Science.gov

Sample records for 5s rrna species

  1. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    PubMed

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  2. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  3. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  4. Species identification of Crassostrea and Ostrea oysters by polymerase chain reaction amplification of the 5S rRNA gene.

    PubMed

    Cross, Ismael; Rebordinos, Laureana; Diaz, Edgardo

    2006-01-01

    A specific multiplex polymerase chain reaction (PCR) was developed for the identification of Crassostrea angulata, C. gigas, Ostrea edulis, and O. stentina oyster species. Universal primers were used for the amplification of complete repetition units of 5S rDNA in each of the 4 species. The alignment of the obtained sequences was the basis for the specific design of species-specific primers (ED1, ED2, ST1, ST2, CR1, and CR2) located in the nontranscribed spacer regions. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed identification of Crassostrea and Ostrea species. A multiplex PCR with a set of the 6 designed primers showed that they did not interfere with each other and bound specifically to the DNA target. This genetic marker can be very useful for traceability of the species, application in the management of oyster cultures, and conservation of the genetic resources of the species. PMID:16512239

  5. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  6. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  7. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

  8. Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA.

    PubMed

    Bullerwell, Charles E; Schnare, Murray N; Gray, Michael W

    2003-03-01

    Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.

  9. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  10. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    PubMed

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes.

  11. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    PubMed

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes. PMID:26835745

  12. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  13. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    PubMed

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level.

  14. Direct 5S rRNA assay for monitoring mixed-culture bioprocesses

    SciTech Connect

    Stoner, D.L.; Bulmer, D.K.; Ward, T.E.

    1996-06-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis in denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the general Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. 40 refs., 12 figs., 1 tab.

  15. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  16. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  17. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    PubMed

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  18. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  19. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  20. Chromosomal localization of 5S rRNA gene loci and the implications for relationships within the Allium complex.

    PubMed

    Lee, S H; Do, G S; Seo, B B

    1999-01-01

    Chromosomal localizations and distribution patterns of the 5S rRNA genes by means of fluorescence in-situ hybridization in diploid Allium species could help to classify species into chromosome types and aid in determining relationships among genomes. All eleven diploid species were classified into five types, A to E. Species of type A showed a pair of 5S rRNA signals on the short arm of chromosome 5 and two pairs of signals on both arms of chromosome 7. Species of types B and C showed one pair and two pairs of signals on the short arm of chromosome 7, respectively. Type D species showed two pairs of signals on the satellite region of the short arm and a pair of signals on the long arm of chromosome 7. Type E species showed three distinct 5S rRNA gene loci signals on the short arm of chromosome 7. Information on chromosomal localization of 5S rRNA gene loci and distribution patterns within chromosomes in diploid Allium species could help to infer the pathway of origin of the three kinds of alloploid species. Data indicate that A. wakegi is an allopolyploid with genomes of types B and C, and A. deltoide-fistulosum is an allotetraploid derived from a natural hybridization between different species within chromosome type A. Results indicate that A. senescens is an allopolyploid with type B chromosomes and an unidentified chromosomal type. PMID:10328620

  1. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  2. Seasonal dynamics of bacterioplankton community structure in a eutrophic lake as determined by 5S rRNA analysis.

    PubMed

    Höfle, M G; Haas, H; Dominik, K

    1999-07-01

    Community structure of bacterioplankton was studied during the major growth season for phytoplankton (April to October) in the epilimnion of a temperate eutrophic lake (Lake Plusssee, northern Germany) by using comparative 5S rRNA analysis. Estimates of the relative abundances of single taxonomic groups were made on the basis of the amounts of single 5S rRNA bands obtained after high-resolution electrophoresis of RNA directly from the bacterioplankton. Full-sequence analysis of single environmental 5S rRNAs enabled the identification of single taxonomic groups of bacteria. Comparison of partial 5S rRNA sequences allowed the detection of changes of single taxa over time. Overall, the whole bacterioplankton community showed two to eight abundant (>4% of the total 5S rRNA) taxa. A distinctive seasonal succession was observed in the taxonomic structure of this pelagic community. A rather-stable community structure, with seven to eight different taxonomic units, was observed beginning in April during the spring phytoplankton bloom. A strong reduction in this diversity occurred at the beginning of the clear-water phase (early May), when only two to four abundant taxa were observed, with one taxon dominating (up to 72% of the total 5S rRNA). The community structure during summer stagnation (June and July) was characterized by frequent changes of different dominating taxa. During late summer, a dinoflagellate bloom (Ceratium hirudinella) occurred, with Comamonas acidovorans (beta-subclass of the class Proteobacteria) becoming the dominant bacterial species (average abundance of 43% of the total 5S rRNA). Finally, the seasonal dynamics of the community structure of bacterioplankton were compared with the abundances of other major groups of the aquatic food web, such as phyto- and zooplankton, revealing that strong grazing pressure by zooplankton can reduce microbial diversity substantially in pelagic environments.

  3. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  4. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    PubMed

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis.

  5. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

    2001-01-01

    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  6. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  7. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  8. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    PubMed

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  9. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed Central

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-01-01

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  10. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period.

  11. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  12. A 5 S rRNA gene is present in the mitochondrial genome of the protist Reclinomonas americana but is absent from red algal mitochondrial DNA.

    PubMed

    Lang, B F; Goff, L J; Gray, M W

    1996-09-01

    Except in the case of land plants, mitochondrial ribosomes apparently lack a 5 S rRNA species, even though this small RNA is a component of all prokaryotic, chloroplast and eukaryotic cytosol ribosomes. In plants, the mitochondrial 5 S rRNA is encoded by mtDNA and differs in sequence from the 5 S rRNA specified by plant nuclear and chloroplast genomes. A distinctive 5 S rRNA component has not been found in the mitochondrial ribosomes of non-plant eukaryotes and, with the notable exception of the chlorophycean alga, Prototheca wickerhamii, a 5 S rRNA gene has not been identified in those non-plant mtDNAs characterized to date. Here, we report the presence of a 5 S rRNA gene in the mtDNA of the heterotrophic flagellate Reclinomonas americana. This unicellular eukaryote is a member of the jakobid flagellates, an early-diverging group of protists that share ultrastructural characteristics with the retortamonads, primitive protists that lack mitochondria. We report sequence data from the mtDNAs of the red algae Porphyra purpurea and Gracilariopsis lemaneiformis, which we use to evaluate a recent claim that a 5 S rRNA gene exists in the mtDNA of a third rhodophyte alga, Chondrus crispus. Our results lead us to the opposite conclusion: that a 5 S rRNA gene is not encoded by red algal mtDNA. In view of the accumulating evidence favoring a monophyletic origin of the mitochondrial genome, it is likely that a 5 S rRNA gene was present in an ancestral proto-mitochondrial genome, and that contemporary mtDNA-encoded 5 S rRNA genes have all descended from this ancestral gene. Considering the highly restricted phylogenetic distribution of identified mtDNA-encoded 5 S rRNA genes, it follows that the mitochondrial 5 S rRNA gene must have been lost multiple times during evolutionary diversification of the eukaryotic lineage.

  13. Identification of the gene encoding the 5S ribosomal RNA maturase in Bacillus subtilis: mature 5S rRNA is dispensable for ribosome function.

    PubMed Central

    Condon, C; Brechemier-Baey, D; Beltchev, B; Grunberg-Manago, M; Putzer, H

    2001-01-01

    Over 25 years ago, Pace and coworkers described an activity called RNase M5 in Bacillus subtilis cell extracts responsible for 5S ribosomal RNA maturation (Sogin & Pace, Nature, 1974, 252:598-600). Here we show that RNase M5 is encoded by a gene of previously unknown function that is highly conserved among the low G + C gram-positive bacteria. We propose that the gene be named rnmV. The rnmV gene is nonessential. B. subtilis strains lacking RNase M5 do not make mature 5S rRNA, indicating that this process is not necessary for ribosome function. 5S rRNA precursors can, however, be found in both free and translating ribosomes. In contrast to RNase E, which cleaves the Escherichia coli 5S precursor in a single-stranded region, which is then trimmed to yield mature 5S RNA, RNase M5 cleaves the B. subtilis equivalent in a double-stranded region to yield mature 5S rRNA in one step. For the most part, eubacteria contain one or the other system for 5S rRNA production, with an imperfect division along gram-negative and gram-positive lines. A potential correlation between the presence of RNase E or RNase M5 and the single- or double-stranded nature of the predicted cleavage sites is explored. PMID:11233981

  14. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria.

    PubMed

    Smirnov, Alexandre; Tarassov, Ivan; Mager-Heckel, Anne-Marie; Letzelter, Michel; Martin, Robert P; Krasheninnikov, Igor A; Entelis, Nina

    2008-04-01

    RNA import into mitochondria is a widespread phenomenon. Studied in details for yeast, protists, and plants, it still awaits thorough investigation for human cells, in which the nuclear DNA-encoded 5S rRNA is imported. Only the general requirements for this pathway have been described, whereas specific protein factors needed for 5S rRNA delivery into mitochondria and its structural determinants of import remain unknown. In this study, a systematic analysis of the possible role of human 5S rRNA structural elements in import was performed. Our experiments in vitro and in vivo show that two distinct regions of the human 5S rRNA molecule are needed for its mitochondrial targeting. One of them is located in the proximal part of the helix I and contains a conserved uncompensated G:U pair. The second and most important one is associated with the loop E-helix IV region with several noncanonical structural features. Destruction or even destabilization of these sites leads to a significant decrease of the 5S rRNA import efficiency. On the contrary, the beta-domain of the 5S rRNA was proven to be dispensable for import, and thus it can be deleted or substituted without affecting the 5S rRNA importability. This finding was used to demonstrate that the 5S rRNA can function as a vector for delivering heterologous RNA sequences into human mitochondria. 5S rRNA-based vectors containing a substitution of a part of the beta-domain by a foreign RNA sequence were shown to be much more efficiently imported in vivo than the wild-type 5S rRNA.

  15. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    PubMed

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  16. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    PubMed

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA.

  17. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  18. Release of ribosome-bound 5S rRNA upon cleavage of the phosphodiester bond between nucleotides A54 and A55 in 5S rRNA.

    PubMed

    Holmberg, L; Nygård, O

    2000-11-01

    Reticulocyte lysates contain ribosome-bound and free populations of 5S RNA. The free population is sensitive to nuclease cleavage in the internal loop B, at the phosphodiester bond connecting nucleotides A54 and A55. Similar cleavage sites were detected in 5S rRNA in 60S subunits and 80S ribosomes. However, 5S rRNA in reticulocyte polysomes is insensitive to cleavage unless ribosomes are salt-washed. This suggests that a translational factor protects the backbone surrounding A54 from cleavage in polysomes. Upon nuclease treatment of mouse 60S subunits or reticulocyte lysates a small population of ribosomes released its 5S rRNA together with ribosomal protein L5. Furthermore, rRNA sequences from 5.8S, 28S and 18S rRNA were released. In 18S rRNA the sequences mainly originate from the 630 loop and stem (helix 18) in the 5' domain, whereas in 28S rRNA a majority of fragments is derived from helices 47 and 81 in domains III and V, respectively. We speculate that this type of rRNA-fragmentation may mimic a ribosome degradation pathway.

  19. Triphosphate residues at the 5' ends of rRNA precursor and 5S RNA from Dictyostelium discoideum.

    PubMed Central

    Batts-Young, B; Lodish, H F

    1978-01-01

    We present here direct evidence for the preservation of a transcriptional initiation sequence in a eukaryotic rRNA precursor: the 5'-end group for precursor to 17S rRNA (p17S RNA) from Dictyostelium discoideum is identified as the triphosphate residue pppA-. We also show that mature 5S RNA form Dictyostelium bears a different triphosphate residue, pppG-. In contrast, we find no evidence for more than one phosphate at the 5' end of the 25S rRNA precursor (p25S RNA). These observations indicate that synthesis of the large ribosomal RNAs of Dictyostelium begins with the 5'-terminal sequence of the p17S RNA, and that 5S RNA transcription must be initiated independently, despite the close association of the 5S and rRNA coding segments. Images PMID:204930

  20. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  1. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  2. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    PubMed

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  3. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  4. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  5. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  6. Characterization of a novel association between two trypanosome-specific proteins and 5S rRNA.

    PubMed

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC.

  7. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  8. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  9. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    PubMed

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  10. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  11. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  12. Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

    PubMed Central

    Carol, P; Rozier, C; Lazaro, E; Ballesta, J P; Mache, R

    1993-01-01

    The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain. Images PMID:8441674

  13. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  14. What does the 5S rRNA multigene family tell us about the origin of the annual Triticeae (Poaceae)?

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2013-05-01

    We have investigated the complex relationships among the annual genera within the tribe Triticeae through phylogenetic analyses of the 5S rRNA multigene family. Cloned sequences were assigned to groups of orthologous sequences, called unit classes, that were subjected to several analyses including BLAST (Basic Local Alignment Search Tool) searches to assess possible ancestral relationships with perennial genera; phylogenetic analyses using parsimony (Pars), maximum likelihood (ML), and Bayesian methods; and minimum reticulation networks from the Pars, ML, and Bayesian trees. In this study, we included genera with both annual and perennial species, such as Dasypyrum, Hordeum, and Secale. BLAST pointed to Pseudoroegneria (carrier of the St genome) and possibly Thinopyrum (carrier of the J genome) as the potential next of kin. However, Thinopyrum and Pseudoroegneria have never fallen together on the individual trees with the former generally associated with Crithopsis, Aegilops, Triticum, and Dasypyrum, while the latter is usually associated with the rest of the genera within Triticeae. The "long" unit classes placed Dasypyrum breviaristatum together with Dasypyrum villosum, whereas the "short" unit classes put them far apart on the trees. None of the gene trees alone was able to summarize the complex relationships among the genera, in line with previous results in the Triticeae. However, the application of tools designed to display phylogenetic networks was able to depict the complex links among the genera based on the short and the long gene trees, including the close link between Thinopyrum and Pseudoroegneria suggested by the phylogenetic analyses. In addition, our analyses provide support for the hypothesis that at least some annual Triticeae taxa are derived from their perennial relatives. PMID:23789993

  15. 5S rDNA genome regions of Lens species.

    PubMed

    Fernández, M; Ruiz, M L; Linares, C; Fominaya, A; Pérez de la Vega, M

    2005-10-01

    The length variability of the nontranscribed spacer (NTS) of the 5S rDNA repeats was analyzed in species of the genus Lens by means of PCR amplification. The NTS ranged from approximately 227 to approximately 952 bp. The polymorphism detected was higher than previous NTS polymorphisms described in this genus. Three NTS length variants from Lens culinaris subsp. culinaris and 2 from Lens culinaris subsp. orientalis were sequenced. The culinaris NTS fragment lengths were 239, 371, and 838 bp, whereas the orientalis ones were 472 bp and 506 bp, respectively. As a result of sequence similarities, 2 families of sequences were distinguished, 1 including the sequences of 838 and 506 bp, and others with the sequences of 239, 371, and 472 bp. The 1st family was characterized by the presence of a repeated sequence designated A, whereas the 2nd family showed a single A sequence and other repeated sequences designated B, C, and D. The presence of an (AT)n microsatellite was also observed in the 2nd family of sequences. The fragments, which included the 239-bp and 838-bp NTS sequences, as well as the intergenic spacer (IGS) of the 18S-5.8S-26S ribosomal DNA also from L. culinaris subsp. culinaris, were used to localize the nucleolar organizer region (NOR) and the 5S rDNA loci in the chromosomes of several species of the genus Lens by means of fluorescence in situ hybridization (FISH). The selective hybridization of the 2 NTS probes allowed us to distinguish between different 5S rDNA chromosomal loci.

  16. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides

    PubMed Central

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S.; McBee, Megan E.; Dedon, Peter C.

    2015-01-01

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. PMID:25539917

  17. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    PubMed

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria.

  18. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment. PMID:22724546

  19. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

  20. Cytogenetic characterization by in situ hybridization techniques and molecular analysis of 5S rRNA genes of the European hazelnut (Corylus avellana).

    PubMed

    Falistocco, E; Marconi, G

    2013-03-01

    The European hazelnut (Corylus avellana L.) is widespread in Europe, where it has been cultivated for centuries. Despite progress in genetics, most of the cytogenetic aspects of this species have been overlooked. The aim of this study was to fill in this gap and obtain basic information on the chromosome structure of this species. Karyomorphological analysis confirmed the chromosome number 2n = 22 and showed that, despite their apparent uniformity, the chromosomes could be separated into three groups of different size: large (L), medium (M), and small (S). As a first step towards the physical mapping of the hazelnut chromosomes, we applied FISH to localize the position of rRNA genes (rDNA). The sites of 45S and 5S rDNA enabled us to identify two chromosome pairs belonging, respectively, to the L and S groups. The self-GISH procedure revealed that repetitive DNA is concentrated in the pericentromeric regions of the chromosomes, as with other species with rather small genomes. The analysis of 5S rDNA repeats offered additional information on the hazelnut genome by obtaining the whole sequence of the transcribed region so far unpublished. The overall results constitute a substantial advance in hazelnut cytogenetics. Further investigation of other species of Corylus could be an effective approach to understanding the phylogenesis of the genus and resolving taxonomic problems.

  1. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    PubMed

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  2. A novel association between two trypanosome-specific factors and the conserved L5-5S rRNA complex.

    PubMed

    Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis.

  3. Natural Microbial Community Compositions Compared by a Back-Propagating Neural Network and Cluster Analysis of 5S rRNA

    PubMed Central

    Noble, P. A.; Bidle, K. D.; Fletcher, M.

    1997-01-01

    The community compositions of free-living and particle-associated bacteria in the Chesapeake Bay estuary were analyzed by comparing banding patterns of stable low-molecular-weight RNA (SLMW RNA) which include 5S rRNA and tRNA molecules. By analyzing images of autoradiographs of SLMW RNAs on polyacrylamide gels, band intensities of 5S rRNA were converted to binary format for transmission to a back-propagating neural network (NN). The NN was trained to relate binary input to sample stations, collection times, positions in the water column, and sample types (e.g., particle-associated versus free-living communities). Dendrograms produced by using Euclidean distance and average and Ward's linkage methods on data of three independently trained NNs yielded the following results. (i) Community compositions of Chesapeake Bay water samples varied both seasonally and spatially. (ii) Although there was no difference in the compositions of free-living and particle-associated bacteria in the summer, these community types differed significantly in the winter. (iii) In the summer, most bay samples had a common 121-nucleotide 5S rRNA molecule. Although this band occurred in the top water of midbay samples, it did not occur in particle-associated communities of bottom-water samples. (iv) Regardless of the season, midbay samples had the greatest variety of 5S rRNA sizes. The utility of NNs for interpreting complex banding patterns in electrophoresis gels was demonstrated. PMID:16535593

  4. Chromosomal localization of the 18S-28S and 5S rRNA genes and (TTAGGG)n sequences of butterfly lizards (Leiolepis belliana belliana and Leiolepis boehmei, Agamidae, Squamata).

    PubMed

    Srikulnath, Kornsorn; Uno, Yoshinobu; Matsubara, Kazumi; Thongpan, Amara; Suputtitada, Saowanee; Apisitwanich, Somsak; Nishida, Chizuko; Matsuda, Yoichi

    2011-10-01

    Chromosomal mapping of the butterfly lizards Leiolepis belliana belliana and L. boehmei was done using the 18S-28S and 5S rRNA genes and telomeric (TTAGGG)n sequences. The karyotype of L. b. belliana was 2n = 36, whereas that of L. boehmei was 2n = 34. The 18S-28S rRNA genes were located at the secondary constriction of the long arm of chromosome 1, while the 5S rRNA genes were found in the pericentromeric region of chromosome 6 in both species. Hybridization signals for the (TTAGGG)n sequence were observed at the telomeric ends of all chromosomes, as well as interstitially at the same position as the 18S-28S rRNA genes in L. boehmei. This finding suggests that in L. boehmei telomere-to-telomere fusion probably occurred between chromosome 1 and a microchromosome where the 18S-28S rRNA genes were located or, alternatively, at the secondary constriction of chromosome 1. The absence of telomeric sequence signals in chromosome 1 of L. b. belliana suggested that its chromosomes may have only a few copies of the (TTAGGG)n sequence or that there may have been a gradual loss of the repeat sequences during chromosomal evolution.

  5. Cytogenetic mapping of 5S and 18S rRNAs and H3 histone genes in 4 ancient Proscopiidae grasshopper species: contribution to understanding the evolutionary dynamics of multigene families.

    PubMed

    Cabral-de-Mello, D C; Martins, C; Souza, M J; Moura, R C

    2011-01-01

    This paper reports on the chromosomal location of 18S rRNA, 5S rRNA and H3 histone multigene families in 4 species of a relatively ancient and diversified group of grasshoppers belonging to the family Proscopiidae. The 5S rRNA and H3 histone genes were highly conserved in the number of sites and chromosomal position in the 4th chromosome pair in all species analyzed, whereas the 18S rRNA genes showed slightly more variation because they were present on one or 2 chromosome pairs, depending on the species. The 5S and 18S rRNA gene families occurred in different chromosomes; in contrast, H3 histone and 5S rRNA genes co-localized in the same chromosomal position, with an apparently interspersed organization. Considering that the Proscopiidae family is a relatively ancient group compared with the Acrididae family, the association of the H3 histone and 5S rRNA multigene families can represent a basal condition for grasshoppers, although more research is needed on other representatives of this insect group to confirm this statement. The presence of such an association of 5S rDNA and H3 histone in mussels and arthropods (beetles, grasshoppers and crustaceans) suggests that this linked configuration could represent an ancestral pattern for invertebrates. These results provide new insights into the understanding of the genome organization and the evolution of multigene families in grasshoppers and in insects as a whole.

  6. Interaction of ribosomal proteins S5, S6, S11, S12, S18 and S21 with 16 S rRNA.

    PubMed

    Stern, S; Powers, T; Changchien, L M; Noller, H F

    1988-06-20

    We have examined the effects of assembly of ribosomal proteins S5, S6, S11, S12, S18 and S21 on the reactivities of residues in 16 S rRNA towards chemical probes. The results show that S6, S18 and S11 interact with the 690-720 and 790 loop regions of 16 S rRNA in a highly co-operative manner, that is consistent with the previously defined assembly map relationships among these proteins. The results also indicate that these proteins, one of which (S18) has previously been implicated as a component of the ribosomal P-site, interact with residues near some of the recently defined P-site (class II tRNA protection) nucleotides in 16 S rRNA. In addition, assembly of protein S12 has been found to result in the protection of residues in both the 530 stem/loop and the 900 stem regions; the latter group is closely juxtaposed to a segment of 16 S rRNA recently shown to be protected from chemical probes by streptomycin. Interestingly, both S5 and S12 appear to protect, to differing degrees, a well-defined set of residues in the 900 stem/loop and 5'-terminal regions. These observations are discussed in terms of the effects of S5 and S12 on streptomycin binding, and in terms of the class III tRNA protection found in the 900 stem of 16 S rRNA. Altogether these results show that many of the small subunit proteins, which have previously been shown to be functionally important, appear to be associated with functionally implicated segments of 16 S rRNA.

  7. Cocrystallizing natural RNA with its unnatural mirror image: biochemical and preliminary X-ray diffraction analysis of a 5S rRNA A-helix racemate

    SciTech Connect

    Förster, Charlotte; Brauer, Arnd B. E.; Lehmann, Daniel; Borowski, Tordis; Brode, Svenja; Fürste, Jens P.; Perbandt, Markus; Betzel, Christian

    2007-10-01

    A 5S rRNA A-helix 7-mer oligonucleotide was chemically synthesized both as d-RNA and as l-RNA, biochemically investigated, crystallized as a stochiometric racemate and examined by X-ray diffraction. Chemically synthesized RNAs with the unnatural l-configuration possess enhanced in vivo stability and nuclease resistance, which is a highly desirable property for pharmacological applications. For a structural comparison, both l- and d-RNA oligonucleotides of a shortened Thermus flavus 5S rRNA A-helix were chemically synthesized. The enantiomeric RNA duplexes were stochiometrically cocrystallized as a racemate, which enabled analysis of the d- and l-RNA enantiomers in the same crystals. In addition to a biochemical investigation, diffraction data were collected to 3.0 Å resolution using synchrotron radiation. The crystals belonged to space group P3{sub 1}21, with unit-cell parameters a = b = 35.59, c = 135.30 Å, γ = 120° and two molecules per asymmetric unit.

  8. Fresh-water planarias and a marine planaria are relatively dissimilar in the 5S rRNA sequences.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S; Takai, M

    1983-01-25

    The nucleotide sequences from fresh-water Dugesia japonica and marine Planocera reticulata have been determined. The similarity between these two species is only 69%. The Planocera sequence reveals nearly 80% similarity (72-81%) to the sequences of multicellular animals, while the Dugesia sequences are considerably different from them (66-73%).

  9. Intraspecific 16S rRNA gene diversity among clinical isolates of Neisseria species.

    PubMed

    Mechergui, Arij; Achour, Wafa; Hassen, Assia Ben

    2014-05-01

    In the present work, nearly the entire 16S rRNA gene sequences of 46 clinical samples of Neisseria spp. were determined, and the aligned sequences were analyzed to investigate the diversity of 16S rRNA genes in each commensal Neisseria species. Two 16S rRNA types were identified in two Neisseria sicca strains, three 16S rRNA types in five Neisseria macacae strains, fourteen 16S rRNA types in twenty Neisseria flavescens isolates, and fourteen 16S rRNA types in nineteen Neisseria mucosa isolates. The number of nucleotides that were different between 16S rRNA sequences within specie ranged from 1 to 15. We found high intraspecific sequence variation in 16S rRNA genes of Neisseria spp. strains.

  10. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.

    PubMed

    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A

    2008-01-01

    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  11. Regulation of the rplY gene encoding 5S rRNA binding protein L25 in Escherichia coli and related bacteria.

    PubMed

    Aseev, Leonid V; Bylinkina, Natalia S; Boni, Irina V

    2015-05-01

    Ribosomal protein (r-protein) L25 is one of the three r-proteins (L25, L5, L18) that interact with 5S rRNA in eubacteria. Specific binding of L25 with a certain domain of 5S r-RNA, a so-called loop E, has been studied in detail, but information about regulation of L25 synthesis has remained totally lacking. In contrast to the rplE (L5) and rplR (L18) genes that belong to the polycistronic spc-operon and are regulated at the translation level by r-protein S8, the rplY (L25) gene forms an independent transcription unit. The main goal of this work was to study the regulation of the rplY expression in vivo. We show that the rplY promoter is down-regulated by ppGpp and its cofactor DksA in response to amino acid starvation. At the level of translation, the rplY expression is subjected to the negative feedback control. The 5'-untranslated region of the rplY mRNA comprises specific sequence/structure features, including an atypical SD-like sequence, which are highly conserved in a subset of gamma-proteobacterial families. Despite the lack of a canonical SD element, the rplY'-'lacZ single-copy reporter showed unusually high translation efficiency. Expression of the rplY gene in trans decreased the translation yield, indicating the mechanism of autogenous repression. Site-directed mutagenesis of the rplY 5' UTR revealed an important role of the conserved elements in the translation control. Thus, the rplY expression regulation represents one more example of regulatory pathways that control ribosome biogenesis in Escherichia coli and related bacteria.

  12. Mutations in TFIIIA that increase stability of the TFIIIA-5 S rRNA gene complex: unusual effects on the kinetics of complex assembly and dissociation.

    PubMed

    Brady, Kristina L; Ponnampalam, Stephen N; Bumbulis, Michael J; Setzer, David R

    2005-07-22

    We have identified four mutations in Xenopus TFIIIA that increase the stability of TFIIIA-5 S rRNA gene complexes. In each case, the mutation has a relatively modest effect on equilibrium binding affinity. In three cases, these equilibrium binding effects can be ascribed primarily to decreases in the rate constant for protein-DNA complex dissociation. In the fourth case, however, a substitution of phenylalanine for the wild-type leucine at position 148 in TFIIIA results in much larger compensating changes in the kinetics of complex assembly and dissociation. The data support a model in which a relatively unstable population of complexes with multi-component dissociation kinetics forms rapidly; complexes then undergo a slow conformational change that results in very stable, kinetically homogeneous TFIIIA-DNA complexes. The L148F mutant protein acts as a particularly potent transcriptional activator when it is fused to the VP16 activation domain and expressed in yeast cells. Substitution of L148 to tyrosine or tryptophan produces an equally strong transcriptional activator. Substitution to histidine results in genetic and biochemical effects that are more modest than, but similar to, those observed with the L148F mutation. We propose that an amino acid with a planar side chain at position 148 can intercalate between adjacent base pairs in the intermediate element of the 5 S rRNA gene. Intercalation occurs slowly but results in a very stable DNA-protein complex. These results suggest that transcriptional activation by a cis-acting sequence element is largely dependent on the kinetic, rather than the thermodynamic, stability of the complex formed with an activator protein. Thus, transcriptional activation is dependent in large part on the lifetime of the activator-DNA complex rather than on binding site occupancy at steady state. Introduction of intercalating amino acids into zinc finger proteins may be a useful tool for producing artificial transcription factors with

  13. Regulation of the rplY gene encoding 5S rRNA binding protein L25 in Escherichia coli and related bacteria

    PubMed Central

    Aseev, Leonid V.; Bylinkina, Natalia S.; Boni, Irina V.

    2015-01-01

    Ribosomal protein (r-protein) L25 is one of the three r-proteins (L25, L5, L18) that interact with 5S rRNA in eubacteria. Specific binding of L25 with a certain domain of 5S r-RNA, a so-called loop E, has been studied in detail, but information about regulation of L25 synthesis has remained totally lacking. In contrast to the rplE (L5) and rplR (L18) genes that belong to the polycistronic spc-operon and are regulated at the translation level by r-protein S8, the rplY (L25) gene forms an independent transcription unit. The main goal of this work was to study the regulation of the rplY expression in vivo. We show that the rplY promoter is down-regulated by ppGpp and its cofactor DksA in response to amino acid starvation. At the level of translation, the rplY expression is subjected to the negative feedback control. The 5′-untranslated region of the rplY mRNA comprises specific sequence/structure features, including an atypical SD-like sequence, which are highly conserved in a subset of gamma-proteobacterial families. Despite the lack of a canonical SD element, the rplY’-‘lacZ single-copy reporter showed unusually high translation efficiency. Expression of the rplY gene in trans decreased the translation yield, indicating the mechanism of autogenous repression. Site-directed mutagenesis of the rplY 5′ UTR revealed an important role of the conserved elements in the translation control. Thus, the rplY expression regulation represents one more example of regulatory pathways that control ribosome biogenesis in Escherichia coli and related bacteria. PMID:25749694

  14. Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells.

    PubMed

    Wang, Xinyu; Ren, Yanli; Wang, Zhiqiong; Xiong, Xiangyu; Han, Sichong; Pan, Wenting; Chen, Hongwei; Zhou, Liqing; Zhou, Changchun; Yuan, Qipeng; Yang, Ming

    2015-12-21

    5S rRNA plays an important part in ribosome biology and is over-expression in multiple cancers. In this study, we found that 5S rRNA is a direct target of miR-150 and miR-383 in esophageal squamous cell carcinoma (ESCC). Overexpression of miR-150 and miR-383 inhibited ESCC cell proliferation in vitro and in vivo. Moreover, 5S rRNA silencing by miR-150 and miR-383 might intensify rpL11-c-Myc interaction, which attenuated role of c-Myc as an oncogenic transcriptional factor and dysregulation of multiple c-Myc target genes. Taken together, our results highlight the involvement of miRNAs in ribosomal regulation during tumorigenesis.

  15. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    PubMed

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends.

  16. Phylogenetic relationships among diploid Aegilops species inferred from 5S rDNA units.

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2009-10-01

    Relationships among the currently recognized 11 diploid species within the genus Aegilops have been investigated. Sequence similarity analysis, based upon 363 sequenced 5S rDNA clones from 44 accessions plus 15 sequences retrieved from GenBank, depicted two unit classes labeled the long AE1 and short AE1. Several different analytical methods were applied to infer relationships within haplomes, between haplomes and among the species, including maximum parsimony and maximum likelihood analyses of consensus sequences, "total evidence" phylogeny analysis and "matrix representation with parsimony" analysis. None were able to depict suites of markers or unit classes that could discern among the seven haplomes as is observed among established haplomes in other genera within the tribe Triticeae; however, most species could be separated when displayed on gene trees. These results suggest that the haplomes currently recognized are so refined that they may be relegated as sub-haplomes or haplome variants. Amblyopyrum shares the same 5S rDNA unit classes with the diploid Aegilops species suggesting that it belongs within the latter. Comparisons of the Aegilops sequences with those of Triticum showed that the long AE1 unit class of Ae. tauschii shared the clade with the equivalent long D1 unit class, i.e., the putative D haplome donor, but the short AE1 unit class did not. The long AE1 unit class but not the short, of Ae. speltoides and Ae. searsii both share the clade with the previously identified long {S1 and long G1 unit classes meaning that both Aegilops species can be equally considered putative B haplome donors to tetraploid Triticum species. The semiconserved nature of the nontranscribed spacer in Aegilops and in Triticeae in general is discussed in view that it may have originated by processes of incomplete gene conversion or biased gene conversion or birth-and-death evolution.

  17. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central

    2012-01-01

    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  18. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. PMID:25261903

  19. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps.

  20. Physical mapping of 5S rDNA in two species of Knifefishes: Gymnotus pantanal and Gymnotus paraguensis (Gymnotiformes).

    PubMed

    da Silva, M; Matoso, D A; Vicari, M R; de Almeida, M C; Margarido, V P; Artoni, R F

    2011-01-01

    Physical mapping of 5S rDNA in 2 species of knifefishes, Gymnotuspantanal and G. paraguensis (Gymnotiformes), was performed using fluorescence in situ hybridization with a 5S rDNA probe. The 5S rDNA PCR product from the genomes of both species was also sequenced and aligned to determine non-transcribed spacer sequences (NTS). Both species under study had different patterns of 5S rDNA gene cluster distribution. While in the karyotype of G. pantanal two 5S rDNA-bearing pairs were observed, the karyotype of G. paraguensis possessed as many as 19 such pairs. Such multiplication of 5S rDNA gene clusters might be caused by the involvement of transposable elements because the NTS of G. paraguensis was 400 bp long with high identity (90%) with a mobile transposable element called Tc1-like transposon, described from the cyprinid fish Labeo rohita.

  1. Molecular characterization and chromosomal mapping of the 5S rRNA gene in Solea senegalensis: a new linkage to the U1, U2, and U5 small nuclear RNA genes.

    PubMed

    Manchado, Manuel; Zuasti, Eugenia; Cross, Ismael; Merlo, Alejandro; Infante, Carlos; Rebordinos, Laureana

    2006-01-01

    Some units of the 5S rDNA of Solea senegalensis were amplified by PCR and sequenced. Three main PCR products (227, 441, and 2166 bp) were identified. The 227- and 441-bp fragments were characterized by highly divergent nontranscribed spacer sequences (referred to as NTS-I and NTS-II) that were 109 and 324 bp long, respectively, yet their coding sequences were nearly identical. The 2166-bp 5S rDNA unit was composed of two 5S rRNA genes separated by NTS-I and followed by a 1721-bp spacer containing the U2, U5, and U1 small nuclear RNA genes (snRNAs). They were inverted and arranged in the transcriptional direction opposite that of the 5S rRNA gene. This simultaneous linkage of 3 different snRNAs had never been observed before. The PCR products were used as probes in fluorescence in situ hybridization experiments to locate the corresponding loci on the chromosomes of S. senegalensis. A major 5S rDNA chromosomal site was located along most of the short arm of a submetacentric pair, while a minor site was detected near the centromeric region of an acrocentric pair.

  2. Comparative calorimetric studies on the dynamic conformation of plant 5S rRNA. I. Thermal unfolding pattern of lupin seeds and wheat germ 5S rRNAs, also in the presence of magnesium and sperminium cations.

    PubMed Central

    Barciszewski, J; Bratek-Wiewiórowska, M D; Górnicki, P; Naskret-Barciszewska, M; Wiewiórowski, M; Zielenkiewicz, A; Zielenkiewicz, W

    1988-01-01

    An attempt has been made to correlate differential scanning calorimetry melting profiles of 5S rRNAs from lupin seeds (L.s.) and wheat germ (W.g.) with their structure. It is suggested that the observed differences in thermal unfolding are due to differences in RNA nucleotide sequence and as a consequence in higher order structures. Interesting effects induced by magnesium cation, perprotonated and permethylated sperminium tetracations are discussed. It is suggested that the difference in the stabilizing effect of the three cations results from different mode of their interactions with RNA. "Pure" electrostatic interactions expected for permethylated tetracations are rather weak due to the steric hindrance around each positively charged nitrogen atom. Electrostatic interactions of the other two cations are significantly enhanced by coordination bonding for magnesium and by hydrogen bonding for protonated sperminium cation. PMID:3340550

  3. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  4. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

    1992-01-01

    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  5. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  6. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).

    PubMed

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  7. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).

    PubMed

    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F

    2014-11-14

    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera.

  8. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    PubMed Central

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  9. The inconstant gut microbiota of Drosophila species revealed by 16S rRNA gene analysis

    PubMed Central

    Wong, Adam C-N; Chaston, John M; Douglas, Angela E

    2013-01-01

    The gut microorganisms in some animals are reported to include a core microbiota of consistently associated bacteria that is ecologically distinctive and may have coevolved with the host. The core microbiota is promoted by positive interactions among bacteria, favoring shared persistence; its retention over evolutionary timescales is evident as congruence between host phylogeny and bacterial community composition. This study applied multiple analyses to investigate variation in the composition of gut microbiota in drosophilid flies. First, the prevalence of five previously described gut bacteria (Acetobacter and Lactobacillus species) in individual flies of 21 strains (10 Drosophila species) were determined. Most bacteria were not present in all individuals of most strains, and bacterial species pairs co-occurred in individual flies less frequently than predicted by chance, contrary to expectations of a core microbiota. A complementary pyrosequencing analysis of 16S rRNA gene amplicons from the gut microbiota of 11 Drosophila species identified 209 bacterial operational taxonomic units (OTUs), with near-saturating sampling of sequences, but none of the OTUs was common to all host species. Furthermore, in both of two independent sets of Drosophila species, the gut bacterial community composition was not congruent with host phylogeny. The final analysis identified no common OTUs across three wild and four laboratory samples of D. melanogaster. Our results yielded no consistent evidence for a core microbiota in Drosophila. We conclude that the taxonomic composition of gut microbiota varies widely within and among Drosophila populations and species. This is reminiscent of the patterns of bacterial composition in guts of some other animals, including humans. PMID:23719154

  10. The inconstant gut microbiota of Drosophila species revealed by 16S rRNA gene analysis.

    PubMed

    Wong, Adam C-N; Chaston, John M; Douglas, Angela E

    2013-10-01

    The gut microorganisms in some animals are reported to include a core microbiota of consistently associated bacteria that is ecologically distinctive and may have coevolved with the host. The core microbiota is promoted by positive interactions among bacteria, favoring shared persistence; its retention over evolutionary timescales is evident as congruence between host phylogeny and bacterial community composition. This study applied multiple analyses to investigate variation in the composition of gut microbiota in drosophilid flies. First, the prevalence of five previously described gut bacteria (Acetobacter and Lactobacillus species) in individual flies of 21 strains (10 Drosophila species) were determined. Most bacteria were not present in all individuals of most strains, and bacterial species pairs co-occurred in individual flies less frequently than predicted by chance, contrary to expectations of a core microbiota. A complementary pyrosequencing analysis of 16S rRNA gene amplicons from the gut microbiota of 11 Drosophila species identified 209 bacterial operational taxonomic units (OTUs), with near-saturating sampling of sequences, but none of the OTUs was common to all host species. Furthermore, in both of two independent sets of Drosophila species, the gut bacterial community composition was not congruent with host phylogeny. The final analysis identified no common OTUs across three wild and four laboratory samples of D. melanogaster. Our results yielded no consistent evidence for a core microbiota in Drosophila. We conclude that the taxonomic composition of gut microbiota varies widely within and among Drosophila populations and species. This is reminiscent of the patterns of bacterial composition in guts of some other animals, including humans.

  11. Beyond 16S rRNA Community Profiling: Intra-Species Diversity in the Gut Microbiota

    PubMed Central

    Ellegaard, Kirsten M.; Engel, Philipp

    2016-01-01

    Interactions with microbes affect many aspects of animal biology, including immune system development, nutrition and health. In vertebrates, the gut microbiota is dominated by a small subset of phyla, but the species composition within these phyla is typically not conserved. Moreover, several recent studies have shown that bacterial species in the gut are composed of a multitude of strains, which frequently co-exist in their host, and may be host-specific. However, since the study of intra-species diversity is challenging, particularly in the setting of complex, host-associated microbial communities, our current understanding of the distribution, evolution and functional relevance of intra-species diversity in the gut is scarce. In order to unravel how genomic diversity translates into phenotypic diversity, community analyses going beyond 16S rRNA profiling, in combination with experimental approaches, are needed. Recently, the honeybee has emerged as a promising model for studying gut bacterial communities, particularly in terms of strain-level diversity. Unlike most other invertebrates, the honeybee gut is colonized by a remarkably consistent and specific core microbiota, which is dominated by only eight bacterial species. As for the vertebrate gut microbiota, these species are composed of highly diverse strains suggesting that similar evolutionary forces shape gut community structures in vertebrates and social insects. In this review, we outline current knowledge on the evolution and functional relevance of strain diversity within the gut microbiota, including recent insights gained from mammals and other animals such as the honeybee. We discuss methodological approaches and propose possible future avenues for studying strain diversity in complex bacterial communities. PMID:27708630

  12. Species-level identification of staphylococci isolated from bovine mastitis in Brazil using partial 16S rRNA sequencing.

    PubMed

    Lange, Carla C; Brito, Maria A V P; Reis, Daniele R L; Machado, Marco A; Guimarães, Alessandro S; Azevedo, Ana L S; Salles, Érica B; Alvim, Mariana C T; Silva, Fabiana S; Meurer, Igor R

    2015-04-17

    Staphylococci isolated from bovine milk and not classified as Staphylococcus aureus represent a heterogeneous group of microorganisms that are frequently associated with bovine mastitis. The identification of these microorganisms is important, although it is difficult and relatively costly. Genotypic methods add precision in the identification of Staphylococcus species. In the present study, partial 16S rRNA sequencing was used for the species identification of coagulase-positive and coagulase-negative staphylococci isolated from bovine mastitis. Two hundred and two (95%) of the 213 isolates were successfully identified at the species level. The assigning of an isolate to a particular species was based on ≥99% identity with 16S rRNA sequences deposited in GenBank. The identified isolates belonged to 13 different Staphylococcus species; Staphylococcus chromogenes, S. aureus and Staphylococcus epidermidis were the most frequently identified species. Eight isolates could not be assigned to a single species, as the obtained sequences showed 99% or 100% similarity to sequences from two or three different Staphylococcus species. The relatedness of these isolates with the other isolates and reference strains was visualized using a cladogram. In conclusion, 16S rRNA sequencing was an objective and accurate method for the proper identification of Staphylococcus species isolated from bovine mastitis. Additional target genes could be used in non-conclusive cases for the species-level identification of these microorganisms.

  13. Species-level identification of staphylococci isolated from bovine mastitis in Brazil using partial 16S rRNA sequencing.

    PubMed

    Lange, Carla C; Brito, Maria A V P; Reis, Daniele R L; Machado, Marco A; Guimarães, Alessandro S; Azevedo, Ana L S; Salles, Érica B; Alvim, Mariana C T; Silva, Fabiana S; Meurer, Igor R

    2015-04-17

    Staphylococci isolated from bovine milk and not classified as Staphylococcus aureus represent a heterogeneous group of microorganisms that are frequently associated with bovine mastitis. The identification of these microorganisms is important, although it is difficult and relatively costly. Genotypic methods add precision in the identification of Staphylococcus species. In the present study, partial 16S rRNA sequencing was used for the species identification of coagulase-positive and coagulase-negative staphylococci isolated from bovine mastitis. Two hundred and two (95%) of the 213 isolates were successfully identified at the species level. The assigning of an isolate to a particular species was based on ≥99% identity with 16S rRNA sequences deposited in GenBank. The identified isolates belonged to 13 different Staphylococcus species; Staphylococcus chromogenes, S. aureus and Staphylococcus epidermidis were the most frequently identified species. Eight isolates could not be assigned to a single species, as the obtained sequences showed 99% or 100% similarity to sequences from two or three different Staphylococcus species. The relatedness of these isolates with the other isolates and reference strains was visualized using a cladogram. In conclusion, 16S rRNA sequencing was an objective and accurate method for the proper identification of Staphylococcus species isolated from bovine mastitis. Additional target genes could be used in non-conclusive cases for the species-level identification of these microorganisms. PMID:25704228

  14. Structural and functional exchangeability of 5 S RNA species from the eubacterium E.coli and the thermoacidophilic archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Teixidò, J; Altamura, S; Londei, P; Amils, R

    1989-01-01

    The role of 5 S RNA within the large ribosomal subunit of the extremely thermophilic archaebacterium Sulfolobus solfataricus has been analysed by means of in vitro reconstitution procedures. It is shown that Sulfolobus 50 S subunits reconstituted in the absence of 5 S RNA are inactive in protein synthesis and lack 2-3 ribosomal proteins. Furthermore, it has been determined that in the course of the in vitro assembly process Sulfolobus 5 S RNA can be replaced by the correspondent RNA species of E.coli; Sulfolobus reconstituted particles containing the eubacterial 5 S molecule are stable and active in polypeptide synthesis at high temperatures. Images PMID:2493632

  15. 16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

    PubMed

    Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

    2013-12-01

    Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type.

  16. Identification of aquatic Burkholderia (Pseudomonas) cepacia by hybridization with species-specific rRNA gene probes

    SciTech Connect

    Leff, L.G.; Kernan, R.M.; McArthur, J.V.

    1995-04-01

    Burkholderia (Pseudomonas) cepacia is a common environmental bacterium which can be pathogenic for plants and humans. In this study, four strategies were used to identify aquatic isolates: API test strips, hybridization with species-specific DNA probes for the 16S and 23S rRNA genes, fatty acid methyl ester (FAME) profiles, and growth on selective medium (TB-T agar [C. Hagedorn, W.D. Gould, T.R. Bardinelli, and D.R. Gustarson, Appl. Environ. Microbiol. 53:2265-2268, 1987]). Only 59% of the isolates identified as B. cepacia with the API test strips were confirmed as B. cepacia by using fatty acids profiles. The 23S rRNA probe generated a few false-positive results but dramatically underestimated the number of B. cepacia isolates (i.e., 40% of the colonies that did not hybridize to the probe were B. cepacia, as determined by FAME). The 16S rRNA probe generated more false-positive results than the 23S rRNA probe but was effective in identifying the majority of the B. cepacia isolates. The selective medium was only partially successful in recovering B. cepacia. Use of the B. cepacia-specific 16S rRNA probe was the most efficient and accurate way of identifying B. cepacia. 13 refs., 1 fig., 2 tabs.

  17. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    PubMed

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. PMID:24643007

  18. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    PubMed

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome.

  19. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    PubMed

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  20. Clinical Fusobacterium mortiferum Isolates Cluster with Undifferentiated Clostridium rectum Species Based on 16S rRNA Gene Phylogenetic Analysis.

    PubMed

    Lee, Yangsoon; Eun, Chang Soo; Han, Dong Soo

    2016-05-01

    The most commonly encountered clinical Fusobacterium species are F. nucleatum and F. necrophorum; other Fusobacteria, such as F. mortiferum and F. varium, have occasionally been isolated from human specimens. Clostridium rectum is a gram-positive species characterized as a straight bacillus with oval sub-terminal spores. The close 16S rRNA gene sequence relationship of C. rectum with the genus Fusobacterium is unexpected given their very different phenotypic characteristics. Between 2014 and 2015, a total of 19 Fusobacterium isolates were recovered from the colonic tissue of 10 patients at a university hospital. All isolates were identified based on 16S rRNA gene sequencing. The phylogenetic relationship among these isolates was estimated using the neighbor-joining method and the Molecular Evolutionary Genetic Analysis (MEGA) version 6. Based on phylogenetic analysis, the F. mortiferum isolates clustered into two groups - F. mortiferum DSM 19809 (group I) and F. mortiferum ATCC 25557 (group II) - even though they are of the same species. Furthermore, the F. mortiferum DSM 19809 (group I) showed a close phylogenetic relationship with C. rectum, even though C. rectum is classified as a gram-positive spore-producing bacillus. C. rectum is clearly unrelated to the genus Clostridium as it shows highest 16S rRNA gene sequence similarity with species from the genus Fusobacterium Therefore, additional methods such as Gram staining and other biochemical methods should be performed for Fusobacterium identification. PMID:27312552

  1. Clinical Fusobacterium mortiferum Isolates Cluster with Undifferentiated Clostridium rectum Species Based on 16S rRNA Gene Phylogenetic Analysis.

    PubMed

    Lee, Yangsoon; Eun, Chang Soo; Han, Dong Soo

    2016-05-01

    The most commonly encountered clinical Fusobacterium species are F. nucleatum and F. necrophorum; other Fusobacteria, such as F. mortiferum and F. varium, have occasionally been isolated from human specimens. Clostridium rectum is a gram-positive species characterized as a straight bacillus with oval sub-terminal spores. The close 16S rRNA gene sequence relationship of C. rectum with the genus Fusobacterium is unexpected given their very different phenotypic characteristics. Between 2014 and 2015, a total of 19 Fusobacterium isolates were recovered from the colonic tissue of 10 patients at a university hospital. All isolates were identified based on 16S rRNA gene sequencing. The phylogenetic relationship among these isolates was estimated using the neighbor-joining method and the Molecular Evolutionary Genetic Analysis (MEGA) version 6. Based on phylogenetic analysis, the F. mortiferum isolates clustered into two groups - F. mortiferum DSM 19809 (group I) and F. mortiferum ATCC 25557 (group II) - even though they are of the same species. Furthermore, the F. mortiferum DSM 19809 (group I) showed a close phylogenetic relationship with C. rectum, even though C. rectum is classified as a gram-positive spore-producing bacillus. C. rectum is clearly unrelated to the genus Clostridium as it shows highest 16S rRNA gene sequence similarity with species from the genus Fusobacterium Therefore, additional methods such as Gram staining and other biochemical methods should be performed for Fusobacterium identification.

  2. Variability of the 5S and 45S rDNA Sites in Passiflora L. Species with Distinct Base Chromosome Numbers

    PubMed Central

    DE MELO, NATONIEL FRANKLIN; GUERRA, MARCELO

    2003-01-01

    Cytologically, the species of Passiflora with known chromosome number can be divided into four groups: (1) 2n = 12, 24, 36; (2) 2n = 24; (3) 2n = 18, 72; and (4) 2n = 20. The base chromosome number proposed for the genus is x = 6, with x = 9, x = 10 and x = 12 being considered secondary base numbers. In the present study, variability of 5S and 45S rDNA sites was investigated in 20 species of these four groups to check the reliability of this hypothesis. In the group with x = 6, five diploid species (2n = 12) exhibit two 5S rDNA sites and two (P. capsularis, P. morifolia and P. rubra) or four (P. misera 2x and P. tricuspis) 45S rDNA sites. The hexaploid cytotype of P. misera had 12 45S rDNA sites and six 5S rDNA. A tetraploid species, P. suberosa, had ten 45S rDNA sites and four 5S rDNA sites, both in the same chromosomes as the 45S rDNA sites. In the group with x = 9, P. actinia, P. amethystina, P. edmundoi, P. elegans, P. galbana, P. glandulosa and P. mucronata displayed six 45S rDNA sites, whereas P. alata, P. cincinnata, P. edulis f. flavicarpa, P. edulis var. roxo and P. laurifolia had four sites. In this group, all species were diploid (2n = 18) and had only two 5S rDNA sites. Passiflora foetida, the only species with 2n = 20, had six 45S rDNA sites and four 5S rDNA sites. The species with x = 12 (2n = 24), P. haematostigma and P. pentagona, showed four 45S rDNA sites and two 5S rDNA. In general, the number and location of 5S and 45S rDNA sites were consistent with the hypothesis of x = 6 as the probable ancestral genome for the genus, while the groups of species with x = 9, x = 10 and x = 12 were considered to be of tetraploid origin with descending dysploidy and gene silencing of some redundant gene sites, mainly those of 5S rDNA. PMID:12876193

  3. Variability of the 5S and 45S rDNA sites in Passiflora L. species with distinct base chromosome numbers.

    PubMed

    de Melo, Natoniel Franklin; Guerra, Marcelo

    2003-08-01

    Cytologically, the species of Passiflora with known chromosome number can be divided into four groups: (1) 2n = 12, 24, 36; (2) 2n = 24; (3) 2n = 18, 72; and (4) 2n = 20. The base chromosome number proposed for the genus is x = 6, with x = 9, x = 10 and x = 12 being considered secondary base numbers. In the present study, variability of 5S and 45S rDNA sites was investigated in 20 species of these four groups to check the reliability of this hypothesis. In the group with x = 6, five diploid species (2n = 12) exhibit two 5S rDNA sites and two (P. capsularis, P. morifolia and P. rubra) or four (P. misera 2x and P. tricuspis) 45S rDNA sites. The hexaploid cytotype of P. misera had 12 45S rDNA sites and six 5S rDNA. A tetraploid species, P. suberosa, had ten 45S rDNA sites and four 5S rDNA sites, both in the same chromosomes as the 45S rDNA sites. In the group with x = 9, P. actinia, P. amethystina, P. edmundoi, P. elegans, P. galbana, P. glandulosa and P. mucronata displayed six 45S rDNA sites, whereas P. alata, P. cincinnata, P. edulis f. flavicarpa, P. edulis var. roxo and P. laurifolia had four sites. In this group, all species were diploid (2n = 18) and had only two 5S rDNA sites. Passiflora foetida, the only species with 2n = 20, had six 45S rDNA sites and four 5S rDNA sites. The species with x = 12 (2n = 24), P. haematostigma and P. pentagona, showed four 45S rDNA sites and two 5S rDNA. In general, the number and location of 5S and 45S rDNA sites were consistent with the hypothesis of x = 6 as the probable ancestral genome for the genus, while the groups of species with x = 9, x = 10 and x = 12 were considered to be of tetraploid origin with descending dysploidy and gene silencing of some redundant gene sites, mainly those of 5S rDNA. PMID:12876193

  4. Reverse transcription and polymerase chain reaction amplification of rRNA for detection of Helicobacter species.

    PubMed

    Engstrand, L; Nguyen, A M; Graham, D Y; el-Zaatari, F A

    1992-09-01

    Sequence data on Helicobacter pylori 16S rRNA were used to select two 22-base oligonucleotide primers for use in a polymerase chain reaction (PCR) for detection of H. pylori. H. pylori cells were treated with lysis buffer, boiled, and chloroform extracted. Reverse transcription of rRNA was followed by PCR amplification (RT-PCR) of the synthesized cDNA and 16S rRNA gene. The amplified PCR products were analyzed by agarose gel electrophoresis and Southern blotting. Using ethidium bromide-stained agarose gels, we were able to detect the expected 500-bp DNA fragment from as few as two H. pylori organisms per reaction. The specificity of the RT-PCR assay was tested with 27 clinical isolates and related reference strains; although the number of bacterial cells used per reaction was 10(5)-fold greater than the number of H. pylori organisms used, amplification was detected only with bacteria in the same genus, H. cinaedi and H. mustelae. Ten H. pylori organisms per biopsy specimen were detected on agarose gels when organisms were added to samples prepared from a processed colon biopsy sample. RT-PCR results were consistent with urea breath test and culture results in 14 of 15 gastric biopsy specimens; the specificity was 100%. RT-PCR of rRNA from H. pylori increased the sensitivity of pathogen detection at least 25- to 50-fold compared with that of previous PCR assays. This low level of detection by RT-PCR assay may prove to be well suited for verifying eradication following therapy. PMID:1383268

  5. [Chromosomal localization of 5S and 45S ribosomal DNA in species of Linum L. section Linum (syn=Protolinum and Adenolinum)].

    PubMed

    Muravenko, O V; Amosova, A V; Samatadze, T E; Semenova, O Iu; Nosova, I V; Popov, K V; Shostak, N G; Zoshchuk, S A; Zelenin, A V

    2004-02-01

    Fluorescence in situ hybridization (FISH) was for the first time used to study the chromosomal location of the 45S (18-2.5S-26S) and 5S ribosomal genes in the genomes of five flax species of the section Linum (syn. Protolinum and Adenolinum). In L. usitatissimum L. (2n = 30), L. angustifolium Huds. (2n = 30), and L. bienne Mill. (2n = 30), a major hybridization site of 45S rDNA was observed in the pericentric region of a large metacentric chromosome. A polymorphic minor locus of 45S rDNA was found on one of the small chromosomes. Sites of 5S rDNA colocalized with those of 45S rDNA, but direct correlation between signal intensities from the 45S and 5S rDNA sites was observed only in some cases. Other 5S rDNA sites mapped to two chromosomes in these flax species. In L. grandiflorum Desf. (2n = 16) and L. austriacum L. (2n = 18), large regions of 45S and 5S rDNA were similarly located on a pair of homologous satellite-bearing chromosomes. An additional large polymorphic site of 45S and 5S rDNA was found in the proximal region of one arm of a small chromosome in the L. usitatissimum. L. angustifolium, and L. bienne karyotypes. The other arm of this chromosome contained a large 5S rDNA cluster. A similar location of the ribosomal genes in the pericentric region of the pair of satellite-bearing metacentrics confirmed the close relationships of the species examined. The difference in chromosomal location of the ribosomal genes between flax species with 2n = 30 and those with 2n = 16 or 18 testified to their assignment to different sections. The use of ribosomal genes as chromosome markers was assumed to be of importance for comparative genomic studies in cultivated flax, a valuable crop species of Russia, and in its wild relatives. PMID:15065434

  6. PCR-based method for targeting 16S-23S rRNA intergenic spacer regions among Vibrio species

    PubMed Central

    2010-01-01

    Background The genus Vibrio is a diverse group of Gram-negative bacteria comprised of 74 species. Furthermore, the genus has and is expected to continue expanding with the addition of several new species annually. Consequently, it is of paramount importance to have a method which is able to reliably and efficiently differentiate the numerous Vibrio species. Results In this study, a novel and rapid polymerase chain reaction (PCR)-based intergenic spacer (IGS)-typing system for vibrios was developed that is based on the well-known IGS regions located between the 16S and 23S rRNA genes on the bacterial chromosome. The system was optimized to resolve heteroduplex formation as well as to take advantage of capillary gel electrophoresis technology such that reproducible analyses could be achieved in a rapid manner. System validation was achieved through testing of 69 archetypal Vibrio strains, representing 48 Vibrio species, from which an 'IGS-type' profile database was generated. These data, presented here in several cluster analyses, demonstrated successful differentiation of the 69 type strains showing that this PCR-based fingerprinting method easily discriminates bacterial strains at the species level among Vibrio. Furthermore, testing 36 strains each of V. parahaemolyticus and V. vulnificus, important food borne pathogens, isolated from a variety of geographical locations with the IGS-typing method demonstrated distinct IGS-typing patterns indicative of subspecies divergence in both populations making this technique equally useful for intraspecies differentiation, as well. Conclusion This rapid, reliable and efficient IGS-typing system, especially in combination with 16S rRNA gene sequencing, has the capacity to not only discern and identify vibrios at the species level but, in some cases, at the sub-species level, as well. This procedure is particularly well-suited for preliminary species identification and, lends itself nicely to epidemiological investigations

  7. Lactobacillus species identification by amplified ribosomal 16S-23S rRNA restriction fragment length polymorphism analysis.

    PubMed

    Sandes, S H C; Alvin, L B; Silva, B C; Zanirati, D F; Jung, L R C; Nicoli, J R; Neumann, E; Nunes, A C

    2014-12-01

    Lactic acid bacteria strains are commonly used for animal and human consumption due to their probiotic properties. One of the major genera used is Lactobacillus, a highly diverse genus comprised of several closely related species. The selection of new strains for probiotic use, especially strains of Lactobacillus, is the focus of several research groups. Accurate identification to species level is fundamental for research on new strains, as well as for safety assessment and quality assurance. The 16S-23S internal transcribed spacer (ITS-1) is a deeply homologous region among prokaryotes that is commonly used for identification to the species level because it is able to acquire and accumulate mutations without compromising general bacterial metabolism. In the present study, 16S-23S ITS regions of 45 Lactobacillus species (48 strains) were amplified and subjected to independent enzymatic digestions, using 12 restriction enzymes that recognise six-base sequences. Twenty-nine species showed unique restriction patterns, and could therefore be precisely identified solely by this assay (64%). This approach proved to be reproducible, allowing us to establish simplified restriction patterns for each evaluated species. The restriction patterns of each species were similar among homologous strains, and to a large extent reflected phylogenetic relationships based on 16S rRNA sequences, demonstrating the promising nature of this region for evolutionary studies.

  8. Comparison of Bacteroides-Prevotella 16S rRNA genetic markers for fecal samples from different animal species

    USGS Publications Warehouse

    Fogarty, L.R.; Voytek, M.A.

    2005-01-01

    To effectively manage surface and ground waters it is necessary to improve our ability to detect and identify sources of fecal contamination. We evaluated the use of the anaerobic bacterial group Bacteroides-Prevotella as a potential fecal indicator. Terminal restriction length polymorphism (T-RFLP) of the 16S rRNA genes from this group was used to determine differences in populations and to identify any unique populations in chickens, cows, deer, dogs, geese, horses, humans, pigs, and seagulls. The group appears to be a good potential fecal indicator in all groups tested except for avians. Cluster analysis of Bacteroides-Prevotella community T-RFLP profiles indicates that Bacteroides-Prevotella populations from samples of the same host species are much more similar to each other than to samples from different source species. We were unable to identify unique peaks that were exclusive to any source species; however, for most host species, at least one T-RFLP peak was identified to be more commonly found in that species, and a combination of peaks could be used to identify the source. T-RFLP profiles obtained from water spiked with known-source feces contained the expected diagnostic peaks from the source. These results indicate that the approach of identifying Bacteroides-Prevotella molecular markers associated with host species might be useful in identifying sources of fecal contamination in the environment.

  9. Comparison of 16S rRNA sequencing with biochemical testing for species-level identification of clinical isolates of Neisseria spp.

    PubMed

    Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia

    2014-08-01

    We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.

  10. Chaperoning 5S RNA assembly.

    PubMed

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit.

  11. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  12. Rapid differentiation of Francisella species and subspecies by fluorescent in situ hybridization targeting the 23S rRNA

    PubMed Central

    2010-01-01

    Background Francisella (F.) tularensis is the causative agent of tularemia. Due to its low infectious dose, ease of dissemination and high case fatality rate, F. tularensis was the subject in diverse biological weapons programs and is among the top six agents with high potential if misused in bioterrorism. Microbiological diagnosis is cumbersome and time-consuming. Methods for the direct detection of the pathogen (immunofluorescence, PCR) have been developed but are restricted to reference laboratories. Results The complete 23S rRNA genes of representative strains of F. philomiragia and all subspecies of F. tularensis were sequenced. Single nucleotide polymorphisms on species and subspecies level were confirmed by partial amplification and sequencing of 24 additional strains. Fluorescent In Situ Hybridization (FISH) assays were established using species- and subspecies-specific probes. Different FISH protocols allowed the positive identification of all 4 F. philomiragia strains, and more than 40 F. tularensis strains tested. By combination of different probes, it was possible to differentiate the F. tularensis subspecies holarctica, tularensis, mediasiatica and novicida. No cross reactivity with strains of 71 clinically relevant bacterial species was observed. FISH was also successfully applied to detect different F. tularensis strains in infected cells or tissue samples. In blood culture systems spiked with F. tularensis, bacterial cells of different subspecies could be separated within single samples. Conclusion We could show that FISH targeting the 23S rRNA gene is a rapid and versatile method for the identification and differentiation of F. tularensis isolates from both laboratory cultures and clinical samples. PMID:20205957

  13. Emergence of Multidrug-Resistant Campylobacter Species Isolates with a Horizontally Acquired rRNA Methylase

    PubMed Central

    Wang, Yang; Zhang, Maojun; Deng, Fengru; Shen, Zhangqi; Wu, Congming; Zhang, Jianzhong

    2014-01-01

    Antibiotic-resistant Campylobacter constitutes a serious threat to public health, and resistance to macrolides is of particular concern, as this class of antibiotics is the drug of choice for clinical therapy of campylobacteriosis. Very recently, a horizontally transferrable macrolide resistance mediated by the rRNA methylase gene erm(B) was reported in a Campylobacter coli isolate, but little is known about the dissemination of erm(B) among Campylobacter isolates and the association of erm(B)-carrying isolates with clinical disease. To address this question and facilitate the control of antibiotic-resistant Campylobacter, we determined the distribution of erm(B) in 1,554 C. coli and Campylobacter jejuni isolates derived from food-producing animals and clinically confirmed human diarrheal cases. The results revealed that 58 of the examined isolates harbored erm(B) and exhibited high-level resistance to macrolides, and most were recent isolates, derived in 2011-2012. In addition, the erm(B)-positive isolates were all resistant to fluoroquinolones, another clinically important antibiotic used for treating campylobacteriosis. The erm(B) gene is found to be associated with chromosomal multidrug resistance genomic islands (MDRGIs) of Gram-positive origin or with plasmids of various sizes. All MDRGIs were transferrable to macrolide-susceptible C. jejuni by natural transformation under laboratory conditions. Molecular typing of the erm(B)-carrying isolates by pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) identified diverse genotypes and outbreak-associated diarrheal isolates. Molecular typing also suggested zoonotic transmission of erm(B)-positive Campylobacter. These findings reveal an emerging and alarming trend of dissemination of erm(B) and MDRGIs in Campylobacter and underscore the need for heightened efforts to control their further spread. PMID:24982085

  14. Diversity within the genus Elymus (Poaceae: Triticeae) as investigated by the analysis of the nr5S rDNA variation in species with St and H haplomes.

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2015-02-01

    The genus Elymus ("Ryegrass") is a repository for a range of species with a variety of haplome contents; hence the pejorative name "dustbin" genus. We have analyzed 1,059 sequences from 128 accessions representing 24 species to investigate the relationships among the StH haplomes-containing species described by Yen and Yang (Genus Elymus Beijing 5:58-362, 2013). Sequences were assigned to "unit classes" of orthologous sequences and subjected to a suite of analyses including BLAST (Basic Local Alignment Search Tool) searches, phylogenetic analysis and population genetic analysis to estimate species diversity. Our results support the genome analyses in Yen and Yang (Genus Elymus Beijing 5:58-362, 2013), i.e., genomic constitution StStHH including variants restricted to Elymus. Population genetic analysis of the 5S nrDNA sequence data revealed that the within-species variance component is roughly ±89 %; thus, we were unable to identify molecular markers capable to separate the 24 species analyzed. Separate phylogenetic analyses of the two unit classes and of all the data exhibit a trend only of the species to cluster on the phylograms. Finally, the analysis provides evidence for the multiple origins of American and Eurasian species. PMID:25248636

  15. Detection and identification of Legionella species in hospital water supplies through Polymerase Chain Reaction (16S rRNA)

    PubMed Central

    2014-01-01

    Legionella spp. are important waterborne pathogens that are normally transmitted through aerosols. The present work was conducted to investigate the presence of Legionella spp. and its common species in hospital water supplies. Considering the limitations of culture method, polymerase chain reaction (PCR) assays were developed to detect the gene 16S rRNA irrespective of the bacterial serotype. Four well-established DNA extraction protocols (freeze & thaw and phenol-chloroform as two manual protocols and two commercial kits) were tested and evaluated to release DNA from bacterial cells. A total of 45 samples were collected from seven distinct hospitals’ sites during a period of 10 months. The PCR assay was used to amplify a 654-bp fragment of the 16S rRNA gene. Legionella were detected in 13 samples (28.9%) by all of the methods applied for DNA extraction. Significant differences were noted in the yield of extracted nucleic acids. Legionella were not detected in any of the samples when DNA extraction by freeze & thaw was used. Excluding this method and comparing manual protocol with commercial kits, Kappa coefficient was calculated as 0.619 with p < 0.05. Although no meaningful differences were found between the kits, DNA extraction with Bioneer kit exhibited a higher sensitivity than classical Qiagen. Showerheads and cold-water taps were the most and least contaminated sources with 55.5 and 9 percent positive samples, respectively. Moreover two positive samples were identified for species by DNA sequencing and submitted to the Gene Bank database with accession Nos. FJ480932 and FJ480933. The results obtained showed that despite the advantages of molecular assays in Legionella tracing in environmental sources, the use of optimised DNA extraction methods is critical. PMID:24860661

  16. Detection and identification of Legionella species in hospital water supplies through Polymerase Chain Reaction (16S rRNA).

    PubMed

    Rafiee, Mohammad; Jahangiri-Rad, Mahsa; Hajjaran, Homa; Mesdaghinia, Alireza; Hajaghazadeh, Mohammad

    2014-01-01

    Legionella spp. are important waterborne pathogens that are normally transmitted through aerosols. The present work was conducted to investigate the presence of Legionella spp. and its common species in hospital water supplies. Considering the limitations of culture method, polymerase chain reaction (PCR) assays were developed to detect the gene 16S rRNA irrespective of the bacterial serotype. Four well-established DNA extraction protocols (freeze & thaw and phenol-chloroform as two manual protocols and two commercial kits) were tested and evaluated to release DNA from bacterial cells. A total of 45 samples were collected from seven distinct hospitals' sites during a period of 10 months. The PCR assay was used to amplify a 654-bp fragment of the 16S rRNA gene. Legionella were detected in 13 samples (28.9%) by all of the methods applied for DNA extraction. Significant differences were noted in the yield of extracted nucleic acids. Legionella were not detected in any of the samples when DNA extraction by freeze & thaw was used. Excluding this method and comparing manual protocol with commercial kits, Kappa coefficient was calculated as 0.619 with p < 0.05. Although no meaningful differences were found between the kits, DNA extraction with Bioneer kit exhibited a higher sensitivity than classical Qiagen. Showerheads and cold-water taps were the most and least contaminated sources with 55.5 and 9 percent positive samples, respectively. Moreover two positive samples were identified for species by DNA sequencing and submitted to the Gene Bank database with accession Nos. FJ480932 and FJ480933. The results obtained showed that despite the advantages of molecular assays in Legionella tracing in environmental sources, the use of optimised DNA extraction methods is critical. PMID:24860661

  17. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).

    PubMed

    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C

    2015-01-01

    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition. PMID:26634462

  18. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).

    PubMed

    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C

    2015-11-25

    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition.

  19. 16S rRNA gene-based detection of tetrachloroethene-dechlorinating Desulfuromonas and Dehalococcoides species

    SciTech Connect

    Loeffler, F.E.; Sun, Q.; Li, J.; Tiedje, J.M.

    2000-03-01

    Members of the genera Desulfuromonas and Dehalococcoides reductively dechlorinate tetrachloroethene (PCE) and trichloroethene. Two primer pairs specific to hypervariable regions of the 16S rRNA genes of the Dehalococcoides group (comprising Dehalococcoides ethenogenes and Dehalococcoides sp. strain FL2) and the acetate-oxidizing, PCE-dechlorinating Desulfuromonas group (comprising Desulfuromonas sp. strain BB1 and Desulfuromonas chloroethenica) were designed. The detection threshold of a nested PCR approach using universal bacterial primers followed by a second PCR with the Desulfuromonas dechlorinator-targeted primer pair was 1 x 10{sup 3} BB1 cells added per gram (wet weight) of sandy aquifer material. Total community DNA isolated from sediments of three Michigan rivers and six different chloroethene-contaminated aquifer samples was used as template in nested PCR. All river sediment samples yielded positive signals with the BB1- and the Dehalococcoides-targeted primers. One chloroethene-contaminated aquifer tested positive with the Dehalococcoides-targeted primers, and another contaminated aquifer tested positive with the Desulfuromonas dechlorinator-targeted primer pair. Restriction fragment analysis of the amplicons could discriminate strain BB1 from other known Desulfuromonas species. Microcosm studies confirmed the presence of PCE-dechlorinating, acetate-oxidizing Desulfuromonas and hydrogenotrophic Dehalococcoides species in samples yielding positive PCR signals with the specific primers.

  20. Differentiation of non-pylori Helicobacter species based on PCR-restriction fragment length polymorphism of the 23S rRNA gene.

    PubMed

    Yadegar, Abbas; Alebouyeh, Masoud; Lawson, Andy J; Mirzaei, Tabassom; Nazemalhosseini Mojarad, Ehsan; Zali, Mohammad Reza

    2014-06-01

    Phenotypic identification of non-pylori Helicobacter species has always been problematic and time-consuming in comparison with many other bacteria. We developed a rapid two-step identification assay based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 23S rRNA gene for differentiating between non-pylori Helicobacter species. A new genus-specific primer pair based on all available complete and partial 23S rRNA sequences of Helicobacter species was designed. In silico restriction analysis of variable regions of the 23S rRNA gene suggested SmaI and HindIII endonucleases would provide a good level of differentiation. Analysis of the obtained 23S rRNA RFLP patterns divided all Helicobacter study strains into three species groups (groups A-C) and 12 unique restriction patterns. Wolinella succinogenes also gave a unique pattern. Our proposed PCR-RFLP method was found to be as a valuable tool for routine identification of non-pylori Helicobacter species from human or animal samples.

  1. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    PubMed

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  2. 18S rRNA gene sequencing identifies a novel species of Henneguya parasitizing the gills of the channel catfish (Ictaluridae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In the southeastern United States, the channel catfish Ictalurus punctatus is a host to at least eight different species of myxozoan parasites belonging to the genus Henneguya, four of which have been characterized molecularly using sequencing of the small subunit ribosomal RNA gene (SSU rRNA). Howe...

  3. Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

    PubMed

    Röder, Christoph; König, Helmut; Fröhlich, Jürgen

    2007-09-01

    Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples. PMID:17596183

  4. PCR-Independent Detection of Bacterial Species-Specific 16S rRNA at 10 fM by a Pore-Blockage Sensor

    PubMed Central

    Esfandiari, Leyla; Wang, Siqing; Wang, Siqi; Banda, Anisha; Lorenzini, Michael; Kocharyan, Gayane; Monbouquette, Harold G.; Schmidt, Jacob J.

    2016-01-01

    A PCR-free, optics-free device is used for the detection of Escherichia coli (E. coli) 16S rRNA at 10 fM, which corresponds to ~100–1000 colony forming units/mL (CFU/mL) depending on cellular rRNA levels. The development of a rapid, sensitive, and cost-effective nucleic acid detection platform is sought for the detection of pathogenic microbes in food, water and body fluids. Since 16S rRNA sequences are species specific and are present at high copy number in viable cells, these nucleic acids offer an attractive target for microbial pathogen detection schemes. Here, target 16S rRNA of E. coli at 10 fM concentration was detected against a total RNA background using a conceptually simple approach based on electromechanical signal transduction, whereby a step change reduction in ionic current through a pore indicates blockage by an electrophoretically mobilized bead-peptide nucleic acid probe conjugate hybridized to target nucleic acid. We investigated the concentration detection limit for bacterial species-specific 16S rRNA at 1 pM to 1 fM and found a limit of detection of 10 fM for our device, which is consistent with our previous finding with single-stranded DNA of similar length. In addition, no false positive responses were obtained with control RNA and no false negatives with target 16S rRNA present down to the limit of detection (LOD) of 10 fM. Thus, this detection scheme shows promise for integration into portable, low-cost systems for rapid detection of pathogenic microbes in food, water and body fluids. PMID:27455337

  5. PCR-Independent Detection of Bacterial Species-Specific 16S rRNA at 10 fM by a Pore-Blockage Sensor.

    PubMed

    Esfandiari, Leyla; Wang, Siqing; Wang, Siqi; Banda, Anisha; Lorenzini, Michael; Kocharyan, Gayane; Monbouquette, Harold G; Schmidt, Jacob J

    2016-07-22

    A PCR-free, optics-free device is used for the detection of Escherichia coli (E. coli) 16S rRNA at 10 fM, which corresponds to ~100-1000 colony forming units/mL (CFU/mL) depending on cellular rRNA levels. The development of a rapid, sensitive, and cost-effective nucleic acid detection platform is sought for the detection of pathogenic microbes in food, water and body fluids. Since 16S rRNA sequences are species specific and are present at high copy number in viable cells, these nucleic acids offer an attractive target for microbial pathogen detection schemes. Here, target 16S rRNA of E. coli at 10 fM concentration was detected against a total RNA background using a conceptually simple approach based on electromechanical signal transduction, whereby a step change reduction in ionic current through a pore indicates blockage by an electrophoretically mobilized bead-peptide nucleic acid probe conjugate hybridized to target nucleic acid. We investigated the concentration detection limit for bacterial species-specific 16S rRNA at 1 pM to 1 fM and found a limit of detection of 10 fM for our device, which is consistent with our previous finding with single-stranded DNA of similar length. In addition, no false positive responses were obtained with control RNA and no false negatives with target 16S rRNA present down to the limit of detection (LOD) of 10 fM. Thus, this detection scheme shows promise for integration into portable, low-cost systems for rapid detection of pathogenic microbes in food, water and body fluids.

  6. Contrasting evolutionary patterns of 28S and ITS rRNA genes reveal high intragenomic variation in Cephalenchus (Nematoda): Implications for species delimitation.

    PubMed

    Pereira, Tiago José; Baldwin, James Gordon

    2016-05-01

    Concerted evolution is often assumed to be the evolutionary force driving multi-family genes, including those from ribosomal DNA (rDNA) repeat, to complete homogenization within a species, although cases of non-concerted evolution have been also documented. In this study, sequence variation of 28S and ITS ribosomal RNA (rRNA) genes in the genus Cephalenchus is assessed at three different levels, intragenomic, intraspecific, and interspecific. The findings suggest that not all Cephalenchus species undergo concerted evolution. High levels of intraspecific polymorphism, mostly due to intragenomic variation, are found in Cephalenchus sp1 (BRA-01). Secondary structure analyses of both rRNA genes and across different species show a similar substitution pattern, including mostly compensatory (CBC) and semi-compensatory (SBC) base changes, thus suggesting the functionality of these rRNA copies despite the variation found in some species. This view is also supported by low sequence variation in the 5.8S gene in relation to the flanking ITS-1 and ITS-2 as well as by the existence of conserved motifs in the former gene. It is suggested that potential cross-fertilization in some Cephalenchus species, based on inspection of female reproductive system, might contribute to both intragenomic and intraspecific polymorphism of their rRNA genes. These results reinforce the potential implications of intragenomic and intraspecific genetic diversity on species delimitation, especially in biodiversity studies based solely on metagenetic approaches. Knowledge of sequence variation will be crucial for accurate species diversity estimation using molecular methods.

  7. Application of 16S rRNA, cytochrome b and control region sequences for understanding the phylogenetic relationships in Oryx species.

    PubMed

    Khan, H A; Arif, I A; Al Homaidan, A A; Al Farhan, A H

    2008-01-01

    The present study reports the application of mitochondrial markers for the molecular phylogeny of Oryx species, including the Arabian oryx (AO), scimitar-horned oryx (SHO) and plains oryx (PO), using the Addax as an outgroup. Sequences of three molecular markers, 16S rRNA, cytochrome b and a control region, for the above four taxa were aligned and the topologies of respective phylogenetic trees were compared. All these markers clearly differentiated the genus Addax from Oryx. However, for species-level grouping, while 16S rRNA and cytochrome b produced similar phylogeny (SHO grouped with PO), the control region grouped SHO with AO. Further studies are warranted to generate more sequencing data, apply multiple bioinformatics tools and to include relevant nuclear markers for phylogenetic analysis of Oryx species. PMID:19224456

  8. Identification of Clinically Relevant Fungi and Prototheca Species by rRNA Gene Sequencing and Multilocus PCR Coupled with Electrospray Ionization Mass Spectrometry

    PubMed Central

    Wang, Rui-Ying; Li, Li; Cao, Ya-Hui; Chen, Yan-Qiong; Zhao, Hua-Zhen; Zhang, Qiang-Qiang; Wu, Ji-Qin; Weng, Xin-Hua; Cheng, Xun-Jia; Zhu, Li-Ping

    2014-01-01

    Background Multilocus PCR coupled with electrospray ionization mass spectrometry (PCR/ESI-MS) is a new strategy for pathogen identification, but information about its application in fungal identification remains sparse. Methods One-hundred and twelve strains and isolates of clinically important fungi and Prototheca species were subjected to both rRNA gene sequencing and PCR/ESI-MS. Three regions of the rRNA gene were used as targets for sequencing: the 5′ end of the large subunit rRNA gene (D1/D2 region), and the internal transcribed spacers 1 and 2 (ITS1 and ITS2 regions). Microbial identification (Micro ID), acquired by combining results of phenotypic methods and rRNA gene sequencing, was used to evaluate the results of PCR/ESI-MS. Results For identification of yeasts and filamentous fungi, combined sequencing of the three regions had the best performance (species-level identification rate of 93.8% and 81.8% respectively). The highest species-level identification rate was achieved by sequencing of D1/D2 for yeasts (92.2%) and ITS2 for filamentous fungi (75.8%). The two Prototheca species could be identified to species level by D1/D2 sequencing but not by ITS1 or ITS2. For the 102 strains and isolates within the coverage of PCR/ESI-MS identification, 87.3% (89/102) achieved species-level identification, 100% (89/89) of which were concordant to Micro ID on species/complex level. The species-level identification rates for yeasts and filamentous fungi were 93.9% (62/66) and 75% (27/36) respectively. Conclusions rRNA gene sequencing provides accurate identification information, with the best results obtained by a combination of ITS1, ITS2 and D1/D2 sequencing. Our preliminary data indicated that PCR/ESI-MS method also provides a rapid and accurate identification for many clinical relevant fungi. PMID:24835205

  9. Comparison of Traditional Phenotypic Identification Methods with Partial 5′ 16S rRNA Gene Sequencing for Species-Level Identification of Nonfermenting Gram-Negative Bacilli▿

    PubMed Central

    Cloud, Joann L.; Harmsen, Dag; Iwen, Peter C.; Dunn, James J.; Hall, Gerri; LaSala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L.; Mellmann, Alexander

    2010-01-01

    Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5′ 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB. PMID:20164273

  10. DNA-based classification and sequence heterogeneities in the 16S rRNA genes of Lactobacillus casei/paracasei and related species.

    PubMed

    Vásquez, Alejandra; Molin, Göran; Pettersson, Bertil; Antonsson, Martin; Ahrné, Siv

    2005-07-01

    The sequence differences within the 16S rRNA genes of Lactobacillus casei/paracasei and related species, Lactobacillus zeae and Lactobacillus rhamnosus, were investigated. Thirty-seven strains of mostly human or cheese origin were grouped by restriction endonuclease analysis (REA) of the total chromosomal DNA and by temporal temperature gradient gel electrophoresis (TTGE) of PCR-amplified 16S rRNA gene fragments. REA verified that all strains were genomically unique and singled out three major clusters, one L. rhamnosus-cluster and two clusters containing L. paracasei strains. The groups obtained by TTGE corresponded with one exception to the REA-clusters. In the TTGE clustering all L. paracasei strains formed one general group with one TTGE-band in common, and this group was sub-divided into five subgroups due to the presence of more than one TTGE-band in four of the subgroups. The occurrence of multiple TTGE-bands was investigated by amplifying and cloning of the 16S rRNA genes from the strains showing this phenomenon, thereby 12 clones from each strain were sequenced, demonstrating polymorphisms in almost all the cases. Subjecting the clones displaying sequence variations to TTGE as well as sequencing of 16S rDNA revealed by ribotyping of the strains, verified the presence of polymorphisms within the 16S rRNA genes. The migration characteristic of amplified DNA from a single clone corresponded to a specific band in the TTGE-pattern of the strain from which the clone originated. Southern blot hybridisation with a 16S rDNA probe demonstrated the presence of at least five 16S rRNA genes in L. casei/paracasei. A higher degree of variable positions than previously reported was observed in the 16S rRNA gene fragments of the members in the complex. Sequence comparison between the 16S rRNA gene copies of L. casei (CCUG 21451T) and L. zeae (CCUG 35515T) demonstrated that the two species shared almost the same sequence in some copies while the others were more different

  11. Abundant 5S rRNA-like transcripts encoded by the mitochondrial genome in amoebozoa.

    PubMed

    Bullerwell, Charles E; Burger, Gertraud; Gott, Jonatha M; Kourennaia, Olga; Schnare, Murray N; Gray, Michael W

    2010-05-01

    5S rRNAs are ubiquitous components of prokaryotic, chloroplast, and eukaryotic cytosolic ribosomes but are apparently absent from mitochondrial ribosomes (mitoribosomes) of many eukaryotic groups including animals and fungi. Nevertheless, a clearly identifiable, mitochondrion-encoded 5S rRNA is present in Acanthamoeba castellanii, a member of Amoebozoa. During a search for additional mitochondrial 5S rRNAs, we detected small abundant RNAs in other members of Amoebozoa, namely, in the lobose amoeba Hartmannella vermiformis and in the myxomycete slime mold Physarum polycephalum. These RNAs are encoded by mitochondrial DNA (mtDNA), cosediment with mitoribosomes in glycerol gradients, and can be folded into a secondary structure similar to that of bona fide 5S rRNAs. Further, in the mtDNA of another slime mold, Didymium nigripes, we identified a region that in sequence, potential secondary structure, and genomic location is similar to the corresponding region encoding the Physarum small RNA. A mtDNA-encoded small RNA previously identified in Dictyostelium discoideum is here shown to share several characteristics with known 5S rRNAs. Again, we detected genes encoding potential homologs of this RNA in the mtDNA of three other species of the genus Dictyostelium as well as in a related genus, Polysphondylium. Taken together, our results indicate a widespread occurrence of small, abundant, mtDNA-encoded RNAs with 5S rRNA-like structures that are associated with the mitoribosome in various amoebozoan taxa. Our working hypothesis is that these novel small abundant RNAs represent radically divergent mitochondrial 5S rRNA homologs. We posit that currently unrecognized 5S-like RNAs may exist in other mitochondrial systems in which a conventional 5S rRNA cannot be identified.

  12. Sequence determination of rRNA genes of pathogenic Vibrio species and whole-cell identification of Vibrio vulnificus with rRNA-targeted oligonucleotide probes.

    PubMed

    Aznar, R; Ludwig, W; Amann, R I; Schleifer, K H

    1994-04-01

    A comparative analysis of seven new 16S rRNA gene sequences of pathogenic Vibrio species with previously published vibrio sequences confirmed that Vibrio vulnificus represents a group that is not closely related to the core organisms of the genus Vibrio. In addition, we found that V. vulnificus, Listonella (Vibrio) anguillarum and Vibrio diazotrophicus branch off separately from the core group. A comparison of the 16S rRNA gene sequences of V. vulnificus strains belonging to biotypes 1 and 2 revealed that the sequences of all but four biotype 1 strains were identical to each other but slightly different (17 bases) from the sequences of the rest of the V. vulnificus strains investigated. In addition, the sequences of variable regions of the 23S rRNA genes of Vibrio fluvialis, Vibrio furnissii, Vibrio harveyi, Vibrio cholerae, and V. vulnificus C7184 and TW1 were determined, aligned, and compared with all available bacterial 23S rRNA sequences in order to search for specific target sites. As a result, four oligonucleotide probes specific for V. vulnificus were synthesized, and the specificities of these probes were evaluated by dot blot hybridization to membrane-bound RNAs from 21 V. vulnificus strains, 13 strains belonging to other Vibrio species, 61 strains belonging to species that are members of the alpha, beta, and gamma subclasses of the Proteobacteria, and 3 eucaryotic microorganisms. Two probes hybridized with all of the V. vulnificus strains tested, and the other two probes distinguished V. vulnificus biotype 1 strains from all other organisms. In situ identification of V. vulnificus by using tetramethylrhodamine- or fluorescein-labelled oligonucleotides is now possible.

  13. Targeting single-nucleotide polymorphisms in the 16S rRNA gene to detect and differentiate Legionella pneumophila and non-Legionella pneumophila species.

    PubMed

    Zhan, Xiao-Yong; Hu, Chao-Hui; Zhu, Qing-Yi

    2016-08-01

    A PCR-based method targeting single-nucleotide polymorphisms (SNPs) in the 16S rRNA gene was developed for differential identification of Legionella pneumophila and non-Legionella pneumophila. Based on the bioinformatics analysis for 176 Legionella 16S rRNA gene fragments of 56 different Legionella species, a set of SNPs, A(628)C(629) was found to be highly specific to L. pneumophila strains. A multiplex assay was designed that was able to distinguish sites with limited sequence heterogeneity between L. pneumophila and non-L. pneumophila in the targeted 16S rRNA gene. The assay amplified a 261-bp amplicon for Legionella spp. and a set of 203- and 97-bp amplicons only specific to L. pneumophila species. Among 49 ATCC strains and 284 Legionella isolates from environmental water and clinical samples, 100 % of L. pneumophila and non-L. pneumophila strains were correctly identified and differentiated by this assay. The assay presents a more rapid, sensitive and alternative method to the currently available PCR-sequencing detection and differentiation method.

  14. Molecular Phylogenetics and Systematics of the Bivalve Family Ostreidae Based on rRNA Sequence-Structure Models and Multilocus Species Tree

    PubMed Central

    Salvi, Daniele; Macali, Armando; Mariottini, Paolo

    2014-01-01

    The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassotreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics. PMID:25250663

  15. Identification of Mushroom Species by Automated rRNA Intergenic Spacer Analysis (ARISA) and Its Application to a Suspected Case of Food Poisoning with Tricholoma ustale.

    PubMed

    Sugawara, Ryota; Yamada, Sayumi; Tu, Zhihao; Sugawara, Akiko; Hoshiba, Toshihiro; Eisaka, Sadao; Yamaguchi, Akihiro

    2016-01-01

    Automated rRNA intergenic spacer analysis (ARISA), a method of microbiome analysis, was evaluated for species identification of mushrooms based on the specific fragment sizes. We used 51 wild mushroom-fruiting bodies collected in the centre of Hokkaido and two cultivated mushrooms. Samples were hot-air-dried and DNA were extracted by a beads beating procedure. Sequencing analysis of portions of the rRNA gene (rDNA) provided 33 identifications of mushrooms by genus or species. The results of ARISA identification based on the combination of the fragment sizes corresponding to two inter spacer regions (ITS2 and ITS1) of rDNA within±0.1% accuracy showed that 27 out of the 33 species had specific fragment sizes differentiated from other species. The remaining 6 species formed 3 pairs that showed overlapping fragment sizes. In addition, within-species polymorphisms were observed as 1 bp differences among 32 samples of 13 species. ARISA was applied to investigate a case of suspected food poisoning in which the mushroom was thought to be a toxic Kakishimeji. The morphological identification of the mushroom was ambiguous since the remaining sample lacked a part of the fruiting body. Further, yeast colonies had grown on the surface of the fruiting body during storage. The ARISA fragment size of the mushroom showed 7 bp difference from that of the candidate toxic mushroom. Although ARISA could be a useful tools for estimation of mushroom species, especially in case where the fruiting bodies have deteriorated or been processed, further studies are necessary for reliable identification. For example, it may be necessary to adopt more informative genes which could provide clearer species-specific polymorphisms than the ITS regions. PMID:27211917

  16. Development of quantitative PCR assays targeting the 16S rRNA genes of Enterococcus spp. and their application to the identification of enterococcus species in environmental samples.

    PubMed

    Ryu, Hodon; Henson, Michael; Elk, Michael; Toledo-Hernandez, Carlos; Griffith, John; Blackwood, Denene; Noble, Rachel; Gourmelon, Michèle; Glassmeyer, Susan; Santo Domingo, Jorge W

    2013-01-01

    The detection of environmental enterococci has been determined primarily by using culture-based techniques that might exclude some enterococcal species as well as those that are nonculturable. To address this, the relative abundances of enterococci were examined by challenging fecal and water samples against a currently available genus-specific assay (Entero1). To determine the diversity of enterococcal species, 16S rRNA gene-based group-specific quantitative PCR (qPCR) assays were developed and evaluated against eight of the most common environmental enterococcal species. Partial 16S rRNA gene sequences of 439 presumptive environmental enterococcal strains were analyzed to study further the diversity of enterococci and to confirm the specificities of group-specific assays. The group-specific qPCR assays showed relatively high amplification rates with targeted species (>98%), although some assays cross-amplified with nontargeted species (1.3 to 6.5%). The results with the group-specific assays also showed that different enterococcal species co-occurred in most fecal samples. The most abundant enterococci in water and fecal samples were Enterococcus faecalis and Enterococcus faecium, although we identified more water isolates as Enterococcus casseliflavus than as any of the other species. The prevalence of the Entero1 marker was in agreement with the combined number of positive signals determined by the group-specific assays in most fecal samples, except in gull feces. On the other hand, the number of group-specific assay signals was lower in all water samples tested, suggesting that other enterococcal species are present in these samples. While the results highlight the value of genus- and group-specific assays for detecting the major enterococcal groups in environmental water samples, additional studies are needed to determine further the diversity, distributions, and relative abundances of all enterococcal species found in water.

  17. Development of Quantitative PCR Assays Targeting the 16S rRNA Genes of Enterococcus spp. and Their Application to the Identification of Enterococcus Species in Environmental Samples

    PubMed Central

    Ryu, Hodon; Henson, Michael; Elk, Michael; Toledo-Hernandez, Carlos; Griffith, John; Blackwood, Denene; Noble, Rachel; Gourmelon, Michèle; Glassmeyer, Susan

    2013-01-01

    The detection of environmental enterococci has been determined primarily by using culture-based techniques that might exclude some enterococcal species as well as those that are nonculturable. To address this, the relative abundances of enterococci were examined by challenging fecal and water samples against a currently available genus-specific assay (Entero1). To determine the diversity of enterococcal species, 16S rRNA gene-based group-specific quantitative PCR (qPCR) assays were developed and evaluated against eight of the most common environmental enterococcal species. Partial 16S rRNA gene sequences of 439 presumptive environmental enterococcal strains were analyzed to study further the diversity of enterococci and to confirm the specificities of group-specific assays. The group-specific qPCR assays showed relatively high amplification rates with targeted species (>98%), although some assays cross-amplified with nontargeted species (1.3 to 6.5%). The results with the group-specific assays also showed that different enterococcal species co-occurred in most fecal samples. The most abundant enterococci in water and fecal samples were Enterococcus faecalis and Enterococcus faecium, although we identified more water isolates as Enterococcus casseliflavus than as any of the other species. The prevalence of the Entero1 marker was in agreement with the combined number of positive signals determined by the group-specific assays in most fecal samples, except in gull feces. On the other hand, the number of group-specific assay signals was lower in all water samples tested, suggesting that other enterococcal species are present in these samples. While the results highlight the value of genus- and group-specific assays for detecting the major enterococcal groups in environmental water samples, additional studies are needed to determine further the diversity, distributions, and relative abundances of all enterococcal species found in water. PMID:23087032

  18. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  19. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces.

  20. Physical mapping of the 5S and 18S rDNA in ten species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): evolutionary tendencies in the genus.

    PubMed

    Bueno, Vanessa; Venere, Paulo César; Thums Konerat, Jocicléia; Zawadzki, Cláudio Henrique; Vicari, Marcelo Ricardo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  1. Physical Mapping of the 5S and 18S rDNA in Ten Species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): Evolutionary Tendencies in the Genus

    PubMed Central

    César Venere, Paulo; Thums Konerat, Jocicléia; Henrique Zawadzki, Cláudio; Ricardo Vicari, Marcelo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus. PMID:25405240

  2. Development and application of small-subunit rRNA probes for assessment of selected Thiobacillus species and members of the genus Acidiphilium.

    PubMed

    Peccia, J; Marchand, E A; Silverstein, J; Hernandez, M

    2000-07-01

    Culture-dependent studies have implicated sulfur-oxidizing bacteria as the causative agents of acid mine drainage and concrete corrosion in sewers. Thiobacillus species are considered the major representatives of the acid-producing bacteria in these environments. Small-subunit rRNA genes from all of the Thiobacillus and Acidiphilium species catalogued by the Ribosomal Database Project were identified and used to design oligonucleotide DNA probes. Two oligonucleotide probes were synthesized to complement variable regions of 16S rRNA in the following acidophilic bacteria: Thiobacillus ferrooxidans and T. thiooxidans (probe Thio820) and members of the genus Acidiphilium (probe Acdp821). Using (32)P radiolabels, probe specificity was characterized by hybridization dissociation temperature (T(d)) with membrane-immobilized RNA extracted from a suite of 21 strains representing three groups of bacteria. Fluorochrome-conjugated probes were evaluated for use with fluorescent in situ hybridization (FISH) at the experimentally determined T(d)s. FISH was used to identify and enumerate bacteria in laboratory reactors and environmental samples. Probing of laboratory reactors inoculated with a mixed culture of acidophilic bacteria validated the ability of the oligonucleotide probes to track specific cell numbers with time. Additionally, probing of sediments from an active acid mine drainage site in Colorado demonstrated the ability to identify numbers of active bacteria in natural environments that contain high concentrations of metals, associated precipitates, and other mineral debris.

  3. Development and application of small-subunit rRNA probes for assessment of selected Thiobacillus species and members of the genus Acidiphilium.

    PubMed

    Peccia, J; Marchand, E A; Silverstein, J; Hernandez, M

    2000-07-01

    Culture-dependent studies have implicated sulfur-oxidizing bacteria as the causative agents of acid mine drainage and concrete corrosion in sewers. Thiobacillus species are considered the major representatives of the acid-producing bacteria in these environments. Small-subunit rRNA genes from all of the Thiobacillus and Acidiphilium species catalogued by the Ribosomal Database Project were identified and used to design oligonucleotide DNA probes. Two oligonucleotide probes were synthesized to complement variable regions of 16S rRNA in the following acidophilic bacteria: Thiobacillus ferrooxidans and T. thiooxidans (probe Thio820) and members of the genus Acidiphilium (probe Acdp821). Using (32)P radiolabels, probe specificity was characterized by hybridization dissociation temperature (T(d)) with membrane-immobilized RNA extracted from a suite of 21 strains representing three groups of bacteria. Fluorochrome-conjugated probes were evaluated for use with fluorescent in situ hybridization (FISH) at the experimentally determined T(d)s. FISH was used to identify and enumerate bacteria in laboratory reactors and environmental samples. Probing of laboratory reactors inoculated with a mixed culture of acidophilic bacteria validated the ability of the oligonucleotide probes to track specific cell numbers with time. Additionally, probing of sediments from an active acid mine drainage site in Colorado demonstrated the ability to identify numbers of active bacteria in natural environments that contain high concentrations of metals, associated precipitates, and other mineral debris. PMID:10877807

  4. Development and Application of Small-Subunit rRNA Probes for Assessment of Selected Thiobacillus Species and Members of the Genus Acidiphilium

    PubMed Central

    Peccia, Jordan; Marchand, Eric A.; Silverstein, Joann; Hernandez, Mark

    2000-01-01

    Culture-dependent studies have implicated sulfur-oxidizing bacteria as the causative agents of acid mine drainage and concrete corrosion in sewers. Thiobacillus species are considered the major representatives of the acid-producing bacteria in these environments. Small-subunit rRNA genes from all of the Thiobacillus and Acidiphilium species catalogued by the Ribosomal Database Project were identified and used to design oligonucleotide DNA probes. Two oligonucleotide probes were synthesized to complement variable regions of 16S rRNA in the following acidophilic bacteria: Thiobacillus ferrooxidans and T. thiooxidans (probe Thio820) and members of the genus Acidiphilium (probe Acdp821). Using 32P radiolabels, probe specificity was characterized by hybridization dissociation temperature (Td) with membrane-immobilized RNA extracted from a suite of 21 strains representing three groups of bacteria. Fluorochrome-conjugated probes were evaluated for use with fluorescent in situ hybridization (FISH) at the experimentally determined Tds. FISH was used to identify and enumerate bacteria in laboratory reactors and environmental samples. Probing of laboratory reactors inoculated with a mixed culture of acidophilic bacteria validated the ability of the oligonucleotide probes to track specific cell numbers with time. Additionally, probing of sediments from an active acid mine drainage site in Colorado demonstrated the ability to identify numbers of active bacteria in natural environments that contain high concentrations of metals, associated precipitates, and other mineral debris. PMID:10877807

  5. Phylogenetic relationships of the five extant Rhinoceros species (Rhinocerotidae, Perissodactyla) based on mitochondrial cytochrome b and 12S rRNA genes.

    PubMed

    Tougard, C; Delefosse, T; Hänni, C; Montgelard, C

    2001-04-01

    A major question in rhinocerotid phylogenetics concerns the position of the Sumatran rhinoceros (Dicerorhinus sumatrensis) with regard to the other extant Asian (Rhinoceros unicornis and R. sondaicus) and African (Diceros bicornis and Ceratotherium simum) species. We have examined this particular question through the phylogenetic analysis of the complete sequences of the mitochondrial 12S rRNA and cytochrome b genes. Three additional perissodactyls (one tapir and two equids) plus several outgroup cetartiodactyls were included in the analysis. The analysis identified a basal rhinocerotid divergence between the African and the Asian species, with the Sumatran rhinoceros forming the sister group of the genus Rhinoceros. We estimate the Asian and African lineages to have diverged at about 26 million years before present.

  6. Evaluation of four methods of assigning species and genus to medically important bacteria using 16S rRNA gene sequence analysis.

    PubMed

    Park, Geon; Jin, Won-Young; Jang, Sook-Jin; Kook, Joong-Ki; Choi, Ji Ae; Park, Gyun Cheol; Lee, Min-Jung; Park, Soon-Nang; Li, Xue Min; Cho, Seong-Sig; Jang, Chul Ho; Kang, Seong-Ho; Moon, Dae-Soo

    2015-05-01

    The four methods for assigning bacterial species are the Clinical and Laboratory Standards Institute (CLSI), modified CLSI (mCLSI), phylogenetic analysis (PA) and closest match (CM) methods, these are used to identify the genus and species using 16S rRNA gene sequence results. In this study, the results of identification by these four methods of 37 aerobic reference strains, 30 anaerobic reference strains, 15 Acinetobacter reference strains and 167 Acinetobacter clinical strains were compared. The rates of accurate identification to the species level using the CLSI, mCLSI, PA and CM methods were as follows: 24.3, 86.5, 86.5 and 89.2%, respectively, for the 37 aerobic reference strains; 73.3%, 96.7%, 90.0% and 93.3%, respectively, for the 30 anaerobic reference strains; 40.0%, 93.3%, 100% and 93.3%, respectively, for the 15 Acinetobacter reference strains; and 53.9%, 90.4%, 95.8% and 90.4%, respectively, for the 167 Acinetobacter clinical strains. The rates of accurate identification to the genus level using the CLSI, mCLSI, PA, and CM methods were as follows: 91.9%, 91.9%, 94.6% and 91.9%, respectively, for the 37 aerobic reference strains; 100%, 100%, 100% and 100%, respectively, for all of the 30 anaerobic reference strains, 15 Acinetobacter reference strains and the 167 Acinetobacter clinical strains. The mCLSI is the most practical and pragmatic method for identification of species based on 16S rRNA sequences for hospital, research or industry laboratories because it performs well and involves a simple procedure.

  7. Polymorphism of genes coding for nuclear 18S rRNA indicates genetic distinctiveness of anastomosis group 10 from other groups in the Rhizoctonia solani species complex.

    PubMed

    Liu, Z L; Domier, L L; Sinclair, J B

    1995-07-01

    DNA polymorphism in the 18S nuclear rRNA gene region was investigated by using 11 restriction endonucleases for 161 isolates of 25 intraspecific groups (ISGs) representing 11 reported anastomosis groups (AGs) of Rhizoctonia solani. A PCR-based restriction mapping method in which enzymatically amplified DNA fragments and subfragments were digested with one or two restriction enzymes was employed. Four types of DNA restriction maps of this region were constructed for these 25 ISGs. Map type I of the 18S rDNA region was represented by isolates of a majority of R. solani ISGs. Map types II and III, represented by ISG 2E and 9 isolates and 5C isolates, respectively, differed from map I by the absence of one (map type II) or two (map type III) restriction sites. Map type IV, represented by ISG 10A and B (or AG 10) isolates, showed significant restriction site variations, with five enzymes in this region compared with those of the remaining ISGs or AGs. Ten of the 25 restriction sites in the 18S rRNA gene region were informative and selected for analysis. Previously reported restriction maps of the 5.8S rRNA gene region, including the internal transcribed spacers, were aligned with each other, and 12 informative restriction sites were identified. These data were used alone and in combination to evaluate group relationships. Analyses derived from these data sets by maximum parsimony and likelihood methods showed that AG 10 isolates were distinct and distantly related to the majority isolates of the other AGs of this species complex.

  8. Reverse Transcriptase-PCR Analysis of Bacterial rRNA for Detection and Characterization of Bacterial Species in Arthritis Synovial Tissue

    PubMed Central

    Kempsell, Karen E.; Cox, Charles J.; Hurle, Michael; Wong, Anthony; Wilkie, Scott; Zanders, Edward D.; Gaston, J. S. Hill; Crowe, J. Scott

    2000-01-01

    Onset of rheumatoid arthritis (RA) is widely believed to be preceded by exposure to some environmental trigger such as bacterial infectious agents. The influence of bacteria on RA disease onset or pathology has to date been controversial, due to inconsistencies between groups in the report of bacterial species isolated from RA disease tissue. Using a modified technique of reverse transcriptase-PCR amplification, we have detected bacterial rRNA in the synovial tissue of late-stage RA and non-RA arthritis controls. This may be suggestive of the presence of live bacteria. Sequencing of cloned complementary rDNA (crDNA) products revealed a number of bacterial sequences in joint tissue from each patient, and from these analyses a comprehensive profile of the organisms present was compiled. This revealed a number of different organisms in each patient, some of which are common to both RA and non-RA controls and are probably opportunistic colonizers of previously diseased tissue and others which are unique species. These latter organisms may be candidates for a specific role in disease pathology and require further investigation to exclude them as causative agents in the complex bacterial millieu. In addition, many of the detected bacterial species have not been identified previously from synovial tissue or fluid from arthritis patients. These may not be easily cultivable, since they were not revealed in previous studies using conventional in vitro bacterial culture methods. In situ hybridization analyses have revealed the joint-associated bacterial rRNA to be both intra- and extracellular. The role of viable bacteria or their nucleic acids as triggers in disease onset or pathology in either RA or non-RA arthritis controls is unclear and requires further investigation. PMID:10992514

  9. Real-Time Quantitative Broad-Range PCR Assay for Detection of the 16S rRNA Gene Followed by Sequencing for Species Identification

    PubMed Central

    Zucol, Franziska; Ammann, Roland A.; Berger, Christoph; Aebi, Christoph; Altwegg, Martin; Niggli, Felix K.; Nadal, David

    2006-01-01

    Here we determined the analytical sensitivities of broad-range real-time PCR-based assays employing one of three different genomic DNA extraction protocols in combination with one of three different primer pairs targeting the 16S rRNA gene to detect a panel of 22 bacterial species. DNA extraction protocol III, using lysozyme, lysostaphin, and proteinase K, followed by PCR with the primer pair Bak11W/Bak2, giving amplicons of 796 bp in length, showed the best overall sensitivity, detecting DNA of 82% of the strains investigated at concentrations of ≤102 CFU in water per reaction. DNA extraction protocols I and II, using less enzyme treatment, combined with other primer pairs giving shorter amplicons of 466 bp and 342 or 346 bp, respectively, were slightly more sensitive for the detection of gram-negative but less sensitive for the detection of gram-positive bacteria. The obstacle of detecting background DNA in blood samples spiked with bacteria was circumvented by introducing a broad-range hybridization probe, and this preserved the minimal detection limits observed in samples devoid of blood. Finally, sequencing of the amplicons generated using the primer pair Bak11W/Bak2 allowed species identification of the detected bacterial DNA. Thus, broad-spectrum PCR targeting the 16S rRNA gene in the quantitative real-time format can achieve an analytical sensitivity of 1 to 10 CFU per reaction in water, avoid detection of background DNA with the introduction of a broad-range probe, and generate amplicons that allow species identification of the detected bacterial DNA by sequencing. These prerequisites are important for its application to blood-containing patient samples. PMID:16891488

  10. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.

    PubMed

    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto

    2015-01-01

    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group. PMID:26329975

  11. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.

    PubMed

    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto

    2015-01-01

    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group.

  12. IDENTIFICATION OF CRYPTOSPORIDIUM SPECIES AND SOURCES IN RAW WASTEWATER USING A SMALL SUBUNIT RRNA-BASED PCR-RFLP TOOL

    EPA Science Inventory

    The species composition and source of Cryptosporidium oocysts in wastewater have never been determined, even though it is widely assumed that these oocysts are from human sewage. Recent molecular characterizations of Cryptosporidium parasites make it possible to differentiate hum...

  13. Species-level core oral bacteriome identified by 16S rRNA pyrosequencing in a healthy young Arab population

    PubMed Central

    Al-hebshi, Nezar Noor; Abdulhaq, Ahmed; Albarrag, Ahmed; Basode, Vinod Kumar; Chen, Tsute

    2016-01-01

    Background Reports on the composition of oral bacteriome in Arabs are lacking. In addition, the majority of previous studies on other ethnic groups have been limited by low-resolution taxonomic assignment of next-generation sequencing reads. Furthermore, there has been a conflict about the existence of a ‘core’ bacteriome. Objective The objective of this study was to characterize the healthy core oral bacteriome in a young Arab population at the species level. Methods Oral rinse DNA samples obtained from 12 stringently selected healthy young subjects of Arab origin were pyrosequenced (454's FLX chemistry) for the bacterial 16S V1–V3 hypervariable region at an average depth of 11,500 reads. High-quality, non-chimeric reads ≥380 bp were classified to the species level using the recently described, prioritized, multistage assignment algorithm. A core bacteriome was defined as taxa present in at least 11 samples. The Chao2, abundance-based coverage estimator (ACE), and Shannon indices were computed to assess species richness and diversity. Results Overall, 557 species-level taxa (211±42 per subject) were identified, representing 122 genera and 13 phyla. The core bacteriome comprised 55 species-level taxa belonging to 30 genera and 7 phyla, namely Firmicutes, Proteobacteria, Actinobacteria, Bacteroidetes, Fusobacteria, Saccharibacteria, and SR1. The core species constituted between 67 and 87% of the individual bacteriomes. However, the abundances differed by up to three orders of magnitude among the study subjects. On average, Streptococcus mitis, Rothia mucilaginosa, Haemophilus parainfluenzae, Neisseria flavescence/subflava group, Prevotella melaninogenica, and Veillonella parvula group were the most abundant. Streptococcus sp. C300, a taxon never reported in the oral cavity, was identified as a core species. Species richness was estimated at 586 (Chao2) and 614 (ACE) species, whereas diversity (Shannon index) averaged at 3.99. Conclusions A species

  14. Disseminated neoplastic cells in Mytilus trossulus: verification of host species origin by (16S-like) rRNA sequence comparison.

    PubMed

    Gee, A; Specht, J M; Kerk, D; Moore, J D; Drum, A S; Elston, R A

    1994-02-01

    Disseminated neoplasia is a leukemia-like disease that occurs in many species of bivalve molluscs worldwide, including the bay mussel (Mytilus trossulus). The etiology of the disease is undetermined, but an early report proposed that the anomalous bivalve cells were actually an invasive parasite rather than cancerous cells of host origin. Comparison of partial sequences of small subunit rRNA from normal and putative cancer cells was performed to resolve this issue. These studies showed a close phylogenetic relationship of the different forms of cancer cells to each other (similarity coefficient, 0.982), to the normal hemocytes (similarity coefficient, 0.990, 0.992), and to the oyster, Crassostrea virginica (similarity coefficient, 0.895-0.927). A large phylogenetic distance separates all 3 mussel hemocyte types from several representative protists (similarity coefficient, 0.702-0.761). These results indicate that the disseminated neoplastic cells in mussels are indeed proliferative host cells and not unicellular parasites.

  15. PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid.

    PubMed Central

    Greisen, K; Loeffelholz, M; Purohit, A; Leong, D

    1994-01-01

    A set of broad-range PCR primers for the 16S rRNA gene in bacteria were tested, along with three series of oligonucleotide probes to detect the PCR product. The first series of probes is broad in range and consists of a universal bacterial probe, a gram-positive probe, a Bacteroides-Flavobacterium probe, and two probes for other gram-negative species. The second series was designed to detect PCR products from seven major bacterial species or groups frequently causing meningitis: Neisseria meningitidis, Haemophilus influenzae, Streptococcus pneumoniae, S. agalactiae, Escherichia coli and other enteric bacteria, Listeria monocytogenes, and Staphylococcus aureus. The third series was designed for the detection of DNA from species or genera commonly considered potential contaminants of clinical samples, including cerebrospinal fluid (CSF): Bacillus, Corynebacterium, Propionibacterium, and coagulase-negative Staphylococcus spp. The primers amplified DNA from all 124 different species of bacteria tested. Southern hybridization testing of the broad-range probes with washes containing 3 M tetramethylammonium chloride indicated that this set of probes correctly identified all but two of the 102 bacterial species tested, the exceptions being Deinococcus radiopugnans and Gardnerella vaginalis. The gram-negative and gram-positive probes hybridized to isolates of two newly characterized bacteria, Alloiococcus otitis and Rochalimaea henselii, as predicted by Gram stain characteristics. The CSF pathogen and contaminant probe sequences were compared with available sequence information and with sequencing data for 32 different species. Testing of the CSF pathogen and contaminant probes against DNA from over 60 different strains indicated that, with the exception of the coagulase-negative Staphylococcus probes, these probes provided the correct identification of bacterial species known to be found in CSF. Images PMID:7512093

  16. 18S rRNA gene sequencing identifies a novel species of Henneguya parasitizing the gills of the channel catfish (Ictaluridae).

    PubMed

    Rosser, Thomas G; Griffin, Matt J; Quiniou, Sylvie M A; Khoo, Lester H; Pote, Linda M

    2014-12-01

    In the southeastern USA, the channel catfish Ictalurus punctatus is a host to at least eight different species of myxozoan parasites belonging to the genus Henneguya, four of which have been characterized molecularly using sequencing of the small subunit ribosomal RNA (SSU rRNA) gene. However, only two of these have confirmed life cycles that involve the oligochaete Dero digitata as the definitive host. During a health screening of farm-raised channel catfish, several fish presented with deformed primary lamellae. Lamellae harbored large, nodular, white pseudocysts 1.25 mm in diameter, and upon rupturing, these pseudocysts released Henneguya myxospores, with a typical lanceolate-shaped spore body, measuring 17.1 ± 1.0 μm (mean ± SD; range = 15.0-19.3 μm) in length and 4.8 ± 0.4 μm (3.7-5.6 μm) in width. Pyriform-shaped polar capsules were 5.8 ± 0.3 μm in length (5.1-6.4 μm) and 1.7 ± 0.1 μm (1.4-1.9 μm) in width. The two caudal processes were 40.0 ± 5.1 μm in length (29.5-50.0 μm) with a spore length of 57.2 ± 4.7 (46.8-66.8 μm). The contiguous SSU rRNA gene sequence obtained from myxospores of five excised cysts did not match any Henneguya sp. in GenBank. The greatest sequence homology (91% over 1,900 bp) was with Henneguya pellis, associated with blister-like lesions on the skin of blue catfish Ictalurus furcatus. Based on the unique combination of pseudocyst and myxospore morphology, tissue location, host, and SSU rRNA gene sequence data, we report this isolate to be a previously unreported species, Henneguya bulbosus sp. nov.

  17. Robust species taxonomy assignment algorithm for 16S rRNA NGS reads: application to oral carcinoma samples

    PubMed Central

    Al-Hebshi, Nezar Noor; Nasher, Akram Thabet; Idris, Ali Mohamed; Chen, Tsute

    2015-01-01

    Background Usefulness of next-generation sequencing (NGS) in assessing bacteria associated with oral squamous cell carcinoma (OSCC) has been undermined by inability to classify reads to the species level. Objective The purpose of this study was to develop a robust algorithm for species-level classification of NGS reads from oral samples and to pilot test it for profiling bacteria within OSCC tissues. Methods Bacterial 16S V1-V3 libraries were prepared from three OSCC DNA samples and sequenced using 454's FLX chemistry. High-quality, well-aligned, and non-chimeric reads ≥350 bp were classified using a novel, multi-stage algorithm that involves matching reads to reference sequences in revised versions of the Human Oral Microbiome Database (HOMD), HOMD extended (HOMDEXT), and Greengene Gold (GGG) at alignment coverage and percentage identity ≥98%, followed by assignment to species level based on top hit reference sequences. Priority was given to hits in HOMD, then HOMDEXT and finally GGG. Unmatched reads were subject to operational taxonomic unit analysis. Results Nearly, 92.8% of the reads were matched to updated-HOMD 13.2, 1.83% to trusted-HOMDEXT, and 1.36% to modified-GGG. Of all matched reads, 99.6% were classified to species level. A total of 228 species-level taxa were identified, representing 11 phyla; the most abundant were Proteobacteria, Bacteroidetes, Firmicutes, Fusobacteria, and Actinobacteria. Thirty-five species-level taxa were detected in all samples. On average, Prevotella oris, Neisseria flava, Neisseria flavescens/subflava, Fusobacterium nucleatum ss polymorphum, Aggregatibacter segnis, Streptococcus mitis, and Fusobacterium periodontium were the most abundant. Bacteroides fragilis, a species rarely isolated from the oral cavity, was detected in two samples. Conclusion This multi-stage algorithm maximizes the fraction of reads classified to the species level while ensuring reliable classification by giving priority to the human, oral reference

  18. Development and evaluation of 16S rRNA gene targeting Enterococcus genus- and species-specific assays

    EPA Science Inventory

    Enterococci have been widely used as indicators of fecal pollution in recreational waters. Most studies enumerate enterococci using culture-based techniques that are time consuming and do not provide information on the identity of enterococci species within a given sample. Althou...

  19. Phylogenetic position of the enigmatic clawless eutardigrade genus Apodibius Dastych, 1983 (Tardigrada), based on 18S and 28S rRNA sequence data from its type species A. confusus.

    PubMed

    Dabert, Miroslawa; Dastych, Hieronymus; Hohberg, Karin; Dabert, Jacek

    2014-01-01

    The systematics of Eutardigrada, the largest lineage among the three classes of the phylum Tardigrada, is based mainly on the morphology of the leg claws and of the buccal apparatus. However, three members of the rarely recorded and poorly known limno-terrestrial eutardigrade genus Apodibius have no claws on their strongly reduced legs, a unique character among all tardigrades. This absence of all claws makes the systematic position of Apodibius one of the most enigmatic among the whole class. Until now all known associates of the genus Apodibius have been located in the incertae sedis species group or, quite recently, included into the Necopinatidae family. In the present study, phylogenetic analyses of 18S and 28S rRNA sequence data from 31 tardigrade species representing four parachelan superfamilies (Isohypsibioidea, Hypsibioidea, Macrobiotoidea, Eohypsibioidea), the apochelan Milnesium tardigradum, and the type species of the genus Apodibius, A. confusus, indicated close relationship of the Apodibius with tardigrade species recently included in the superfamily Isohypsibioidea. This result was well-supported and consistent across all markers (separate 18S rRNA, 28S rRNA, and combined 18S rRNA+28S rRNA datasets) and methods (MP, ML) applied.

  20. Phylogenetic position of the enigmatic clawless eutardigrade genus Apodibius Dastych, 1983 (Tardigrada), based on 18S and 28S rRNA sequence data from its type species A. confusus.

    PubMed

    Dabert, Miroslawa; Dastych, Hieronymus; Hohberg, Karin; Dabert, Jacek

    2014-01-01

    The systematics of Eutardigrada, the largest lineage among the three classes of the phylum Tardigrada, is based mainly on the morphology of the leg claws and of the buccal apparatus. However, three members of the rarely recorded and poorly known limno-terrestrial eutardigrade genus Apodibius have no claws on their strongly reduced legs, a unique character among all tardigrades. This absence of all claws makes the systematic position of Apodibius one of the most enigmatic among the whole class. Until now all known associates of the genus Apodibius have been located in the incertae sedis species group or, quite recently, included into the Necopinatidae family. In the present study, phylogenetic analyses of 18S and 28S rRNA sequence data from 31 tardigrade species representing four parachelan superfamilies (Isohypsibioidea, Hypsibioidea, Macrobiotoidea, Eohypsibioidea), the apochelan Milnesium tardigradum, and the type species of the genus Apodibius, A. confusus, indicated close relationship of the Apodibius with tardigrade species recently included in the superfamily Isohypsibioidea. This result was well-supported and consistent across all markers (separate 18S rRNA, 28S rRNA, and combined 18S rRNA+28S rRNA datasets) and methods (MP, ML) applied. PMID:24071560

  1. Direct Analysis of Genes Encoding 16S rRNA from Complex Communities Reveals Many Novel Molecular Species within the Human Gut

    PubMed Central

    Suau, Antonia; Bonnet, Régis; Sutren, Malène; Godon, Jean-Jacques; Gibson, Glenn R.; Collins, Matthew D.; Doré, Joel

    1999-01-01

    The human intestinal tract harbors a complex microbial ecosystem which plays a key role in nutrition and health. Although this microbiota has been studied in great detail by culture techniques, microscopic counts on human feces suggest that 60 to 80% of the observable bacteria cannot be cultivated. Using comparative analysis of cloned 16S rRNA gene (rDNA) sequences, we have investigated the bacterial diversity (both cultivated and noncultivated bacteria) within an adult-male fecal sample. The 284 clones obtained from 10-cycle PCR were classified into 82 molecular species (at least 98% similarity). Three phylogenetic groups contained 95% of the clones: the Bacteroides group, the Clostridium coccoides group, and the Clostridium leptum subgroup. The remaining clones were distributed among a variety of phylogenetic clusters. Only 24% of the molecular species recovered corresponded to described organisms (those whose sequences were available in public databases), and all of these were established members of the dominant human fecal flora (e.g., Bacteroides thetaiotaomicron, Fusobacterium prausnitzii, and Eubacterium rectale). However, the majority of generated rDNA sequences (76%) did not correspond to known organisms and clearly derived from hitherto unknown species within this human gut microflora. PMID:10543789

  2. Phylogeny of 54 representative strains of species in the family Pasteurellaceae as determined by comparison of 16S rRNA sequences.

    PubMed Central

    Dewhirst, F E; Paster, B J; Olsen, I; Fraser, G J

    1992-01-01

    Virtually complete 16S rRNA sequences were determined for 54 representative strains of species in the family Pasteurellaceae. Of these strains, 15 were Pasteurella, 16 were Actinobacillus, and 23 were Haemophilus. A phylogenetic tree was constructed based on sequence similarity, using the Neighbor-Joining method. Fifty-three of the strains fell within four large clusters. The first cluster included the type strains of Haemophilus influenzae, H. aegyptius, H. aphrophilus, H. haemolyticus, H. paraphrophilus, H. segnis, and Actinobacillus actinomycetemcomitans. This cluster also contained A. actinomycetemcomitans FDC Y4, ATCC 29522, ATCC 29523, and ATCC 29524 and H. aphrophilus NCTC 7901. The second cluster included the type strains of A. seminis and Pasteurella aerogenes and H. somnus OVCG 43826. The third cluster was composed of the type strains of Pasteurella multocida, P. anatis, P. avium, P. canis, P. dagmatis, P. gallinarum, P. langaa, P. stomatis, P. volantium, H. haemoglobinophilus, H. parasuis, H. paracuniculus, H. paragallinarum, and A. capsulatus. This cluster also contained Pasteurella species A CCUG 18782, Pasteurella species B CCUG 19974, Haemophilus taxon C CAPM 5111, H. parasuis type 5 Nagasaki, P. volantium (H. parainfluenzae) NCTC 4101, and P. trehalosi NCTC 10624. The fourth cluster included the type strains of Actinobacillus lignieresii, A. equuli, A. pleuropneumoniae, A. suis, A. ureae, H. parahaemolyticus, H. parainfluenzae, H. paraphrohaemolyticus, H. ducreyi, and P. haemolytica. This cluster also contained Actinobacillus species strain CCUG 19799 (Bisgaard taxon 11), A. suis ATCC 15557, H. ducreyi ATCC 27722 and HD 35000, Haemophilus minor group strain 202, and H. parainfluenzae ATCC 29242. The type strain of P. pneumotropica branched alone to form a fifth group. The branching of the Pasteurellaceae family tree was quite complex. The four major clusters contained multiple subclusters. The clusters contained both rapidly and slowly evolving

  3. Comparison of restriction enzyme pattern analysis and full gene sequencing of 16S rRNA gene for Nocardia species identification, the first report of Nocardia transvalensis isolated of sputum from Iran, and review of the literature.

    PubMed

    Fatahi-Bafghi, Mehdi; Heidarieh, Parvin; Rasouli-Nasab, Masoumeh; Habibnia, Shadi; Hashemi-Shahraki, Abdorazagh; Eshraghi, Seyyed Saeed

    2016-10-01

    Nocardial infections occur in different organs of the body and are common in immune disorder diseases of individuals. The aim of this study was to assess Nocardia species identification by phenotypic tests and molecular techniques applied to nocardiosis in Iranian patients. In the current study, various clinical samples were collected and cultured on conventional media and using the paraffin baiting method. Various phenotypic tests were performed. For accurate identification at the species level, restriction fragment length polymorphisms (RFLP) in the hsp65 and partial 16S rRNA genes and full gene sequencing of the 16S rRNA gene were used. Twenty-seven Nocardia spp. were isolated and analysis of phenotypic tests results showed Nocardia asteroides complex, Nocardia otitidiscaviarum, Nocardia nova, and Nocardia spp. New RFLP patterns of Nocardia strains with hsp65 and partial 16S rRNA genes were obtained. Full gene sequencing of the 16S rRNA gene identified Nocardia cyriacigeorgica, N. otitidiscaviarum, Nocardia farcinica, Nocardia transvalensis, and N. nova. Nocardia infections are rarely reported and this genus is the cause of various illnesses. Accurate identification of Nocardia spp. is important for epidemiology studies and treatment. It should also be noted that some species may have similar RFLP patterns; therefore, full gene sequencing of the 16S rRNA gene is necessary for confirmation.

  4. Comparison of restriction enzyme pattern analysis and full gene sequencing of 16S rRNA gene for Nocardia species identification, the first report of Nocardia transvalensis isolated of sputum from Iran, and review of the literature.

    PubMed

    Fatahi-Bafghi, Mehdi; Heidarieh, Parvin; Rasouli-Nasab, Masoumeh; Habibnia, Shadi; Hashemi-Shahraki, Abdorazagh; Eshraghi, Seyyed Saeed

    2016-10-01

    Nocardial infections occur in different organs of the body and are common in immune disorder diseases of individuals. The aim of this study was to assess Nocardia species identification by phenotypic tests and molecular techniques applied to nocardiosis in Iranian patients. In the current study, various clinical samples were collected and cultured on conventional media and using the paraffin baiting method. Various phenotypic tests were performed. For accurate identification at the species level, restriction fragment length polymorphisms (RFLP) in the hsp65 and partial 16S rRNA genes and full gene sequencing of the 16S rRNA gene were used. Twenty-seven Nocardia spp. were isolated and analysis of phenotypic tests results showed Nocardia asteroides complex, Nocardia otitidiscaviarum, Nocardia nova, and Nocardia spp. New RFLP patterns of Nocardia strains with hsp65 and partial 16S rRNA genes were obtained. Full gene sequencing of the 16S rRNA gene identified Nocardia cyriacigeorgica, N. otitidiscaviarum, Nocardia farcinica, Nocardia transvalensis, and N. nova. Nocardia infections are rarely reported and this genus is the cause of various illnesses. Accurate identification of Nocardia spp. is important for epidemiology studies and treatment. It should also be noted that some species may have similar RFLP patterns; therefore, full gene sequencing of the 16S rRNA gene is necessary for confirmation. PMID:27613736

  5. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  6. Prevalence of Bartonella species and 16s rRNA gene types of Bartonella henselae from domestic cats in Thailand.

    PubMed

    Maruyama, S; Sakai, T; Morita, Y; Tanaka, S; Kabeya, H; Boonmar, S; Poapolathep, A; Chalarmchaikit, T; Chang, C C; Kasten, R W; Chomel, B B; Katsube, Y

    2001-12-01

    Prevalence of Bartonella infection among 275 cats in 9 sites from 4 geographical regions (northern area: Chiang Mai; central area: Kanchanaburi, Ratchaburi, and Bangkok; northeastern area: Khon Kaen, Roi Et, Ubon Ratcharthani, and Nakhonratchasima; southern area: Songkhla) of Thailand was investigated. Overall, Bartonella species were isolated from 27.6% (76 of 275) of the cats. The isolation rate varied from 12.8% (5 of 39) in Songkhla (southern area) to 50.0% (26 of 52) in Khon Kaen (northeastern area). Bartonella henselae and B. clarridgeiae were isolated from 82.9% (63 of 76) and 11.8% (9 of 76) of the Bartonella-positive cats, respectively. Coinfection with both species was found in 5.3% (4 of 76) of the bacteremic cats. Of the 67 bacteremic cats from which B. henselae was isolated, 48 (71.6%) and 13 (19.4%) were infected with only Type I and Type II, respectively. Coinfection with both types was observed in 9.0% (6 of 67) of the B. henselae-positive cats. To our knowledge, this is the first report on the presence of Bartonella infection in domestic cats from Thailand, which constitute a large reservoir of Bartonella infection in this country.

  7. Evolutionary dynamics of the 5S rDNA gene family in the mussel Mytilus: mixed effects of birth-and-death and concerted evolution.

    PubMed

    Freire, Ruth; Arias, Alberto; Insua, Ana M; Méndez, Josefina; Eirín-López, José M

    2010-05-01

    In higher eukaryotes, the gene family encoding the 5S ribosomal RNA (5S rRNA) has been used (together with histones) to showcase the archetypal example of a gene family subject to concerted evolution. However, recent studies have revealed conspicuous features challenging the predictions of this model, including heterogeneity of repeat units, the presence of functional 5S gene variants as well as the existence of 5S rDNA divergent pseudogenes lacking traces of homogenization. In the present work, we have broadened the scope in the evolutionary study of ribosomal gene families by studying the 5S rRNA family in mussels, a model organism which stands out among other animals due to the heterogeneity it displays regarding sequence and organization. To this end, 48 previously unknown 5S rDNA units (coding and spacer regions) were sequenced in five mussel species, leading to the characterization of two new types of units (referred to here as small-beta 5S rDNA and gamma-5S rDNA) coexisting in the genome with alpha and beta rDNA units. The intense genetic dynamics of this family is further supported by the first description of an association between gamma-5S rDNA units and tRNA genes. Molecular evolutionary and phylogenetic analyses revealed an extensive lack of homology among spacer sequences belonging to different rDNA types, suggesting the presence of independent evolutionary pathways leading to their differentiation. Overall, our results suggest that the long-term evolution of the 5S rRNA gene family in mussels is most likely mediated by a mixed mechanism involving the generation of genetic diversity through birth-and-death, followed by a process of local homogenization resulting from concerted evolution in order to maintain the genetic identities of the different 5S units, probably after their transposition to independent chromosomal locations.

  8. Deconvoluting Mixtures ofEmissions Sources to Investigate PM2.5's Ability to Generate Reactive Oxygen Species and its Associations with Cardiorespiratory Effects

    NASA Astrophysics Data System (ADS)

    Weber, R. J.; Bates, J.; Abrams, J.; Verma, V.; Fang, T.; Klein, M.; Strickland, M. J.; Sarnat, S. E.; Chang, H. H.; Mulholland, J. A.; Tolbert, P. E.; Russell, A. G.

    2015-12-01

    It is hypothesized that fine particulate matter (PM2.5) inhalation can catalytically generate reactive oxygen species (ROS) in excess of the body's antioxidant capacity, leading to oxidative stress and ultimately adverse health. PM2.5 emissions from different sources vary widely in chemical composition, with varied effects on the body. Here, the ability of mixtures of different sources of PM2.5 to generate ROS and associations of this capability with acute health effects were investigated. A dithiothreitol (DTT) assay that integrates over different sources was used to quantify ROS generation potential of ambient water-soluble PM2.5 in Atlanta from June 2012 - June 2013. PM2.5 source impacts, estimated using the Chemical Mass Balance method with ensemble-averaged source impact profiles, were related to DTT activity using a linear regression model, which provided information on intrinsic DTT activity (i.e., toxicity) of each source. The model was then used to develop a time series of daily DTT activity over a ten-year period (1998-2010) for use in an epidemiologic study. Light-duty gasoline vehicles exhibited the highest intrinsic DTT activity, followed by biomass burning and heavy-duty diesel vehicles. Biomass burning contributed the largest fraction to total DTT activity, followed by gasoline and diesel vehicles (45%, 20% and 14%, respectively). These results suggest the importance of aged oxygenated organic aerosols and metals in ROS generation. Epidemiologic analyses found significant associations between estimated DTT activity and emergency department visits for congestive heart failure and asthma/wheezing attacks in the 5-county Atlanta area. Estimated DTT activity was the only pollutant measure out of PM2.5, O3, and PM2.5 constituents elemental carbon and organic carbon) that exhibited a significant link to congestive heart failure. In two-pollutant models, DTT activity was significantly associated with asthma/wheeze and congestive heart failure while PM2

  9. Identification of Carnobacterium species by restriction fragment length polymorphism of the 16S-23S rRNA gene intergenic spacer region and species-specific PCR.

    PubMed

    Rachman, Cinta; Kabadjova, Petia; Valcheva, Rosica; Prévost, Hervé; Dousset, Xavier

    2004-08-01

    The genus Carnobacterium is currently divided into the following eight species: Carnobacterium piscicola, C. divergens, C. gallinarum, C. mobile, C. funditum, C. alterfunditum, C. inhibens, and C. viridans. An identification tool for the rapid differentiation of these eight Carnobacterium species was developed, based on the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR). PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of this 16S-23S rDNA ISR was performed in order to obtain restriction profiles for all of the species. Three PCR amplicons, which were designated small ISR (S-ISR), medium ISR (M-ISR), and large ISR (L-ISR), were obtained for all Carnobacterium species. The L-ISR sequence revealed the presence of two tRNA genes, tRNA(Ala) and tRNA(Ile), which were separated by a spacer region that varied from 24 to 38 bp long. This region was variable among the species, allowing the design of species-specific primers. These primers were tested and proved to be species specific. The identification method based on the 16S-23S rDNA ISR, using PCR-RFLP and specific primers, is very suitable for the rapid low-cost identification and discrimination of all of the Carnobacterium species from other phylogenetically related lactic acid bacteria.

  10. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  11. Genetic diversity of Helicobacter pylori indexed with respect to clinical symptomatology, using a 16S rRNA and a species-specific DNA probe.

    PubMed

    Desai, M; Linton, D; Owen, R J; Cameron, H; Stanley, J

    1993-12-01

    DNA probes are described which identify group and fingerprint strains of the human gastric pathogen Helicobacter pylori, on the basis of well-defined band homologies. A 544 bp internal fragment of the 16S ribosomal RNA gene was generated by polymerase chain reaction (PCR) with primers derived from the Escherichia coli rRNA gene sequence. In genomic Southern blots this probe detected restriction site variation around these loci, generating simple but strain-specific molecular fingerprints. A small conserved chromosomal fragment of 1.2 kbp, Hps, species-specific for H. pylori, was obtained by cloning random HindIII fragments into pUC19. It was useful for dot-blot identification, and also separated isolates into one major and two minor groups. When results for these two probes were combined, a baseline characterization of genotype was obtained. A band-matching database of molecular fingerprints for the type strain and 63 clinical isolates of H. pylori from asymptomatic, ulcer and gastritis contexts is presented. No significant association between the genotypes at this level of definition and the associated clinical symptomatology of the isolates was detected.

  12. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    PubMed

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  13. Comparison of potential diatom 'barcode' genes (the 18S rRNA gene and ITS, COI, rbcL) and their effectiveness in discriminating and determining species taxonomy in the Bacillariophyta.

    PubMed

    Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan

    2015-04-01

    Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode.

  14. Characterization of Sarcocystis species in domestic animals using a PCR-RFLP analysis of variation in the 18S rRNA gene: a cost-effective and simple technique for routine species identification.

    PubMed

    Yang, Zhao-Qing; Li, Qing-Qing; Zuo, Yang-Xian; Chen, Xin-Wen; Chen, Yong-Jiu; Nie, Long; Wei, Chang-Gue; Zen, Jia-Shun; Attwood, S W; Zhang, Xue-Zheng; Zhang, Ya-Ping

    2002-01-01

    Thirteen restriction endonucleases were used to investigate nuclotide sequence variation in the 18S rRNA DNA of 88 individuals from ten Sarcocystis taxa collected as cysts from their intermediate hosts, swine, cattle and water buffalo. A DNA sequence of approximately 900 bp was used. A total of 26 electromorphs were detected. The electromorphs were sorted into seven different haplotypes that coincided with the six named species and an unidentified species from cattle. These findings support those of our morphological examinations, which suggested that the taxa resembling Sarcocystis hirsuta, S. hominis, both found in water buffalo, and S. sinensis found in cattle, are not new species but are in fact S. hirsuta and S. hominis as found in cattle, and S. sinensis as found in water buffalo; this finding supports the idea that these species can utilize both cattle and water buffalo as intermediate hosts and are not restricted to one or the other host group as previously thought. PCR-RFLP resolved by agarose gel electrophoresis is shown to be an easy and rapid method of discriminating between these species.

  15. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  16. Species-Level Identification of Actinomyces Isolates Causing Invasive Infections: Multiyear Comparison of Vitek MS (Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry) to Partial Sequencing of the 16S rRNA Gene.

    PubMed

    Lynch, T; Gregson, D; Church, D L

    2016-03-01

    Actinomyces species are uncommon but important causes of invasive infections. The ability of our regional clinical microbiology laboratory to report species-level identification of Actinomyces relied on molecular identification by partial sequencing of the 16S ribosomal gene prior to the implementation of the Vitek MS (matrix-assisted laser desorption ionization-time of flight mass spectrometry [MALDI-TOF MS]) system. We compared the use of the Vitek MS to that of 16S rRNA gene sequencing for reliable species-level identification of invasive infections caused by Actinomyces spp. because limited data had been published for this important genera. A total of 115 cases of Actinomyces spp., either alone or as part of a polymicrobial infection, were diagnosed between 2011 and 2014. Actinomyces spp. were considered the principal pathogen in bloodstream infections (n = 17, 15%), in skin and soft tissue abscesses (n = 25, 22%), and in pulmonary (n = 26, 23%), bone (n = 27, 23%), intraabdominal (n = 16, 14%), and central nervous system (n = 4, 3%) infections. Compared to sequencing and identification from the SmartGene Integrated Database Network System (IDNS), Vitek MS identified 47/115 (41%) isolates to the correct species and 10 (9%) isolates to the correct genus. However, the Vitek MS was unable to provide identification for 43 (37%) isolates while 15 (13%) had discordant results. Phylogenetic analyses of the 16S rRNA sequences demonstrate high diversity in recovered Actinomyces spp. and provide additional information to compare/confirm discordant identifications between MALDI-TOF and 16S rRNA gene sequences. This study highlights the diversity of clinically relevant Actinomyces spp. and provides an important typing comparison. Based on our analysis, 16S rRNA gene sequencing should be used to rapidly identify Actinomyces spp. until MALDI-TOF databases are optimized.

  17. Complexities of bloom dynamics in the toxic dinoflagellate Alexandrium fundyense revealed through DNA measurements by imaging flow cytometry coupled with species-specific rRNA probes

    NASA Astrophysics Data System (ADS)

    Brosnahan, Michael L.; Farzan, Shahla; Keafer, Bruce A.; Sosik, Heidi M.; Olson, Robert J.; Anderson, Donald M.

    2014-05-01

    Measurements of the DNA content of different protist populations can shed light on a variety of processes, including cell division, sex, prey ingestion, and parasite invasion. Here, we modified an Imaging FlowCytobot (IFCB), a custom-built flow cytometer that records images of microplankton, to measure the DNA content of large dinoflagellates and other high-DNA content species. The IFCB was also configured to measure fluorescence from Cy3-labeled rRNA probes, aiding the identification of Alexandrium fundyense (syn. A. tamarense Group I), a photosynthetic dinoflagellate that causes paralytic shellfish poisoning (PSP). The modified IFCB was used to analyze samples from the development, peak and termination phases of an inshore A. fundyense bloom (Salt Pond, Eastham, MA, USA), and from a rare A. fundyense ‘red tide’ that occurred in the western Gulf of Maine, offshore of Portsmouth, NH (USA). Diploid or G2 phase (‘2C’) A. fundyense cells were frequently enriched at the near-surface, suggesting an important role for aggregation at the air-sea interface during sexual events. Also, our analysis showed that large proportions of A. fundyense cells in both the Salt Pond and red tide blooms were planozygotes during bloom decline, highlighting the importance of sexual fusion to bloom termination. At Salt Pond, bloom decline also coincided with a dramatic rise in infections by the parasite genus Amoebophrya. The samples that were most heavily infected contained many large cells with higher DNA-associated fluorescence than 2C vegetative cells, but these cells' nuclei were also frequently consumed by Amoebophrya trophonts. Neither large cell size nor increased DNA-associated fluorescence could be replicated by infecting an A. fundyense culture of vegetative cells. Therefore, we attribute these characteristics of the large Salt Pond cells to planozygote maturation rather than Amoebophrya infection, though an interaction between infection and planozygote maturation may

  18. Identification of bacterial species associated with the sheep scab mite (Psoroptes ovis) by using amplified genes coding for 16S rRNA.

    PubMed

    Hogg, J C; Lehane, M J

    1999-09-01

    This was the first molecular study of the bacterial flora of the sheep scab mite (Psoroptes ovis). A sequence analysis of genes coding for 16S rRNA revealed that Serratia marcescens and bacteria closely related to Staphylococcus intermedius or Staphylococcus chromogens and Alloiococcus otitidis were present. These bacteria were associated with skin lesions, dermatitis, and otitis media caused by P. ovis.

  19. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA.

  20. Taxonomy of 5 S ribosomal RNA by the linguistic technique: probing with mitochondrial and mammalian sequences.

    PubMed

    Guimarães, R C; Trifonov, E N; Lagunez-Otero, J

    1997-09-01

    Linguistic similarities and dissimilarities between 5 S rRNA sequences allowed taxonomical separation of species and classes. Comparisons with the molecule from mammals distinguished fungi and plants from protists and animals. Similarities to mammalians progressively increased from protists to invertebrates and to somatic-type molecules of the vertebrates lineage. In this, deviations were detected in avian, oocyte type, and pseudogene sequences. Among bacteria, actinobacteria were most similar to the mammalians, which could be related to the high frequency of associations among members of these groups. Some archaebacterial species most similar to the mammalians belonged to the Thermoproteales and Halobacteria groups. Comparisons with the soybean mitochondrial molecule revealed high internal homogeneity among plant mitochondria. The eubacterial groups most similar to it were Thermus and Rhodobacteria gamma-1 and alpha-2. Other procedures have already indicated similarities of Rhodobacteria alpha to mitochondria but the linguistic similarities were on the average higher with the first two groups.

  1. Species-level identification of isolates of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex by sequence analysis of the 16S-23S rRNA gene spacer region.

    PubMed

    Chang, Hsien Chang; Wei, Yu Fang; Dijkshoorn, Lenie; Vaneechoutte, Mario; Tang, Chung Tao; Chang, Tsung Chain

    2005-04-01

    The species Acinetobacter calcoaceticus, A. baumannii, genomic species 3, and genomic species 13TU included in the Acinetobacter calcoaceticus-Acinetobacter baumannii complex are genetically highly related and difficult to distinguish phenotypically. Except for A. calcoaceticus, they are all important nosocomial species. In the present study, the usefulness of the 16S-23S rRNA gene intergenic spacer (ITS) sequence for the differentiation of (genomic) species in the A. calcoaceticus-A. baumannii complex was evaluated. The ITSs of 11 reference strains of the complex and 17 strains of other (genomic) species of Acinetobacter were sequenced. The ITS lengths (607 to 638 bp) and sequences were highly conserved for strains within the A. calcoaceticus-A. baumannii complex. Intraspecies ITS sequence similarities ranged from 0.99 to 1.0, whereas interspecies similarities varied from 0.86 to 0.92. By using these criteria, 79 clinical isolates identified as A. calcoaceticus (18 isolates) or A. baumannii (61 isolates) with the API 20 NE system (bioMerieux Vitek, Marcy l'Etoile, France) were identified as A. baumannii (46 isolates), genomic species 3 (19 isolates), and genomic species 13TU (11 isolates) by ITS sequencing. An identification rate of 96.2% (76 of 79 isolates) was obtained by using ITS sequence analysis for identification of isolates in the A. calcoaceticus-A. baumannii complex, and the accuracy of the method was confirmed for a subset of strains by amplified rRNA gene restriction analysis and genomic DNA analysis by AFLP analysis by using libraries of profiles of reference strains. In conclusion, ITS sequence-based identification is reliable and provides a promising tool for elucidation of the clinical significance of the different species of the A. calcoaceticus-A. baumannii complex.

  2. Molecular characterization and physical mapping of two classes of 5S rDNA in the genomes of Gymnotus sylvius and G. inaequilabiatus (Gymnotiformes, Gymnotidae).

    PubMed

    Scacchetti, P C; Alves, J C P; Utsunomia, R; Claro, F L; de Almeida Toledo, L F; Oliveira, C; Foresti, F

    2012-01-01

    The nucleotide sequences of the 5S rRNA multigene family and their distribution across the karyotypes in 2 species of Gymnotiformes, genus Gymnotus (G. sylvius and G. inaequilabiatus) were investigated by means of fluorescence in situ hybridization (FISH). The results showed the existence of 2 distinct classes of 5S rDNA sequences in both species: class I and class II. A high conservative pattern of the codifying region of the 5S rRNA gene was identified, contrasting with significant alterations detected in the nontranscribed spacer (NTS). The presence of TATA-like sequences along the NTS of both species was an expected occurrence, since such sequences have been associated with the regulation of the gene expression. FISH using 5S rDNA class I and class II probes revealed that both gene classes were collocated in the same chromosome pair in the genome of G. sylvius, while in that of G. inaequilabiatus, class II appeared more disperse than class I.

  3. Two sequence classes of kinetoplastid 5S ribosomal RNA gene revealed among bodonid spliced leader RNA gene arrays.

    PubMed

    Santana, D M; Lukes, J; Sturm, N R; Campbell, D A

    2001-11-13

    The spliced leader RNA genes of Bodo saltans, Cryptobia helicis and Dimastigella trypaniformis were analyzed as molecular markers for additional taxa within the suborder Bodonina. The non-transcribed spacer regions were distinctive for each organism, and 5S rRNA genes were present in Bodo and Dimastigella but not in C. helicis. Two sequence classes of 5S rRNA were evident from analysis of the bodonid genes. The two classes of 5S rRNA genes were found in other Kinetoplastids independent of co-localization with the spliced leader RNA gene.

  4. Phylogenetic Analysis Using the 28S rRNA Gene Reveals That the Genus Paracreptotrema (Digenea: Allocreadiidae) Is Not Monophyletic; Description of Two New Genera and One New Species.

    PubMed

    de León, Gerardo Pérez-Ponce; Pinacho-Pinacho, Carlos D; Mendoza-Garfias, Berenit; Choudhury, Anindo; García-Varela, Martín

    2016-02-01

    This study investigates the systematics of Paracreptotrema Choudhury, Pérez-Ponce de León, Brooks and Daverdin, 2006 using morphological data (stained whole mounts and scanning electron microscopy) and partial sequences of the 28S ribosomal rRNA gene, obtained from freshly collected material. In total, 484 specimens representing 4 species, i.e., Paracreptotrema blancoi (157), Paracreptotrema profundulusi (12), Paracreptotrema rosenthali (8), and Paracreptotrema blancoi sensu Salgado-Maldonado et al. (2011) (307) were collected. Existing museum depositions were also studied. The 28S rRNA gene sequences of these Paracreptotrema spp. were aligned, along with sequences from 22 other allocreadiids and 4 other non-allocreadiid xiphidiatan species. Bayesian inference and maximum likelihood analyses indicated a paraphyletic Paracreptotrema split into 3 clades: 1 comprising P. blancoi and P. rosenthali that was sister to a clade formed by 3 other species of allocreadiids (species of Wallinia, Creptotrematina, and Auriculostoma) typically found in characid fishes, a second clade formed solely by Paracreptotrema heterandriae as the sister taxon of the aforementioned species, and a third by P. profundulusi and specimens erroneously identified as P. blancoi. Two new taxa were erected to reflect these results: Paracreptotrematoides for Paracreptotrema heterandriae, and Pseudoparacreptotrema for Paracreptotrema profundulusi and P. macroacetabulata (the species erroneously identified as P. blancoi from profundulids across Middle America). Closer consideration of the morphology corroborates these findings. The revised systematics also indicated that Paracreptotrema spp. are found in poeciliids, whereas Pseudoparacreptotrema spp. parasitize profundulids. The study demonstrates the value of an integrative taxonomy approach to address the apparently complicated systematics of the allocreadiids.

  5. Genetic classification and distinguishing of Staphylococcus species based on different partial gap, 16S rRNA, hsp60, rpoB, sodA, and tuf gene sequences.

    PubMed

    Ghebremedhin, B; Layer, F; König, W; König, B

    2008-03-01

    The analysis of 16S rRNA gene sequences has been the technique generally used to study the evolution and taxonomy of staphylococci. However, the results of this method do not correspond to the results of polyphasic taxonomy, and the related species cannot always be distinguished from each other. Thus, new phylogenetic markers for Staphylococcus spp. are needed. We partially sequenced the gap gene (approximately 931 bp), which encodes the glyceraldehyde-3-phosphate dehydrogenase, for 27 Staphylococcus species. The partial sequences had 24.3 to 96% interspecies homology and were useful in the identification of staphylococcal species (F. Layer, B. Ghebremedhin, W. König, and B. König, J. Microbiol. Methods 70:542-549, 2007). The DNA sequence similarities of the partial staphylococcal gap sequences were found to be lower than those of 16S rRNA (approximately 97%), rpoB (approximately 86%), hsp60 (approximately 82%), and sodA (approximately 78%). Phylogenetically derived trees revealed four statistically supported groups: S. hyicus/S. intermedius, S. sciuri, S. haemolyticus/S. simulans, and S. aureus/epidermidis. The branching of S. auricularis, S. cohnii subsp. cohnii, and the heterogeneous S. saprophyticus group, comprising S. saprophyticus subsp. saprophyticus and S. equorum subsp. equorum, was not reliable. Thus, the phylogenetic analysis based on the gap gene sequences revealed similarities between the dendrograms based on other gene sequences (e.g., the S. hyicus/S. intermedius and S. sciuri groups) as well as differences, e.g., the grouping of S. arlettae and S. kloosii in the gap-based tree. From our results, we propose the partial sequencing of the gap gene as an alternative molecular tool for the taxonomical analysis of Staphylococcus species and for decreasing the possibility of misidentification.

  6. Cellular identity of an 18S rRNA gene sequence clade within the class Kinetoplastea: the novel genus Actuariola gen. nov. (Neobodonida) with description of the type species Actuariola framvarensis sp. nov.

    PubMed

    Stoeck, Thorsten; Schwarz, M V Julian; Boenigk, Jens; Schweikert, Michael; von der Heyden, Sophie; Behnke, Anke

    2005-11-01

    Environmental molecular surveys of microbial diversity have uncovered a vast number of novel taxonomic units in the eukaryotic tree of life that are exclusively known by their small-subunit (SSU) rRNA gene signatures. In this study, we reveal the cellular and taxonomic identity of a novel eukaryote SSU rRNA gene sequence clade within the Kinetoplastea. Kinetoplastea are ubiquitously distributed flagellated protists of high ecological and medical importance. We isolated an organism from the oxic-anoxic interface of the anoxic Framvaren Fjord (Norway), which branches within an unidentified kinetoplastean sequence clade. Ultrastructural studies revealed a typical cellular organization that characterized the flagellated isolate as a member of the order Neobodonida Vickerman 2004, which contains five genera. The isolate differed in several distinctive characters from Dimastigella, Cruzella, Rhynchobodo and Rhynchomonas. The arrangement of the microtubular rod that supports the apical cytostome and the cytopharynx differed from the diagnosis of the fifth described genus (Neobodo Vickerman 2004) within the order Neobodonida. On the basis of both molecular and microscopical data, a novel genus within the order Neobodonida, Actuariola gen. nov., is proposed. Here, we characterize its type species, Actuariola framvarensis sp. nov., and provide an in situ tool to access the organism in nature and study its ecology.

  7. IDENTIFICATION OF SPECIES AND SOURCES OF CRYPTOSPORIDIUM OOCYSTS IN STORM WATERS BY A SMALL SUBUNIT RRNA-BASED DIAGNOSTIC AND GENOTYPING TOOL

    EPA Science Inventory

    The identification of Cryptosporidium oocysts in environmental samples is largely made by the use of immunofluorescent assay (IFA). because IFA detects oocysts from all Cryptosporidium parasites, the species distribution and source of Cryptosporidium parasites in environmental sa...

  8. IDENTIFICATION OF CRYPTOSPORIDIUM SPECIES AND THE SOURCES IN RAW WASTEWATER USING A SMALL SUBUNIT RRNA-BASED PCR-RFLP TOOL

    EPA Science Inventory

    The species composition and source of Cryptosporidium oocysts in wastewater have never been determined, even though it is widely assumed that these oocysts are from human sewage. Recent molecular characterizations of Cryptosporidium parasites make it possible to differentiate hum...

  9. RAPID DETECTION OF MICROORGANISMS USING 5S RRNA SPECIFIC MOLECULAR BEACONS. (R825354)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  10. 5S RRNA GENE DELETIONS CAUSE AN UNEXPECTEDLY HIGH FITNESS LOSS IN ESCHERICHIA COLI. (R825354)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  11. A combination of morphology and 28S rRNA gene sequences provide grouping and ranking criteria to merge eight into three Ambispora species (Ambisporaceae, Glomeromycota).

    PubMed

    Bills, Robert J; Morton, Joseph B

    2015-08-01

    Ambispora, the only genus in Ambisporaceae and one of three deeply rooted families in Archaeosporales, Glomeromycetes, is amended. Analysis of the morphology of specimens from types and living cultures and 28S ribosomal DNA (rDNA; LSU) sequences resulted in two major changes that redefined Ambispora to include only species with the potential for spore dimorphism (acaulosporoid and glomoid). First, species described as producing only glomoid spores (Ambispora leptoticha, Ambispora fecundispora, and Ambispora callosa), only acaulosporoid spores (Ambispora jimgerdemannii), or both spore morphotypes (Ambispora appendicula) were synonymized with a redefined dimorphic species, A. leptoticha. LSU sequences and more conserved SSU gene data indicated little divergence between genotypes formerly classified as separate species. Second, Ambispora fennica was synonymized with Ambispora gerdemannii based on morphological and LSU sequence variation equivalent to that measured in the sister clade A. leptoticha. With this analysis, Ambispora was reduced to three species: A. leptoticha, A. gerdemannii, and Ambispora granatensis. Morphological and molecular characters were given equal treatment in this study, as each data set informed and clarified grouping and ranking decisions. The two inner layers of the acaulosporoid spore wall were the only structural characters uniquely defining each of these three species; all other characters were shared. Phenotypes of glomoid spores were indistinguishable between species, and thus were informative only at the genus level. Distinct subclade structure of the LSU gene tree suggests fixation of discrete variants typical of clonal reproduction and possible retention of polymorphisms in rDNA repeats, so that not all discrete genetic variants are indicative of speciation.

  12. Gordonia Species as Emerging Causes of Continuous-Ambulatory-Peritoneal-Dialysis-Related Peritonitis Identified by 16S rRNA and secA1 Gene Sequencing and Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry (MALDI-TOF MS)

    PubMed Central

    Lam, Jimmy Y. W.; Leung, Wai-Shing; Cheung, Ingrid; Chan, Jasper F. W.; Tse, Cindy W. S.; Lee, Rodney A.; Lau, Susanna K. P.

    2014-01-01

    We report here four cases of continuous ambulatory peritoneal dialysis-related peritonitis caused by three different species of Gordonia. The portal of entry was likely through Tenckhoff catheters. 16S rRNA and secA1 gene sequencing are so far the most reliable methods for the accurate identification of Gordonia species. PMID:25428146

  13. Single-Cell DNA barcoding using sequences from the small subunit rRNA and internal transcribed spacer region identifies new species of Trichonympha and Trichomitopsis from the hindgut of the termite Zootermopsis angusticollis.

    PubMed

    Tai, Vera; James, Erick R; Perlman, Steve J; Keeling, Patrick J

    2013-01-01

    To aid in their digestion of wood, lower termites are known to harbour a diverse community of prokaryotes as well as parabasalid and oxymonad protist symbionts. One of the best-studied lower termite gut communities is that of Zootermopsis angusticollis which has been known for almost 100 years to possess 3 species of Trichonympha (T. campanula, T. collaris, and T. sphaerica), 1 species of Trichomitopsis (T. termopsidis), as well as smaller flagellates. We have re-assessed this community by sequencing the small subunit (SSU) rRNA gene and the internal transcribed spacer (ITS) region from a large number of single Trichonympha and Trichomitopsis cells for which morphology was also documented. Based on phylogenetic clustering and sequence divergence, we identify 3 new species: Trichonympha postcylindrica, Trichomitopsis minor, and Trichomitopsis parvus spp. nov. Once identified by sequencing, the morphology of the isolated cells for all 3 new species was re-examined and found to be distinct from the previously described species: Trichonympha postcylindrica can be morphologically distinguished from the other Trichonympha species by an extension on its posterior end, whereas Trichomitopsis minor and T. parvus are smaller than T. termopsidis but similar in size to each other and cannot be distinguished based on morphology using light microscopy. Given that Z. angusticollis has one of the best characterized hindgut communities, the near doubling of the number of the largest and most easily identifiable symbiont species suggests that the diversity of hindgut symbionts is substantially underestimated in other termites as well. Accurate descriptions of the diversity of these microbial communities are essential for understanding hindgut ecology and disentangling the interactions among the symbionts, and molecular barcoding should be a priority for these systems.

  14. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    PubMed Central

    2010-01-01

    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  15. Development of quantitative PCR assays targeting 16S rRNA gene of Enterococcus spp. and their application to the identification of Enterococcus species in environmental samples

    EPA Science Inventory

    The detection of environmental enterococci has primarily been determined using culture-based techniques that might exclude some enterococci species as well as those that are nonculturable. To address this, the relative abundance of enterococci was examined by challenging fecal an...

  16. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.

    PubMed

    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa

    2011-03-01

    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained.

  17. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.

    PubMed

    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa

    2011-03-01

    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained. PMID:21429462

  18. Comparison of sequence differences in a variable 23S rRNA domain among sets of cryptic species of ciliated protozoa.

    PubMed

    Nanney, D L; Park, C; Preparata, R; Simon, E M

    1998-01-01

    Studies were undertaken to discover the relative molecular distances separating some familiar forms of ciliated protozoa, and the genetic species they include. Sequences of 190 bases of the D2 domain of the large ribosomal nucleic acid molecule were obtained by polymerase chain reaction from protists of three distinctive groups of ciliated protozoa-Colpoda, Paramecium and Tetrahymena. Evolutionary trees were constructed for each set of sequences using the PHYLOGEN 1.0 string programs. All three groups of ciliates manifested large molecular diversity among strains difficult or impossible to distinguish morphologically. The largest single evolutionary distance within a group was the 75 differences separating Tetrahymena paravorax from the other tetrahymenids. The largest mean distance for a group was the 21.2 for the colpodids. In all the protist groups the large molecular diversity is obscured by morphological conservatism associated with constraints of ancient designs. The molecular diversity within morphotypes argues for long evolutionary coexistence of species differentiated from each other in significant physiological, ecological, or nutritional ways.

  19. Species-genomic relationships among the tribasic diploid and polyploid Carthamus taxa based on physical mapping of active and inactive 18S-5.8S-26S and 5S ribosomal RNA gene families, and the two tandemly repeated DNA sequences.

    PubMed

    Agrawal, Renuka; Tsujimoto, Hisashi; Tandon, Rajesh; Rao, Satyawada Rama; Raina, Soom Nath

    2013-05-25

    In the genus Carthamus (2n=20, 22, 24, 44, 64; x=10, 11, 12), most of the homologues within and between the chromosome complements are difficult to be identified. In the present work, we used fluorescent in situ hybridisation (FISH) to determine the chromosome distribution of the two rRNA gene families, and the two isolated repeated DNA sequences in the 14 Carthamus taxa. The distinctive variability in the distribution, number and signal intensity of hybridisation sites for 18S-26S and 5S rDNA loci could generally distinguish the 14 Carthamus taxa. Active 18S-26S rDNA sites were generally associated with NOR loci on the nucleolar chromosomes. The two A genome taxa, C. glaucus ssp. anatolicus and C. boissieri with 2n=20, and the two botanical varieties of B genome C. tinctorius (2n=24) had diagnostic FISH patterns. The present results support the origin of C. tinctorius from C. palaestinus. FISH patterns of C. arborescens vis-à-vis the other taxa indicate a clear division of Carthamus taxa into two distinct lineages. Comparative distribution and intensity pattern of 18S-26S rDNA sites could distinguish each of the tetraploid and hexaploid taxa. The present results indicate that C. boissieri (2n=20) is one of the genome donors for C. lanatus and C. lanatus ssp. lanatus (2n=44), and C. lanatus is one of the progenitors for the hexaploid (2n=64) taxa. The association of pCtKpnI-2 repeated sequence with rRNA gene cluster (orphon) in 2-10 nucleolar and non-nucleolar chromosomes and the consistent occurrence of pCtKpnI-1 repeated sequence at the subtelomeric region in all the taxa analysed indicate some functional role of these sequences.

  20. Homologous genes for mouse 4.5S hybRNA are found in all eukaryotes and their low molecular weight RNA transcripts intermolecularly hybridize with eukaryotic 18S ribosomal RNAs.

    PubMed

    Trinh-Rohlik, Q; Maxwell, E S

    1988-07-11

    Previous work has reported the isolation and sequencing of a mouse low molecular weight RNA species designated 4.5S hybridizing RNA or hybRNA because of its ability to intermolecularly hybridize with mouse mRNA and 18S rRNA sequences. Using synthetic DNA oligonucleotide probes we have examined the conservation of this gene sequence and its expression as a lmwRNA transcript across evolution. Southern blot analysis has shown that homologous genes of single or low copy number are found in all eukaryotes examined as well as in E. coli. Northern blot analysis has demonstrated 4.5S hybRNA transcription in all mouse tissues as well as expression in yeast and Xenopus laevis as lmwRNAs of approximately 130 and 100 nucleotides, respectively, as compared with mouse/rat/hamster species of approximately 87 nucleotides. Yeast and X. laevis 4.5S hybRNA homologs, isolated by hybrid-selection, were shown by Northern blot analysis to intermolecularly hybridize with homologous as well as heterologous 18S rRNA sequences. The conservation of 4.5S hybRNA homologous genes and their expression as lmwRNA transcripts with common intermolecular RNA:RNA hybridization capabilities in fungi, amphibians, and mammals argues for a common, conserved and required biological function for this lmwRNA in all eukaryotes and potential utilization of its intermolecular RNA:RNA hybridization capabilities to carry out this function.

  1. Eukaryotic origins: string analysis of 5S ribosomal RNA sequences from some relevant organisms.

    PubMed

    Nanney, D L; Mobley, D O; Preparata, R M; Meyer, E B; Simon, E M

    1991-04-01

    Using the PHYLOGEN tree-forming programs, we evaluate the published 5S rRNA sequences in certain of the files in the Berlin DataBank in an attempt to identify the connection between archaebacteria and the eukaryotic protists. These programs are based on methods of string analysis developed by Sankoff and others. Their discriminatory power is derived from their continuous realignment of sequences through repeated assessment of insertions and deletions as well as substitutions. The programs demonstrate that even these small molecules (ca. 120 bases) retain substantial records of evolutionary events that occurred over a billion years ago. The eukaryotes seem to have been derived from ancestors near the common origins of the halobacterial and Methanococcales groups. Identifying what might have been a primordial eukaryote is more difficult because several of the species considered as early derivatives from the common root are isolated species with large genetic differences from each other and from all other extant forms that have been sequenced. The ameboid, flagellated, and ciliated protists seem to have emerged nearly simultaneously from an ancient cluster, but the sarcodinid protozoa have preference as the group of most ancient origin. The euglenozoa and the ciliates are of later derivation. Our ability to tease plausible trees from such small molecules suggests that the mode of analysis rather than the size of the molecule is often a major limitation in the reconstruction of acceptable ancient phylogenics.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Correct identification of species makes the amoebozoan rRNA tree congruent with morphology for the order Leptomyxida Page 1987; with description of Acramoeba dendroida n. g., n. sp., originally misidentified as 'Gephyramoeba sp.'.

    PubMed

    Smirnov, Alexey V; Nassonova, Elena S; Cavalier-Smith, Thomas

    2008-02-01

    Morphological identification of protists remains an expert task, especially for little known and poorly described species. Culture collections normally accept organisms under the name provided by depositors and are not responsible for identification. Uncritical acceptance of these names by molecular phylogeneticists may result in serious errors of interpretation of phylogenetic trees based on DNA sequences, making them appear more incongruent with morphology than they really are. Several cases of misidentification in a major culture collection have recently been reported. Here we provide evidence for misidentifications of two more gymnamoebae. The first concerns "Gephyramoeba sp." ATCC 50654; it is not Gephyramoeba, a leptomyxid with lobose pseudopods, but a hitherto undescribed branching amoeba with fine, filamentous subpseudopods named here Acramoeba dendroida gen. et sp. nov. We also sequenced 18S rRNA of Page's strain of Rhizamoeba saxonica (CCAP 1570/2) and show that it is the most deeply branching leptomyxid and is not phylogenetically close to 'Rhizamoeba saxonica' ATCC 50742, which was misidentified. Correcting these misidentifications improves the congruence between morphological diversity of Amoebozoa and their rRNA-based phylogenies, both for Leptomyxida and for the Acramoeba part of the tree. On morphological grounds we transfer Gephyramoebidae from Varipodida back to Leptomyxida and remove Flamella from Leptomyxida; sequences are needed to confirm these two revisions.

  3. rRNA operons and genome size of 'Candidatus Liberibacter americanus', a bacterium associated with citrus huanglongbing in Brazil.

    PubMed

    Wulff, N A; Eveillard, S; Foissac, X; Ayres, A J; Bové, J-M

    2009-08-01

    Huanglongbing is one of the most severe diseases of citrus worldwide and is associated with 'Candidatus (Ca.) Liberibacter africanus' in Africa, 'Ca. Liberibacter asiaticus' in Asia and the Americas (Brazil, USA and Cuba) and 'Ca. Liberibacter americanus' (Lam) in Brazil. In the absence of axenic cultures, genetic information on liberibacters is scarce. The sequences of the entire 23S rRNA and 5S rRNA genes from Lam have now been obtained, using a consensus primer designed on known tRNAMet sequences of rhizobia. The size of the Lam genome was determined by PFGE, using Lam-infected periwinkle plants for bacterial enrichment, and was found to be close to 1.31 Mbp. In order to determine the number of ribosomal operons on the Lam genome, probes designed to detect the 16S rRNA gene and the 3' end of the 23S rRNA gene were developed and used for Southern hybridization with I-CeuI-treated genomic DNA. Our results suggest that there are three ribosomal operons in a circular genome. Lam is the first liberibacter species for which such data are available.

  4. Towards a phylogeny of the genus Vibrio based on 16S rRNA sequences.

    PubMed

    Dorsch, M; Lane, D; Stackebrandt, E

    1992-01-01

    The inter- and intrageneric relationships of the genus Vibrio were investigated by performing a comparative analysis of the 16S rRNAs of 10 species, including four pathogenic representatives. The results of immunological and 5S rRNA studies were confirmed in that the genus is a neighboring taxon of the family Enterobacteriaceae. With regard to the intrageneric structure, Vibrio alginolyticus, Vibrio campbellii, Vibrio natriegens, Vibrio harveyi, Vibrio proteolyticus, Vibrio parahaemolyticus, and Vibrio vulnificus form the core of the genus, while Vibrio (Listonella) anguillarum, Vibrio diazotrophicus, and Vibrio hollisae are placed on the outskirts of the genus. Variable regions around positions 80, 180, and 450 could be used as target sites for genus- and species-specific oligonucleotide probes and polymerase chain reaction primers to be used in molecular identification.

  5. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  6. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    PubMed

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-01

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  7. 5 S and 5.8 S ribosomal RNA sequences and protist phylogenetics.

    PubMed

    Walker, W F

    1985-01-01

    More than 100 5 S 5.8 S rRNA sequences from protists, including fungi, are known. Through a combination of quantitative treeing and special consideration of "signature' nucleotide combinations, the most significant phylogenetic implications of these data are emphasized. Also, limitations of the data for phylogenetic inferences are discussed and other significant data are brought to bear on the inferences obtained. 5 S sequences from red algae are seen as the most isolated among eukaryotics. A 5 S sequence lineage consisting of oomycetes, euglenoids, most protozoa, most slime molds and perhaps dinoflagellates and mesozoa is defined. Such a lineage is not evident from 5.8 S rRNA or cytochrome c sequence data. 5 S sequences from Ascomycota and Basidiomycota are consistent with the proposal that each is derived from a mycelial form with a haploid yeast phase and simple septal pores, probably most resembling present Taphrinales. 5 S sequences from Chytridiomycota and Zygomycota are not clearly distinct from each other and suggest that a major lineage radiation occurred in the early history of each. Qualitative biochemical data clearly supports a dichotomy between an Ascomycota-Basidiomycota lineage and a Zygomycota-Chytridiomycota lineage.

  8. Generalized oscillator strengths for 5s, 5s{sup '}, and 5p excitations of krypton

    SciTech Connect

    Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing

    2003-06-01

    The absolute generalized oscillator strengths (GOSs) for 5s, 5s{sup '}, 5p [5/2]{sub 3,2}, 5p [3/2]{sub 1,2}, and 5p [1/2]{sub 0} transitions of krypton have been determined in a large K{sup 2} region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s{sup '} transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s{sup '} transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)].

  9. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    PubMed

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  10. Identification of Sex and Female's Reproductive Stage in Commercial Fish Species through the Quantification of Ribosomal Transcripts in Gonads.

    PubMed

    Rojo-Bartolomé, Iratxe; Diaz de Cerio, Oihane; Diez, Guzman; Cancio, Ibon

    2016-01-01

    The estimation of maturity and sex of fish stocks in European waters is a requirement of the EU Data Collection Framework as part of the policy to improve fisheries management. On the other hand, research on fish biology is increasingly focused in molecular approaches, researchers needing correct identification of fish sex and reproductive stage without necessarily having in house the histological know-how necessary for the task. Taking advantage of the differential gene transcription occurring during fish sex differentiation and gametogenesis, the utility of 5S ribosomal RNA (5S rRNA) and General transcription factor IIIA (gtf3a) in the molecular identification of sex and gametogenic stage was tested in different economically-relevant fish species from the Bay of Biscay. Gonads of 9 fish species (, Atlantic, Atlantic-chub and horse mackerel, blue whiting, bogue, European anchovy, hake and pilchard and megrim), collected from local commercial fishing vessels were histologically sexed and 5S and 18S rRNA concentrations were quantified by capillary electrophoresis to calculate a 5S/18S rRNA index. Degenerate primers permitted cloning and sequencing of gtf3a fragments in 7 of the studied species. 5S rRNA and gtf3a transcript levels, together with 5S/18S rRNA index, distinguished clearly ovaries from testis in all of the studied species. The values were always higher in females than in males. 5S/18S rRNA index values in females were always highest when fish were captured in early phases of ovary development whilst, in later vitellogenic stages, the values decreased significantly. In megrim and European anchovy, where gonads in different oogenesis stages were obtained, the 5S/18S rRNA index identified clearly gametogenic stage. This approach, to the sexing and the quantitative non-subjective identification of the maturity stage of female fish, could have multiple applications in the study of fish stock dynamics, fish reproduction and fecundity and fish biology in

  11. Identification of Sex and Female's Reproductive Stage in Commercial Fish Species through the Quantification of Ribosomal Transcripts in Gonads.

    PubMed

    Rojo-Bartolomé, Iratxe; Diaz de Cerio, Oihane; Diez, Guzman; Cancio, Ibon

    2016-01-01

    The estimation of maturity and sex of fish stocks in European waters is a requirement of the EU Data Collection Framework as part of the policy to improve fisheries management. On the other hand, research on fish biology is increasingly focused in molecular approaches, researchers needing correct identification of fish sex and reproductive stage without necessarily having in house the histological know-how necessary for the task. Taking advantage of the differential gene transcription occurring during fish sex differentiation and gametogenesis, the utility of 5S ribosomal RNA (5S rRNA) and General transcription factor IIIA (gtf3a) in the molecular identification of sex and gametogenic stage was tested in different economically-relevant fish species from the Bay of Biscay. Gonads of 9 fish species (, Atlantic, Atlantic-chub and horse mackerel, blue whiting, bogue, European anchovy, hake and pilchard and megrim), collected from local commercial fishing vessels were histologically sexed and 5S and 18S rRNA concentrations were quantified by capillary electrophoresis to calculate a 5S/18S rRNA index. Degenerate primers permitted cloning and sequencing of gtf3a fragments in 7 of the studied species. 5S rRNA and gtf3a transcript levels, together with 5S/18S rRNA index, distinguished clearly ovaries from testis in all of the studied species. The values were always higher in females than in males. 5S/18S rRNA index values in females were always highest when fish were captured in early phases of ovary development whilst, in later vitellogenic stages, the values decreased significantly. In megrim and European anchovy, where gonads in different oogenesis stages were obtained, the 5S/18S rRNA index identified clearly gametogenic stage. This approach, to the sexing and the quantitative non-subjective identification of the maturity stage of female fish, could have multiple applications in the study of fish stock dynamics, fish reproduction and fecundity and fish biology in

  12. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    PubMed Central

    2010-01-01

    Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s) occurring in 39.6% of the analyzed individuals (both male and female) were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH) was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs) enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement. PMID:20051104

  13. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules

    PubMed Central

    Valach, Matus; Burger, Gertraud; Gray, Michael W.; Lang, B. Franz

    2014-01-01

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. PMID:25429974

  14. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    PubMed

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator.

  15. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array.

  16. Chromosomal mapping of repetitive DNAs in Gobionellus oceanicus and G. stomatus (Gobiidae; Perciformes): A shared XX/XY system and an unusual distribution of 5S rDNA sites on the Y chromosome.

    PubMed

    Lima-Filho, Paulo A; Amorim, Karlla D J; Cioffi, Marcelo B; Bertollo, Luiz A C; Molina, Wagner F

    2014-01-01

    With nearly 2,000 species, Gobiidae is the most specious family of the vertebrates. This high level of speciation is accompanied by conspicuous karyotypic modifications, where the role of repetitive sequences remains largely unknown. This study analyzed the karyotype of 2 species of the genus Gobionellus and mapped 18S and 5S ribosomal RNA genes and (CA)15 microsatellite sequences onto their chromosomes. G. oceanicus (2n = 56; ♂ 12 metacentrics (m) + 4 submetacentrics (sm) + 1 subtelocentric (st) + 39 acrocentrics (a); ♀ 12m + 4sm + 2st + 38a) and G. stomatus (2n = 56; ♂ 20m + 14sm + 1st + 21a; ♀ 20m + 14sm + 2st + 20a) possess the highest diploid chromosome number among the Gobiidae and have different karyotypes. Both species share an XX/XY sex chromosome system with a large subtelocentric X and a small acrocentric Y chromosome which is rich in (CA)15 sequences and bears 5S rRNA sites. Although coding and noncoding repetitive DNA sequences may be involved in the genesis or differentiation of the sex chromosomes, the exclusive presence of 5S rDNA sites on the Y, but not on the X chromosome of both species, represents a novelty in fishes. In summary, the karyotypic differences, as well as new data on the sex chromosome systems in these 2 Gobiidae species, confirm the high chromosomal dynamism observed in this family.

  17. {upsilon}(5S) Results from CLEO

    SciTech Connect

    Pavlunin, Victor

    2006-07-11

    Using the CLEO detector at the Cornell Electron Storage Ring, we have observed the Bs meson in e+e- annihilation at the {upsilon}(5S) resonance. We have fully reconstructed 14 candidates consistent with Bs decays into final states with a J/{psi} or a D{sub s}{sup (*)-}. The probability that this is a background fluctuation is less than 8 x 10-10. We have established that Bs production proceeds predominantly through the creation of B{sub s}*B-bar{sub s}* pairs with {sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) =0[ .11{sub -0.03}{sup +0.04}(stat) {+-} 0.02(syst)] nb. The following limits are set: {sigma}(e{sup +}e{sup -} {yields} B{sub s}B-bar{sub s})/{sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) < 0.16 and [{sigma}(e{sup +}e{sup -} {yields} B{sub s}B-bar{sub s}*) + {sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s})]/{sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) < 0.16 (90% CL). In a separate analysis, by comparing production rates of D{sub s}{sup +} mesons in {upsilon}(5S) and {upsilon}(4S) decays, an estimate of the ratio of B{sub s}{sup (*)} B-bar{sub s}{sup (*)} to the total bb-bar quark pair production at the {upsilon}(5S) energy of (16 {+-} 3 {+-} 6)% is obtained.

  18. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    PubMed

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production.

  19. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    PubMed

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  20. Modified 16S-23S rRNA intergenic region restriction endonuclease analysis for species identification of Enterococcus strains isolated from pigs, compared with identification using classical methods and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    PubMed

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Zięba, Przemysław; Trościańczyk, Aleksandra; Banach, Tomasz; Kowalski, Cezary

    2015-03-01

    Fast and reliable identification of bacteria to at least the species level is currently the basis for correct diagnosis and appropriate treatment of infections. This is particularly important in the case of bacteria of the genus Enterococcus, whose resistance profile is often correlated with their species (e.g. resistance to vancomycin). In this study, we evaluated restriction endonuclease analysis of the 16S-23S rRNA gene intergenic transcribed spacer (ITS) region for species identification of Enterococcus. The utility of the method was compared with that of phenotypic methods [biochemical profile evaluation and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS)]. Identification was based on 21 Enterococcus reference strains, of the species E. faecalis, E. faecium, E. hirae, E. durans, E. casseliflavus, E. gallinarum, E. avium, E. cecorum and E. columbae, and 47 Enterococcus field strains isolated from pigs. Restriction endonuclease analysis of the ITS-PCR product using HinfI, RsaI and MboI, in the order specified, enabled species differentiation of the Enterococcus reference and field strains, and in the case of the latter, the results of species identification were identical (47/47) to those obtained by MALDI-TOF MS. Moreover, as a result of digestion with MboI, a unique restriction profile was also obtained for the strains (3/3) identified by MALDI-TOF MS as E. thailandicus. In our opinion, restriction endonuclease analysis of the 16S-23S rRNA gene ITS region of Enterococcus may be a simple and relatively fast (less than 4 h) alternative method for identifying the species occurring most frequently in humans and animals.

  1. Identification of Sex and Female’s Reproductive Stage in Commercial Fish Species through the Quantification of Ribosomal Transcripts in Gonads

    PubMed Central

    Rojo-Bartolomé, Iratxe; Diaz de Cerio, Oihane; Diez, Guzman; Cancio, Ibon

    2016-01-01

    The estimation of maturity and sex of fish stocks in European waters is a requirement of the EU Data Collection Framework as part of the policy to improve fisheries management. On the other hand, research on fish biology is increasingly focused in molecular approaches, researchers needing correct identification of fish sex and reproductive stage without necessarily having in house the histological know-how necessary for the task. Taking advantage of the differential gene transcription occurring during fish sex differentiation and gametogenesis, the utility of 5S ribosomal RNA (5S rRNA) and General transcription factor IIIA (gtf3a) in the molecular identification of sex and gametogenic stage was tested in different economically-relevant fish species from the Bay of Biscay. Gonads of 9 fish species (, Atlantic, Atlantic-chub and horse mackerel, blue whiting, bogue, European anchovy, hake and pilchard and megrim), collected from local commercial fishing vessels were histologically sexed and 5S and 18S rRNA concentrations were quantified by capillary electrophoresis to calculate a 5S/18S rRNA index. Degenerate primers permitted cloning and sequencing of gtf3a fragments in 7 of the studied species. 5S rRNA and gtf3a transcript levels, together with 5S/18S rRNA index, distinguished clearly ovaries from testis in all of the studied species. The values were always higher in females than in males. 5S/18S rRNA index values in females were always highest when fish were captured in early phases of ovary development whilst, in later vitellogenic stages, the values decreased significantly. In megrim and European anchovy, where gonads in different oogenesis stages were obtained, the 5S/18S rRNA index identified clearly gametogenic stage. This approach, to the sexing and the quantitative non-subjective identification of the maturity stage of female fish, could have multiple applications in the study of fish stock dynamics, fish reproduction and fecundity and fish biology in

  2. Novel Approach to Quantitative Detection of Specific rRNA in a Microbial Community, Using Catalytic DNA

    PubMed Central

    Suenaga, Hikaru; Liu, Rui; Shiramasa, Yuko; Kanagawa, Takahiro

    2005-01-01

    We developed a novel method for the quantitative detection of the 16S rRNA of a specific bacterial species in the microbial community by using deoxyribozyme (DNAzyme), which possesses the catalytic function to cleave RNA in a sequence-specific manner. A mixture of heterogeneous 16S rRNA containing the target 16S rRNA was incubated with a species-specific DNAzyme. The cleaved target 16S rRNA was separated from the intact 16S rRNA by electrophoresis, and then their amounts were compared for the quantitative detection of target 16S rRNA. This method was used to determine the abundance of the 16S rRNA of a filamentous bacterium, Sphaerotilus natans, in activated sludge, which is a microbial mixture used in wastewater treatment systems. The result indicated that this DNAzyme-based approach would be applicable to actual microbial communities. PMID:16085888

  3. The terminal balls characteristic of eukaryotic rRNA transcription units in chromatin spreads are rRNA processing complexes.

    PubMed

    Mougey, E B; O'Reilly, M; Osheim, Y; Miller, O L; Beyer, A; Sollner-Webb, B

    1993-08-01

    When spread chromatin is visualized by electron microscopy, active rRNA genes have a characteristic Christmas tree appearance: From a DNA "trunk" extend closely packed "branches" of nascent transcripts whose ends are decorated with terminal "balls." These terminal balls have been known for more than two decades, are shown in most biology textbooks, and are reported in hundreds of papers, yet their nature has remained elusive. Here, we show that a rRNA-processing signal in the 5'-external transcribed spacer (ETS) of the Xenopus laevis ribosomal primary transcript forms a large, processing-related complex with factors of the Xenopus oocyte, analogous to 5' ETS processing complexes found in other vertebrate cell types. Using mutant rRNA genes, we find that the same rRNA residues are required for this biochemically defined complex formation and for terminal ball formation, analyzed electron microscopically after injection of these cloned genes into Xenopus oocytes. This, plus other presented evidence, implies that rRNA terminal balls in Xenopus, and by inference, also in the multitude of other species where they have been observed, are the ultrastructural visualization of an evolutionarily conserved 5' ETS processing complex that forms on the nascent rRNA.

  4. Chromosomal organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the evolutionary dynamics of multigene families and heterochromatin

    PubMed Central

    2011-01-01

    Background Scarabaeinae beetles show a high level of macro-chromosomal variability, although the karyotypic organization of heterochromatin and multigene families (rDNAs and histone genes) is poorly understood in this group. To better understand the chromosomal organization and evolution in this group, we analyzed the karyotypes, heterochromatin distribution and chromosomal locations of the rRNAs and histone H3 genes in beetles belonging to eight tribes from the Scarabaeinae subfamily (Coleoptera, Scarabaeidae). Results The number of 18S rRNA gene (a member of the 45S rDNA unit) sites varied from one to 16 and were located on the autosomes, sex chromosomes or both, although two clusters were most common. Comparison of the 45S rDNA cluster number and the diploid numbers revealed a low correlation value. However, a comparison between the number of 45S rDNA sites per genome and the quantity of heterochromatin revealed (i) species presenting heterochromatin restricted to the centromeric/pericentromeric region that contained few rDNA sites and (ii) species with a high quantity of heterochromatin and a higher number of rDNA sites. In contrast to the high variability for heterochromatin and 45S rDNA cluster, the presence of two clusters (one bivalent cluster) co-located on autosomal chromosomes with the 5S rRNA and histone H3 genes was highly conserved. Conclusions Our results indicate that the variability of the 45S rDNA chromosomal clusters is not associated with macro-chromosomal rearrangements but are instead related to the spread of heterochromatin. The data obtained also indicate that both heterochromatin and the 45S rDNA loci could be constrained by similar evolutionary forces regulating spreading in the distinct Scarabaeinae subfamily lineages. For the 5S rRNA and the histone H3 genes, a similar chromosomal organization could be attributed to their association/co-localization in the Scarabaeinae karyotypes. These data provide evidence that different evolutionary

  5. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status.

  6. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. PMID:23933480

  7. Molecular organization of the 5S rDNA gene type II in elasmobranchs

    PubMed Central

    Castro, Sergio I.; Hleap, Jose S.; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    ABSTRACT The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  8. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  9. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.

    2016-01-01

    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  10. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  11. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  12. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  13. The nucleotide sequences of 5S rRNAs from a sea-cucumber, a starfish and a sea-urchin.

    PubMed Central

    Ohama, T; Hori, H; Osawa, S

    1983-01-01

    The nucleotide sequences of 5S rRNA from three echinoderms, a sea-cucumber Stichopus oshimae, a starfish Asterina pectinifera and a sea-urchin Hemicentrotus pulcherrimus have been determined. These 5S rRNAs are all 120 nucleotides long. The echinoderm sequences are more related to the sequences of proterostomes animals such as mollusc, annelids and some others (87% identity on average) than to those of vertebrates (82% identity on average). PMID:6878041

  14. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  15. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  16. Evaluation of genetic markers from the 16S rRNA gene V2 region for use in quantitative detection of selected Bacteroidales species and human fecal waste by real time PCR

    EPA Science Inventory

    Molecular methods for rapidly quantifying defined Bacteroidales species from the human gastrointestinal tract may have important clinical and environmental applications, ranging from diagnosis of infections to fecal source tracking in surface waters. In this study, sequences from...

  17. Strategies used by pathogenic and nonpathogenic mycobacteria to synthesize rRNA.

    PubMed Central

    Gonzalez-y-Merchand, J A; Garcia, M J; Gonzalez-Rico, S; Colston, M J; Cox, R A

    1997-01-01

    One rRNA operon of all mycobacteria studied so far is located downstream from a gene thought to code for the enzyme UDP-N-acetylglucosamine carboxyvinyl transferase (UNAcGCT), which is important to cell wall synthesis. This operon has been designated rrnAf for fast-growing mycobacteria and rrnAs for slow growers. We have investigated the upstream sequences and promoter activities of rrnA operons of typical fast growers which also possess a second rrn (rrnBf) operon and of the rrnA operons of the fast growers Mycobacterium abscessus and Mycobacterium chelonae, which each have a single rrn operon per genome. These fast growers have a common strategy for increasing the efficiency of transcription of their rrnA operons, thereby increasing the cells' potential for ribosome synthesis. This strategy involves the use of multiple (three to five) promoters which may have arisen through successive duplication events. Thus we have identified a hypervariable multiple promoter region (HMPR) located between the UNAcGCT gene and the 16S rRNA coding region. Two promoters, P1 and PCL1, appear to play pivotal roles in mycobacterial rRNA synthesis; they are present in all of the species examined and are the only promoters used for rRNA synthesis by the pathogenic slow growers. P1 is located within the coding region of the UNAcGCT gene, and PCL1 has a characteristic sequence that is related to but distinct from that of the additional promoters. In fast-growing species, P1 and PCL1 produce less than 10% of rRNA transcripts, so the additional promoters found in the HMPR are important in increasing the potential for rRNA synthesis during rapid growth. In contrast, rrnB operons appear to be regulated by a single promoter; because less divergence has taken place, rrnB appears to be younger than rrnA. PMID:9371439

  18. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  19. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  20. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  1. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  2. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    PubMed

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  3. Ultraviolet damage and nucleosome folding of the 5S ribosomal RNA gene.

    SciTech Connect

    Liu, X; Mann, David B.; Suquet, C; Springer, David L. ); Smerdon, Michael J.

    2000-01-25

    The Xenopus borealis somatic 5S ribosomal RNA gene was used as a model system to determine the mutual effects of nucleosome folding and formation of ultraviolet (UV) photoproducts (primarily cis-syn cyclobutane pyrimidine dimers, or CPDs) in chromatin. We analyzed the preferred rotational and translational settings of 5S rDNA on the histone octamer surface after induction of up to 0.8 CPD/nucleosome core (2.5 kJ/m(2) UV dose). DNase I and hydroxyl radical footprints indicate that UV damage at these levels does not affect the average rotational setting of the 5S rDNA molecules. Moreover, a combination of nuclease trimming and restriction enzyme digestion indicates the preferred translational positions of the histone octamer are not affected by this level of UV damage. We also did not observe differences in the UV damage patterns of irradiated 5S rDNA before or after nucleosome formation, indicating there is little difference in the inhibition of nucleosome folding by specific CPD sites in the 5S rRNA gene. Conversely, nucleosome folding significantly restricts CPD formation at all sites in the three helical turns of the nontranscribed strand located in the dyad axis region of the nucleosome, where DNA is bound exclusively by the histone H3-H4 tetramer. Finally, modulation of the CPD distribution in a 14 nt long pyrimidine tract correlates with its rotational setting on the histone surface, when the strong sequence bias for CPD formation in this tract is minimized by normalization. These results help establish the mutual roles of histone binding and UV photoproducts on their formation in chromatin.

  4. Direct detection of 16S rRNA in soil extracts by using oligonucleotide microarrays.

    PubMed

    Small, J; Call, D R; Brockman, F J; Straub, T M; Chandler, D P

    2001-10-01

    We report on the development and validation of a simple microarray method for the direct detection of intact 16S rRNA from unpurified soil extracts. Total RNAs from Geobacter chapellei and Desulfovibrio desulfuricans were hybridized to an oligonucleotide array consisting of universal and species-specific 16S rRNA probes. PCR-amplified products from Geobacter and Desulfovibrio were easily and specifically detected under a range of hybridization times, temperatures, and buffers. However, reproducible, specific hybridization and detection of intact rRNA could be accomplished only by using a chaperone-detector probe strategy. With this knowledge, assay conditions were developed for rRNA detection using a 2-h hybridization time at room temperature. Hybridization specificity and signal intensity were enhanced using fragmented RNA. Formamide was required in the hybridization buffer in order to achieve species-specific detection of intact rRNA. With the chaperone detection strategy, we were able to specifically hybridize and detect G. chapellei 16S rRNA directly from a total-RNA soil extract, without further purification or removal of soluble soil constituents. The detection sensitivity for G. chapellei 16S rRNA in soil extracts was at least 0.5 microg of total RNA, representing approximately 7.5 x 10(6) Geobacter cell equivalents of RNA. These results suggest that it is now possible to apply microarray technology to the direct detection of microorganisms in environmental samples, without using PCR. PMID:11571176

  5. Sequence arrangement of the rRNA genes of the dipteran Sarcophaga bullata.

    PubMed

    French, C K; Fouts, D L; Manning, J E

    1981-06-11

    Velocity sedimentation studies of RNA of Sarcophaga bullata show that the major rRNA species have sedimentation values of 26S and 18S. Analysis of the rRNA under denaturing conditions indicates that there is a hidden break centrally located in the 26S rRNA species. Saturation hybridization studies using total genomic DNA and rRNA show that 0.08% of the nuclear DNA is occupied by rRNA coding sequences and that the average repetition frequency of these coding sequences is approximately 144. The arrangement of the rRNA genes and their spacer sequences on long strands of purified rDNA was determined by the examination of the structure of rRNa:DNA hybrids in the electron microscope. Long DNA strands contain several gene sets (18S + 26S) with one repeat unit containing the following sequences in order given: (a) An 18S gene of length 2.12 kb, (b) an internal transcribed spacer of length 2.01 kb, which contains a short sequence that may code for a 5.8S rRNA, (c) A 26S gene of length 4.06 kb which, in 20% of the cases, contains an intron with an average length of 5.62 kb, and (d) an external spacer of average length of 9.23 kb.

  6. Higher-order structure of rRNA

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  7. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  8. Comparative cytogenetic analysis of Avena macrostachya and diploid C-genome Avena species.

    PubMed

    Badaeva, Ekaterina D; Shelukhina, Olga Yu; Diederichsen, Axel; Loskutov, Igor G; Pukhalskiy, Vitaly A

    2010-02-01

    The chromosome set of Avena macrostachya Balansa ex Coss. et Durieu was analyzed using C-banding and fluorescence in situ hybridization with 5S and 18S-5.8S-26S rRNA gene probes, and the results were compared with the C-genome diploid Avena L. species. The location of major nucleolar organizer regions and 5S rDNA sites on different chromosomes confirmed the affiliation of A. macrostachya with the C-genome group. However, the symmetric karyotype, the absence of "diffuse heterochromatin" and the location of large C-band complexes in proximal chromosome regions pointed to an isolated position of A. macrostachya from other Avena species. Based on the distribution of rDNA loci on the C-genome chromosomes of diploid and polyploid Avena species, we propose a model of the chromosome alterations that occurred during the evolution of oat species.

  9. Ribosomal protein-dependent orientation of the 16 S rRNA environment of S15.

    PubMed

    Jagannathan, Indu; Culver, Gloria M

    2004-01-30

    Ribosomal protein S15 binds specifically to the central domain of 16 S ribosomal RNA (16 S rRNA) and directs the assembly of four additional proteins to this domain. The central domain of 16 S rRNA along with these five proteins form the platform of the 30 S subunit. Previously, directed hydroxyl radical probing from Fe(II)-S15 in small ribonucleoprotein complexes was used to study assembly of the central domain of 16 S rRNA. Here, this same approach was used to understand the 16 S rRNA environment of Fe(II)-S15 in 30 S subunits and to determine the ribosomal proteins that are involved in forming the mature S15-16 S rRNA environment. We have identified additional sites of Fe(II)-S15-directed cleavage in 30S subunits compared to the binary complex of Fe(II)-S15/16 S rRNA. Along with novel targets in the central domain, sites within the 5' and 3' minor domains are also cleaved. This suggests that during the course of 30S subunit assembly these elements are positioned in the vicinity of S15. Besides the previously determined role for S8, roles for S5, S6+S18, and S16 in altering the 16 S rRNA environment of S15 were established. These studies reveal that ribosomal proteins can alter the assembly of regions of the 30 S subunit from a considerable distance and influence the overall conformation of this ribonucleoprotein particle.

  10. Molecular cloning and characterization of an rRNA operon in Streptomyces lividans TK21.

    PubMed Central

    Suzuki, Y; Ono, Y; Nagata, A; Yamada, T

    1988-01-01

    The number of rRNA genes in Streptomyces lividans was examined by Southern hybridization. Randomly labeled 23 and 16S rRNAs were hybridized with BamHI, BglII, PstI, SalI, or XhoI digests of S. lividans TK21 DNA. BamHi, BglII, SalI and XhoI digests yielded six radioactive bands each for the 23 and 16S rRNAs, whereas PstI digests gave one band for the 23S rRNA and one high-intensity band and six low-density bands for the 16S rRNA. The 7.4-kilobase-pair BamHI fragment containing one of the rRNA gene clusters was cloned into plasmid pBR322. The hybrid plasmid, pSLTK1, was characterized by physical mapping, Southern hybridization, and electron microscopic analysis of the R loops formed between pSLTK1 and the 23 and 16S rRNAs. There were at least six rRNA genes in S. lividans TK21. The 16 and 23S rRNA genes were estimated to be about 1.40 and 3.17 kilobase pairs, respectively. The genes for the rRNAs were aligned in the sequence 16S-23S-5S. tRNA genes were not found in the spacer region or in the context of the rRNA genes. The G + C content of the spacer region was calculated to be approximately 58%, in contrast to 73% for the chromosome as a whole. Images PMID:2832372

  11. [Comparative cytogenetic analysis of hexaploid Avena L. species].

    PubMed

    Badaeva, E D; Shelukhina, O Iu; Dedkova, O S; Loskutov, I G; Pukhal'skiĭ, V A

    2011-06-01

    Using C-banding method and in situ hybridization with the 45S and 5S rRNA gene probes, six hexaploid species of the genus Avena L. with the ACD genome constitution were studied to reveal evolutionary karyotypic changes. Similarity in the C-banding patterns of chromosomal and in the patterns of distribution of the rRNA gene families suggests a common origin of all hexaploid species. Avena fatua is characterized by the broadest intraspecific variation of the karyotype; this species displays chromosomal variants typical of other hexaploid species of Avena. For instance, a translocation with the involvement of chromosome 5C marking A. occidentalis was discovered in many A. fatua accessions, whereas in other representatives of this species this chromosome is highly similar to the chromosome of A. sterilis. Only A. fatua and A. sativa show slight changes in the morphology and in the C-banding pattern of chromosome 2C. These results can be explained either by a hybrid origin of A. fatua or by the fact that this species is an intermediate evolutionary form of hexaploid oats. The 7C-17 translocation was identified in all studied accessions of wild and weedy species (A. sterilis, A. fatua, A. ludoviciana, and A. occidentalis) and in most A. sativa cultivars, but it was absent in A. byzantina and in two accessions of A. sativa. The origin and evolution of the Avena hexaploid species are discussed in context of the results.

  12. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  13. Dynamics and rRNA transcriptional activity of lactococci and lactobacilli during Cheddar cheese ripening.

    PubMed

    Desfossés-Foucault, Émilie; LaPointe, Gisèle; Roy, Denis

    2013-08-16

    Cheddar cheese is a complex ecosystem where both the bacterial population and the cheese making process contribute to flavor and texture development. The aim of this study was to use molecular methods to evaluate the impact of milk heat treatment and ripening temperature on starter lactococci and non-starter lactic acid bacteria (NSLAB) throughout ripening of Cheddar cheese. Eight Cheddar cheese batches were manufactured (four with thermized and four with pasteurized milk) and ripened at 4, 7 and 12°C to analyze the bacterial composition and rRNA transcriptional activity reflecting the ability of lactococci and lactobacilli to synthesize proteins. Abundance and rRNA transcription of lactococci and lactobacilli were quantified after DNA and RNA extraction by using quantitative PCR (qPCR) and reverse transcription-quantitative PCR (RT-qPCR) targeting the 16S rRNA gene, respectively. Results showed that lactococci remained dominant throughout ripening, although 16S rRNA genome and cDNA copies/g of cheese decreased by four and two log copy numbers, respectively. Abundance and rRNA transcription of Lactobacillus paracasei, Lactobacillus buchneri/parabuchneri, Lactobacillus rhamnosus, Lactobacillus brevis, and Lactobacillus coryniformis as well as total lactobacilli were also estimated using specific 16S rRNA primers. L. paracasei and L. buchneri/parabuchneri concomitantly grew in cheese made from thermized milk at 7 and 12°C, although L. paracasei displayed the most rRNA transcription among Lactobacillus species. This work showed that rRNA transcriptional activity of lactococci decreased throughout ripening and supports the usefulness of RNA analysis to assess which bacterial species have the ability to synthesize proteins during ripening, and could thereby contribute to cheese quality. PMID:23850855

  14. Chromosome-specific NOR inactivation explains selective rRNA gene silencing and dosage control in Arabidopsis

    PubMed Central

    Chandrasekhara, Chinmayi; Mohannath, Gireesha; Blevins, Todd; Pontvianne, Frederic; Pikaard, Craig S.

    2016-01-01

    In eukaryotes, scores of excess ribosomal RNA (rRNA) genes are silenced by repressive chromatin modifications. Given the near sequence identity of rRNA genes within a species, it is unclear how specific rRNA genes are reproducibly chosen for silencing. Using Arabidopsis thaliana ecotype (strain) Col-0, a systematic search identified sequence polymorphisms that differ between active and developmentally silenced rRNA gene subtypes. Recombinant inbred mapping populations derived from three different ecotype crosses were then used to map the chromosomal locations of silenced and active RNA gene subtypes. Importantly, silenced and active rRNA gene subtypes are not intermingled. All silenced rRNA gene subtypes mapped to the nucleolus organizer region (NOR) on chromosome 2 (NOR2). All active rRNA gene subtypes mapped to NOR4. Using an engineered A. thaliana line in which a portion of Col-0 chromosome 4 was replaced by sequences of another ecotype, we show that a major rRNA gene subtype silenced at NOR2 is active when introgressed into the genome at NOR4. Collectively, these results reveal that selective rRNA gene silencing is not regulated gene by gene based on mechanisms dependent on subtle gene sequence variation. Instead, we propose that a subchromosomal silencing mechanism operates on a multimegabase scale to inactivate NOR2. PMID:26744421

  15. Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group.

    SciTech Connect

    Bayvkin, S. G.; Lysov, Y. P.; Zakhariev, V.; Kelly, J. J.; Jackman, J.; Stahl, D. A.; Cherni, A.; Engelhardt Inst. of Molecular Biology; Loyola Univ.; Johns Hopkins Univ.; Univ. of Washington

    2004-08-01

    In order to determine if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30 gyrB sequences for B. cereus group strains with published 16S rRNA sequences. Our findings indicated that the three most common species of the B. cereus group, B. cereus, Bacillus thuringiensis, and Bacillus mycoides, were each heterogeneous in all three gene sequences, while all analyzed strains of Bacillus anthracis were found to be homogeneous. Based on analysis of 16S and 23S rRNA sequence variations, the microorganisms within the B. cereus group were divided into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, and these seven subgroups were further organized into two distinct clusters. This classification of the B. cereus group conflicts with current taxonomic groupings, which are based on phenotypic traits. The presence of B. cereus strains in six of the seven subgroups and the presence of B. thuringiensis strains in three of the subgroups do not support the proposed unification of B. cereus and B. thuringiensis into one species. Analysis of the available phenotypic data for the strains included in this study revealed phenotypic traits that may be characteristic of several of the subgroups. Finally, our results demonstrated that rRNA and gyrB sequences may be used for discriminating B. anthracis from other microorganisms in the B. cereus group.

  16. High-Resolution Infrared Spectroscopy of Carbon-Sulfur Chains: II. C_5S and SC_5S

    NASA Astrophysics Data System (ADS)

    Thorwirth, Sven; Salomon, Thomas; Dudek, John B.

    2016-06-01

    Unbiased high-resolution infrared survey scans of the ablation products from carbon-sulfur targets in the 2100 to 2150 cm-1 regime reveal two bands previously not observed in the gas phase. On the basis of comparison against laboratory matrix-isolation work and new high-level quantum-chemical calculations these bands are attributed to the linear C_5S and SC_5S clusters. While polar C_5S was studied earlier using Fourier-transform microwave techniques, the present work marks the first gas-phase spectroscopic detection of SC_5S. H. Wang, J. Szczepanski, P. Brucat, and M. Vala 2005, Int. J. Quant. Chem. 102, 795 Y. Kasai, K. Obi, Y. Ohshima, Y. Hirahara, Y. Endo, K. Kawaguchi, and A. Murakami 1993, ApJ 410, L45 V. D. Gordon, M. C. McCarthy, A. J. Apponi, and P. Thaddeus 2001, ApJS 134, 311

  17. Chromosomal localization of 18S and 5S rDNA using FISH in the genus Tor (Pisces, Cyprinidae).

    PubMed

    Singh, Mamta; Kumar, Ravindra; Nagpure, N S; Kushwaha, B; Gond, Indramani; Lakra, W S

    2009-12-01

    Dual color fluorescence in situ hybridization (FISH) was performed to study the simultaneous chromosomal localization of 18S and 5S ribosomal genes in the genus Tor for the first time. The 18S and 5S rDNAs in four Tor species were amplified, sequenced and mapped on the metaphase chromosomes. The number and distribution of 18S and 5S rDNA clusters were examined on metaphase chromosome spreads using FISH. The specimens of T. chelynoides, T. putitora and T. progeneius showed six bright fluorescent signals of 18S rDNA and T. tor exhibited ten such signals. The 5S rDNA signals were present only on one pair of chromosomes in all the four Tor species. Ag-NORs were observed on two pairs of chromosomes in T. chelynoides, T. putitora, T. progeneius and four pairs in T. tor. Comparison of the observed 18S rDNA FISH signals and Ag-NORs strongly suggested a possible inactivation of NORs localized at the telomeres of a subtelocentric and telocentric chromosome pairs in all four species. The 5S rDNA contained an identical 120 bp long coding region and 81 bp long highly divergent non-transcribed spacers in all species examined. 18S and 5S rDNA sequencing and chromosomal localization can be a useful genetic marker in species identification as well as phylogenetic and evolutionary studies.

  18. Chromosome mapping of 18S rDNA and 5S rDNA by dual-color fluorescence in situ hybridization in the half-smooth tongue sole (Cynoglossus semilaevis).

    PubMed

    Jiang, L; Jiang, J; Liu, J; Yuan, J; Chen, Y; Zhang, Q; Wang, X

    2014-12-18

    Half-smooth tongue sole (Cynoglossus semilaevis) is an important aquaculture flatfish in China. Cytogenetic analysis has revealed that its sex determination system is female heterogametic (ZZ/ZW). The W chromosome is morphologically larger and has been considered evolutionarily younger than any other chromosome in the set. However, the genetic origin and evolution process of this neo-chromosome remains unclear. In this study, 2 tandem arrays of rRNA genes were chosen to address this question. Both the major rDNA (18S rDNA) and the minor rDNA (5S rDNA) were located on the C. semilaevis chromosomes by fluorescence in situ hybridization (FISH). Six 18S rDNA signals were observed on the centromeric regions of 3 pairs of autosomes in both males and females. In females, there was an additional 18S rDNA signal mapping to the telomeric region of the W chromosome long arm. With respect to the 5S rDNA, 12 signals were mapped to the centromeric regions of six pairs of autosomes. Two-color FISH further confirmed that the two pairs of the 5S rDNA signals were correspondingly located at the same positions of the same autosomes as those of the 18S rDNA signals. These results allowed us to speculate about the evolution process of the W chromosome. Chromosome fusions and repetitive sequence accumulations might have occurred in C. semilaevis. The synteny and non-synteny of C. semilaevis 18S rDNA and 5S rDNA might imply the original and evolutionary characteristics of this species. These findings will facilitate studies on karyotype evolution of the order Pleuronectiformes.

  19. Enterococcus faecium PBP5-S/R, the missing link between PBP5-S and PBP5-R.

    PubMed

    Pietta, Ester; Montealegre, Maria Camila; Roh, Jung Hyeob; Cocconcelli, Pier Sandro; Murray, Barbara E

    2014-11-01

    During a study to investigate the evolution of ampicillin resistance in Enterococcus faecium, we observed that a number of E. faecium strains, mainly from the recently described subclade A2, showed PBP5 sequences in between PBP5-S and PBP5-R. These hybrid PBP5-S/R patterns reveal a progression of amino acid changes from the S form to the R form of this protein; however, these changes do not strictly correlate with changes in ampicillin MICs.

  20. TFIIIA binds to different domains of 5S RNA and the Xenopus borealis 5S RNA gene.

    PubMed Central

    Sands, M S; Bogenhagen, D F

    1987-01-01

    We have established the conditions for the reassociation of 5S RNA and TFIIIA to form 7S particles. We tested the ability of altered 5S RNAs to bind TFIIIA, taking advantage of the slower mobility of 7S particles compared with free 5S RNA in native polyacrylamide gels. Linker substitution mutants were constructed encompassing the entire gene, including the intragenic control region. In vitro transcripts of the linker substitution mutants were tested for their ability to bind TFIIIA to form 7S ribonucleoprotein particles. Altered 5S RNAs with base changes in or around helices IV and V, which would interfere with the normal base pairing of that region, showed decreased ability to bind TFIIIA. The transcripts of some mutant genes that were efficiently transcribed (greater than 50% of wild-type efficiency) failed to bind TFIIIA in this gel assay. In contrast, the RNA synthesized from a poorly transcribed mutant, LS 86/97, in which residues 87 to 96 of the RNA were replaced in the single-stranded loop at the base of helix V, bound TFIIIA well. The data indicate that TFIIIA binds to different domains in the 5S RNA gene and 5S RNA. Images PMID:3431548

  1. Analysis of 5S rDNA organization and variation in polyploid hybrids from crosses of different fish subfamilies.

    PubMed

    Qin, Qinbo; He, Weiguo; Liu, Shaojun; Wang, Jing; Xiao, Jun; Liu, Yun

    2010-07-15

    In this article, sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) were conducted in red crucian carp (RCC), blunt snout bream (BSB), and their polyploid offspring. Three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) of RCC were characterized by distinct NTS types (designated NTS-I, II, and III for the 83, 220, and 357 bp monomers, respectively). In BSB, only one monomeric 5S rDNA was observed (designated class IV: 188 bp), which was characterized by one NTS type (designated NTS-IV: 68 bp). In the polyploid offspring, the tetraploid (4nRB) hybrids partially inherited 5S rDNA classes from their female parent (RCC); however, they also possessed a unique 5S rDNA sequence (designated class I-L: 203 bp) with a novel NTS sequence (designated NTS-I-L: 83 bp). The characteristic paternal 5S rDNA sequences (class IV) were not observed. The 5S rDNA of triploid (3nRB) hybrids was completely inherited from the parental species, and generally preserved the parental 5S rDNA structural organization. These results first revealed the influence of polyploidy on the organization and evolution of the multigene family of 5S rDNA of fish, and are also useful in clarifying aspects of vertebrate genome evolution.

  2. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  3. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    PubMed

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  4. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    PubMed

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  5. Molecular relationships between closely related strains and species of nematodes

    NASA Technical Reports Server (NTRS)

    Butler, M. H.; Wall, S. M.; Luehrsen, K. R.; Fox, G. E.; Hecht, R. M.

    1981-01-01

    Electrophoretic comparisons have been made for 24 enzymes in the Bergerac and Bristol strains of Caenorhabditis elegans and the related species, Caenorhabditis briggsae. No variation was detected between the two strains of C. elegans. In contrast, the two species, C. elegans and C. briggsae exhibited electrophoretic differences in 22 of 24 enzymes. A consensus 5S rRNA sequence was determined for C. elegans and found to be identical to that from C. briggsae. By analogy with other species with relatively well established fossil records it can be inferred that the time of divergence between the two nematode species is probably in the tens of millions of years. The limited anatomical evolution during a time period in which proteins undergo extensive changes supports the hypothesis that anatomical evolution is not dependent on overall protein changes.

  6. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  7. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  8. L5-S1 Laparoscopic Anterior Interbody Fusion

    PubMed Central

    Zeni, Tallal M.; Phillips, Frank M.; Mathur, Sameer; Zografakis, John G.; Moore, Ronald M.; Laguna, Luis E.

    2006-01-01

    Objective: We evaluated our experience with laparoscopic L5-S1 anterior lumbar interbody fusion (ALIF). Methods: This represents a retrospective analysis of consecutive patients who underwent L5-S1 laparoscopic ALIF between February 1998 and August 2003. Results: Twenty-eight patients underwent L5-S1 LAIF (15 males and 13 females). The mean age was 43 years (range, 26 to 67). Mean operative time was 225 minutes (range, 137 to 309 minutes). No conversions to an open procedure were necessary. Twenty-four (85.7%) patients underwent successful bilateral cage placement. Four patients (14.3%) in whom only a single cage could be placed underwent supplementary posterior pedicle screw placement. Mean length of stay (LOS) was 4.1 days (range, 2 to 15). Two patients underwent reoperation subacutely secondary to symptomatic lateral displacement of the cage. One patient developed radiculopathy 6 months postoperatively and required reoperation. One patient developed a small bowel obstruction secondary to adhesions to the cage requiring laparoscopic reoperation. Fusion was achieved in all patients. Visual analogue scale scores for back pain were significantly improved from 8.6±0.8 to 2.8±0.8 (P<0.0001) at 1 year. Conclusion: L5-S1 LAIF is feasible and safe with all the advantages of minimally invasive surgery. Fusion rates and pain improvement were comparable to those with an open repair. PMID:17575763

  9. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  10. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron.

    PubMed Central

    MacKay, R M; Salgado, D; Bonen, L; Stackebrandt, E; Doolittle, W F

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are (formula: see text), respectively. Specific phylogenetic relationships of P. denitrificans with purple non-sulphur bacteria, and of Prochloron with cyanobacteria are demonstrated, and unique features of potential secondary structure are described. PMID:7099971

  11. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.

    PubMed

    Rozier, C; Mache, R

    1984-10-11

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  12. Sequence and phylogenetic analysis of SSU rRNA gene of five microsporidia.

    PubMed

    Dong, ShiNan; Shen, ZhongYuan; Xu, Li; Zhu, Feng

    2010-01-01

    The complete small subunit rRNA (SSU rRNA) gene sequences of five microsporidia including Nosema heliothidis, and four novel microsporidia isolated from Pieris rapae, Phyllobrotica armta, Hemerophila atrilineata, and Bombyx mori, respectively, were obtained by PCR amplification, cloning, and sequencing. Two phylogenetic trees based on SSU rRNA sequences had been constructed by using Neighbor-Joining of Phylip software and UPGMA of MEGA4.0 software. The taxonomic status of four novel microsporidia was determined by analysis of phylogenetic relationship, length, G+C content, identity, and divergence of the SSU rRNA sequences. The results showed that the microsporidia isolated from Pieris rapae, Phyllobrotica armta, and Hemerophila atrilineata have close phylogenetic relationship with the Nosema, while another microsporidium isolated from Bombyx mori is closely related to the Endoreticulatus. So, we temporarily classify three novel species of microsporidia to genus Nosema, as Nosema sp. PR, Nosema sp. PA, Nosema sp. HA. Another is temporarily classified into genus Endoreticulatus, as Endoreticulatus sp. Zhenjiang. The result indicated as well that it is feasible and valuable to elucidate phylogenetic relationships and taxonomic status of microsporidian species by analyzing information from SSU rRNA sequences of microsporidia. PMID:19768503

  13. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection

    PubMed Central

    2011-01-01

    Background The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. Results The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. Conclusions These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection. PMID:22004418

  14. Functional domains of the Xenopus laevis 5S gene promoter.

    PubMed Central

    Pieler, T; Oei, S L; Hamm, J; Engelke, U; Erdmann, V A

    1985-01-01

    To study the fine structure of the Xenopus laevis somatic 5S gene internal control region, we have created 15 different transversions using mutagenic oligonucleotide primers. The effects of these mutations on 5S DNA transcription in vitro as well as on stable complex formation with transcription factor TF III A and TF III C in crude nuclear extracts were analyzed. Mutations in the common class III 5' promoter element (nucleotides 50-61 in the 5S gene) interfere with transcription activity and stable complex formation whenever they contradict the tDNA box A consensus sequence. The second promoter element is defined by a major sequence block (nucleotides 80-89, box C) and two additional internal residues (70 and 71) at a distance of roughly one helical turn from both the major 3' and 5' control sequences; these two 3' elements contain the primary TF III A binding domain. The remaining nucleotides (62-69 and 71-79) when mutated do not interfere with transcription activity or factor binding and thus they constitute two spacer elements within a symmetrically structured 5S gene promoter. An increase in the relative spacing of box A and box C by insertion of 3 bp between nucleotides 66 and 67 leads to a drastic reduction in transcription activity and the ability to form a stable complex with TF III A and/or TF III C. Thus, accurate spacing is essential for the proper orientation of TF III A on 5S DNA and/or TF III C binding. Images Fig. 1. Fig. 3. Fig. 4. PMID:3004969

  15. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples. PMID:25343859

  16. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples.

  17. Chromosomal mapping of rRNA genes, core histone genes and telomeric sequences in Brachidontes puniceus and Brachidontes rodriguezi (Bivalvia, Mytilidae)

    PubMed Central

    2010-01-01

    Background Chromosome rearrangements are an important part of the speciation process in many taxa. The study of chromosome evolution in bivalves is hampered by the absence of clear chromosomal banding patterns and the similarity in both chromosome size and morphology. For this reason, obtaining good chromosome markers is essential for reliable karyotypic comparisons. To begin this task, the chromosomes of the mussels Brachidontes puniceus and B. rodriguezi were studied by means of fluorochrome staining and fluorescent in situ hybridization (FISH). Results Brachidontes puniceus and B. rodriguezi both have 2n = 32 chromosomes but differing karyotype composition. Vertebrate-type telomeric sequences appear at both ends of every single chromosome. B. puniceus presents a single terminal major rRNA gene cluster on a chromosome pair while B. rodriguezi shows two. Both mussels present two 5S rDNA and two core histone gene clusters intercalary located on the long arms of two chromosome pairs. Double and triple-FISH experiments demonstrated that one of the 5S rDNA and one of the major rDNA clusters appear on the same chromosome pair in B. rodriguezi but not in B. puniceus. On the other hand, the second 5S rDNA cluster is located in one of the chromosome pairs also bearing one of the core histone gene clusters in the two mussel species. Conclusion Knowledge of the chromosomal distribution of these sequences in the two species of Brachidontes is a first step in the understanding of the role of chromosome changes on bivalve evolution. PMID:21143946

  18. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  19. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells

    PubMed Central

    Cao, Weibiao

    2016-01-01

    Mechanisms of the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA. PMID:26901778

  20. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes.

    PubMed

    Soni, Dharmendra Kumar; Dubey, Suresh Kumar

    2014-12-01

    The discrimination between Listeria monocytogenes and Listeria species has been detected. The 16S rRNA and hlyA were PCR amplified with set of oligonucleotide primers with flank 1,500 and 456 bp fragments, respectively. Based on the differences in 16S rRNA and hlyA genes, a total 80 isolates from different environmental, food and clinical samples confirmed it to be L. monocytogenes. The 16S rRNA sequence similarity suggested that the isolates were similar to the previously reported ones from different habitats by others. The phylogenetic interrelationships of the genus Listeria were investigated by sequencing of 16S rRNA and hlyA gene. The 16S rRNA sequence indicated that genus Listeria is comprised of following closely related but distinct lines of descent, one is the L. monocytogenes species group (including L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) and other, the species L. grayi, L. rocourtiae and L. fleischmannii. The phylogenetic tree based on hlyA gene sequence clearly differentiates between the L. monocytogenes, L. ivanovii and L. seeligeri. In the present study, we identified 80 isolates of L. monocytogenes originating from different clinical, food and environmental samples based on 16S rRNA and hlyA gene sequence similarity.

  1. Performance of 18S rRNA in littorinid phylogeny (Gastropoda: Caenogastropoda).

    PubMed

    Winnepenninckx, B M; Reid, D G; Backeljau, T

    1998-11-01

    In the past, 18S rRNA sequences have proved to be very useful for tracing ancient divergences but were rarely used for resolving more recent ones. Moreover, it was suggested that the molecule does not contain useful information to resolve divergences which took place during less than 40 Myr. The present paper takes littorinid phylogeny as a case study to reevaluate the utility of the molecule for resolving recent divergences. Two data sets for nine species of the snail family Littorinidae were analyzed, both separately and combined. One data set comprised 7 new complete 18S rRNA sequences aligned with 2 published littorinid sequences; the other comprised 12 morphological, 1 biochemical, and 2 18S rRNA secondary structure characters. On the basis of its ability to confirm generally accepted relationships and the congruence of results derived from the different data sets, it is concluded that 18S rRNA sequences do contain information to resolve "rapid" cladogenetic events, provided that they occurred in the not too distant past. 18S rRNA sequences yielded support for (1) the branching order (L. littorea, (L. obtusata, (L. saxatilis, L. compressa))) and (2) the basal position of L. striata in the Littorina clade. PMID:9797409

  2. Karyotypic diversification in Mytilus mussels (Bivalvia: Mytilidae) inferred from chromosomal mapping of rRNA and histone gene clusters

    PubMed Central

    2014-01-01

    Background Mussels of the genus Mytilus present morphologically similar karyotypes that are presumably conserved. The absence of chromosome painting probes in bivalves makes difficult verifying this hypothesis. In this context, we comparatively mapped ribosomal RNA and histone gene families on the chromosomes of Mytilus edulis, M. galloprovincialis, M. trossulus and M. californianus by fluorescent in situ hybridization (FISH). Results Major rRNA, core and linker histone gene clusters mapped to different chromosome pairs in the four taxa. In contrast, minor rRNA gene clusters showed a different behavior. In all Mytilus two of the 5S rDNA clusters mapped to the same chromosome pair and one of them showed overlapping signals with those corresponding to one of the histone H1 gene clusters. The overlapping signals on mitotic chromosomes became a pattern of alternate 5S rRNA and linker histone gene signals on extended chromatin fibers. Additionally, M. trossulus showed minor and major rDNA clusters on the same chromosome pair. Conclusion The results obtained suggest that at least some of the chromosomes bearing these sequences are orthologous and that chromosomal mapping of rRNA and histone gene clusters could be a good tool to help deciphering some of the many unsolved questions in the systematic classification of Mytilidae. PMID:25023072

  3. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  4. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease.

  5. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    PubMed Central

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  6. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.

    PubMed

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G

    2005-09-01

    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  7. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location. PMID:27334092

  8. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

  9. Proteins associated with rRNA in the Escherichia coli ribosome.

    PubMed

    Bernabeu, C; Vazquez, D; Ballesta, J P

    1978-04-27

    Ribosomal proteins located near the rRNA have been identified by cross linking to [14C]spermine with 1,5-difluoro-2,4-dinitrobenzene. The polyamine binds to double-stranded rRNA; those proteins showing radioactivity covalently bound after treatment with the bifunctional reagent should therefore be located in the vicinity of these regions of rRNA. Six proteins from the small subunit, S4, S5, S9, S18, S19 and S20 and ten proteins from the large subunit L2, L6, L13, L14, L16, L17, L18, L19, L22 and L27 preferentially take up the label. The results obtained with three proteins from the large subunit, L6, L16 and L27, show a high degree of variability that could reflect differences of conformation in the subunit population. Several proteins were drastically modified by the cross-linking agent but were not detected in the two-dimensional gel electrophoresis (e.g., S1, S11, S21, L7, L8 and L12) and therefore could not be studied.

  10. Characterization and physical mapping of 18S and 5S ribosomal genes in Indian major carps (Pisces, Cyprinidae).

    PubMed

    Ravindra Kumar; Kushwaha, Basdeo; Nagpure, Naresh S

    2013-06-01

    Characterization of the major (18S) and minor (5S) ribosomal RNA genes were carried out in three commercially important Indian major carp (IMC) species, viz. Catla catla, Labeo rohita and Cirrhinus mrigala along with their physical localizations using dual colour fluorescence in situ hybridization. The diploid chromosome number in the above carps was confirmed to be 50 with inter-species karyo-morphological variations. The 18S rDNA signals were observed on 3 pair of chromosomes in C. catla and L. rohita, and two pairs in C. mrigala. The 5S rDNA signal was found on single pair of chromosome in all the species with variation in their position on chromosomes. The sequencing of 18S rDNA generated 1804, 1805 and 1805 bp long fragments, respectively, in C. catla, L. rohita and C. mrigala with more than 98% sequence identity among them. Similarly, sequencing of 5S rDNA generated 191 bp long fragments in the three species with 100% identity in coding region and 23.2% overall variability in non-transcribed spacer region. Thus, these molecular markers could be used as species-specific markers for taxonomic identification and might help in understanding the genetic diversity, genome organization and karyotype evolution of these species.

  11. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    PubMed

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae.

  12. Duplex-specific nuclease efficiently removes rRNA for prokaryotic RNA-seq.

    PubMed

    Yi, Hana; Cho, Yong-Joon; Won, Sungho; Lee, Jong-Eun; Jin Yu, Hyung; Kim, Sujin; Schroth, Gary P; Luo, Shujun; Chun, Jongsik

    2011-11-01

    Next-generation sequencing has great potential for application in bacterial transcriptomics. However, unlike eukaryotes, bacteria have no clear mechanism to select mRNAs over rRNAs; therefore, rRNA removal is a critical step in sequencing-based transcriptomics. Duplex-specific nuclease (DSN) is an enzyme that, at high temperatures, degrades duplex DNA in preference to single-stranded DNA. DSN treatment has been successfully used to normalize the relative transcript abundance in mRNA-enriched cDNA libraries from eukaryotic organisms. In this study, we demonstrate the utility of this method to remove rRNA from prokaryotic total RNA. We evaluated the efficacy of DSN to remove rRNA by comparing it with the conventional subtractive hybridization (Hyb) method. Illumina deep sequencing was performed to obtain transcriptomes from Escherichia coli grown under four growth conditions. The results clearly showed that our DSN treatment was more efficient at removing rRNA than the Hyb method was, while preserving the original relative abundance of mRNA species in bacterial cells. Therefore, we propose that, for bacterial mRNA-seq experiments, DSN treatment should be preferred to Hyb-based methods.

  13. Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

    PubMed

    Galián, José A; Rosato, Marcela; Rosselló, Josep A

    2014-03-01

    Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

  14. Differentiation of Debaryomyces hansenii and Candida famata by rRNA gene intergenic spacer fingerprinting and reassessment of phylogenetic relationships among D. hansenii, C. famata, D. fabryi, C. flareri (=D. subglobosus) and D. prosopidis: description of D. vietnamensis sp. nov. closely related to D. nepalensis.

    PubMed

    Nguyen, Huu-Vang; Gaillardin, Claude; Neuvéglise, Cécile

    2009-06-01

    The intergenic spacer rDNA amplification and AluI fingerprinting (IGSAF) method detected four distinct groups among 170 Debaryomyces hansenii strains: D. hansenii var. hansenii; Candida famata var. famata; D. hansenii var. fabryi and C. famata var. flareri. IGS sequence comparison of representative strains showed that D. hansenii var. hansenii and C. famata var. famata belonged to one species, whereas D. hansenii var. fabryi and C. famata var. flareri belonged to two different ones. This confirmed the following three species recently reinstated: D. hansenii (=C. famata), Debaryomyces fabryi and Debaryomyces subglobosus (=Candida flareri). Accordingly, growth at 37 degrees C may no longer be used to differentiate D. hansenii from D. fabryi. Riboflavin production is more specific for D. fabryi and D. subglobosus strains. IGSAF identified all the other 17 species of the genus Debaryomyces, six of them sharing with D. hansenii an rRNA gene unit harbouring two 5S rRNA genes. The phylogenetic tree established with IGS sequences was congruent with the one based on ACT1, GPD1 and COX2 sequences depicting a distinct D. hansenii clade close to the D. subglobosus, Debaryomyces prosopidis and D. fabryi clade. Description of Debaryomyces vietnamensis sp. nov. (type strain CBS 10535(T), MUCL 51648(T)), closely related to Debaryomyces nepalensis is given. PMID:19385997

  15. METAXA2: improved identification and taxonomic classification of small and large subunit rRNA in metagenomic data.

    PubMed

    Bengtsson-Palme, Johan; Hartmann, Martin; Eriksson, Karl Martin; Pal, Chandan; Thorell, Kaisa; Larsson, Dan Göran Joakim; Nilsson, Rolf Henrik

    2015-11-01

    The ribosomal rRNA genes are widely used as genetic markers for taxonomic identification of microbes. Particularly the small subunit (SSU; 16S/18S) rRNA gene is frequently used for species- or genus-level identification, but also the large subunit (LSU; 23S/28S) rRNA gene is employed in taxonomic assignment. The METAXA software tool is a popular utility for extracting partial rRNA sequences from large sequencing data sets and assigning them to an archaeal, bacterial, nuclear eukaryote, mitochondrial or chloroplast origin. This study describes a comprehensive update to METAXA - METAXA2 - that extends the capabilities of the tool, introducing support for the LSU rRNA gene, a greatly improved classifier allowing classification down to genus or species level, as well as enhanced support for short-read (100 bp) and paired-end sequences, among other changes. The performance of METAXA2 was compared to other commonly used taxonomic classifiers, showing that METAXA2 often outperforms previous methods in terms of making correct predictions while maintaining a low misclassification rate. METAXA2 is freely available from http://microbiology.se/software/metaxa2/. PMID:25732605

  16. Repumping and spectroscopy of laser-cooled Sr atoms using the (5s5p)3P2-(5s4d)3D2 transition

    NASA Astrophysics Data System (ADS)

    Mickelson, P. G.; Martinez de Escobar, Y. N.; Anzel, P.; De Salvo, B. J.; Nagel, S. B.; Traverso, A. J.; Yan, M.; Killian, T. C.

    2009-12-01

    We describe repumping and spectroscopy of laser-cooled strontium (Sr) atoms using the (5s5p)3P2-(5s4d)3D2 transition. Atom number in a magneto-optical trap is enhanced by driving this transition because Sr atoms that have decayed into the (5s5p)3P2 dark state are repumped back into the (5s2)1S0 ground state. Spectroscopy of 84Sr, 86Sr, 87Sr and 88Sr improves the value of the (5s5p)3P2-(5s4d)3D2 transition frequency and determines the isotope shifts for the transition accurately enough to guide laser-cooling experiments with less abundant isotopes.

  17. Evolutionary dynamics of 5S rDNA location in acridid grasshoppers and its relationship with H3 histone gene and 45S rDNA location.

    PubMed

    Cabral-de-Mello, Diogo C; Cabrero, Josefa; López-León, María Dolores; Camacho, Juan Pedro M

    2011-07-01

    We analyze the chromosomal location of 5S rDNA clusters in 29 species of grasshoppers belonging to the family Acrididae. There was extensive variation among species for the number and location of 5S rDNA sites. Out of 148 sites detected, 75% were proximally located, 21.6% were interstitial, and only 3.4% were distal. The number of 5S rDNA sites per species varied from a single chromosome pair (in six species) to all chromosome pairs (in five species), with a range of intermediate situations. Thirteen chromosomes from eight species carried two 5S rDNA clusters. At intraspecific level, differences among populations were detected in Eyprepocnemis plorans, and some heteromorphisms have also been observed in some species. Double FISH for 5S rDNA and H3 histone gene DNA, performed on 17 of these 29 species, revealed that both markers are sometimes placed in a same chromosome but at different location, whereas they appeared to co-localize in five species (Calliptamus barbarus, Heteracris adpersa, Aiolopus strepens, Oedipoda charpentieri and O. coerulescens). Double fiber-FISH in A. strepens and O. coerulescens showed that the two DNAs are closely interspersed with variable relative amounts of both classes of DNA. Finally, no correlation was observed between the number of 5S and 45S rDNA clusters in 23 species where this information was available. These results are discussed in the light of possible mechanisms of spread that led to the extensive variation in the number of clusters observed for both rDNA types in acridid grasshoppers.

  18. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    PubMed

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  19. Characterization of Xanthomonas campestris Pathovars by rRNA Gene Restriction Patterns

    PubMed Central

    Berthier, Yvette; Verdier, Valérie; Guesdon, Jean-Luc; Chevrier, Danièle; Denis, Jean-Baptiste; Decoux, Guy; Lemattre, Monique

    1993-01-01

    Genomic DNA of 191 strains of the family Pseudomonadaceae, including 187 strains of the genus Xanthomonas, was cleaved by EcoRI endonuclease. After hybridization of Southern transfer blots with 2-acetylamino-fluorene-labelled Escherichia coli 16+23S rRNA probe, 27 different patterns were obtained. The strains are clearly distinguishable at the genus, species, and pathovar levels. The variability of the rRNA gene restriction patterns was determined for four pathovars of Xanthomonas campestris species. The 16 strains of X. campestris pv. begoniae analyzed gave only one pattern. The variability of rRNA gene restriction patterns of X. campestris pv. manihotis strains could be related to ecotypes. In contrast, the variability of patterns observed for X. campestris pv. malvacearum was not correlated with pathogenicity or with the geographical origins of the strains. The highest degree of variability of DNA fingerprints was observed within X. campestris pv. dieffenbachiae, which is pathogenic to several hosts of the Araceae family. In this case, variability was related to both host plant and pathogenicity. Images PMID:16348894

  20. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA.

    PubMed

    Kumke, Katrin; Macas, Jiří; Fuchs, Jörg; Altschmied, Lothar; Kour, Jasmeet; Dhar, Manoj K; Houben, Andreas

    2016-01-01

    B chromosomes are supernumerary dispensable parts of the karyotype which appear in some individuals of some populations in some species. Using advanced sequencing technology, we in silico characterized the high-copy DNA composition of Plantago lagopus with and without B chromosomes. The nuclear genome (2.46 pg/2C) was found to be relatively rich in repetitive sequences, with highly and moderately repeated elements making up 68% of the genome. Besides a centromere-specific marker, we identified a B-specific satellite and a repeat enriched in polymorphic A chromosome segments. The B-specific tandem repeat PLsatB originated from sequence amplification including 5S rDNA fragments. PMID:27173804

  1. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.

    PubMed

    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V

    2015-02-25

    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences. PMID:25523504

  2. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.

    PubMed

    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V

    2015-02-25

    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences.

  3. Bead Array Direct rRNA Capture Assay (rCapA) for Amplification Free Speciation of Mycobacterium Cultures

    PubMed Central

    de Ronde, Hans; González Alonso, Paula; van Soolingen, Dick; Klatser, Paul R.; Anthony, Richard M.

    2012-01-01

    Mycobacterium cultures, from patients suspected of tuberculosis or nontuberculous mycobacteria (NTM) infection, need to be identified. It is most critical to identify cultures belonging to the Mycobacterium tuberculosis complex, but also important to recognize clinically irrelevant or important NTM to allow appropriate patient management. Identification of M. tuberculosis can be achieved by a simple and cheap lateral flow assay, but identification of other Mycobacterium spp. generally requires more complex molecular methods. Here we demonstrate that a paramagnetic liquid bead array method can be used to capture mycobacterial rRNA in crude lysates of positive cultures and use a robust reader to identify the species in a direct and sensitive manner. We developed an array composed of paramagnetic beads coupled to oligonucleotides to capture 16 rRNA from eight specific Mycobacterium species and a single secondary biotinilated reporter probe to allow the captured rRNA to be detected. A ninth less specific bead and its associated reporter probe, designed to capture 23S rRNA from mycobacteria and related genera, is included as an internal control to confirm the presence of bacterial rRNA from a GC rich Gram variable genera. Using this rRNA capture assay (rCapA) with the array developed we were already able to confirm the presence of members of the M. tuberculosis complex and to discriminate a range of NTM species. This approach is not based on DNA amplification and therefore does not require precautions to avoid amplicon contamination. Moreover, the new generation of stable and cost effective liquid bead readers provides the necessary multiplexing potential to develop a robust and highly discriminatory assay. PMID:22396779

  4. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH.

    PubMed

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.

  5. Detection and identification of mycobacteria by amplification of rRNA.

    PubMed

    Böddinghaus, B; Rogall, T; Flohr, T; Blöcker, H; Böttger, E C

    1990-08-01

    Oligonucleotides specific at a genus, group, or species level were defined by a systematic comparison of small-subunit rRNA sequences from Mycobacterium tuberculosis, M. bovis, M. africanum, M. bovis BCG, M. avium, M. kansasii, M. marinum, M. gastri, M. chelonae, M. smegmatis, M. terrae, M. nonchromogenicum, M. xenopi, M. malmoense, M. szulgai, M. scrofulaceum, M. fortuitum, M. gordonae, M. intracellulare, M. simiae, M. flavescens, M. paratuberculosis, M. sphagni, M. cookii, M. komossense, M. phlei, and M. farcinica. On the basis of the defined oligonucleotides, the polymerase chain reaction technique was explored to develop a sensitive taxon-specific detection system for mycobacteria. By using M. tuberculosis as a model system, fewer than 10 bacteria could be reliably detected by this kind of assay. These results suggest that amplification of rRNA sequences by the polymerase chain reaction may provide a highly sensitive and specific tool for the direct detection of microorganisms without the need for prior cultivation.

  6. Methodology of protistan discovery: from rRNA detection to quality scanning electron microscope images.

    PubMed

    Stoeck, Thorsten; Fowle, William H; Epstein, Slava S

    2003-11-01

    Each year, thousands of new protistan 18S rRNA sequences are detected in environmental samples. Many of these sequences are molecular signatures of new protistan species, classes, and/or kingdoms that have never been seen before. The main goal of this study was to enable visualization of these novel organisms and to conduct quality ultrastructural examination. We achieved this goal by modifying standard procedures for cell fixation, fluorescence in situ hybridization, and scanning electron microscopy (SEM) and by making these methodologies work in concert. As a result, the same individual cell can now be detected by 18S rRNA-targeted fluorochrome-labeled probes and then viewed by SEM to reveal its diagnostic morphological characteristics. The method was successfully tested on a wide range of protists (alveolates, stramenopiles, kinetoplastids, and cryptomonads). The new methodology thus opens a way for fine microscopy studies of many organisms previously known exclusively by their 18S rRNA sequences.

  7. Essential role of conserved DUF177A protein in plastid 23S rRNA accumulation and plant embryogenesis

    PubMed Central

    Yang, Jiani; Suzuki, Masaharu; McCarty, Donald R.

    2016-01-01

    DUF177 proteins are nearly universally conserved in bacteria and plants except the Chlorophyceae algae. Thus far, duf177 mutants in bacteria have not established a function. In contrast, duf177a mutants have embryo lethal phenotypes in maize and Arabidopsis. In maize inbred W22, duf177a mutant embryos arrest at an early transition stage, whereas the block is suppressed in the B73 inbred background, conditioning an albino seedling phenotype. Background-dependent embryo lethal phenotypes are characteristic of maize plastid gene expression mutants. Consistent with the plastid gene expression hypothesis, quantitative real-time PCR revealed a significant reduction of 23S rRNA in an Escherichia coli duf177 knockout. Plastid 23S rRNA contents of duf177a mutant tissues were also markedly reduced compared with the wild-type, whereas plastid 16S, 5S, and 4.5S rRNA contents were less affected, indicating that DUF177 is specifically required for accumulation of prokaryote-type 23S rRNA. An AtDUF177A–green fluorescent protein (GFP) transgene controlled by the native AtDUF177A promoter fully complemented the Arabidopsis atduf177a mutant. Transient expression of AtDUF177A–GFP in Nicotiana benthamiana leaves showed that the protein was localized in chloroplasts. The essential role of DUF177A in chloroplast–ribosome formation is reminiscent of IOJAP, another highly conserved ribosome-associated protein, suggesting that key mechanisms controlling ribosome formation in plastids evolved from non-essential pathways for regulation of the prokaryotic ribosome. PMID:27574185

  8. Ultraviolet light-induced crosslinking reveals a unique region of local tertiary structure in potato spindle tuber viroid and HeLa 5S RNA

    SciTech Connect

    Branch, A.D.; Benenfeld, B.J.; Robertson, H.D.

    1985-10-01

    The positions of intramolecular crosslinks induced by irradiation with ultraviolet light were mapped into potato spindle tuber viroid RNA and HeLa 5S rRNA. Crosslinking in each of these molecules occurred at a single major site, which was located by RNA fingerprinting and secondary analysis. Various lines of evidence suggest that these crosslinks identify a previously undescribed element of local tertiary structure common to these two widely divergent RNA molecules: (i) both crosslinks occur in an identical eight-base context, with the sequence 5 GGGAA 3 on one side and the sequence 5 UAC 3 on the other; (ii) both crosslinks connect bases that are not thought to be involved in conventional hydrogen bonding, within regions usually depicted as single-stranded loops flanked by short helical segments; and (iii) both crosslinks connect a purine and a pyrimidine residue, and both may generate the same G-U dimer. Furthermore, it is likely that the crosslinking site is of functional significance because it is located within the most highly conserved region of the viroid sequence and involves bases that are essentially invariant among eukaryotic 5S rRNA molecules.

  9. Identification of a novel 16S rRNA gene variant of Actinomyces funkei from six patients with purulent infections.

    PubMed

    Hinić, V; Straub, C; Schultheiss, E; Kaempfer, P; Frei, R; Goldenberger, D

    2013-07-01

    Little is known about the clinical significance and laboratory diagnosis of Actinomyces funkei. In this report we describe six clinical cases where A. funkei was isolated from purulent, polymicrobial infections. Conventional identification procedures were compared with molecular methods including matrix-assisted laser desorption/ionization time-of-flight mass spectrometry technique. Analysis of the full 16S rRNA gene sequence of the six investigated strains revealed differences from the A. funkei type strain. DNA-DNA hybridization showed that the clinical strains represent a novel 16S rRNA gene variant within the species of A. funkei.

  10. An improved amplification and sequencing strategy for phylogenetic studies using the mitochondrial large subunit rRNA gene.

    PubMed

    Parker, A; Kornfield, I

    1996-08-01

    Numerous molecular systematic studies have employed variation in the mitochondrial large subunit (16s) rRNA gene to infer patterns of relationship among species and higher taxa. The primers most commonly employed in 16s rRNA amplification and sequencing bracket an approximately 600 bp portion of this gene. However, most of the informative variation occurs within a 200 bp subset of this segment. We describe a novel primer pair designed to amplify this variable region in a wide range of taxa, allowing broader application and considerable streamlining of data acquisition for studies using this gene.

  11. Selective Recovery of 16S rRNA Sequences from Natural Microbial Communities in the Form of cDNA.

    PubMed

    Weller, R; Ward, D M

    1989-07-01

    Cloning of cDNA obtained from 16S rRNA (16S rcDNA) selectively retrieves species-specific sequence information useful for analyzing the composition and structure of natural microbial communities. With this technique we obtained recombinant 16S rcDNA libraries from Escherichia coli and from a model hot-spring cyanobacterial-mat community. The recombinant plasmids contained exclusively 16S rRNA-derived inserts. This selective approach is independent of biasing culture techniques and eliminates the laborious screening required to locate 16S rRNA gene-bearing recombinants in genomic DNA libraries obtained from natural communities. PMID:16347975

  12. Identification of goose (Anser anser) and mule duck (Anasplatyrhynchos x Cairina moschata) foie gras by multiplex polymerase chain reaction amplification of the 5S RDNA gene.

    PubMed

    Rodríguez, M A; García, T; González, I; Asensio, L; Fernández, A; Lobo, E; Hernández, P E; Martín, R

    2001-06-01

    Polymerase chain reaction (PCR) amplification of the nuclear 5S rDNA gene has been used for the identification of goose and mule duck foie gras. Two species-specific reverse primers were designed and used in a multiplex reaction, together with a forward universal primer, to amplify specific fragments of the 5S rDNA in each species. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed clear identification of goose and mule duck foie gras samples. This genetic marker can be useful for detecting fraudulent substitution of the duck liver for the more expensive goose liver.

  13. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq

    2015-01-01

    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  14. Promoter of the Mycoplasma pneumoniae rRNA operon.

    PubMed Central

    Hyman, H C; Gafny, R; Glaser, G; Razin, S

    1988-01-01

    RNA transcripts starting from the 5' end of the single Mycoplasma pneumoniae rRNA operon were analyzed by several methods. By primer extension analysis a start site was found 62 nucleotides upstream from the start site of the 16S rRNA. This site was preceded by a putative Pribnow box; however, a defined -35 recognition region was absent. The cloned rRNA operon was transcribed in vitro by using purified RNA polymerase of Escherichia coli. A single start site could be demonstrated within a few nucleotides of the start site found by primer extension analysis of M. pneumoniae transcripts. When fragments from the cloned operon were used as hybridization probes, S1 nuclease mapping yielded a single transcript extending approximately 193 nucleotides upstream from the 16S rRNA start site. The region surrounding this endpoint did not resemble any known promoter sequence. Dot blot hybridization of M. pneumoniae RNA to three oligonucleotides consisting of nucleotides -5 to -21, -38 to -54, and -112 to -132 (from the start of the 16S rRNA gene) indicated that most rRNA transcripts were processed at the stem site preceding the 16S rRNA gene. The majority of the longer precursor transcripts, extending beyond this point, did not extend further upstream to an oligonucleotide consisting of nucleotides -112 to -132. It was concluded that transcription of the rRNA operon of M. pneumoniae is initiated by a single promoter. The nucleotide sequence of the region is presented. Images PMID:2838465

  15. An unusual Y chromosome of Drosophila simulans carrying amplified rDNA spacer without rRNA genes.

    PubMed

    Lohe, A R; Roberts, P A

    1990-06-01

    The X and Y chromosomes of Drosophila melanogaster each contain a cluster of several hundred ribosomal RNA genes (rDNA). A nontranscribed spacer region separates adjacent rRNA genes and contains tandem copies of 240 bp repeats that include the initiation site for RNA polymerase I transcription. We show here that Drosophila simulans, a sibling species of D. melanogaster, contains few, if any, rRNA genes on its Y chromosome but carries instead a large block (3,000 kb or 12,500 copies) of 240 bp nontranscribed spacer repeats. The repeats are located at the tip of the long arm of the simulans Y chromosome, in contrast to their location among rRNA genes on the short arm of the Y chromosome of D. melanogaster. The bobbed mutation in homozygous females of D. melanogaster shortens and thins the bristles, owing to a partial deletion of rRNA genes on the X chromosome. The bristles of bobbed/Y males are normal owing to the presence of a full complement of rRNA genes on the Y chromosome. Peculiarly, in bobbed/Y males of D. simulans the short bristle phenotype does not return to normal but is enhanced by the presence of the Y chromosome. We propose that the 12,500 nontranscribed spacer repeats on the Y chromosome are responsible for this biological effect by competition for a protein factor(s) essential for normal levels of rDNA transcription at the X-linked locus.

  16. An empirical analysis of mt 16S rRNA covarion-like evolution in insects: site-specific rate variation is clustered and frequently detected.

    PubMed

    Misof, B; Anderson, C L; Buckley, T R; Erpenbeck, D; Rickert, A; Misof, K

    2002-10-01

    The structural and functional analysis of rRNA molecules has attracted considerable scientific interest. Empirical studies have demonstrated that sequence variation is not directly translated into modifications of rRNA secondary structure. Obviously, the maintenance of secondary structure and sequence variation are in part governed by different selection regimes. The nature of those selection regimes still remains quite elusive. The analysis of individual bacterial models cannot adequately explore this topic. Therefore, we used primary sequence data and secondary structures of a mitochondrial 16S rRNA fragment of 558 insect species from 15 monophyletic groups to study patterns of sequence variation, and variation of secondary structure. Using simulation studies to establish significance levels of change, we found that despite conservation of secondary structure, the location of sequence variation within the conserved rRNA structure changes significantly between groups of insects. Despite our conservative estimation procedure we found significant site-specific rate changes at 56 sites out of 184. Additionally, site-specific rate variation is somewhat clustered in certain helices. Both results confirm what has been predicted from an application of non-stationary maximum likelihood models to rRNA sequences. Clearly, constraints on sequence variation evolve and leave footprints in the form of evolutionary plasticity in rRNA sequences. Here, we show that a better understanding of the evolution of rRNA sequences can be obtained by integrating both phylogenetic and structural information.

  17. Description of an unusual Neisseria meningitidis isolate containing and expressing Neisseria gonorrhoeae-Specific 16S rRNA gene sequences.

    PubMed

    Walcher, Marion; Skvoretz, Rhonda; Montgomery-Fullerton, Megan; Jonas, Vivian; Brentano, Steve

    2013-10-01

    An apparently rare Neisseria meningitidis isolate containing one copy of a Neisseria gonorrhoeae 16S rRNA gene is described herein. This isolate was identified as N. meningitidis by biochemical identification methods but generated a positive signal with Gen-Probe Aptima assays for the detection of Neisseria gonorrhoeae. Direct 16S rRNA gene sequencing of the purified isolate revealed mixed bases in signature regions that allow for discrimination between N. meningitidis and N. gonorrhoeae. The mixed bases were resolved by sequencing individually PCR-amplified single copies of the genomic 16S rRNA gene. A total of 121 discrete sequences were obtained; 92 (76%) were N. meningitidis sequences, and 29 (24%) were N. gonorrhoeae sequences. Based on the ratio of species-specific sequences, the N. meningitidis strain seems to have replaced one of its four intrinsic 16S rRNA genes with the gonococcal gene. Fluorescence in situ hybridization (FISH) probes specific for meningococcal and gonococcal rRNA were used to demonstrate the expression of the rRNA genes. Interestingly, the clinical isolate described here expresses both N. meningitidis and N. gonorrhoeae 16S rRNA genes, as shown by positive FISH signals with both probes. This explains why the probes for N. gonorrhoeae in the Gen-Probe Aptima assays cross-react with this N. meningitidis isolate. The N. meningitidis isolate described must have obtained N. gonorrhoeae-specific DNA through interspecies recombination.

  18. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  19. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  20. Molecular confirmation of the genomic constitution of Douglasdeweya (Triticeae: Poaceae): demonstration of the utility of the 5S rDNA sequence as a tool for haplome identification.

    PubMed

    Baum, Bernard R; Johnson, Douglas A

    2008-06-01

    A new genus Douglasdeweya containing the two species, Douglasdeweya deweyi and D. wangii was published in 2005 by Yen et al. based upon the results of cytogenetical and morphological findings. The genome constitution of Douglasdeweya-PPStSt-allowed its segregation from the genus Pseudoroegneria which contains the StSt or StStStSt genomes. Our previous work had demonstrated the utility of using 5S rDNA units, especially the non-transcribed spacer sequence variation, for the resolution of genomes (haplomes) previously established by cytology. Here, we show that sequence analysis of the 5S DNA units from these species strongly supports the proposed species relationships of Yen et al. (Can J Bot 83:413-419, 2005), i.e., the PP genome from Agropyron and the StSt genome from Pseudoroegneria. Analysis of the 5S rDNA units constitutes a powerful tool for genomic research especially in the Triticeae. PMID:18421479

  1. Identification of nine sequence types of the 16S rRNA genes of Campylobacter jejuni subsp. jejuni isolated from broilers

    PubMed Central

    Hansson, Ingrid; Persson, Marianne; Svensson, Linda; Engvall, Eva Olsson; Johansson, Karl-Erik

    2008-01-01

    Background Campylobacter is the most commonly reported bacterial cause of enteritis in humans in the EU Member States and other industrialized countries. One significant source of infection is broilers and consumption of undercooked broiler meat. Campylobacter jejuni is the Campylobacter sp. predominantly found in infected humans and colonized broilers. Sequence analysis of the 16S rRNA gene is very useful for identification of bacteria to genus and species level. The objectives in this study were to determine the degree of intraspecific variation in the 16S rRNA genes of C. jejuni and C. coli and to determine whether the 16S rRNA sequence types correlated with genotypes generated by PFGE analysis of SmaI restricted genomic DNA of the strains. Methods The 16S rRNA genes of 45 strains of C. jejuni and two C. coli strains isolated from broilers were sequenced and compared with 16S rRNA sequences retrieved from the Ribosomal Database Project or GenBank. The strains were also genotyped by PFGE after digestion with SmaI. Results Sequence analyses of the 16S rRNA genes revealed nine sequence types of the Campylobacter strains and the similarities between the different sequence types were in the range 99.6–99.9%. The number of nucleotide substitutions varied between one and six among the nine 16S rRNA sequence types. One of the nine 16S rRNA sequence profiles was common to 12 of the strains from our study and two of these were identified as Campylobacter coli by PCR/REA. The other 10 strains were identified as Campylobacter jejuni. Five of the nine sequence types were also found among the Campylobacter sequences deposited in GenBank. The three 16S rRNA genes in the analysed strains were identical within each individual strain for all 47 strains. Conclusion C. jejuni and C. coli seem to lack polymorphisms in their 16S rRNA gene, but phylogenetic analysis based on 16S rRNA sequences was not always sufficient for differentiation between C. jejuni and C. coli. The strains

  2. Unexpected Accumulation of ncm5U and ncm5s2U in a trm9 Mutant Suggests an Additional Step in the Synthesis of mcm5U and mcm5s2U

    PubMed Central

    Chen, Changchun; Huang, Bo; Anderson, James T.; Byström, Anders S.

    2011-01-01

    Background Transfer RNAs are synthesized as a primary transcript that is processed to produce a mature tRNA. As part of the maturation process, a subset of the nucleosides are modified. Modifications in the anticodon region often modulate the decoding ability of the tRNA. At position 34, the majority of yeast cytosolic tRNA species that have a uridine are modified to 5-carbamoylmethyluridine (ncm5U), 5-carbamoylmethyl-2′-O-methyluridine (ncm5Um), 5-methoxycarbonylmethyl-uridine (mcm5U) or 5-methoxycarbonylmethyl-2-thiouridine (mcm5s2U). The formation of mcm5 and ncm5 side chains involves a complex pathway, where the last step in formation of mcm5 is a methyl esterification of cm5 dependent on the Trm9 and Trm112 proteins. Methodology and Principal Findings Both Trm9 and Trm112 are required for the last step in formation of mcm5 side chains at wobble uridines. By co-expressing a histidine-tagged Trm9p together with a native Trm112p in E. coli, these two proteins purified as a complex. The presence of Trm112p dramatically improves the methyltransferase activity of Trm9p in vitro. Single tRNA species that normally contain mcm5U or mcm5s2U nucleosides were isolated from trm9Δ or trm112Δ mutants and the presence of modified nucleosides was analyzed by HPLC. In both mutants, mcm5U and mcm5s2U nucleosides are absent in tRNAs and the major intermediates accumulating were ncm5U and ncm5s2U, not the expected cm5U and cm5s2U. Conclusions Trm9p and Trm112p function together at the final step in formation of mcm5U in tRNA by using the intermediate cm5U as a substrate. In tRNA isolated from trm9Δ and trm112Δ strains, ncm5U and ncm5s2U nucleosides accumulate, questioning the order of nucleoside intermediate formation of the mcm5 side chain. We propose two alternative explanations for this observation. One is that the intermediate cm5U is generated from ncm5U by a yet unknown mechanism and the other is that cm5U is formed before ncm5U and mcm5U. PMID:21687733

  3. Phylogenetic diversity of bacterial symbionts of Solemya hosts based on comparative sequence analysis of 16S rRNA genes.

    PubMed Central

    Krueger, D M; Cavanaugh, C M

    1997-01-01

    The bacterial endosymbionts of two species of the bivalve genus Solemya from the Pacific Ocean, Solemya terraeregina and Solemya pusilla, were characterized. Prokaryotic cells resembling gram-negative bacteria were observed in the gills of both host species by transmission electron microscopy. The ultrastructure of the symbiosis in both host species is remarkably similar to that of all previously described Solemya spp. By using sequence data from 16S rRNA, the identity and evolutionary origins of the S. terraeregina and S. pusilla symbionts were also determined. Direct sequencing of PCR-amplified products from host gill DNA with primers specific for Bacteria 16S rRNA genes gave a single, unambiguous sequence for each of the two symbiont species. In situ hybridization with symbiont-specific oligonucleotide probes confirmed that these gene sequences belong to the bacteria residing in the hosts gills. Phylogenetic analyses of the 16S rRNA gene sequences by both distance and parsimony methods identify the S. terraeregina and S. pusilla symbionts as members of the gamma subdivision of the Proteobacteria. In contrast to symbionts of other bivalve families, which appear to be monophyletic, the S. terraeregina and S. pusilla symbionts share a more recent common ancestry with bacteria associating endosymbiotically with bivalves of the superfamily Lucinacea than with other Solemya symbionts (host species S. velum, S. occidentalis, and S. reidi). Overall, the 16S rRNA gene sequence data suggest that the symbionts of Solemya hosts represent at least two distinct bacterial lineages within the gamma-Proteobacteria. While it is increasingly clear that all extant species of Solemya live in symbiosis with specific bacteria, the associations appear to have multiple evolutionary origins. PMID:8979342

  4. Trypanosoma livingstonei: a new species from African bats supports the bat seeding hypothesis for the Trypanosoma cruzi clade

    PubMed Central

    2013-01-01

    Background Bat trypanosomes have been implicated in the evolutionary history of the T. cruzi clade, which comprises species from a wide geographic and host range in South America, Africa and Europe, including bat-restricted species and the generalist agents of human American trypanosomosis T. cruzi and T. rangeli. Methods Trypanosomes from bats (Rhinolophus landeri and Hipposideros caffer) captured in Mozambique, southeast Africa, were isolated by hemoculture. Barcoding was carried out through the V7V8 region of Small Subunit (SSU) rRNA and Fluorescent Fragment Length barcoding (FFLB). Phylogenetic inferences were based on SSU rRNA, glyceraldehyde phosphate dehydrogenase (gGAPDH) and Spliced Leader (SL) genes. Morphological characterization included light, scanning and transmission electron microscopy. Results New trypanosomes from bats clustered together forming a clade basal to a larger assemblage called the T. cruzi clade. Barcoding, phylogenetic analyses and genetic distances based on SSU rRNA and gGAPDH supported these trypanosomes as a new species, which we named Trypanosoma livingstonei n. sp. The large and highly polymorphic SL gene repeats of this species showed a copy of the 5S ribosomal RNA into the intergenic region. Unique morphological (large and broad blood trypomastigotes compatible to species of the subgenus Megatrypanum and cultures showing highly pleomorphic epimastigotes and long and slender trypomastigotes) and ultrastructural (cytostome and reservosomes) features and growth behaviour (when co-cultivated with HeLa cells at 37°C differentiated into trypomastigotes resembling the blood forms and do not invaded the cells) complemented the description of this species. Conclusion Phylogenetic inferences supported the hypothesis that Trypanosoma livingstonei n. sp. diverged from a common ancestral bat trypanosome that evolved exclusively in Chiroptera or switched at independent opportunities to mammals of several orders forming the clade T. cruzi

  5. Evaluation of 16SpathDB 2.0, an automated 16S rRNA gene sequence database, using 689 complete bacterial genomes.

    PubMed

    Teng, Jade L L; Ho, Tom C C; Yeung, Ronald S Y; Wong, Annette Y P; Wang, Haiyin; Chen, Chen; Fung, Kitty S C; Lau, Susanna K P; Woo, Patrick C Y

    2014-02-01

    Interpretation of 16S rRNA sequences is a difficult problem faced by clinical microbiologists and technicians. In this study, we evaluated the updated 16SpathDB 2.0 database, using 689 16S rRNA sequences from 689 complete genomes of medically important bacteria. Among these 689 16S rRNA sequences, none was wrongly identified, with 35.8% reported as a single bacterial species having >98% identity with the query sequence (category 1), 63.9% reported as more than 1 bacterial species having >98% identity with the query sequence (category 2), 0.3% reported to the genus level (category 3), and none reported as no match (category 4). For the 16S rRNA sequences of non-duplicated bacterial species reported as category 1 or 2, the percentage of bacterial species reported as category 1 was significantly higher for anaerobic Gram-positive/Gram-negative bacteria than aerobic/facultative anaerobic Gram-positive/Gram-negative bacteria. 16SpathDB 2.0 is a user-friendly and accurate database for 16S rRNA sequence interpretation in clinical laboratories.

  6. The nuclear 5S RNAs from chicken, rat and man. U5 RNAs are encoded by multiple genes.

    PubMed

    Krol, A; Gallinaro, H; Lazar, E; Jacob, M; Branlant, C

    1981-02-25

    Preparations of chicken, rat and human nuclear 5S RNA contain two sets of molecules. The set with the lowest electrophoretic mobility (5Sa) contains RNAs identical or closely related to ribosomal 5S RNA from the corresponding animal species. In HeLa cells and rat brain, we only detected an RNA identical to the ribosomal 5S RNA. In hen brain and liver, we found other species differing by a limited number of substitutions. The results suggest that mutated 5S genes may be expressed differently according to the cell type. The set with the highest mobility corresponds to U5 RNA. In both rat brain and HeLa cells, U5 RNA was found to be composed of 4 and 5 different molecules respectively (U5A, U5B1-4) differing by a small number of substitutions or insertions. In hen brain, no U5B was detected but U5A' differing from U5A by the absence of the 3'-terminal adenosine. All the U5 RNAs contain the same set of modified nucleotides. They also have the same secondary structure which consists of two hairpins joined together by a 17 nucleotide long single-stranded region. The 3' half of the molecule has a compact conformation. Together, the results suggest that U5 RNAs are transcribed from a multigene family and that mutated genes may be expressed as far as secondary structure is conserved. The conformation of U5 RNA is likely to be related to its function and it is of interest to mention that several similarities of structure are found between U5 and U1A RNA.

  7. Quantitative Northern Blot Analysis of Mammalian rRNA Processing.

    PubMed

    Wang, Minshi; Pestov, Dimitri G

    2016-01-01

    Assembly of eukaryotic ribosomes is an elaborate biosynthetic process that begins in the nucleolus and requires hundreds of cellular factors. Analysis of rRNA processing has been instrumental for studying the mechanisms of ribosome biogenesis and effects of stress conditions on the molecular milieu of the nucleolus. Here, we describe the quantitative analysis of the steady-state levels of rRNA precursors, applicable to studies in mammalian cells and other organisms. We include protocols for gel electrophoresis and northern blotting of rRNA precursors using procedures optimized for the large size of these RNAs. We also describe the ratio analysis of multiple precursors, a technique that facilitates the accurate assessment of changes in the efficiency of individual pre-rRNA processing steps. PMID:27576717

  8. Control of rRNA transcription in Escherichia coli.

    PubMed Central

    Condon, C; Squires, C; Squires, C L

    1995-01-01

    The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

  9. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing.

    PubMed

    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan

    2016-01-01

    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  10. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing

    PubMed Central

    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan

    2016-01-01

    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  11. A tandem array of 5S ribosomal RNA genes in Pythium irregulare.

    PubMed

    Belkhiri, A; Intengan, H; Klassen, G R

    1997-02-28

    The 5S ribosomal RNA genes of the oomycete Pythium irregulare exist in tandem arrays unlinked to the rDNA repeat unit. A clone with a 9.2-kb insert containing an array of 5S genes was identified in a lambda genomic library and was characterized by restriction mapping and partial sequencing. The array consisted of 9 apparently identical 5S genes and their spacers in tandem, followed by a diverged 5S-like sequence that is likely to be a pseudogene. This gene arrangement, although almost universal in plants and animals, is rare in fungi and protists.

  12. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae)

    PubMed Central

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-01-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at −25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  13. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    PubMed

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.

  14. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    PubMed

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  15. Comparative analysis of dinoflagellate chloroplast genomes reveals rRNA and tRNA genes

    PubMed Central

    Barbrook, Adrian C; Santucci, Nicole; Plenderleith, Lindsey J; Hiller, Roger G; Howe, Christopher J

    2006-01-01

    Background Peridinin-containing dinoflagellates have a highly reduced chloroplast genome, which is unlike that found in other chloroplast containing organisms. Genome reduction appears to be the result of extensive transfer of genes to the nuclear genome. Unusually the genes believed to be remaining in the chloroplast genome are found on small DNA 'minicircles'. In this study we present a comparison of sets of minicircle sequences from three dinoflagellate species. Results PCR was used to amplify several minicircles from Amphidinium carterae so that a homologous set of gene-containing minicircles was available for Amphidinium carterae and Amphidinium operculatum, two apparently closely related peridinin-containing dinoflagellates. We compared the sequences of these minicircles to determine the content and characteristics of their chloroplast genomes. We also made comparisons with minicircles which had been obtained from Heterocapsa triquetra, another peridinin-containing dinoflagellate. These in silico comparisons have revealed several genetic features which were not apparent in single species analyses. The features include further protein coding genes, unusual rRNA genes, which we show are transcribed, and the first examples of tRNA genes from peridinin-containing dinoflagellate chloroplast genomes. Conclusion Comparative analysis of minicircle sequences has allowed us to identify previously unrecognised features of dinoflagellate chloroplast genomes, including additional protein and RNA genes. The chloroplast rRNA gene sequences are radically different from those in other organisms, and in many ways resemble the rRNA genes found in some highly reduced mitochondrial genomes. The retention of certain tRNA genes in the dinoflagellate chloroplast genome has important implications for models of chloroplast-mitochondrion interaction. PMID:17123435

  16. Bacillus nanhaiisediminis sp. nov., an alkalitolerant member of Bacillus rRNA group 6.

    PubMed

    Zhang, Jianli; Wang, Jiewei; Song, Fei; Fang, Caiyuan; Xin, Yuhua; Zhang, Yabo

    2011-05-01

    A Gram-stain-positive, rod-shaped bacterium, designated strain NH3(T), was isolated from a sediment sample from the South China Sea and was subjected to a polyphasic taxonomic study. The isolate grew optimally at 37 °C and pH 9. Strain NH3(T) had cell-wall peptidoglycan based on meso-diaminopimelic acid and MK-7 as the predominant menaquinone. The cellular fatty acid profile included significant amounts of iso-C(15 : 0) and iso-C(14 : 0). The major polar lipids were phosphatidylethanolamine, phosphatidylglycerol and diphosphatidylglycerol. The DNA G+C content of strain NH3(T) was 40.3 mol%. Phylogenetic analysis of the 16S rRNA gene sequence revealed that strain NH3(T) was a member of rRNA group 6 of the genus Bacillus, which includes alkalitolerant, alkaliphilic and halotolerant species. The closest phylogenetic relatives were Bacillus akibai 1139(T) (96.82 % 16S rRNA gene sequence similarity), B. pseudofirmus DSM 8715(T) (96.76 %), B. okhensis Kh10-101(T) (96.76 %) and B. alkalidiazotrophicus MS 6(T) (96.47 %). Strain NH3(T) could be distinguished from these phylogenetically close neighbours based on a number of phenotypic properties. On the basis of phenotypic and chemotaxonomic characteristics and phylogenetic data, we conclude that strain NH3(T) ( = CGMCC 1.10116(T)  = JCM 16507(T)) merits classification as the type strain of a novel species, for which the name Bacillus nanhaiisediminis sp. nov. is proposed.

  17. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  18. The 5S rDNA gene family in mollusks: characterization of transcriptional regulatory regions, prediction of secondary structures, and long-term evolution, with special attention to Mytilidae mussels.

    PubMed

    Vizoso, Miguel; Vierna, Joaquín; González-Tizón, Ana M; Martínez-Lage, Andrés

    2011-01-01

    Several reports on the characterization of 5S ribosomal DNA (5S rDNA) in various animal groups have been published to date, but there is a lack of studies analyzing this gene family in a much broader context. Here, we have studied 5S rDNA variation in several molluskan species, including bivalves, gastropods, and cephalopods. The degree of conservation of transcriptional regulatory regions was analyzed in these lineages, revealing a conserved TATA-like box in the upstream region. The evolution of the 120 bp coding region (5S) was also studied, suggesting the occurrence of paralogue groups in razor clams, clams, and cockles. In addition, 5S rDNA sequences from 11 species and 7 genus of Mytilidae Rafinesque, 1815 mussels were sampled and studied in detail. Four different 5S rDNA types, based on the nontranscribed spacer region were identified. The phylogenetic analyses performed within each type showed a between-species gene clustering pattern, suggesting ancestral polymorphism. Moreover, some putative pseudogenized 5S copies were also identified. Our report, together with previous studies that found high degree of intragenomic divergence in bivalve species, suggests that birth-and-death evolution may be the main force driving the evolution of 5S rDNA in these animals, even at the genus level.

  19. [Comparative analysis of diploid species of Avena l. using cytogenetic and biochemical markers: Avena canariensis baum et fedak and A. longiglumis dur].

    PubMed

    Shelukhina, O Iu; Badaeva, E D; Brezhneva, T A; Loskutov, I G; Pukhal'skiĭ, V A

    2008-06-01

    The diploid oat species containing the A genome of two types (Al and Ac) were studied by electrophoresis of grain storage proteins (avenins), chromosome C-banding, and in situ hybridization with probes pTa71 and pTa794. The karyotypes of the studied species displayed similar C-banding patterns but differed in size and morphology of several chromosomes, presumably, resulting from structural rearrangements that took place during the divergence of A genomes from a common ancestor. In situ hybridization demonstrated an identical location of the 45S and 5S rRNA gene loci in Avena canariensis and A. longiglumis similar to that in the A. strigosa genome. However, the 5S rDNA locus in A. longiglumis (5S rDNA1) was considerably decreased in the chromosome 3A1 long arm. The analysis demonstrated that these oat species were similar in the avenin component composition, although individual accessions differed in the electrophoretic mobilities of certain components. A considerable similarity of A. canariensis and A. longiglumis to the Avena diploid species carrying the As genome variant was demonstrated.

  20. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  1. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  2. A search for the Bs meson in Υ(5S) decays

    NASA Astrophysics Data System (ADS)

    Shipsey, Ian

    2004-05-01

    The CLEO III detector has recorded approximately 0.5 fb-1 of e^+ e^- annihilation data at the Υ(5S) resonance. Using this data sample, we have searched for fully reconstructed Bs mesons in the reaction Υ(5S) arrow B_s^(*) barB_s^(*)

  3. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  4. Karyological Features of Achyrocline (Asteraceae, Gnaphalieae): stable karyotypes, low DNA content variation and linkage of rRNA genes.

    PubMed

    Mazzella, C; Rodríguez, M; Vaio, M; Gaiero, P; López-Carro, B; Santiñaque, F F; Folle, G A; Guerra, M

    2010-01-01

    Many Achyrocline (Asteraceae, tribe Gnaphalieae) species are widely used in Argentina, Brazil and Uruguay as popular medicinal and aromatic plants. Achyrocline flaccida, A. satureioides, A. alata, and A. crassiuscula are distributed in Uruguay and popularly known as 'marcelas'. In order to characterize them, we performed chromosome counts, compared the karyotypes, mapped the 5S and 45S rDNA sites by fluorescent in situ hybridization, and estimated their DNA content. All species were diploid with 2n = 28 chromosomes, this being the first report for A. flaccida and A. crassiuscula. All species showed symmetrical karyotypes composed exclusively of biarmed chromosomes. DNA content estimated by flow cytometry revealed 2C values ranging from 5.73 to 6.03 pg, the amounts for A. alata and A. crassiuscula being higher than those for the other species. Cytogenetic mapping of 5S and 45S rDNA sequences in three species, A. flaccida, A. satureioides and A. alata, showed that in these species both sites co-localized in the pericentromeric region of chromosome 10. This site corresponds to the only DAPI(-) and CMA(+) band of their genomes. Southern blot hybridization of 5S and 45S rDNA on BamHI digested genomic DNA confirmed the tight linkage of these rDNA families into a single unit. Cytological data indicate that Achyrocline species are karyologically poorly differentiated, whereas the uncommon distribution of 5S and 45S rDNA suggests a close relationship with other genera of the Anthemidae tribe.

  5. Intragenomic heterogeneity and intergenomic recombination among Vibrio parahaemolyticus 16S rRNA genes.

    PubMed

    Harth, Erika; Romero, Jaime; Torres, Rafael; Espejo, Romilio T

    2007-08-01

    Vibrio parahaemolyticus is a marine bacterium bearing 11 copies of ribosomal operons. In some strains, such as RIMD2210633, the genome includes identical copies of 16S rRNA genes (rrs). However, it is known that other strains of the species, such as strains ATCC 17802 and RIMD2210856, show conspicuous intragenomic rrs heterogeneity. The extent and diversity of the rrs heterogeneity in V. parahaemolyticus were studied in further detail by characterization of the rrs copies in environmental isolates belonging to 21 different genotype groups. Thirteen of these groups showed intragenomic heterogeneity, containing altogether 16 sequences differing within a 25 bp segment of their rrs. These sequences grouped into four clusters differing in at least four nucleotide sites. Some isolates contained rrs alleles from up to three different clusters. Each segment sequence conserved the stem-loop characteristic of the 16S rRNA structure of this 25 bp sequence. The double-stranded stem sequence was quite variable, but almost every variation had a compensatory change to maintain seven to eight paired bases. Conversely, the single-strand loop sequence was conserved. The results may be explained as a consequence of recombination among rrs evolving in different bacteria. The results suggest that intergenomic rrs recombination is very high in V. parahaemolyticus and that it occurs solely among Vibrio species. This high rrs homologous intergenomic recombination could be an effective mechanism to maintain intragenomic rrs cohesion, mediating the dispersal of the most abundant rrs version among the 11 intragenomic loci. PMID:17660428

  6. The 5S lean method as a tool of industrial management performances

    NASA Astrophysics Data System (ADS)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  7. Identifications of 5{{s}_{1/2}}-5{{p}_{3/2}} and 5{{s}^{2}}-5s5p EUV transitions of promethium-like Pt, Ir, Os and Re

    NASA Astrophysics Data System (ADS)

    Bekker, H.; Versolato, O. O.; Windberger, A.; Oreshkina, N. S.; Schupp, R.; Baumann, T. M.; Harman, Z.; Keitel, C. H.; Schmidt, P. O.; Ullrich, J.; Crespo López-Urrutia, J. R.

    2015-07-01

    We investigated Pm-, Nd-, and Pr-like spectra in the extreme ultra-violet region around 20 nm of Pt, Ir, Os, and Re (Z = 78-75) produced in the Heidelberg electron beam ion trap. Identification of the transitions was supported by several theoretical calculations, including collisional radiative modeling of the observed spectra. Special attention is given to the identifications of the alkaline-like 5{{s}1/2}-5{{p}3/2} resonance lines in promethium-like highly charged ions. Previous identifications of these lines have been tentative at best due to disagreements with theory and doubts about the experimental charge state identifications. Our experimental results for the 5{{s}1/2}-5{{p}3/2} wavelengths are accurate at the 0.005%-level. Understanding the level-structure of ions near the 4f-5s level crossing is of particular importance for future searches of a possible fine-structure constant variation, and new optical clocks.

  8. Sulfur-oxidizing bacterial endosymbionts: analysis of phylogeny and specificity by 16S rRNA sequences.

    PubMed

    Distel, D L; Lane, D J; Olsen, G J; Giovannoni, S J; Pace, B; Pace, N R; Stahl, D A; Felbeck, H

    1988-06-01

    The 16S rRNAs from the bacterial endosymbionts of six marine invertebrates from diverse environments were isolated and partially sequenced. These symbionts included the trophosome symbiont of Riftia pachyptila, the gill symbionts of Calyptogena magnifica and Bathymodiolus thermophilus (from deep-sea hydrothermal vents), and the gill symbionts of Lucinoma annulata, Lucinoma aequizonata, and Codakia orbicularis (from relatively shallow coastal environments). Only one type of bacterial 16S rRNA was detected in each symbiosis. Using nucleotide sequence comparisons, we showed that each of the bacterial symbionts is distinct from the others and that all fall within a limited domain of the gamma subdivision of the purple bacteria (one of the major eubacterial divisions previously defined by 16S rRNA analysis [C. R. Woese, Microbiol. Rev. 51: 221-271, 1987]). Two host specimens were analyzed in five of the symbioses; in each case, identical bacterial rRNA sequences were obtained from conspecific host specimens. These data indicate that the symbioses examined are species specific and that the symbiont species are unique to and invariant within their respective host species. PMID:3286609

  9. Further resolving the phylogeny of Myxogastria (slime molds) based on COI and SSU rRNA genes.

    PubMed

    Liu, Q Sh; Yan, Sh Zh; Chen, Sh L

    2015-01-01

    To date, molecular systematics of Myxogastria has been based primarily on small subunit ribosomal RNA (SSU rRNA) and elongation factor 1-alpha (EF-1α) genes. To establish a natural classification system for the organisms, we examined phylogenetic relationships among myxogastrian species using cytochrome c oxidase subunit I (COL) and SSU rRNA genes. Twenty new sequences were obtained, including 10 COI and 10 SSU rRNA sequences, were compared with sequences of related species from GenBank in order to construct phylogenic trees. The analysis of the two data sets supported the modern phylogeny of myxogastria: orders Liceida and Trichiida formed a sister group at the most basal clade, while orders Stemonitida and Physarida formed a close group, and order Echinostelida was a sister group to Stemonitida and Physarida. However, the partial COI sequences were too conserved to resolve of the branches in Stemonitida and Physarida. In addition, we also deemed the specific edited mRNA events of COI sequences in myxogastrian species.

  10. Filtering and ranking techniques for automated selection of high-quality 16S rRNA gene sequences.

    PubMed

    De Smet, Wim; De Loof, Karel; De Vos, Paul; Dawyndt, Peter; De Baets, Bernard

    2013-12-01

    StrainInfo has augmented its type strain and species/subspecies passports with a recommendation for a high-quality 16S rRNA gene sequence available from the public sequence databases. These recommendations are generated by an automated pipeline that collects all candidate 16S rRNA gene sequences for a prokaryotic type strain, filters out low-quality sequences and retains a high-quality sequence from the remaining pool. Due to thorough automation, recommendations can be renewed daily using the latest updates of the public sequence databases and the latest species descriptions. We discuss the quality criteria constructed to filter and rank available 16S rRNA gene sequences, and show how a partially ordered set (poset) ranking algorithm can be applied to solve the multi-criteria ranking problem of selecting the best candidate sequence. The proof of concept of the recommender system is validated by comparing the results of automated selection with an expert selection made in the All-Species Living Tree Project. Based on these validation results, the pipeline may reliably be applied for non-type strains and developed further for the automated selection of housekeeping genes.

  11. Further resolving the phylogeny of Myxogastria (slime molds) based on COI and SSU rRNA genes.

    PubMed

    Liu, Q Sh; Yan, Sh Zh; Chen, Sh L

    2015-01-01

    To date, molecular systematics of Myxogastria has been based primarily on small subunit ribosomal RNA (SSU rRNA) and elongation factor 1-alpha (EF-1α) genes. To establish a natural classification system for the organisms, we examined phylogenetic relationships among myxogastrian species using cytochrome c oxidase subunit I (COL) and SSU rRNA genes. Twenty new sequences were obtained, including 10 COI and 10 SSU rRNA sequences, were compared with sequences of related species from GenBank in order to construct phylogenic trees. The analysis of the two data sets supported the modern phylogeny of myxogastria: orders Liceida and Trichiida formed a sister group at the most basal clade, while orders Stemonitida and Physarida formed a close group, and order Echinostelida was a sister group to Stemonitida and Physarida. However, the partial COI sequences were too conserved to resolve of the branches in Stemonitida and Physarida. In addition, we also deemed the specific edited mRNA events of COI sequences in myxogastrian species. PMID:25857192

  12. Phylogeny of intestinal ciliates, including Charonina ventriculi, and comparison of microscopy and 18S rRNA gene pyrosequencing for rumen ciliate community structure analysis.

    PubMed

    Kittelmann, Sandra; Devente, Savannah R; Kirk, Michelle R; Seedorf, Henning; Dehority, Burk A; Janssen, Peter H

    2015-04-01

    The development of high-throughput methods, such as the construction of 18S rRNA gene clone or pyrosequencing libraries, has allowed evaluation of ciliate community composition in hundreds of samples from the rumen and other intestinal habitats. However, several genera of mammalian intestinal ciliates have been described based only on morphological features and, to date, have not been identified using molecular methods. Here, we isolated single cells of one of the smallest but widely distributed intestinal ciliates, Charonina ventriculi, and sequenced its 18S rRNA gene. We verified the sequence in a full-cycle rRNA approach using fluorescence in situ hybridization and thereby assigned an 18S rRNA gene sequence to this species previously known only by its morphology. Based on its full-length 18S rRNA gene sequence, Charonina ventriculi was positioned within the phylogeny of intestinal ciliates in the subclass Trichostomatia. The taxonomic framework derived from this phylogeny was used for taxonomic assignment of trichostome ciliate 18S rRNA gene sequence data stemming from high-throughput amplicon pyrosequencing of rumen-derived DNA samples. The 18S rRNA gene-based ciliate community structure was compared to that obtained from microscopic counts using the same samples. Both methods allowed identification of dominant members of the ciliate communities and classification of the rumen ciliate community into one of the types first described by Eadie in 1962. Notably, each method is associated with advantages and disadvantages. Microscopy is a highly accurate method for evaluation of total numbers or relative abundances of different ciliate genera in a sample, while 18S rRNA gene pyrosequencing represents a valuable alternative for comparison of ciliate community structure in a large number of samples from different animals or treatment groups.

  13. Phylogeny of Intestinal Ciliates, Including Charonina ventriculi, and Comparison of Microscopy and 18S rRNA Gene Pyrosequencing for Rumen Ciliate Community Structure Analysis

    PubMed Central

    Devente, Savannah R.; Kirk, Michelle R.; Seedorf, Henning; Dehority, Burk A.

    2015-01-01

    The development of high-throughput methods, such as the construction of 18S rRNA gene clone or pyrosequencing libraries, has allowed evaluation of ciliate community composition in hundreds of samples from the rumen and other intestinal habitats. However, several genera of mammalian intestinal ciliates have been described based only on morphological features and, to date, have not been identified using molecular methods. Here, we isolated single cells of one of the smallest but widely distributed intestinal ciliates, Charonina ventriculi, and sequenced its 18S rRNA gene. We verified the sequence in a full-cycle rRNA approach using fluorescence in situ hybridization and thereby assigned an 18S rRNA gene sequence to this species previously known only by its morphology. Based on its full-length 18S rRNA gene sequence, Charonina ventriculi was positioned within the phylogeny of intestinal ciliates in the subclass Trichostomatia. The taxonomic framework derived from this phylogeny was used for taxonomic assignment of trichostome ciliate 18S rRNA gene sequence data stemming from high-throughput amplicon pyrosequencing of rumen-derived DNA samples. The 18S rRNA gene-based ciliate community structure was compared to that obtained from microscopic counts using the same samples. Both methods allowed identification of dominant members of the ciliate communities and classification of the rumen ciliate community into one of the types first described by Eadie in 1962. Notably, each method is associated with advantages and disadvantages. Microscopy is a highly accurate method for evaluation of total numbers or relative abundances of different ciliate genera in a sample, while 18S rRNA gene pyrosequencing represents a valuable alternative for comparison of ciliate community structure in a large number of samples from different animals or treatment groups. PMID:25616800

  14. Avoidance and Potential Remedy Solutions of Chimeras in Reconstructing the Phylogeny of Aphids Using the 16S rRNA Gene of Buchnera: A Case in Lachninae (Hemiptera).

    PubMed

    Chen, Rui; Wang, Zhe; Chen, Jing; Qiao, Ge-Xia

    2015-08-25

    It is known that PCR amplification of highly homologous genes from complex DNA mixtures can generate a significant proportion of chimeric sequences. The 16S rRNA gene is not only widely used in estimating the species diversity of endosymbionts in aphids but also used to explore the co-diversification of aphids and their endosymbionts. Thus, chimeric sequences may lead to the discovery of non-existent endosymbiont species and mislead Buchnera-based phylogenetic analysis that lead to false conclusions. In this study, a high probability (6.49%) of chimeric sequence occurrence was found in the amplified 16S rRNA gene sequences of endosymbionts from aphid species in the subfamily Lachninae. These chimeras are hybrid products of multiple parent sequences from the dominant species of endosymbionts in each corresponding host. It is difficult to identify the chimeric sequences of a new or unidentified species due to the high variability of their main parent, Buchnera aphidicola, and because the chimeric sequences can confuse the phylogenetic analysis of 16S rRNA gene sequences. These chimeras present a challenge to Buchnera-based phylogenetic research in aphids. Thus, our study strongly suggests that using appropriate methods to detect chimeric 16S rRNA sequences may avoid some false conclusions in endosymbiont-based aphid research.

  15. Chemical accessibility of the 4.5S RNA in spinach chloroplast ribosomes.

    PubMed Central

    Kumagai, I; Bartsch, M; Subramanian, A R; Erdmann, V A

    1983-01-01

    We have examined the accessibility to diethylpyrocarbonate of spinach chloroplast 4.5S ribosomal RNA when free and when it is part of the ribosomal structure. The modifications in free 4.5S RNA were found mostly in single-stranded regions of the secondary structure model proposed in our previous paper (Kumagai, I. et al. (1982) J.B.C. 257, 12924-28): adenines at positions 17, 19, 33, 36, 54, 55, 60, 64, 68, 72, 77, 86 and 87 were identified as the reactive residues. On the other hand, in 4.5S RNA in 70S ribosomes or 50S subunits, adenine 33 was exclusively modified, and its reactivity was much higher than in free 4.5S RNA. This highly accessible A33 of spinach 4.5S RNA is located within a characteristic seven nucleotide sequence, which is found in the 4.5S rRNAs from spinach, tobacco and a fern but deleted in 4.5S RNAs from maize and wheat. Images PMID:6828382

  16. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio

    2008-01-04

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  17. Primary structure of the 5 S subunit of transcarboxylase as deduced from the genomic DNA sequence.

    PubMed

    Thornton, C G; Kumar, G K; Shenoy, B C; Haase, F C; Phillips, N F; Park, V M; Magner, W J; Hejlik, D P; Wood, H G; Samols, D

    1993-09-13

    Transcarboxylase from Propionibacterium shermanii is a complex biotin-containing enzyme composed of 30 polypeptides of three different types. It is composed of six dimeric outer subunits associated with a central cylindrical hexameric subunit through 12 biotinyl subunits; three outer subunits on each face of the central hexamer. Each outer dimer is termed a 5 S subunit which associates with two biotinyl subunits. The enzyme catalyzes a two-step reaction in which methylmalonyl-CoA and pyruvate form propionyl-CoA and oxalacetate, the 5 S subunit specifically catalyzing one of these reactions. We report here the cloning, sequencing and expression of the monomer of the 5 S subunit. The gene was identified by matching amino acid sequences derived from isolated authentic 5 S peptides with the deduced sequence of an open reading frame present on a cloned P. shermanii genomic fragment known to contain the gene encoding the 1.3 S biotinyl subunit. The cloned 5 S gene encodes a protein of 519 amino acids, M(r) 57,793. The deduced sequence shows regions of extensive homology with that of pyruvate carboxylase and oxalacetate decarboxylase, two enzymes which catalyze the same or reverse reaction. A fragment was subcloned into pUC19 in an orientation such that the 5 S open reading frame could be expressed from the lac promoter of the vector. Crude extracts prepared from these cells contained an immunoreactive band on Western blots which co-migrated with authentic 5 S and were fully active in catalyzing the 5 S partial reaction. We conclude that we have cloned, sequenced and expressed the monomer of the 5 S subunit and that the expressed product is catalytically active. PMID:8365490

  18. Angular distribution of Xe 5s. -->. epsilonp photoelectrons: Disagreement between experiment and theory

    SciTech Connect

    Fahlman, A.; Carlson, T.A.; Krause, M.O.

    1983-04-11

    The angular asymmetry parameter ..beta.. for the Xe 5s..-->..epsilonp photoelectrons has been studied with use of synchrotron radiation (h..nu.. = 28--65 eV). The present results show that the relativistic random-phase approximation theory does not satisfactorily describe the Xe 5s photoionization process close to the Cooper minimum and thus require a renewed theoretical approach. The 5s partial photoionization cross section was obtained over the same photon region and the results agree with experimental values found in the literature.

  19. Abridged 5S rDNA units in sea beet (Beta vulgaris subsp. maritima).

    PubMed

    Turner, Daniel J; Brown, Terence A

    2005-04-01

    Amplification by polymerase chain reaction of the 5S rDNA repeat units of Beta vulgaris subsp. maritima resulted in a 350-bp product corresponding to the full-length 5S unit, but also revealed 4 abridged unit classes, each with a deletion that removed most of the spacer and 12-76 bp of the coding sequence. Each abridged type lacks at least 1 of the conserved elements involved in transcription of the 5S gene, and so appear to be nonfunctional. Network analysis revealed that the abridged units are evolving in the same manner as the full-length versions.

  20. Development of a novel long-range 16S rRNA universal primer set for metagenomic analysis of gastrointestinal microbiota in newborn infants.

    PubMed

    Ku, Hye-Jin; Lee, Ju-Hoon

    2014-06-28

    Metagenomic analysis of the human intestinal microbiota has extended our understanding of the role of these bacteria in improving human intestinal health; however, a number of reports have shown that current total fecal DNA extraction methods and 16S rRNA universal primer sets could affect the species coverage and resolution of these analyses. Here, we improved the extraction method for total DNA from human fecal samples by optimization of the lysis buffer, boiling time (10 min), and bead-beating time (0 min). In addition, we developed a new longrange 16S rRNA universal PCR primer set targeting the V6 to V9 regions with a 580 bp DNA product length. This new 16S rRNA primer set was evaluated by comparison with two previously developed 16S rRNA universal primer sets and showed high species coverage and resolution. The optimized total fecal DNA extraction method and newly designed long-range 16S rRNA universal primer set will be useful for the highly accurate metagenomic analysis of adult and infant intestinal microbiota with minimization of any bias.

  1. Identification and phylogeny of Arabian snakes: Comparison of venom chromatographic profiles versus 16S rRNA gene sequences.

    PubMed

    Al Asmari, Abdulrahman; Manthiri, Rajamohammed Abbas; Khan, Haseeb Ahmad

    2014-11-01

    Identification of snake species is important for various reasons including the emergency treatment of snake bite victims. We present a simple method for identification of six snake species using the gel filtration chromatographic profiles of their venoms. The venoms of Echis coloratus, Echis pyramidum, Cerastes gasperettii, Bitis arietans, Naja arabica, and Walterinnesia aegyptia were milked, lyophilized, diluted and centrifuged to separate the mucus from the venom. The clear supernatants were filtered and chromatographed on fast protein liquid chromatography (FPLC). We obtained the 16S rRNA gene sequences of the above species and performed phylogenetic analysis using the neighbor-joining method. The chromatograms of venoms from different snake species showed peculiar patterns based on the number and location of peaks. The dendrograms generated from similarity matrix based on the presence/absence of particular chromatographic peaks clearly differentiated Elapids from Viperids. Molecular cladistics using 16S rRNA gene sequences resulted in jumping clades while separating the members of these two families. These findings suggest that chromatographic profiles of snake venoms may provide a simple and reproducible chemical fingerprinting method for quick identification of snake species. However, the validation of this methodology requires further studies on large number of specimens from within and across species. PMID:25313278

  2. Radiative lifetime of the 3s3p exp 3(exp 5 S sub 2 exp 0) metastable level of P(+)

    NASA Technical Reports Server (NTRS)

    Calamai, Anthony G.; Han, Xiaofeng; Parkinson, William H.

    1992-01-01

    The present experimental and theoretical results for the radiative lifetime of the 3s3p exp 3(exp 5 S sub 2 exp 0) metastable level of P(+) encompass an experimental determination of the (exp 5 S sub 2 exp 0) lifetime which represents the first measured lifetime of a low charge-state ion in the Si I sequence. This constitutes a fundamental test of the theoretical methods used to determine transition possibilities for intercombination lines involving this level, and suggests that theoretical techniques used to determine such transition probabilities in low-Z species of the Si I isoelectronic sequence should be reevaluated.

  3. Pressure broadening and line shifting of atomic strontium 5s{sup 2} {sup 1}S{sub 0}{yields}5s5p {sup 3}P{sub 1} and 5s5p {sup 3}P{sub 0,1,2}{yields}5s6s {sup 3}S{sub 1} absorption transitions induced by noble-gas collisions

    SciTech Connect

    Holtgrave, Jeremy C.; Wolf, Paul J.

    2005-07-15

    The broadening and shifting of spectral lines induced by collisions with the five noble gases in both the intercombination 5s{sup 2} {sup 1}S{sub 0}{yields}5s5p {sup 3}P{sub 1} system and the triplet 5s5p {sup 3}P{sub 0,1,2}{yields}5s6s {sup 3}S{sub 1} manifold of Sr are studied using tunable dye laser absorption spectroscopy. Cross sections for impact broadening and line shifting are determined from an examination of the spectral line profiles. These results are utilized in an analysis to compute difference potentials modeled by the Lennard-Jones (6-12) potential and the coefficients C{sub 6} and C{sub 12} derived from this analysis are reported.

  4. 104. JOB NO. 1347F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    104. JOB NO. 1347-F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD MOTOR COMPANY; LONGITUDINAL SECTION AND TRUSS DETAILS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  5. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    PubMed

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-11-11

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  6. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  7. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  8. Interaction of Xenopus TFIIIC with the TFIIIA.5 S RNA gene complex.

    PubMed

    Keller, H J; Romaniuk, P J; Gottesfeld, J M

    1992-09-01

    The general transcription factor TFIIIC is necessary for transcription initiation by RNA polymerase III. TFIIIC binds predominantly to the B-Block promoter element, which is present in tRNA genes, several viral RNA genes and repetitive DNA elements, and to the TFIIIA.DNA complex on 5 S RNA genes. Here we report a characterization of Xenopus laevis TFIIIC and its interaction with the TFIIIA.5 S RNA gene complex. A polypeptide with apparent molecular mass of 85 kDa was specifically cross-linked to a B-Block oligonucleotide by UV light. This polypeptide was present in the partially purified TFIIIC fraction and in a complex with a B-Block double-stranded oligonucleotide isolated by nondenaturing gel electrophoresis. TFIIIC.TFIIIA.DNA gel mobility shift complexes were obtained using B-Block DNA affinity-purified TFIIIC and buffer conditions employing low Mg2+ (1 mM) and high dithiothreitol (7 mM) concentrations. Three TFIIIC.TFIIIA.5 S RNA gene complexes were observed by gel mobility shift analysis. One of these complexes was resistant to dissociation by the addition of competing DNA, but the formation of all three complexes was prevented by the inclusion of excess specific competitor DNA in the initial binding reactions. The apparent affinity of TFIIIC for the TFIIIA.5 S DNA complex was 5-fold higher for the somatic-type 5 S RNA gene than for the oocyte-type 5 S RNA gene. Mutations near the 5' boundary of the TFIIIA binding site alter the DNase I footprint of the TFIIIA.DNA complex and reduce the affinity of TFIIIA-mutant 5 S gene complexes for TFIIIC. Differences in TFIIIC affinity for the two classes of 5 S RNA genes may play a role in the developmental regulation of these gene families. PMID:1517247

  9. Satellite DNA derived from 5S rDNA in Physalaemus cuvieri (Anura, Leiuperidae).

    PubMed

    Vittorazzi, S E; Lourenço, L B; Del-Grande, M L; Recco-Pimentel, S M

    2011-01-01

    In the present study, we describe for the first time a family of 190-bp satellite DNA related to 5S rDNA in anurans and the existence of 2 forms of 5S rDNA, type I (201 bp) and type II (690 bp). The sequences were obtained from genomic DNA of Physalaemus cuvieri from Palmeiras, State of Bahia, Brazil. Analysis of the nucleotide sequence revealed that the satellite DNA obtained by digestion with EcoRI, called PcP190EcoRI, is 70% similar to the coding region of type I 5S rDNA and 66% similar to the coding region of type II 5S rDNA. Membrane hybridization and PCR amplification of the sequence showed that PcP190EcoRI is tandemly repeated. The satellite DNA as well as type I and type II 5S rDNA were localized in P. cuvieri chromosomes by fluorescent in situ hybridization. The PcP190EcoRI sequence was found in the centromeres of chromosomes 1-5 and in the pericentromeric region of chromosome 3. Type I 5S rDNA was detected in chromosome 3, coincident with the site of PcP190EcoRI. Type II 5S rDNA was located interstitially in the long arm of chromosome 5. None of these sequences co-localized with nucleolar organizer regions. Our data suggests that this satellite DNA originates from the 5S ribosomal multigene family, probably by gene duplication, nucleotide divergence and sequence dispersion in the genome.

  10. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  11. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  12. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  13. Structural polymorphism in the major groove of a 5S RNA gene complements the zinc finger domains of transcription factor IIIA.

    PubMed Central

    Huber, P W; Morii, T; Mei, H Y; Barton, J K

    1991-01-01

    Metal complexes that bind to DNA on the basis of shape-selection have been used to map the conformational features of the DNA binding site for transcription factor IIIA. Conformationally distinct segments are detected on the 5S rRNA gene that correspond closely to the binding sites identified for the individual zinc finger domains of the protein. The local conformations are characterized by a major groove opened because of a change in base pair inclination and/or displacement at a central 5'-pyrimidine-purine-3' step, flanked by a widened minor groove, as would arise at the junctions between alternating B- and A-like DNA segments. Docking experiments with a consensus structure of a zinc finger reveal that the mixed A-B binding site accommodates the peptide domain better than either canonical B- or A-DNA helices. The close structural matching of the conformational variations in the 5S rDNA both to the proposed sites of zinc finger binding and to the shape of an individual zinc finger domain points to DNA structural polymorphism as providing an important determinant in recognition. In particular, shape selection in the 5' half of the internal control region may orient the multiple finger domains. Images PMID:1961749

  14. Restriction fragment length polymorphism of the 5S-rRNA-NTS region: a rapid and precise method for plant identification.

    PubMed

    Bertea, Cinzia Margherita; Gnavi, Giorgio

    2012-01-01

    Molecular genetic methods have several advantages over classical morphological and chemical analyses. The genetic method requires genotype instead than phenotype, therefore PCR-based techniques have been widely used for a rapid identification of plant species, varieties and chemotypes. Recently, the molecular discrimination of some higher plant species has been evaluated using sequences of a 5S-rRNA gene spacer region. The variation in the nontranscribed sequence (NTS) region has been used in a number of plant species for studying intraspecific variation, genome evolution, and phylogenetic reconstruction. Here, we describe a rapid method based on the use of the 5S-rRNA-NTS region as a tool for plant DNA fingerprinting, which combines PCR, sequencing and restriction fragment length polymorphism analyses. PMID:22419491

  15. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    PubMed Central

    Suslu, Hikmet Turan; Celikoglu, Erhan; Borekcı, Ali; Hıcdonmez, Tufan; Suslu, Hüsnü

    2011-01-01

    Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches. PMID:23125496

  16. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences

    PubMed Central

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-01-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences. PMID:26943621

  17. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences.

    PubMed

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-07-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences. PMID:26943621

  18. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences.

    PubMed

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-07-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences.

  19. A Neurospora crassa ribosomal protein gene, homologous to yeast CRY1, contains sequences potentially coordinating its transcription with rRNA genes.

    PubMed Central

    Tyler, B M; Harrison, K

    1990-01-01

    We have isolated and sequenced a Neurospora crassa ribosomal protein gene (designated crp-2) strongly homologous to the rp59 gene (CRY1) of yeast and the S14 ribosomal protein gene of mammals. The inferred sequence of the crp-2 protein is more homologous (83%) to the mammalian S14 sequence than to the yeast rp59 sequence (69%). The gene has three intervening sequences (IVSs) two of which are offset 7 bp from the position of IVSs in the mammalian genes. None correspond to the position of the IVS in the yeast gene. Crp-2 was mapped by RFLP analysis to the right arm of linkage group III. The 5' region of the gene contains three copies of a sequence, the Ribo box, previously shown to be required for transcription of both 5S and 40S rRNA genes. We speculate that the Ribo box may coordinate ribosomal protein and rRNA gene transcription. Images PMID:1977135

  20. Relationships between parasitoid wasps (Hymenoptera: Braconidae: Opiinae), fruit flies (Diptera: Tephritidae) and their host plants based on 16S rRNA, 12S rRNA, and ND1 gene sequences

    NASA Astrophysics Data System (ADS)

    Ibrahim, N. J.; Md-Zain, B. M.; Yaakop, S.

    2013-11-01

    Opiinae is among the l0 largest subfamilies under the family Braconidae. Opiines species have great potential as natural enemies against fruit fly pests. Before using them as a biological control agent, construction of the phylogenetic trees could facilitate in the molecular identification of individual species and their relationships among members of the Opiines, as well as between Opiines and their host plants. Larval specimens of tephritids were collected from four crop species at five localities throughout the Peninsular Malaysia. A total of 44 specimens of opiines had successfully emerged from the hosts, fruit fly larvae. The DNA sequences of 12S and 16S rRNA were obtained for the braconids while the mitochondrial ND1 sequences were obtained for the tephritids species through polymerase chain reaction. Maximum Parsimony and Bayesian trees were constructed by using PAUP 4.0b10 and MrBayes 3.1.2 to identify the relationships among the taxa. This study illustrates the phylogenetic relationships among parasitoid opiines collected and reared from parasitized fruit flies. The phylogenetic trees constructed based on the mitochondrial 12S and 16S rRNA sequences exhibited similar topology and sequence divergence. The opiines were divided into several clades and subclades according to the genus and species. Each clade also was supported by the similar host plants with high support values. However, their pests were not specific, except for Bactrocera cucurbitae. This study has reconfirmed the associations between Opiinae, tephritids, and host plants based on molecular data.

  1. PCR-based diversity estimates of artificial and environmental 18S rRNA gene libraries.

    PubMed

    Potvin, Marianne; Lovejoy, Connie

    2009-01-01

    Environmental clone libraries constructed using small subunit ribosomal RNA (rRNA) or other gene-specific primers have become the standard molecular approach for identifying microorganisms directly from their environment. This technique includes an initial polymerase chain reaction (PCR) amplification step of a phylogenetically useful marker gene using universal primers. Although it is acknowledged that such primers introduce biases, there have been few studies if any to date systematically examining such bias in eukaryotic microbes. We investigated some implications of such bias by constructing clone libraries using several universal primer pairs targeting rRNA genes. Firstly, we constructed artificial libraries using a known mix of small cultured pelagic arctic algae with representatives from five major lineages and secondly we investigated environmental samples using several primer pairs. No primer pair retrieved all of the original algae in the artificial clone libraries and all showed a favorable bias toward the dinoflagellate Polarella glacialis and a bias against the prasinophyte Micromonas and a pennate diatom. Several other species were retrieved by only one primer pair tested. Despite this, sequences from nine environmental libraries were diverse and contained representatives from all major eukaryotic clades expected in marine samples. Further, libraries from the same sample grouped together using Bray-Curtis clustering, irrespective of primer pairs. We conclude that environmental PCR-based techniques are sufficient to compare samples, but the total diversity will probably always be underestimated and relative abundance estimates should be treated with caution.

  2. Comparison of two approaches for the classification of 16S rRNA gene sequences.

    PubMed

    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan

    2014-10-01

    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods.

  3. An updated 18S rRNA phylogeny of tunicates based on mixture and secondary structure models

    PubMed Central

    Tsagkogeorga, Georgia; Turon, Xavier; Hopcroft, Russell R; Tilak, Marie-Ka; Feldstein, Tamar; Shenkar, Noa; Loya, Yossi; Huchon, Dorothée; Douzery, Emmanuel JP; Delsuc, Frédéric

    2009-01-01

    Background Tunicates have been recently revealed to be the closest living relatives of vertebrates. Yet, with more than 2500 described species, details of their evolutionary history are still obscure. From a molecular point of view, tunicate phylogenetic relationships have been mostly studied based on analyses of 18S rRNA sequences, which indicate several major clades at odds with the traditional class-level arrangements. Nonetheless, substantial uncertainty remains about the phylogenetic relationships and taxonomic status of key groups such as the Aplousobranchia, Appendicularia, and Thaliacea. Results Thirty new complete 18S rRNA sequences were acquired from previously unsampled tunicate species, with special focus on groups presenting high evolutionary rate. The updated 18S rRNA dataset has been aligned with respect to the constraint on homology imposed by the rRNA secondary structure. A probabilistic framework of phylogenetic reconstruction was adopted to accommodate the particular evolutionary dynamics of this ribosomal marker. Detailed Bayesian analyses were conducted under the non-parametric CAT mixture model accounting for site-specific heterogeneity of the evolutionary process, and under RNA-specific doublet models accommodating the occurrence of compensatory substitutions in stem regions. Our results support the division of tunicates into three major clades: 1) Phlebobranchia + Thaliacea + Aplousobranchia, 2) Appendicularia, and 3) Stolidobranchia, but the position of Appendicularia could not be firmly resolved. Our study additionally reveals that most Aplousobranchia evolve at extremely high rates involving changes in secondary structure of their 18S rRNA, with the exception of the family Clavelinidae, which appears to be slowly evolving. This extreme rate heterogeneity precluded resolving with certainty the exact phylogenetic placement of Aplousobranchia. Finally, the best fitting secondary-structure and CAT-mixture models suggest a sister

  4. 16S rRNA sequences of uncultivated hot spring cyanobacterial mat inhabitants retrieved as randomly primed cDNA.

    PubMed Central

    Weller, R; Weller, J W; Ward, D M

    1991-01-01

    Cloning and analysis of cDNAs synthesized from rRNAs is one approach to assess the species composition of natural microbial communities. In some earlier attempts to synthesize cDNA from 16S rRNA (16S rcDNA) from the Octopus Spring cyanobacterial mat, a dominance of short 16S rcDNAs was observed, which appear to have originated only from certain organisms. Priming of cDNA synthesis from small ribosomal subunit RNA with random deoxyhexanucleotides can retrieve longer sequences, more suitable for phylogenetic analysis. Here we report the retrieval of 16S rRNA sequences from three formerly uncultured community members. One sequence type, which was retrieved three times from a total of five sequences analyzed, can be placed in the cyanobacterial phylum. A second sequence type is related to 16S rRNAs from green nonsulfur bacteria. The third sequence type may represent a novel phylogenetic type. Images PMID:1711832

  5. Metagenomic data of fungal internal transcribed Spacer and 18S rRNA gene sequences from Lonar lake sediment, India.

    PubMed

    Dudhagara, Pravin; Ghelani, Anjana; Bhavsar, Sunil; Bhatt, Shreyas

    2015-09-01

    The data in this article contains the sequences of fungal Internal Transcribed Spacer (ITS) and 18S rRNA gene from a metagenome of Lonar soda lake, India. Sequences were amplified using fungal specific primers, which amplified the amplicon lined between the 18S and 28S rRNA genes. Data were obtained using Fungal tag-encoded FLX amplicon pyrosequencing (fTEFAP) technique and used to analyze fungal profile by the culture-independent method. Primary analysis using PlutoF 454 pipeline suggests the Lonar lake mycobiome contained the 29 different fungal species. The raw sequencing data used to perform this analysis along with FASTQ file are located in the NCBI Sequence Read Archive (SRA) under accession No. SRX889598 (http://www.ncbi.nlm.nih.gov/sra/SRX889598).

  6. 16S rRNA sequences of uncultivated hot spring cyanobacterial mat inhabitants retrieved as randomly primed cDNA

    SciTech Connect

    Weller, R.; Ward, D.M. ); Weller, J.W. )

    1991-04-01

    Cloning and analysis of cDNAs synthesized from rRNAs is one approach to assess the species composition of natural microbial communities. In some earlier attempts to synthesize cDNA from 16S rRNA (16S rcDNA) from the Octopus Spring cyanobacterial mat, a dominance of short 16S rcDNAs was observed, which appear to have originated only from certain organisms. Priming of cDNA synthesis from small ribosomal subunit RNA with random deoxyhexanucleotides can retrieve longer sequences, more suitable for phylogenetic analysis. Here we report the retrieval of 16S rRNA sequences form three formerly uncultured community members. One sequence type, which was retrieved three times from a total of five sequences analyzed, can be placed in the cyanobacterial phylum. A second sequence type is related to 16S rRNAs from green nonsulfur bacteria. The third sequence type may represent a novel phylogenetic type.

  7. Formation of Tertiary Interactions during rRNA GTPase Center Folding.

    PubMed

    Rau, Michael J; Welty, Robb; Tom Stump, W; Hall, Kathleen B

    2015-08-28

    The 60-nt GTPase center (GAC) of 23S rRNA has a phylogenetically conserved secondary structure with two hairpin loops and a 3-way junction. It folds into an intricate tertiary structure upon addition of Mg(2+) ions, which is stabilized by the L11 protein in cocrystal structures. Here, we monitor the kinetics of its tertiary folding and Mg(2+)-dependent intermediate states by observing selected nucleobases that contribute specific interactions to the GAC tertiary structure in the cocrystals. The fluorescent nucleobase 2-aminopurine replaced three individual adenines, two of which make long-range stacking interactions and one that also forms hydrogen bonds. Each site reveals a unique response to Mg(2+) addition and temperature, reflecting its environmental change from secondary to tertiary structure. Stopped-flow fluorescence experiments revealed that kinetics of tertiary structure formation upon addition of MgCl2 are also site specific, with local conformational changes occurring from 5 ms to 4s and with global folding from 1 to 5s. Site-specific substitution with (15)N-nucleobases allowed observation of stable hydrogen bond formation by NMR experiments. Equilibrium titration experiments indicate that a stable folding intermediate is present at stoichiometric concentrations of Mg(2+) and suggest that there are two initial sites of Mg(2+) ion association. PMID:26210661

  8. Molecular epidemiology of Theileria annulata and identification of 18S rRNA gene and ITS regions sequences variants in apparently healthy buffaloes and cattle in Pakistan.

    PubMed

    Khan, Muhammad Kasib; He, Lan; Hussain, Altaf; Azam, Sabita; Zhang, Wen-Jie; Wang, Li-Xia; Zhang, Qing-Li; Hu, Min; Zhou, Yan-Qin; Zhao, Junlong

    2013-01-01

    A molecular epidemiological survey was conducted to determine the prevalence of piroplasms in buffaloes and cattle from Sheikhupura and Okara districts of Punjab, Pakistan using reverse line blot (RLB) hybridization assay. The genetic diversity within 18S rRNA gene and ITS regions sequences of various obtained Theileria species (spp.) was also investigated. Briefly, 102 blood samples from buffaloes and cattle in the study districts were collected on blood collection cards and brought to the laboratory. DNA was extracted; the V4 hypervariable region of 18S rRNA was amplified and analyzed using RLB. Out of total samples analyzed, 61 (59.8%) were hybridized with Babesia/Theileria (B/T) genus-specific probe. Only one species of piroplasm was detected in buffaloes and cattle in study districts, i.e. Theileria (T.) annulata. Six samples only hybridized with B/T genus-specific and Theileria genus-specific probes but not with any species-specific probe indicating the presence of novel species or variants. The sequences of 18S rRNA gene and ITS regions of these six samples revealed the presence of T. annulata variants as confirmed through sequence identity estimation and phylogenetic analyses. Meanwhile, an unexpected sequence variation was observed within the 18S rRNA gene and ITS regions sequences of T. annulata identified in the present study. This is the first report on the simultaneous detection of species of piroplasms infecting buffaloes and cattle in Pakistan and molecular characterization of T. annulata 18S rRNA gene and ITS regions. The present study may address the new insights into the epidemiology of theileriosis which will help researches in designing control strategies and developing various molecular diagnostic tools at national level.

  9. Identification of Bacteria in Formalin-Fixed, Paraffin-Embedded Heart Valve Tissue via 16S rRNA Gene Nucleotide Sequencing

    PubMed Central

    Imrit, Kavita; Goldfischer, Michael; Wang, Jie; Green, Jaime; Levine, Jerome; Lombardo, Joseph; Hong, Tao

    2006-01-01

    We applied 16S rRNA gene sequencing to identify bacterial species present in formalin-fixed, paraffin-embedded heart valve tissue. In 40% (12/30) of the cases, we were able to identify the bacterium to the species-genus level. For more recent cases (≤4 years), the success rate was significantly improved, to 70% (P < 0.001). PMID:16825394

  10. Molecular Method for Bartonella Species Identification in Clinical and Environmental Samples▿

    PubMed Central

    García-Esteban, Coral; Gil, Horacio; Rodríguez-Vargas, Manuela; Gerrikagoitia, Xeider; Barandika, Jesse; Escudero, Raquel; Jado, Isabel; García-Amil, Cristina; Barral, Marta; García-Pérez, Ana L.; Bhide, Mangesh; Anda, Pedro

    2008-01-01

    A new, efficient molecular method for detection of Bartonella, based on the 16S-23S rRNA intergenic spacer and 16S rRNA amplification by multiplex PCR combined with reverse line blotting, was designed. This assay could simultaneously detect 20 different known species and other Bartonella species not described previously. PMID:18094134

  11. Non-Random Distribution of 5S rDNA Sites and Its Association with 45S rDNA in Plant Chromosomes.

    PubMed

    Roa, Fernando; Guerra, Marcelo

    2015-01-01

    5S and 45S rDNA sites are the best mapped chromosome regions in eukaryotic chromosomes. In this work, a database was built gathering information about the position and number of 5S rDNA sites in 784 plant species, aiming to identify patterns of distribution along the chromosomes and its correlation with the position of 45S rDNA sites. Data revealed that in most karyotypes (54.5%, including polyploids) two 5S rDNA sites (a single pair) are present, with 58.7% of all sites occurring in the short arm, mainly in the proximal region. In karyotypes of angiosperms with only 1 pair of sites (single sites) they are mostly found in the proximal region (52.0%), whereas in karyotypes with multiple sites the location varies according to the average chromosome size. Karyotypes with multiple sites and small chromosomes (<3 µm) often display proximal sites, while medium-sized (between 3 and 6 µm) and large chromosomes (>6 µm) more commonly show terminal or interstitial sites. In species with holokinetic chromosomes, the modal value of sites per karyotype was also 2, but they were found mainly in a terminal position. Adjacent 5S and 45S rDNA sites were often found in the short arm, reflecting the preferential distribution of both sites in this arm. The high frequency of genera with at least 1 species with adjacent 5S and 45S sites reveals that this association appeared several times during angiosperm evolution, but it has been maintained only rarely as the dominant array in plant genera.

  12. Bacteroides isolated from four mammalian hosts lack host-specific 16S rRNA gene phylogeny and carbon and nitrogen utilization patterns*

    PubMed Central

    Atherly, Todd; Ziemer, Cherie J

    2014-01-01

    One-hundred-and-three isolates of Bacteroides ovatus,B. thetaiotaomicron, and B. xylanisolvens were recovered from cow, goat, human, and pig fecal enrichments with cellulose or xylan/pectin. Isolates were compared using 16S rRNA gene sequencing, repetitive sequence-based polymerase chain reaction (rep-PCR), and phenotypic microarrays. Analysis of 16S rRNA gene sequences revealed high sequence identity in these Bacteroides; with distinct phylogenetic groupings by bacterial species but not host origin. Phenotypic microarray analysis demonstrated these Bacteroides shared the ability to utilize many of the same carbon substrates, without differences due to species or host origin, indicative of their broad carbohydrate fermentation abilities. Limited nitrogen substrates were utilized; in addition to ammonia, guanine, and xanthine, purine derivatives were utilized by most isolates followed by a few amino sugars. Only rep-PCR analysis demonstrated host-specific patterns, indicating that genomic changes due to coevolution with host did not occur by mutation in the 16S rRNA gene or by a gain or loss of carbohydrate utilization genes within these Bacteroides. This is the first report to indicate that host-associated genomic differences are outside of 16S rRNA gene and carbohydrate utilization genes and suggest conservation of specific bacterial species with the same functionality across mammalian hosts for this Bacteroidetes clade. PMID:24532571

  13. Bacteroides isolated from four mammalian hosts lack host-specific 16S rRNA gene phylogeny and carbon and nitrogen utilization patterns.

    PubMed

    Atherly, Todd; Ziemer, Cherie J

    2014-04-01

    One-hundred-and-three isolates of Bacteroides ovatus, B. thetaiotaomicron, and B. xylanisolvens were recovered from cow, goat, human, and pig fecal enrichments with cellulose or xylan/pectin. Isolates were compared using 16S rRNA gene sequencing, repetitive sequence-based polymerase chain reaction (rep-PCR), and phenotypic microarrays. Analysis of 16S rRNA gene sequences revealed high sequence identity in these Bacteroides; with distinct phylogenetic groupings by bacterial species but not host origin. Phenotypic microarray analysis demonstrated these Bacteroides shared the ability to utilize many of the same carbon substrates, without differences due to species or host origin, indicative of their broad carbohydrate fermentation abilities. Limited nitrogen substrates were utilized; in addition to ammonia, guanine, and xanthine, purine derivatives were utilized by most isolates followed by a few amino sugars. Only rep-PCR analysis demonstrated host-specific patterns, indicating that genomic changes due to coevolution with host did not occur by mutation in the 16S rRNA gene or by a gain or loss of carbohydrate utilization genes within these Bacteroides. This is the first report to indicate that host-associated genomic differences are outside of 16S rRNA gene and carbohydrate utilization genes and suggest conservation of specific bacterial species with the same functionality across mammalian hosts for this Bacteroidetes clade.

  14. rrnDB: documenting the number of rRNA and tRNA genes in bacteria and archaea.

    PubMed

    Lee, Zarraz May-Ping; Bussema, Carl; Schmidt, Thomas M

    2009-01-01

    A dramatic exception to the general pattern of single-copy genes in bacterial and archaeal genomes is the presence of 1-15 copies of each ribosomal RNA encoding gene. The original version of the Ribosomal RNA Database (rrnDB) cataloged estimates of the number of 16S rRNA-encoding genes; the database now includes the number of genes encoding each of the rRNAs (5S, 16S and 23S), an internally transcribed spacer region, and the number of tRNA genes. The rrnDB has been used largely by microbiologists to predict the relative rate at which microbial populations respond to favorable growth conditions, and to interpret 16S rRNA-based surveys of microbial communities. To expand the functionality of the rrnDB (http://ribosome.mmg.msu.edu/rrndb/index.php), the search engine has been redesigned to allow database searches based on 16S rRNA gene copy number, specific organisms or taxonomic subsets of organisms. The revamped database also computes average gene copy numbers for any collection of entries selected. Curation tools now permit rapid updates, resulting in an expansion of the database to include data for 785 bacterial and 69 archaeal strains. The rrnDB continues to serve as the authoritative, curated source that documents the phylogenetic distribution of rRNA and tRNA genes in microbial genomes.

  15. Virtual metagenome reconstruction from 16S rRNA gene sequences.

    PubMed

    Okuda, Shujiro; Tsuchiya, Yuki; Kiriyama, Chiho; Itoh, Masumi; Morisaki, Hisao

    2012-01-01

    Microbial ecologists have investigated roles of species richness and diversity in a wide variety of ecosystems. Recently, metagenomics have been developed to measure functions in ecosystems, but this approach is cost-intensive. Here we describe a novel method for the rapid and efficient reconstruction of a virtual metagenome in environmental microbial communities without using large-scale genomic sequencing. We demonstrate this approach using 16S rRNA gene sequences obtained from denaturing gradient gel electrophoresis analysis, mapped to fully sequenced genomes, to reconstruct virtual metagenome-like organizations. Furthermore, we validate a virtual metagenome using a published metagenome for cocoa bean fermentation samples, and show that metagenomes reconstructed from biofilm formation samples allow for the study of the gene pool dynamics that are necessary for biofilm growth.

  16. Phylogeny of some mycoplasmas from ruminants based on 16S rRNA sequences and definition of a new cluster within the hominis group.

    PubMed

    Pettersson, B; Uhlén, M; Johansson, K E

    1996-10-01

    Almost complete (> 96%) 16S rRNA sequences from nine ruminant mycoplasmas have been determined by solid-phase DNA sequencing. Polymorphisms were found in four of the 16S rRNA sequences, which indicated the existence of two different rRNA operons. Seven polymorphisms were found in Mycoplasma agalatiae, three were found in Mycoplasma bovis, one was found in Mycoplasma alkalescens, and one was found in Mycoplasma bovirhinis. The sequence data were used for construction of phylogenetic trees. All but one of the ruminant mycoplasmas sequenced in this work clustered in the hominis group. A close relationship was found between M. agalactiae and M. bovis, with a 99% nucleotide similarity between their 16S rRNA sequences. They were also found to be members of the Mycoplasma lipophilum cluster of the hominis group. Furthermore, the 16S rRNA comparisons showed that Mycoplasma alkalescens and Mycoplasma canadense are closely related (> 98.5%), and these species were found to cluster in the Mycoplasma hominis cluster of the hominis group. Interestingly, M. bovirhinis grouped in a new phylogenetic cluster of the hominis group. The new cluster, which was supported by bootstrap percentage values, signature nucleotide analysis, and higher-order structural elements, was named the Mycoplasma synoviae cluster. Mycoplasma bovoculi, Mycoplasma conjunctivae, and Mycoplasma ovipneumoniae clustered in the Mycoplasma neurolyticum cluster of the hominis group. Mycoplasma alvi clustered with Mycoplasma pirum in the M. pneumoniae cluster of the pneumoniae group.

  17. Phylogenetic diversity of ultraplankton plastid small-subunit rRNA genes recovered in environmental nucleic acid samples from the Pacific and Atlantic coasts of the United States.

    PubMed

    Rappé, M S; Suzuki, M T; Vergin, K L; Giovannoni, S J

    1998-01-01

    The scope of marine phytoplankton diversity is uncertain in many respects because, like bacteria, these organisms sometimes lack defining morphological characteristics and can be a challenge to grow in culture. Here, we report the recovery of phylogenetically diverse plastid small-subunit (SSU) rRNA gene (rDNA) clones from natural plankton populations collected in the Pacific Ocean off the mouth of Yaquina Bay, Oreg. (OCS clones), and from the eastern continental shelf of the United States off Cape Hatteras, N.C. (OM clones). SSU rRNA gene clone libraries were prepared by amplifying rDNAs from nucleic acids isolated from plankton samples and cloning them into plasmid vectors. The PCR primers used for amplification reactions were designed to be specific for bacterial SSU rRNA genes; however, plastid genes have a common phylogenetic origin with bacteria and were common in both SSU rRNA gene clone libraries. A combination of restriction fragment length polymorphism analyses, nucleic acid sequencing, and taxon-specific oligonucleotide probe hybridizations revealed that 54 of the 116 OCS gene clones were of plastid origin. Collectively, clones from the OCS and OM libraries formed at least eight unique lineages within the plastid radiation, including gene lineages related to the classes Bacillariophyceae, Cryptophyceae, Prymnesiophyceae, Chrysophyceae, and Prasinophyceae; for a number of unique clones, no close phylogenetic neighbors could be identified with confidence. Only a group of two OCS rRNA gene clones showed close identity to the plastid SSU rRNA gene sequence of a cultured organism [Emiliania huxleyi (Lohmann) Hay and Mohler; 99.8% similar]. The remaining clones could not be identified to the genus or species level. Although cryptic species are not as prevalent among phytoplankton as they are among their bacterial counterparts, this genetic survey nonetheless uncovered significant new information about phytoplankton diversity. PMID:9435081

  18. Interactions of aminoglycoside antibiotics with rRNA.

    PubMed

    Trylska, Joanna; Kulik, Marta

    2016-08-15

    Aminoglycoside antibiotics are protein synthesis inhibitors applied to treat infections caused mainly by aerobic Gram-negative bacteria. Due to their adverse side effects they are last resort antibiotics typically used to combat pathogens resistant to other drugs. Aminoglycosides target ribosomes. We describe the interactions of aminoglycoside antibiotics containing a 2-deoxystreptamine (2-DOS) ring with 16S rRNA. We review the computational studies, with a focus on molecular dynamics (MD) simulations performed on RNA models mimicking the 2-DOS aminoglycoside binding site in the small ribosomal subunit. We also briefly discuss thermodynamics of interactions of these aminoglycosides with their 16S RNA target. PMID:27528743

  19. Growth rate regulation of rRNA content of a marine Synechococcus (cyanobacterium) strain

    SciTech Connect

    Binder, B.J.; Liu, Y.C.

    1998-09-01

    The relationship between growth rate and rRNA content in a marine Synechococcus strain was examined. A combination of flow cytometry and whole-cell hybridization with fluorescently labeled 16S rRNA-targeted oligonucleotide probes was used to measure the rRNA content of Synechococcus strain WH8101 cells grown at a range of light-limited growth rates. The sensitivity of this approach was sufficient for the analysis of rRNA even in very slowly growing Synechococcus cells. The relationship between growth rate and cellular rRNA content comprised three phases: (1) at low growth rates, rRNA cell{sup {minus}1} remained approximately constant; (2) at intermediate rates, rRNA cell{sup {minus}1} increased proportionally with growth rate; and (3) at the highest, light-saturated rates, rRNA cell{sup {minus}1} dropped abruptly. Total cellular RNA was well correlated with the probe-based measure of rRNA and varied in a similar manner with growth rate. Mean cell volume and rRNA concentration were related to growth rate in a manner similar to rRNA cell{sup {minus}1}, although the overall magnitude linear increase in ribosome efficiency with increasing growth rate, which is consistent with the prevailing prokaryotic model at low growth rates. Taken together, these results support the notion that measurements of cellular rRNA content might be useful for estimating in situ growth rates in natural Synechococcus populations.

  20. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics.

  1. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  2. Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

    PubMed Central

    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2011-01-01

    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

  3. Strong nondipole effect created by multielectron correlation in 5s photoionization of xenon

    SciTech Connect

    Ricz, S.; Koever, A.; Varga, D.; Ricsoka, T.; Sankari, R.; Jurvansuu, M.; Nikkinen, J.; Aksela, H.; Aksela, S.

    2003-01-01

    The angular distribution of the Xe 5s photoelectrons was measured in the 90-225 eV photon energy range using linearly polarized synchrotron radiation. The experimentally determined angular distribution parameters were compared with theoretical values obtained from calculations based on the random-phase approximation and the time-dependent density-functional theory. Experiment shows that the dipole ({beta}) and nondipole ({gamma}) parameters vary strongly as a function of the photon energy, in accordance with calculations that account for the interchannel coupling. Nondipole effects observed clearly in experiment confirm the role of multielectron correlation in describing the 5s photoionization of Xe far from the ionization threshold.

  4. The radiative lifetime of the 5S(0)2 metastable level of O(2+)

    NASA Technical Reports Server (NTRS)

    Johnson, B. C.; Smith, P. L.; Knight, R. D.

    1984-01-01

    The radiative lifetime of the 5S(0)2 metastable level of O(2+) was measured as 1.22 + or - 0.08 ms at the 90 percent confidence level by observing the time dependence of the spontaneous emission from metastable ions created and stored in a cylindrical radio-frequency ion trap. The intersystem line emission 2s(2)2p(2) 3P - 2s2p(3) 5S(0) was observed at 1660.8 and 1666.2 A. Discrepancies between measured and calculated values indicate that certain calculated transition probabilities for intersystem lines may be less reliable than previously believed.

  5. The nucleotide sequences of 5S rRNAs from three ciliated protozoa.

    PubMed Central

    Kumazaki, T; Hori, H; Osawa, S; Mita, T; Higashinakagawa, T

    1982-01-01

    The nucleotide sequences of 5S rRNAs from three ciliated protozoa, Paramecium tetraurelia, Tetrahymena thermophila and Blepharisma japonicum have been determined. All of them are 120 nucleotides long and the sequence of probable tRNA binding site of position 41-44 is GAAC which is characteristic of the plant 5S rRNAs. The sequence similarity percents are 87% (Paramecium/Tetrahymena), 86% (Paramecium/Blepharisma) and 79% (Tetrahymena/Blepharisma), suggesting a close relationship of these three ciliates. PMID:7122243

  6. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    PubMed

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  7. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  8. Natural-abundance stable carbon isotopes of small-subunit ribosomal RNA (SSU rRNA) from Guaymas Basin (Mexico)

    NASA Astrophysics Data System (ADS)

    MacGregor, B. J.; Mendlovitz, H.; Albert, D.; Teske, A. P.

    2012-12-01

    Small-subunit ribosomal RNA (SSU rRNA) is a phylogenetically informative molecule found in all species. Because it is poorly preserved in most environments, it is a useful marker for active microbial populations. We are using the natural-abundance stable carbon isotopic composition of specific microbial groups to help identify the carbon substrates contributing to microbial biomass in a variety of marine environments. At Guaymas Basin, hydrothermal fluids interact with abundant sedimentary organic carbon to produce natural gas and petroleum. Where this reaches the sediment surface, it can support dense patches of seafloor life, including Beggiatoa mats. We report here on the stable carbon isotopic composition of SSU rRNA from a Beggiatoa mat transect, a cold background site, a warm site with high oil concentration, and a second Beggiatoa mat. The central part of the transect mat overlay the steepest temperature gradient, and was visually dominated by orange Beggiatoa. This was fringed by white Beggiatoa mat and bare, but still warm, sediment. Methane concentrations were saturating beneath the orange and white mats and at the oily site, lower beneath bare sediment, and below detection at the background site. Our initial hypotheses were that rRNA isotopic composition would be strongly influenced by methane supply, and that archaeal rRNA might be lighter than bacterial due to contributions from methanogens and anaerobic methane oxidizers. We used biotin-labeled oligonucleotides to capture Bacterial and Archaeal SSU rRNA for isotopic determination. Background-site rRNA was isotopically heaviest, and bacterial RNA from below 2 cm at the oily site was lightest, consistent with control by methane. Within the transect mat, however, the pattern was more complicated; at some sediment depths, rRNA from the mat periphery was isotopically lightest. Part of this may be due to the spatially and temporally variable paths followed by hydrothermal fluid, which can include horizontal

  9. Molecular Cytogenetics in Digenean Parasites: Linked and Unlinked Major and 5S rDNAs, B Chromosomes and Karyotype Diversification.

    PubMed

    García-Souto, Daniel; Pasantes, Juan J

    2015-01-01

    Digenetic trematodes are the largest group of internal metazoan parasites, but their chromosomes are poorly studied. Although chromosome numbers and/or karyotypes are known for about 300 of the 18,000 described species, molecular cytogenetic knowledge is mostly limited to the mapping of telomeric sequences and/or of major rDNA clusters in 9 species. In this work we mapped major and 5S rDNA clusters and telomeric sequences in chromosomes of Bucephalus minimus, B. australis, Prosorhynchoides carvajali (Bucephaloidea), Monascus filiformis (Gymnophalloidea), Parorchis acanthus (Echinostomatoidea), Cryptocotyle lingua (Opisthorchioidea), Cercaria longicaudata, Monorchis parvus (Monorchioidea), Diphterostomum brusinae, and Bacciger bacciger (Microphalloidea). Whilst single major and minor rDNA clusters were mapped to different chromosome pairs in B. minimus and P. acanthus, overlapping signals were detected on a single chromosome pair in the remaining taxa. FISH experiments using major rDNA and telomeric probes clearly demonstrated the presence of highly stretched NORs in most of the digenean taxa analyzed. B chromosomes were detected in the B. bacciger samples hosted by Ruditapes decussatus. Although the cercariae specimens obtained from Donax trunculus, Tellina tenuis, and R. decussatus were in agreement with B. bacciger, their karyotypes showed striking morphological differences in agreement with the proposed assignation of these cercariae to different species of the genus Bacciger. Results are discussed in comparison with previous data on digenean chromosomes. PMID:26680763

  10. Diversity of Archaea in Icelandic hot springs based on 16S rRNA and chaperonin genes.

    PubMed

    Mirete, Salvador; de Figueras, Carolina G; González-Pastor, Jose E

    2011-07-01

    The diversity of archaeal communities growing in four hot springs (65-90 °C, pH 6.5) was assessed with 16S rRNA gene primers specific for the domain Archaea. Overall, mainly uncultured members of the Desulfurococcales, the Thermoproteales and the Korarchaeota, were identified. Based on this diversity, a set of chaperonin heat-shock protein (Hsp60) gene sequences from different archaeal species were aligned to design two degenerate primer sets for the amplification of the chaperonin gene: Ths and Kor (which can also detect the korarchaeotal chaperonin gene from one of the samples). A phylogenetic tree was constructed using the chaperonin sequences retrieved and other sequences from cultured representatives. The Alpha and Beta paralogs of the chaperonin gene were observed within the main clades and orthologs among them. Cultivated representatives from these clades were assigned to either paralog in the chaperonin tree. Uncultured representatives observed in the 16S rRNA gene analysis were found to be related to the Desulfurococcales. The topologies of the 16S rRNA gene and chaperonin phylogenetic trees were compared, and similar phylogenetic relationships were observed. Our results suggest that the chaperonin Hsp60 gene may be used as a phylogenetic marker for the clades found in this extreme environment.

  11. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON QSAR

    EPA Science Inventory

    Dyer, S.D., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to predict HC5's Based on QSARs (Abstract). To be presented at the SETAC Europe 14th Annual Meeting: Environmental Science Solution: A Pan-European Perspective, 18-...

  12. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica.

  13. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON MINIMAL DATA

    EPA Science Inventory

    Dyer, S., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to Predict HC5's Based on Minimal Data (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portland, OR. 1 p. (ERL,GB R1013).

  14. The 5-S RNA . protein complex from an extreme halophile, Halobacterium cutirubrum. Purification and characterization.

    PubMed

    Smith, N; Matheson, A T; Yaguchi, M; Willick, G E; Nazar, R N

    1978-09-01

    A 5-S RNA . protein complex has been isolated from the 50-S ribosomal subunit of an extreme halophile, Halobacterium cutirubrum. The 50-S ribosomal subunit from the extreme halophile requires 3.4 M K+ and 100 mM Mg2+ for stability. However, if the high K+ concentration is maintained but the Mg2+ concentration lowered to 0.3 mM, the 5-S RNA . protein complex is selectively extracted from the subunit. After being purified on an Agarose 0.5-m column the complex had a molecular weight of about 80000 and contained 5-S RNA and two proteins, HL13 and HL19, with molecular weights (by sedimentation equilibrium) of 18700 and 18000, respectively. No ATPase or GTPase activity could be detected in the 5-S RNA . protein complex. The amino acid composition and electrophoretic mobility on polyacrylamide gels indicated both proteins were much more acidic than the equivalent from Escherichia coli or Bacillus stearothermophilus. Partial amino acid sequence data suggest HL13 is homologous to EL18 and HL19 to EL5.

  15. Characterization of Ffh of Mycobacterium tuberculosis and its interaction with 4.5S RNA.

    PubMed

    Palaniyandi, Kannan; Veerasamy, Malini; Narayanan, Sujatha

    2012-10-12

    Signal recognition particle (SRP) mediates targeting of proteins to appropriate cellular compartments, which is an important process in all living organisms. In prokaryotes, SRP consists of Ffh, a protein, and 4.5S RNA that recognizes signal peptide emerging from ribosomes. The SRP (Ffh) of one the most successful intracellular pathogen, Mycobacterium tuberculosis, has been investigated with respect to biochemical properties. In the present study, Ffh of M. tuberculosis was overexpressed and was confirmed to be a GTPase using thin layer chromatography and malachite green assay. The GTP binding ability was confirmed by GTP overlay assay. The 4.5S RNA sequence of M. tuberculosis was synthesized by in vitro transcription assay. The interaction between Ffh and 4.5S RNA was confirmed by overlay assay and RNA gel shift assay. The results show that the biochemical properties of M. tuberculosis Ffh have been conserved, and this is the first report that shows the interaction of components of SRP in M. tuberculosis, namely Ffh protein and 4.5S RNA.

  16. 10. GIRDER APPROACH ON YORKTOWN SIDE, SHOWING PIERS 8S5S (LEFT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. GIRDER APPROACH ON YORKTOWN SIDE, SHOWING PIERS 8S-5S (LEFT TO RIGHT), AND FLOORBEAM/STRINGER SYSTEM. VIEW LOOKING NORTH. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

  17. Nucleolar association and transcriptional inhibition through 5S rDNA in mammals.

    PubMed

    Fedoriw, Andrew M; Starmer, Joshua; Yee, Della; Magnuson, Terry

    2012-01-01

    Changes in the spatial positioning of genes within the mammalian nucleus have been associated with transcriptional differences and thus have been hypothesized as a mode of regulation. In particular, the localization of genes to the nuclear and nucleolar peripheries is associated with transcriptional repression. However, the mechanistic basis, including the pertinent cis- elements, for such associations remains largely unknown. Here, we provide evidence that demonstrates a 119 bp 5S rDNA can influence nucleolar association in mammals. We found that integration of transgenes with 5S rDNA significantly increases the association of the host region with the nucleolus, and their degree of association correlates strongly with repression of a linked reporter gene. We further show that this mechanism may be functional in endogenous contexts: pseudogenes derived from 5S rDNA show biased conservation of their internal transcription factor binding sites and, in some cases, are frequently associated with the nucleolus. These results demonstrate that 5S rDNA sequence can significantly contribute to the positioning of a locus and suggest a novel, endogenous mechanism for nuclear organization in mammals.

  18. Relativistic effects on interchannel coupling in atomic photoionization: The photoelectron angular distribution of Xe 5s

    SciTech Connect

    Hemmers, O.; Manson, S. T.; Sant'Anna, M. M.; Focke, P.; Wang, H.; Sellin, I. A.; Lindle, D. W.

    2001-08-01

    Measurements of the photoelectron angular-distribution asymmetry parameter {beta} for Xe 5s photoionization have been performed in the 80--200 eV photon-energy region. The results show a substantial deviation from the nonrelativistic value of {beta}=2 and provide a clear signature of significant relativistic effects in interchannel coupling.

  19. 12. PIERS 5S AND 4S, SHOWING TRANSITION AT 4S FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. PIERS 5S AND 4S, SHOWING TRANSITION AT 4S FROM GIRDER SPAN TO 'SUSPENDED' TRUSS SPAN AT U0. VIEW LOOKING WEST. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

  20. An efficient synthetic approach to 6,5'-(S)- and 6,5'-(R)-cyclouridine.

    PubMed

    Theile, Christopher S; McLaughlin, Larry W

    2012-06-01

    Here we present new routes for the efficient syntheses of 6,5'-(S)- and 6,5'-(R)-cyclouridine. The syntheses utilize readily accessible uridine as a starting material. This route to the R diastereomer is significantly more efficient than previous synthetic efforts, allowing us to obtain large amounts of pure material for future biological testing.

  1. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  2. Adaptation of the S-5-S pendulum seismometer for measurement of rotational ground motion

    NASA Astrophysics Data System (ADS)

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-10-01

    The Russian electrodynamic seismometer model S-5-S has been adapted for the measurement of rotational ground motion. The mechanical system of the original S-5-S seismometer consists of electrodynamic sensing and damping transducer coils mounted on an asymmetrical double-arm pendulum. This pendulum is suspended on a footing using two pairs of crossed flat springs, which operate as the axis of rotation. The pendulum is stabilised by an additional spring. The S-5-S can be used either as a vertical or as a horizontal sensor. The adaptation of the S-5-S seismometer described below involves removal of the additional spring and installation of an additional mass on the damping arm. Strain gauge angle sensors are installed on one pair of the crossed flat springs. The main dynamic parameters of the rotational seismometer created in this way, i.e. the natural period and damping, are controlled electronically by feedback currents proportional to the angular displacement and angular velocity, both fed to the damping transducer coil. This new seismometer, named the S-5-SR, enables measurement of the rotational component of ground motion around the horizontal or the vertical axes. The output signal from this S-5-SR seismometer can be proportional either to rotational displacement or rotational velocity.

  3. Biosynthesis of resorcylic acid lactone (5S)-5-hydroxylasiodiplodin in Lasiodiplodia theobromae.

    PubMed

    Kashima, Takasumi; Takahashi, Kosaku; Matsuura, Hideyuki; Nabeta, Kensuke

    2009-11-01

    An administration study of (2)H-labeled precursors showed that the 9-hydroxydecanoyl unit, the acyl intermediate of lasiodiplodin (1), was also the intermediate of (5S)-5-hydroxylasiodiplodin (2) in Lasiodiplodia theobromae. The incorporation of [O-methyl-(2)H(3)]-lasiodiplodin (6) into 2 indicated that hydroxylation at C-5 occurred after cyclization. PMID:19897901

  4. PAGE analysis of the heteroduplexes formed between PCR-amplified 16S rRNA genes: estimation of sequence similarity and rDNA complexity.

    PubMed

    Espejo, R T; Feijóo, C G; Romero, J; Vásquez, M

    1998-06-01

    Analysis of the 16S rRNA genes retrieved directly from different environments has proven to be a powerful tool that has greatly expanded our knowledge of microbial diversity and phylogeny. It is shown here that sequence similarity between 80 and 100% among 16S rDNAs can be estimated by the electrophoretic migration of their heteroduplexes. This was measured by hybridization and electrophoresis in polyacrylamide gels of the product obtained after PCR amplification of almost the entire 16S rRNA gene from different bacterial species. These heteroduplexes were also observed after amplification of samples containing DNA from two or more bacterial species and a procedure was applied to identify reliably heteroduplexes among the amplification products. The electrophoretic migration of the heteroduplexes observed after PCR was used to detect the presence of 16S rDNAs with different sequences in DNA extracted from both a mixture of two bacterial species and samples containing a natural bacterial community.

  5. Bile acid receptor TGR5, NADPH Oxidase NOX5-S and CREB Mediate Bile Acid-Induced DNA Damage In Barrett’s Esophageal Adenocarcinoma Cells

    PubMed Central

    Li, Dan; Cao, Weibiao

    2016-01-01

    The mechanisms whereby bile acid reflux may accelerate the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. In this study we found that bile acid taurodeoxycholic acid (TDCA) significantly increased the tail moment (TM) and histone H2AX phosphorylation in FLO-1 EA cells, an increase which was significantly decreased by knockdown of TGR5. Overexpression of TGR5 significantly increased TDCA-induced TM increase and H2AX phosphorylation. In addition, NADPH oxidase inhibitor diphenylene iodonium significantly inhibited the TDCA-induced increase in TM and H2AX phosphorylation. TDCA-induced increase in TM and H2AX phosphorylation was significantly decreased by knockdown of NOX5-S and overexpression of NOX5-S significantly increased TDCA-induced increase in the tail moment and H2AX phosphorylation. Furthermore, TDCA significantly increased cAMP response element binding protein (CREB) phosphorylation in FLO-1 cells. Knockdown of CREB significantly decreased TDCA-induced increase in NOX5-S mRNA and the tail moment. Conversely, overexpression of CREB significantly increased TDCA-induced TM increase. We conclude that TDCA-induced DNA damage may depend on the activation of TGR5, CREB and NOX5-S. It is possible that in Barrett’s patients bile acids may activate NOX5-S and increase reactive oxygen species (ROS) production via activation of TGR5 and CREB. NOX5-S-derived ROS may cause DNA damage, thereby contributing to the progression from BE to EA. PMID:27511066

  6. Bile acid receptor TGR5, NADPH Oxidase NOX5-S and CREB Mediate Bile Acid-Induced DNA Damage In Barrett's Esophageal Adenocarcinoma Cells.

    PubMed

    Li, Dan; Cao, Weibiao

    2016-01-01

    The mechanisms whereby bile acid reflux may accelerate the progression from Barrett's esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. In this study we found that bile acid taurodeoxycholic acid (TDCA) significantly increased the tail moment (TM) and histone H2AX phosphorylation in FLO-1 EA cells, an increase which was significantly decreased by knockdown of TGR5. Overexpression of TGR5 significantly increased TDCA-induced TM increase and H2AX phosphorylation. In addition, NADPH oxidase inhibitor diphenylene iodonium significantly inhibited the TDCA-induced increase in TM and H2AX phosphorylation. TDCA-induced increase in TM and H2AX phosphorylation was significantly decreased by knockdown of NOX5-S and overexpression of NOX5-S significantly increased TDCA-induced increase in the tail moment and H2AX phosphorylation. Furthermore, TDCA significantly increased cAMP response element binding protein (CREB) phosphorylation in FLO-1 cells. Knockdown of CREB significantly decreased TDCA-induced increase in NOX5-S mRNA and the tail moment. Conversely, overexpression of CREB significantly increased TDCA-induced TM increase. We conclude that TDCA-induced DNA damage may depend on the activation of TGR5, CREB and NOX5-S. It is possible that in Barrett's patients bile acids may activate NOX5-S and increase reactive oxygen species (ROS) production via activation of TGR5 and CREB. NOX5-S-derived ROS may cause DNA damage, thereby contributing to the progression from BE to EA. PMID:27511066

  7. Photodissociation dynamics of superexcited O2: Dissociation channels O(5S) vs. O(3S)

    NASA Astrophysics Data System (ADS)

    Zhou, Yiyong; Meng, Qingnan; Mo, Yuxiang

    2014-07-01

    The photodissociation dynamics of O2, O2 + hυ → O(3P) + O(2p3(4S)3s, 3S/5S), has been studied by combining the XUV laser pump / UV laser probe and velocity map imaging methods in the photon energy range 14.64-15.20 eV. The fragment yield spectra of O(3S) and O(5S) and their velocity map images have been recorded using the state-selective (1+1) REMPI method to detect the fragments. The fragment yield spectra show resolved fine structure that arises from the predissociated Rydberg states I, I' and I″ (3ΠΩ = 0,1,2). The branching ratios between the two decay channels have been measured by one-photon ionization of the fragments O(3S) and O(5S) simultaneously. It is surprising to find that the dissociation cross sections for the production of O(5S) are larger than, or comparable to, those of O(3S) for the I and I' states, while the cross sections for the production of O(5S) are smaller than those of O(3S) for the I″ state. All fragments O(5S) arise from perpendicular transitions, which provides direct experimental evidence about the symmetry assignments of the states I, I' and I″ excited in this energy region. Although most of the fragments O(3S) arise from perpendicular transitions, some of them are from parallel transitions. Based on the calculated ab initio potential energy curves, we propose that the neutral dissociation into O(3P) + O(3S) occurs mainly via the interaction of the Rydberg states I, I', and I″ with the vibrational continuum of the diabatic 83Πu state (1π _u^{ - 1} (a^4 {Π}_u {)3}sσ _g ,^3 Π_u), while the neutral dissociation into O(3P) + O(5S) occurs mainly via the interaction of Rydberg states I, I', and I″ with the diabatic 73Πu (1π _g^{ - 1} (X^2 {Π}_g {)3}p{σ }_u ,^3 Π_u).

  8. Transcription factor IIIA induced bending of the Xenopus somatic 5S gene promoter.

    PubMed

    Schroth, G P; Cook, G R; Bradbury, E M; Gottesfeld, J M

    1989-08-10

    Transcription factor IIIA (TFIIIA), the canonical zinc-finger protein, is a protein of relative molecular mass 39,000 (39K) that is required for transcription of 5S-ribosomal subunit genes in Xenopus. It binds in a sequence-specific manner to the internal control region of the 5S gene (see Fig. 1) and facilitates transcription of the gene by RNA polymerase III. It also binds to the 5S gene product to form a 7S ribonucleoprotein particle. In oocytes the 7S particle acts as a storage form of the RNA to be utilized later in development. TFIIIA binds to DNA through its 30 K N-terminal domain, which contains nine zinc-fingers. TFIIIA was the first protein described to have this type of DNA binding motif, but numerous other proteins have now been shown to have zinc-finger domains. A structure for a single zinc-finger from the yeast protein ADR1, was recently proposed based on two-dimensional NMR data (ref. 8), and a similar structure was proposed based on comparison with crystal structures of other metalloproteins. Although models for the interaction of TFIIIA with the 5S-ribosomal gene DNA have been proposed, based on nuclease digestion and methylation interference data, little precise structural information is available for TFIIIA and the physical basis for the interaction of zinc-fingers with DNA is not understood. Using both circular permutation and circularization assays we provide convincing biochemical evidence that TFIIIA bends the DNA at the internal promoter of the 5S gene.

  9. Application of rRNA probes and fluorescence in situ hybridization for rapid detection of the toxic dinoflagellate Alexandrium minutum

    NASA Astrophysics Data System (ADS)

    Tang, Xianghai; Yu, Rencheng; Zhou, Mingjiang; Yu, Zhigang

    2012-03-01

    The dinoflagellate Alexandrium minutum is often associated with harmful algal blooms (HABs). This species consists of many strains that differ in their ability to produce toxins but have similar morphology, making identification difficult. In this study, species-specific rRNA probes were designed for whole-cell fluorescence in situ hybridization (FISH) to distinguish A. minutum from two phylogenetic clades. We acquired the complete SSU to LSU rDNA sequences (GenBank accession numbers JF906989-JF906999) of 11 Alexandrium strains and used these to design rRNA targeted oligonucleotide probes. Three ribotype-specific probes, M-GC-1, M-PC-2, and M-PC-3, were designed. The former is specific for the GC clade ("Global clade") of A. minutum, the majority of which have been found non-toxic, and the latter two are specific for the PSP (paralytic shellfish poisoning)-producing PC clade ("Pacific clade"). The specificity of these three probes was confirmed by FISH. All cells in observed fields of view were fluorescently labeled when probes and target species were incubated under optimized FISH conditions. However, the accessibility of rRNA molecules in ribosomes varied among the probe binding positions. Thus, there was variation in the distribution of positive signals in labeled cells within nucleolus and cytosol (M-GC-1, M-PC-3), or just nucleolus (M-PC-2). Our results provide a methodological basis for studying the biogeography and population dynamics of A. minutum, and providing an early warning of toxic HABs.

  10. SSU rRNA reveals a sequential increase in shell complexity among the euglyphid testate amoebae (Rhizaria: Euglyphida).

    PubMed

    Lara, Enrique; Heger, Thierry J; Mitchell, Edward A D; Meisterfeld, Ralf; Ekelund, Flemming

    2007-04-01

    The existing data on the molecular phylogeny of filose testate amoebae from order Euglyphida has revealed contradictions between traditional morphological classification and SSU rRNA phylogeny and, moreover, the position of several important genera remained unknown. We therefore carried out a study aiming to fill several important gaps and better understand the relationships among the main euglyphid testate amoebae and the evolutionary steps that led to the present diversity at a higher level. We obtained new SSU rRNA sequences from five genera and seven species. This new phylogeny obtained shows that (1) the clade formed by species of genera Assulina and Placocista branches unambiguously at the base of the subclade of Euglyphida comprising all members of the family Trinematidae and genus Euglypha, (2) family Trinematidae (Trachelocorythion, Trinema, and Corythion) branches as a sister group to genus Euglypha, (3) three newly sequenced Euglypha species (E. cf. ciliata, E. penardi, and E. compressa) form a new clade within the genus. Since our results show that Assulina and Placocista do not belong to the Euglyphidae (unless the Trinematidae are also included in this family), we propose the creation of a new family named Assulinidae. Consequently, we give a family status to the genera Euglypha and (tentatively) Scutiglypha, which become the new family Euglyphidae. The evolutionary pattern suggested by SSU rRNA phylogeny shows a clear tendency towards increasing morphological complexity of the shell characterised by changes in the symmetry (migration of the aperture to a ventral position and/or compression of the shell) and the appearance of specialised scales at the aperture (in families Trinematidae and Euglyphidae). PMID:17292668

  11. CLUSTOM: a novel method for clustering 16S rRNA next generation sequences by overlap minimization.

    PubMed

    Hwang, Kyuin; Oh, Jeongsu; Kim, Tae-Kyung; Kim, Byung Kwon; Yu, Dong Su; Hou, Bo Kyeng; Caetano-Anollés, Gustavo; Hong, Soon Gyu; Kim, Kyung Mo

    2013-01-01

    The recent nucleic acid sequencing revolution driven by shotgun and high-throughput technologies has led to a rapid increase in the number of sequences for microbial communities. The availability of 16S ribosomal RNA (rRNA) gene sequences from a multitude of natural environments now offers a unique opportunity to study microbial diversity and community structure. The large volume of sequencing data however makes it time consuming to assign individual sequences to phylotypes by searching them against public databases. Since ribosomal sequences have diverged across prokaryotic species, they can be grouped into clusters that represent operational taxonomic units. However, available clustering programs suffer from overlap of sequence spaces in adjacent clusters. In natural environments, gene sequences are homogenous within species but divergent between species. This evolutionary constraint results in an uneven distribution of genetic distances of genes in sequence space. To cluster 16S rRNA sequences more accurately, it is therefore essential to select core sequences that are located at the centers of the distributions represented by the genetic distance of sequences in taxonomic units. Based on this idea, we here describe a novel sequence clustering algorithm named CLUSTOM that minimizes the overlaps between adjacent clusters. The performance of this algorithm was evaluated in a comparative exercise with existing programs, using the reference sequences of the SILVA database as well as published pyrosequencing datasets. The test revealed that our algorithm achieves higher accuracy than ESPRIT-Tree and mothur, few of the best clustering algorithms. Results indicate that the concept of an uneven distribution of sequence distances can effectively and successfully cluster 16S rRNA gene sequences. The algorithm of CLUSTOM has been implemented both as a web and as a standalone command line application, which are available at http://clustom.kribb.re.kr.

  12. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  13. Sequence and conservation of a rRNA and tRNAVal mitochondrial gene fragment from Penaeus californiensis and comparison with Penaeus vannamei and Penaeus stylirostris.

    PubMed

    Gutiérrez-Millán, Luis Enrique; Peregrino-Uriarte, Alma Beatriz; Sotelo-Mundo, Rogerio; Vargas-Albores, Francisco; Yepiz-Plascencia, Gloria

    2002-09-01

    Penaeus californiensis is an important species for shrimp fisheries in the Pacific Ocean and has recently been described as a potential cultured species, mainly through the winter season in subtropical regions. A fragment of the mitochondrial 12S rRNA-tRNAVal-16S rRNA genes from P. californiensis was sequenced and compared with the corresponding regions from Penaeus vannamei and Penaeus stylirostris. Purified mitochondrial DNA was used for polymerase chain reaction amplification with primers for 12S and 16S rRNA genes. A 1379 +/- 1-bp fragment was obtained, including 90% 16S rRNA, tRNAVal, and a portion of 12S rRNA, cloned, and sequenced. Genetic distances were calculated according to the Kimura 2-parameter distance model, and maximum-likelihood analysis was applied with 1000 bootstrap replications. Sequence identity of P. californiensis with both P. vannamei and P. stylirostris was 0.88, while for P. vannamei and P. stylirostris the identity was 0.92. Maximum-likelihood analysis grouped P. vannamei and P. stylirostris separately from P. californiensis.

  14. [Identification of Hydrocarbon-Oxidizing Dietzia Bacteria from Petroleum Reservoirs Based on Phenotypic Properties and Analysis of the 16S rRNA and gyrB Genes].

    PubMed

    Nazina, T N; Shumkova, E S; Sokolova, D Sh; Babich, T L; Zhurina, M V; Xue, Yan-Fen; Osipov, G A; Poltaraus, A B; Tourova, T P

    2015-01-01

    The taxonomic position of hydrocarbon-oxidizing bacterial strains 263 and 32d isolated from formation water of the Daqing petroleum reservoir (PRC) was determined by polyphasic taxonomy techniques, including analysis of the 16S rRNA and the gyrB genes. The major chemotaxonomic characteristics of both strains, including the IV type cell wall, composition of cell wall fatty acids, mycolic acids, and menaquinones, agreed with those typical of Dietzia strains. The DNA G+C content of strains 263 and 32d were 67.8 and 67.6 mol%, respectively. Phylogenetic analysis of the 16S rRNA gene of strain 32d revealed 99.7% similarity to the gene of D. maris, making it possible to identify strain 32d as belonging to this species. The 16S rRNA gene sequence of strain 263 exhibited 99.7 and 99.9% similarity to those of D. natronolimnaea and D. cercidiphylli YIM65002(T), respectively. Analysis of the gyrB genes of the subterranean isolates and of a number of Dietzia type strains confirmed classiffication of strain 32d as a D. maris strain and of strain 263, as a D. natronolimnaea strain. A conclusion was made concerning higher resolving power of phylogenetic analysis of the gyrB gene compared to the 16S rRNA gene analysis in the case of determination of the species position of Dietzia isolates.

  15. New Primers Targeting Full-Length Ciliate 18S rRNA Genes and Evaluation of Dietary Effect on Rumen Ciliate Diversity in Dairy Cows.

    PubMed

    Zhang, Jun; Zhao, Shengguo; Zhang, Yangdong; Sun, Peng; Bu, Dengpan; Wang, Jiaqi

    2015-12-01

    Analysis of the full-length 18S rRNA gene sequences of rumen ciliates is more reliable for taxonomical classification and diversity assessment than the analysis of partial hypervariable regions only. The objective of this study was to develop new oligonucleotide primers targeting the full-length 18S rRNA genes of rumen ciliates, and to evaluate the effect of different sources of dietary fiber (corn stover or a mixture of alfalfa hay and corn silage) and protein (mixed rapeseed, cottonseed, and/or soybean meals) on rumen ciliate diversity in dairy cows. Primers were designed based on a total of 137 previously reported ciliate 18S rRNA gene sequences. The 3'-terminal sequences of the newly designed primers, P.1747r_2, P.324f, and P.1651r, demonstrated >99% base coverage. Primer pair D (P.324f and P.1747r_2) was selected for the cloning and sequencing of ciliate 18S rRNA genes because it produced a 1423-bp amplicon, and did not amply the sequences of other eukaryotic species, such as yeast. The optimal species-level cutoff value for distinguishing between the operational taxonomic units of different ciliate species was 0.015. The phylogenetic analysis of full-length ciliate 18S rRNA gene sequences showed that distinct ciliate profiles were induced by the different sources of dietary fiber and protein. Dasytricha and Entodinium were the predominant genera in the ruminal fluid of dairy cattle, and Dasytricha was significantly more abundant in cows fed with corn stover than in cows fed with alfalfa hay and corn silage. PMID:26319789

  16. New Primers Targeting Full-Length Ciliate 18S rRNA Genes and Evaluation of Dietary Effect on Rumen Ciliate Diversity in Dairy Cows.

    PubMed

    Zhang, Jun; Zhao, Shengguo; Zhang, Yangdong; Sun, Peng; Bu, Dengpan; Wang, Jiaqi

    2015-12-01

    Analysis of the full-length 18S rRNA gene sequences of rumen ciliates is more reliable for taxonomical classification and diversity assessment than the analysis of partial hypervariable regions only. The objective of this study was to develop new oligonucleotide primers targeting the full-length 18S rRNA genes of rumen ciliates, and to evaluate the effect of different sources of dietary fiber (corn stover or a mixture of alfalfa hay and corn silage) and protein (mixed rapeseed, cottonseed, and/or soybean meals) on rumen ciliate diversity in dairy cows. Primers were designed based on a total of 137 previously reported ciliate 18S rRNA gene sequences. The 3'-terminal sequences of the newly designed primers, P.1747r_2, P.324f, and P.1651r, demonstrated >99% base coverage. Primer pair D (P.324f and P.1747r_2) was selected for the cloning and sequencing of ciliate 18S rRNA genes because it produced a 1423-bp amplicon, and did not amply the sequences of other eukaryotic species, such as yeast. The optimal species-level cutoff value for distinguishing between the operational taxonomic units of different ciliate species was 0.015. The phylogenetic analysis of full-length ciliate 18S rRNA gene sequences showed that distinct ciliate profiles were induced by the different sources of dietary fiber and protein. Dasytricha and Entodinium were the predominant genera in the ruminal fluid of dairy cattle, and Dasytricha was significantly more abundant in cows fed with corn stover than in cows fed with alfalfa hay and corn silage.

  17. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling

    PubMed Central

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.

    2015-01-01

    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  18. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.

    PubMed

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S

    2015-01-01

    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.

  19. Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene.

    PubMed

    Yuan, Youhua; Wen, Yan; You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying

    2015-01-01

    Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China.

  20. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.

    PubMed

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S

    2015-01-01

    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  1. Identification of forensically important beetles (Coleoptera: Histeridae) in China based on 16S rRNA and Cyt b.

    PubMed

    Su, R N; Guo, Y D; Xie, D; Peng, Y L; Cai, J F; Hua, F; Sheng, L H

    2013-09-01

    Exact identification of an insect sample is usually the first essential step in a forensic entomological analysis. However, the morphological similarity of beetles in the level of species usually poses a challenge for forensic scientists within their routine work. As a supplementary to traditional morphological method, molecular genetics identification turns out to be simple and time-saving. A molecular identification method involving a 288-bp segment of the 16S ribosomal RNA (16S rRNA) gene and a 334-bp segment of the cytochrome b (Cyt b) gene from 23 histerid beetles specimens, collected from 7 locations in 6 Chinese provinces, was evaluated. The 16S rRNA and Cyt b genes are sequenced to examine the ability of the region, resolve species identities and enrich the local databases. The monophyletic branches of the phylogenetic tree showed the potential of the markers in identifying beetles within families. Combined analysis is a more accurate approach for species identication than independent analysis.

  2. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    PubMed

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  3. Identification of the Microbiota in Carious Dentin Lesions Using 16S rRNA Gene Sequencing

    PubMed Central

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4–76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  4. Differential identification of Entamoeba spp. based on the analysis of 18S rRNA.

    PubMed

    Santos, Helena Lúcia Carneiro; Bandea, Rebecca; Martins, Luci Ana Fernandes; de Macedo, Heloisa Werneck; Peralta, Regina Helena Saramago; Peralta, Jose Mauro; Ndubuisi, Mackevin I; da Silva, Alexandre J

    2010-03-01

    Entamoeba histolytica is known to cause intestinal and extra-intestinal disease while the other Entamoeba species are not considered to be pathogenic. However, all Entamoeba spp. should be reported when identified in clinical samples. Entamoeba polecki, Entamoeba coli, and Entamoeba hartmanii can be differentiated morphologically from E. histolytica, but some of their diagnostic morphologic features overlap. E. histolytica, Entamoeba dispar, and Entamoeba moshkovskii are morphologically identical but can be differentiated using molecular tools. We developed a polymerase chain reaction (PCR) procedure followed by DNA sequencing of specific regions of 18S rRNA gene to differentiate the Entamoeba spp. commonly found in human stools. This approach was used to analyze 45 samples from cases evaluated for the presence of Entamoeba spp. by microscopy and a real-time PCR method capable of differential detection of E. histolytica and E. dispar. Our results demonstrated an agreement of approximately 98% (45/44) between the real-time PCR for E. histolytica and E. dispar and the 18S rRNA analysis described here. Five previously negative samples by microscopy revealed the presence of E. dispar, E. hartmanii, or E. coli DNA. In addition, we were able to detect E. hartmanii in a stool sample that had been previously reported as negative for Entamoeba spp. by microscopy. Further microscopic evaluation of this sample revealed the presence of E. hartmanii cysts, which went undetected during the first microscopic evaluation. This PCR followed by DNA sequencing will be useful to refine the diagnostic detection of Entamoeba spp. in stool and other clinical specimens.

  5. Analysis of the primary sequence and secondary structure of the unusually long SSU rRNA of the soil bug, Armadillidium vulgare.

    PubMed

    Choe, C P; Hancock, J M; Hwang, U W; Kim, W

    1999-12-01

    The complete nucleotide sequence of the SSU rRNA gene from the soil bug, Armadillidium vulgare (Crustacea, Isopoda), was determined. It is 3214 bp long, with a GC content of 56.3%. It is not only the longest SSU rRNA gene among Crustacea but also longer than any other SSU rRNA gene except that of the strepsipteran insect, Xenos vesparum (3316 bp). The unusually long sequence of this species is explained by the long sequences of variable regions V4 and V7, which make up more than half of the total length. RT-PCR analysis of these two regions showed that the long sequences also exist in the mature rRNA and sequence simplicity analysis revealed the presence of slippage motifs in these two regions. The putative secondary structure of the rRNA is typical for eukaryotes except for the length and shape variations of the V2, V4, V7, and V9 regions. Each of the V2, V4, and V7 regions was elongated, while the V9 region was shortened. In V2, two bulges, located between helix 8 and helix 9 and between helix 9 and helix 10, were elongated. In V4, stem E23-3 was dramatically expanded, with several small branched stems. In V7, stem 43 was branched and expanded. Comparisons with the unusually long SSU rRNAs of other organisms imply that the increase in total length of SSU rRNA is due mainly to expansion in the V4 and V7 regions. PMID:10594181

  6. Transformation of tetrahymena thermophila with hypermethylated rRNA genes

    SciTech Connect

    Karrer, K.M.; Yao, M.C.

    1988-04-01

    The extrachromosomal rRNA genes (rDNA) of Tetrahymena thermophila contain 0.4% N/sup 6/-methyladenine. C3 strain rDNA was isolated, hypermethylated in vitro, and microinjected into B strain host cells. Clonal cell lines were established, and transformants were selected on the basis of resistance to paromomycin, conferred by the injected rDNA. The effects of methylation by three enzymes which methylate the sequence 5'-NAT-3'', the dam, EcoRI, and ClaI methylases, were tested. Hypermethylation of the injected rDNA had no effect on transformation efficiency relative to mock-methylated controls. The injected C3 strain rDNA efficiently replaced host rDNA as the major constituent of the population of rDNA molecules. Hypermethylation of the injected DNA was not maintained through 20 to 25 cell generations.

  7. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    SciTech Connect

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D.

    2008-01-30

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  8. Discrimination of Bacillus anthracis and Closely Related Microorganisms by Analysis of 16S and 23S rRNA with Oligonucleotide Microarray

    PubMed Central

    Bavykin, Sergei G.; Mikhailovich, Vladimir M.; Zakharyev, Vladimir M.; Lysov, Yuri p.; Kelly, John J.; Alferov, Oleg S.; Gavin, Igor M.; Kukhtin, Alexander V.; Jackman, Joany; Stahl, David A.; Chandler, Darrell; Mirzabekov, Andrei D.

    2009-01-01

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 minutes. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead

  9. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens

    DOE PAGES

    Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; MacKichan, Joanna; Kato-Maeda, Midori; Miller, Steve; Nadarajan, Rohan; Brodie, Eoin L.; Lynch, Susan V.; Heimesaat, Markus M.

    2015-02-06

    According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n =more » 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci.« less

  10. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens

    SciTech Connect

    Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; MacKichan, Joanna; Kato-Maeda, Midori; Miller, Steve; Nadarajan, Rohan; Brodie, Eoin L.; Lynch, Susan V.; Heimesaat, Markus M.

    2015-02-06

    According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n = 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci.

  11. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium

    NASA Astrophysics Data System (ADS)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.

    2014-07-01

    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  12. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  13. Molecular identification of adulteration in mutton based on mitochondrial 16S rRNA gene.

    PubMed

    Xu, Jia; Zhao, Wei; Zhu, Mengru; Wen, Yuanju; Xie, Tao; He, Xiaoqian; Zhang, Yongfeng; Cao, Suizhong; Niu, Lili; Zhang, Hongping; Zhong, Tao

    2016-01-01

    The aim of this study is to set up a protocol for identification of the adulteration in mutton based on mitochondrial 16S rRNA gene. The multiplex polymerase chain reaction (multi-PCR) assay was carried out to trace the impure DNA in mutton. A universal primer pair yielded an approximate 610 bp fragment in mutton, pork, duck, chicken, horse and cat meats. The amplicons of multi-PCR assay represented the species-specific products, which could be discriminated by the size ranging from 106 bp to 532 bp. Subsequently, the authentication of each fragment was also confirmed by sequencing. Random analyses of adulterants with various meats yielded the identical results to their components, showing the suitability of the multi-PCR assay for tracing of adulterant meats with high-accuracy and precision. This assay was sensitive to detect the species-specific DNA in different proportional mixtures of mutton and duck/pork (9.1%-90.9%). In conclusion, this multi-PCR assay successfully discriminated the double-, triple-, quadruple-, and quintuple-mixtures containing variant counterparts. This method will be particularly useful in the detection of mutton adulteration in processed foods further. PMID:24739005

  14. Loop-mediated isothermal amplification assay for 16S rRNA methylase genes in Gram-negative bacteria.

    PubMed

    Nagasawa, Mitsuaki; Kaku, Mitsuo; Kamachi, Kazunari; Shibayama, Keigo; Arakawa, Yoshichika; Yamaguchi, Keizo; Ishii, Yoshikazu

    2014-10-01

    Using the loop-mediated isothermal amplification (LAMP) method, we developed a rapid assay for detection of 16S rRNA methylase genes (rmtA, rmtB, and armA), and investigated 16S rRNA methylase-producing strains among clinical isolates. Primer Explorer V3 software was used to design the LAMP primers. LAMP primers were prepared for each gene, including two outer primers (F3 and B3), two inner primers (FIP and BIP), and two loop primers (LF and LB). Detection was performed with the Loopamp DNA amplification kit. For all three genes (rmtA, rmtB, and armA), 10(2) copies/tube could be detected with a reaction time of 60 min. When nine bacterial species (65 strains saved in National Institute of Infectious Diseases) were tested, which had been confirmed to possess rmtA, rmtB, or armA by PCR and DNA sequencing, the genes were detected correctly in these bacteria with no false negative or false positive results. Among 8447 clinical isolates isolated at 36 medical institutions, the LAMP method was conducted for 191 strains that were resistant to aminoglycosides based on the results of antimicrobial susceptibility tests. Eight strains were found to produce 16S rRNA methylase (0.09%), with rmtB being identified in three strains (0.06%) of 4929 isolates of Enterobacteriaceae, rmtA in three strains (0.10%) of 3284 isolates of Pseudomonas aeruginosa, and armA in two strains (0.85%) of 234 isolates of Acinetobacter spp. At present, the incidence of strains possessing 16S rRNA methylase genes is very low in Japan. However, when Gram-negative bacteria showing high resistance to aminoglycosides are isolated by clinical laboratories, it seems very important to investigate the status of 16S rRNA methylase gene-harboring bacilli and monitor their trends among Japanese clinical settings.

  15. Climatic controls on drainage basin topography - a synopsis of the western Andean flanks between 15.5 S and 41.5 S lat

    NASA Astrophysics Data System (ADS)

    Rehak, K.; Strecker, M. R.; Echtler, H. P.; Bookhagen, B.

    2007-12-01

    Topography in tectonically active mountain ranges is determined by the interplay between tectonics and climate. Due to the complexity of natural systems it is difficult to evaluate tectonic versus climatic contributions to the long- term landscape evolution. Previous studies suggest that rainfall and its variability strongly influence the morphology of river profiles and mountain ranges. However, it is still controversially discussed how drainage basins reflect tectonic and climatic processes. The Andean Cordillera provides a unique natural setting for studying the relationship between climate, tectonics, and topography. The Andes host various climatic zones with pronounced differences in rainfall regimes. In the central to southern western Andes, climate ranges from hyperarid in the Atacama Desert, 22 to 23°S lat, with a mean annual rainfall of ~ 5 mm/yr to year-round humid conditions south of Valdivia, ~ 40°S lat, with more than 2500 mm/yr. This zonation is controlled by hemisphere-scale atmospheric circulation patterns. With the exception of a northward shift of the Southern Hemisphere Westerlies during glacials the overall precipitation pattern has remained stable on the west coast of South America. The shelf width is reasonably constant along the margin. Uplift rate and lithology vary non-systematically and do not correlate with climatic parameters. Here, we present an analysis of 120 drainage basins along the watershed of the western Andean flank between 15.5 S and 41.5 S lat, using SRTMV3-90m data and a high-resolution rainfall dataset (TRMM 5x5 km). The basins comprise drainage areas of 1 to ~ 30 x 103 km2 and were split into subsets according to position and size. For each basin, we extracted 21 geometry, relief, and climate parameters in order to unravel the determinants of drainage-basin morphology. Our data shows that river-profile concavity and slope, hypsometric integral, basin maximum and mean elevation decrease with increasing rainfall and

  16. Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer).

    PubMed

    Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

    2013-01-16

    The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples.

  17. Identification of the forensically important beetles Nicrophorus japonicus, Ptomascopus plagiatus and Silpha carinata (Coleoptera: Silphidae) based on 16S rRNA gene in China.

    PubMed

    Tang, Z C; Guo, Y D; Zhang, X W; Shi, J; Yang, K T; Li, X L; Chen, Y Q; Cai, J F

    2012-09-01

    Sarcophagous beetles play an important role in estimating postmortem interval time (PMI) in the later stages decomposition of carcasses. However, the morphological similarity of beetles usually poses a challenge for forensic scientists within their routine work. As a supplementary to traditional morphological method, molecular genetics identification is simple and time-saving. A molecular identification method involving a 288-bp segment of the 16S ribosomal RNA (16S rRNA) gene from 15 beetles of Silphidae (Coleoptera), collected from 5 locations in 4 Chinese provinces, was evaluated. Phenogram analysis of the sequenced segments by the unweighted pairgroup method analysis (UPGMA) method showed that all specimens were properly assigned into four species with strong similarity, which indicated the possibility of separation congeneric species with the short 16S rRNA fragment. These results will be instrumental for implementation of the Chinese database of forensically relevant beetles.

  18. Two genetic clusters in swine hemoplasmas revealed by analyses of the 16S rRNA and RNase P RNA genes.

    PubMed

    Watanabe, Yusaku; Fujihara, Masatoshi; Obara, Hisato; Nagai, Kazuya; Harasawa, Ryô

    2011-12-01

    Only two hemoplasma species, Eperythrozoon parvum and Mycoplasma suis, have been recognized in pigs. Here we demonstrate the genetic variations among six hemoplasma strains detected from pigs, by analyzing the 16S rRNA and RNase P RNA (rnpB) genes, and propose a novel hemoplasma taxon that has not been described previously. Phylogenetic trees based on the nucleotide sequence of the 16S rRNA gene indicated that these six hemoplasmas were divided into two clusters representing M. suis and a novel taxon. We further examined the primary and secondary structures of the nucleotide sequences of the rnpB gene of the novel taxon, and found it distinct from that of M. suis. In conclusion, we unveiled a genetic cluster distinct from M. suis, suggesting a new swine hemoplasma species or E. parvum. Our findings also suggest that this novel cluster should be included in the genus Mycoplasma.

  19. Mechanisms underlying the evolution and maintenance of functionally heterogeneous 18S rRNA genes in Apicomplexans.

    PubMed

    Rooney, Alejandro P

    2004-09-01

    In many species of the protist phylum Apicomplexa, ribosomal RNA (rRNA) gene copies are structurally and functionally heterogeneous, owing to distinct requirements for rRNA-expression patterns at different developmental stages. The genomic mechanisms underlying the maintenance of this system over long-term evolutionary history are unclear. Therefore, the aim of this study was to investigate what processes underlie the long-term evolution of apicomplexan 18S genes in representative species. The results show that these genes evolve according to a birth-and-death model under strong purifying selection, thereby explaining how divergent 18S genes are generated over time while continuing to maintain their ability to produce fully functional rRNAs. In addition, it was found that Cryptosporidium parvum undergoes a rapid form of birth-and-death evolution that may facilitate host-specific adaptation, including that of type I and II strains found in humans. This represents the first case in which an rRNA gene family has been found to evolve under the birth-and-death model. PMID:15175411

  20. Transposable elements in fish chromosomes: a study in the marine cobia species.

    PubMed

    Costa, G W W F; Cioffi, M B; Bertollo, L A C; Molina, W F

    2013-01-01

    Rachycentron canadum, a unique representative of the Rachycentridae family, has been the subject of considerable biotechnological interest due to its potential use in marine fish farming. This species has undergone extensive research concerning the location of genes and multigene families on its chromosomes. Although most of the genome of some organisms is composed of repeated DNA sequences, aspects of the origin and dispersion of these elements are still largely unknown. The physical mapping of repetitive sequences on the chromosomes of R. canadum proved to be relevant for evolutionary and applied purposes. Therefore, here, we present the mapping by fluorescence in situ hybridization of the transposable element (TE) Tol2, the non-LTR retrotransposons Rex1 and Rex3, together with the 18S and 5S rRNA genes in the chromosome of this species. The Tol2 TE, belonging to the family of hAT transposons, is homogeneously distributed in the euchromatic regions of the chromosomes but with huge colocalization with the 18S rDNA sites. The hybridization signals for Rex1 and Rex3 revealed a semi-arbitrary distribution pattern, presenting differentiated dispersion in euchromatic and heterochromatic regions. Rex1 elements are associated preferentially in heterochromatic regions, while Rex3 shows a scarce distribution in the euchromatic regions of the chromosomes. The colocalization of TEs with 18S and 5S rDNA revealed complex chromosomal regions of repetitive sequences. In addition, the nonpreferential distribution of Rex1 and Rex3 in all heterochromatic regions, as well as the preferential distribution of the Tol2 transposon associated with 18S rDNA sequences, reveals a distinct pattern of organization of TEs in the genome of this species. A heterogeneous chromosomal colonization of TEs may confer different evolutionary rates to the heterochromatic regions of this species. PMID:23969732