B. catenulatum-pseudocatenulatum group, (iii) the B. gallinarum-saeculare-pullorum group, and (iv) the B. coryneforme-indicum group, which showed higher than 97% similarity of the 16S rRNA gene sequences in each group. Using ribotyping analysis, unique ribopatterns were obtained from these species, and they could be separated by cluster analysis. Ribopatterns of six B. adolescentis strains were separated into different clusters, and also showed diversity in 16S rRNA gene sequences. B. adolescentis consisted of heterogeneous strains. The nine strains of B. pseudolongum subsp. pseudolongum were divided into five subclusters. Each type strain of B. pseudolongum subsp. pseudolongum and B. pseudolongum subsp. globosum and two intermediate groups, which were suggested by Yaeshima et al., consisted of individual clusters. B. animalis subsp. animalis and B. animalis subsp. lactis could not be separated by ribotyping using Eco RI. We conclude that ribotyping is able to provide another characteristic of Bifidobacterium strains in addition to 16S rRNA gene sequence phylogenetic analysis, and this information suggests that ribotyping analysis is a useful tool for the characterization of Bifidobacterium species in combination with other techniques for taxonomic characterization. PMID:16428867

  20. METAXA2: improved identification and taxonomic classification of small and large subunit rRNA in metagenomic data.

    PubMed

    Bengtsson-Palme, Johan; Hartmann, Martin; Eriksson, Karl Martin; Pal, Chandan; Thorell, Kaisa; Larsson, Dan Göran Joakim; Nilsson, Rolf Henrik

    2015-11-01

    The ribosomal rRNA genes are widely used as genetic markers for taxonomic identification of microbes. Particularly the small subunit (SSU; 16S/18S) rRNA gene is frequently used for species- or genus-level identification, but also the large subunit (LSU; 23S/28S) rRNA gene is employed in taxonomic assignment. The METAXA software tool is a popular utility for extracting partial rRNA sequences from large sequencing data sets and assigning them to an archaeal, bacterial, nuclear eukaryote, mitochondrial or chloroplast origin. This study describes a comprehensive update to METAXA - METAXA2 - that extends the capabilities of the tool, introducing support for the LSU rRNA gene, a greatly improved classifier allowing classification down to genus or species level, as well as enhanced support for short-read (100 bp) and paired-end sequences, among other changes. The performance of METAXA2 was compared to other commonly used taxonomic classifiers, showing that METAXA2 often outperforms previous methods in terms of making correct predictions while maintaining a low misclassification rate. METAXA2 is freely available from http://microbiology.se/software/metaxa2/. PMID:25732605

  1. Sequencing and characterization of full-length sequence of 18S rRNA gene from the reniform nematode

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Variation within this gene is rare but it has been observed in few metazoan species. For the first time, we h...

  2. Differentiation of Debaryomyces hansenii and Candida famata by rRNA gene intergenic spacer fingerprinting and reassessment of phylogenetic relationships among D. hansenii, C. famata, D. fabryi, C. flareri (=D. subglobosus) and D. prosopidis: description of D. vietnamensis sp. nov. closely related to D. nepalensis.

    PubMed

    Nguyen, Huu-Vang; Gaillardin, Claude; Neuvéglise, Cécile

    2009-06-01

    The intergenic spacer rDNA amplification and AluI fingerprinting (IGSAF) method detected four distinct groups among 170 Debaryomyces hansenii strains: D. hansenii var. hansenii; Candida famata var. famata; D. hansenii var. fabryi and C. famata var. flareri. IGS sequence comparison of representative strains showed that D. hansenii var. hansenii and C. famata var. famata belonged to one species, whereas D. hansenii var. fabryi and C. famata var. flareri belonged to two different ones. This confirmed the following three species recently reinstated: D. hansenii (=C. famata), Debaryomyces fabryi and Debaryomyces subglobosus (=Candida flareri). Accordingly, growth at 37 degrees C may no longer be used to differentiate D. hansenii from D. fabryi. Riboflavin production is more specific for D. fabryi and D. subglobosus strains. IGSAF identified all the other 17 species of the genus Debaryomyces, six of them sharing with D. hansenii an rRNA gene unit harbouring two 5S rRNA genes. The phylogenetic tree established with IGS sequences was congruent with the one based on ACT1, GPD1 and COX2 sequences depicting a distinct D. hansenii clade close to the D. subglobosus, Debaryomyces prosopidis and D. fabryi clade. Description of Debaryomyces vietnamensis sp. nov. (type strain CBS 10535(T), MUCL 51648(T)), closely related to Debaryomyces nepalensis is given. PMID:19385997

  3. Oligodeoxynucleotide probes for Campylobacter fetus and Campylobacter hyointestinalis based on 16S rRNA sequences.

    PubMed Central

    Wesley, I V; Wesley, R D; Cardella, M; Dewhirst, F E; Paster, B J

    1991-01-01

    Deoxyoligonucleotide probes were constructed for the identification of Campylobacter fetus and Campylobacter hyointestinalis based on 16S rRNA sequence data. Probes were targeted to hypervariable regions of 16S rRNA. Specificity of oligonucleotide probes was tested in a colony blot assay with type strains of 15 Campylobacter and Arcobacter species as well as in a slot blot format using genomic DNA extracted from field strains of C. fetus and C. hyointestinalis. Two oligonucleotides were constructed for C. fetus that hybridized with equal specificity with each of 57 biochemically confirmed isolates of C. fetus but not with any other Campylobacter species. The C. hyointestinalis probe reacted with 47 of 48 biochemically confirmed field isolates of C. hyointestinalis. In Southern blot hybridization of BglII digests of genomic DNA, the respective probes reacted within three restriction fragments of either C. hyointestinalis (7.2, 8.2, and 10.1 kb) or C. fetus (7.0, 7.7, and 9.0 kb). This suggests multiple copies of genes encoding 16S rRNA. Images PMID:1723076

  4. Characterization of Xanthomonas campestris Pathovars by rRNA Gene Restriction Patterns

    PubMed Central

    Berthier, Yvette; Verdier, Valérie; Guesdon, Jean-Luc; Chevrier, Danièle; Denis, Jean-Baptiste; Decoux, Guy; Lemattre, Monique

    1993-01-01

    Genomic DNA of 191 strains of the family Pseudomonadaceae, including 187 strains of the genus Xanthomonas, was cleaved by EcoRI endonuclease. After hybridization of Southern transfer blots with 2-acetylamino-fluorene-labelled Escherichia coli 16+23S rRNA probe, 27 different patterns were obtained. The strains are clearly distinguishable at the genus, species, and pathovar levels. The variability of the rRNA gene restriction patterns was determined for four pathovars of Xanthomonas campestris species. The 16 strains of X. campestris pv. begoniae analyzed gave only one pattern. The variability of rRNA gene restriction patterns of X. campestris pv. manihotis strains could be related to ecotypes. In contrast, the variability of patterns observed for X. campestris pv. malvacearum was not correlated with pathogenicity or with the geographical origins of the strains. The highest degree of variability of DNA fingerprints was observed within X. campestris pv. dieffenbachiae, which is pathogenic to several hosts of the Araceae family. In this case, variability was related to both host plant and pathogenicity. Images PMID:16348894

  5. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.

    PubMed

    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V

    2015-02-25

    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences. PMID:25523504

  6. Rapid identification of Renibacterium salmoninarum using an oligonucleotide probe complementary to 16S rRNA.

    PubMed

    Mattsson, J G; Gersdorf, H; Jansson, E; Hongslo, T; Göbel, U B; Johansson, K E

    1993-02-01

    Bacterial kidney disease in salmonid fish is caused by the slow-growing Gram-positive rod, Renibacterium salmoninarum. The partial sequence of 16S rRNA from R. salmoninarum was determined and compared with published bacterial 16S rRNA sequences. From this sequence information, a 30-bases-long oligonucleotide was designed and used as a specific probe for identification of R. salmoninarum in filter hybridization experiments. Strong specific hybridization signals were observed for all strains of R. salmoninarum tested. Furthermore, no cross-hybridization could be seen against 22 other bacterial species, among them other salmonid fish pathogens. The detection limit for the probe in direct filter hybridization by the dot-blot technique was 2.5 x 10(4) bacteria. It was also possible to detect R. salmoninarum in clinical samples by direct filter hybridization. PMID:8455640

  7. SAXS investigation on the temperature dependence of the conformation of Carcinus aestuarii 5S hemocyanin subunit

    NASA Astrophysics Data System (ADS)

    Beltramini, M.; Di Muro, P.; Favilla, R.; La Monaca, A.; Mariani, P.; Sabatucci, A. L.; Salvato, B.; Solari, P. L.

    1999-01-01

    The small-angle X-ray scattering technique has been used to study the spatial distribution of a subunit isolated from Carcinus hemocyanin, in solution at pH 7.5 in the 20°C-40°C temperature range. From the obtained scattering profiles, two species with different gyration radius have been detected by Guinier approximation: one species with Rg1≈25 Å is assigned to the 75 kDa 5S subunit whereas a second species with Rg2≈48 Å, and accounting for ≈3% of the total protein, is attributed to the 450 kDa 16S hexamer. Whereas Rg2 decreases slightly (≈10%) and reversibly on increasing the temperature, Rg2 decreases more markedly (≈30%), but irreversibly. The scattering data have been analysed also on the basis of the impenetrable spheres model and by means of the distance distribution function: the temperature dependence of the geometrical dimensions of the particles is confirmed. In addition, for the 5S subunit also the cross-section gyration radius decreases appreciably (15%) and reversibly with temperature. These results are interpreted on the basis of temperature induced structural rearrangements among the three domains of 5S subunit leading to an increased compactness of the molecule and a more elongated form. In contrast, the effect on the hexamer is assigned to its irreversible dissociation to monomers. This interpretation agrees with the analysis of the distance distribution functions, calculated from the Fourier's transforms of the scattering curves at the different temperatures.

  8. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location. PMID:27334092

  9. Promoter of the Mycoplasma pneumoniae rRNA operon.

    PubMed Central

    Hyman, H C; Gafny, R; Glaser, G; Razin, S

    1988-01-01

    RNA transcripts starting from the 5' end of the single Mycoplasma pneumoniae rRNA operon were analyzed by several methods. By primer extension analysis a start site was found 62 nucleotides upstream from the start site of the 16S rRNA. This site was preceded by a putative Pribnow box; however, a defined -35 recognition region was absent. The cloned rRNA operon was transcribed in vitro by using purified RNA polymerase of Escherichia coli. A single start site could be demonstrated within a few nucleotides of the start site found by primer extension analysis of M. pneumoniae transcripts. When fragments from the cloned operon were used as hybridization probes, S1 nuclease mapping yielded a single transcript extending approximately 193 nucleotides upstream from the 16S rRNA start site. The region surrounding this endpoint did not resemble any known promoter sequence. Dot blot hybridization of M. pneumoniae RNA to three oligonucleotides consisting of nucleotides -5 to -21, -38 to -54, and -112 to -132 (from the start of the 16S rRNA gene) indicated that most rRNA transcripts were processed at the stem site preceding the 16S rRNA gene. The majority of the longer precursor transcripts, extending beyond this point, did not extend further upstream to an oligonucleotide consisting of nucleotides -112 to -132. It was concluded that transcription of the rRNA operon of M. pneumoniae is initiated by a single promoter. The nucleotide sequence of the region is presented. Images PMID:2838465

  10. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  11. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  12. rRNA Binding Sites and the Molecular Mechanism of Action of the Tetracyclines.

    PubMed

    Chukwudi, Chinwe U

    2016-08-01

    The tetracycline antibiotics are known to be effective in the treatment of both infectious and noninfectious disease conditions. The 16S rRNA binding mechanism currently held for the antibacterial action of the tetracyclines does not explain their activity against viruses, protozoa that lack mitochondria, and noninfectious conditions. Also, the mechanism by which the tetracyclines selectively inhibit microbial protein synthesis against host eukaryotic protein synthesis despite conservation of ribosome structure and functions is still questionable. Many studies have investigated the binding of the tetracyclines to the 16S rRNA using the small ribosomal subunit of different bacterial species, but there seems to be no agreement between various reports on the exact binding site on the 16S rRNA. The wide range of activity of the tetracyclines against a broad spectrum of bacterial pathogens, viruses, protozoa, and helminths, as well as noninfectious conditions, indicates a more generalized effect on RNA. In the light of recent evidence that the tetracyclines bind to various synthetic double-stranded RNAs (dsRNAs) of random base sequences, suggesting that the double-stranded structures may play a more important role in the binding of the tetracyclines to RNA than the specific base pairs, as earlier speculated, it is imperative to consider possible alternative binding modes or sites that could help explain the mechanisms of action of the tetracyclines against various pathogens and disease conditions. PMID:27246781

  13. Identification of a 5S rDNA spacer type specific Triticum urartu and wheats containing the T. urartu genome.

    PubMed

    Allaby, R G; Brown, T A

    2000-04-01

    A PCR system was designed to amplify 5S spacer rDNA specifically from homeologous chromosome 1 in a variety of species representative of the Aegilops and Triticum genera. Two polymerase chain reaction (PCR) primer combinations were used, one of which appears to be apomorphic in nature and specific to chromosome 1A in Triticum urartu and tetraploid and hexaploid wheats containing the AA genome donated by T. urartu. The value of studying single repeat types to investigate the molecular evolution of 5S-rDNA arrays is considered. PMID:10791812

  14. Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses

    PubMed Central

    Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

    2015-01-01

    Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the

  15. Phylogenetic diversity of bacterial symbionts of Solemya hosts based on comparative sequence analysis of 16S rRNA genes.

    PubMed Central

    Krueger, D M; Cavanaugh, C M

    1997-01-01

    The bacterial endosymbionts of two species of the bivalve genus Solemya from the Pacific Ocean, Solemya terraeregina and Solemya pusilla, were characterized. Prokaryotic cells resembling gram-negative bacteria were observed in the gills of both host species by transmission electron microscopy. The ultrastructure of the symbiosis in both host species is remarkably similar to that of all previously described Solemya spp. By using sequence data from 16S rRNA, the identity and evolutionary origins of the S. terraeregina and S. pusilla symbionts were also determined. Direct sequencing of PCR-amplified products from host gill DNA with primers specific for Bacteria 16S rRNA genes gave a single, unambiguous sequence for each of the two symbiont species. In situ hybridization with symbiont-specific oligonucleotide probes confirmed that these gene sequences belong to the bacteria residing in the hosts gills. Phylogenetic analyses of the 16S rRNA gene sequences by both distance and parsimony methods identify the S. terraeregina and S. pusilla symbionts as members of the gamma subdivision of the Proteobacteria. In contrast to symbionts of other bivalve families, which appear to be monophyletic, the S. terraeregina and S. pusilla symbionts share a more recent common ancestry with bacteria associating endosymbiotically with bivalves of the superfamily Lucinacea than with other Solemya symbionts (host species S. velum, S. occidentalis, and S. reidi). Overall, the 16S rRNA gene sequence data suggest that the symbionts of Solemya hosts represent at least two distinct bacterial lineages within the gamma-Proteobacteria. While it is increasingly clear that all extant species of Solemya live in symbiosis with specific bacteria, the associations appear to have multiple evolutionary origins. PMID:8979342

  16. Quantitative Northern Blot Analysis of Mammalian rRNA Processing.

    PubMed

    Wang, Minshi; Pestov, Dimitri G

    2016-01-01

    Assembly of eukaryotic ribosomes is an elaborate biosynthetic process that begins in the nucleolus and requires hundreds of cellular factors. Analysis of rRNA processing has been instrumental for studying the mechanisms of ribosome biogenesis and effects of stress conditions on the molecular milieu of the nucleolus. Here, we describe the quantitative analysis of the steady-state levels of rRNA precursors, applicable to studies in mammalian cells and other organisms. We include protocols for gel electrophoresis and northern blotting of rRNA precursors using procedures optimized for the large size of these RNAs. We also describe the ratio analysis of multiple precursors, a technique that facilitates the accurate assessment of changes in the efficiency of individual pre-rRNA processing steps. PMID:27576717

  17. Imprint of Ancient Evolution on rRNA Folding.

    PubMed

    Lanier, Kathryn A; Athavale, Shreyas S; Petrov, Anton S; Wartell, Roger; Williams, Loren Dean

    2016-08-23

    In a model describing the origin and evolution of the translation system, ribosomal RNA (rRNA) grew in size by accretion [Petrov, A. S., et al. (2015) History of the Ribosome and the Origin of Translation. Proc. Natl. Acad. Sci. U.S.A. 112, 15396-15401]. Large rRNAs were built up by iterative incorporation and encasement of small folded RNAs, in analogy with addition of new LEGOs onto the surface of a preexisting LEGO assembly. In this model, rRNA robustness in folding arises from inherited autonomy of local folding. We propose that rRNAs can be decomposed at various granularities, retaining folding mechanism and folding competence. To test these predictions, we disassembled Domain III of the large ribosomal subunit (LSU). We determined whether local rRNA structure, stability, and folding pathways are autonomous. Thermal melting, chemical footprinting, and circular dichroism were used to infer rules that govern folding of rRNA. We deconstructed Domain III of the LSU rRNA by mapping out its complex multistep melting pathway. We studied Domain III and two equal-size "sub-Domains" of Domain III. The combined results are consistent with a model in which melting transitions of Domain III are conserved upon cleavage into sub-Domains. Each of the eight melting transitions of Domain III corresponds in Tm and ΔH with a transition observed in one of the two isolated sub-Domains. The results support a model in which structure, stability, and folding mechanisms are dominated by local interactions and are unaffected by separation of the sub-Domains. Domain III rRNA is distinct from RNAs that form long-range cooperative interaction networks at early stages of folding or that do not fold reversibly. PMID:27428664

  18. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing.

    PubMed

    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan

    2016-01-01

    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  19. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing

    PubMed Central

    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan

    2016-01-01

    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  20. Evolution of rRNA gene clusters and telomeric repeats during explosive genome repatterning in TATERILLUS X (Rodentia, Gerbillinae).

    PubMed

    Dobigny, G; Ozouf-Costaz, C; Bonillo, C; Volobouev, V

    2003-01-01

    A survey of 28S and 5S rRNA gene clusters, and telomeric repeats was performed using single and double FISH in the Taterillus genus (Rodentia, Muridae, Gerbillinae). Taterillus was previously demonstrated to have undergone a very recent and extensive chromosomal evolution. Our FISH results demonstrate that rRNA genes can vary in location and number irrespective of the phylogenetic relationships. Telomeric repeats were detected in pericentromeric and interstitial regions of several chromosomes, thus providing nonambiguous evolutionary footprints of Robertsonian and tandem translocation events. These footprints are discussed in reference to the molecular process of these karyotypical changes. Also, examples of colocation of rDNA clusters and telomeric repeats lend support to their possible involvement in nucleolus formation. Finally, the presence of rRNA genes, and the extensive amplification of telomeric repeats at specific loci within a double X-autosome translocated element which were not observed on the homologous Y1 and Y2, served as basis for an epigenomic hypothesis on X-autosome translocation viability in mammals. PMID:15004471

  1. Post-transcriptional Modifications Modulate rRNA Structure and Ligand Interactions.

    PubMed

    Jiang, Jun; Seo, Hyosuk; Chow, Christine S

    2016-05-17

    Post-transcriptional modifications play important roles in modulating the functions of RNA species. The presence of modifications in RNA may directly alter its interactions with binding partners or cause structural changes that indirectly affect ligand recognition. Given the rapidly growing list of modifications identified in noncoding and mRNAs associated with human disease, as well as the dynamic control over modifications involved in various physiological processes, it is imperative to understand RNA structural modulation by these modifications. Among the RNA species, rRNAs provide numerous examples of modification types located in differing sequence and structural contexts. In addition, the modified rRNA motifs participate in a wide variety of ligand interactions, including those with RNA, protein, and small molecules. In fact, several classes of antibiotics exert their effects on protein synthesis by binding to functionally important and highly modified regions of the rRNAs. These RNA regions often display conservation in sequence, secondary structure, tertiary interactions, and modifications, trademarks of ideal drug-targeting sites. Furthermore, ligand interactions with such regions often favor certain modification-induced conformational states of the RNA. Our laboratory has employed a combination of biophysical methods such as nuclear magnetic resonance spectroscopy (NMR), circular dichroism, and UV melting to study rRNA modifications in functionally important motifs, including helix 31 (h31) and helix h44 (h44) of the small subunit rRNA and helix 69 (H69) of the large subunit rRNA. The modified RNA oligonucleotides used in these studies were generated by solid-phase synthesis with a variety of phosphoramidite chemistries. The natural modifications were shown to impact thermal stability, dynamic behavior, and tertiary structures of the RNAs, with additive or cooperative effects occurring with multiple, clustered modifications. Taking advantage of the

  2. Trypanosoma livingstonei: a new species from African bats supports the bat seeding hypothesis for the Trypanosoma cruzi clade

    PubMed Central

    2013-01-01

    Background Bat trypanosomes have been implicated in the evolutionary history of the T. cruzi clade, which comprises species from a wide geographic and host range in South America, Africa and Europe, including bat-restricted species and the generalist agents of human American trypanosomosis T. cruzi and T. rangeli. Methods Trypanosomes from bats (Rhinolophus landeri and Hipposideros caffer) captured in Mozambique, southeast Africa, were isolated by hemoculture. Barcoding was carried out through the V7V8 region of Small Subunit (SSU) rRNA and Fluorescent Fragment Length barcoding (FFLB). Phylogenetic inferences were based on SSU rRNA, glyceraldehyde phosphate dehydrogenase (gGAPDH) and Spliced Leader (SL) genes. Morphological characterization included light, scanning and transmission electron microscopy. Results New trypanosomes from bats clustered together forming a clade basal to a larger assemblage called the T. cruzi clade. Barcoding, phylogenetic analyses and genetic distances based on SSU rRNA and gGAPDH supported these trypanosomes as a new species, which we named Trypanosoma livingstonei n. sp. The large and highly polymorphic SL gene repeats of this species showed a copy of the 5S ribosomal RNA into the intergenic region. Unique morphological (large and broad blood trypomastigotes compatible to species of the subgenus Megatrypanum and cultures showing highly pleomorphic epimastigotes and long and slender trypomastigotes) and ultrastructural (cytostome and reservosomes) features and growth behaviour (when co-cultivated with HeLa cells at 37°C differentiated into trypomastigotes resembling the blood forms and do not invaded the cells) complemented the description of this species. Conclusion Phylogenetic inferences supported the hypothesis that Trypanosoma livingstonei n. sp. diverged from a common ancestral bat trypanosome that evolved exclusively in Chiroptera or switched at independent opportunities to mammals of several orders forming the clade T. cruzi

  3. Cytogenetic studies and karyotype nomenclature of three wild canid species: maned wolf (Chrysocyon brachyurus), bat-eared fox (Otocyon megalotis) and fennec fox (Fennecus zerda).

    PubMed

    Pieńkowska-Schelling, A; Schelling, C; Zawada, M; Yang, F; Bugno, M; Ferguson-Smith, M

    2008-01-01

    We have analysed the chromosomes of three wild and endangered canid species: the maned wolf (Chrysocyon brachyurus), the bat-eared fox (Otocyon megalotis) and the fennec fox (Fennecuszerda) using classical and molecular cytogenetic methods. For the first time detailed and encompassing descriptions of the chromosomes are presented including the chromosomal assignment of nucleolar organizer regions and the 5S rRNA gene cluster. We propose a karyotype nomenclature with ideograms including more than 300 bands per haploid set for each of these three species which will form the basis for further research. In addition, we propose four basic different patterns of karyotype organization in the family Canidae. A comparison of these patterns with the most recent molecular phylogeny of Canidae revealed that the karyotype evolution of a species is not always strongly connected with its phylogenetic position. Our findings underline the need and justification for basic cytogenetic work in rare and exotic species. PMID:18544923

  4. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  5. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH

    PubMed Central

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution. PMID:23826377

  6. Identification of goat cashmere and sheep wool by PCR-RFLP analysis of mitochondrial 12S rRNA gene.

    PubMed

    Geng, Rong-Qing; Yuan, Chao; Chen, Yu-Lin

    2012-12-01

    The efficacy of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of mitochondrial 12S rRNA gene in identification of goat cashmere and sheep wool samples was evaluated. The specific fragments of the mitochondrial 12S rRNA gene, which were about 440 bp, were obtained using the PCR. Restriction enzyme digestion of the PCR products with endonucleases BspT I and Hinf I revealed species-specific RFLP patterns. Application of this technique on mixed samples could identify goat cashmere and sheep wool from each other within the proportion of 8:1. The technique, however, could detect only one species when the proportion of mixture was more than 9:1. The PCR-RFLP technique was demonstrated to possess potential value in precise identification of goat cashmere and sheep wool. PMID:22943150

  7. Sulfur-oxidizing bacterial endosymbionts: analysis of phylogeny and specificity by 16S rRNA sequences.

    PubMed

    Distel, D L; Lane, D J; Olsen, G J; Giovannoni, S J; Pace, B; Pace, N R; Stahl, D A; Felbeck, H

    1988-06-01

    The 16S rRNAs from the bacterial endosymbionts of six marine invertebrates from diverse environments were isolated and partially sequenced. These symbionts included the trophosome symbiont of Riftia pachyptila, the gill symbionts of Calyptogena magnifica and Bathymodiolus thermophilus (from deep-sea hydrothermal vents), and the gill symbionts of Lucinoma annulata, Lucinoma aequizonata, and Codakia orbicularis (from relatively shallow coastal environments). Only one type of bacterial 16S rRNA was detected in each symbiosis. Using nucleotide sequence comparisons, we showed that each of the bacterial symbionts is distinct from the others and that all fall within a limited domain of the gamma subdivision of the purple bacteria (one of the major eubacterial divisions previously defined by 16S rRNA analysis [C. R. Woese, Microbiol. Rev. 51: 221-271, 1987]). Two host specimens were analyzed in five of the symbioses; in each case, identical bacterial rRNA sequences were obtained from conspecific host specimens. These data indicate that the symbioses examined are species specific and that the symbiont species are unique to and invariant within their respective host species. PMID:3286609

  8. Phylogeny of Intestinal Ciliates, Including Charonina ventriculi, and Comparison of Microscopy and 18S rRNA Gene Pyrosequencing for Rumen Ciliate Community Structure Analysis

    PubMed Central

    Devente, Savannah R.; Kirk, Michelle R.; Seedorf, Henning; Dehority, Burk A.

    2015-01-01

    The development of high-throughput methods, such as the construction of 18S rRNA gene clone or pyrosequencing libraries, has allowed evaluation of ciliate community composition in hundreds of samples from the rumen and other intestinal habitats. However, several genera of mammalian intestinal ciliates have been described based only on morphological features and, to date, have not been identified using molecular methods. Here, we isolated single cells of one of the smallest but widely distributed intestinal ciliates, Charonina ventriculi, and sequenced its 18S rRNA gene. We verified the sequence in a full-cycle rRNA approach using fluorescence in situ hybridization and thereby assigned an 18S rRNA gene sequence to this species previously known only by its morphology. Based on its full-length 18S rRNA gene sequence, Charonina ventriculi was positioned within the phylogeny of intestinal ciliates in the subclass Trichostomatia. The taxonomic framework derived from this phylogeny was used for taxonomic assignment of trichostome ciliate 18S rRNA gene sequence data stemming from high-throughput amplicon pyrosequencing of rumen-derived DNA samples. The 18S rRNA gene-based ciliate community structure was compared to that obtained from microscopic counts using the same samples. Both methods allowed identification of dominant members of the ciliate communities and classification of the rumen ciliate community into one of the types first described by Eadie in 1962. Notably, each method is associated with advantages and disadvantages. Microscopy is a highly accurate method for evaluation of total numbers or relative abundances of different ciliate genera in a sample, while 18S rRNA gene pyrosequencing represents a valuable alternative for comparison of ciliate community structure in a large number of samples from different animals or treatment groups. PMID:25616800

  9. Avoidance and Potential Remedy Solutions of Chimeras in Reconstructing the Phylogeny of Aphids Using the 16S rRNA Gene of Buchnera: A Case in Lachninae (Hemiptera).

    PubMed

    Chen, Rui; Wang, Zhe; Chen, Jing; Qiao, Ge-Xia

    2015-01-01

    It is known that PCR amplification of highly homologous genes from complex DNA mixtures can generate a significant proportion of chimeric sequences. The 16S rRNA gene is not only widely used in estimating the species diversity of endosymbionts in aphids but also used to explore the co-diversification of aphids and their endosymbionts. Thus, chimeric sequences may lead to the discovery of non-existent endosymbiont species and mislead Buchnera-based phylogenetic analysis that lead to false conclusions. In this study, a high probability (6.49%) of chimeric sequence occurrence was found in the amplified 16S rRNA gene sequences of endosymbionts from aphid species in the subfamily Lachninae. These chimeras are hybrid products of multiple parent sequences from the dominant species of endosymbionts in each corresponding host. It is difficult to identify the chimeric sequences of a new or unidentified species due to the high variability of their main parent, Buchnera aphidicola, and because the chimeric sequences can confuse the phylogenetic analysis of 16S rRNA gene sequences. These chimeras present a challenge to Buchnera-based phylogenetic research in aphids. Thus, our study strongly suggests that using appropriate methods to detect chimeric 16S rRNA sequences may avoid some false conclusions in endosymbiont-based aphid research. PMID:26307984

  10. Avoidance and Potential Remedy Solutions of Chimeras in Reconstructing the Phylogeny of Aphids Using the 16S rRNA Gene of Buchnera: A Case in Lachninae (Hemiptera)

    PubMed Central

    Chen, Rui; Wang, Zhe; Chen, Jing; Qiao, Ge-Xia

    2015-01-01

    It is known that PCR amplification of highly homologous genes from complex DNA mixtures can generate a significant proportion of chimeric sequences. The 16S rRNA gene is not only widely used in estimating the species diversity of endosymbionts in aphids but also used to explore the co-diversification of aphids and their endosymbionts. Thus, chimeric sequences may lead to the discovery of non-existent endosymbiont species and mislead Buchnera-based phylogenetic analysis that lead to false conclusions. In this study, a high probability (6.49%) of chimeric sequence occurrence was found in the amplified 16S rRNA gene sequences of endosymbionts from aphid species in the subfamily Lachninae. These chimeras are hybrid products of multiple parent sequences from the dominant species of endosymbionts in each corresponding host. It is difficult to identify the chimeric sequences of a new or unidentified species due to the high variability of their main parent, Buchnera aphidicola, and because the chimeric sequences can confuse the phylogenetic analysis of 16S rRNA gene sequences. These chimeras present a challenge to Buchnera-based phylogenetic research in aphids. Thus, our study strongly suggests that using appropriate methods to detect chimeric 16S rRNA sequences may avoid some false conclusions in endosymbiont-based aphid research. PMID:26307984

  11. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq

    2015-01-01

    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  12. Intrageneric relationships of Enterococci as determined by reverse transcriptase sequencing of small-subunit rRNA.

    PubMed

    Williams, A M; Rodrigues, U M; Collins, M D

    1991-01-01

    The 16S ribosomal ribonucleic acid (rRNA) sequences of eleven Enterococcus species were determined by reverse transcription in an attempt to clarify their intrageneric relationships. Comparative analysis of the sequence data revealed the presence of several species groups within the genus. The species E. avium, E. malodoratus, E. pseudoavium and E. raffinosus formed a distinct group as did E. durans, E. faecium, E. hirae and E. mundtii and the pair of species E. casseliflavus and E. gallinarum. Of the remaining species, E. cecorum, E. columbae, E. faecalis and E. saccharolyticus formed distinct lines of descent within the genus, whereas E. solitarius displayed a closer affinity with Tetragenococcus halophilus than with other enterococcal species. PMID:1712504

  13. Identification and phylogeny of Arabian snakes: Comparison of venom chromatographic profiles versus 16S rRNA gene sequences.

    PubMed

    Al Asmari, Abdulrahman; Manthiri, Rajamohammed Abbas; Khan, Haseeb Ahmad

    2014-11-01

    Identification of snake species is important for various reasons including the emergency treatment of snake bite victims. We present a simple method for identification of six snake species using the gel filtration chromatographic profiles of their venoms. The venoms of Echis coloratus, Echis pyramidum, Cerastes gasperettii, Bitis arietans, Naja arabica, and Walterinnesia aegyptia were milked, lyophilized, diluted and centrifuged to separate the mucus from the venom. The clear supernatants were filtered and chromatographed on fast protein liquid chromatography (FPLC). We obtained the 16S rRNA gene sequences of the above species and performed phylogenetic analysis using the neighbor-joining method. The chromatograms of venoms from different snake species showed peculiar patterns based on the number and location of peaks. The dendrograms generated from similarity matrix based on the presence/absence of particular chromatographic peaks clearly differentiated Elapids from Viperids. Molecular cladistics using 16S rRNA gene sequences resulted in jumping clades while separating the members of these two families. These findings suggest that chromatographic profiles of snake venoms may provide a simple and reproducible chemical fingerprinting method for quick identification of snake species. However, the validation of this methodology requires further studies on large number of specimens from within and across species. PMID:25313278

  14. Alternate rRNA secondary structures as regulators of translation.

    PubMed

    Feng, Shu; Li, Heng; Zhao, Jing; Pervushin, Konstantin; Lowenhaupt, Ky; Schwartz, Thomas U; Dröge, Peter

    2011-02-01

    Structural dynamics of large molecular assemblies are intricately linked to function. For ribosomes, macromolecular changes occur especially during mRNA translation and involve participation of ribosomal RNA. Without suitable probes specific to RNA secondary structure, however, elucidation of more subtle dynamic ribosome structure-function relationships, especially in vivo, remains challenging. Here we report that the Z-DNA- and Z-RNA-binding domain Zα, derived from the human RNA editing enzyme ADAR1-L, binds with high stability to specific rRNA segments of Escherichia coli and human ribosomes. Zα impaired in Z-RNA recognition does not associate with ribosomes. Notably, Zα(ADAR1)-ribosome interaction blocks translation in vitro and in vivo, with substantial physiological consequences. Our study shows that ribosomes can be targeted by a protein that specifically recognizes an alternate rRNA secondary structure, and suggests a new mechanism of translational regulation on the ribosome. PMID:21217697

  15. Molecular confirmation of the genomic constitution of Douglasdeweya (Triticeae: Poaceae): demonstration of the utility of the 5S rDNA sequence as a tool for haplome identification.

    PubMed

    Baum, Bernard R; Johnson, Douglas A

    2008-06-01

    A new genus Douglasdeweya containing the two species, Douglasdeweya deweyi and D. wangii was published in 2005 by Yen et al. based upon the results of cytogenetical and morphological findings. The genome constitution of Douglasdeweya-PPStSt-allowed its segregation from the genus Pseudoroegneria which contains the StSt or StStStSt genomes. Our previous work had demonstrated the utility of using 5S rDNA units, especially the non-transcribed spacer sequence variation, for the resolution of genomes (haplomes) previously established by cytology. Here, we show that sequence analysis of the 5S DNA units from these species strongly supports the proposed species relationships of Yen et al. (Can J Bot 83:413-419, 2005), i.e., the PP genome from Agropyron and the StSt genome from Pseudoroegneria. Analysis of the 5S rDNA units constitutes a powerful tool for genomic research especially in the Triticeae. PMID:18421479

  16. DNA polymorphism in morels: complete sequences of the internal transcribed spacer of genes coding for rRNA in Morchella esculenta (yellow morel) and Morchella conica (black morel).

    PubMed Central

    Wipf, D; Munch, J C; Botton, B; Buscot, F

    1996-01-01

    The internal transcribed spacer (ITS) of the gene coding for rRNA was sequenced in both directions with the gene walking technique in a black morel (Morchella conica) and a yellow morel (M. esculenta) to elucidate the ITS length discrepancy between the two species groups (750-bp ITS in black morels and 1,150-bp ITS in yellow morels. PMID:8795250

  17. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences.

    PubMed

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-07-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences. PMID:26943621

  18. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences

    PubMed Central

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-01-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences. PMID:26943621

  19. Relationships between parasitoid wasps (Hymenoptera: Braconidae: Opiinae), fruit flies (Diptera: Tephritidae) and their host plants based on 16S rRNA, 12S rRNA, and ND1 gene sequences

    NASA Astrophysics Data System (ADS)

    Ibrahim, N. J.; Md-Zain, B. M.; Yaakop, S.

    2013-11-01

    Opiinae is among the l0 largest subfamilies under the family Braconidae. Opiines species have great potential as natural enemies against fruit fly pests. Before using them as a biological control agent, construction of the phylogenetic trees could facilitate in the molecular identification of individual species and their relationships among members of the Opiines, as well as between Opiines and their host plants. Larval specimens of tephritids were collected from four crop species at five localities throughout the Peninsular Malaysia. A total of 44 specimens of opiines had successfully emerged from the hosts, fruit fly larvae. The DNA sequences of 12S and 16S rRNA were obtained for the braconids while the mitochondrial ND1 sequences were obtained for the tephritids species through polymerase chain reaction. Maximum Parsimony and Bayesian trees were constructed by using PAUP 4.0b10 and MrBayes 3.1.2 to identify the relationships among the taxa. This study illustrates the phylogenetic relationships among parasitoid opiines collected and reared from parasitized fruit flies. The phylogenetic trees constructed based on the mitochondrial 12S and 16S rRNA sequences exhibited similar topology and sequence divergence. The opiines were divided into several clades and subclades according to the genus and species. Each clade also was supported by the similar host plants with high support values. However, their pests were not specific, except for Bactrocera cucurbitae. This study has reconfirmed the associations between Opiinae, tephritids, and host plants based on molecular data.

  20. An updated 18S rRNA phylogeny of tunicates based on mixture and secondary structure models

    PubMed Central

    Tsagkogeorga, Georgia; Turon, Xavier; Hopcroft, Russell R; Tilak, Marie-Ka; Feldstein, Tamar; Shenkar, Noa; Loya, Yossi; Huchon, Dorothée; Douzery, Emmanuel JP; Delsuc, Frédéric

    2009-01-01

    Background Tunicates have been recently revealed to be the closest living relatives of vertebrates. Yet, with more than 2500 described species, details of their evolutionary history are still obscure. From a molecular point of view, tunicate phylogenetic relationships have been mostly studied based on analyses of 18S rRNA sequences, which indicate several major clades at odds with the traditional class-level arrangements. Nonetheless, substantial uncertainty remains about the phylogenetic relationships and taxonomic status of key groups such as the Aplousobranchia, Appendicularia, and Thaliacea. Results Thirty new complete 18S rRNA sequences were acquired from previously unsampled tunicate species, with special focus on groups presenting high evolutionary rate. The updated 18S rRNA dataset has been aligned with respect to the constraint on homology imposed by the rRNA secondary structure. A probabilistic framework of phylogenetic reconstruction was adopted to accommodate the particular evolutionary dynamics of this ribosomal marker. Detailed Bayesian analyses were conducted under the non-parametric CAT mixture model accounting for site-specific heterogeneity of the evolutionary process, and under RNA-specific doublet models accommodating the occurrence of compensatory substitutions in stem regions. Our results support the division of tunicates into three major clades: 1) Phlebobranchia + Thaliacea + Aplousobranchia, 2) Appendicularia, and 3) Stolidobranchia, but the position of Appendicularia could not be firmly resolved. Our study additionally reveals that most Aplousobranchia evolve at extremely high rates involving changes in secondary structure of their 18S rRNA, with the exception of the family Clavelinidae, which appears to be slowly evolving. This extreme rate heterogeneity precluded resolving with certainty the exact phylogenetic placement of Aplousobranchia. Finally, the best fitting secondary-structure and CAT-mixture models suggest a sister

  1. Identification of Dermatophyte Species by 28S Ribosomal DNA Sequencing with a Commercial Kit

    PubMed Central

    Ninet, Béatrice; Jan, Isabelle; Bontems, Olympia; Léchenne, Barbara; Jousson, Olivier; Panizzon, Renato; Lew, Daniel; Monod, Michel

    2003-01-01

    We have shown that dermatophyte species can be easily identified on the basis of a DNA sequence encoding a part of the large-subunit (LSU) rRNA (28S rRNA) by using the MicroSeq D2 LSU rRNA Fungal Sequencing Kit. Two taxa causing distinct dermatophytoses were clearly distinguished among isolates of the Trichophyton mentagrophytes species complex. PMID:12574293

  2. Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

  3. Assessment of microbial dynamics in the Pearl River Estuary by 16S rRNA terminal restriction fragment analysis

    NASA Astrophysics Data System (ADS)

    Wu, Madeline; Song, Liansheng; Ren, Jianping; Kan, Jianjun; Qian, Pei-Yuan

    2004-10-01

    We have evaluated the feasibility of using the terminal restriction fragment length polymorphism (T-RFLP) pattern of polymerase chain reaction (PCR) amplified 16S rRNA sequences to track the changes of the free-living bacterial community for the Pearl River Estuary surface waters. The suitability of specific PCR primers, PCR bias induced by thermal cycles, and field-sampling volumes were critically evaluated in laboratory tests. We established a workable protocol and obtained TRF patterns that reflected the changes in the bacterial population. The temporal dynamics over a 24 h period were examined at one anchored station, as well as the spatial distribution pattern of the bacterial community at several stations, covering the transects along the river discharge direction and across the river plume. The TRF pattern revealed 9 dominant bacterial groups. Changes in their relative abundance reflecting the changes in the bacterial community composition were documented. Many culturable species were isolated from each field sample and a portion of the 16S rRNA gene for each species was sequenced. The species was identified based on sequence data comparison. In this region, the dominant species belong to the γ-subdivision of proteobacteria and the Bacillus/Clostridium group of Firmicutes. We also detected the wide spread distribution of Acinetobacter spp.; many of these species are known nosocomial pathogen for humans.

  4. Prevalence of Corynebacterial 16S rRNA Sequences in Patients with Bacterial and “Nonbacterial” Prostatitis

    PubMed Central

    Tanner, Michael A.; Shoskes, Daniel; Shahed, Asha; Pace, Norman R.

    1999-01-01

    The etiology of chronic prostatitis syndromes in men is controversial, particularly when positive cultures for established uropathogens are lacking. Although identification of bacteria in prostatic fluid has relied on cultivation and microscopy, most microorganisms in the environment, including some human pathogens, are resistant to cultivation. We report here on an rRNA-based molecular phylogenetic approach to the identification of bacteria in prostate fluid from prostatitis patients. Positive bacterial signals were seen for 65% of patients with chronic prostatitis overall. Seven of 11 patients with bacterial signals but none of 6 patients without bacterial signals were cured with antibiotic-based therapy. Results indicate the occurrence in the prostate fluid of a wide spectrum of bacterial species representing several genera. Most rRNA genes were closely related to those of species belonging to the genera Corynebacterium, Staphylococcus, Peptostreptococcus, Streptococcus, and Escherichia. Unexpectedly, a wide diversity of Corynebacterium species was found in high proportion compared to the proportions of other bacterial species found. A subset of these 16S rRNA sequences represent those of undescribed species on the basis of their positions in phylogenetic trees. These uncharacterized organisms were not detected in control samples, suggesting that the organisms have a role in the disease or are the consequence of the disease. These studies show that microorganisms associated with prostatitis generally occur as complex microbial communities that differ between patients. The results also indicate that microbial communities distinct from those associated with prostatitis may occur at low levels in normal prostatic fluid. PMID:10325338

  5. A Neurospora crassa ribosomal protein gene, homologous to yeast CRY1, contains sequences potentially coordinating its transcription with rRNA genes.

    PubMed Central

    Tyler, B M; Harrison, K

    1990-01-01

    We have isolated and sequenced a Neurospora crassa ribosomal protein gene (designated crp-2) strongly homologous to the rp59 gene (CRY1) of yeast and the S14 ribosomal protein gene of mammals. The inferred sequence of the crp-2 protein is more homologous (83%) to the mammalian S14 sequence than to the yeast rp59 sequence (69%). The gene has three intervening sequences (IVSs) two of which are offset 7 bp from the position of IVSs in the mammalian genes. None correspond to the position of the IVS in the yeast gene. Crp-2 was mapped by RFLP analysis to the right arm of linkage group III. The 5' region of the gene contains three copies of a sequence, the Ribo box, previously shown to be required for transcription of both 5S and 40S rRNA genes. We speculate that the Ribo box may coordinate ribosomal protein and rRNA gene transcription. Images PMID:1977135

  6. Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry as an Alternative to 16S rRNA Gene Sequencing for Identification of Difficult-To-Identify Bacterial Strains▿†

    PubMed Central

    Bizzini, A.; Jaton, K.; Romo, D.; Bille, J.; Prod'hom, G.; Greub, G.

    2011-01-01

    Conventional methods are sometimes insufficient to identify human bacterial pathogens, and alternative techniques, often molecular, are required. Matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) identified with a valid score 45.9% of 410 clinical isolates from 207 different difficult-to-identify species having required 16S rRNA gene sequencing. MALDI-TOF MS might represent an alternative to 16S rRNA gene sequencing. PMID:21106794

  7. Formation of Tertiary Interactions during rRNA GTPase Center Folding.

    PubMed

    Rau, Michael J; Welty, Robb; Tom Stump, W; Hall, Kathleen B

    2015-08-28

    The 60-nt GTPase center (GAC) of 23S rRNA has a phylogenetically conserved secondary structure with two hairpin loops and a 3-way junction. It folds into an intricate tertiary structure upon addition of Mg(2+) ions, which is stabilized by the L11 protein in cocrystal structures. Here, we monitor the kinetics of its tertiary folding and Mg(2+)-dependent intermediate states by observing selected nucleobases that contribute specific interactions to the GAC tertiary structure in the cocrystals. The fluorescent nucleobase 2-aminopurine replaced three individual adenines, two of which make long-range stacking interactions and one that also forms hydrogen bonds. Each site reveals a unique response to Mg(2+) addition and temperature, reflecting its environmental change from secondary to tertiary structure. Stopped-flow fluorescence experiments revealed that kinetics of tertiary structure formation upon addition of MgCl2 are also site specific, with local conformational changes occurring from 5 ms to 4s and with global folding from 1 to 5s. Site-specific substitution with (15)N-nucleobases allowed observation of stable hydrogen bond formation by NMR experiments. Equilibrium titration experiments indicate that a stable folding intermediate is present at stoichiometric concentrations of Mg(2+) and suggest that there are two initial sites of Mg(2+) ion association. PMID:26210661

  8. Bacteroides isolated from four mammalian hosts lack host-specific 16S rRNA gene phylogeny and carbon and nitrogen utilization patterns*

    PubMed Central

    Atherly, Todd; Ziemer, Cherie J

    2014-01-01

    One-hundred-and-three isolates of Bacteroides ovatus,B. thetaiotaomicron, and B. xylanisolvens were recovered from cow, goat, human, and pig fecal enrichments with cellulose or xylan/pectin. Isolates were compared using 16S rRNA gene sequencing, repetitive sequence-based polymerase chain reaction (rep-PCR), and phenotypic microarrays. Analysis of 16S rRNA gene sequences revealed high sequence identity in these Bacteroides; with distinct phylogenetic groupings by bacterial species but not host origin. Phenotypic microarray analysis demonstrated these Bacteroides shared the ability to utilize many of the same carbon substrates, without differences due to species or host origin, indicative of their broad carbohydrate fermentation abilities. Limited nitrogen substrates were utilized; in addition to ammonia, guanine, and xanthine, purine derivatives were utilized by most isolates followed by a few amino sugars. Only rep-PCR analysis demonstrated host-specific patterns, indicating that genomic changes due to coevolution with host did not occur by mutation in the 16S rRNA gene or by a gain or loss of carbohydrate utilization genes within these Bacteroides. This is the first report to indicate that host-associated genomic differences are outside of 16S rRNA gene and carbohydrate utilization genes and suggest conservation of specific bacterial species with the same functionality across mammalian hosts for this Bacteroidetes clade. PMID:24532571

  9. 16S classifier: a tool for fast and accurate taxonomic classification of 16S rRNA hypervariable regions in metagenomic datasets.

    PubMed

    Chaudhary, Nikhil; Sharma, Ashok K; Agarwal, Piyush; Gupta, Ankit; Sharma, Vineet K

    2015-01-01

    The diversity of microbial species in a metagenomic study is commonly assessed using 16S rRNA gene sequencing. With the rapid developments in genome sequencing technologies, the focus has shifted towards the sequencing of hypervariable regions of 16S rRNA gene instead of full length gene sequencing. Therefore, 16S Classifier is developed using a machine learning method, Random Forest, for faster and accurate taxonomic classification of short hypervariable regions of 16S rRNA sequence. It displayed precision values of up to 0.91 on training datasets and the precision values of up to 0.98 on the test dataset. On real metagenomic datasets, it showed up to 99.7% accuracy at the phylum level and up to 99.0% accuracy at the genus level. 16S Classifier is available freely at http://metagenomics.iiserb.ac.in/16Sclassifier and http://metabiosys.iiserb.ac.in/16Sclassifier. PMID:25646627

  10. Preliminary study on mitochondrial 16S rRNA gene sequences and phylogeny of flatfishes (Pleuronectiformes)

    NASA Astrophysics Data System (ADS)

    You, Feng; Liu, Jing; Zhang, Peijun; Xiang, Jianhai

    2005-09-01

    A 605 bp section of mitochondrial 16S rRNA gene from Paralichthys olivaceus, Pseudorhombus cinnamomeus, Psetta maxima and Kareius bicoloratus, which represent 3 families of Order Pleuronectiformes was amplified by PCR and sequenced to show the molecular systematics of Pleuronectiformes for comparison with related gene sequences of other 6 flatfish downloaded from GenBank. Phylogenetic analysis based on genetic distance from related gene sequences of 10 flatfish showed that this method was ideal to explore the relationship between species, genera and families. Phylogenetic trees set-up is based on neighbor-joining, maximum parsimony and maximum likelihood methods that accords to the general rule of Pleuronectiformes evolution. But they also resulted in some confusion. Unlike data from morphological characters, P. olivaceus clustered with K. bicoloratus, but P. cinnamomeus did not cluster with P. olivaceus, which is worth further studying.

  11. Determining Fungi rRNA Copy Number by PCR

    PubMed Central

    Black, Jonathan; Dean, Timothy; Byfield, Grace; Foarde, Karin; Menetrez, Marc

    2013-01-01

    The goal of this project is to improve the quantification of indoor fungal pollutants via the specific application of quantitative PCR (qPCR). Improvement will be made in the controls used in current qPCR applications. This work focuses on the use of two separate controls within a standard qPCR reaction. The first control developed was the internal standard control gene, benA. This gene encodes for β-tubulin and was selected based on its single-copy nature. The second control developed was the standard control plasmid, which contained a fragment of the ribosomal RNA (rRNA) gene and produced a specific PCR product. The results confirm the multicopy nature of the rRNA region in several filamentous fungi and show that we can quantify fungi of unknown genome size over a range of spore extractions by inclusion of these two standard controls. Advances in qPCR have led to extremely sensitive and quantitative methods for single-copy genes; however, it has not been well established that the rRNA can be used to quantitate fungal contamination. We report on the use of qPCR, combined with two controls, to identify and quantify indoor fungal contaminants with a greater degree of confidence than has been achieved previously. Advances in indoor environmental health have demonstrated that contamination of the built environment by the filamentous fungi has adverse impacts on the health of building occupants. This study meets the need for more accurate and reliable methods for fungal identification and quantitation in the indoor environment. PMID:23543828

  12. Development and evaluation of immunochromatography to detect Gram-negative bacteria producing ArmA 16S rRNA methylase responsible for aminoglycoside resistance.

    PubMed

    Oshiro, Satoshi; Tada, Tatsuya; Kameoka, Yousuke; Suzuki, Kazuo; Ohmagari, Norio; Miyoshi-Akiyama, Tohru; Kirikae, Teruo

    2015-11-01

    Rapid and reliable detection of aminoglycoside-resistant bacteria is an important infection-control measure and a crucial aspect of antimicrobial chemotherapy. The enzyme 16S rRNA methylase has been shown to mediate aminoglycoside resistance in bacteria. This study describes a newly developed immunochromatographic assay using novel monoclonal antibodies (mAbs) that recognize ArmA 16S rRNA methylase. Epitope mapping showed that these mAbs recognized amino acids 1-93 of ArmA, which consists of 257 amino acids. Evaluation of the assay using ArmA producing and non-producing bacterial species, as well as bacteria producing other types of 16S rRNA methylases, indicated that immunochromatographic detection of the ArmA-type 16S rRNA methylase was fully consistent with PCR analysis for armA genes, with all immunochromatographically positive strains being resistant to aminoglycosides (MIC≥128μg/mL). The detection limit of the assay was 12ng ArmA. These findings indicate that this assay can be used for the rapid and reliable detection of the production of ArmA 16S rRNA methylase by Gram-negative bacteria, including Acinetobacter baumannii and Escherichia coli. PMID:26381663

  13. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    PubMed

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  14. A new species of trypanosome, Trypanosoma desterrensis sp. n., isolated from South American bats.

    PubMed

    Grisard, E C; Sturm, N R; Campbell, D A

    2003-09-01

    Trypanosomes isolated from South American bats include the human pathogen Trypanosoma cruzi. Other Trypanosoma spp. that have been found exclusively in bats are not well characterized at the DNA sequence level and we have therefore used the SL RNA gene to differentiate and characterize kinetoplastids isolated from bats in South America. A Trypanosoma sp. isolated from hats in southern Brazil was compared with the geographically diverse isolates T. cruzi marinkellei, T. vespertilionis, and T. dionisii. Analysis of the SL RNA gene repeats revealed size and sequence variability among these bat trypanosomes. We have developed hybridization probes to separate these bat isolates and have analysed the DNA sequence data to estimate their relatedness. A new species, Trypanosoma desterrensis sp. n., is proposed, for which a 5S rRNA gene was also found within the SL RNA repeat. PMID:12964829

  15. Interactions of aminoglycoside antibiotics with rRNA.

    PubMed

    Trylska, Joanna; Kulik, Marta

    2016-08-15

    Aminoglycoside antibiotics are protein synthesis inhibitors applied to treat infections caused mainly by aerobic Gram-negative bacteria. Due to their adverse side effects they are last resort antibiotics typically used to combat pathogens resistant to other drugs. Aminoglycosides target ribosomes. We describe the interactions of aminoglycoside antibiotics containing a 2-deoxystreptamine (2-DOS) ring with 16S rRNA. We review the computational studies, with a focus on molecular dynamics (MD) simulations performed on RNA models mimicking the 2-DOS aminoglycoside binding site in the small ribosomal subunit. We also briefly discuss thermodynamics of interactions of these aminoglycosides with their 16S RNA target. PMID:27528743

  16. Molecular Method for Bartonella Species Identification in Clinical and Environmental Samples▿

    PubMed Central

    García-Esteban, Coral; Gil, Horacio; Rodríguez-Vargas, Manuela; Gerrikagoitia, Xeider; Barandika, Jesse; Escudero, Raquel; Jado, Isabel; García-Amil, Cristina; Barral, Marta; García-Pérez, Ana L.; Bhide, Mangesh; Anda, Pedro

    2008-01-01

    A new, efficient molecular method for detection of Bartonella, based on the 16S-23S rRNA intergenic spacer and 16S rRNA amplification by multiplex PCR combined with reverse line blotting, was designed. This assay could simultaneously detect 20 different known species and other Bartonella species not described previously. PMID:18094134

  17. Growth rate regulation of rRNA content of a marine Synechococcus (cyanobacterium) strain

    SciTech Connect

    Binder, B.J.; Liu, Y.C.

    1998-09-01

    The relationship between growth rate and rRNA content in a marine Synechococcus strain was examined. A combination of flow cytometry and whole-cell hybridization with fluorescently labeled 16S rRNA-targeted oligonucleotide probes was used to measure the rRNA content of Synechococcus strain WH8101 cells grown at a range of light-limited growth rates. The sensitivity of this approach was sufficient for the analysis of rRNA even in very slowly growing Synechococcus cells. The relationship between growth rate and cellular rRNA content comprised three phases: (1) at low growth rates, rRNA cell{sup {minus}1} remained approximately constant; (2) at intermediate rates, rRNA cell{sup {minus}1} increased proportionally with growth rate; and (3) at the highest, light-saturated rates, rRNA cell{sup {minus}1} dropped abruptly. Total cellular RNA was well correlated with the probe-based measure of rRNA and varied in a similar manner with growth rate. Mean cell volume and rRNA concentration were related to growth rate in a manner similar to rRNA cell{sup {minus}1}, although the overall magnitude linear increase in ribosome efficiency with increasing growth rate, which is consistent with the prevailing prokaryotic model at low growth rates. Taken together, these results support the notion that measurements of cellular rRNA content might be useful for estimating in situ growth rates in natural Synechococcus populations.

  18. Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

    PubMed Central

    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2011-01-01

    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

  19. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    PubMed

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  20. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  1. Natural-abundance stable carbon isotopes of small-subunit ribosomal RNA (SSU rRNA) from Guaymas Basin (Mexico)

    NASA Astrophysics Data System (ADS)

    MacGregor, B. J.; Mendlovitz, H.; Albert, D.; Teske, A. P.

    2012-12-01

    Small-subunit ribosomal RNA (SSU rRNA) is a phylogenetically informative molecule found in all species. Because it is poorly preserved in most environments, it is a useful marker for active microbial populations. We are using the natural-abundance stable carbon isotopic composition of specific microbial groups to help identify the carbon substrates contributing to microbial biomass in a variety of marine environments. At Guaymas Basin, hydrothermal fluids interact with abundant sedimentary organic carbon to produce natural gas and petroleum. Where this reaches the sediment surface, it can support dense patches of seafloor life, including Beggiatoa mats. We report here on the stable carbon isotopic composition of SSU rRNA from a Beggiatoa mat transect, a cold background site, a warm site with high oil concentration, and a second Beggiatoa mat. The central part of the transect mat overlay the steepest temperature gradient, and was visually dominated by orange Beggiatoa. This was fringed by white Beggiatoa mat and bare, but still warm, sediment. Methane concentrations were saturating beneath the orange and white mats and at the oily site, lower beneath bare sediment, and below detection at the background site. Our initial hypotheses were that rRNA isotopic composition would be strongly influenced by methane supply, and that archaeal rRNA might be lighter than bacterial due to contributions from methanogens and anaerobic methane oxidizers. We used biotin-labeled oligonucleotides to capture Bacterial and Archaeal SSU rRNA for isotopic determination. Background-site rRNA was isotopically heaviest, and bacterial RNA from below 2 cm at the oily site was lightest, consistent with control by methane. Within the transect mat, however, the pattern was more complicated; at some sediment depths, rRNA from the mat periphery was isotopically lightest. Part of this may be due to the spatially and temporally variable paths followed by hydrothermal fluid, which can include horizontal

  2. A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

    PubMed

    Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W

    2000-12-01

    Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants. PMID:11249027

  3. Chromosomal Organization of Rrna Operons in Bacillus Subtilis

    PubMed Central

    Jarvis, E. D.; Widom, R. L.; LaFauci, G.; Setoguchi, Y.; Richter, I. R.; Rudner, R.

    1988-01-01

    Integrative mapping with vectors containing ribosomal DNA sequences were used to complete the mapping of the 10 rRNA gene sets in the endospore forming bacterium Bacillus subtilis. Southern hybridizations allowed the assignment of nine operons to distinct BclI restriction fragments and their genetic locus identified by transductional crosses. Nine of the ten rRNA gene sets are located between 0 and 70° on the genomic map. In the region surrounding cysA14, two sets of closely spaced tandem clusters are present. The first (rrnJ and rrnW) is located between purA16 and cysA14 closely linked to the latter; the second (rrnI, rrnH and rrnG) previously mapped within this area is located between attSPO2 and glpT6. The operons at or near the origin of replication (rrnO,rrnA and rrnJ,rrnW) represent ``hot spots'' of plasmid insertion. PMID:2465199

  4. Evolution of compensatory substitutions through G.U intermediate state in Drosophila rRNA.

    PubMed Central

    Rousset, F; Pélandakis, M; Solignac, M

    1991-01-01

    It has often been suggested that the frequently observed Watson-Crick base-pair compensatory substitutions in RNA helical structures occur mainly through a slightly deleterious G.U intermediate state. We have scored base substitutions in a set of 82 related Drosophila species for the D1 and D2 variable domains of the large rRNA subunit. In all locations where a G-C in equilibrium with A-U compensatory base change occurred, a G.U pair has been observed in one or several species. As this dominant process implies two transitions, their rate was far higher in paired regions (92%) than in unpaired regions (47%). The other types of compensation were rarer and no intermediate states were observed. Most of the G.U base pairs observed in a species are not slightly deleterious. The rate of evolution of compensatory substitution is close to that predicted by a simple model of compensatory substitution through slightly deleterious or slightly advantageous G.U pairs, although some exceptions are presented. PMID:1946420

  5. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  6. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  7. A search for the Bs meson in Υ(5S) decays

    NASA Astrophysics Data System (ADS)

    Shipsey, Ian

    2004-05-01

    The CLEO III detector has recorded approximately 0.5 fb-1 of e^+ e^- annihilation data at the Υ(5S) resonance. Using this data sample, we have searched for fully reconstructed Bs mesons in the reaction Υ(5S) arrow B_s^(*) barB_s^(*)

  8. The 5S lean method as a tool of industrial management performances

    NASA Astrophysics Data System (ADS)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  9. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  10. Application of rRNA probes and fluorescence in situ hybridization for rapid detection of the toxic dinoflagellate Alexandrium minutum

    NASA Astrophysics Data System (ADS)

    Tang, Xianghai; Yu, Rencheng; Zhou, Mingjiang; Yu, Zhigang

    2012-03-01

    The dinoflagellate Alexandrium minutum is often associated with harmful algal blooms (HABs). This species consists of many strains that differ in their ability to produce toxins but have similar morphology, making identification difficult. In this study, species-specific rRNA probes were designed for whole-cell fluorescence in situ hybridization (FISH) to distinguish A. minutum from two phylogenetic clades. We acquired the complete SSU to LSU rDNA sequences (GenBank accession numbers JF906989-JF906999) of 11 Alexandrium strains and used these to design rRNA targeted oligonucleotide probes. Three ribotype-specific probes, M-GC-1, M-PC-2, and M-PC-3, were designed. The former is specific for the GC clade ("Global clade") of A. minutum, the majority of which have been found non-toxic, and the latter two are specific for the PSP (paralytic shellfish poisoning)-producing PC clade ("Pacific clade"). The specificity of these three probes was confirmed by FISH. All cells in observed fields of view were fluorescently labeled when probes and target species were incubated under optimized FISH conditions. However, the accessibility of rRNA molecules in ribosomes varied among the probe binding positions. Thus, there was variation in the distribution of positive signals in labeled cells within nucleolus and cytosol (M-GC-1, M-PC-3), or just nucleolus (M-PC-2). Our results provide a methodological basis for studying the biogeography and population dynamics of A. minutum, and providing an early warning of toxic HABs.

  11. New Primers Targeting Full-Length Ciliate 18S rRNA Genes and Evaluation of Dietary Effect on Rumen Ciliate Diversity in Dairy Cows.

    PubMed

    Zhang, Jun; Zhao, Shengguo; Zhang, Yangdong; Sun, Peng; Bu, Dengpan; Wang, Jiaqi

    2015-12-01

    Analysis of the full-length 18S rRNA gene sequences of rumen ciliates is more reliable for taxonomical classification and diversity assessment than the analysis of partial hypervariable regions only. The objective of this study was to develop new oligonucleotide primers targeting the full-length 18S rRNA genes of rumen ciliates, and to evaluate the effect of different sources of dietary fiber (corn stover or a mixture of alfalfa hay and corn silage) and protein (mixed rapeseed, cottonseed, and/or soybean meals) on rumen ciliate diversity in dairy cows. Primers were designed based on a total of 137 previously reported ciliate 18S rRNA gene sequences. The 3'-terminal sequences of the newly designed primers, P.1747r_2, P.324f, and P.1651r, demonstrated >99% base coverage. Primer pair D (P.324f and P.1747r_2) was selected for the cloning and sequencing of ciliate 18S rRNA genes because it produced a 1423-bp amplicon, and did not amply the sequences of other eukaryotic species, such as yeast. The optimal species-level cutoff value for distinguishing between the operational taxonomic units of different ciliate species was 0.015. The phylogenetic analysis of full-length ciliate 18S rRNA gene sequences showed that distinct ciliate profiles were induced by the different sources of dietary fiber and protein. Dasytricha and Entodinium were the predominant genera in the ruminal fluid of dairy cattle, and Dasytricha was significantly more abundant in cows fed with corn stover than in cows fed with alfalfa hay and corn silage. PMID:26319789

  12. Characterization of Mycobacterium leprae Genotypes in China—Identification of a New Polymorphism C251T in the 16S rRNA Gene

    PubMed Central

    You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying

    2015-01-01

    Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China. PMID:26196543

  13. Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene.

    PubMed

    Yuan, Youhua; Wen, Yan; You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying

    2015-01-01

    Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China. PMID:26196543

  14. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.

    PubMed

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S

    2015-01-01

    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  15. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling

    PubMed Central

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.

    2015-01-01

    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  16. Molecular identification of Trichinella spiralis and Trichinella britovi by diagnostic multiprimer large mitochondrial rRNA amplification.

    PubMed

    Borsuk, P; Moskwa, B; Pastusiak, K; Cabaj, W

    2003-11-01

    Trichinella parasites with different epidemiological features still occur in Europe and four species of genus Trichinella have been identified: T. spiralis, T. britovi, T. nativa and T. pseudospiralis. Until now, two of them, T. spiralis and T. britovi, have been identified in Poland. In our studies we selected sequence coding for large mitochondrial rRNA (mt LrDNA) as a genetic marker and developed a sensitive LrDNA multiprimer PCR assay allowing for rapid identification of T. spiralis and T. britovi, parasites present in wild and domestic animals in Poland. PMID:14505042

  17. Genetic Diversity and Phylogeny of Rhizobia That Nodulate Acacia spp. in Morocco Assessed by Analysis of rRNA Genes

    PubMed Central

    Khbaya, Bouchaib; Neyra, Marc; Normand, Philippe; Zerhari, Karim; Filali-Maltouf, Abdelkarim

    1998-01-01

    Forty rhizobia nodulating four Acacia species (A. gummifera, A. raddiana, A. cyanophylla, and A. horrida) were isolated from different sites in Morocco. These rhizobia were compared by analyzing both the 16S rRNA gene (rDNA) and the 16S-23S rRNA spacer by PCR with restriction fragment length polymorphism (RFLP) analysis. Analysis of the length of 16S-23S spacer showed a considerable diversity within these microsymbionts, but RFLP analysis of the amplified spacer revealed no additional heterogeneity. Three clusters were identified when 16S rDNA analysis was carried out. Two of these clusters include some isolates which nodulate, nonspecifically, the four Acacia species. These clusters, A and B, fit within the Sinorhizobium lineage and are closely related to S. meliloti and S. fredii, respectively. The third cluster appeared to belong to the Agrobacterium-Rhizobium galegae phylum and is more closely related to the Agrobacterium tumefaciens species. These relations were confirmed by sequencing a representative strain from each cluster. PMID:9835582

  18. 16S rRNA PCR-Denaturing Gradient Gel Electrophoresis of Oral Lactobacillus casei Group and Their Phenotypic Appearances

    PubMed Central

    Piwat, S.; Teanpaisan, R.

    2013-01-01

    This study aimed to develop a 16S rRNA PCR-denaturing gradient gel electrophoresis (DGGE) to identify the species level of Lactobacillus casei group and to investigate their characteristics of acid production and inhibitory effect. PCR-DGGE has been developed based on the 16S rRNA gene, and a set of HDA-1-GC and HDA-2, designed at V2-V3 region, and another set of CARP-1-GC and CARP-2, designed at V1 region, have been used. The bacterial strains included L. casei ATCC 393, L. paracasei CCUG 32212, L. rhamnosus ATCC 7469, L. zeae CCUG 35515, and 46 clinical strains of L. casei/paracasei/rhamnosus. Inhibitory effect against Streptococcus mutans and acid production were examined. Results revealed that each type species strain and identified clinical isolate showed its own unique DGGE pattern using CARP1-GC and CARP2 primers. HDA1-GC and HDA2 primers could distinguish the strains of L. paracasei from L. casei. It was found that inhibitory effect of L. paracasei was stronger than L. casei and L. rhamnosus. The acid production of L. paracasei was lower than L. casei and L. rhamnosus. In conclusion, the technique has been proven to be able to differentiate between closely related species in L. casei group and thus provide reliable information of their phenotypic appearances. PMID:24191230

  19. Comparative sequence analyses of the genes coding for 16S rRNA of Lactobacillus casei-related taxa.

    PubMed

    Mori, K; Yamazaki, K; Ishiyama, T; Katsumata, M; Kobayashi, K; Kawai, Y; Inoue, N; Shinano, H

    1997-01-01

    The primary structures of the 16S rRNA genes of the type strains of Lactobacillus casei and related taxa were determined by PCR DNA-sequencing methods. The sequences of Lactobacillus casei, Lactobacillus zeae, Lactobacillus paracasei, and Lactobacillus rhamnosus were different. The Knuc values ranged from 0.0040 to 0.0126. On the basis of the Knuc values and the levels of DNA-DNA relatedness among the strains of these species, the L. casei-related taxa should be classified in the following three species: L. zeae, which includes the type strains of L. zeae and L. casei; a species that includes the strains of L. paracasei and L. casei ATCC 334; and L. rhamnosus. PMID:8995801

  20. Identification of the Microbiota in Carious Dentin Lesions Using 16S rRNA Gene Sequencing

    PubMed Central

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4–76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  1. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    PubMed

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  2. Analysis of the primary sequence and secondary structure of the unusually long SSU rRNA of the soil bug, Armadillidium vulgare.

    PubMed

    Choe, C P; Hancock, J M; Hwang, U W; Kim, W

    1999-12-01

    The complete nucleotide sequence of the SSU rRNA gene from the soil bug, Armadillidium vulgare (Crustacea, Isopoda), was determined. It is 3214 bp long, with a GC content of 56.3%. It is not only the longest SSU rRNA gene among Crustacea but also longer than any other SSU rRNA gene except that of the strepsipteran insect, Xenos vesparum (3316 bp). The unusually long sequence of this species is explained by the long sequences of variable regions V4 and V7, which make up more than half of the total length. RT-PCR analysis of these two regions showed that the long sequences also exist in the mature rRNA and sequence simplicity analysis revealed the presence of slippage motifs in these two regions. The putative secondary structure of the rRNA is typical for eukaryotes except for the length and shape variations of the V2, V4, V7, and V9 regions. Each of the V2, V4, and V7 regions was elongated, while the V9 region was shortened. In V2, two bulges, located between helix 8 and helix 9 and between helix 9 and helix 10, were elongated. In V4, stem E23-3 was dramatically expanded, with several small branched stems. In V7, stem 43 was branched and expanded. Comparisons with the unusually long SSU rRNAs of other organisms imply that the increase in total length of SSU rRNA is due mainly to expansion in the V4 and V7 regions. PMID:10594181

  3. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio

    2008-01-04

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  4. Mouse nucleolin binds to 4.5S RNAh, a small noncoding RNA.

    PubMed

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAh is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAh is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAh-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAhin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAh-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAh recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAh was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus. PMID:17971306

  5. Exchange of Spacer Regions between Rrna Operons in Escherichia Coli

    PubMed Central

    Harvey, S.; Hill, C. W.

    1990-01-01

    The Escherichia coli rRNA operons each have one of two types of spacer separating the 16S and 23S coding regions. The spacers of four operons encode tRNA(Glu2) and the other three encode both tRNA(Ile) and tRNA(Ala 1 B). We have prepared a series of mutants in which the spacer region of a particular rrn operon has been replaced by the opposite type. Included among these were a mutant retaining only a single copy of the tRNA(Glu2) spacer (at rrnG) and another retaining only a single copy of the tRNA(Ile)-tRNA(Ala 1 B) spacer (at rrnA). While both mutants grew more slowly than controls, the mutant deficient in tRNA(Glu2) spacers was more severely affected. At a frequency of 6 X 10(-5), these mutants phenotypically reverted to faster growing types by increasing the copy number of the deficient spacer. In most of these phenotypic revertants, the deficient spacer type appeared in a rrn operon which previously contained the surplus type, bringing the ratio of spacer types closer to normal. In a few cases, these spacer changes were accompanied by an inversion of the chromosomal material between the donor and recipient rrn operons. Two examples of inversion of one-half of the E. coli chromosome between rrnG and rrnH were observed. The correlation of spacer change with inversion indicated that, in these particular cases, the change was due to an intrachromatid gene conversion event accompanied by a reciprocal crossover rather than reciprocal exchange between sister chromatids. PMID:2168847

  6. Radiative lifetime of the 3s3p exp 3(exp 5 S sub 2 exp 0) metastable level of P(+)

    NASA Technical Reports Server (NTRS)

    Calamai, Anthony G.; Han, Xiaofeng; Parkinson, William H.

    1992-01-01

    The present experimental and theoretical results for the radiative lifetime of the 3s3p exp 3(exp 5 S sub 2 exp 0) metastable level of P(+) encompass an experimental determination of the (exp 5 S sub 2 exp 0) lifetime which represents the first measured lifetime of a low charge-state ion in the Si I sequence. This constitutes a fundamental test of the theoretical methods used to determine transition possibilities for intercombination lines involving this level, and suggests that theoretical techniques used to determine such transition probabilities in low-Z species of the Si I isoelectronic sequence should be reevaluated.

  7. Structural polymorphism in the major groove of a 5S RNA gene complements the zinc finger domains of transcription factor IIIA.

    PubMed Central

    Huber, P W; Morii, T; Mei, H Y; Barton, J K

    1991-01-01

    Metal complexes that bind to DNA on the basis of shape-selection have been used to map the conformational features of the DNA binding site for transcription factor IIIA. Conformationally distinct segments are detected on the 5S rRNA gene that correspond closely to the binding sites identified for the individual zinc finger domains of the protein. The local conformations are characterized by a major groove opened because of a change in base pair inclination and/or displacement at a central 5'-pyrimidine-purine-3' step, flanked by a widened minor groove, as would arise at the junctions between alternating B- and A-like DNA segments. Docking experiments with a consensus structure of a zinc finger reveal that the mixed A-B binding site accommodates the peptide domain better than either canonical B- or A-DNA helices. The close structural matching of the conformational variations in the 5S rDNA both to the proposed sites of zinc finger binding and to the shape of an individual zinc finger domain points to DNA structural polymorphism as providing an important determinant in recognition. In particular, shape selection in the 5' half of the internal control region may orient the multiple finger domains. Images PMID:1961749

  8. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens

    DOE PAGESBeta

    Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; MacKichan, Joanna; Kato-Maeda, Midori; Miller, Steve; Nadarajan, Rohan; Brodie, Eoin L.; Lynch, Susan V.; Heimesaat, Markus M.

    2015-02-06

    According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n =more » 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci.« less

  9. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens

    SciTech Connect

    Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; MacKichan, Joanna; Kato-Maeda, Midori; Miller, Steve; Nadarajan, Rohan; Brodie, Eoin L.; Lynch, Susan V.; Heimesaat, Markus M.

    2015-02-06

    According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n = 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci.

  10. Restriction fragment length polymorphism of the 5S-rRNA-NTS region: a rapid and precise method for plant identification.

    PubMed

    Bertea, Cinzia Margherita; Gnavi, Giorgio

    2012-01-01

    Molecular genetic methods have several advantages over classical morphological and chemical analyses. The genetic method requires genotype instead than phenotype, therefore PCR-based techniques have been widely used for a rapid identification of plant species, varieties and chemotypes. Recently, the molecular discrimination of some higher plant species has been evaluated using sequences of a 5S-rRNA gene spacer region. The variation in the nontranscribed sequence (NTS) region has been used in a number of plant species for studying intraspecific variation, genome evolution, and phylogenetic reconstruction. Here, we describe a rapid method based on the use of the 5S-rRNA-NTS region as a tool for plant DNA fingerprinting, which combines PCR, sequencing and restriction fragment length polymorphism analyses. PMID:22419491

  11. Bacterial communities in the phylloplane of Prunus species.

    PubMed

    Jo, Yeonhwa; Cho, Jin Kyong; Choi, Hoseong; Chu, Hyosub; Lian, Sen; Cho, Won Kyong

    2015-04-01

    Bacterial populations in the phylloplane of four different Prunus species were investigated by 16 S rRNA pyrosequencing. Bioinformatic analysis identified an average of 510 operational taxonomic units belonging to 159 genera in 76 families. The two genera, Sphingomonas and Methylobacterium, were dominant in the phylloplane of four Prunus species. Twenty three genera were commonly identified in the four Prunus species, indicating a high level of bacterial diversity dependent on the plant species. Our study based on 16 S rRNA sequencing reveals the complexity of bacterial diversity in the phylloplane of Prunus species in detail. PMID:25515303

  12. Molecular identification of adulteration in mutton based on mitochondrial 16S rRNA gene.

    PubMed

    Xu, Jia; Zhao, Wei; Zhu, Mengru; Wen, Yuanju; Xie, Tao; He, Xiaoqian; Zhang, Yongfeng; Cao, Suizhong; Niu, Lili; Zhang, Hongping; Zhong, Tao

    2016-01-01

    The aim of this study is to set up a protocol for identification of the adulteration in mutton based on mitochondrial 16S rRNA gene. The multiplex polymerase chain reaction (multi-PCR) assay was carried out to trace the impure DNA in mutton. A universal primer pair yielded an approximate 610 bp fragment in mutton, pork, duck, chicken, horse and cat meats. The amplicons of multi-PCR assay represented the species-specific products, which could be discriminated by the size ranging from 106 bp to 532 bp. Subsequently, the authentication of each fragment was also confirmed by sequencing. Random analyses of adulterants with various meats yielded the identical results to their components, showing the suitability of the multi-PCR assay for tracing of adulterant meats with high-accuracy and precision. This assay was sensitive to detect the species-specific DNA in different proportional mixtures of mutton and duck/pork (9.1%-90.9%). In conclusion, this multi-PCR assay successfully discriminated the double-, triple-, quadruple-, and quintuple-mixtures containing variant counterparts. This method will be particularly useful in the detection of mutton adulteration in processed foods further. PMID:24739005

  13. 104. JOB NO. 1347F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    104. JOB NO. 1347-F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD MOTOR COMPANY; LONGITUDINAL SECTION AND TRUSS DETAILS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  14. Loop-mediated isothermal amplification assay for 16S rRNA methylase genes in Gram-negative bacteria.

    PubMed

    Nagasawa, Mitsuaki; Kaku, Mitsuo; Kamachi, Kazunari; Shibayama, Keigo; Arakawa, Yoshichika; Yamaguchi, Keizo; Ishii, Yoshikazu

    2014-10-01

    Using the loop-mediated isothermal amplification (LAMP) method, we developed a rapid assay for detection of 16S rRNA methylase genes (rmtA, rmtB, and armA), and investigated 16S rRNA methylase-producing strains among clinical isolates. Primer Explorer V3 software was used to design the LAMP primers. LAMP primers were prepared for each gene, including two outer primers (F3 and B3), two inner primers (FIP and BIP), and two loop primers (LF and LB). Detection was performed with the Loopamp DNA amplification kit. For all three genes (rmtA, rmtB, and armA), 10(2) copies/tube could be detected with a reaction time of 60 min. When nine bacterial species (65 strains saved in National Institute of Infectious Diseases) were tested, which had been confirmed to possess rmtA, rmtB, or armA by PCR and DNA sequencing, the genes were detected correctly in these bacteria with no false negative or false positive results. Among 8447 clinical isolates isolated at 36 medical institutions, the LAMP method was conducted for 191 strains that were resistant to aminoglycosides based on the results of antimicrobial susceptibility tests. Eight strains were found to produce 16S rRNA methylase (0.09%), with rmtB being identified in three strains (0.06%) of 4929 isolates of Enterobacteriaceae, rmtA in three strains (0.10%) of 3284 isolates of Pseudomonas aeruginosa, and armA in two strains (0.85%) of 234 isolates of Acinetobacter spp. At present, the incidence of strains possessing 16S rRNA methylase genes is very low in Japan. However, when Gram-negative bacteria showing high resistance to aminoglycosides are isolated by clinical laboratories, it seems very important to investigate the status of 16S rRNA methylase gene-harboring bacilli and monitor their trends among Japanese clinical settings. PMID:25179393

  15. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  16. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  17. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  18. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    PubMed Central

    Suslu, Hikmet Turan; Celikoglu, Erhan; Borekcı, Ali; Hıcdonmez, Tufan; Suslu, Hüsnü

    2011-01-01

    Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches. PMID:23125496

  19. The mitochondrial 16 s rRNA reveals high anthropogenic influence on land snail diversity in a preliminary island survey.

    PubMed

    Abu-Bakar, Siti-Balkhis; Razali, Norhanis M; Naggs, Fred; Wade, Christopher; Mohd-Nor, Siti-Azizah; Aileen-Tan, Shau-Hwai

    2014-03-01

    A total of 30 specimens belonging to five species, namely; Cryptozona siamensis, Sarika resplendens and Sarika sp. from the family Ariophantidae as well as Quantula striata and Quantula sp. from the family Dyakiidae were collected from the Langkawi Island in Northern Peninsular Malaysia. All specimens were identified through comparisons of shell morphology and amplification of a 500 bp segment of the 16S rRNA mtDNA gene. To assess phylogenetic insights, the sequences were aligned using ClustalW and phylogenetic trees were constructed. The analyses showed two major lineages in both Maximum Parsimony and Neighbour Joining phylogenetic trees. Each putative taxonomic group formed a monophyletic cluster. Our study revealed low species and intraspecies genetic diversities based on the 16S rRNA gene sequences. Thus, this study has provided an insight of land snail diversity in populations of an island highly influenced by anthropogenic activities through complementary use of shell morphological and molecular data. PMID:24443224

  20. Detection and Identification of Gastrointestinal Lactobacillus Species by Using Denaturing Gradient Gel Electrophoresis and Species-Specific PCR Primers

    PubMed Central

    Walter, J.; Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Loach, D. M.; Munro, K.; Alatossava, T.

    2000-01-01

    Denaturing gradient gel electrophoresis (DGGE) of DNA fragments obtained by PCR amplification of the V2-V3 region of the 16S rRNA gene was used to detect the presence of Lactobacillus species in the stomach contents of mice. Lactobacillus isolates cultured from human and porcine gastrointestinal samples were identified to the species level by using a combination of DGGE and species-specific PCR primers that targeted 16S-23S rRNA intergenic spacer region or 16S rRNA gene sequences. The identifications obtained by this approach were confirmed by sequencing the V2-V3 region of the 16S rRNA gene and by a BLAST search of the GenBank database. PMID:10618239

  1. Secondary structure of mouse 28S rRNA and general model for the folding of the large rRNA in eukaryotes.

    PubMed Central

    Michot, B; Hassouna, N; Bachellerie, J P

    1984-01-01

    We present a secondary structure model for the entire sequence of mouse 28S rRNA (1) which is based on an extensive comparative analysis of the available eukaryotic sequences, i.e. yeast (2, 3), Physarum polycephalum (4), Xenopus laevis (5) and rat (6). It has been derived with close reference to the models previously proposed for yeast 26S rRNA (2) and for prokaryotic 23S rRNA (7-9). Examination of the recently published eukaryotic sequences confirms that all pro- and eukaryotic large rRNAs share a largely conserved secondary structure core, as already apparent from the previous analysis of yeast 26S rRNA (2). These new comparative data confirm most features of the yeast model (2). They also provide the basis for a few modifications and for new proposals which extend the boundaries of the common structural core (now representing about 85% of E. coli 23S rRNA length) and bring new insights for tracing the structural evolution, in higher eukaryotes, of the domains which have no prokaryotic equivalent and are inserted at specific locations within the common structural core of the large subunit rRNA. PMID:6374617

  2. Mechanisms underlying the evolution and maintenance of functionally heterogeneous 18S rRNA genes in Apicomplexans.

    PubMed

    Rooney, Alejandro P

    2004-09-01

    In many species of the protist phylum Apicomplexa, ribosomal RNA (rRNA) gene copies are structurally and functionally heterogeneous, owing to distinct requirements for rRNA-expression patterns at different developmental stages. The genomic mechanisms underlying the maintenance of this system over long-term evolutionary history are unclear. Therefore, the aim of this study was to investigate what processes underlie the long-term evolution of apicomplexan 18S genes in representative species. The results show that these genes evolve according to a birth-and-death model under strong purifying selection, thereby explaining how divergent 18S genes are generated over time while continuing to maintain their ability to produce fully functional rRNAs. In addition, it was found that Cryptosporidium parvum undergoes a rapid form of birth-and-death evolution that may facilitate host-specific adaptation, including that of type I and II strains found in humans. This represents the first case in which an rRNA gene family has been found to evolve under the birth-and-death model. PMID:15175411

  3. Identification of Bacillus Probiotics Isolated from Soil Rhizosphere Using 16S rRNA, recA, rpoB Gene Sequencing and RAPD-PCR.

    PubMed

    Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes

    2016-03-01

    Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products. PMID:26898909

  4. Quantification of Hyphomicrobium Populations in Activated Sludge from an Industrial Wastewater Treatment System as Determined by 16S rRNA Analysis

    PubMed Central

    Layton, A. C.; Karanth, P. N.; Lajoie, C. A.; Meyers, A. J.; Gregory, I. R.; Stapleton, R. D.; Taylor, D. E.; Sayler, G. S.

    2000-01-01

    The bacterial community structure of the activated sludge from a 25 million-gal-per-day industrial wastewater treatment plant was investigated using rRNA analysis. 16S ribosomal DNA (rDNA) libraries were created from three sludge samples taken on different dates. Partial rRNA gene sequences were obtained for 46 rDNA clones, and nearly complete 16S rRNA sequences were obtained for 18 clones. Seventeen of these clones were members of the beta subdivision, and their sequences showed high homology to sequences of known bacterial species as well as published 16S rDNA sequences from other activated sludge sources. Sixteen clones belonged to the alpha subdivision, 7 of which showed similarity to Hyphomicrobium species. This cluster was chosen for further studies due to earlier work on Hyphomicrobium sp. strain M3 isolated from this treatment plant. A nearly full-length 16S rDNA sequence was obtained from Hyphomicrobium sp. strain M3. Phylogenetic analysis revealed that Hyphomicrobium sp. strain M3 was 99% similar to Hyphomicrobium denitrificans DSM 1869T in Hyphomicrobium cluster II. Three of the cloned sequences from the activated sludge samples also grouped with those of Hyphomicrobium cluster II, with a 96% sequence similarity to that of Hyphomicrobium sp. strain M3. The other four cloned sequences from the activated sludge sample were more closely related to those of the Hyphomicrobium cluster I organisms (95 to 97% similarity). Whole-cell fluorescence hybridization of microorganisms in the activated sludge with genus-specific Hyphomicrobium probe S-G-Hypho-1241-a-A-19 enhanced the visualization of Hyphomicrobium and revealed that Hyphomicrobium appears to be abundant both on the outside of flocs and within the floc structure. Dot blot hybridization of activated sludge samples from 1995 with probes designed for Hyphomicrobium cluster I and Hyphomicrobium cluster II indicated that Hyphomicrobium cluster II-positive 16S rRNA dominated over Hyphomicrobium cluster I

  5. Sulfur-oxidizing bacterial endosymbionts: analysis of phylogeny and specificity by 16S rRNA sequences. [Calyptogena magnifica; Bathymodiolus thermophilus; Lucinoma annulata; Lucinoma aequizonata; Codakia orbicularis

    SciTech Connect

    Distel, D.L.; Lane, D.J.; Olsen, G.J.; Giovannoni, S.J.; Pace, B.; Pace, N.R.; Stahl, D.A.; Felbeck, H.

    1988-06-01

    The 16S rRNAs from the bacterial endosymbionts of six marine invertebrates from diverse environments were isolated and partially sequenced. These symbionts included the trophosome symbiont of Riftia pachyptila, the gill symbionts of Calyptogena magnifica and Bathymodiolus thermophilus (from deep-sea hydrothermal vents), and the gill symbionts of Lucinoma annulata, Lucinoma aequizonata, and Codakia orbicularis (from relatively shallow coastal environments). Only one type of bacterial 16S rRNA was detected in each symbiosis. Using nucleotide sequence comparisons, we showed that each of the bacterial symbionts is distinct from the others and that all fall within a limited domain of the gamma subdivision of the purple bacteria (one of the major eubacterial divisions previously defined by 16S rRNA analysis. Two host specimens were analyzed in five of the symbioses; in each case, identical bacterial rRNA sequences were obtained from conspecific host specimens. These data indicate that the symbioses examined are species specific and that the symbiont species are unique to and invariant within their respective host species.

  6. Evidence for 5S rDNA Horizontal Transfer in the toadfish Halobatrachus didactylus (Schneider, 1801) based on the analysis of three multigene families

    PubMed Central

    2012-01-01

    Background The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH). Results Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS) sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. Conclusions A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not in the Pleuronectiformes

  7. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  8. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  9. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  10. Subnuclear partitioning of rRNA genes between the nucleolus and nucleoplasm reflects alternative epiallelic states

    PubMed Central

    Pontvianne, Frederic; Blevins, Todd; Chandrasekhara, Chinmayi; Mozgová, Iva; Hassel, Christiane; Pontes, Olga M.F.; Tucker, Sarah; Mokroš, Petr; Muchová, Veronika; Fajkus, Jiří; Pikaard, Craig S.

    2013-01-01

    Eukaryotes can have thousands of 45S ribosomal RNA (rRNA) genes, many of which are silenced during development. Using fluorescence-activated sorting techniques, we show that active rRNA genes in Arabidopsis thaliana are present within sorted nucleoli, whereas silenced rRNA genes are excluded. DNA methyltransferase (met1), histone deacetylase (hda6), or chromatin assembly (caf1) mutants that disrupt silencing abrogate this nucleoplasmic–nucleolar partitioning. Bisulfite sequencing data indicate that active nucleolar rRNA genes are nearly completely demethylated at promoter CGs, whereas silenced genes are nearly fully methylated. Collectively, the data reveal that rRNA genes occupy distinct but changeable nuclear territories according to their epigenetic state. PMID:23873938

  11. Phylogenetic reconstruction of the wolf spiders (Araneae: Lycosidae) using sequences from the 12S rRNA, 28S rRNA, and NADH1 genes: implications for classification, biogeography, and the evolution of web building behavior.

    PubMed

    Murphy, Nicholas P; Framenau, Volker W; Donnellan, Stephen C; Harvey, Mark S; Park, Yung-Chul; Austin, Andrew D

    2006-03-01

    Current knowledge of the evolutionary relationships amongst the wolf spiders (Araneae: Lycosidae) is based on assessment of morphological similarity or phylogenetic analysis of a small number of taxa. In order to enhance the current understanding of lycosid relationships, phylogenies of 70 lycosid species were reconstructed by parsimony and Bayesian methods using three molecular markers; the mitochondrial genes 12S rRNA, NADH1, and the nuclear gene 28S rRNA. The resultant trees from the mitochondrial markers were used to assess the current taxonomic status of the Lycosidae and to assess the evolutionary history of sheet-web construction in the group. The results suggest that a number of genera are not monophyletic, including Lycosa, Arctosa, Alopecosa, and Artoria. At the subfamilial level, the status of Pardosinae needs to be re-assessed, and the position of a number of genera within their respective subfamilies is in doubt (e.g., Hippasa and Arctosa in Lycosinae and Xerolycosa, Aulonia and Hygrolycosa in Venoniinae). In addition, a major clade of strictly Australasian taxa may require the creation of a new subfamily. The analysis of sheet-web building in Lycosidae revealed that the interpretation of this trait as an ancestral state relies on two factors: (1) an asymmetrical model favoring the loss of sheet-webs and (2) that the suspended silken tube of Pirata is directly descended from sheet-web building. Paralogous copies of the nuclear 28S rRNA gene were sequenced, confounding the interpretation of the phylogenetic analysis and suggesting that a cautionary approach should be taken to the further use of this gene for lycosid phylogenetic analysis. PMID:16503280

  12. [Antimicrobial susceptibilities of clinical Nocardia isolates identified by 16S rRNA gene sequence analysis].

    PubMed

    Uner, Mahmut Celalettin; Hasçelik, Gülşen; Müştak, Hamit Kaan

    2016-01-01

    Nocardia species are ubiquitous in the environment and responsible for various human infections such as pulmonary, cutaneous, central nervous system and disseminated nocardiosis. Since the clinical pictures and antimicrobial susceptibilities of Nocardia species exhibit variability, susceptibility testing is recommended for every Nocardia isolates. The aims of this study was to determine the antimicrobial susceptibilities of Nocardia clinical isolates and to compare the results of broth microdilution and disc diffusion susceptibility tests. A total of 45 clinical Nocardia isolates (isolated from 17 respiratory tract, 8 brain abscess, 7 pus, 3 skin, 3 conjunctiva, 2 blood, 2 tissue, 2 pleural fluid and 1 cerebrospinal fluid samples) were identified by using conventional methods and 16S rRNA gene sequence analysis. Susceptibility testing was performed for amikacin, ciprofloxacin, ceftriaxone, linezolid and trimethoprim-sulfamethoxazole (TMP-SMX) by broth microdilution method according to the Clinical and Laboratory Standards Institute (CLSI) criteria recommended in 2011 approved standard (M24-A2) and disk diffusion method used as an alternative comparative susceptibility testing method. Among the 45 Nocardia strains, N.cyriacigeorgica (n: 26, 57.8%) was the most common species, followed by N.farcinica (n: 12, 26.7%), N.otitiscaviarum (n: 4, 8.9%), N.asteroides (n: 1, 2.2%), N.neocaledoniensis (n: 1, 2.2%) and N.abscessus (n: 1, 2.2%). Amikacin and linezolid were the only two antimicrobials to which all isolates were susceptible for both broth microdilution and disk diffusion tests. In broth microdilution test, resistance rates to TMP-SMX, ceftriaxone and ciprofloxacin were found as 15.6%, 37.8% and 84.4% respectively, whereas in the disk diffusion test, the highest resistance rate was observed against ciprofloxacin (n: 33, 73.3%), followed by TMP-SMX (n: 22, 48.9%) and ceftriaxone (n: 15, 33.3%). In both of these tests, N.cyriacigeorgica was the species with the

  13. Molecular Cytogenetics in Digenean Parasites: Linked and Unlinked Major and 5S rDNAs, B Chromosomes and Karyotype Diversification.

    PubMed

    García-Souto, Daniel; Pasantes, Juan J

    2015-01-01

    Digenetic trematodes are the largest group of internal metazoan parasites, but their chromosomes are poorly studied. Although chromosome numbers and/or karyotypes are known for about 300 of the 18,000 described species, molecular cytogenetic knowledge is mostly limited to the mapping of telomeric sequences and/or of major rDNA clusters in 9 species. In this work we mapped major and 5S rDNA clusters and telomeric sequences in chromosomes of Bucephalus minimus, B. australis, Prosorhynchoides carvajali (Bucephaloidea), Monascus filiformis (Gymnophalloidea), Parorchis acanthus (Echinostomatoidea), Cryptocotyle lingua (Opisthorchioidea), Cercaria longicaudata, Monorchis parvus (Monorchioidea), Diphterostomum brusinae, and Bacciger bacciger (Microphalloidea). Whilst single major and minor rDNA clusters were mapped to different chromosome pairs in B. minimus and P. acanthus, overlapping signals were detected on a single chromosome pair in the remaining taxa. FISH experiments using major rDNA and telomeric probes clearly demonstrated the presence of highly stretched NORs in most of the digenean taxa analyzed. B chromosomes were detected in the B. bacciger samples hosted by Ruditapes decussatus. Although the cercariae specimens obtained from Donax trunculus, Tellina tenuis, and R. decussatus were in agreement with B. bacciger, their karyotypes showed striking morphological differences in agreement with the proposed assignation of these cercariae to different species of the genus Bacciger. Results are discussed in comparison with previous data on digenean chromosomes. PMID:26680763

  14. Photoionization study of Xe 5s: ionization cross sections and photoelectron angular distributions

    NASA Astrophysics Data System (ADS)

    Aarthi, G.; Jose, J.; Deshmukh, S.; Radojevic, V.; Deshmukh, P. C.; Manson, S. T.

    2014-01-01

    We report studies of photoelectron angular distribution and cross-section for photoionization of xenon 5s electrons using the relativistic multiconfiguration Tamm-Dancoff (MCTD) approximation. We find that MCTD provides a significantly improved agreement with experiment, compared to some of the other relativistic many body approximations such as the relativistic random phase approximation and the relativistic random phase approximation with relaxation, over the entire photon energy region bracketing the near-threshold 5s Cooper minimum, from the 5s threshold up to about 70 eV. The MCTD results in the length form are in much better agreement with the experiment than those in the velocity form, suggesting residual correlations that must be of importance.

  15. Group-specific small-subunit rRNA hybridization probes to characterize filamentous foaming in activated sludge systems.

    PubMed Central

    de los Reyes, F L; Ritter, W; Raskin, L

    1997-01-01

    Foaming in activated sludge systems is characterized by the formation of a thick, chocolate brown-colored scum that floats on the surface of aeration basins and secondary clarifiers. These viscous foams have been associated with the presence of filamentous mycolic acid-containing actinomycetes. To aid in evaluating the microbial representation in foam, we developed and characterized group-, genus-, and species-specific oligonucleotide probes targeting the small subunit rRNA of the Mycobacterium complex, Gordona spp., and Gordona (Nocardia) amarae, respectively. The use of a universal base analog, 5-nitroindole, in oligonucleotide probe design was evaluated by comparing the characteristics of two different versions of the Mycobacterium complex probe. The temperature of dissociation of each probe was determined. Probe specificity studies with a diverse collection of 67 target and nontarget rRNAs demonstrated the specificity of the probes to the target groups. Whole-cell hybridizations with fluorescein- and rhodamine-labeled probes were performed with pure cultures of various members of the Mycobacterium complex as well as with environmental samples from a full-scale activated sludge plant which experienced foaming. Quantitative membrane hybridizations with activated sludge and anaerobic digester foam showed that 15.0 to 18.3% of the total small-subunit rRNAs could be attributed to members of the Mycobacterium complex, of which a vast majority consisted of Gordona rRNA. Several G. amarae strains made up only a very small percentage of the Gordona strains present. We demonstrated that group-specific rRNA probes are useful tools for the in situ monitoring and identification of filamentous bacteria in activated sludge systems. PMID:9055425

  16. Group-specific small-subunit rRNA hybridization probes to characterize filamentous foaming in activated sludge systems.

    PubMed

    de los Reyes, F L; Ritter, W; Raskin, L

    1997-03-01

    Foaming in activated sludge systems is characterized by the formation of a thick, chocolate brown-colored scum that floats on the surface of aeration basins and secondary clarifiers. These viscous foams have been associated with the presence of filamentous mycolic acid-containing actinomycetes. To aid in evaluating the microbial representation in foam, we developed and characterized group-, genus-, and species-specific oligonucleotide probes targeting the small subunit rRNA of the Mycobacterium complex, Gordona spp., and Gordona (Nocardia) amarae, respectively. The use of a universal base analog, 5-nitroindole, in oligonucleotide probe design was evaluated by comparing the characteristics of two different versions of the Mycobacterium complex probe. The temperature of dissociation of each probe was determined. Probe specificity studies with a diverse collection of 67 target and nontarget rRNAs demonstrated the specificity of the probes to the target groups. Whole-cell hybridizations with fluorescein- and rhodamine-labeled probes were performed with pure cultures of various members of the Mycobacterium complex as well as with environmental samples from a full-scale activated sludge plant which experienced foaming. Quantitative membrane hybridizations with activated sludge and anaerobic digester foam showed that 15.0 to 18.3% of the total small-subunit rRNAs could be attributed to members of the Mycobacterium complex, of which a vast majority consisted of Gordona rRNA. Several G. amarae strains made up only a very small percentage of the Gordona strains present. We demonstrated that group-specific rRNA probes are useful tools for the in situ monitoring and identification of filamentous bacteria in activated sludge systems. PMID:9055425

  17. Rapid detection of rRNA group I pseudomonads in contaminated metalworking fluids and biofilm formation by fluorescent in situ hybridization.

    PubMed

    Saha, Ratul; Donofrio, Robert S; Goeres, Darla M; Bagley, Susan T

    2012-05-01

    Metalworking fluids (MWFs), used in different machining operations, are highly prone to microbial degradation. Microbial communities present in MWFs lead to biofilm formation in the MWF systems, which act as a continuous source of contamination. Species of rRNA group I Pseudomonas dominate in contaminated MWFs. However, their actual distribution is typically underestimated when using standard culturing techniques as most fail to grow on the commonly used Pseudomonas Isolation Agar. To overcome this, fluorescent in situ hybridization (FISH) was used to study their abundance along with biofilm formation by two species recovered from MWFs, Pseudomonas fluorescens MWF-1 and the newly described Pseudomonas oleovorans subsp. lubricantis. Based on 16S rRNA sequences, a unique fluorescent molecular probe (Pseudo120) was designed targeting a conserved signature sequence common to all rRNA group I Pseudomonas. The specificity of the probe was evaluated using hybridization experiments with whole cells of different Pseudomonas species. The probe's sensitivity was determined to be 10(3) cells/ml. It successfully detected and enumerated the abundance and distribution of Pseudomonas indicating levels between 3.2 (± 1.1) × 10(6) and 5.0 (± 2.3) × 10(6) cells/ml in four different industrial MWF samples collected from three different locations. Biofilm formation was visualized under stagnant conditions using high and low concentrations of cells for both P. fluorescens MWF-1 and P. oleovorans subsp. lubricantis stained with methylene blue and Pseudo120. On the basis of these observations, this molecular probe can be successfully be used in the management of MWF systems to monitor the levels and biofilm formation of rRNA group I pseudomonads. PMID:22042232

  18. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  19. Genetic characterization and phylogenetic relationships based on 18S rRNA and ITS1 region of small form of canine Babesia spp. from India.

    PubMed

    Mandal, M; Banerjee, P S; Garg, Rajat; Ram, Hira; Kundu, K; Kumar, Saroj; Kumar, G V P P S Ravi

    2014-10-01

    Canine babesiosis is a vector borne disease caused by intra-erythrocytic apicomplexan parasites Babesia canis (large form) and Babesia gibsoni (small form), throughout the globe. Apart from few sporadic reports on the occurrence of B. gibsoni infection in dogs, no attempt has been made to characterize Babesia spp. of dogs in India. Fifteen canine blood samples, positive for small form of Babesia, collected from northern to eastern parts of India, were used for amplification of 18S rRNA gene (∼1665bp) of Babesia sp. and partial ITS1 region (∼254bp) of B. gibsoni Asian genotype. Cloning and sequencing of the amplified products of each sample was performed separately. Based on sequences and phylogenetic analysis of 18S rRNA and ITS1 sequences, 13 were considered to be B. gibsoni. These thirteen isolates shared high sequence identity with each other and with B. gibsoni Asian genotype. The other two isolates could not be assigned to any particular species because of the difference(s) in 18S rRNA sequence with B. gibsoni and closer identity with Babesiaoccultans and Babesiaorientalis. In the phylogenetic tree, all the isolates of B. gibsoni Asian genotype formed a separate major clade named as Babesia spp. sensu stricto clade with high bootstrap support. The two unnamed Babesia sp. (Malbazar and Ludhiana isolates) clustered close together with B. orientalis, Babesia sp. (Kashi 1 isolate) and B. occultans of bovines. It can be inferred from this study that 18S rRNA gene and ITS1 region are highly conserved among 13 B. gibsoni isolates from India. It is the maiden attempt of genetic characterization by sequencing of 18S rRNA gene and ITS1 region of B. gibsoni from India and is also the first record on the occurrence of an unknown Babesia sp. of dogs from south and south-east Asia. PMID:25120099

  20. Primer and platform effects on 16S rRNA tag sequencing

    SciTech Connect

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.

  1. Primer and platform effects on 16S rRNA tag sequencing

    PubMed Central

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-01-01

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. Beta diversity metrics are surprisingly robust to both primer and sequencing platform biases. PMID:26300854

  2. Primer and platform effects on 16S rRNA tag sequencing

    DOE PAGESBeta

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  3. Bile acid receptor TGR5, NADPH Oxidase NOX5-S and CREB Mediate Bile Acid-Induced DNA Damage In Barrett’s Esophageal Adenocarcinoma Cells

    PubMed Central

    Li, Dan; Cao, Weibiao

    2016-01-01

    The mechanisms whereby bile acid reflux may accelerate the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. In this study we found that bile acid taurodeoxycholic acid (TDCA) significantly increased the tail moment (TM) and histone H2AX phosphorylation in FLO-1 EA cells, an increase which was significantly decreased by knockdown of TGR5. Overexpression of TGR5 significantly increased TDCA-induced TM increase and H2AX phosphorylation. In addition, NADPH oxidase inhibitor diphenylene iodonium significantly inhibited the TDCA-induced increase in TM and H2AX phosphorylation. TDCA-induced increase in TM and H2AX phosphorylation was significantly decreased by knockdown of NOX5-S and overexpression of NOX5-S significantly increased TDCA-induced increase in the tail moment and H2AX phosphorylation. Furthermore, TDCA significantly increased cAMP response element binding protein (CREB) phosphorylation in FLO-1 cells. Knockdown of CREB significantly decreased TDCA-induced increase in NOX5-S mRNA and the tail moment. Conversely, overexpression of CREB significantly increased TDCA-induced TM increase. We conclude that TDCA-induced DNA damage may depend on the activation of TGR5, CREB and NOX5-S. It is possible that in Barrett’s patients bile acids may activate NOX5-S and increase reactive oxygen species (ROS) production via activation of TGR5 and CREB. NOX5-S-derived ROS may cause DNA damage, thereby contributing to the progression from BE to EA. PMID:27511066

  4. Bile acid receptor TGR5, NADPH Oxidase NOX5-S and CREB Mediate Bile Acid-Induced DNA Damage In Barrett's Esophageal Adenocarcinoma Cells.

    PubMed

    Li, Dan; Cao, Weibiao

    2016-01-01

    The mechanisms whereby bile acid reflux may accelerate the progression from Barrett's esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. In this study we found that bile acid taurodeoxycholic acid (TDCA) significantly increased the tail moment (TM) and histone H2AX phosphorylation in FLO-1 EA cells, an increase which was significantly decreased by knockdown of TGR5. Overexpression of TGR5 significantly increased TDCA-induced TM increase and H2AX phosphorylation. In addition, NADPH oxidase inhibitor diphenylene iodonium significantly inhibited the TDCA-induced increase in TM and H2AX phosphorylation. TDCA-induced increase in TM and H2AX phosphorylation was significantly decreased by knockdown of NOX5-S and overexpression of NOX5-S significantly increased TDCA-induced increase in the tail moment and H2AX phosphorylation. Furthermore, TDCA significantly increased cAMP response element binding protein (CREB) phosphorylation in FLO-1 cells. Knockdown of CREB significantly decreased TDCA-induced increase in NOX5-S mRNA and the tail moment. Conversely, overexpression of CREB significantly increased TDCA-induced TM increase. We conclude that TDCA-induced DNA damage may depend on the activation of TGR5, CREB and NOX5-S. It is possible that in Barrett's patients bile acids may activate NOX5-S and increase reactive oxygen species (ROS) production via activation of TGR5 and CREB. NOX5-S-derived ROS may cause DNA damage, thereby contributing to the progression from BE to EA. PMID:27511066

  5. Role of intracellular calcium and NADPH oxidase NOX5-S in acid-induced DNA damage in Barrett's cells and Barrett's esophageal adenocarcinoma cells

    PubMed Central

    Li, Dan

    2014-01-01

    Mechanisms whereby acid reflux may accelerate the progression from Barrett's esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. Acid and reactive oxygen species (ROS) have been reported to cause DNA damage in Barrett's cells. We have previously shown that NADPH oxidase NOX5-S is responsible for acid-induced H2O2 production in Barrett's cells and in EA cells. In this study we examined the role of intracellular calcium and NADPH oxidase NOX5-S in acid-induced DNA damage in a Barrett's EA cell line FLO and a Barrett's cell line CP-A. We found that pulsed acid treatment significantly increased tail moment in FLO and CP-A cells and histone H2AX phosphorylation in FLO cells. In addition, acid treatment significantly increased intracellular Ca2+ in FLO cells, an increase that is blocked by Ca2+-free medium with EGTA and thapsigargin. Acid-induced increase in tail moment was significantly decreased by NADPH oxidase inhibitor diphenylene iodonium in FLO cells, and by blockade of intracellular Ca2+ increase or knockdown of NOX5-S with NOX5 small-interfering RNA (siRNA) in FLO and CP-A cells. Acid-induced increase in histone H2AX phosphorylation was significantly decreased by NOX5 siRNA in FLO cells. Conversely, overexpression of NOX5-S significantly increased tail moment and histone H2AX phosphorylation in FLO cells. We conclude that pulsed acid treatment causes DNA damage via increase of intracellular calcium and activation of NOX5-S. It is possible that in BE acid reflux increases intracellular calcium, activates NOX5-S, and increases ROS production, which causes DNA damage, thereby contributing to the progression from BE to EA. PMID:24699332

  6. Trans-splicing and RNA editing of LSU rRNA in Diplonema mitochondria

    PubMed Central

    Valach, Matus; Moreira, Sandrine; Kiethega, Georgette N.; Burger, Gertraud

    2014-01-01

    Mitochondrial ribosomal RNAs (rRNAs) often display reduced size and deviant secondary structure, and sometimes are fragmented, as are their corresponding genes. Here we report a mitochondrial large subunit rRNA (mt-LSU rRNA) with unprecedented features. In the protist Diplonema, the rnl gene is split into two pieces (modules 1 and 2, 534- and 352-nt long) that are encoded by distinct mitochondrial chromosomes, yet the rRNA is continuous. To reconstruct the post-transcriptional maturation pathway of this rRNA, we have catalogued transcript intermediates by deep RNA sequencing and RT-PCR. Gene modules are transcribed separately. Subsequently, transcripts are end-processed, the module-1 transcript is polyuridylated and the module-2 transcript is polyadenylated. The two modules are joined via trans-splicing that retains at the junction ∼26 uridines, resulting in an extent of insertion RNA editing not observed before in any system. The A-tail of trans-spliced molecules is shorter than that of mono-module 2, and completely absent from mitoribosome-associated mt-LSU rRNA. We also characterize putative antisense transcripts. Antisense-mono-modules corroborate bi-directional transcription of chromosomes. Antisense-mt-LSU rRNA, if functional, has the potential of guiding concomitantly trans-splicing and editing of this rRNA. Together, these findings open a window on the investigation of complex regulatory networks that orchestrate multiple and biochemically diverse post-transcriptional events. PMID:24259427

  7. Molecular and Cytogenetic Characterization of Wild Musa Species

    PubMed Central

    Čížková, Jana; Hřibová, Eva; Christelová, Pavla; Van den Houwe, Ines; Häkkinen, Markku; Roux, Nicolas; Swennen, Rony; Doležel, Jaroslav

    2015-01-01

    The production of bananas is threatened by rapid spreading of various diseases and adverse environmental conditions. The preservation and characterization of banana diversity is essential for the purposes of crop improvement. The world's largest banana germplasm collection maintained at the Bioversity International Transit Centre (ITC) in Belgium is continuously expanded by new accessions of edible cultivars and wild species. Detailed morphological and molecular characterization of the accessions is necessary for efficient management of the collection and utilization of banana diversity. In this work, nuclear DNA content and genomic distribution of 45S and 5S rDNA were examined in 21 diploid accessions recently added to ITC collection, representing both sections of the genus Musa. 2C DNA content in the section Musa ranged from 1.217 to 1.315 pg. Species belonging to section Callimusa had 2C DNA contents ranging from 1.390 to 1.772 pg. While the number of 45S rDNA loci was conserved in the section Musa, it was highly variable in Callimusa species. 5S rRNA gene clusters were found on two to eight chromosomes per diploid cell. The accessions were genotyped using a set of 19 microsatellite markers to establish their relationships with the remaining accessions held at ITC. Genetic diversity done by SSR genotyping platform was extended by phylogenetic analysis of ITS region. ITS sequence data supported the clustering obtained by SSR analysis for most of the accessions. High level of nucleotide diversity and presence of more than two types of ITS sequences in eight wild diploids pointed to their origin by hybridization of different genotypes. This study significantly expands the number of wild Musa species where nuclear genome size and genomic distribution of rDNA loci is known. SSR genotyping identified Musa species that are closely related to the previously characterized accessions and provided data to aid in their classification. Sequence analysis of ITS region

  8. Comparative molecular cytogenetics of major repetitive sequence families of three Dendrobium species (Orchidaceae) from Bangladesh

    PubMed Central

    Begum, Rabeya; Alam, Sheikh Shamimul; Menzel, Gerhard; Schmidt, Thomas

    2009-01-01

    Background and Aims Dendrobium species show tremendous morphological diversity and have broad geographical distribution. As repetitive sequence analysis is a useful tool to investigate the evolution of chromosomes and genomes, the aim of the present study was the characterization of repetitive sequences from Dendrobium moschatum for comparative molecular and cytogenetic studies in the related species Dendrobium aphyllum, Dendrobium aggregatum and representatives from other orchid genera. Methods In order to isolate highly repetitive sequences, a c0t-1 DNA plasmid library was established. Repeats were sequenced and used as probes for Southern hybridization. Sequence divergence was analysed using bioinformatic tools. Repetitive sequences were localized along orchid chromosomes by fluorescence in situ hybridization (FISH). Key Results Characterization of the c0t-1 library resulted in the detection of repetitive sequences including the (GA)n dinucleotide DmoO11, numerous Arabidopsis-like telomeric repeats and the highly amplified dispersed repeat DmoF14. The DmoF14 repeat is conserved in six Dendrobium species but diversified in representative species of three other orchid genera. FISH analyses showed the genome-wide distribution of DmoF14 in D. moschatum, D. aphyllum and D. aggregatum. Hybridization with the telomeric repeats demonstrated Arabidopsis-like telomeres at the chromosome ends of Dendrobium species. However, FISH using the telomeric probe revealed two pairs of chromosomes with strong intercalary signals in D. aphyllum. FISH showed the terminal position of 5S and 18S–5·8S–25S rRNA genes and a characteristic number of rDNA sites in the three Dendrobium species. Conclusions The repeated sequences isolated from D. moschatum c0t-1 DNA constitute major DNA families of the D. moschatum, D. aphyllum and D. aggregatum genomes with DmoF14 representing an ancient component of orchid genomes. Large intercalary telomere-like arrays suggest chromosomal

  9. Reevaluation of the Taxonomic Status of Recently Described Species of Enterococcus: Evidence that E. thailandicus Is a Senior Subjective Synonym of “E. sanguinicola” and Confirmation of E. caccae as a Species Distinct from E. silesiacus▿

    PubMed Central

    Shewmaker, Patricia Lynn; Steigerwalt, Arnold G.; Nicholson, Ainsley C.; Carvalho, Maria da Glória S.; Facklam, Richard R.; Whitney, Anne M.; Teixeira, Lúcia M.

    2011-01-01

    Several of the more recently proposed new species of Enterococcus are nearly identical based on 16S rRNA gene sequence analysis and phenotypic traits. In the present study, DNA-DNA reassociation experiments, in conjunction with sequencing of the 16S rRNA and rpoB genes, provided evidence that “Enterococcus sanguinicola” and Enterococcus thailandicus actually represent the same species. In contrast, Enterococcus caccae and Enterococcus silesiacus, two other species with nearly identical 16S rRNA gene sequences, were confirmed to be separate species. PMID:21543565

  10. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON QSAR

    EPA Science Inventory

    Dyer, S.D., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to predict HC5's Based on QSARs (Abstract). To be presented at the SETAC Europe 14th Annual Meeting: Environmental Science Solution: A Pan-European Perspective, 18-...

  11. Sacrum fracture following L5-S1 stand-alone interbody fusion for isthmic spondylolisthesis.

    PubMed

    Phan, Kevin; Mobbs, Ralph J

    2015-11-01

    We report a 72-year-old man with a rare sacral fracture following stand-alone L5-S1 anterior lumbar interbody fusion for isthmic spondylolisthesis. The man underwent a minimally invasive management strategy using posterior percutaneous pedicle fixation and partial reduction of the deformity. We also discuss the current literature on fusion procedures for isthmic spondylolisthesis. PMID:26100158

  12. 5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO BRIDGE WITH EAST BRIDGE HOUSE IN RIGHT FOREGROUND. VIEW TO WEST. - MacArthur Bridge, Spanning Mississippi River on Highway 34 between IA & IL, Burlington, Des Moines County, IA

  13. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON MINIMAL DATA

    EPA Science Inventory

    Dyer, S., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to Predict HC5's Based on Minimal Data (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portland, OR. 1 p. (ERL,GB R1013).

  14. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  15. Adaptation of the S-5-S pendulum seismometer for measurement of rotational ground motion

    NASA Astrophysics Data System (ADS)

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-10-01

    The Russian electrodynamic seismometer model S-5-S has been adapted for the measurement of rotational ground motion. The mechanical system of the original S-5-S seismometer consists of electrodynamic sensing and damping transducer coils mounted on an asymmetrical double-arm pendulum. This pendulum is suspended on a footing using two pairs of crossed flat springs, which operate as the axis of rotation. The pendulum is stabilised by an additional spring. The S-5-S can be used either as a vertical or as a horizontal sensor. The adaptation of the S-5-S seismometer described below involves removal of the additional spring and installation of an additional mass on the damping arm. Strain gauge angle sensors are installed on one pair of the crossed flat springs. The main dynamic parameters of the rotational seismometer created in this way, i.e. the natural period and damping, are controlled electronically by feedback currents proportional to the angular displacement and angular velocity, both fed to the damping transducer coil. This new seismometer, named the S-5-SR, enables measurement of the rotational component of ground motion around the horizontal or the vertical axes. The output signal from this S-5-SR seismometer can be proportional either to rotational displacement or rotational velocity.

  16. Comparative analyses of phenotypic methods and 16S rRNA, khe, rpoB genes sequencing for identification of clinical isolates of Klebsiella pneumoniae.

    PubMed

    He, Yanxia; Guo, Xianguang; Xiang, Shifei; Li, Jiao; Li, Xiaoqin; Xiang, Hui; He, Jinlei; Chen, Dali; Chen, Jianping

    2016-07-01

    The present work aimed to evaluate 16S rRNA, khe and rpoB gene sequencing for the identification of Klebsiella pneumoniae in comparison with phenotypic methods. Fifteen clinical isolates were examined, which were initially identified as K. pneumoniae subsp. pneumoniae using the automated VITEK 32 system in two hospitals in Enshi City, China. Their identity was further supported by conventional phenotypic methods on the basis of morphological and biochemical characteristics. Using Bayesian phylogenetic analyses and haplotypes network reconstruction, 13 isolates were identified as K. pneumoniae, whereas the other two isolates (K19, K24) were classified as Shigella sp. and Enterobacter sp., respectively. Of the three genes, 16S rRNA and khe gene could discriminate the clinical isolates at the genus level, whereas rpoB could discriminate Klebsiella at the species and even subspecies level. Overall, the gene tree based on rpoB is more compatible with the currently accepted classification of Klebsiella than those based on 16S rRNA and khe genes, showing that rpoB can be a powerful tool for identification of K. pneumoniae isolates. Above all, our study challenges the utility of khe as a species-specific marker for identification of K. pneumoniae. PMID:27147066

  17. RNomics in Archaea reveals a further link between splicing of archaeal introns and rRNA processing

    PubMed Central

    Tang, Thean Hock; Rozhdestvensky, Timofey S.; d’Orval, Béatrice Clouet; Bortolin, Marie-Line; Huber, Harald; Charpentier, Bruno; Branlant, Christiane; Bachellerie, Jean-Pierre; Brosius, Jürgen; Hüttenhofer, Alexander

    2002-01-01

    The bulge–helix–bulge (BHB) motif recognised by the archaeal splicing endonuclease is also found in the long processing stems of archaeal rRNA precursors in which it is cleaved to generate pre-16S and pre-23S rRNAs. We show that in two species, Archaeoglobus fulgidus and Sulfolobus solfataricus, representatives from the two major archaeal kingdoms Euryarchaeota and Crenarchaeota, respectively, the pre-rRNA spacers cleaved at the BHB motifs surrounding pre-16S and pre-23S rRNAs subsequently become ligated. In addition, we present evidence that this is accompanied by circularisation of ribosomal pre-16S and pre-23S rRNAs in both species. These data reveal a further link between intron splicing and pre-rRNA processing in Archaea, which might reflect a common evolutionary origin of the two processes. One spliced RNA species designated 16S-D RNA, resulting from religation at the BHB motif of 16S pre-rRNA, is a highly abundant and stable RNA which folds into a three-stem structure interrupted by two single-stranded regions as assessed by chemical probing. It spans a region of the pre-rRNA 5′ external transcribed spacer exhibiting a highly conserved folding pattern in Archaea. Surprisingly, 16S-D RNA contains structural motifs found in archaeal C/D box small RNAs and binds to the L7Ae protein, a core component of archaeal C/D box RNPs. This supports the notion that it might have an important but still unknown role in pre-rRNA biogenesis or might even target RNA molecules other than rRNA. PMID:11842103

  18. 16S rRNA gene phylogenesis of culturable predominant bacteria from diseased Apostichopus japonicus (Holothuroidea, Echinodermata)

    NASA Astrophysics Data System (ADS)

    Ma, Haiyan; Jiang, Guoliang; Wu, Zhiqiang; Wang, Xin

    2009-06-01

    Cultured Apostichopus japonicus in China suffers from a kind of skin ulceration disease that has caused severe economic loss in recent years. The disease, pathogens of which are supposed to be bacteria by most researchers, is highly infectious and can often cause all individuals in the same culture pool to die in a very short time. The 16S rRNA gene phylogenesis of the culturable bacteria from the lesions of diseased individuals was conducted to study the biodiversity of the bacterial communities in the lesions and to identify probable pathogen(s) associated with this kind of disease. S. japonica samples were selected from a hatchery located in the eastern part of Qingdao, China. Bacterial universal primers GM5F and DS907R were used to amplify the 16S rRNA gene of bacteria colonies, and touchdown PCR was performed to amplify the target sequences. The results suggest that γ- proteobacteria (Alteromonadales and Vibrionales) of CFB group, many strains of which have been also determined as pathogens in other marine species, are the predominant bacterial genera of the diseased Apostichopus japonicus individuals.

  19. Phylogenetic relationships within caniform carnivores based on analyses of the mitochondrial 12S rRNA gene.

    PubMed

    Ledje, C; Arnason, U

    1996-12-01

    The complete 12S rRNA gene of 32 carnivore species, including four feliforms and 28 caniforms, was sequenced. The sequences were aligned on the basis of their secondary structures and used in phylogenetic analyses that addressed several evolutionary relationships within the Caniformia. The analyses showed an unresolved polytomy of the basic caniform clades; pinnipeds, mustelids, procyonids, skunks, Ailurus (lesser panda), ursids, and canids. The polytomy indicates a major diversification of caniforms during a relatively short period of time. The lesser panda was distinct from other caniforms, suggesting its inclusion in a monotypic family, Ailuridae. The giant panda and the bears were joined on the same branch. The skunks are traditionally included in the family Mustelidae. The present analysis, however, showed a less close molecular relationship between the skunks and the remaining Mustelidae (sensu stricto) than between Mustelidae (sensu stricto) and Procyonidae, making Mustelidae (sensu lato) paraphyletic. The results suggest that the skunks should be included in a separate family, Mephitidae. Within the Pinnipedia, the grouping of walrus, sea lions, and fur seals was strongly supported. Analyses of a combined set of 12S rRNA and cytochrome b data were generally consistent with the findings based on each gene. PMID:8995061

  20. Reassessment of PCR primers targeting 16S rRNA genes of the organohalide-respiring genus Dehalogenimonas.

    PubMed

    Chen, Jie; Bowman, Kimberly S; Rainey, Fred A; Moe, William M

    2014-09-01

    Representatives from the genus Dehalogenimonas have the metabolic capacity to anaerobically transform a variety of environmentally important polychlorinated aliphatic compounds. In light of the recent isolation of additional strains, description of a new species, and an expanded number of uncultured DNA sequences, PCR primers and protocols intended to uniquely target members of this organohalide-respiring genus were reevaluated. Nine of fourteen primer combinations reported previously as genus-specific failed to amplify 16S rRNA genes of recently isolated Dehalogenimonas strains. Use of alternative combinations or modified genus-specific primers, however, allowed detection of all presently known Dehalogenimonas strains. Use of a modified primer set in qPCR revealed an approximately two-order of magnitude increase in concentration of Dehalogenimonas 16S rRNA gene copies following subsurface injection of electron donors at a Louisiana Superfund site, demonstrating the utility of the newly developed protocol and suggesting that the genus Dehalogenimonas can respond to biostimulation remediation strategies in a manner similar to that previously reported for other dechlorinating genera such as Dehalococcoides. PMID:24989478

  1. Structural and Functional Studies of the Thermus Thermophilus 16S rRNA Methyltransferase RsmG

    SciTech Connect

    Gregory, S.; Demirci, H; Belardinelli, R; Monshupanee, T; Gualerzi, C; Dahlberg, A; Jogl, G

    2009-01-01

    The RsmG methyltransferase is responsible for N7 methylation of G527 of 16S rRNA in bacteria. Here, we report the identification of the Thermus thermophilus rsmG gene, the isolation of rsmG mutants, and the solution of RsmG X-ray crystal structures at up to 1.5 A resolution. Like their counterparts in other species, T. thermophilus rsmG mutants are weakly resistant to the aminoglycoside antibiotic streptomycin. Growth competition experiments indicate a physiological cost to loss of RsmG activity, consistent with the conservation of the modification site in the decoding region of the ribosome. In contrast to Escherichia coli RsmG, which has been reported to recognize only intact 30S subunits, T. thermophilus RsmG shows no in vitro methylation activity against native 30S subunits, only low activity with 30S subunits at low magnesium concentration, and maximum activity with deproteinized 16S rRNA. Cofactor-bound crystal structures of RsmG reveal a positively charged surface area remote from the active site that binds an adenosine monophosphate molecule. We conclude that an early assembly intermediate is the most likely candidate for the biological substrate of RsmG.

  2. Analysis of the cystic fibrosis lung microbiota via serial Illumina sequencing of bacterial 16S rRNA hypervariable regions.

    PubMed

    Maughan, Heather; Wang, Pauline W; Diaz Caballero, Julio; Fung, Pauline; Gong, Yunchen; Donaldson, Sylva L; Yuan, Lijie; Keshavjee, Shaf; Zhang, Yu; Yau, Yvonne C W; Waters, Valerie J; Tullis, D Elizabeth; Hwang, David M; Guttman, David S

    2012-01-01

    The characterization of bacterial communities using DNA sequencing has revolutionized our ability to study microbes in nature and discover the ways in which microbial communities affect ecosystem functioning and human health. Here we describe Serial Illumina Sequencing (SI-Seq): a method for deep sequencing of the bacterial 16S rRNA gene using next-generation sequencing technology. SI-Seq serially sequences portions of the V5, V6 and V7 hypervariable regions from barcoded 16S rRNA amplicons using an Illumina short-read genome analyzer. SI-Seq obtains taxonomic resolution similar to 454 pyrosequencing for a fraction of the cost, and can produce hundreds of thousands of reads per sample even with very high multiplexing. We validated SI-Seq using single species and mock community controls, and via a comparison to cystic fibrosis lung microbiota sequenced using 454 FLX Titanium. Our control runs show that SI-Seq has a dynamic range of at least five orders of magnitude, can classify >96% of sequences to the genus level, and performs just as well as 454 and paired-end Illumina methods in estimation of standard microbial ecology diversity measurements. We illustrate the utility of SI-Seq in a pilot sample of central airway secretion samples from cystic fibrosis patients. PMID:23056217

  3. Bacterial community analysis of a gas-phase biotrickling filter for biogas mimics desulfurization through the rRNA approach.

    PubMed

    Maestre, Juan P; Rovira, R; Alvarez-Hornos, F J; Fortuny, M; Lafuente, J; Gamisans, X; Gabriel, D

    2010-08-01

    The bacterial composition of a lab-scale biotrickling filter (BTF) treating high loads of H(2)S was investigated by the rRNA approach. Two 16S rRNA gene clone libraries were established 42 and 189 d after reactor startup, while fluorescent in-situ hybridization (FISH) with DNA probes was performed throughout 260d of reactor operation. Diversity, community structure and metamorphosis were studied from reactor startup to fully-established pseudo-steady state operation at near neutral pH and at an inlet H(2)S concentration of 2000 ppmv (load of 55.6g H(2)S m(-3)h(-1)). In addition, FISH was used for assessing the spatial distribution of sulfur-oxidizing bacteria (SOB) along the length of the reactor under pseudo-steady state operation. A major shift in the diversity of the community was observed with the operating time, from a well-diverse community at startup to pseudo-steady state operation with a majority of retrieved sequences affiliated to SOB of the sulfur cycle including Thiothrix spp., Thiobacillus spp., and Sulfurimonas denitrificans. Although aerobic species were predominant along the BTF, a vertical stratification was encountered, in which facultative anaerobes had a major relative abundance in the inlet part of the BTF, where the sulfide to oxygen ratio was higher. The observed changes were related to the trophic properties of the community, the DO concentration, the accumulation of elemental sulfur and the operation at neutral pH. PMID:20554311

  4. In situ hybridization of phytoplankton using fluorescently labeled rRNA probes.

    PubMed

    Groben, René; Medlin, Linda

    2005-01-01

    Phytoplankton are one of the major components of ecosystem processes and play an important role in many biogeochemical cycles in the marine and freshwater environment. Despite their importance, many microalgae are poorly described and little is known of broad spatial and temporal scale trends in their abundance and distribution. Reasons for this are that microalgae are often small, lack distinct morphological features, and are unculturable, which make analyses difficult. It is now possible by using molecular biological techniques to advance our knowledge of aquatic biodiversity and to understand how biodiversity supports ecosystem structure, dynamics, and resilience. We present in this chapter a brief review of the progress that has been made in analyzing microalgae from populations to the species level. The described methods range from DNA fingerprinting techniques, such as random amplified polymorphic DNA (RAPD), amplified fragment length polymorphisms (AFLPs), and simple sequence repeats (SSRs), to microsatellites, which are used in population studies, to sequence analysis, which help to reconstruct the evolutionary history of organisms and to examine relationships at various taxonomic levels. Special emphasis is given to the application of molecular probes for the identification and characterization of microalgal taxa. The fast and secure identification of phytoplankton, especially of toxic species, is important from an ecological and economical point of view and whole-cell hybridization with specific fluorochrome-labeled probes followed by fluorescence microscopy or flow cytometry offers a fast method for this purpose. In this context, we present a detailed protocol for fluorescence in situ hybridization (FISH) of ribosomal RNA (rRNA) probes that can be applied to many algal cell types and discuss practical considerations of its use. PMID:15865974

  5. 18S rRNA Gene Variation among Common Airborne Fungi, and Development of Specific Oligonucleotide Probes for the Detection of Fungal Isolates

    PubMed Central

    Wu, Zhihong; Tsumura, Yoshihiko; Blomquist, Göran; Wang, Xiao-Ru

    2003-01-01

    In this study, we sequenced 18S rRNA genes (rDNA) from 49 fungal strains representing 31 species from 15 genera. Most of these species are common airborne fungi and pathogens that may cause various public health concerns. Sequence analysis revealed distinct divergence between Zygomycota and Ascomycota. Within Ascomycota, several strongly supported clades were identified that facilitate the taxonomic placement of several little-studied fungi. Wallemia appeared as the group most diverged from all the other Ascomycota species. Based on the 18S rDNA sequence variation, 108 oligonucleotide probes were designed for each genus and species included in this study. After homology searches and DNA hybridization evaluations, 33 probes were verified as genus or species specific. The optimal hybridization temperatures to achieve the best specificity for these 33 probes were determined. These new probes can contribute to the molecular diagnostic research for environmental monitoring. PMID:12957927

  6. Molecular evolution of the 5'-terminal domain of large-subunit rRNA from lower eukaryotes. A broad phylogeny covering photosynthetic and non-photosynthetic protists.

    PubMed

    Qu, L H; Perasso, R; Baroin, A; Brugerolle, G; Bachellerie, J P; Adoutte, A

    1988-01-01

    This paper summarizes the present status of an analysis of protist phylogeny using rapid partial sequencing of 28S rRNA. Data from 12 protistan phyla are now available and have been used to construct a tentative dendrogram based on a distance matrix method. The tree is robust and has considerable internal consistency. The following salient points are observed: a number of flagellate groups (particularly Euglenozoa) emerge very early among eukaryotes, whereas ciliates and dinoflagellates emerge late, suggesting that some characteristics that had been considered as primitive may in fact be derived. Both chlorophytic and chromophytic photosynthetic protists emerge very late in the tree, close to the Metazoa-Metaphyta-Fungi radiation, suggesting relatively late occurrence of the photosynthetic symbiosis. Taxonomic and phylogenetic information is also obtained within a phylum where rRNA of enough species are sequenced. A deep trichotomy is thus observed within the ciliates. The data are discussed with respect to classical protist phylogenies. PMID:3395679

  7. Phylogeny and Taxonomy of Archaea: A Comparison of the Whole-Genome-Based CVTree Approach with 16S rRNA Sequence Analysis

    PubMed Central

    Zuo, Guanghong; Xu, Zhao; Hao, Bailin

    2015-01-01

    A tripartite comparison of Archaea phylogeny and taxonomy at and above the rank order is reported: (1) the whole-genome-based and alignment-free CVTree using 179 genomes; (2) the 16S rRNA analysis exemplified by the All-Species Living Tree with 366 archaeal sequences; and (3) the Second Edition of Bergey’s Manual of Systematic Bacteriology complemented by some current literature. A high degree of agreement is reached at these ranks. From the newly proposed archaeal phyla, Korarchaeota, Thaumarchaeota, Nanoarchaeota and Aigarchaeota, to the recent suggestion to divide the class Halobacteria into three orders, all gain substantial support from CVTree. In addition, the CVTree helped to determine the taxonomic position of some newly sequenced genomes without proper lineage information. A few discrepancies between the CVTree and the 16S rRNA approaches call for further investigation. PMID:25789552

  8. New anamorphic yeast species: Candida infanticola sp. nov., Candida polysorbophila sp. nov., Candida transvaalensis sp. nov., and Trigonopsis californica sp. nov.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Three new species of Candida and a new species of Trigonopsis are described based on their recognition from phylogenetic analysis of gene sequences from large subunit ribosomal RNA, ITS1/ITS2 rRNA, mitochondrial small subunit rRNA and cytochrome oxidase II. Candida infanticola sp. nov. (type strain...

  9. The phylogeny of Aerococcus and Pediococcus as determined by 16S rRNA sequence analysis: description of Tetragenococcus gen. nov.

    PubMed

    Collins, M D; Williams, A M; Wallbanks, S

    1990-08-01

    The phylogenetic interrelationships of the genera Pediococcus and Aerococcus were investigated using reverse transcriptase sequencing of 16S rRNA. The genus Pediococcus was found to be phylogenetically heterogeneous. The four species P. acidilactici, P. damnosus, P. parvulus and P. pentosaceus formed a phylogenetically distinct group. Within this pediococcal cluster, P. acidilactici was closely related to P. pentosaceus whereas P. damnosus showed a specific relationship with P. parvulus. The species P. dextrinicus, although showing significant sequence relatedness with these pediococcal species, was peripheral to the genus. Pediococcus halophilus exhibited low sequence homology with all of the species examined and formed a distinct line of descent. Pediococcus halophilus exhibited a closer affinity with enterococci and carnobacteria than with the other lactic acid bacteria. Pediococcus urinae-equi was phylogenetically very closely related to Aerococcus viridans. The 16S rRNA sequences of the type strains of these species differed by only two nucleotides (99.9% sequence homology) and clearly demonstrate that P. urinae-equi is a member of the genus Aerococcus. PMID:2227360

  10. Melioidosis presenting as a mycotic aneurysm in a Korean patient, diagnosed by 16S rRNA sequencing and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    PubMed

    Jang, Hee Ryeong; Lee, Chung Won; Ok, Soon Jung; Kim, Min Ji; Bae, Mi Ju; Song, Seunghwan; Yi, Jongyoun; Kim, Kye-Hyung

    2015-09-01

    A case of melioidosis with a mycotic aneurysm is reported. The blood and tissue isolates were identified as three different species of Burkholderia using the automated identification systems, VITEK 2 and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). The isolate was confirmed as Burkholderia pseudomallei by 16S rRNA sequencing. The typical features of the Gram staining of colonies and 16S rRNA sequencing can be useful to identify B. pseudomallei. PMID:26216763

  11. Thermus thermophilus 16S rRNA is transcribed from an isolated transcription unit.

    PubMed Central

    Hartmann, R K; Erdmann, V A

    1989-01-01

    A cloned 16S rRNA gene from the extreme thermophilic eubacterium Thermus thermophilus HB8 was used to characterize the in vivo expression of the 16S rRNA genes in this organism by nuclease S1 mapping. The gene represents an isolated transcription unit encoding solely 16S rRNA. Under exponential growth conditions, transcription was initiated at a single promoter, which represents the structural equivalent of Escherichia coli rrn P2 promoters. The promoter-leader region was very similar to the E. coli rrn P2 promoter-leader segment that is responsible for antitermination. The T. thermophilus leader region was approximately 85 nucleotides shorter than its E. coli P2 counterpart. Potential processing intermediates were correlated with a proposed secondary structure of T. thermophilus pre-16S rRNA. Images PMID:2722737

  12. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  13. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  14. Fine mapping of 28S rRNA sites specifically cleaved in cells undergoing apoptosis.

    PubMed Central

    Houge, G; Robaye, B; Eikhom, T S; Golstein, J; Mellgren, G; Gjertsen, B T; Lanotte, M; Døskeland, S O

    1995-01-01

    Bona fide apoptosis in rat and human leukemia cells, rat thymocytes, and bovine endothelial cells was accompanied by limited and specific cleavage of polysome-associated and monosome-associated 28S rRNA, with 18S rRNA being spared. Specific 28S rRNA cleavage was observed in all instances of apoptotic death accompanied by internucleosomal DNA fragmentation, with cleavage of 28S rRNA and of DNA being linked temporally. This indicates that 28S rRNA fragmentation may be as general a feature of apoptosis as internucleosomal DNA fragmentation and that concerted specific cleavage of intra- and extranuclear polynucleotides occurs in apoptosis. Apoptosis-associated cleavage sites were mapped to the 28S rRNA divergent domains D2, D6 (endothelial cells), and D8. The D2 cuts occurred in hairpin loop junctions considered to be buried in the intact ribosome, suggesting that this rRNA region becomes a target for RNase attack in apoptotic cells. D8 was cleaved in two exposed UU(U) sequences in bulge loops. Treatment with agents causing necrotic cell death or aging of cell lysates failed to produce any detectable limited D2 cleavage but did produce a more generalized cleavage in the D8 region. Of potential functional interest was the finding that the primary cuts in D2 exactly flanked a 0.3-kb hypervariable subdomain (D2c), allowing excision of the latter. The implication of hypervariable rRNA domains in apoptosis represents the first association of any functional process with these enigmatic parts of the ribosomes. PMID:7891700

  15. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  16. 1s2s2p2 5p3 5S transition in B ii

    NASA Astrophysics Data System (ADS)

    Mannervik, S.; Cederquist, H.; Martinson, I.; Brage, T.; Froese Fischer, C.

    1987-04-01

    An experimental and theoretical study has been made of the 1s2s2p2 5P-1s2p3 5S transition in B ii. The experimental wavelength and lifetime (1323.92+/-0.07 Å and 0.65+/-0.01 ns), determined by beam-foil spectroscopy, are more than five times more accurate than previous experimental results. Our theoretical data, from multiconfiguration Hartree-Fock calculations, 1311.6 Å and 0.601 ns, are in excellent agreement with previous theoretical predictions of Beck and Nicolaides [Phys. Lett. 61A, 227 (1977)]. We have also observed the 1s2p3 5S-1s2p23s 5P transition, at 857.7+/-0.2 Å, in accord with the theoretical value 859.1 Å.

  17. Optical characterization of CuIn5S8 crystals by ellipsometry measurements

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2016-04-01

    Optical properties of CuIn5S8 crystals grown by Bridgman method were investigated by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficients were obtained from the analysis of ellipsometry experiments performed in the 1.2-6.2 eV spectral region. Analysis of spectral dependence of the absorption coefficient revealed the existence of direct band gap transitions with energy 1.53 eV. Wemple-DiDomenico and Spitzer-Fan models were used to find the oscillator energy, dispersion energy, zero-frequency refractive index and high-frequency dielectric constant values. Structural properties of the CuIn5S8 crystals were investigated using X-ray diffraction and energy dispersive spectroscopy analysis.

  18. Ellipsometry study of optical parameters of AgIn5S8 crystals

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2015-12-01

    AgIn5S8 crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2-6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn5S8 crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  19. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium

    NASA Astrophysics Data System (ADS)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.

    2014-07-01

    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  20. Interplay of RNA Pol IV and ROS1 during post-embryonic 5S rDNA chromatin remodeling.

    PubMed

    Douet, Julien; Blanchard, Bertrand; Cuvillier, Claudine; Tourmente, Sylvette

    2008-12-01

    We have investigated the chromatin structure of 5S rDNA, a heterochromatic pericentromeric tandemly repeated family, at 2, 3, 4 and 5 days post-germination. Our results revealed a large-scale reorganization of 5S rDNA chromatin that occurs during the first days of development. Unexpectedly, there is a decondensation followed by a 're'condensation of 5S rDNA chromatin, to obtain almost mature nuclei 5 d post-germination. The reorganization of 5S rDNA chromatin is accompanied by a rapid and active demethylation of 5S rDNA mediated by the ROS1 (repressor of silencing 1) demethylase, whereas the plant-specific RNA polymerase IV (Pol IV) is essential to the 5S chromatin 're'condensation. In conclusion, Pol IV and ROS1 collaborate to unlock the 5S rDNA chromatin inherited from the seed, and establish adult features. PMID:18845569

  1. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  2. Global determinants of mortality in under 5s: 10 year worldwide longitudinal study

    PubMed Central

    Nacher, Mathieu; Guihenneuc, Chantal; Tubert-Bitter, Pascale; Chavance, Michel

    2013-01-01

    Objective To assess at country level the association of mortality in under 5s with a large set of determinants. Design Longitudinal study. Setting 193 United Nations member countries, 2000-09. Methods Yearly data between 2000 and 2009 based on 12 world development indicators were used in a multivariable general additive mixed model allowing for non-linear relations and lag effects. Main outcome measure National rate of deaths in under 5s per 1000 live births Results The model retained the variables: gross domestic product per capita; percentage of the population having access to improved water sources, having access to improved sanitation facilities, and living in urban areas; adolescent fertility rate; public health expenditure per capita; prevalence of HIV; perceived level of corruption and of violence; and mean number of years in school for women of reproductive age. Most of these variables exhibited non-linear behaviours and lag effects. Conclusions By providing a unified framework for mortality in under 5s, encompassing both high and low income countries this study showed non-linear behaviours and lag effects of known or suspected determinants of mortality in this age group. Although some of the determinants presented a linear action on log mortality indicating that whatever the context, acting on them would be a pertinent strategy to effectively reduce mortality, others had a threshold based relation potentially mediated by lag effects. These findings could help designing efficient strategies to achieve maximum progress towards millennium development goal 4, which aims to reduce mortality in under 5s by two thirds between 1990 and 2015. PMID:24212105

  3. Accumulation of poly(3-hydroxybutyrate) from octanoate in different pseudomonas belonging to the rRNA homology group I.

    PubMed

    Diard, Stéphane; Carlier, Jean-Philippe; Ageron, Elisabeth; Grimont, Patrick A D; Langlois, Valérie; Guérin, Philippe; Bouvet, Odile M M

    2002-08-01

    It is admitted that one of the characteristics of pseudomonads is their inability to accumulate poly(3-hydroxybutyrate). In this paper, we show that poly(3-hydroxyoctanoate) synthesis is restricted to Pseudomonas rRNA homology group I, which includes both fluorescent and nonfluorescent species. However, within the genus Pseudomonas, the P. aeruginosa complex can be subdivided into two groups: the "P. aeruginosa group", which includes P. aeruginosa, P. alcaligenes, P. citronellolis, P. mendocina, produce poly(3-hydroxyoctanoate) from octanoate and the "P. oleovorans group" which includes the type strain of P. oleovorans, P. pseudoalcaligenes and two Pseudomonas sp., produce poly(3-hydroxybutyrate) during cultivation on octanoate. Strain GPo1 (ATCC 29347) formely identified as P. oleovorans and known to produce various medium-side-chain PHAs such as poly(3-hydroxyoctanoate) has been reclassified in the P. putida complex. PMID:12353870

  4. Analysis of 18S rRNA gene sequences suggests significant molecular differences between Macrodasyida and Chaetonotida (Gastrotricha).

    PubMed

    Manylov, Oleg G; Vladychenskaya, Natalia S; Milyutina, Irina A; Kedrova, Olga S; Korokhov, Nikolai P; Dvoryanchikov, Gennady A; Aleshin, Vladimir V; Petrov, Nikolai B

    2004-03-01

    Partial 18S rRNA gene sequences of four macrodasyid and one chaetonotid gastrotrichs were obtained and compared with the available sequences of other gastrotrich species and representatives of various metazoan phyla. Contrary to the earlier molecular data, the gastrotrich sequences did not comprise a monophyletic group but formed two distinct clades, corresponding to the Macrodasyida and Chaetonotida, with the basal position occupied by the sequences of Tetranchyroderma sp. and Xenotrichula sp., respectively. Depending on the taxon sampling and methods of analysis, the two clades were separated by various combinations of clades Rotifera, Gnathostomulida, and Platyhelminthes, and never formed a clade with Nematoda. Thus, monophyly of the Gastrotricha is not confirmed by analysis of the presently available molecular data. PMID:15012964

  5. Avian malaria in captive psittacine birds: detection by microscopy and 18S rRNA gene amplification.

    PubMed

    Belo, N O; Passos, L F; Júnior, L M C; Goulart, C E; Sherlock, T M; Braga, E M

    2009-03-01

    A cross-sectional survey was conducted to estimate the occurrence of malaria infection among captive psittacine birds (n=127) from three zoological gardens in Brazil. Malaria infection was evaluated by the association of direct examination of blood smears with amplification of the 18SSU rRNA gene of the Plasmodium genus, demonstrating an overall occurrence of 36%. Most infected bird species were Amazona aestiva (28/73), Ara ararauna (6/10), and Amazona amazonica (3/10). The low parasitemias observed among the infected birds suggest a chronic infection. The sequence analyses of 10 isolates indicate a potential occurrence of four distinct Plasmodium lineages. These findings provide new data on malarial infection in captive psittacine birds, and emphasize the need for better control of importation and exportation of these birds. PMID:18937986

  6. Direct application to dairy foods of a Listeria-specific oligonucleotide probe to 16S rRNA.

    PubMed

    Brooks, J L; Back, J P; Kroll, R G

    1992-08-01

    A potentially Listeria-specific 28 base oligonucleotide probe was designed from 16S rRNA sequence data. Using either 32P or non-radioactive (alkaline phosphatase) labels, the probe was shown to be highly specific as it hybridised to RNA extracted from all of the species of Listeria but not to any of the other bacteria tested. Both probe methods were highly sensitive and ca 10(2) cfu/ml Listeria could be detected in pure cultures. A rapid procedure for extracting RNA from milk, Camembert and cottage cheese was developed. This allowed the direct application of the probe to these foods and gave a rapid and specific method of detecting > 10(2) cfu/g or ml Listeria in these foods. PMID:1280986

  7. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  8. Bacillus plakortidis sp. nov. and Bacillus murimartini sp. nov., novel alkalitolerant members of rRNA group 6.

    PubMed

    Borchert, Martin S; Nielsen, Preben; Graeber, Ingeborg; Kaesler, Ines; Szewzyk, Ulrich; Pape, Thomas; Antranikian, Garabed; Schäfer, Thomas

    2007-12-01

    The Gram-positive, alkali- and salt-tolerant marine bacterium strain P203(T) is described together with its closest phylogenetic neighbour, terrestrial isolate LMG 21005(T). Strain P203(T) was isolated from material from the sponge Plakortis simplex that was obtained from the Sula-Ridge, Norwegian Sea. Strain LMG 21005(T) was an undescribed strain that was isolated from a church wall mural in Germany. Strains P203(T) and LMG 21005(T) were identified as novel alkalitolerant members of the Bacillus rRNA group 6 with a 16S rRNA gene sequence similarity of 99.5 %. The closest described neighbour, Bacillus gibsonii DSM 8722(T), showed 99.0 % gene sequence similarity with P203(T) and 98.8 % similarity with strain LMG 21005(T). Despite the high 16S rRNA gene sequence similarity, DNA-DNA cross-hybridization revealed only 25.8-34.1 % similarity amongst the three strains. The DNA G+C contents were 41.1 mol% for strain P203(T) and 39.6 mol% for strain LMG 21005(T). Both strains grew well between pH 7 and pH 11. Strain P203(T) showed growth at moderate temperatures (from 4 to 30 degrees C) and in the presence of up to 12 % (w/v) NaCl at pH 9.7, whereas strain LMG 21005(T) was not salt tolerant (up to 4 % NaCl) and no growth was observed at 4 degrees C. The major fatty acids of strains P203(T), LMG 21005(T) and the type strain of B. gibsonii were the saturated terminally methyl-branched compounds iso-C(15 : 0) (19.8, 15.6 and 28.0 %, respectively) and anteiso-C(15 : 0) (57.1, 48.6 and 45.2 %, respectively). Physiological and biochemical tests allowed genotypic and phenotypic differentiation of strains P203(T) and LMG 21005(T) from the six related Bacillus species with validly published names and supported the proposal of two novel species, Bacillus plakortidis [type strain P203(T) (=DSM 19153(T)=NCIMB 14288(T))] and Bacillus murimartini [type strain LMG 21005(T) (=NCIMB 14102(T))]. PMID:18048744

  9. Interordinal mammalian relationships: evidence for paenungulate monophyly is provided by complete mitochondrial 12S rRNA sequences.

    PubMed

    Lavergne, A; Douzery, E; Stichler, T; Catzeflis, F M; Springer, M S

    1996-10-01

    The complete mitochondrial 12S rRNA sequences of 5 placental mammals belonging to the 3 orders Sirenia, Proboscidea, and Hyracoidea are reported together with phylogenetic analyses (distance and parsimony) of a total of 51 mammalian orthologues. This 12S rRNA database now includes the 2 extant proboscideans (the African and Asiatic elephants Loxodonta africana and Elephas maximus), 2 of the 3 extant sirenian genera (the sea cow Dugong dugon and the West Indian manatee Trichechus manatus), and 2 of the 3 extant hyracoid genera (the rock and tree hyraxes Procavia capensis and Dendrohyrax dorsalis). The monophyly of the 3 orders Sirenia, Proboscidea, and Hyracoidea is supported by all kinds of analysis. There are 23 and 3 diagnostic subsitutions shared by the 2 proboscideans and the 2 hyracoids, respectively, but none by the 2 sirenians. The 2 proboscideans exhibit the fastest rates of 12S rRNA evolution among the 11 placental orders studied. Based on various taxonomic sampling methods among eutherian orders and marsupial outgroups, the most strongly supported clade in our comparisons clusters together the 3 orders Sirenia, Proboscidea, and Hyracoidea in the superorder Paenungulata. Within paenungulates, the grouping of sirenians and proboscideans within the mirorder Tethytheria is observed. This branching pattern is supported by all analyses by high bootstrap percentages (BPs) and decay indices. When only one species is selected per order or suborder, the taxonomic sampling leads to a relative variation in bootstrap support of 53% for Tethytheria (BPs ranging from 44 to 93%) and 7% for Paernungulata (92-99%). When each order or suborder is represented by two species, this relative variation decreased to 10% for Tethytheria (78-87%) and 3% for Paenungulata (96-99%). Two nearly exclusive synapomorphies for paenungulates are identified in the form of one transitional compensatory change, but none were detected for tethytherians. Such a robust and reliable resolution of

  10. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

    PubMed

    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina

    2016-05-15

    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. PMID:27084467

  11. 16S rRNA genes reveal stratified open ocean bacterioplankton populations related to the Green Non-Sulfur bacteria.

    PubMed Central

    Giovannoni, S J; Rappé, M S; Vergin, K L; Adair, N L

    1996-01-01

    Microorganisms play an important role in the biogeochemistry of the ocean surface layer, but spatial and temporal structures in the distributions of specific bacterioplankton species are largely unexplored, with the exceptions of those organisms that can be detected by either autofluorescence or culture methods. The use of rRNA genes as genetic markers provides a tool by which patterns in the growth, distribution, and activity of abundant bacterioplankton species can be studied regardless of the ease with which they can be cultured. Here we report an unusual cluster of related 16S rRNA genes (SAR202, SAR263, SAR279, SAR287, SAR293, SAR307) cloned from seawater collected at 250 m in the Sargasso Sea in August 1991, when the water column was highly stratified and the deep chlorophyll maximum was located at a depth of 120 m. Phylogenetic analysis and an unusual 15-bp deletion confirmed that the genes were related to the Green Non-Sulfur phylum of the domain Bacteria. This is the first evidence that representatives of this phylum occur in the open ocean. Oligonucleotide probes were used to examine the distribution of the SAR202 gene cluster in vertical profiles (0-250 m) from the Atlantic and Pacific Oceans, and in discrete (monthly) time series (O and 200 m) (over 30 consecutive months in the Western Sargasso Sea. The data provide robust statistical support for the conclusion that the SAR202 gene cluster is proportionately most abundant at the lower boundary of the deep chlorophyll maximum (P = 2.33 x 10(-5)). These results suggest that previously unsuspected stratification of microbial populations may be a significant factor in the ecology of the ocean surface layer. Images Fig. 4 PMID:8755588

  12. Monitoring Bacterial Communities in Raw Milk and Cheese by Culture-Dependent and -Independent 16S rRNA Gene-Based Analyses▿

    PubMed Central

    Delbès, Céline; Ali-Mandjee, Leila; Montel, Marie-Christine

    2007-01-01

    The diversity and dynamics of bacterial populations in Saint-Nectaire, a raw-milk, semihard cheese, were investigated using a dual culture-dependent and direct molecular approach combining single-strand conformation polymorphism (SSCP) fingerprinting and sequencing of 16S rRNA genes. The dominant clones, among 125 16S rRNA genes isolated from milk, belonged to members of the Firmicutes (58% of the total clones) affiliated mainly with the orders Clostridiales and the Lactobacillales, followed by the phyla Proteobacteria (21.6%), Actinobacteria (16.8%), and Bacteroidetes (4%). Sequencing the 16S rRNA genes of 126 milk isolates collected from four culture media revealed the presence of 36 different species showing a wider diversity in the Gammaproteobacteria phylum and Staphylococcus genus than that found among clones. In cheese, a total of 21 species were obtained from 170 isolates, with dominant species belonging to the Lactobacillales and subdominant species affiliated with the Actinobacteria, Bacteroidetes (Chryseobacterium sp.), or Gammaproteobacteria (Stenotrophomonas sp.). Fingerprinting DNA isolated from milk by SSCP analysis yielded complex patterns, whereas analyzing DNA isolated from cheese resulted in patterns composed of a single peak which corresponded to that of lactic acid bacteria. SSCP fingerprinting of mixtures of all colonies harvested from plate count agar supplemented with crystal violet and vancomycin showed good potential for monitoring the subdominant Proteobacteria and Bacteroidetes (Flavobacteria) organisms in milk and cheese. Likewise, analyzing culturable subcommunities from cheese-ripening bacterial medium permitted assessment of the diversity of halotolerant Actinobacteria and Staphylococcus organisms. Direct and culture-dependent approaches produced complementary information, thus generating a more accurate view of milk and cheese microbial ecology. PMID:17259356

  13. From learning taxonomies to phylogenetic learning: Integration of 16S rRNA gene data into FAME-based bacterial classification

    PubMed Central

    2010-01-01

    Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for

  14. Diversity of endophytic bacteria in Malaysian plants as revealed by 16S rRNA encoding gene sequence based method of bacterial identification☆

    PubMed Central

    Loh, Chye Ying; Tan, Yin Yin; Rohani, Rahim; Weber, Jean-Frédéric F.; Bhore, Subhash Janardhan

    2013-01-01

    Bacterial endophytes do have several potential applications in pharmacy, medicine and agricultural biotech industry. The main objective of this study was to understand types of bacterial endophytes associated with dicotyledonous (dicot) and monocotyledonous (monocot) plant species. Isolation of the endophytic bacteria was performed using surface-sterilized various tissue samples, and identification of the endophytic bacterial isolates (EBIs) was completed using 16S rRNA encoding gene sequence similarity based method. In total, 996 EBIs were isolated and identified from 1055 samples of 31 monocot and 65 dicot plant species from Peninsular Malaysia. The 996 EBIs represented 71 different types of bacterial species. Twelve (12) out of 71 species are reported as endophytes for the first time. We conclude that diverse types of bacterial endophytes are associated with dicot and monocot plants, and could be useful in pharmacy, medicine and agricultural biotechnology for various potential applications. PMID:24396249

  15. Molecular analysis of 18S rRNA gene of Cryptosporidium parasites from patients living in Iran, Malawi, Nigeria and Vietnam.

    PubMed

    Ghaffari, Salman; Kalantari, Narges

    2012-01-01

    Cryptosporidium species are one of the most common causes of gastrointestinal infection in humans around the world. This study has aimed to investigate the hyper variable region of the 18S rRNA gene in Cryptosporidium for exact parasite identification. DNA was extracted from 26 fecal samples from which initially Cryptosporidium oocysts were identified by Ziehl-Neelsen acid-fast , Auramine phenol and ELISA techniques. Nested PCR, targeting the most polymorphic region of the 18S rRNA gene and genotyping was performed by restriction endonuclease digestion of the PCR product followed by nucleotide sequencing and phylogenic analysis. Among 26 isolates analyzed, three species of Cryptosporidium were identified; 38.5% of the isolates were C. hominis while 53.8% of the isolates were C. parvum and 7.7% of the isolates were C. meleagridis, which the last two species have the potentially zoonotic transmission. The only 11T subtype of C. hominis was demonstrated. These strains clustered distinctly into either human or animal origin regardless of the geographical origin, age, or immunity status of the patients. In summary, this work is the first report of C. meleagridis infecting human in Iran. Moreover, it suggested that multi-locus study of Cryptosporidium species in developing countries would be necessary to determine the extent of transmission of cryptosporidiosis in the populations. PMID:24551771

  16. Morphology, ontogenetic features and SSU rRNA gene-based phylogeny of a soil ciliate, Bistichella cystiformans spec. nov. (Protista, Ciliophora, Stichotrichia).

    PubMed

    Fan, Yangbo; Hu, Xiaozhong; Gao, Feng; Al-Farraj, Saleh A; Al-Rasheid, Khaled A S

    2014-12-01

    The morphology, ontogeny and SSU rRNA gene-based phylogeny of Bistichella cystiformans spec. nov., isolated from the slightly saline soil of a mangrove wetland in Zhanjiang, southern China, were investigated. The novel species was characterized by having five to eight buccal cirri arranged in a row, three to five transverse cirri, four macronuclear nodules aligned, and 17-32 and 20-34 cirri in frontoventral rows V and VI, respectively, both extending to the transverse cirri. The main ontogenetic features of the novel species were as follows: (1) the parental adoral zone of the membranelles is completely inherited by the proter; (2) the frontoventral and transverse cirri are formed in a six-anlagen mode; (3) basically, the frontal-ventral-transverse cirral anlagen II-V generate one transverse cirrus each at their posterior ends, while anlage VI provides no transverse cirrus; (4) both marginal rows and dorsal kineties develop intrakinetally, no dorsal kinety fragment is formed; and (5) the macronuclear nodules fuse into a single mass at the middle stage. Phylogenetic analyses based on the SSU rRNA gene showed that the novel species groups with the clade containing Bistichella variabilis, Parabistichella variabilis, Uroleptoides magnigranulosus and two species of the genus Orthoamphisiella. Given present knowledge, it was considered to be still too early to come to a final conclusion regarding the familial classification of the genus Bistichella; further investigations of key taxa with additional molecular markers are required. PMID:25242538

  17. Mutations of mitochondrial 12S rRNA in gastric carcinoma and their significance

    PubMed Central

    Han, Cheng-Bo; Ma, Jia-Ming; Xin, Yan; Mao, Xiao-Yun; Zhao, Yu-Jie; Wu, Dong-Ying; Zhang, Su-Min; Zhang, Yu-Kui

    2005-01-01

    AIM: To detect the variations of mitochondrial 12S rRNA in patients with gastric carcinoma, and to study their significance and the relationship between these variations and the genesis of gastric carcinoma. METHODS: PCR amplified mitochondrial 12S rRNA of 44 samples including 22 from gastric carcinoma tissues and 22 from adjacent normal tissues, was detected by direct DNA sequencing. Then laser capture microdissection technique (LCM) was used to separate the cancerous cells and dysplasia cells with specific mutations. Denaturing high performance liquid chromatography (DHPLC) plus allele-specific PCR (AS-PCR), nest-PCR and polyacrylamide gel electrophoresis (PAGE) were used to further evaluate this mutant property and quantitative difference of mutant type between cancerous and dysplasia cells. Finally, RNAdraw biosoft was used to analyze the RNA secondary structure of mutant-type 12S rRNA. RESULTS: Compared with Mitomap database, some new variations were found, among which np652 G insertion and np716 T-G transversion were found only in cancerous tissues. There was a statistic difference in the frequency of 12S rRNA variation between intestinal type (12/17, 70.59%) and diffusive type (5/17, 29.41%) of gastric carcinoma (P<0.05). DHPLC analysis showed that 12S rRNA np652 G insertion and np716 T-G transversion were heteroplasmic mutations. The frequency of 12S rRNA variation in cancerous cells was higher than that in dysplasia cells (P<0.01). 12S rRNA np652 G insertion showed obviously negative effects on the stability of 12S rRNA secondary structure, while others such as T-G transversion did not. CONCLUSION: The mutations of mitochondrial 12S rRNA may be associated with the occurrence of intestinal-type gastric carcinoma. Most variations exist both in gastric carcinomas and in normal tissues, and they might not be the characteristics of tumors. However, np652 G insertion and np716 T-G transversion may possess some molecular significance in gastric carcinogenesis

  18. Development and Validation of an Improved PCR Method Using the 23S-5S Intergenic Spacer for Detection of Rickettsiae in Dermacentor variabilis Ticks and Tissue Samples from Humans and Laboratory Animals

    PubMed Central

    Kakumanu, Madhavi L.; Ponnusamy, Loganathan; Sutton, Haley T.; Meshnick, Steven R.; Nicholson, William L.

    2016-01-01

    A novel nested PCR assay was developed to detect Rickettsia spp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) of Rickettsia spp. The newly designed primers were evaluated using genomic DNA from 11 Rickettsia species belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to other Rickettsia-specific PCR targets (ompA, gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11 Rickettsia spp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from “Candidatus Rickettsia amblyommii.” Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adult Dermacentor variabilis ticks. The nested 23S-5S IGS assay detected Rickettsia DNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species of Rickettsia. The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species of Rickettsia in the ticks. “Candidatus Rickettsia amblyommii,” R. montanensis, R. felis, and R. bellii were frequently identified species, along with some potentially novel Rickettsia strains that were closely related to R. bellii and R. conorii. PMID:26818674

  19. Genetic variation and identification of cultivated Fallopia multiflora and its wild relatives by using chloroplast matK and 18S rRNA gene sequences.

    PubMed

    Yan, Ping; Pang, Qi-Hua; Jiao, Xu-Wen; Zhao, Xuan; Shen, Yan-Jing; Zhao, Shu-Jin

    2008-10-01

    FALLOPIA MULTIFLORA (Thunb.) Harald . has been widely and discriminatingly used in China for the study and treatment of anemia, swirl, deobstruent, pyrosis, insomnia, amnesia, atheroma and also for regulating immune functions. However, there is still confusion about the herbal drug's botanical origins and the phylogenetic relationship between the cultivars and the wild relatives. In order to develop an efficient method for identification, a molecular analysis was performed based on 18 S rRNA gene and partial MATK gene sequences. The 18 S rRNA gene sequences of F. MULTIFLORA were 1809 bp in length and were highly conserved, indicating that the cultivars and the wild F. MULTIFLORA have the same botanical origin. Based on our 18 S rRNA gene sequences analysis, F. MULTIFLORA could be easily distinguished at the DNA level from adulterants and some herbs with similar components. The MATK gene partial sequences were found to span 1271 bp. The phylogenetic relation of F. MULTIFLORA based on the MATK gene showed that all samples in this paper were divided into four clades. The sequences of the partial MATK gene had many permutations, which were related to the geographical distributions of the samples. MATK gene sequences provided valuable information for the identification of F. MULTIFLORA. New taxonomic information could be obtained to authenticate the botanical origin of the F. MULTIFLORA, the species and the medicines made of it. PMID:18759218

  20. Identification of coagulase-negative staphylococci isolated from ovine milk samples by PCR-RFLP of 16S rRNA and gap genes.

    PubMed

    Onni, T; Sanna, G; Cubeddu, G P; Marogna, G; Lollai, S; Leori, G; Tola, S

    2010-08-26

    The identification of coagulase-negative staphylococci (CNS) causing ovine infections remains problematic, although these bacteria are considered the main etiologic agents of subclinical mastitis in sheep and goats. In this study, 226 CNS isolates were collected from 2201 milking sarda sheep belonging to 15 flocks with high somatic cell count scores. All isolates were subjected to identification with the API Staph ID test, and then to the amplification of staphylococcal 16S rRNA and gap genes by PCR assays. The gap gene was subjected to restriction fragment length polymorphism analysis with the restriction endonuclease AluI, whereas the 16S rRNA gene was subjected to ribosomal fingerprinting with the restriction endonucleases RsaI, PstI and AluI. When PCR-RFLP patterns of CNS isolates were different from those of their reference strains, gap gene amplicons were sequenced for definitive identification. The API Staph ID test, in alternative to the genotypic identification method, produced considerably different results in terms of species identified within each group. Using the PCR-RFLP assay, most of the isolates clustered together with the Staphylococcus epidermidis type strain (131, corresponding to 57.9%), followed by S. caprae (34, corresponding to 15%) and S. chromogenes (30, corresponding to 13.2%). In conclusion, the PCR-RFLP assay of 16S rRNA and gap genes is a more reliable and reproducible method than the API Staph ID test for the identification of CNS causing sheep mastitis. PMID:20167442

  1. Molecular dissection of the rDNA array and of the 5S rDNA gene in Meloidogyne artiellia: phylogenetic and diagnostic implications.

    PubMed

    Veronico, Pasqua; De Luca, Francesca; De Giorgi, Carla

    2004-06-01

    The sequence of a 13.423 nucleotide genomic fragment has been determined for the plant parasitic nematode Meloidogyne artiellia. It contains an entire rDNA cluster, the bordering intergenic regions and portions of the flanking coding regions. The sequence analysis of the rDNA repeats suggests homogeneity in M. artiellia, thus providing a further indication of the usefulness of these genes for the diagnostic identification of this species. The comparison of the secondary structures of the internal transcribed spacer 2 region in several Meloidogyne species indicates that RNA folding predictions can be used as a tool of potential diagnostic relevance. The other ribosomal gene, 5S rDNA, has been demonstrated to be functional and located near the trans-spliced leader sequences, in the same arrangement found in the distantly related nematode Caenorhabditis elegans but never in other Meloidogyne thus providing species-specific markers for the identification of several Thylenchida parasitic nematodes. PMID:15135452

  2. Two spatially separated phases in semiconducting Rb0.8Fe1.5S2

    DOE PAGESBeta

    Wang, Meng; Tian, Wei; Valdivia, P.; Chi, Songxue; Bourret-Courchesne, E.; Dai, Pengcheng; Birgeneau, R. J.

    2014-09-26

    We report neutron scattering and transport measurements on semiconducting Rb0.8Fe1.5S2, a compound isostructural and isoelectronic to the well-studied A0.8FeySe2(A = K, Rb, Cs, Tl/K) superconducting systems. Both resistivity and DC susceptibility measurements reveal a magnetic phase transition at T = 275 K. Neutron diffraction studies show that the 275 K transition originates from a phase with rhombic iron vacancy order which exhibits an in-plane stripe antiferromagnetic ordering below 275 K. In addition, the stripe antiferromagnetic phase interdigitates mesoscopically with an ubiquitous phase with √5 x√5 iron vacancy order. This phase has a magnetic transition at TN = 425 K andmore » an iron vacancy order-disorder transition at TS = 600 K. These two different structural phases are closely similar to those observed in the isomorphous Se materials. Based on the close similarities of the in-plane antiferromagnetic structures, moments sizes, and ordering temperatures in semiconducting Rb0.8Fe1.5S2 and K0.81Fe1.58Se2, we argue that the in-plane antiferromagnetic order arises from strong coupling between local moments. Superconductivity, previously observed in the A0.8FeySe2₋ zSz system, is absent in A0.8Fe1.5S2, which has a semiconducting ground state. We discuss the implied relationship between stripe and block antiferromagnetism and superconductivity in these materials as well as a strategy for further investigation.« less

  3. Mutations in 23S rRNA and Ribosomal Protein L4 Account for Resistance in Pneumococcal Strains Selected In Vitro by Macrolide Passage

    PubMed Central

    Tait-Kamradt, A.; Davies, T.; Cronan, M.; Jacobs, M. R.; Appelbaum, P. C.; Sutcliffe, J.

    2000-01-01

    The mechanisms responsible for macrolide resistance in Streptococcus pneumoniae mutants, selected from susceptible strains by serial passage in azithromycin, were investigated. These mutants were resistant to 14- and 15-membered macrolides, but resistance could not be explained by any clinically relevant resistance determinant [mef(A), erm(A), erm(B), erm(C), erm(TR), msr(A), mph(A), mph(B), mph(C), ere(A), ere(B)]. An investigation into the sequences of 23S rRNAs in the mutant and parental strains revealed individual changes of C2611A, C2611G, A2058G, and A2059G (Escherichia coli numbering) in four mutants. Mutations at these residues in domain V of 23S rRNA have been noted to confer erythromycin resistance in other species. Not all four 23S rRNA alleles have to contain the mutation to confer resistance. Some of the mutations also confer coresistance to streptogramin B (C2611A, C2611G, and A2058G), 16-membered macrolides (all changes), and clindamycin (A2058G and A2059G). Interestingly, none of these mutations confer high-level resistance to telithromycin (HMR-3647). Further, two of the mutants which had no changes in their 23S rRNA sequences had changes in a highly conserved stretch of amino acids (63KPWRQKGTGRAR74) in ribosomal protein L4. One mutant contained a single amino acid change (G69C), while the other mutant had a 6-base insert, resulting in two amino acids (S and Q) being inserted between amino acids Q67 and K68. To our knowledge, this is the first description of mutations in 23S rRNA genes or ribosomal proteins in macrolide-resistant S. pneumoniae strains. PMID:10898684

  4. 16S rRNA Gene Sequence-Based Identification of Bacteria in Automatically Incubated Blood Culture Materials from Tropical Sub-Saharan Africa

    PubMed Central

    Schwarz, Norbert Georg; Hahn, Andreas; Boahen, Kennedy; Sarpong, Nimako; Adu-Sarkodie, Yaw; Halbgewachs, Eva; Marks, Florian; von Kalckreuth, Vera; Poppert, Sven; Loderstaedt, Ulrike; May, Jürgen; Hagen, Ralf Matthias

    2015-01-01

    Background The quality of microbiological diagnostic procedures depends on pre-analytic conditions. We compared the results of 16S rRNA gene PCR and sequencing from automatically incubated blood culture materials from tropical Ghana with the results of cultural growth after automated incubation. Methods Real-time 16S rRNA gene PCR and subsequent sequencing were applied to 1500 retained blood culture samples of Ghanaian patients admitted to a hospital with an unknown febrile illness after enrichment by automated culture. Results Out of all 1500 samples, 191 were culture-positive and 98 isolates were considered etiologically relevant. Out of the 191 culture-positive samples, 16S rRNA gene PCR and sequencing led to concordant results in 65 cases at species level and an additional 62 cases at genus level. PCR was positive in further 360 out of 1309 culture-negative samples, sequencing results of which suggested etiologically relevant pathogen detections in 62 instances, detections of uncertain relevance in 50 instances, and DNA contamination due to sample preparation in 248 instances. In two instances, PCR failed to detect contaminants from the skin flora that were culturally detectable. Pre-analytical errors caused many Enterobacteriaceae to be missed by culture. Conclusions Potentially correctable pre-analytical conditions and not the fastidious nature of the bacteria caused most of the discrepancies. Although 16S rRNA gene PCR and sequencing in addition to culture led to an increase in detections of presumably etiologically relevant blood culture pathogens, the application of this procedure to samples from the tropics was hampered by a high contamination rate. Careful interpretation of diagnostic results is required. PMID:26270631

  5. Magic wavelengths for the 5 s -18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, E. A.; Norris, D. G.; Koller, S. B.; Wyllie, R.; Brown, R. C.; Porto, J. V.; Safronova, U. I.; Safronova, M. S.

    2015-03-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s -18 s transition of rubidium, and compare the calculation to experiment by measuring the light shift for atoms held in an optical dipole trap at a range of wavelengths near a calculated magic value.

  6. Nucleotide sequences of 5S ribosomal RNA from four oomycete and chytrid water molds.

    PubMed

    Walker, W F; Doolittle, W F

    1982-09-25

    The nucleotide sequences of the 5S rRNAs of the oomycete water molds Saprolegnia ferax and Pythium hydnosporum and of the chytrid water molds Blastocladiella simplex and Phlyctochytrium irregulare were determined by chemical and enzymatic partial degradation of 3' and 5' end-labelled molecules, followed by gel sequence analysis. The two oomycete sequences differed in 24 positions and the two chytrid sequences differed in 27 positions. These pairs differed in a mean of 44 positions. The chytrid sequences clearly most resemble the sequence from the zygomycete Phycomyces, while the oomycete sequences appear to be allied with those from protozoa and slime molds. PMID:6890670

  7. Minimally invasive L5-S1 oblique lumbar interbody fusion with anterior plate.

    PubMed

    Pham, Martin H; Jakoi, Andre M; Hsieh, Patrick C

    2016-07-01

    Lumbar interbody fusion is an important technique for the treatment of degenerative disc disease and degenerative scoliosis. The oblique lumbar interbody fusion (OLIF) establishes a minimally invasive retroperitoneal exposure anterior to the psoas and lumbar plexus. In this video case presentation, the authors demonstrate the techniques of the OLIF at L5-S1 performed on a 69-year-old female with degenerative scoliosis as one component of an overall strategy for her deformity correction. The video can be found here: https://youtu.be/VMUYWKLAl0g . PMID:27364428

  8. Comparative sequence analyses on the 16S rRNA (rDNA) of Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus and proposal for creation of a new genus, Alicyclobacillus gen. nov

    NASA Technical Reports Server (NTRS)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.; Deinhard, G.; Poralla, K.

    1992-01-01

    Comparative 16S rRNA (rDNA) sequence analyses performed on the thermophilic Bacillus species Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus revealed that these organisms are sufficiently different from the traditional Bacillus species to warrant reclassification in a new genus, Alicyclobacillus gen. nov. An analysis of 16S rRNA sequences established that these three thermoacidophiles cluster in a group that differs markedly from both the obligately thermophilic organisms Bacillus stearothermophilus and the facultatively thermophilic organism Bacillus coagulans, as well as many other common mesophilic and thermophilic Bacillus species. The thermoacidophilic Bacillus species B. acidocaldarius, B. acidoterrestris, and B. cycloheptanicus also are unique in that they possess omega-alicylic fatty acid as the major natural membranous lipid component, which is a rare phenotype that has not been found in any other Bacillus species characterized to date. This phenotype, along with the 16S rRNA sequence data, suggests that these thermoacidophiles are biochemically and genetically unique and supports the proposal that they should be reclassified in the new genus Alicyclobacillus.

  9. Differentiation of Phylogenetically Related Slowly Growing Mycobacteria Based on 16S-23S rRNA Gene Internal Transcribed Spacer Sequences

    PubMed Central

    Roth, Andreas; Fischer, Marga; Hamid, Mohamed E.; Michalke, Sabine; Ludwig, Wolfgang; Mauch, Harald

    1998-01-01

    Interspecific polymorphisms of the 16S rRNA gene (rDNA) are widely used for species identification of mycobacteria. 16S rDNA sequences, however, do not vary greatly within a species, and they are either indistinguishable in some species, for example, in Mycobacterium kansasii and M. gastri, or highly similar, for example, in M. malmoense and M. szulgai. We determined 16S-23S rDNA internal transcribed spacer (ITS) sequences of 60 strains in the genus Mycobacterium representing 13 species (M. avium, M. conspicuum, M. gastri, M. genavense, M. kansasii, M. malmoense, M. marinum, M. shimoidei, M. simiae, M. szulgai, M. triplex, M. ulcerans, and M. xenopi). An alignment of these sequences together with additional sequences available in the EMBL database (for M. intracellulare, M. phlei, M. smegmatis, and M. tuberculosis) was established according to primary- and secondary-structure similarities. Comparative sequence analysis applying different treeing methods grouped the strains into species-specific clusters with low sequence divergence between strains belonging to the same species (0 to 2%). The ITS-based tree topology only partially correlated to that based on 16S rDNA, but the main branching orders were preserved, notably, the division of fast-growing from slowly growing mycobacteria, separate branching for M. simiae, M. genavense, and M. triplex, and distinct branches for M. xenopi and M. shimoidei. Comparisons of M. gastri with M. kansasii and M. malmoense with M. szulgai revealed ITS sequence similarities of 93 and 88%, respectively. M. marinum and M. ulcerans possessed identical ITS sequences. Our results show that ITS sequencing represents a supplement to 16S rRNA gene sequences for the differentiation of closely related species. Slowly growing mycobacteria show a high sequence variation in the ITS; this variation has the potential to be used for the development of probes as a rapid approach to mycobacterial identification. PMID:9431937

  10. Refinement of the spinal muscular atrophy locus to the interval between D5S435 and MAP1B

    SciTech Connect

    Soares, V.M.; Brzustowicz, L.M.; Kleyn, P.W.; Knowles, J.A.; Palmer, D.A.; Asokan, S.; Penchaszadeh, G.K.; Gilliam, T.C. ); Munsat, T.L. )

    1993-02-01

    The childhood-onset SMA locus has been mapped to chromosome 5q13, in a region bounded by the proximal locus, D5S6, and the closely linked distal loci, D5S112 and MAP1B. We now describe a highly polymorphic, tightly linked microsatellite marker (D5S435) that is very likely the closet proximal marker to the SMA locus. Multipoint linkage analysis firmly establishes the following order of markers at 5q13; centromere-D5S76-D5S6-D5S435-MAP1B/D5S112-D5S39-telomere. The data indicate that SMA resides in an approximately 0.7-cM (range 01.-2.1) region between D5S435 and MAP1B. This finding reduces by approximately fourfold the genetic region that most likely harbors the SMA locus and will facilitate the physical mapping and cloning of the disease gene region. 24 refs., 3 figs., 1 tab.

  11. Decreases in average bacterial community rRNA operon copy number during succession.

    PubMed

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  12. Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

    PubMed Central

    Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

    1996-01-01

    Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

  13. Tax4Fun: predicting functional profiles from metagenomic 16S rRNA data

    PubMed Central

    Aßhauer, Kathrin P.; Wemheuer, Bernd; Daniel, Rolf; Meinicke, Peter

    2015-01-01

    Motivation: The characterization of phylogenetic and functional diversity is a key element in the analysis of microbial communities. Amplicon-based sequencing of marker genes, such as 16S rRNA, is a powerful tool for assessing and comparing the structure of microbial communities at a high phylogenetic resolution. Because 16S rRNA sequencing is more cost-effective than whole metagenome shotgun sequencing, marker gene analysis is frequently used for broad studies that involve a large number of different samples. However, in comparison to shotgun sequencing approaches, insights into the functional capabilities of the community get lost when restricting the analysis to taxonomic assignment of 16S rRNA data. Results: Tax4Fun is a software package that predicts the functional capabilities of microbial communities based on 16S rRNA datasets. We evaluated Tax4Fun on a range of paired metagenome/16S rRNA datasets to assess its performance. Our results indicate that Tax4Fun provides a good approximation to functional profiles obtained from metagenomic shotgun sequencing approaches. Availability and implementation: Tax4Fun is an open-source R package and applicable to output as obtained from the SILVAngs web server or the application of QIIME with a SILVA database extension. Tax4Fun is freely available for download at http://tax4fun.gobics.de/. Contact: kasshau@gwdg.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25957349

  14. The impact of transcriptional tuning on in vitro integrated rRNA transcription and ribosome construction

    PubMed Central

    Fritz, Brian R.; Jewett, Michael C.

    2014-01-01

    In vitro ribosome construction could enable studies of ribosome assembly and function, provide a route toward constructing minimal cells for synthetic biology, and permit the construction of ribosome variants with new functions. Toward these long-term goals, we recently reported on an integrated, one-pot ribosomal RNA synthesis (rRNA), ribosome assembly, and translation technology (termed iSAT) for the construction of Escherichia coli ribosomes in crude ribosome-free S150 extracts. Here, we aimed to improve the activity of iSAT through transcriptional tuning. Specifically, we increased transcriptional efficiency through 3′ modifications to the rRNA gene sequences, optimized plasmid and polymerase concentrations, and demonstrated the use of a T7-promoted rRNA operon for stoichiometrically balanced rRNA synthesis and native rRNA processing. Our modifications produced a 45-fold improvement in iSAT protein synthesis activity, enabling synthesis of 429 ± 15 nmol/l green fluorescent protein in 6 h batch reactions. Further, we show that the translational activity of ribosomes purified from iSAT reactions is about 20% the activity of native ribosomes purified directly from E. coli cells. Looking forward, we believe iSAT will enable unique studies to unravel the systems biology of ribosome biogenesis and open the way to new methods for making and studying ribosomal variants. PMID:24792158

  15. Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces

    PubMed Central

    Orsi, William; Biddle, Jennifer F.; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface. PMID:23418556

  16. Interactions between 23S rRNA and tRNA in the ribosomal E site.

    PubMed Central

    Bocchetta, M; Xiong, L; Shah, S; Mankin, A S

    2001-01-01

    Interactions between tRNA or its analogs and 23S rRNA in the large ribosomal subunit were analyzed by RNA footprinting and by modification-interference selection. In the E site, tRNA protected bases G2112, A2392, and C2394 of 23S rRNA. Truncated tRNA, lacking the anticodon stem-loop, protected A2392 and C2394, but not G2112, and tRNA derivatives with a shortened 3' end protected only G2112, but not A2392 or C2394. Modification interference revealed C2394 as the only accessible nucleotide in 23S rRNA whose modification interferes with binding of tRNA in the large ribosomal subunit E site. The results suggest a direct contact between A76 of tRNA A76 and C2394 of 23S rRNA. Protections at G2112 may reflect interaction of this 23S rRNA region with the tRNA central fold. PMID:11214181

  17. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    NASA Astrophysics Data System (ADS)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-03-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

  18. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure.

    PubMed

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30-70 K in pressure range of 100-170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50-70 K in pressure range of 100-150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  19. Magnetization reversal phenomena in (Cr0.70Ti0.30)5S6

    NASA Astrophysics Data System (ADS)

    Hashimoto, Satoshi; Matsuda, Yuji; Sato, Tetsuya; Anzai, Shuichiro

    2005-12-01

    Magnetization reversal phenomena (MRP) along magnetic order-order transitions have recently been reported on impurity-doped magnetic systems. Because imperfect long-range magnetic order exists in these systems, it is expected that a systematic investigation of MRP will give physical information on thermomagnetic processes of magnetic systems in the range from the micro- to nanoscales. As a typical order-order transition (a state doubly modulated by helical and canting orders to a collinear ferrimagnetic state) has been known to occur on Cr5S6 at a transition temperature Tt, we investigate the magnetizations of (Cr0.70Ti0.30)5S6 on heating and cooling runs in various magnetic fields. At 20Oe, the field-cooled magnetization just below the Curie temperature has a positive sign; the sign turns negative below the compensation temperature TCM (first step) and finally returns to positive below Tt (second step). The first-step MRP observed in this system is explained by the potential barriers resulting from anisotropy energy when the preferred direction of collinear ferrimagnetic moment reverses. The proposed mechanism for second-step MRP is the pinning effect caused by the impurity atoms (Ti) in the helical long-range-order chains. Comparing other examples of MRPs, we discuss the roles of local impurity centers in the thermomagnetic process in magnetic order-order transitions.

  20. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    PubMed Central

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  1. Homology of the 3' terminal sequences of the 18S rRNA of Bombyx mori and the 16S rRNA of Escherchia coli.

    PubMed Central

    Samols, D R; Hagenbuchle, O; Gage, L P

    1979-01-01

    The terminal 220 base pairs (bp) of the gene for 18S rRNA and 18 bp of the adjoining spacer rDNA of the silkworm Bombyx mori have been sequenced. Comparison with the sequence of the 16S rRNA gene of Escherichia coli has shown that a region including 45 bp of the B. mori sequence at the 3' end is remarkably homologous with the 3' terminal E. coli sequence. Other homologies occur in the terminal regions of the 18S and 16S rRNAs, including a perfectly conserved stretch of 13 bp within a longer homology located 150--200 bp from the 3' termini. These homologies are the most extensive so far reported between prokaryotic and eukaryotic genomic DNA. Images PMID:390496

  2. Microbiological and 16S rRNA analysis of sulphite-reducing clostridia from river sediments in central Italy

    PubMed Central

    Marcheggiani, Stefania; Iaconelli, Marcello; D'angelo, Annamaria; Pierdominici, Elio; La Rosa, Giuseppina; Muscillo, Michele; Equestre, Michele; Mancini, Laura

    2008-01-01

    's presence in all sampling sites, and in both seasons, coupled with its detectability using commercial diagnostic kits. The study also illustrates the presence of an anaerobic community of considerable biodiversity in the lower Tiber basin, with C. perfringens as its main component. The 16S rRNA analysis, while confirming the phylogenetic relationships among isolated species, also showed haplotype patterns different from those present in the NCBI database. PMID:18842132

  3. Development and evaluation of a 28S rRNA gene-based nested PCR assay for P. falciparum and P. vivax

    PubMed Central

    Pakalapati, Deepak; Garg, Shilpi; Middha, Sheetal; Acharya, Jyoti; Subudhi, Amit K; Boopathi, Arunachalam P; Saxena, Vishal; Kochar, Sanjay K; Kochar, Dhanpat K; Das, Ashis

    2013-01-01

    The 28S rRNA gene was amplified and sequenced from P. falciparum and P. vivax isolates collected from northwest India. Based upon the sequence diversity of the Plasmodium 28SrRNA gene in comparison with its human counterpart, various nested polymerase chain reaction (PCR) primers were designed from the 3R region of the 28SrRNA gene and evaluated on field isolates. This is the first report demonstrating the utility of this gene for species-specific diagnosis of malaria for these two species, prevalent in India. The initial evaluation on 363 clinical isolates indicated that, in comparison with microscopy, which showed sensitivity and specificity of 85.39% and 100% respectively, the sensitivity and specificity of the nested PCR assay was found to be 99.08% and 100% respectively. This assay was also successful in detecting mixed infections that are undetected by microscopy. Our results demonstrate the utility of the 28S rRNA gene as a diagnostic target for the detection of the major plasmodial species infecting humans. PMID:23816509

  4. Differentiation of Listeria monocytogenes and Listeria innocua by 16S rRNA genes and intraspecies discrimination of Listeria monocytogenes strains by random amplified polymorphic DNA polymorphisms.

    PubMed Central

    Czajka, J; Bsat, N; Piani, M; Russ, W; Sultana, K; Wiedmann, M; Whitaker, R; Batt, C A

    1993-01-01

    Differences in the 16S rRNA genes (16S rDNA) which can be used to discriminate Listeria monocytogenes from Listeria innocua have been detected. The 16S rDNA were amplified by polymerase chain reaction with a set of oligonucleotide primers which flank a 1.5-kb fragment. Sequence differences were observed in the V2 region of the 16S rDNA both between L. monocytogenes Scott A and L. innocua and between different L. monocytogenes serotypes. Although L. monocytogenes SLCC2371 had the same V2 region sequence as L. innocua, the two species were different within the V9 region at nucleotides 1259 and 1292, in agreement with previous studies (R.-F. Wang, W.-W. Cao, and M.G. Johnson, Appl. Environ. Microbiol. 57:3666-3670, 1991). Intraspecies discrimination of L. monocytogenes strains was achieved by using the patterns generated by random amplified polymorphic DNA primers. Although some distinction can be made within the L. monocytogenes species by their 16S rDNA sequence, a far greater discrimination within species could be made by generating random amplified polymorphic DNA patterns from chromosomal DNA. By using a number of 10-bp primers, unique patterns for each isolate which in all cases examined differentiate between various L. monocytogenes serotypes, even though they may have the same 16S rRNA sequences, could be generated. Images PMID:8439157

  5. Rapid Origin Determination of the Northern Mauxia Shrimp (Acetes chinensis) Based on Allele Specific Polymerase Chain Reaction of Partial Mitochondrial 16S rRNA Gene

    PubMed Central

    Kang, Jung-Ha; Noh, Eun-Soo; Park, Jung-Youn; An, Chel-Min; Choi, Jung-Hwa; Kim, Jin-Koo

    2015-01-01

    Acetes chinensis is an economically important shrimp that belongs to the Sergestidae family; following fermentation, A. chinensis′ economic value, however, is low in China, and much of the catch in China is exported to Korea at a low price, thus leading to potential false labeling. For this reason, we developed a simple method to identify A. chinensis′ origin using allele-specific polymerase chain reaction (PCR). Ten single nucleotide polymorphisms (SNPs) were identified from partial (i.e., 570 bp) DNA sequence analysis of the mitochondrial 16s rRNA gene in 96 Korean and 96 Chinese individual shrimp. Among 10 SNP sites, four sites were observed in populations from both countries, and two sites located in the middle with SNP sites at their 3′-ends were used to design allele-specific primers. Among the eight internal primers, the C220F primer specific to the Chinese A. chinensis population amplified a DNA fragment of 364 bp only from that population. We were able to identify the A. chinensis population origin with 100% accuracy using multiplex PCR performed with two external primers and C220F primers. These results show that the 16S rRNA gene that is generally used for the identification of species can be used for the identification of the origin within species of A. chinensis, which is an important finding for the fair trade of the species between Korea and China. PMID:25656197

  6. Rapid Origin Determination of the Northern Mauxia Shrimp (Acetes chinensis) Based on Allele Specific Polymerase Chain Reaction of Partial Mitochondrial 16S rRNA Gene.

    PubMed

    Kang, Jung-Ha; Noh, Eun-Soo; Park, Jung-Youn; An, Chel-Min; Choi, Jung-Hwa; Kim, Jin-Koo

    2015-04-01

    Acetes chinensis is an economically important shrimp that belongs to the Sergestidae family; following fermentation, A. chinensis' economic value, however, is low in China, and much of the catch in China is exported to Korea at a low price, thus leading to potential false labeling. For this reason, we developed a simple method to identify A. chinensis' origin using allele-specific polymerase chain reaction (PCR). Ten single nucleotide polymorphisms (SNPs) were identified from partial (i.e., 570 bp) DNA sequence analysis of the mitochondrial 16s rRNA gene in 96 Korean and 96 Chinese individual shrimp. Among 10 SNP sites, four sites were observed in populations from both countries, and two sites located in the middle with SNP sites at their 3'-ends were used to design allele-specific primers. Among the eight internal primers, the C220F primer specific to the Chinese A. chinensis population amplified a DNA fragment of 364 bp only from that population. We were able to identify the A. chinensis population origin with 100% accuracy using multiplex PCR performed with two external primers and C220F primers. These results show that the 16S rRNA gene that is generally used for the identification of species can be used for the identification of the origin within species of A. chinensis, which is an important finding for the fair trade of the species between Korea and China. PMID:25656197

  7. In Situ Accessibility of Saccharomyces cerevisiae 26S rRNA to Cy3-Labeled Oligonucleotide Probes Comprising the D1 and D2 Domains

    PubMed Central

    Inácio, João; Behrens, Sebastian; Fuchs, Bernhard M.; Fonseca, Álvaro; Spencer-Martins, Isabel; Amann, Rudolf

    2003-01-01

    Fluorescence in situ hybridization (FISH) has proven to be most useful for the identification of microorganisms. However, species-specific oligonucleotide probes often fail to give satisfactory results. Among the causes leading to low hybridization signals is the reduced accessibility of the targeted rRNA site to the oligonucleotide, mainly for structural reasons. In this study we used flow cytometry to determine whole-cell fluorescence intensities with a set of 32 Cy3-labeled oligonucleotide probes covering the full length of the D1 and D2 domains in the 26S rRNA of Saccharomyces cerevisiae PYCC 4455T. The brightest signal was obtained with a probe complementary to positions 223 to 240. Almost half of the probes conferred a fluorescence intensity above 60% of the maximum, whereas only one probe could hardly detect the cells. The accessibility map based on the results obtained can be extrapolated to other yeasts, as shown experimentally with 27 additional species (14 ascomycetes and 13 basidiomycetes). This work contributes to a more rational design of species-specific probes for yeast identification and monitoring. PMID:12732564

  8. Molecular phylogenetic analysis of the coccidian cephalopod parasites Aggregata octopiana and Aggregata eberthi (Apicomplexa: Aggregatidae) from the NE Atlantic coast using 18S rRNA sequences.

    PubMed

    Castellanos-Martínez, Sheila; Pérez-Losada, Marcos; Gestal, Camino

    2013-08-01

    The coccidia genus Aggregata is responsible for intestinal coccidiosis in wild and cultivated cephalopods. Two coccidia species, Aggregata octopiana, (infecting the common octopus Octopus vulgaris), and A. eberthi, (infecting the cuttlefish Sepia officinalis), are identified in European waters. Extensive investigation of their morphology resulted in a redescription of A. octopiana in octopuses from the NE Atlantic Coast (NW Spain) thus clarifying confusing descriptions recorded in the past. The present study sequenced the 18S rRNA gene in A. octopiana and A. eberthi from the NE Atlantic coast in order to assess their taxonomic and phylogenetic status. Phylogenetic analyses revealed conspecific genetic differences (2.5%) in 18S rRNA sequences between A. eberthi from the Ria of Vigo (NW Spain) and the Adriatic Sea. Larger congeneric differences (15.9%) were observed between A. octopiana samples from the same two areas, which suggest the existence of two species. Based on previous morphological evidence, host specificity data, and new molecular phylogenetic analyses, we suggest that A. octopiana from the Ria of Vigo is the valid type species. PMID:23498588

  9. The utility of diversity profiling using Illumina 18S rRNA gene amplicon deep sequencing to detect and discriminate Toxoplasma gondii among the cyst-forming coccidia.

    PubMed

    Cooper, Madalyn K; Phalen, David N; Donahoe, Shannon L; Rose, Karrie; Šlapeta, Jan

    2016-01-30

    Next-generation sequencing (NGS) has the capacity to screen a single DNA sample and detect pathogen DNA from thousands of host DNA sequence reads, making it a versatile and informative tool for investigation of pathogens in diseased animals. The technique is effective and labor saving in the initial identification of pathogens, and will complement conventional diagnostic tests to associate the candidate pathogen with a disease process. In this report, we investigated the utility of the diversity profiling NGS approach using Illumina small subunit ribosomal RNA (18S rRNA) gene amplicon deep sequencing to detect Toxoplasma gondii in previously confirmed cases of toxoplasmosis. We then tested the diagnostic approach with species-specific PCR genotyping, histopathology and immunohistochemistry of toxoplasmosis in a Risso's dolphin (Grampus griseus) to systematically characterise the disease and associate causality. We show that the Euk7A/Euk570R primer set targeting the V1-V3 hypervariable region of the 18S rRNA gene can be used as a species-specific assay for cyst-forming coccidia and discriminate T. gondii. Overall, the approach is cost-effective and improves diagnostic decision support by narrowing the differential diagnosis list with more certainty than was previously possible. Furthermore, it supplements the limitations of cryptic protozoan morphology and surpasses the need for species-specific PCR primer combinations. PMID:26801593

  10. Development and Validation of an Improved PCR Method Using the 23S-5S Intergenic Spacer for Detection of Rickettsiae in Dermacentor variabilis Ticks and Tissue Samples from Humans and Laboratory Animals.

    PubMed

    Kakumanu, Madhavi L; Ponnusamy, Loganathan; Sutton, Haley T; Meshnick, Steven R; Nicholson, William L; Apperson, Charles S

    2016-04-01

    A novel nested PCR assay was developed to detectRickettsiaspp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) ofRickettsiaspp. The newly designed primers were evaluated using genomic DNA from 11Rickettsiaspecies belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to otherRickettsia-specific PCR targets (ompA,gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11Rickettsiaspp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from "CandidatusRickettsia amblyommii." Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adultDermacentor variabilisticks. The nested 23S-5S IGS assay detectedRickettsiaDNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species ofRickettsia The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species ofRickettsiain the ticks. "CandidatusRickettsia amblyommii,"R. montanensis,R. felis, andR. belliiwere frequently identified species, along with some potentially novelRickettsiastrains that were closely related toR. belliiandR. conorii. PMID:26818674

  11. Chromosomal localization of 5S rDNA in Chinese shrimp ( Fenneropenaeus chinensis): a chromosome-specific marker for chromosome identification

    NASA Astrophysics Data System (ADS)

    Huan, Pin; Zhang, Xiaojun; Li, Fuhua; Zhao, Cui; Zhang, Chengsong; Xiang, Jianhai

    2010-03-01

    Chinese shrimp ( Fenneropenaeus chinensis) is an economically important aquaculture species in China. However, cytogenetic and genomic data is limited in the organism partly because the chromosomes are difficult to isolate and analyze. In this study, fluorescence in-situ hybridization (FISH) was used to identify the chromosomes of F. chinensis. The 5S ribosomal RNA gene (rDNA) of F. chinensis was isolated, cloned and then used as a hybridization probe. The results show that the 5S rDNA was located on one pair of homologous chromosomes in F. chinensis. In addition, triploid shrimp were used to evaluate the feasibility of chromosome identification using FISH and to validate the method. It was confirmed that 5S rDNA can be used as a chromosome-specific probe for chromosome identification in F. chinensis. The successful application of FISH in F. chinensis shows that chromosome-specific probes can be developed and this finding will facilitate further research on the chromosomes of penaeid shrimps.

  12. The human 18S rRNA base methyltransferases DIMT1L and WBSCR22-TRMT112 but not rRNA modification are required for ribosome biogenesis

    PubMed Central

    Zorbas, Christiane; Nicolas, Emilien; Wacheul, Ludivine; Huvelle, Emmeline; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2015-01-01

    At the heart of the ribosome lie rRNAs, whose catalytic function in translation is subtly modulated by posttranscriptional modifications. In the small ribosomal subunit of budding yeast, on the 18S rRNA, two adjacent adenosines (A1781/A1782) are N6-dimethylated by Dim1 near the decoding site, and one guanosine (G1575) is N7-methylated by Bud23-Trm112 at a ridge between the P- and E-site tRNAs. Here we establish human DIMT1L and WBSCR22-TRMT112 as the functional homologues of yeast Dim1 and Bud23-Trm112. We report that these enzymes are required for distinct pre-rRNA processing reactions leading to synthesis of 18S rRNA, and we demonstrate that in human cells, as in budding yeast, ribosome biogenesis requires the presence of the modification enzyme rather than its RNA-modifying catalytic activity. We conclude that a quality control mechanism has been conserved from yeast to human by which binding of a methyltransferase to nascent pre-rRNAs is a prerequisite to processing, so that all cleaved RNAs are committed to faithful modification. We further report that 18S rRNA dimethylation is nuclear in human cells, in contrast to yeast, where it is cytoplasmic. Yeast and human ribosome biogenesis thus have both conserved and distinctive features. PMID:25851604

  13. Phylogenetic relationships of the marine Haplosclerida (Phylum Porifera) employing ribosomal (28S rRNA) and mitochondrial (cox1, nad1) gene sequence data.

    PubMed

    Redmond, Niamh E; Raleigh, Jean; van Soest, Rob W M; Kelly, Michelle; Travers, Simon A A; Bradshaw, Brian; Vartia, Salla; Stephens, Kelly M; McCormack, Grace P

    2011-01-01

    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, are highly congruent and suggest the presence of four clades. Clade A is comprised primarily of species of Haliclona and Callyspongia, and clade B is comprised of H. simulans and H. vansoesti (Family Chalinidae), Amphimedon queenslandica (Family Niphatidae) and Tabulocalyx (Family Phloeodictyidae), Clade C is comprised primarily of members of the Families Petrosiidae and Niphatidae, while Clade D is comprised of Aka species. The polyphletic nature of the suborders, families and genera described in other studies is also found here. PMID:21931685

  14. Phylogenetic Relationships of the Marine Haplosclerida (Phylum Porifera) Employing Ribosomal (28S rRNA) and Mitochondrial (cox1, nad1) Gene Sequence Data

    PubMed Central

    Redmond, Niamh E.; Raleigh, Jean; van Soest, Rob W. M.; Kelly, Michelle; Travers, Simon A. A.; Bradshaw, Brian; Vartia, Salla; Stephens, Kelly M.; McCormack, Grace P.

    2011-01-01

    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, are highly congruent and suggest the presence of four clades. Clade A is comprised primarily of species of Haliclona and Callyspongia, and clade B is comprised of H. simulans and H. vansoesti (Family Chalinidae), Amphimedon queenslandica (Family Niphatidae) and Tabulocalyx (Family Phloeodictyidae), Clade C is comprised primarily of members of the Families Petrosiidae and Niphatidae, while Clade D is comprised of Aka species. The polyphletic nature of the suborders, families and genera described in other studies is also found here. PMID:21931685

  15. Bacterial rRNA Genes Associated with Soil Suppressiveness against the Plant-Parasitic Nematode Heterodera schachtii

    PubMed Central

    Yin, Bei; Valinsky, Lea; Gao, Xuebiao; Becker, J. Ole; Borneman, James

    2003-01-01

    The goal of this study was to identify bacteria involved in soil suppressiveness against the plant-parasitic nematode Heterodera schachtii. Since H. schachtii cysts isolated from the suppressive soil can transfer this beneficial property to nonsuppressive soils, analysis of the cyst-associated microorganisms should lead to the identification of the causal organisms. Our experimental approach was to identify bacterial rRNA genes (rDNA) associated with H. schachtii cysts obtained from soil mixtures with various levels of suppressiveness. We hypothesized that we would be able to identify bacteria involved in the suppressiveness by correlating population shifts with differing levels of suppressiveness. Soil treatments containing different amounts of suppressive and fumigation-induced nonsuppressive soils exhibited various levels of suppressiveness after two nematode generations. The 10%-suppressive-soil treatment contained numbers of eggs per gram of soil similar to those of the 100%-suppressive-soil treatment, indicating that the suppressive factor(s) had been transferred. Bacterial rDNA associated with H. schachtii cysts were identified using a culture-independent method termed oligonucleotide fingerprinting of rRNA genes. Bacteria from five major taxonomic groups (Actinobacteria, Cytophaga-Flexibacter-Bacteroides, α-Proteobacteria, β-Proteobacteria, and γ-Proteobacteria) were identified. Three bacterial rDNA groups contained clones that were more prevalent in the highly suppressive soil treatments than in the less suppressive treatments, indicating a potential involvement in the H. schachtii suppressiveness. When these three groups were examined with specific PCR analyses performed on H. schachtii cysts that developed in soils treated with three biocidal compounds, only one bacterial rDNA group with moderate to high sequence identity to rDNA from several Rhizobium species and uncultured α-proteobacterial clones was consistently associated with the highly

  16. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy.

    PubMed

    Wang, Qiong; Garrity, George M; Tiedje, James M; Cole, James R

    2007-08-01

    The Ribosomal Database Project (RDP) Classifier, a naïve Bayesian classifier, can rapidly and accurately classify bacterial 16S rRNA sequences into the new higher-order taxonomy proposed in Bergey's Taxonomic Outline of the Prokaryotes (2nd ed., release 5.0, Springer-Verlag, New York, NY, 2004). It provides taxonomic assignments from domain to genus, with confidence estimates for each assignment. The majority of classifications (98%) were of high estimated confidence (> or = 95%) and high accuracy (98%). In addition to being tested with the corpus of 5,014 type strain sequences from Bergey's outline, the RDP Classifier was tested with a corpus of 23,095 rRNA sequences as assigned by the NCBI into their alternative higher-order taxonomy. The results from leave-one-out testing on both corpora show that the overall accuracies at all levels of confidence for near-full-length and 400-base segments were 89% or above down to the genus level, and the majority of the classification errors appear to be due to anomalies in the current taxonomies. For shorter rRNA segments, such as those that might be generated by pyrosequencing, the error rate varied greatly over the length of the 16S rRNA gene, with segments around the V2 and V4 variable regions giving the lowest error rates. The RDP Classifier is suitable both for the analysis of single rRNA sequences and for the analysis of libraries of thousands of sequences. Another related tool, RDP Library Compare, was developed to facilitate microbial-community comparison based on 16S rRNA gene sequence libraries. It combines the RDP Classifier with a statistical test to flag taxa differentially represented between samples. The RDP Classifier and RDP Library Compare are available online at http://rdp.cme.msu.edu/. PMID:17586664

  17. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae

    PubMed Central

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-01-01

    Methylation of ribose sugars at the 2′-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2′-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5′ central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D′ box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  18. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae.

    PubMed

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-02-27

    Methylation of ribose sugars at the 2'-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2'-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5' central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D' box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  19. Cloning of 16S rRNA genes amplified from normal and disturbed vaginal microflora suggests a strong association between Atopobium vaginae, Gardnerella vaginalis and bacterial vaginosis

    PubMed Central

    Verhelst, Rita; Verstraelen, Hans; Claeys, Geert; Verschraegen, Gerda; Delanghe, Joris; Van Simaey, Leen; De Ganck, Catharine; Temmerman, Marleen; Vaneechoutte, Mario

    2004-01-01

    Background The pathogenesis of bacterial vaginosis remains largely elusive, although some microorganisms, including Gardnerella vaginalis, are suspected of playing a role in the etiology of this disorder. Recently culture-independent analysis of microbial ecosystems has proven its efficacy in characterizing the diversity of bacterial populations. Here, we report on the results obtained by combining culture and PCR-based methods to characterize the normal and disturbed vaginal microflora. Results A total of 150 vaginal swab samples from healthy women (115 pregnant and 35 non-pregnant) were categorized on the basis of Gram stain of direct smear as grade I (n = 112), grade II (n = 26), grade III (n = 9) or grade IV (n = 3). The composition of the vaginal microbial community of eight of these vaginal swabs (three grade I, two grade II and three grade III), all from non-pregnant women, were studied by culture and by cloning of the 16S rRNA genes obtained after direct amplification. Forty-six cultured isolates were identified by tDNA-PCR, 854 cloned 16S rRNA gene fragments were analysed of which 156 by sequencing, yielding a total of 38 species, including 9 presumptively novel species with at least five species that have not been isolated previously from vaginal samples. Interestingly, cloning revealed that Atopobium vaginae was abundant in four out of the five non-grade I specimens. Finally, species specific PCR for A. vaginae and Gardnerella vaginalis pointed to a statistically significant co-occurrence of both species in the bacterial vaginosis samples. Conclusions Although historically the literature regarding bacterial vaginosis has largely focused on G. vaginalis in particular, several findings of this study – like the abundance of A. vaginae in disturbed vaginal microflora and the presence of several novel species – indicate that much is to be learned about the composition of the vaginal microflora and its relation to the etiology of BV. PMID:15102329

  20. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    PubMed Central

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1–RpL5-N–RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1–RpL5–RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  1. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  2. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    PubMed Central

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  3. 16S rRNA Phylogenetic Investigation of the Candidate Division “Korarchaeota”

    PubMed Central

    Auchtung, Thomas A.; Takacs-Vesbach, Cristina D.; Cavanaugh, Colleen M.

    2006-01-01

    The environmental distribution and phylogeny of “Korarchaeota,” a proposed ancient archaeal division, was investigated by using the 16S rRNA gene framework. Korarchaeota-specific primers were designed based on previously published sequences and used to screen a variety of environments. Korarchaeota 16S rRNA genes were amplified exclusively from high temperature Yellowstone National Park hot springs and a 9°N East Pacific Rise deep-sea hydrothermal vent. Phylogenetic analyses of these and all available sequences suggest that Korarchaeota exhibit a high level of endemicity. PMID:16820509

  4. Phylogeny of protostome worms derived from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade. PMID:7659019

  5. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    SciTech Connect

    Vilkas, M J; Ishikawa, Y; Trabert, E

    2008-02-29

    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  6. Solution-Based Processing of the Phase-Change Material KSb5S8

    SciTech Connect

    Mitzi,D.; Raoux, S.; Schrott, A.; Copel, M.; Kellock, A.; Jordan-Sweet, J.

    2006-01-01

    A hydrazine-based process for solution-depositing phase-change materials (PCMs) is demonstrated, using KSb{sub 5}S{sub 8} (KSS) as an example. The process involves dissolving the elemental metals and chalcogen in hydrazine at room temperature and spin-coating the solution onto a substrate, followed by a short low-temperature (T {<=} 250 C) anneal. The spin-coated KSS films, which range in thickness from 10 to 90 nm, are examined using variable temperature X-ray diffraction, medium energy ion scattering (MEIS), Rutherford backscattering spectroscopy (RBS), and scanning electron microscopy (SEM). The spin-coated KSS films exhibit a reversible amorphous-crystalline transition with a relatively high crystallization temperature ({approx}280 C). Selected other chalcogenide-based PCMs are also expected to be suitable for thin-film deposition using this approach.

  7. Minimally Invasive Approach For Extraforaminal Synovial Cyst L5-S1

    PubMed Central

    Torres Campa-Santamarina, Jose; Towne, Sara; Alimi, Marjan; Härtl, Roger

    2015-01-01

    Symptoms from synovial cysts are produced by neural compression in the spinal canal or the foramen. Few cases of extraforaminal synovial cyst have been published in the literature. This is a case report of a 65-year-old female who presented with a three-month history of sciatic pain and no relief with conservative treatment. MRI showed a left-sided extraforaminal synovial cyst at L5-S1 with compression of the L5 nerve root at the lateral portion of the foramen. Minimally invasive surgery for resection was performed using an extraforaminal tubular microscopic endoscopy-assisted approach. The patient improved clinically and remained symptom-free for the entire follow-up of 30 months. PMID:26623217

  8. Magic wavelengths for the 5 s - 18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, Elizabeth; Norris, David; Koller, Silvio; Wyllie, Robert; Brown, Roger; Porto, Trey; Safronova, Ulyana; Safronova, Marianna

    2015-05-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s - 18 s transition of rubidium near the 18 s - 6 p resonances. We compare the calculation to experiment by measuring the light shift for atoms held in a crossed optical dipole trap with wavelength tuned around the 18 s - 6p3 / 2 resonance at the experimentally convenient wavelength of 1064 nm.

  9. Taxonomic evaluation of Streptomyces hirsutus and related species using multi-locus sequence analysis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phylogenetic analyses of species of Streptomyces based on 16S rRNA gene sequences resulted in a statistically well-supported clade (100% bootstrap value) containing 8 species having very similar gross morphology. These species, including Streptomyces bambergiensis, Streptomyces chlorus, Streptomyces...

  10. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    PubMed Central

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  11. 16S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects.

    PubMed Central

    O'Neill, S L; Giordano, R; Colbert, A M; Karr, T L; Robertson, H M

    1992-01-01

    Bacterial endosymbionts of insects have long been implicated in the phenomenon of cytoplasmic incompatibility, in which certain crosses between symbiont-infected individuals lead to embryonic death or sex ratio distortion. The taxonomic position of these bacteria has, however, not been known with any certainty. Similarly, the relatedness of the bacteria infecting various insect hosts has been unclear. The inability to grow these bacteria on defined cell-free medium has been the major factor underlying these uncertainties. We circumvented this problem by selective PCR amplification and subsequent sequencing of the symbiont 16S rRNA genes directly from infected insect tissue. Maximum parsimony analysis of these sequences indicates that the symbionts belong in the alpha-subdivision of the Proteobacteria, where they are most closely related to the Rickettsia and their relatives. They are all closely related to each other and are assigned to the type species Wolbachia pipientis. Lack of congruence between the phylogeny of the symbionts and their insect hosts suggest that horizontal transfer of symbionts between insect species may occur. Comparison of the sequences for W. pipientis and for Wolbachia persica, an endosymbiont of ticks, shows that the genus Wolbachia is polyphyletic. A PCR assay based on 16S primers was designed for the detection of W. pipientis in insect tissue, and initial screening of insects indicates that cytoplasmic incompatibility may be a more general phenomenon in insects than is currently recognized. Images PMID:1557375

  12. Bacterial communities in two Antarctic ice cores analyzed by 16S rRNA gene sequencing analysis

    NASA Astrophysics Data System (ADS)

    Segawa, Takahiro; Ushida, Kazunari; Narita, Hideki; Kanda, Hiroshi; Kohshima, Shiro

    2010-08-01

    Antarctic ice cores could preserve ancient airborne microorganisms. We examined bacteria in two Antarctic ice core samples, an interglacial age sample from Mizuho Base and a glacial age sample from the Yamato Mountains, by 16S rRNA gene sequencing analysis. Bacterial density, the number of bacterial OTUs and Simpson’s diversity index was larger in the Mizuho sample than in the Yamato sample. The 16S rDNA clone library from the Mizuho sample was dominated by the phylum Firmicutes, while the large part of that from the Yamato sample was composed of the Gamma proteobacteria group. Major sources of these identified bacteria estimated from their database records also differed between the samples: in the Mizuho sample bacterial species recorded from animals were higher than that of the Yamato sample, while in the Yamato sample bacteria from aquatic and snow-ice environments were higher than that of the Mizuho sample. The results suggest that these bacteria were past airborne bacteria that would vary in density, diversity and species composition depending on global environmental change. Our results imply that bacteria in Antarctic ice cores could be used as new environmental markers for past environmental studies.

  13. Establishment of a continuous culture system for Entamoeba muris and analysis of the small subunit rRNA gene.

    PubMed

    Kobayashi, S; Suzuki, J; Takeuchi, T

    2009-06-01

    We established a culture system for Entamoeba muris (MG-EM-01 strain isolated from a Mongolian gerbil) using a modified Balamuth's egg yolk infusion medium supplemented with 4% adult bovine serum and Bacteroides fragilis cocultured with Escherichia coli. Further, encystation was observed in the culture medium. The morphological characteristics of E. muris are similar to those of Entamoeba coli (E. coli); moreover, the malic isoenzyme electrophoretic band, which shows species-specific electrophoretic mobility, of E. muris had almost the same mobility as that observed with the malic isoenzyme electrophorectic band of E. coli (UZG-EC-01 strain isolated from a gorilla). We determined the small subunit rRNA (SSU-rRNA) gene sequence of the MG-EM-01 strain, and this sequence was observed to show 82.7% homology with that of the UZG-EC-01 strain. Further, the resultant phylogenetic tree for molecular taxonomy based on the SSU-rRNA genes of the 21 strains of the intestinal parasitic amoeba species indicated that the MG-EM-01 strain was most closely related to E. coli. PMID:19585892

  14. Sequencing of 16S rRNA reveals a distinct salivary microbiome signature in Behçet's disease.

    PubMed

    Coit, Patrick; Mumcu, Gonca; Ture-Ozdemir, Filiz; Unal, Ali Ugur; Alpar, Ugur; Bostanci, Nagihan; Ergun, Tulin; Direskeneli, Haner; Sawalha, Amr H

    2016-08-01

    Behçet's disease (BD) is characterized by recurrent oro-genital ulcers, mucocutaneous lesions, and serious organ involvement. We investigated the salivary microbiome in BD using high-throughput sequencing of the 16S rRNA V4 region. Stimulated saliva samples were collected from 31 BD patients and 15 healthy controls, and in 9 BD patients, a second saliva sample was collected following dental and periodontal treatment. Sequence analysis identified a total of 908 operational taxonomic units (OTUs) present across all samples. Patients had a microbial community structure that is significantly less diverse than healthy controls. The most overabundant species in BD was Haemophilus parainfluenzae, while the most depleted included Alloprevotella rava and species in the genus Leptotrichia. Periodontal treatment improved oral health indices in BD but had no short-term effect on bacterial community structure. Neither the BD-associated genetic risk locus within the HLA-B/MICA region nor being on immunosuppressive medications explained the differences between patients and controls. PMID:27283393

  15. The genetic diversity of genus Bacillus and the related genera revealed by 16s rRNA gene sequences and ardra analyses isolated from geothermal regions of turkey

    PubMed Central

    Cihan, Arzu Coleri; Tekin, Nilgun; Ozcan, Birgul; Cokmus, Cumhur

    2012-01-01

    Previously isolated 115 endospore-forming bacilli were basically grouped according to their temperature requirements for growth: the thermophiles (74%), the facultative thermophiles (14%) and the mesophiles (12%). These isolates were taken into 16S rRNA gene sequence analyses, and they were clustered among the 7 genera: Anoxybacillus, Aeribacillus, Bacillus, Brevibacillus, Geobacillus, Paenibacillus, and Thermoactinomycetes. Of these bacilli, only the thirty two isolates belonging to genera Bacillus (16), Brevibacillus (13), Paenibacillus (1) and Thermoactinomycetes (2) were selected and presented in this paper. The comparative sequence analyses revealed that the similarity values were ranged as 91.4–100 %, 91.8- 99.2 %, 92.6- 99.8 % and 90.7 - 99.8 % between the isolates and the related type strains from these four genera, respectively. Twenty nine of them were found to be related with the validly published type strains. The most abundant species was B. thermoruber with 9 isolates followed by B. pumilus (6), B. lichenformis (3), B. subtilis (3), B. agri (3), B. smithii (2), T. vulgaris (2) and finally P. barengoltzii (1). In addition, isolates of A391a, B51a and D295 were proposed as novel species as their 16S rRNA gene sequences displayed similarities ≤ 97% to their closely related type strains. The AluI-, HaeIII- and TaqI-ARDRA results were in congruence with the 16S rRNA gene sequence analyses. The ARDRA results allowed us to differentiate these isolates, and their discriminative restriction fragments were able to be determined. Some of their phenotypic characters and their amylase, chitinase and protease production were also studied and biotechnologically valuable enzyme producing isolates were introduced in order to use in further studies. PMID:24031834

  16. Characterization of Microbial Communities Found in the Human Vagina by Analysis of Terminal Restriction Fragment Length Polymorphisms of 16S rRNA Genes

    PubMed Central

    Coolen, Marco J. L.; Post, Eduard; Davis, Catherine C.; Forney, Larry J.

    2005-01-01

    To define and monitor the structure of microbial communities found in the human vagina, a cultivation-independent approach based on analyses of terminal restriction fragment length polymorphisms (T-RFLP) of 16S rRNA genes was developed and validated. Sixteen bacterial strains commonly found in the human vagina were used to construct model communities that were subsequently used to develop efficient means for the isolation of genomic DNA and an optimal strategy for T-RFLP analyses. The various genera in the model community could best be resolved by digesting amplicons made using bacterial primers 8f and 926r with HaeIII; fewer strains could be resolved using other primer-enzyme combinations, and no combination successfully distinguished certain species of the same genus. To demonstrate the utility of the approach, samples from five women that had been collected over a 2-month period were analyzed. Differences and similarities among the vaginal microbial communities of the women were readily apparent. The T-RFLP data suggest that the communities of three women were dominated by a single phylotype, most likely species of Lactobacillus. In contrast, the communities of two other women included numerically abundant populations that differed from Lactobacillus strains whose 16S rRNA genes had been previously determined. The T-RFLP profiles of samples from all the women were largely invariant over time, indicating that the kinds and abundances of the numerically dominant populations were relatively stable throughout two menstrual cycles. These findings show that T-RFLP of 16S rRNA genes can be used to compare vaginal microbial communities and gain information about the numerically dominant populations that are present. PMID:16332868

  17. Comparison of ribosomal DNA sites in Lolium species by fluorescence in situ hybridization.

    PubMed

    Thomas, H M; Harper, J A; Meredith, M R; Morgan, W G; Thomas, I D; Timms, E; King, I P

    1996-11-01

    The position of the 18S-5.8S-26S and 5S rRNA genes have been physically mapped on the chromosomes of seven Lolium taxa. 18S-5.8S-26S sites were seen on two pairs of chromosomes in the inbreeding taxa. In the outbreeding taxa six sites were found in the L. multiflorum, seven in L. perenne and nine in L. rigidum var. rigidum. Two 5S sites were found in each of the taxa. In the inbreeders, the 5S sites were found adjacent to the 18S-5.8S-26S sites on chromosome 2. In L. multifiorum and L.perenne the 5S sites were on the short arm of chromosome 3. However, in L. rigidum var. rigidum the 5S rDNA site was found in either of the two positions. PMID:8939359

  18. Use of species-specific PCR for the identification of 10 sea cucumber species

    NASA Astrophysics Data System (ADS)

    Wen, Jing; Zeng, Ling

    2014-11-01

    We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.

  19. Molecular Diagnosis of Actinomadura madurae Infection by 16S rRNA Deep Sequencing

    PubMed Central

    SenGupta, Dhruba J.; Hoogestraat, Daniel R.; Cummings, Lisa A.; Bryant, Bronwyn H.; Natividad, Catherine; Thielges, Stephanie; Monsaas, Peter W.; Chau, Mimosa; Barbee, Lindley A.; Rosenthal, Christopher; Cookson, Brad T.; Hoffman, Noah G.

    2013-01-01

    Next-generation DNA sequencing can be used to catalog individual organisms within complex, polymicrobial specimens. Here, we utilized deep sequencing of 16S rRNA to implicate Actinomadura madurae as the cause of mycetoma in a diabetic patient when culture and conventional molecular methods were overwhelmed by overgrowth of other organisms. PMID:24108607

  20. Ribosome origins: The relative age of 23S rRNA Domains

    NASA Astrophysics Data System (ADS)

    Hury, James; Nagaswamy, Uma; Larios-Sanz, Maia; Fox, George E.

    2006-08-01

    The modern ribosome and its component RNAs are quite large and it is likely that at an earlier time they were much smaller. Hence, not all regions of the modern ribosomal RNAs (rRNA) are likely to be equally old. In the work described here, it is hypothesized that the oldest regions of the RNAs will usually be highly integrated into the machinery. When this is the case, an examination of the interconnectivity between local RNA regions can provide insight to the relative age of the various regions. Herein, we describe an analysis of all known long-range RNA/RNA interactions within the 23S rRNA and between the 23S rRNA and the 16S rRNA in order to assess the interconnectivity between the usual Domains as defined by secondary structure. Domain V, which contains the peptidyl transferase center is centrally located, extensively connected, and therefore likely to be the oldest region. Domain IV and Domain II are extensively interconnected with both themselves and Domain V. A portion of Domain IV is also extensively connected with the 30S subunit and hence Domain IV may be older than Domain II. These results are consistent with other evidence relating to the relative age of RNA regions. Although the relative time of addition of the GTPase center can not be reliably deduced it is pointed out that the development of this may have dramatically affected the progenotes that preceded the last common ancestor.

  1. Ribosomal Database Project: data and tools for high throughput rRNA analysis

    PubMed Central

    Cole, James R.; Wang, Qiong; Fish, Jordan A.; Chai, Benli; McGarrell, Donna M.; Sun, Yanni; Brown, C. Titus; Porras-Alfaro, Andrea; Kuske, Cheryl R.; Tiedje, James M.

    2014-01-01

    Ribosomal Database Project (RDP; http://rdp.cme.msu.edu/) provides the research community with aligned and annotated rRNA gene sequence data, along with tools to allow researchers to analyze their own rRNA gene sequences in the RDP framework. RDP data and tools are utilized in fields as diverse as human health, microbial ecology, environmental microbiology, nucleic acid chemistry, taxonomy and phylogenetics. In addition to aligned and annotated collections of bacterial and archaeal small subunit rRNA genes, RDP now includes a collection of fungal large subunit rRNA genes. RDP tools, including Classifier and Aligner, have been updated to work with this new fungal collection. The use of high-throughput sequencing to characterize environmental microbial populations has exploded in the past several years, and as sequence technologies have improved, the sizes of environmental datasets have increased. With release 11, RDP is providing an expanded set of tools to facilitate analysis of high-throughput data, including both single-stranded and paired-end reads. In addition, most tools are now available as open source packages for download and local use by researchers with high-volume needs or who would like to develop custom analysis pipelines. PMID:24288368

  2. Unequal Crossing over at the Rrna Tandon as a Source of Quantitative Genetic Variation in Drosophila

    PubMed Central

    Frankham, R.; Briscoe, D. A.; Nurthen, R. K.

    1980-01-01

    Abdominal bristle selection lines (three high and three low) and controls were founded from a marked homozygous line to measure the contribution of sex-linked "mutations" to selection response. Two of the low lines exhibited a period of rapid response to selection in females, but not in males. There were corresponding changes in female variance, in heritabilities in females, in the sex ratio (a deficiency of females) and in fitness, as well as the appearance of a mutant phenotype in females of one line. All of these changes were due to bb alleles (partial deficiencies for the rRNA tandon) in the X chromosomes of these lines, while the Y chromosomes remained wild-type bb+. We argue that the bb alleles arose by unequal crossing over in the rRNA tandon.—A prediction of this hypothesis is that further changes can occur in the rRNA tandon as selection is continued. This has now been shown to occur.—Our minimum estimate of the rate of occurrence of changes at the rRNA tandon is 3 x 10-4. As this is substantially higher than conventional mutation rates, the questions of the mechanisms and rates of origin of new quantitative genetic variation require careful re-examination. PMID:7439683

  3. Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis and proposals to emend the description of Streptomyces albus and describe Streptomyces pathocidini sp. nov

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T forms a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these oth...

  4. Phylogenetic relationships of marine bacteria, mainly members of the family Vibrionaceae, determined on the basis of 16S rRNA sequences.

    PubMed

    Kita-Tsukamoto, K; Oyaizu, H; Nanba, K; Simidu, U

    1993-01-01

    The phylogenetic relationships of 50 reference strains, mostly marine bacteria which require Na+ for growth, were determined on the basis of 600 16S rRNA nucleotides by using reverse transcriptase sequencing. Strains belonging to 10 genera were included (four genera of the family Vibrionaceae, the genus Aeromonas of the family Aeromonadaceae, and the genera Alteromonas, Marinomonas, Shewanella, Pseudomonas, and Deleya). The sequences were aligned, the similarity values and evolutionary distance values were determined, and a phylogenetic tree was constructed by using the neighbor-joining method. On the basis of our results, the family Vibrionaceae was separated into at least seven groups (genera and families). Vibrio marinus clearly was on a line of descent that was remote from other vibrios. As determined by the similarity and evolutionary distance values, V. marinus is more distantly related to the family Vibrionaceae than the members of the Aeromonadaceae are. Also, Vibrio cholerae strains formed a separate group with Vibrio mimicus at the genus level. Of 30 species of the Vibrionaceae, 17 formed a large phylogenetic cluster. The genus Listonella was found to be a heterogeneous group, and the species were distributed in various subgroups of the Vibrionaceae. The separation of the family Aeromonadaceae from the family Vibrionaceae and the separation of the genera Marinomonas and Shewanella from the genus Alteromonas were confirmed in this phylogenetic study. However, a marine Pseudomonas species, Pseudomonas nautica, was clearly separated from two terrestrial Pseudomonas species. Each group that was separated by the phylogenetic analysis had characteristic 16S rRNA sequence patterns that were common only to species in that group. Therefore, the characteristic sequences described in this paper may be useful for identification purposes. PMID:8427811

  5. Phylogeny and classification of bacteria in the genera Clavibacter and Rathayibacter on the basis of 16s rRNA gene sequence analyses.

    PubMed Central

    Lee, I M; Bartoszyk, I M; Gundersen-Rindal, D E; Davis, R E

    1997-01-01

    A phylogenetic analysis by parsimony of 16S rRNA gene sequences (16S rDNA) revealed that species and subspecies of Clavibacter and Rathayibacter form a discrete monophyletic clade, paraphyletic to Corynebacterium species. Within the Clavibacter-Rathayibacter clade, four major phylogenetic groups (subclades) with a total of 10 distinct taxa were recognized: (I) species C. michiganensis; (II) species C. xyli; (III) species R. iranicus and R. tritici; and (IV) species R. rathayi. The first three groups form a monophyletic cluster, paraphyletic to R. rathayi. On the basis of the phylogeny inferred, reclassification of members of Clavibacter-Rathayibacter group is proposed. A system for classification of taxa in Clavibacter and Rathayibacter was developed based on restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified 16S rDNA sequences. The groups delineated on the basis of RFLP patterns of 16S rDNA coincided well with the subclades delineated on the basis of phylogeny. In contrast to previous classification systems, which are based primarily on phenotypic properties and are laborious, the RFLP analyses allow for rapid differentiation among species and subspecies in the two genera. PMID:9212413

  6. A Pol V–Mediated Silencing, Independent of RNA–Directed DNA Methylation, Applies to 5S rDNA

    PubMed Central

    Douet, Julien; Tutois, Sylvie; Tourmente, Sylvette

    2009-01-01

    The plant-specific RNA polymerases Pol IV and Pol V are essential to RNA–directed DNA methylation (RdDM), which also requires activities from RDR2 (RNA–Dependent RNA Polymerase 2), DCL3 (Dicer-Like 3), AGO4 (Argonaute), and DRM2 (Domains Rearranged Methyltransferase 2). RdDM is dedicated to the methylation of target sequences which include transposable elements, regulatory regions of several protein-coding genes, and 5S rRNA–encoding DNA (rDNA) arrays. In this paper, we have studied the expression of the 5S-210 transcript, a marker of silencing release at 5S RNA genes, to show a differential impact of RNA polymerases IV and V on 5S rDNA arrays during early development of the plant. Using a combination of molecular and cytological assays, we show that Pol IV, RDR2, DRM2, and Pol V, actors of the RdDM, are required to maintain a transcriptional silencing of 5S RNA genes at chromosomes 4 and 5. Moreover, we have shown a derepression associated to chromatin decondensation specific to the 5S array from chromosome 4 and restricted to the Pol V–loss of function. In conclusion, our results highlight a new role for Pol V on 5S rDNA, which is RdDM–independent and comes specifically at chromosome 4, in addition to the RdDM pathway. PMID:19834541

  7. Analysis of 5S rDNA arrays in Arabidopsis thaliana: physical mapping and chromosome-specific polymorphisms.

    PubMed

    Cloix, C; Tutois, S; Mathieu, O; Cuvillier, C; Espagnol, M C; Picard, G; Tourmente, S

    2000-05-01

    A physical map of a pericentromeric region of chromosome 5 containing a 5S rDNA locus and spanning approximately 1000 kb was established using the CIC YAC clones. Three 5S rDNA arrays were resolved in this YAC contig by PFGE analysis and we have mapped different types of sequences between these three blocks. 5S rDNA units from each of these three arrays of chromosome 5, and from chromosomes 3 and 4, were isolated by PCR. A total of 38 new DNA sequences were obtained. Two types of 5S rDNA repeated units exist: the major variant with 0.5-kb repeats and one with short repeats (251 bp) only detected on YAC 11A3 from chromosome 3. Although the 38 sequences displayed noticeable heterogeneity, we were able to group them according to their 5S array origin. The presence of 5S array-specific variants was confirmed with the restriction polymorphism study of all the YACs carrying 5S units. PMID:10810091

  8. Ribosomal ribonucleic acid isolated from Salmonella typhimurium: absence of the intact 23S species.

    PubMed Central

    Winkler, M E

    1979-01-01

    Ribonucleic acid (RNA) isolated by four distinct methods and from a variety of Salmonella typhimurium strains lacked intact 23S ribosomal RNA (rRNA). On sucrose gradients which minimize aggregation, the vast majority of S. typhimurium rRNA sedimented as a 16S peak with a 14S shoulder. RNA from this region of the gradient was resolved into three discrete bands by electrophoresis in formamide. Two very minor S. typhimurium RNA peaks were resolved at 21S and 10S on sucrose gradients, and each peak formed discrete bands in electrophoresis. It is concluded that if S. typhimurium does possess an intact 23S rRNA species, this species is extremely "labile." The absence of isolatable S. typhimurium 23S rRNA possibly reflected in vivo processing of the rRNA before isolation. Under certain conditions, S. typhimurium rRNA formed discrete aggregates which sedimented similarly to intact Escherichia coli 23S rRNA. Images PMID:383696

  9. Genome-wide analysis of small nucleolar RNAs of Leishmania major reveals a rich repertoire of RNAs involved in modification and processing of rRNA.

    PubMed

    Eliaz, Dror; Doniger, Tirza; Tkacz, Itai Dov; Biswas, Viplov Kumar; Gupta, Sachin Kumar; Kolev, Nikolay G; Unger, Ron; Ullu, Elisabetta; Tschudi, Christian; Michaeli, Shulamit

    2015-01-01

    Trypanosomatids are protozoan parasites and the causative agent of infamous infectious diseases. These organisms regulate their gene expression mainly at the post-transcriptional level and possess characteristic RNA processing mechanisms. In this study, we analyzed the complete repertoire of Leishmania major small nucleolar (snoRNA) RNAs by performing RNA-seq analysis on RNAs that were affinity-purified using the C/D snoRNA core protein, SNU13, and the H/ACA core protein, NHP2. This study revealed a large collection of C/D and H/ACA snoRNAs, organized in gene clusters generally containing both snoRNA types. Abundant snoRNAs were identified and predicted to guide trypanosome-specific rRNA cleavages. The repertoire of snoRNAs was compared to that of the closely related Trypanosoma brucei, and 80% of both C/D and H/ACA molecules were found to have functional homologues. The comparative analyses elucidated how snoRNAs evolved to generate molecules with analogous functions in both species. Interestingly, H/ACA RNAs have great flexibility in their ability to guide modifications, and several of the RNA species can guide more than one modification, compensating for the presence of single hairpin H/ACA snoRNA in these organisms. Placing the predicted modifications on the rRNA secondary structure revealed hypermodification regions mostly in domains which are modified in other eukaryotes, in addition to trypanosome-specific modifications. PMID:25970223

  10. Nature of polymorphisms in 16S-23S rRNA gene intergenic transcribed spacer fingerprinting of Bacillus and related genera.

    PubMed

    Daffonchio, Daniele; Cherif, Ameur; Brusetti, Lorenzo; Rizzi, Aurora; Mora, Diego; Boudabous, Abdellatif; Borin, Sara

    2003-09-01

    The intergenic transcribed spacers (ITS) between the 16S and 23S rRNA genetic loci are frequently used in PCR fingerprinting to discriminate bacterial strains at the species and intraspecies levels. We investigated the molecular nature of polymorphisms in ITS-PCR fingerprinting of low-G+C-content spore-forming bacteria belonging to the genera Bacillus, Brevibacillus, Geobacillus, and Paenibacillus: We found that besides the polymorphisms in the homoduplex fragments amplified by PCR, heteroduplex products formed during PCR between amplicons from different ribosomal operons, with or without tRNA genes in the ITS, contribute to the interstrain variability in ITS-PCR fingerprinting patterns obtained in polyacrylamide-based gel matrices. The heteroduplex nature of the discriminating bands was demonstrated by fragment separation in denaturing polyacrylamide gels, by capillary electrophoresis, and by cloning, sequencing, and recombination of purified short and tRNA gene-containing long ITS. We also found that heteroduplex product formation is enhanced by increasing the number of PCR cycles. Homoduplex-heteroduplex polymorphisms (HHP) in a conserved region, such as the 16S and 23S rRNA gene ITS, allowed discrimination of closely related strains and species undistinguishable by other methods, indicating that ITS-HHP analysis is an easy and reproducible additional tool for strain typing. PMID:12957895

  11. Phylogenetic positions of four hypotrichous ciliates (Protista, Ciliophora) based on SSU rRNA gene, with notes on their morphological characters.

    PubMed

    Yang, Caiting; Liu, An; Xu, Yusen; Xu, Yuan; Fan, Xinpeng; Al-Farraj, Saleh A; Ni, Bing; Gu, Fukang

    2015-01-01

     The morphology and infraciliature of the four hypotrichous ciliates; Rigidohymena inquieta (Stokes, 1887) Berger, 2011, Pattersoniella vitiphila Foissner, 1987, Notohymena australis Foissner & O' Donoghue, 1990, and Cyrtohymena (Cyrtohymenides) australis (Foissner, 1995) Foissner, 2004, collected from east China, were investigated by using live observation and protargol impregnation method. An improved diagnosis for R. inquieta was supplied based on descriptions of present and previous populations. New morphology and morphogenesis information based on Chinese populations of another three hypotrichids were also supplemented. The Small-subunit rRNA (SSU rRNA) gene sequences of the four species were characterized and their phylogenetic positions were revealed by means of Bayesian inference and Maximum-likelihood analysis. The analyses shows that R. inquieta clusters with other members of the subfamily Stylonychinae, which confirms the monophyly of the subfamily and verified R. inquieta as a separated species from R. candens though it differs from others mainly by body size. C. (C.) australis occupying the basal position of the clade which contains cyrtohymenids and some other groups, declines the idea of separating Cyrtohymena into two subgenus. Notohymena australis and China population of Pattersoniella vitiphila respectively clustering with their congeners correspond well with the systematics revealed by morphological similarities. PMID:26623736

  12. Analysis of 16S rRNA and mxaF genes revealing insights into Methylobacterium niche-specific plant association

    PubMed Central

    Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz

    2012-01-01

    The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant. PMID:22481887

  13. The nature of Z_b states from a combined analysis of Upsilon (5S)rightarrow h_b(mP) π ^+ π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π

    NASA Astrophysics Data System (ADS)

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-03-01

    With a combined analysis of data on Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π in an effective field theory approach, we determine resonance parameters of Z_b states in two scenarios. In one scenario we assume that Z_b states are pure molecular states, while in the other one we assume that Z_b states contain compact components. We find that the present data favor that there should be some compact components inside Z_b^{(' )} associated with the molecular components. By fitting the invariant mass spectra of Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{*}π , we determine that the probability of finding the compact components in Z_b states may be as large as about 40 %.

  14. A new quadrannulate species of Orobdella (Hirudinida, Arhynchobdellida, Orobdellidae) from western Honshu, Japan

    PubMed Central

    Nakano, Takafumi

    2016-01-01

    Abstract A new quadrannulate species of Orobdella Oka, 1895, Orobdella naraharaetmagarum sp. n., from the mountainous region of western Honshu, Japan is described. Orobdella naraharaetmagarum is a small species with a body length of less than 5 cm. Phylogenetic analyses using nuclear 18S rRNA and histone H3, as well as mitochondrial cytochrome c oxidase subunit I, tRNACys, tRNAMet, 12S rRNA, tRNAVal, 16S rRNA, tRNALeu and NADH dehydrogenase subunit 1 markers indicated that the present new species is the sister species of the quadrannulate Orobdella esulcata Nakano, 2010. Furthermore, mitochondrial DNA genealogy within Orobdella naraharaetmagarum demonstrated that this new species is divided into eastern and western lineages. PMID:26877670

  15. A new quadrannulate species of Orobdella (Hirudinida, Arhynchobdellida, Orobdellidae) from western Honshu, Japan.

    PubMed

    Nakano, Takafumi

    2016-01-01

    A new quadrannulate species of Orobdella Oka, 1895, Orobdella naraharaetmagarum sp. n., from the mountainous region of western Honshu, Japan is described. Orobdella naraharaetmagarum is a small species with a body length of less than 5 cm. Phylogenetic analyses using nuclear 18S rRNA and histone H3, as well as mitochondrial cytochrome c oxidase subunit I, tRNA(Cys), tRNA(Met), 12S rRNA, tRNA(Val), 16S rRNA, tRNA(Leu) and NADH dehydrogenase subunit 1 markers indicated that the present new species is the sister species of the quadrannulate Orobdella esulcata Nakano, 2010. Furthermore, mitochondrial DNA genealogy within Orobdella naraharaetmagarum demonstrated that this new species is divided into eastern and western lineages. PMID:26877670

  16. Use of 16S rRNA Gene Profiling by Terminal Restriction Fragment Length Polymorphism Analysis To Compare Bacterial Communities in Sputum and Mouthwash Samples from Patients with Cystic Fibrosis†

    PubMed Central

    Rogers, G. B.; Carroll, M. P.; Serisier, D. J.; Hockey, P. M.; Jones, G.; Kehagia, V.; Connett, G. J.; Bruce, K. D.

    2006-01-01

    The bacterial communities present in the oral cavity and the lungs of 19 adult cystic fibrosis (CF) patients were compared by using terminal restriction fragment length polymorphism analysis of 16S rRNA gene PCR products amplified from nucleic acids extracted directly from bacteria in clinical samples. Sputum samples were not found to be subject to profound contamination by oral cavity bacteria. Evidence of colonization of the CF lung by certain oral bacterial species was found. PMID:16825392

  17. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing.

    PubMed Central

    Schmidt, T M; DeLong, E F; Pace, N R

    1991-01-01

    The phylogenetic diversity of an oligotrophic marine picoplankton community was examined by analyzing the sequences of cloned ribosomal genes. This strategy does not rely on cultivation of the resident microorganisms. Bulk genomic DNA was isolated from picoplankton collected in the north central Pacific Ocean by tangential flow filtration. The mixed-population DNA was fragmented, size fractionated, and cloned into bacteriophage lambda. Thirty-eight clones containing 16S rRNA genes were identified in a screen of 3.2 x 10(4) recombinant phage, and portions of the rRNA gene were amplified by polymerase chain reaction and sequenced. The resulting sequences were used to establish the identities of the picoplankton by comparison with an established data base of rRNA sequences. Fifteen unique eubacterial sequences were obtained, including four from cyanobacteria and eleven from proteobacteria. A single eucaryote related to dinoflagellates was identified; no archaebacterial sequences were detected. The cyanobacterial sequences are all closely related to sequences from cultivated marine Synechococcus strains and with cyanobacterial sequences obtained from the Atlantic Ocean (Sargasso Sea). Several sequences were related to common marine isolates of the gamma subdivision of proteobacteria. In addition to sequences closely related to those of described bacteria, sequences were obtained from two phylogenetic groups of organisms that are not closely related to any known rRNA sequences from cultivated organisms. Both of these novel phylogenetic clusters are proteobacteria, one group within the alpha subdivision and the other distinct from known proteobacterial subdivisions. The rRNA sequences of the alpha-related group are nearly identical to those of some Sargasso Sea picoplankton, suggesting a global distribution of these organisms. Images PMID:2066334

  18. Origin and evolution of organisms as deduced from 5S ribosomal RNA sequences.

    PubMed

    Hori, H; Osawa, S

    1987-09-01

    A phylogenetic tree of most of the major groups of organisms has been constructed from the 352 5S ribosomal RNA sequences now available. The tree suggests that there are several major groups of eubacteria that diverged during the early stages of their evolution. Metabacteria (= archaebacteria) and eukaryotes separated after the emergence of eubacteria. Among eukaryotes, red algae emerged first; and, later, thraustochytrids (a Proctista group), ascomycetes (yeast), green plants (green algae and land plants), "yellow algae" (brown algae, diatoms, and chrysophyte algae), basidiomycetes (mushrooms and rusts), slime- and water molds, various protozoans, and animals emerged, approximately in that order. Three major types of photosynthetic eukaryotes--i.e., red algae (= Chlorophyll a group), green plants (Chl. a + b group) and yellow algae (Chl. a + c)--are remotely related to one another. Other photosynthetic unicellular protozoans--such as Cyanophora (Chl. a), Euglenophyta (Chl. a + b), Cryptophyta (Chl. a + c), and Dinophyta (Chl. a + c)--seem to have separated shortly after the emergence of the yellow algae. PMID:2452957

  19. Hard X-ray XAFS beamline, BL5S1, at AichiSR

    NASA Astrophysics Data System (ADS)

    Tabuchi, M.; Asakura, H.; Morimoto, H.; Watanabe, N.; Takeda, Y.

    2016-05-01

    A XAFS beamline, BL5S1, had been operated at Aichi Synchrotron Radiation Center, Japan since March 2013. The beamline was designed for the measurements in the energy range from 5 to 20 keV. The photon flux of 6 x 1010 at around 9 keV and beam spot size of 0.5 x 0.3 mm at sample position are as good as designed. For the standard transmission XAFS measurement, both of the step- and quick- scan modes are available. Energy resolution at around 9keV is good enough to discuss the energy shift of the order of 0.1 eV or higher even when the measurements are conducted in the quick-scan mode. With several kinds of detectors for fluorescence and/or CEY detection mode measurements, and various kinds of sample holders which are supported by the XAFS measurement software, users easily obtain spectra for their samples. Such a standard, well operated and easy to access XAFS beamline must be very important to broaden the base of the XAFS society further.

  20. Design and performance of a 1 MW-5 s high temperature superconductor magnetic energy storage system

    NASA Astrophysics Data System (ADS)

    Morandi, Antonio; Gholizad, Babak; Fabbri, Massimo

    2016-01-01

    The feasibility of a 1 MW-5 s