Science.gov

Sample records for 5s rrna structure

  1. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  2. Comparative structural analysis of eubacterial 5S rRNA by oxidation of adenines in the N-1 position.

    PubMed Central

    Pieler, T; Schreiber, A; Erdmann, V A

    1984-01-01

    Adenines in free 5S rRNA from Escherichia coli, Bacillus stearothermophilus and Thermus thermophilus have been oxidized at their N-1 position using monoperphthalic acid. The determination of the number of adenine 1-N-oxides was on the basis of UV spectroscopic data of the intact molecule. Identification of the most readily accessible nucleotides by sequencing gel analysis reveals that they are located in conserved positions within loops, exposed hairpin loops and single-base bulge loops. Implications for the structure and function of 5S rRNA will be discussed on the basis of this comparative analysis. Images PMID:6201825

  3. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    PubMed Central

    Leontis, N B; Westhof, E

    1998-01-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  4. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    PubMed

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  5. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  6. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  7. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  8. Diversity of 5S rRNA genes within individual prokaryotic genomes

    PubMed Central

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V.; Parsons, Tamasha; Yang, Liying; Gerz, Erika A.; Lee, Peng; Xiang, Charlie; Nossa, Carlos W.; Pei, Zhiheng

    2012-01-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1168 genomes from 779 unique species, 96 species exhibited >3% diversity. Twenty seven species with >10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there were tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. There is supplementary material. PMID:22765222

  9. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  10. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  11. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  12. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    PubMed Central

    Durovic, P; Kutay, U; Schleper, C; Dennis, P P

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-coding sequence. This result suggests that the primary transcript of the 5S rRNA gene corresponds in length (within 1 or 2 nucleotides) to the mature 5S rRNA sequence found in 50S ribosomal subunits. Images PMID:8288546

  13. Evidence for the presence of 5S rRNA in mammalian mitochondria.

    PubMed

    Magalhães, P J; Andreu, A L; Schon, E A

    1998-09-01

    Mammalian mitochondrial ribosomes contain two prokaryotic-like rRNAs, 12S and 16S, both encoded by mitochondrial DNA. As opposed to cytosolic ribosomes, however, these ribosomes are not thought to contain 5S rRNA. For this reason, it has been unclear whether 5S rRNA, which can be detected in mitochondrial preparations, is an authentic organellar species imported from the cytosol or is merely a copurifying cytosol-derived contaminant. We now show that 5S rRNA is tightly associated with highly purified mitochondrial fractions of human and rat cells and that 5S rRNA transcripts derived from a synthetic gene transfected transiently into human cells are both expressed in vivo and present in highly purified mitochondria and mitoplasts. We conclude that 5S rRNA is imported into mammalian mitochondria, but its function there still remains to be clarified. PMID:9725900

  14. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  15. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  16. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    PubMed

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  17. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  18. 5S rRNA sequences from four marine invertebrates and implications for base pairing models of metazoan sequences.

    PubMed

    Walker, W F; Doolittle, W F

    1983-08-11

    The nucleotide sequences of 5S rRNAs from the starfish Asterias vulgaris, the squid Illex illecebrosus, the sipunculid Phascolopsis gouldii and the jellyfish Aurelia aurita were determined. The sequence from Asterias lends support for one of two previous base pairing models for helix E in metazoan sequences. The Aurelia sequence differs by five nucleotides from that previously reported and does not violate the consensus secondary structure model for eukaryotic 5S rRNA. PMID:6136024

  19. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  20. 5 S Rrna Is Involved in Fidelity of Translational Reading Frame

    PubMed Central

    Dinman, J. D.; Wickner, R. B.

    1995-01-01

    Chromosomal mutants (maintenance of frame = mof) in which the efficiency of -1 ribosomal frame-shifting is increased can be isolated using constructs in which lacZ expression is dependent upon a -1 shift of reading frame. We isolate a new mof mutation, mof9, in Saccharomyces cerevisiae and show that it is complemented by both single and multi-copy 5 S rDNA clones. Two independent insertion mutations in the rDNA locus (rDNA::LEU2 and rDNA::URA3) also display the Mof(-) phenotype and are also complemented by single and multi-copy 5 S rDNA clones. Mutant 5 S rRNAs expressed from a plasmid as 20-50% of total 5 S rRNA in a wild-type host also induced the Mof(-) phenotype. The increase in frameshifting is greatest when the lacZ reporter gene is expressed on a high copy, episomal vector. No differences were found in 5 S rRNA copy number or electrophoretic mobilities in mof9 strains. Both mof9 and rDNA::LEU2 increase the efficiency of +1 frameshifting as well but have no effect on readthrough of UAG or UAA termination codons, indicating that not all translational specificity is affected. These data suggest a role for 5 S rRNA in the maintenance of frame in translation. PMID:8536994

  1. Phylogenetic analysis of the genera Thiobacillus and Thiomicrospira by 5S rRNA sequences.

    PubMed Central

    Lane, D J; Stahl, D A; Olsen, G J; Heller, D J; Pace, N R

    1985-01-01

    5S rRNA nucleotide sequences from Thiobacillus neapolitanus, Thiobacillus ferrooxidans, Thiobacillus thiooxidans, Thiobacillus intermedius, Thiobacillus perometabolis, Thiobacillus thioparus, Thiobacillus versutus, Thiobacillus novellus, Thiobacillus acidophilus, Thiomicrospira pelophila, Thiomicrospira sp. strain L-12, and Acidiphilium cryptum were determined. A phylogenetic tree, based upon comparison of these and other related 5S rRNA sequences, is presented. The results place the thiobacilli, Thiomicrospira spp., and Acidiphilium spp. in the "purple photosynthetic" bacterial grouping which also includes the enteric, vibrio, pseudomonad, and other familiar eubacterial groups in addition to the purple photosynthetic bacteria. The genus Thiobacillus is not an evolutionarily coherent grouping but rather spans the full breadth of the purple photosynthetic bacteria. PMID:3924899

  2. Construction of the mycoplasma evolutionary tree from 5S rRNA sequence data.

    PubMed Central

    Rogers, M J; Simmons, J; Walker, R T; Weisburg, W G; Woese, C R; Tanner, R S; Robinson, I M; Stahl, D A; Olsen, G; Leach, R H

    1985-01-01

    The 5S rRNA sequences of eubacteria and mycoplasmas have been analyzed and a phylogenetic tree constructed. We determined the sequences of 5S rRNA from Clostridium innocuum, Acholeplasma laidlawii, Acholeplasma modicum, Anaeroplasma bactoclasticum, Anaeroplasma abactoclasticum, Ureaplasma urealyticum, Mycoplasma mycoides mycoides, Mycoplasma pneumoniae, and Mycoplasma gallisepticum. Analysis of these and published sequences shows that mycoplasmas form a coherent phylogenetic group that, with C. innocuum, arose as a branch of the low G+C Gram-positive tree, near the lactobacilli and streptococci. The initial event in mycoplasma phylogeny was formation of the Acholeplasma branch; hence, loss of cell wall probably occurred at the time of genome reduction to approximately to 1000 MDa. A subsequent branch produced the Spiroplasma. This branch appears to have been the origin of sterol-requiring mycoplasmas. During development of the Spiroplasma branch there were several independent genome reductions, each to approximately 500 MDa, resulting in Mycoplasma and Ureaplasma species. Mycoplasmas, particularly species with the smallest genomes, have high mutation rates, suggesting that they are in a state of rapid evolution. PMID:2579388

  3. Phylogenetic tree derived from bacterial, cytosol and organelle 5S rRNA sequences.

    PubMed Central

    Küntzel, H; Heidrich, M; Piechulla, B

    1981-01-01

    A phylogenetic tree was constructed by computer analysis of 47 completely determined 5S rRNA sequences. The wheat mitochondrial sequence is significantly more related to prokaryotic than to eukaryotic sequences, and its affinity to that of the thermophilic Gram-negative bacterium Thermus aquaticus is comparable to the affinity between Anacystis nidulans and chloroplastic sequences. This strongly supports the idea of an endosymbiotic origin of plant mitochondria. A comparison of the plant cytosol and chloroplast sub-trees suggests a similar rate of nucleotide substitution in nuclear genes and chloroplastic genes. Other features of the tree are a common precursor of protozoa and metazoa, which appears to be more related to the fungal than to the plant protosequence, and an early divergence of the archebacterial sequence (Halobacterium cutirubrum) from the prokaryotic branch. PMID:6785727

  4. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  5. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  6. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  7. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families. PMID:25315165

  8. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    PubMed Central

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387

  9. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  10. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  11. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.

    2016-01-01

    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  12. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  13. Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

    PubMed Central

    Carol, P; Rozier, C; Lazaro, E; Ballesta, J P; Mache, R

    1993-01-01

    The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain. Images PMID:8441674

  14. Involvement of multiple basic amino acids in yeast ribosomal protein L1 in 5S rRNA recognition.

    PubMed

    Yeh, L C; Lee, J C

    1995-01-01

    The role of basic amino acid residues located at the C-terminal region of the yeast ribosomal protein L1 in 5S rRNA binding was characterized in vitro and in vivo. Mutant proteins containing single or multiple amino acid substitutions were generated by site-directed mutagenesis of the L1 gene carried on a plasmid. In vitro RNP formation was examined by production of the mutant protein in the presence of the RNA molecule. The thermostability of the resultant RNP was also studied. Effects of these mutations on cell viability and ribosome assembly were characterized by transformation of a conditional null L1 yeast mutant with the mutated L1 gene expressed from the plasmid. Substitution of any one of the lysine or arginine residue did not affect significantly RNA binding in vitro or cell growth in vivo. However, several mutant proteins with substitutions of two of these basic amino acids bound RNA weakly and the RNPs were less stable. Cells expressing these mutant proteins were lethal. Theoretical structural prediction of these amino acids further provided information regarding their collective contributions to RNA recognition and to interaction between the RNP and other components of the 60S ribosomal subunit. PMID:8643400

  15. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    PubMed

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  16. Secondary structure and domain architecture of the 23S and 5S rRNAs

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hershkovits, Eli; Xue, Yuzhen; Waterbury, Chris C.; Hsiao, Chiaolong; Stepanov, Victor G.; Gaucher, Eric A.; Grover, Martha A.; Harvey, Stephen C.; Hud, Nicholas V.; Wartell, Roger M.; Fox, George E.; Williams, Loren Dean

    2013-01-01

    We present a de novo re-determination of the secondary (2°) structure and domain architecture of the 23S and 5S rRNAs, using 3D structures, determined by X-ray diffraction, as input. In the traditional 2° structure, the center of the 23S rRNA is an extended single strand, which in 3D is seen to be compact and double helical. Accurately assigning nucleotides to helices compels a revision of the 23S rRNAstructure. Unlike the traditional 2° structure, the revised 2° structure of the 23S rRNA shows architectural similarity with the 16S rRNA. The revised 2° structure also reveals a clear relationship with the 3D structure and is generalizable to rRNAs of other species from all three domains of life. The 2° structure revision required us to reconsider the domain architecture. We partitioned the 23S rRNA into domains through analysis of molecular interactions, calculations of 2D folding propensities and compactness. The best domain model for the 23S rRNA contains seven domains, not six as previously ascribed. Domain 0 forms the core of the 23S rRNA, to which the other six domains are rooted. Editable 2° structures mapped with various data are provided (http://apollo.chemistry.gatech.edu/RibosomeGallery). PMID:23771137

  17. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  18. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment. PMID:22724546

  19. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    PubMed

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. PMID:26800847

  20. Accurate transcription of homologous 5S rRNA and tRNA genes and splicing of tRNA in vitro by soluble extracts of Neurospora.

    PubMed Central

    Tyler, B M; Giles, N H

    1984-01-01

    We have developed soluble extracts from Neurospora crassa capable of accurately and efficiently transcribing homologous 5S rRNA and tRNA genes. The extracts also appear to quantitatively end-process and splice the primary tRNA transcripts. Although the extracts could not transcribe a heterologous (yeast) 5S rRNA gene, they did transcribe a yeast tRNALeu gene and slowly process the transcripts. In addition, we have developed a novel strategy for rapidly sequencing uniformly labelled RNAs using base-specific ribonucleases. We have used this procedure to verify the identity of the in vitro transcripts and processing products. Images PMID:6235482

  1. What does the 5S rRNA multigene family tell us about the origin of the annual Triticeae (Poaceae)?

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2013-05-01

    We have investigated the complex relationships among the annual genera within the tribe Triticeae through phylogenetic analyses of the 5S rRNA multigene family. Cloned sequences were assigned to groups of orthologous sequences, called unit classes, that were subjected to several analyses including BLAST (Basic Local Alignment Search Tool) searches to assess possible ancestral relationships with perennial genera; phylogenetic analyses using parsimony (Pars), maximum likelihood (ML), and Bayesian methods; and minimum reticulation networks from the Pars, ML, and Bayesian trees. In this study, we included genera with both annual and perennial species, such as Dasypyrum, Hordeum, and Secale. BLAST pointed to Pseudoroegneria (carrier of the St genome) and possibly Thinopyrum (carrier of the J genome) as the potential next of kin. However, Thinopyrum and Pseudoroegneria have never fallen together on the individual trees with the former generally associated with Crithopsis, Aegilops, Triticum, and Dasypyrum, while the latter is usually associated with the rest of the genera within Triticeae. The "long" unit classes placed Dasypyrum breviaristatum together with Dasypyrum villosum, whereas the "short" unit classes put them far apart on the trees. None of the gene trees alone was able to summarize the complex relationships among the genera, in line with previous results in the Triticeae. However, the application of tools designed to display phylogenetic networks was able to depict the complex links among the genera based on the short and the long gene trees, including the close link between Thinopyrum and Pseudoroegneria suggested by the phylogenetic analyses. In addition, our analyses provide support for the hypothesis that at least some annual Triticeae taxa are derived from their perennial relatives. PMID:23789993

  2. Natural Microbial Community Compositions Compared by a Back-Propagating Neural Network and Cluster Analysis of 5S rRNA

    PubMed Central

    Noble, P. A.; Bidle, K. D.; Fletcher, M.

    1997-01-01

    The community compositions of free-living and particle-associated bacteria in the Chesapeake Bay estuary were analyzed by comparing banding patterns of stable low-molecular-weight RNA (SLMW RNA) which include 5S rRNA and tRNA molecules. By analyzing images of autoradiographs of SLMW RNAs on polyacrylamide gels, band intensities of 5S rRNA were converted to binary format for transmission to a back-propagating neural network (NN). The NN was trained to relate binary input to sample stations, collection times, positions in the water column, and sample types (e.g., particle-associated versus free-living communities). Dendrograms produced by using Euclidean distance and average and Ward's linkage methods on data of three independently trained NNs yielded the following results. (i) Community compositions of Chesapeake Bay water samples varied both seasonally and spatially. (ii) Although there was no difference in the compositions of free-living and particle-associated bacteria in the summer, these community types differed significantly in the winter. (iii) In the summer, most bay samples had a common 121-nucleotide 5S rRNA molecule. Although this band occurred in the top water of midbay samples, it did not occur in particle-associated communities of bottom-water samples. (iv) Regardless of the season, midbay samples had the greatest variety of 5S rRNA sizes. The utility of NNs for interpreting complex banding patterns in electrophoresis gels was demonstrated. PMID:16535593

  3. Higher-order structure of rRNA

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  4. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  5. Comparative analysis of the genes encoding 23S-5S rRNA intergenic spacer regions of Lactobacillus casei-related strains.

    PubMed

    Chen, H; Lim, C K; Lee, Y K; Chan, Y N

    2000-03-01

    In this study, investigations into the 23S-5S rRNA intergenic spacer regions (ISRs) of the Lactobacillus casei group were performed. A 1.6 kb fragment, from Lactobacillus paracasei strain ATCC 27092, containing part of the 5S rRNA gene (60 bp), the 5S-23S spacer region (198 bp) and part of the 23S rRNA gene (1295 bp) was cloned and sequenced (GenBank no. AF098107). This fragment was used as a probe to determine the rRNA restriction fragment length polymorphism (RFLP) patterns of nine strains belonging to the Lactobacillus casei group, along with four other non-Lactobacillus casei lactobacilli species. A pair of PCR primers, 23-Fl and 5-Ru, was designed and used for PCR amplification of the 23S-5S rRNA ISRs of these strains. The ISR length and sequence polymorphisms provided additional information for the taxonomic study of the Lactobacillus casei group. The spacer-length polymorphism of Lactobacillus rhamnosus was distinct from those of the other strains and this observation is consistent with the classification of Lactobacillus rhamnosus proposed by Mori et al. For all Lactobacillus casei and Lactobacillus paracasei strains, two major bands (approx. 250 and 170 bp in size) were obtained except in the case of Lactobacillus paracasei subsp. tolerans strain NCIMB 9709T, which yielded only one amplified product (250 bp). The sequencing data of the PCR products of seven well-characterized Lactobacillus casei and Lactobacillus paracasei strains revealed the presence of a 76/80 bp insertion/deletion with some random, single-base substitutions between the longer and shorter spacers for each respective strain. A few base variations were also detected within different strains in this group although the overall sequence similarity was very high (95.9-99.5%). The rRNA RFLP and the spacer sequence of Lactobacillus casei type strain ATCC 393T exhibited unique identities in this cluster. On the other hand, Lactobacillus casei strain ATCC 334 showed a high level of similarity

  6. Localization of 5S and 25S rRNA genes on somatic and meiotic chromosomes in Capsicum species of chili pepper.

    PubMed

    Kwon, Jin-Kyung; Kim, Byung-Dong

    2009-02-28

    The loci of the 5S and 45S rRNA genes were localized on chromosomes in five species of Capsicum, namely, annuum, chacoense, frutescens, baccatum, and chinense by FISH. The 5S rDNA was localized to the distal region of one chromosome in all species observed. The number of 45S rDNA loci varied among species; one in annuum, two in chacoense, frutescens, and chinense, and four in baccatum, with the exceptions that 'CM334' of annuum had three loci and 'tabasco' of frutescens had one locus. 'CM334'-derived BAC clones, 384B09 and 365P05, were screened with 5S rDNA as a probe, and BACs 278M03 and 262A23 were screened with 25S rDNA as a probe. Both ends of these BAC clones were sequenced. FISH with these BAC probes on pachytenes from 'CM334' plant showed one 5S rDNA locus and three 45S rDNA loci, consistent with the patterns on the somatic chromosomes. The 5S rDNA probe was also applied on extended DNA fibers to reveal that its coverage measured as long as 0.439 Mb in the pepper genome. FISH techniques applied on somatic and meiotic chromosomes and fibers have been established for chili to provide valuable information about the copy number variation of 45S rDNA and the actual physical size of the 5S rDNA in chili. PMID:19277503

  7. The karyotype and 5S rRNA genes from Spanish individuals of the bat species Rhinolophus hipposideros (Rhinolophidae; Chiroptera).

    PubMed

    Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio

    2008-11-01

    The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair. PMID:18066670

  8. mTOR associates with TFIIIC, is found at tRNA and 5S rRNA genes, and targets their repressor Maf1.

    PubMed

    Kantidakis, Theodoros; Ramsbottom, Ben A; Birch, Joanna L; Dowding, Sarah N; White, Robert J

    2010-06-29

    Synthesis of tRNA and 5S rRNA by RNA polymerase (pol) III is regulated by the mTOR pathway in mammalian cells. The mTOR kinase localizes to tRNA and 5S rRNA genes, providing an opportunity for direct control. Its presence at these sites can be explained by interaction with TFIIIC, a DNA-binding factor that recognizes the promoters of these genes. TFIIIC contains a TOR signaling motif that facilitates its association with mTOR. Maf1, a repressor that binds and inhibits pol III, is phosphorylated in a mTOR-dependent manner both in vitro and in vivo at serine 75, a site that contributes to its function as a transcriptional inhibitor. Proximity ligation assays confirm the interaction of mTOR with Maf1 and TFIIIC in nuclei. In contrast to Maf1 regulation in yeast, no evidence is found for nuclear export of Maf1 in response to mTOR signaling in HeLa cells. We conclude that mTOR associates with TFIIIC, is recruited to pol III-transcribed genes, and relieves their repression by Maf1. PMID:20543138

  9. Secondary structure of Tetrahymena thermophilia 5S ribosomal RNA as revealed by enzymatic digestion and microdensitometric analysis.

    PubMed Central

    Sneath, B; Vary, C; Pavlakis, G; Vournakis, J

    1986-01-01

    The secondary structure of [32P] end-labeled 5S rRNA from Tetrahymena thermophilia (strain B) has been investigated using the enzymes S1 nuclease, cobra venom ribonuclease and T2 ribonuclease. The results, analyzed by scanning microdensitometry and illustrated by three-dimensional computer graphics, support the secondary structure model of Curtiss and Vournakis for 5S rRNA. Aberrent mobility of certain RNA fragments on sequencing gels was observed as regions of band compression. These regions are postulated to be caused by stable internal base-pairing. The molecule was probed with T2 RNase in neutral (pH 7.5) and acidic (pH 4.5) buffers and only minor structural differences were revealed. One of the helices was found to be susceptible to enzymatic attack by both the single-strand and double-strand specific enzymes. These observations are evidence for the existence of dynamic structural equilibria in 5S rRNA. Images PMID:3005972

  10. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  11. Mutations in TFIIIA that increase stability of the TFIIIA-5 S rRNA gene complex: unusual effects on the kinetics of complex assembly and dissociation.

    PubMed

    Brady, Kristina L; Ponnampalam, Stephen N; Bumbulis, Michael J; Setzer, David R

    2005-07-22

    We have identified four mutations in Xenopus TFIIIA that increase the stability of TFIIIA-5 S rRNA gene complexes. In each case, the mutation has a relatively modest effect on equilibrium binding affinity. In three cases, these equilibrium binding effects can be ascribed primarily to decreases in the rate constant for protein-DNA complex dissociation. In the fourth case, however, a substitution of phenylalanine for the wild-type leucine at position 148 in TFIIIA results in much larger compensating changes in the kinetics of complex assembly and dissociation. The data support a model in which a relatively unstable population of complexes with multi-component dissociation kinetics forms rapidly; complexes then undergo a slow conformational change that results in very stable, kinetically homogeneous TFIIIA-DNA complexes. The L148F mutant protein acts as a particularly potent transcriptional activator when it is fused to the VP16 activation domain and expressed in yeast cells. Substitution of L148 to tyrosine or tryptophan produces an equally strong transcriptional activator. Substitution to histidine results in genetic and biochemical effects that are more modest than, but similar to, those observed with the L148F mutation. We propose that an amino acid with a planar side chain at position 148 can intercalate between adjacent base pairs in the intermediate element of the 5 S rRNA gene. Intercalation occurs slowly but results in a very stable DNA-protein complex. These results suggest that transcriptional activation by a cis-acting sequence element is largely dependent on the kinetic, rather than the thermodynamic, stability of the complex formed with an activator protein. Thus, transcriptional activation is dependent in large part on the lifetime of the activator-DNA complex rather than on binding site occupancy at steady state. Introduction of intercalating amino acids into zinc finger proteins may be a useful tool for producing artificial transcription factors with

  12. Alternate rRNA secondary structures as regulators of translation.

    PubMed

    Feng, Shu; Li, Heng; Zhao, Jing; Pervushin, Konstantin; Lowenhaupt, Ky; Schwartz, Thomas U; Dröge, Peter

    2011-02-01

    Structural dynamics of large molecular assemblies are intricately linked to function. For ribosomes, macromolecular changes occur especially during mRNA translation and involve participation of ribosomal RNA. Without suitable probes specific to RNA secondary structure, however, elucidation of more subtle dynamic ribosome structure-function relationships, especially in vivo, remains challenging. Here we report that the Z-DNA- and Z-RNA-binding domain Zα, derived from the human RNA editing enzyme ADAR1-L, binds with high stability to specific rRNA segments of Escherichia coli and human ribosomes. Zα impaired in Z-RNA recognition does not associate with ribosomes. Notably, Zα(ADAR1)-ribosome interaction blocks translation in vitro and in vivo, with substantial physiological consequences. Our study shows that ribosomes can be targeted by a protein that specifically recognizes an alternate rRNA secondary structure, and suggests a new mechanism of translational regulation on the ribosome. PMID:21217697

  13. Organization of rRNA structural genes in the archaebacterium Thermoplasma acidophilum.

    PubMed Central

    Tu, J; Zillig, W

    1982-01-01

    In the archaebacterium Thermoplasma acidophilum, each of the structural genes for 5S, 16S and 23S rRNA occur once per genome. In contrast to those of eubacteria and eukaryotes, they appear unlinked. The distance between the 16S and the 23S rDNA is at least 7.5 Kb, that between 23S and 5S rDNA at least 6 Kb and that between 16S and 5S rDNA at least 1.5 Kb. No linkage between those genes has been found by the analysis of recombinant plasmids carrying Bam HI and Hind III rDNA fragments as by hybridizing those plasmids to fragments of Thermoplasma DNA generated by 6 individual restriction endonucleases, recognizing hexanucleotide sequences. Images PMID:7155894

  14. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  15. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. PMID:25261903

  16. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central

    2012-01-01

    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  17. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    PubMed

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes. PMID:26835745

  18. Genetic and cytogenetic analyses of the A genome of Triticum monococcum. VIII. Localization of rDNAs and characterization of 5S rRNA genes.

    PubMed

    Kim, N S; Kuspira, J; Armstrong, K; Bhambhani, R

    1993-02-01

    In situ hybridization with [3H]dCTP labelled pScT7 (5S rDNA) and pTa80 (18S + 26S rDNA) indicated that both hybridized to the terminal regions of two pairs of chromosomes in Triticum monococcum. When the hybridization was performed with a mixture of both probes, only two pairs of chromosome arms were labelled, which suggested that the loci of both genes were located in juxtaposition to one another. Both probes labelled one pair of sites more heavily than the other. Southern analysis of 5S with BamHI-digested DNA from 12 accessions of T. monococcum (including T. urartu) produced two superimposed ladders of approximate sizes of 500 and 330 bp, which differ from T. aestivum in which 500- and 420-bp ladders were found. The 500-bp ladder is derived from chromosome 5A (5SDna-A2) and the 330-bp ladder from chromosome 1A (5SDna-A1). The recognition site for SstI was present in the long spacer region but absent in the short spacer as in T. aestivum; however, unlike T. aestivum, there were HaeIII (GGCC) and HindIII (AAGCTT) recognition sites in the short spacer region. The TaqI recognition sites (TCGA) in the long and short spacer regions are probably more highly methylated in T. monococcum than in T. aestivum. The results have implications regarding the evolutionary changes that occurred in the A genome of the hexaploid compared with the diploid. PMID:18469972

  19. Secondary structure of mouse 28S rRNA and general model for the folding of the large rRNA in eukaryotes.

    PubMed Central

    Michot, B; Hassouna, N; Bachellerie, J P

    1984-01-01

    We present a secondary structure model for the entire sequence of mouse 28S rRNA (1) which is based on an extensive comparative analysis of the available eukaryotic sequences, i.e. yeast (2, 3), Physarum polycephalum (4), Xenopus laevis (5) and rat (6). It has been derived with close reference to the models previously proposed for yeast 26S rRNA (2) and for prokaryotic 23S rRNA (7-9). Examination of the recently published eukaryotic sequences confirms that all pro- and eukaryotic large rRNAs share a largely conserved secondary structure core, as already apparent from the previous analysis of yeast 26S rRNA (2). These new comparative data confirm most features of the yeast model (2). They also provide the basis for a few modifications and for new proposals which extend the boundaries of the common structural core (now representing about 85% of E. coli 23S rRNA length) and bring new insights for tracing the structural evolution, in higher eukaryotes, of the domains which have no prokaryotic equivalent and are inserted at specific locations within the common structural core of the large subunit rRNA. PMID:6374617

  20. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  1. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  2. 5SRNAdb: an information resource for 5S ribosomal RNAs

    PubMed Central

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A.; Karlowski, Wojciech M.

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA–protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  3. Physical and genetic maps of the Leptospira interrogans serovar icterohaemorrhagiae strain Ictero no.1 chromosome and sequencing of a 19-kb region of the genome containing the 5S rRNA gene.

    PubMed

    Takahashi, Y; Akase, K; Hirano, H; Fukunaga, M

    1998-07-17

    We report the construction of physical and genetic maps of the chromosome of Leptospira interrogans serovar icterohaemorrhagiae strain Ictero No.1 using pulsed-field gel electrophoresis of DNA fragments generated by digestion with enzymes SrfI, AscI, FseI, and NotI and using reciprocal hybridization. We also sequenced the 19-kilobase (kb) DNA segment including the one gene for 5S rRNA (rrf) of pathogenic Leptospira. The size of the chromosome of the strain Ictero No.1 was estimated to be 4673kb and was found to be similar to those of the chromosomes of the leptospira strains Verdun (serovar icterohaemorrhagiae) and RZ11 (serovar pomona). The strains Verdun and RZ11 carry a small 350-kb replicon (minichromosome), and the strain Ictero No.1 also contained the same kind of molecule together with the chromosome. The physical maps of the strains Ictero No.1 and Verdun were almost identical, as were the locations of the selected genes, except for the location of one of the 16S rRNA genes. Overall, the genetic organization appeared to be conserved within the serovar icterohaemorrhagiae strains. In the sequenced region, we identified 10 putative ORFs and one rrf sequence, and the transcription orientations were all the same. A homology search for the products deduced from the sequenced data revealed that the orf H exhibited high similarity to malic acid enzyme of Haemophilus influenzae and fumarate hydratase of Escherichia coli (orf J). The rest of the putative products encoded by ORFs in the sequenced region showed little similarity with the proteins contained in the databases and were considered to be unknown proteins. PMID:9666070

  4. Simultaneous alignment and folding of 28S rRNA sequences uncovers phylogenetic signal in structure variation.

    PubMed

    Letsch, Harald O; Greve, Carola; Kück, Patrick; Fleck, Günther; Stocsits, Roman R; Misof, Bernhard

    2009-12-01

    Secondary structure models of mitochondrial and nuclear (r)RNA sequences are frequently applied to aid the alignment of these molecules in phylogenetic analyses. Additionally, it is often speculated that structure variation of (r)RNA sequences might profitably be used as phylogenetic markers. The benefit of these approaches depends on the reliability of structure models. We used a recently developed approach to show that reliable inference of large (r)RNA secondary structures as a prerequisite of simultaneous sequence and structure alignment is feasible. The approach iteratively establishes local structure constraints of each sequence and infers fully folded individual structures by constrained MFE optimization. A comparison of structure edit distances of individual constraints and fully folded structures showed pronounced phylogenetic signal in fully folded structures. As model sequences we characterized secondary structures of 28S rRNA sequences of selected insects and examined their phylogenetic signal according to established phylogenetic hypotheses. PMID:19654047

  5. Structural Analysis of Base Substitutions in Thermus thermophilus 16S rRNA Conferring Streptomycin Resistance

    PubMed Central

    Demirci, Hasan; Murphy, Frank V.; Murphy, Eileen L.; Connetti, Jacqueline L.; Dahlberg, Albert E.; Jogl, Gerwald

    2014-01-01

    Streptomycin is a bactericidal antibiotic that induces translational errors. It binds to the 30S ribosomal subunit, interacting with ribosomal protein S12 and with 16S rRNA through contacts with the phosphodiester backbone. To explore the structural basis for streptomycin resistance, we determined the X-ray crystal structures of 30S ribosomal subunits from six streptomycin-resistant mutants of Thermus thermophilus both in the apo form and in complex with streptomycin. Base substitutions at highly conserved residues in the central pseudoknot of 16S rRNA produce novel hydrogen-bonding and base-stacking interactions. These rearrangements in secondary structure produce only minor adjustments in the three-dimensional fold of the pseudoknot. These results illustrate how antibiotic resistance can occur as a result of small changes in binding site conformation. PMID:24820088

  6. Complete sequence and gene organization of the Nosema spodopterae rRNA gene.

    PubMed

    Tsai, Shu-Jen; Huang, Wei-Fone; Wang, Chung-Hsiung

    2005-01-01

    By sequencing the entire ribosomal RNA (rRNA) gene of Nosema spodopterae, we show here that its gene organization follows a pattern similar to the Nosema type species, Nosema bombycis, i.e. 5'-large subunit rRNA (2,497 bp)-internal transcribed spacer (185 bp)-small subunit rRNA (1,232 bp)-intergenic spacer (277 bp)-5S rRNA (114 bp)-3'. Gene sequences and the secondary structures of large subunit rRNA, small subunit rRNA, and 5S rRNA are compared with the known corresponding sequences and structures of closely related microsporidia. The results suggest that the Nosema genus may be heterogeneous and that the rRNA gene organization may be a useful characteristic for determining which species are closely related to the type species. PMID:15702980

  7. Structural polymorphism in the major groove of a 5S RNA gene complements the zinc finger domains of transcription factor IIIA.

    PubMed Central

    Huber, P W; Morii, T; Mei, H Y; Barton, J K

    1991-01-01

    Metal complexes that bind to DNA on the basis of shape-selection have been used to map the conformational features of the DNA binding site for transcription factor IIIA. Conformationally distinct segments are detected on the 5S rRNA gene that correspond closely to the binding sites identified for the individual zinc finger domains of the protein. The local conformations are characterized by a major groove opened because of a change in base pair inclination and/or displacement at a central 5'-pyrimidine-purine-3' step, flanked by a widened minor groove, as would arise at the junctions between alternating B- and A-like DNA segments. Docking experiments with a consensus structure of a zinc finger reveal that the mixed A-B binding site accommodates the peptide domain better than either canonical B- or A-DNA helices. The close structural matching of the conformational variations in the 5S rDNA both to the proposed sites of zinc finger binding and to the shape of an individual zinc finger domain points to DNA structural polymorphism as providing an important determinant in recognition. In particular, shape selection in the 5' half of the internal control region may orient the multiple finger domains. Images PMID:1961749

  8. Post-transcriptional Modifications Modulate rRNA Structure and Ligand Interactions.

    PubMed

    Jiang, Jun; Seo, Hyosuk; Chow, Christine S

    2016-05-17

    Post-transcriptional modifications play important roles in modulating the functions of RNA species. The presence of modifications in RNA may directly alter its interactions with binding partners or cause structural changes that indirectly affect ligand recognition. Given the rapidly growing list of modifications identified in noncoding and mRNAs associated with human disease, as well as the dynamic control over modifications involved in various physiological processes, it is imperative to understand RNA structural modulation by these modifications. Among the RNA species, rRNAs provide numerous examples of modification types located in differing sequence and structural contexts. In addition, the modified rRNA motifs participate in a wide variety of ligand interactions, including those with RNA, protein, and small molecules. In fact, several classes of antibiotics exert their effects on protein synthesis by binding to functionally important and highly modified regions of the rRNAs. These RNA regions often display conservation in sequence, secondary structure, tertiary interactions, and modifications, trademarks of ideal drug-targeting sites. Furthermore, ligand interactions with such regions often favor certain modification-induced conformational states of the RNA. Our laboratory has employed a combination of biophysical methods such as nuclear magnetic resonance spectroscopy (NMR), circular dichroism, and UV melting to study rRNA modifications in functionally important motifs, including helix 31 (h31) and helix h44 (h44) of the small subunit rRNA and helix 69 (H69) of the large subunit rRNA. The modified RNA oligonucleotides used in these studies were generated by solid-phase synthesis with a variety of phosphoramidite chemistries. The natural modifications were shown to impact thermal stability, dynamic behavior, and tertiary structures of the RNAs, with additive or cooperative effects occurring with multiple, clustered modifications. Taking advantage of the

  9. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  10. Primary and secondary structure of 5.8S rRNA from the silkgland of Bombyx mori.

    PubMed Central

    Fujiwara, H; Kawata, Y; Ishikawa, H

    1982-01-01

    Nucleotide sequence of 5.8S rRNA of the silkworm, Bombyx mori has been determined by gel sequencing methods. The 5.8S rRNA was the longest so far reported, with the 5'-terminal sequence several nucleotides longer than those of the other organisms. Upon constructing the secondary structure in accordance with the "burp gun" model (12), the Bombyx 5.8S rRNA formed a wide-open "muzzle" due to several unpaired bases at the ends. The overall structure also appeared less stable with less G . C pairs and more unpaired bases than that of the HeLa 5.8S rRNA. These structural features may be essential for those 5.8S rRNAs which interact with 28S rRNAs containing the hidden break to form a stable complex. PMID:7088713

  11. The 9S RNA precursor of Escherichia coli 5S RNA has three structural domains: implications for processing.

    PubMed Central

    Christiansen, J

    1988-01-01

    The secondary structure of the 9S RNA precursor to ribosomal 5S RNA in Escherichia coli has been determined using chemical reagents and ribonucleases in combination with a reverse transcription procedure. The 9S RNA precursor was generated in vitro by T7 RNA polymerase, and the rrnB operon terminator, T1, was able to terminate the in vitro transcript. The secondary structure model exhibits three structural domains corresponding to a 5' region, a mature region and a terminator region. The mature domain is structurally identical to 5S RNA, and the ribosomal proteins L18 and L25 are able to bind to the precursor. The processing endoribonuclease RNase E cleaves between the structural domains. Moreover, an intramolecular refolding of the nascent transcript must take place if the current view of RNase III processing stems is correct. Images PMID:3045757

  12. rRNA genes from the lower chordate Herdmania momus: structural similarity with higher eukaryotes.

    PubMed Central

    Degnan, B M; Yan, J; Hawkins, C J; Lavin, M F

    1990-01-01

    Ascidians, primitive chordates that have retained features of the likely progenitors to all vertebrates, are a useful model to study the evolutionary relationship of chordates to other animals. We have selected the well characterized ribosomal RNA (rRNA) genes to investigate this relationship, and we describe here the cloning and characterization of an entire ribosomal DNA (rDNA) tandem repeat unit from a lower chordate, the ascidian Herdmania momus. rDNA copy number and considerable sequence differences were observed between two H. momus populations. Comparison of rDNA primary sequence and rRNA secondary structures from H. momus with those from other well characterized organisms, demonstrated that the ascidians are more closely related to other chordates than invertebrates. The rDNA tandem repeat makes up a larger percentage (7%) of the genome of this animal than in other higher eukaryotes. The total length of the spacer and transcribed region in H. momus rDNA is small compared to most higher eukaryotes, being less than 8 kb, and the intergenic spacer region consists of smaller internal repeats. Comparative analysis of rDNA sequences has allowed the construction of secondary structures for the 18S, 5.8S and 26S rRNAs. Images PMID:2263465

  13. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  14. An updated 18S rRNA phylogeny of tunicates based on mixture and secondary structure models

    PubMed Central

    Tsagkogeorga, Georgia; Turon, Xavier; Hopcroft, Russell R; Tilak, Marie-Ka; Feldstein, Tamar; Shenkar, Noa; Loya, Yossi; Huchon, Dorothée; Douzery, Emmanuel JP; Delsuc, Frédéric

    2009-01-01

    Background Tunicates have been recently revealed to be the closest living relatives of vertebrates. Yet, with more than 2500 described species, details of their evolutionary history are still obscure. From a molecular point of view, tunicate phylogenetic relationships have been mostly studied based on analyses of 18S rRNA sequences, which indicate several major clades at odds with the traditional class-level arrangements. Nonetheless, substantial uncertainty remains about the phylogenetic relationships and taxonomic status of key groups such as the Aplousobranchia, Appendicularia, and Thaliacea. Results Thirty new complete 18S rRNA sequences were acquired from previously unsampled tunicate species, with special focus on groups presenting high evolutionary rate. The updated 18S rRNA dataset has been aligned with respect to the constraint on homology imposed by the rRNA secondary structure. A probabilistic framework of phylogenetic reconstruction was adopted to accommodate the particular evolutionary dynamics of this ribosomal marker. Detailed Bayesian analyses were conducted under the non-parametric CAT mixture model accounting for site-specific heterogeneity of the evolutionary process, and under RNA-specific doublet models accommodating the occurrence of compensatory substitutions in stem regions. Our results support the division of tunicates into three major clades: 1) Phlebobranchia + Thaliacea + Aplousobranchia, 2) Appendicularia, and 3) Stolidobranchia, but the position of Appendicularia could not be firmly resolved. Our study additionally reveals that most Aplousobranchia evolve at extremely high rates involving changes in secondary structure of their 18S rRNA, with the exception of the family Clavelinidae, which appears to be slowly evolving. This extreme rate heterogeneity precluded resolving with certainty the exact phylogenetic placement of Aplousobranchia. Finally, the best fitting secondary-structure and CAT-mixture models suggest a sister

  15. Radiation-modified structure of Ge25Sb15S60 and Ge35Sb5S60 glasses.

    PubMed

    Kavetskyy, T; Shpotyuk, O; Kaban, I; Hoyer, W

    2008-06-28

    Atomic structures of Ge(25)Sb(15)S(60) and Ge(35)Sb(5)S(60) glasses are investigated in the gamma-irradiated and annealed after gamma-irradiation states by means of high-energy synchrotron x-ray diffraction technique. The first sharp diffraction peak (FSDP) is detected at around 1.1 A(-1) in the structure factors of both alloys studied. The FSDP position is found to be stable for radiation/annealing treatment of the samples, while the FSDP intensity shows some changes between gamma-irradiated and annealed states. The peaks in the pair distribution functions observed between 2 and 4 A are related to the Ge-S, Ge-Sb, and Sb-Sb first neighbor correlations and Ge-Ge second neighbor correlations in the edge-shared GeS(42) tetrahedra, and S-S and/or Ge-Ge second neighbor correlations in the corner-shared GeS(42) tetrahedra. Three mechanisms of the radiation-/annealing-induced changes are discussed in the framework of coordination topological defect formation and bond-free solid angle concepts. PMID:18601355

  16. Structure of ERA in complex with the 3′ end of 16S rRNA: Implications for ribosome biogenesis

    SciTech Connect

    Tu, Chao; Zhou, Xiaomei; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua

    2009-10-09

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the {sub 1531}AUCACCUCCUUA{sub 1542} sequence at the 3' end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  17. Global stabilization of rRNA structure by ribosomal proteins S4, S17 and S20

    PubMed Central

    Ramaswamy, Priya; Woodson, Sarah A.

    2009-01-01

    Summary Ribosomal proteins stabilize the folded structure of the rRNA and enable the recruitment of further proteins to the complex. Quantitative hydroxyl radical footprinting was used to measure the extent to which three different primary assembly proteins, S4, S17 and S20, stabilize the 3D structure of the E. coli 16S 5′ domain. The stability of the complexes was perturbed by varying the concentration of MgCl2. Each protein influences the stability of the rRNA tertiary interactions beyond its immediate binding site. S4 and S17 stabilize the entire 5′ domain, while S20 has a more local effect. Multi-stage folding of individual helices within the 5′ domain shows that each protein stabilizes a different ensemble of structural intermediates, that include non-native interactions at low Mg2+. We propose that the combined interactions of S4, S17 and S20 with different helical junctions bias the free energy landscape toward a few RNA conformations that are competent to add the secondary assembly protein S16 in the next step of assembly. PMID:19616559

  18. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera

    PubMed Central

    2008-01-01

    Background The cytoplasmic ribosomal small subunit (SSU, 18S) ribosomal RNA (rRNA) is the most frequently-used gene for molecular phylogenetic studies. However, information regarding its secondary structure is neglected in most phylogenetic analyses. Incorporation of this information is essential in order to apply specific rRNA evolutionary models to overcome the problem of co-evolution of paired sites, which violates the basic assumption of the independent evolution of sites made by most phylogenetic methods. Information about secondary structure also supports the process of aligning rRNA sequences across taxa. Both aspects have been shown to increase the accuracy of phylogenetic reconstructions within various taxa. Here, we explore SSU rRNA secondary structures from the three extant classes of Phylum Porifera (Grant, 1836), a pivotal, but largely unresolved taxon of early branching Metazoa. This is the first phylogenetic study of poriferan SSU rRNA data to date that includes detailed comparative secondary structure information for all three sponge classes. Results We found base compositional and structural differences in SSU rRNA among Demospongiae, Hexactinellida (glass sponges) and Calcarea (calcareous sponges). We showed that analyses of primary rRNA sequences, including secondary structure-specific evolutionary models, in combination with reconstruction of the evolution of unusual structural features, reveal a substantial amount of additional information. Of special note was the finding that the gene tree topologies of marine haplosclerid demosponges, which are inconsistent with the current morphology-based classification, are supported by our reconstructed evolution of secondary structure features. Therefore, these features can provide alternative support for sequence-based topologies and give insights into the evolution of the molecule itself. To encourage and facilitate the application of rRNA models in phylogenetics of early metazoans, we present 52 SSU rRNA

  19. Structural and Functional Studies of the Thermus Thermophilus 16S rRNA Methyltransferase RsmG

    SciTech Connect

    Gregory, S.; Demirci, H; Belardinelli, R; Monshupanee, T; Gualerzi, C; Dahlberg, A; Jogl, G

    2009-01-01

    The RsmG methyltransferase is responsible for N7 methylation of G527 of 16S rRNA in bacteria. Here, we report the identification of the Thermus thermophilus rsmG gene, the isolation of rsmG mutants, and the solution of RsmG X-ray crystal structures at up to 1.5 A resolution. Like their counterparts in other species, T. thermophilus rsmG mutants are weakly resistant to the aminoglycoside antibiotic streptomycin. Growth competition experiments indicate a physiological cost to loss of RsmG activity, consistent with the conservation of the modification site in the decoding region of the ribosome. In contrast to Escherichia coli RsmG, which has been reported to recognize only intact 30S subunits, T. thermophilus RsmG shows no in vitro methylation activity against native 30S subunits, only low activity with 30S subunits at low magnesium concentration, and maximum activity with deproteinized 16S rRNA. Cofactor-bound crystal structures of RsmG reveal a positively charged surface area remote from the active site that binds an adenosine monophosphate molecule. We conclude that an early assembly intermediate is the most likely candidate for the biological substrate of RsmG.

  20. The crystal structure of Mtr4 reveals a novel arch domain required for rRNA processing

    SciTech Connect

    Jackson, R.N.; Robinson, H.; Klauer, A. A.; Hintze, B. J.; van Hoof, A.; Johnson, S. J.

    2010-07-01

    The essential RNA helicase, Mtr4, performs a critical role in RNA processing and degradation as an activator of the nuclear exosome. The molecular basis for this vital function is not understood and detailed analysis is significantly limited by the lack of structural data. In this study, we present the crystal structure of Mtr4. The structure reveals a new arch-like domain that is specific to Mtr4 and Ski2 (the cytosolic homologue of Mtr4). In vivo and in vitro analyses demonstrate that the Mtr4 arch domain is required for proper 5.8S rRNA processing, and suggest that the arch functions independently of canonical helicase activity. In addition, extensive conservation along the face of the putative RNA exit site highlights a potential interface with the exosome. These studies provide a molecular framework for understanding fundamental aspects of helicase function in exosome activation, and more broadly define the molecular architecture of Ski2-like helicases.

  1. Superconductivity versus structural phase transition in the closely related Bi2Rh3.5S2 and Bi2Rh3S2

    DOE PAGESBeta

    Kaluarachchi, Udhara S.; Xie, Weiwei; Lin, Qisheng; Taufour, Valentin; Bud'ko, Sergey L.; Miller, Gordon J.; Canfield, Paul C.

    2015-05-19

    Single crystals of Bi2Rh3S2 and Bi2Rh3.5S2 were synthesized by solution growth, and the crystal structures and thermodynamic and transport properties of both compounds were studied. In the case of Bi2Rh3S2, a structural first-order transition at around 165 K is identified by single-crystal diffraction experiments, with clear signatures visible in resistivity, magnetization, and specific heat data. No superconducting transition for Bi2Rh3S2 was observed down to 0.5 K. In contrast, no structural phase transition at high temperature was observed for Bi2Rh3.5S2; however, bulk superconductivity with a critical temperature, Tc ≈ 1.7 K, was observed. The Sommerfeld coefficient γ and the Debye temperaturemore » (ΘD) were found to be 9.41 mJ mol–1K–2 and 209 K, respectively, for Bi2Rh3S2, and 22 mJ mol–1K–2 and 196 K, respectively, for Bi2Rh3.5S2. As a result, the study of the specific heat in the superconducting state of Bi2Rh3.5S2 suggests that Bi2Rh3.5S2 is a weakly coupled, BCS superconductor.« less

  2. Superconductivity versus structural phase transition in the closely related Bi2Rh3.5S2 and Bi2Rh3S2

    NASA Astrophysics Data System (ADS)

    Kaluarachchi, Udhara S.; Xie, Weiwei; Lin, Qisheng; Taufour, Valentin; Bud'ko, Sergey L.; Miller, Gordon J.; Canfield, Paul C.

    2015-05-01

    Single crystals of Bi2Rh3S2 and Bi2Rh3.5S2 were synthesized by solution growth, and the crystal structures and thermodynamic and transport properties of both compounds were studied. In the case of Bi2Rh3S2 , a structural first-order transition at around 165 K is identified by single-crystal diffraction experiments, with clear signatures visible in resistivity, magnetization, and specific heat data. No superconducting transition for Bi2Rh3S2 was observed down to 0.5 K. In contrast, no structural phase transition at high temperature was observed for Bi2Rh3.5S2 ; however, bulk superconductivity with a critical temperature, Tc≈1.7 K, was observed. The Sommerfeld coefficient γ and the Debye temperature (ΘD ) were found to be 9.41 mJ mol-1K-2 and 209 K, respectively, for Bi2Rh3S2 , and 22 mJ mol-1K-2 and 196 K, respectively, for Bi2Rh3.5S2 . Study of the specific heat in the superconducting state of Bi2Rh3.5S2 suggests that Bi2Rh3.5S2 is a weakly coupled, BCS superconductor.

  3. Z{sub b}(10 610) and Z{sub b}(10 650) structures produced by the initial single pion emission in the {Upsilon}(5S) decays

    SciTech Connect

    Chen Dianyong; Liu Xiang

    2011-11-01

    We propose a unique mechanism called initial single pion emission existing in the {Upsilon}(5S) decays, and further study the line shapes of d{Gamma}({Upsilon}(5S{yields}{Upsilon}(nS){pi}{sup +}{pi}{sup -}))/dm{sub {Upsilon}}(nS){pi}{sup +} (n=1,2,3) and d{Gamma}({Upsilon}(5S{yields}h{sub b}(mP){pi}{sup +}{pi}{sup -}))/dm{sub h{sub b}(mP)}{pi}{sup +} (m=1,2). We find sharp structures around 10 610 MeV and 10 650 MeV in the obtained theoretical line shapes of d{Gamma}({Upsilon}(5S{yields}{Upsilon}(nS){pi}{sup +}{pi}{sup -}))/dm{sub {Upsilon}}(nS){pi}{sup +} and d{Gamma}({Upsilon}(5S{yields}h{sub b}(mP){pi}{sup +}{pi}{sup -}))/dm{sub h{sub b}(mP)}{pi}{sup +} distributions, which could naturally correspond to the Z{sub b}(10 610) and Z{sub b}(10 650) structures newly observed by Belle.

  4. Phylogeny of Intestinal Ciliates, Including Charonina ventriculi, and Comparison of Microscopy and 18S rRNA Gene Pyrosequencing for Rumen Ciliate Community Structure Analysis

    PubMed Central

    Devente, Savannah R.; Kirk, Michelle R.; Seedorf, Henning; Dehority, Burk A.

    2015-01-01

    The development of high-throughput methods, such as the construction of 18S rRNA gene clone or pyrosequencing libraries, has allowed evaluation of ciliate community composition in hundreds of samples from the rumen and other intestinal habitats. However, several genera of mammalian intestinal ciliates have been described based only on morphological features and, to date, have not been identified using molecular methods. Here, we isolated single cells of one of the smallest but widely distributed intestinal ciliates, Charonina ventriculi, and sequenced its 18S rRNA gene. We verified the sequence in a full-cycle rRNA approach using fluorescence in situ hybridization and thereby assigned an 18S rRNA gene sequence to this species previously known only by its morphology. Based on its full-length 18S rRNA gene sequence, Charonina ventriculi was positioned within the phylogeny of intestinal ciliates in the subclass Trichostomatia. The taxonomic framework derived from this phylogeny was used for taxonomic assignment of trichostome ciliate 18S rRNA gene sequence data stemming from high-throughput amplicon pyrosequencing of rumen-derived DNA samples. The 18S rRNA gene-based ciliate community structure was compared to that obtained from microscopic counts using the same samples. Both methods allowed identification of dominant members of the ciliate communities and classification of the rumen ciliate community into one of the types first described by Eadie in 1962. Notably, each method is associated with advantages and disadvantages. Microscopy is a highly accurate method for evaluation of total numbers or relative abundances of different ciliate genera in a sample, while 18S rRNA gene pyrosequencing represents a valuable alternative for comparison of ciliate community structure in a large number of samples from different animals or treatment groups. PMID:25616800

  5. Structure of 4.5S RNA in the signal recognition particle of Escherichia coli as studied by enzymatic and chemical probing.

    PubMed Central

    Lentzen, G; Moine, H; Ehresmann, C; Ehresmann, B; Wintermeyer, W

    1996-01-01

    The structure of 4.5S RNA, the Escherichia coli homologue of the signal recognition particle (SRP) RNA, alone and in the SRP complex with protein P48 (Ffh) was probed both enzymatically and chemically. The molecule is largely resistant against single strand-specific nucleases, indicating a highly base paired structure. Reactivity appears mainly in the apical tetraloop and in one of the conserved internal loops. Although some residues are found reactive toward dimethylsulphate and kethoxal in regions predicted to be unpaired by the phylogenetic secondary structure model of 4.5S RNA, generally the reactivity is low, and some residues in internal loops are not reactive at all. RNase V1 cleaves the RNA at multiple sites that coincide with predicted helices, although the cleavages show a pronounced asymmetry. The binding of protein P48 to 4.5S RNA results in a protection of residues in the apical part of the molecule homologous to eukaryotic SRP RNA (domain IV), whereas the cleavages in the conserved apical tetraloop are not protected. Hydroxyl radical treatment reveals an asymmetric pattern of backbone reactivity; in particular, the region encompassing nucleotides 60-82, i.e., the 3' part of the conserved domain IV, is protected. The data suggest that a bend in the domain IV region, most likely at the central asymmetric internal loop, is an important element of the tertiary structure of 4.5S RNA. Hyperchromicity and lead cleavage data are consistent with the model as they reveal the unfolding of a higher-order structure between 30 and 40 degrees C. Protection by protein P48 occurs in this region of the RNA and, more strongly, in the 5' part of domain IV (nt 26-50, most strongly from 35 to 49). It is likely that P48 binds to the outside of the bent form of 4.5S RNA. PMID:8608448

  6. Structural and functional insights into the molecular mechanism of rRNA m6A methyltransferase RlmJ.

    PubMed

    Punekar, Avinash S; Liljeruhm, Josefine; Shepherd, Tyson R; Forster, Anthony C; Selmer, Maria

    2013-11-01

    RlmJ catalyzes the m(6)A2030 methylation of 23S rRNA during ribosome biogenesis in Escherichia coli. Here, we present crystal structures of RlmJ in apo form, in complex with the cofactor S-adenosyl-methionine and in complex with S-adenosyl-homocysteine plus the substrate analogue adenosine monophosphate (AMP). RlmJ displays a variant of the Rossmann-like methyltransferase (MTase) fold with an inserted helical subdomain. Binding of cofactor and substrate induces a large shift of the N-terminal motif X tail to make it cover the cofactor binding site and trigger active-site changes in motifs IV and VIII. Adenosine monophosphate binds in a partly accommodated state with the target N6 atom 7 Å away from the sulphur of AdoHcy. The active site of RlmJ with motif IV sequence 164DPPY167 is more similar to DNA m(6)A MTases than to RNA m(6)2A MTases, and structural comparison suggests that RlmJ binds its substrate base similarly to DNA MTases T4Dam and M.TaqI. RlmJ methylates in vitro transcribed 23S rRNA, as well as a minimal substrate corresponding to helix 72, demonstrating independence of previous modifications and tertiary interactions in the RNA substrate. RlmJ displays specificity for adenosine, and mutagenesis experiments demonstrate the critical roles of residues Y4, H6, K18 and D164 in methyl transfer. PMID:23945937

  7. Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

    PubMed Central

    Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

    2015-01-01

    RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

  8. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    PubMed Central

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding. PMID:11350033

  9. Structural Rearrangements in the Active Site of the Thermus thermophilus 16S rRNA Methyltransferase KsgA in a Binary Complex with 5'-Methylthioadenosine

    SciTech Connect

    Demirci, H.; Belardinelli, R; Seri, E; Gregory, S; Gualerzi, C; Dahlberg, A; Jogl, G

    2009-01-01

    Posttranscriptional modification of ribosomal RNA (rRNA) occurs in all kingdoms of life. The S-adenosyl-l-methionine-dependent methyltransferase KsgA introduces the most highly conserved rRNA modification, the dimethylation of A1518 and A1519 of 16S rRNA. Loss of this dimethylation confers resistance to the antibiotic kasugamycin. Here, we report biochemical studies and high-resolution crystal structures of KsgA from Thermus thermophilus. Methylation of 30S ribosomal subunits by T. thermophilus KsgA is more efficient at low concentrations of magnesium ions, suggesting that partially unfolded RNA is the preferred substrate. The overall structure is similar to that of other methyltransferases but contains an additional ?-helix in a novel N-terminal extension. Comparison of the apoenzyme with complex structures with 5?-methylthioadenosine or adenosine bound in the cofactor-binding site reveals novel features when compared with related enzymes. Several mobile loop regions that restrict access to the cofactor-binding site are observed. In addition, the orientation of residues in the substrate-binding site indicates that conformational changes are required for binding two adjacent residues of the substrate rRNA.

  10. Analysis of the primary sequence and secondary structure of the unusually long SSU rRNA of the soil bug, Armadillidium vulgare.

    PubMed

    Choe, C P; Hancock, J M; Hwang, U W; Kim, W

    1999-12-01

    The complete nucleotide sequence of the SSU rRNA gene from the soil bug, Armadillidium vulgare (Crustacea, Isopoda), was determined. It is 3214 bp long, with a GC content of 56.3%. It is not only the longest SSU rRNA gene among Crustacea but also longer than any other SSU rRNA gene except that of the strepsipteran insect, Xenos vesparum (3316 bp). The unusually long sequence of this species is explained by the long sequences of variable regions V4 and V7, which make up more than half of the total length. RT-PCR analysis of these two regions showed that the long sequences also exist in the mature rRNA and sequence simplicity analysis revealed the presence of slippage motifs in these two regions. The putative secondary structure of the rRNA is typical for eukaryotes except for the length and shape variations of the V2, V4, V7, and V9 regions. Each of the V2, V4, and V7 regions was elongated, while the V9 region was shortened. In V2, two bulges, located between helix 8 and helix 9 and between helix 9 and helix 10, were elongated. In V4, stem E23-3 was dramatically expanded, with several small branched stems. In V7, stem 43 was branched and expanded. Comparisons with the unusually long SSU rRNAs of other organisms imply that the increase in total length of SSU rRNA is due mainly to expansion in the V4 and V7 regions. PMID:10594181

  11. Modified Method of rRNA Structure Analysis Reveals Novel Characteristics of Box C/D RNA Analogues.

    PubMed

    Filippova, J A; Stepanov, G A; Semenov, D V; Koval, O A; Kuligina, E V; Rabinov, I V; Richter, V A

    2015-01-01

    Ribosomal RNA (rRNA) maturation is a complex process that involves chemical modifications of the bases or sugar residues of specific nucleotides. One of the most abundant types of rRNA modifications, ribose 2'-O-methylation, is guided by ribonucleoprotein complexes containing small nucleolar box C/D RNAs. Since the majority of 2'-O-methylated nucleotides are located in the most conserved regions of rRNA that comprise functionally important centers of the ribosome, an alteration in a 2'-O-methylation profile can affect ribosome assembly and function. One of the key approaches for localization of 2'-O-methylated nucleotides in long RNAs is a method based on the termination of reverse transcription. The current study presents an adaptation of this method for the use of fluorescently labeled primers and analysis of termination products by capillary gel electrophoresis on an automated genetic analyzer. The developed approach allowed us to analyze the influence of the synthetic analogues of box C/D RNAs on post-transcriptional modifications of human 28S rRNA in MCF-7 cells. It has been established that the transfection of MCF-7 cells with a box C/D RNA analogue leads to an enhanced modification level of certain native sites of 2'-O-methylation in the target rRNA. The observed effect of synthetic RNAs on the 2'-O-methylation of rRNA in human cells demonstrates a path towards targeted regulation of rRNA post-transcriptional maturation. The described approach can be applied in the development of novel diagnostic methods for detecting diseases in humans. PMID:26085946

  12. The impact of rRNA secondary structure consideration in alignment and tree reconstruction: simulated data and a case study on the phylogeny of hexapods.

    PubMed

    Letsch, Harald O; Kück, Patrick; Stocsits, Roman R; Misof, Bernhard

    2010-11-01

    The use of secondary structures has been advocated to improve both the alignment and the tree reconstruction processes of ribosomal RNA (rRNA) data sets. We used simulated and empirical rRNA data to test the impact of secondary structure consideration in both steps of molecular phylogenetic analyses. A simulation approach was used to generate realistic rRNA data sets based on real 16S, 18S, and 28S sequences and structures in combination with different branch length and topologies. Alignment and tree reconstruction performance of four recent structural alignment methods was compared with exclusively sequence-based approaches. As empirical data, we used a hexapod rRNA data set to study the influence of nucleotide interdependencies in sequence alignment and tree reconstruction. Structural alignment methods delivered significantly better sequence alignments compared with pure sequence-based methods. Also, structural alignment methods delivered better trees judged by topological congruence to simulation base trees. However, the advantage of structural alignments was less pronounced and even vanished in several instances. For simulated data, application of mixed RNA/DNA models to stems and loops, respectively, led to significantly shorter branches. The application of mixed RNA/DNA models in the hexapod analyses delivered partly implausible relationships. This can be interpreted as a stronger sensitivity of mixed model setups to nonphylogenetic signal. Secondary structure consideration clearly influenced sequence alignment and tree reconstruction of ribosomal genes. Although sequence alignment quality can considerably be improved by the use of secondary structure information, the application of mixed models in tree reconstructions needs further studies to understand the observed effects. PMID:20530152

  13. Molecular Phylogenetics and Systematics of the Bivalve Family Ostreidae Based on rRNA Sequence-Structure Models and Multilocus Species Tree

    PubMed Central

    Salvi, Daniele; Macali, Armando; Mariottini, Paolo

    2014-01-01

    The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassotreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics. PMID:25250663

  14. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  15. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  16. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  17. Mitochondrial Enzyme Rhodanese Is Essential for 5 S Ribosomal RNA Import into Human Mitochondria*

    PubMed Central

    Smirnov, Alexandre; Comte, Caroline; Mager-Heckel, Anne-Marie; Addis, Vanessa; Krasheninnikov, Igor A.; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan

    2010-01-01

    5 S rRNA is an essential component of ribosomes. In eukaryotic cells, it is distinguished by particularly complex intracellular traffic, including nuclear export and re-import. The finding that in mammalian cells 5 S rRNA can eventually escape its usual circuit toward nascent ribosomes to get imported into mitochondria has made the scheme more complex, and it has raised questions about both the mechanism of 5 S rRNA mitochondrial targeting and its function inside the organelle. Previously, we showed that import of 5 S rRNA into mitochondria requires unknown cytosolic proteins. Here, one of them was identified as mitochondrial thiosulfate sulfurtransferase, rhodanese. Rhodanese in its misfolded form was found to possess a strong and specific 5 S rRNA binding activity, exploiting sites found earlier to function as signals of 5 S rRNA mitochondrial localization. The interaction with 5 S rRNA occurs cotranslationally and results in formation of a stable complex in which rhodanese is preserved in a compact enzymatically inactive conformation. Human 5 S rRNA in a branched Mg2+-free form, upon its interaction with misfolded rhodanese, demonstrates characteristic functional traits of Hsp40 cochaperones implicated in mitochondrial precursor protein targeting, suggesting that it may use this mechanism to ensure its own mitochondrial localization. Finally, silencing of the rhodanese gene caused not only a proportional decrease of 5 S rRNA import but also a general inhibition of mitochondrial translation, indicating the functional importance of the imported 5 S rRNA inside the organelle. PMID:20663881

  18. Population genetic structure of Cheyletus malaccensis (Acari: Cheyletidae) in China based on mitochondrial COI and 12S rRNA genes.

    PubMed

    Yang, Xiaoqiang; Ye, Qingtian; Xin, Tianrong; Zou, Zhiwen; Xia, Bin

    2016-06-01

    Cheyletus malaccensis is a predatory mite widely distributed in grain storages. It has been regarded as an important biological control agent for pest mites. In this study, we investigated the population genetic structure of C. malaccensis distributed in China based on the partial regions of mitochondrial COI and 12S rRNA genes. We collected 256 individuals of C. malaccensis from stored grain in 34 sites of China. We detected 50 COI gene haplotypes and nine 12S rRNA gene haplotypes. There were three clades in the haplotype network and Bayesian and maximum parsimony phylogenetic trees based on COI sequences, and two based on 12S rRNA sequences. The clustering of haplotypes was not correlated with their geographical distributions. The analysis of molecular variance, AMOVA, indicated that the genetic differentiation between populations was relatively weak. The major genetic differentiation was found within populations. We suggest that the genetic structure of C. malaccensis observed in this study may be the result of long-term climate fluctuations and recent human disturbances. PMID:26947027

  19. Exploration of RNA structure spaces

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1991-01-01

    In order to understand the structure of real structure spaces, we are studying the 5S rRNA structure space experimentally. A plasmid containing a synthetic 5S rRNA gene, two rRNA promoters, and transcription terminators has been assembled. Assays are conducted to determine if the foreign 5S rRNA is expressed, and to see whether or not it is incorporated into ribosomes. Evolutionary competition is used to determine the relative fitness of strains containing the foreign 5S rRNA and a control 5S rRNA. By using site directed mutagenesis, a number of mutants can be made in order to study the boundaries of the structure space and how sharply defined they are. By making similar studies in the vicinity of structure space, it will be possible to determine how homogeneous the 5S rRNA structure space is. Useable experimental protocols have been developed, and a number of mutants have already been studied. Initial results suggest an explanation of why single stranded regions of the RNA are less subject to mutation than double stranded regions.

  20. Turkey fecal microbial community structure and functional gene diversity revealed by 16S rRNA gene and metagenomic sequences.

    PubMed

    Lu, Jingrang; Domingo, Jorge Santo

    2008-10-01

    The primary goal of this study was to better understand the microbial composition and functional genetic diversity associated with turkey fecal communities. To achieve this, 16S rRNA gene and metagenomic clone libraries were sequenced from turkey fecal samples. The analysis of 382 16S rRNA gene sequences showed that the most abundant bacteria were closely related to Lactobacillales (47%), Bacillales (31%), and Clostridiales (11%). Actinomycetales, Enterobacteriales, and Bacteroidales sequences were also identified, but represented a smaller part of the community. The analysis of 379 metagenomic sequences showed that most clones were similar to bacterial protein sequences (58%). Bacteriophage (10%) and avian viruses (3%) sequences were also represented. Of all metagenomic clones potentially encoding for bacterial proteins, most were similar to low G+C Gram-positive bacterial proteins, particularly from Lactobacillales (50%), Bacillales (11%), and Clostridiales (8%). Bioinformatic analyses suggested the presence of genes encoding for membrane proteins, lipoproteins, hydrolases, and functional genes associated with the metabolism of nitrogen and sulfur containing compounds. The results from this study further confirmed the predominance of Firmicutes in the avian gut and highlight the value of coupling 16S rRNA gene and metagenomic sequencing data analysis to study the microbial composition of avian fecal microbial communities. PMID:18974945

  1. Structural and functional exchangeability of 5 S RNA species from the eubacterium E.coli and the thermoacidophilic archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Teixidò, J; Altamura, S; Londei, P; Amils, R

    1989-01-01

    The role of 5 S RNA within the large ribosomal subunit of the extremely thermophilic archaebacterium Sulfolobus solfataricus has been analysed by means of in vitro reconstitution procedures. It is shown that Sulfolobus 50 S subunits reconstituted in the absence of 5 S RNA are inactive in protein synthesis and lack 2-3 ribosomal proteins. Furthermore, it has been determined that in the course of the in vitro assembly process Sulfolobus 5 S RNA can be replaced by the correspondent RNA species of E.coli; Sulfolobus reconstituted particles containing the eubacterial 5 S molecule are stable and active in polypeptide synthesis at high temperatures. Images PMID:2493632

  2. WN4 longitudinal structure in the O (5S - 3P) and O+ (2P - 2D) ionospheric emissions as simulated by the C-IAM

    NASA Astrophysics Data System (ADS)

    Martynenko, Oleg; Ward, William E.; Shepherd, Gordon; Cho, Young-Min; Namgaladze, Alexander; Fomichev, Victor; McConnell, John; Semeniuk, Kirill; Beagley, Stephen

    A newly developed Canadian Ionosphere and Atmosphere Model (C-IAM) is introduced. It is being developed on the basis of two existing first principle models: the extended Canadian Middle Atmosphere Model (CMAM) and the ionospheric part of the Upper Atmosphere Model (UAM). The model extends from the surface to the inner magnetosphere and hence, is able to describe in a self-consistent way how lower atmosphere dynamical variability propagates into and affects the upper atmosphere and ionosphere. The C-IAM was applied to model the spatial structure of two different ionospheric emissions: the nighttime 135.6 nm O ( (5) S - (3) P) and daytime 732 nm O (+) ( (2) P - (2) D) emissions. The IMAGE satellite observations showed a wave number 4 (WN4) longitudinal structure in the 135.6 nm ionospheric emission emanating from the equatorial ionization anomaly at 350-400 km near 20:00 local time at each longitude. C-IAM simulations are in a good agreement with the observations. Model result analysis reveals that the main mechanism for generating the WN4 structure in the 135.6 nm emission is a modification of the ionospheric dynamo field caused by longitudinal variation of the zonal wind due to waves penetrating from the lower atmosphere. It was also shown, that during geomagnetic storms and substorms the high-latitudinal electric field fully suppresses the dynamo, so that the emission intensity dramatically decreases and the WN4 structure does not appear. The 732 nm emission simulated with the C-IAM also reveals the WN4 structure. Similar to the 135.6 nm emission, this structure is caused by waves penetrating from the lower atmosphere. However, the mechanism of excitation is quite different. The 732 nm emission is produced by the instant local ionization and excitation, and, hence, its variation is caused by the neutral density variability in the F2 region (above 200 km) without any involvement of the electric field effects. Correspondingly, latitudinal distribution of this

  3. Domain organization and crystal structure of the catalytic domain of E.coli RluF, a pseudouridine synthase that acts on 23S rRNA

    SciTech Connect

    Sunita,S.; Zhenxing, H.; Swaathi, J.; Cygler, M.; Matte, A.; Sivaraman, J.

    2006-01-01

    Pseudouridine synthases catalyze the isomerization of uridine to pseudouridine ({psi}) in rRNA and tRNA. The pseudouridine synthase RluF from Escherichia coli (E.C. 4.2.1.70) modifies U2604 in 23S rRNA, and belongs to a large family of pseudouridine synthases present in all kingdoms of life. Here we report the domain architecture and crystal structure of the catalytic domain of E. coli RluF at 2.6 Angstroms resolution. Limited proteolysis, mass spectrometry and N-terminal sequencing indicate that RluF has a distinct domain architecture, with the catalytic domain flanked at the N and C termini by additional domains connected to it by flexible linkers. The structure of the catalytic domain of RluF is similar to those of RsuA and TruB. RluF is a member of the RsuA sequence family of {psi}-synthases, along with RluB and RluE. Structural comparison of RluF with its closest structural homologues, RsuA and TruB, suggests possible functional roles for the N-terminal and C-terminal domains of RluF.

  4. A conserved secondary structural motif in 23S rRNA defines the site of interaction of amicetin, a universal inhibitor of peptide bond formation.

    PubMed Central

    Leviev, I G; Rodriguez-Fonseca, C; Phan, H; Garrett, R A; Heilek, G; Noller, H F; Mankin, A S

    1994-01-01

    The binding site and probable site of action have been determined for the universal antibiotic amicetin which inhibits peptide bond formation. Evidence from in vivo mutants, site-directed mutations and chemical footprinting all implicate a highly conserved motif in the secondary structure of the 23S-like rRNA close to the central circle of domain V. We infer that this motif lies at, or close to, the catalytic site in the peptidyl transfer centre. The binding site of amicetin is the first of a group of functionally related hexose-cytosine inhibitors to be localized on the ribosome. Images PMID:8157007

  5. Differentiation of bacterial 16S rRNA genes and intergenic regions and Mycobacterium tuberculosis katG genes by structure-specific endonuclease cleavage.

    PubMed Central

    Brow, M A; Oldenburg, M C; Lyamichev, V; Heisler, L M; Lyamicheva, N; Hall, J G; Eagan, N J; Olive, D M; Smith, L M; Fors, L; Dahlberg, J E

    1996-01-01

    We describe here a new approach for analyzing nucleic acid sequences using a structure-specific endonuclease, Cleavase I. We have applied this technique to the detection and localization of mutations associated with isoniazid resistance in Mycobacterium tuberculosis and for differentiating bacterial genera, species and strains. The technique described here is based on the observation that single strands of DNAs can assume defined conformations, which can be detected and cleaved by structure-specific endonucleases such as Cleavase I. The patterns of fragments produced are characteristic of the sequences responsible for the structure, so that each DNA has its own structural fingerprint. Amplicons, containing either a single 5'-fluorescein or 5'-tetramethyl rhodamine label were generated from a 620-bp segment of the katG gene of isoniazid-resistant and -sensitive M. tuberculosis, the 5' 350 bp of the 16S rRNA genes of Escherichia coli O157:H7, Salmonella typhimurium, Salmonella enteritidis, Salmonella arizonae, Shigella sonnei, Shigella dysenteriae, Campylobacter jejuni, staphylococcus, hominis, Staphylococcus warneri, and Staphylococcus aureus and an approximately 550-bp DNA segment comprising the intergenic region between the 16S and 23S rRNA genes of Salmonella typhimurium, Salmonella enteritidis, Salmonella arizonae, Shigella sonnei, and Shigella dysenteriae serotypes 1, 2, and 8. Changes in the structural fingerprints of DNA fragments derived from the katG genes of isoniazid-resistant M. tuberculosis isolates were clearly identified and could be mapped to the site of the actual mutation relative to the labeled end. Bland patterns which clearly differentiated bacteria to the level of genus and, in some cases, species were generated from the 16S genes. Cleavase I analysis of the intergenic regions of Salmonella and Shigella species differentiated genus, species, and serotypes. Structural fingerprinting by digestion with Cleavase I is a rapid, simple, and sensitive

  6. 4.5S ribonucleic acid, a novel ribosome component in the chloroplasts of flowering plants.

    PubMed Central

    Bowman, C M; Dyer, T A

    1979-01-01

    A species of low-molecular-weight ribosomal RNA, referred to as '4.5S rRNA', was found in addition to 5S rRNA in the large subunit of chloroplast ribosomes of a wide range of flowering plants. It was shown by sequence analysis that several variants of this RNA may occur in a plant. Furthermore, although in most flowering plants the predominant variant contains about 100 nucleotides, in the broad bean it has less than 80. It seems, therefore, to be much more diverse in size and sequence than the other ribosomal RNA species. Like 5S rRNA , it does not contain modified nucleotides and it is also unusual in having an unphosphorylated 5'-end. It is apparently neither a homologue of cytosol 5.8S rRNA nor a fragment of 23S rRNA. Images Fig. 1. Fig. 3. Fig. 4. PMID:540035

  7. Crystal Structure of the Thermus thermophilus 16 S rRNA Methyltransferase RsmC in Complex with Cofactor and Substrate Guanosine*S⃞

    PubMed Central

    Demirci, Hasan; Gregory, Steven T.; Dahlberg, Albert E.; Jogl, Gerwald

    2008-01-01

    Post-transcriptional modification is a ubiquitous feature of ribosomal RNA in all kingdoms of life. Modified nucleotides are generally clustered in functionally important regions of the ribosome, but the functional contribution to protein synthesis is not well understood. Here we describe high resolution crystal structures for the N2-guanine methyltransferase RsmC that modifies residue G1207 in 16 S rRNA near the decoding site of the 30 S ribosomal subunit. RsmC is a class I S-adenosyl-l-methionine-dependent methyltransferase composed of two methyltransferase domains. However, only one S-adenosyl-l-methionine molecule and one substrate molecule, guanosine, bind in the ternary complex. The N-terminal domain does not bind any cofactor. Two structures with bound S-adenosyl-l-methionine and S-adenosyl-l-homocysteine confirm that the cofactor binding mode is highly similar to other class I methyltransferases. Secondary structure elements of the N-terminal domain contribute to cofactor-binding interactions and restrict access to the cofactor-binding site. The orientation of guanosine in the active site reveals that G1207 has to disengage from its Watson-Crick base pairing interaction with C1051 in the 16 S rRNA and flip out into the active site prior to its modification. Inspection of the 30 S crystal structure indicates that access to G1207 by RsmC is incompatible with the native subunit structure, consistent with previous suggestions that this enzyme recognizes a subunit assembly intermediate. PMID:18667428

  8. Crystal Structure of Rcl1 an Essential Component of the Eukaryal pre-rRNA Processosome Implicated in 18s rRNA Biogenesis

    SciTech Connect

    T Tanaka; P Smith; S Shuman

    2011-12-31

    Rcl1 is an essential nucleolar protein required for U3 snoRNA-guided pre-rRNA processing at sites flanking the 18S rRNA sequence. A potential catalytic role for Rcl1 during pre-rRNA cleavage has been suggested based on its primary structure similarity to RNA 3'-terminal phosphate cyclase (Rtc) enzymes, which perform nucleotidyl transfer and phosphoryl transfer reactions at RNA ends. Here, we report the 2.6 {angstrom} crystal structure of a biologically active yeast Rcl1, which illuminates its modular 4-domain architecture and overall homology with RNA cyclases while revealing numerous local differences that account for why Rtcs possess metal-dependent adenylyltransferase activity and Rcls do not. A conserved oxyanion-binding site in Rcl1 was highlighted for possible catalytic or RNA-binding functions. However, the benign effects of mutations in and around the anion site on Rcl1 activity in vivo militate against such a role.

  9. Microsporidian Encephalitozoon cuniculi, a unicellular eukaryote with an unusual chromosomal dispersion of ribosomal genes and a LSU rRNA reduced to the universal core.

    PubMed Central

    Peyretaillade, E; Biderre, C; Peyret, P; Duffieux, F; Méténier, G; Gouy, M; Michot, B; Vivarès, C P

    1998-01-01

    Microsporidia are eukaryotic parasites lacking mitochondria, the ribosomes of which present prokaryote-like features. In order to better understand the structural evolution of rRNA molecules in microsporidia, the 5S and rDNA genes were investigated in Encephalitozoon cuniculi . The genes are not in close proximity. Non-tandemly arranged rDNA units are on every one of the 11 chromosomes. Such a dispersion is also shown in two other Encephalitozoon species. Sequencing of the 5S rRNA coding region reveals a 120 nt long RNA which folds according to the eukaryotic consensus structural shape. In contrast, the LSU rRNA molecule is greatly reduced in length (2487 nt). This dramatic shortening is essentially due to truncation of divergent domains, most of them being removed. Most variable stems of the conserved core are also deleted, reducing the LSU rRNA to only those structural features preserved in all living cells. This suggests that the E.cuniculi LSU rRNA performs only the basic mechanisms of translation. LSU rRNA phylogenetic analysis with the BASEML program favours a relatively recent origin of the fast evolving microsporidian lineage. Therefore, the prokaryote-like ribosomal features, such as the absence of ITS2, may be derived rather than primitive characters. PMID:9671812

  10. The preparation, crystal structures and properties of the potassium vanadium sulfides K /sub x/ V/sub 5/S/sub 8/ (0. 5less than or equal toXless than or equal to0. 7)

    SciTech Connect

    Bronsema, K.D.; Jansen, R.; Wiegers, G.A.

    1984-05-01

    The crystal structures of the potassium vanadium sulphides K /sub 0.7/ V/sub 5/S/sub 8/ and K /sub 0.5/ V/sub 5/S/sub 8/ (=KV/sub 10/S/sub 16/) have been determined. K /sub 0.7/ V/sub 5/S/sub 8/ has a C-centered monoclinic unit cell of dimensions a=17.499(3) A, b=3.2986(6) A, c=8.489(1) A, ..beta..=103.98(1)/sup 0/, space group C2/m; isomorphous with T1V/sub 5/S/sub 8/; K /sub 0.5/ V/sub 5/S/sub 8/ has essentially the same structure, but due to ordering of the K atoms, the monoclinic b-axis is doubled, thus forming a superstructure. The cell parameters are: a=17.462(4) A, b=6.556(2) A, c=8.4595(9) A, ..beta..=103.86(1)/sup 0/, space group P2. The structures are characterized by a three-dimensional framework of VS/sub 6/ octahedra with channels in which the K atoms are situated. Both compounds exhibit metallic behavior.

  11. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-04-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  12. Elongation factor G-induced structural change in helix 34 of 16S rRNA related to translocation on the ribosome.

    PubMed Central

    Matassova, A B; Rodnina, M V; Wintermeyer, W

    2001-01-01

    During the translocation step of the elongation cycle, two tRNAs together with the mRNA move synchronously and rapidly on the ribosome. The movement is catalyzed by the binding of elongation factor G (EF-G) and driven by GTP hydrolysis. Here we study structural changes of the ribosome related to EF-G binding and translocation by monitoring the accessibility of ribosomal RNA (rRNA) for chemical modification by dimethyl sulfate or cleavage by hydroxyl radicals generated by Fe(II)-EDTA. In the state of the ribosome that is formed upon binding of EF-G but before the movement of the tRNAs takes place, residues 1054,1196, and 1201 in helix 34 in 16S rRNA are strongly protected. The protections depend on EF-G binding, but do not require GTP hydrolysis, and are lost upon translocation. Mutants of EF-G, which are active in ribosome binding and GTP hydrolysis but impaired in translocation, do not bring about the protections. According to cryo-electron microscopy (Stark et al., Cell, 2000, 100:301-309), there is no contact of EF-G with the protected residues of helix 34 in the pretranslocation state, suggesting that the observed protections are due to an induced conformational change. Thus, the present results indicate that EF-G binding to the pretranslocation ribosome induces a structural change of the head of the 30S subunit that is essential for subsequent tRNA-mRNA movement in translocation. PMID:11780642

  13. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA. PMID:21574431

  14. Enhanced photocatalytic activity over Cd0.5Zn0.5S with stacking fault structure combined with Cu2+ modified carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Gong, Beini; Lu, Yonghong; Wu, Pingxiao; Huang, Zhujian; Zhu, Yajie; Dang, Zhi; Zhu, Nengwu; Lu, Guining; Huang, Junyi

    2016-03-01

    For enhanced photocatalytic performance of visible light responsive CdZnS, a series of Cd0.5Zn0.5S solid solutions were fabricated by different methods. It was found that the semiconductor obtained through the precipitation-hydrothermal method (CZS-PH) exhibited the highest photocatalytic hydrogen production rate of 2154 μmol h-1 g-1. The enhanced photocatalytic hydrogen production of CZS-PH was probably due to stacking fault formation as well as narrow bandgap, a large surface area and a small crystallite size. Based on this, carbon nanotubes modified with Cu2+ (CNTs (Cu)) were used as a cocatalyst for CZS-PH. The addition of CNTs (Cu) enhanced notably the absorption of the composites for visible light. The highest photocatalytic hydrogen production rate of the Cd0.5Zn0.5S-CNTs (Cu) composite was 2995 μmol h-1 g-1 with 1.0 wt.% of CNTs (Cu). The improvement of the photocatalytic activity by loading of CNTs (Cu) was not due to alteration of bandgap energy or surface area, and was probably attributed to suppression of the electron-hole recombination by the CNTs, with Cu2+ anchored in the interface optimizing the photogenerated electron transfer pathway between the semiconductor and CNTs. We report here the successful combination of homojunction and heterojunction in CdZnS semiconductor, which resulted in promotion of charge separation and enhanced photocatalytic activity.

  15. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  16. Structural and functional divergence within the Dim1/KsgA family of rRNA methyltransferases

    PubMed Central

    Pulicherla, Nagesh; Pogorzala, Leah A.; Xu, Zhili; O’Farrell, Heather C.; Musayev, Faik N.; Scarsdale, J. Neel; Sia, Elaine A.; Culver, Gloria M.; Rife, Jason P.

    2009-01-01

    The enzymes of the KsgA/Dim1 family are universally distributed throughout all phylogeny; however, structural and functional differences are known to exist. The well-characterized function of these enzymes is to dimethylate two adjacent adenosines of the small ribosomal subunit in the normal course of ribosome maturation and the structures of KsgA from Escherichia coli and Dim1 from Homo sapiens and Plasmodium falciparum have been determined. To this point no examples of archaeal structures have been reported. Here we report the structure of Dim1 from the thermophilic archaeon Methanocaldococcus jannaschii. While it shares obvious similarities with the bacterial and eukaryotic orthologs, notable structural differences exist among the three members, particularly in the C-terminal domain. Previous work showed that eukaryotic and archaeal Dim1 were able to robustly complement for KsgA in E. coli. Here we repeated similar experiments to test for complementarity of archaeal Dim1 and bacterial KsgA in Saccharomyces cerevisiae. However, neither the bacterial nor the archaeal ortholog could complement for the eukaryotic Dim1. This might be related to the secondary, non-methyltransferase function that Dim1 is known to play in eukaryotic ribosomal maturation. To further delineate regions of the eukaryotic Dim1 critical to its function, we created and tested KsgA/Dim1 chimeras. Of the chimeras, only one constructed with the N-terminal domain from eukaryotic Dim1 and the C-terminal domain from archaeal Dim1 was able to complement, suggesting that eukaryotic-specific Dim1 function resides in the N-terminal domain also, where few structural differences are observed between members of the KsgA/Dim1 family. Future work is required to identify those determinants directly responsible for Dim1 function in ribosome biogenesis. Finally, we have conclusively established that none of the methyl groups are critically important to growth in yeast under standard conditions at a variety of

  17. Size Matters: Assessing Optimum Soil Sample Size for Fungal and Bacterial Community Structure Analyses Using High Throughput Sequencing of rRNA Gene Amplicons

    PubMed Central

    Penton, C. Ryan; Gupta, Vadakattu V. S. R.; Yu, Julian; Tiedje, James M.

    2016-01-01

    We examined the effect of different soil sample sizes obtained from an agricultural field, under a single cropping system uniform in soil properties and aboveground crop responses, on bacterial and fungal community structure and microbial diversity indices. DNA extracted from soil sample sizes of 0.25, 1, 5, and 10 g using MoBIO kits and from 10 and 100 g sizes using a bead-beating method (SARDI) were used as templates for high-throughput sequencing of 16S and 28S rRNA gene amplicons for bacteria and fungi, respectively, on the Illumina MiSeq and Roche 454 platforms. Sample size significantly affected overall bacterial and fungal community structure, replicate dispersion and the number of operational taxonomic units (OTUs) retrieved. Richness, evenness and diversity were also significantly affected. The largest diversity estimates were always associated with the 10 g MoBIO extractions with a corresponding reduction in replicate dispersion. For the fungal data, smaller MoBIO extractions identified more unclassified Eukaryota incertae sedis and unclassified glomeromycota while the SARDI method retrieved more abundant OTUs containing unclassified Pleosporales and the fungal genera Alternaria and Cercophora. Overall, these findings indicate that a 10 g soil DNA extraction is most suitable for both soil bacterial and fungal communities for retrieving optimal diversity while still capturing rarer taxa in concert with decreasing replicate variation. PMID:27313569

  18. Size Matters: Assessing Optimum Soil Sample Size for Fungal and Bacterial Community Structure Analyses Using High Throughput Sequencing of rRNA Gene Amplicons

    DOE PAGESBeta

    Penton, C. Ryan; Gupta, Vadakattu V. S. R.; Yu, Julian; Tiedje, James M.

    2016-06-02

    We examined the effect of different soil sample sizes obtained from an agricultural field, under a single cropping system uniform in soil properties and aboveground crop responses, on bacterial and fungal community structure and microbial diversity indices. DNA extracted from soil sample sizes of 0.25, 1, 5, and 10 g using MoBIO kits and from 10 and 100 g sizes using a bead-beating method (SARDI) were used as templates for high-throughput sequencing of 16S and 28S rRNA gene amplicons for bacteria and fungi, respectively, on the Illumina MiSeq and Roche 454 platforms. Sample size significantly affected overall bacterial and fungalmore » community structure, replicate dispersion and the number of operational taxonomic units (OTUs) retrieved. Richness, evenness and diversity were also significantly affected. The largest diversity estimates were always associated with the 10 g MoBIO extractions with a corresponding reduction in replicate dispersion. For the fungal data, smaller MoBIO extractions identified more unclassified Eukaryota incertae sedis and unclassified glomeromycota while the SARDI method retrieved more abundant OTUs containing unclassified Pleosporales and the fungal genera Alternaria and Cercophora. Overall, these findings indicate that a 10 g soil DNA extraction is most suitable for both soil bacterial and fungal communities for retrieving optimal diversity while still capturing rarer taxa in concert with decreasing replicate variation.« less

  19. Nucleotide sequence of 5S ribosomal RNA from Aspergillus nidulans and Neurospora crassa.

    PubMed Central

    Piechulla, B; Hahn, U; McLaughlin, L W; Küntzel, H

    1981-01-01

    The nucleotide sequences of 5S rRNA molecules isolated from the cytosol and the mitochondria of the ascomycetes A. nidulans and N. crassa were determined by partial chemical cleavage of 3'-terminally labelled RNA. The sequence identity of the cytosolic and mitochondrial RNA preparations confirms the absence of mitochondrion-specific 5S rRNA in these fungi. The sequences of the two organisms differ in 35 positions, and each sequence differs from yeast 5S rRNA in 44 positions. Both molecules contain the sequence GCUC in place of GAAC or GAUY found in all other 5S rRNAs, indicating that this region is not universally involved in base-pairing to the invariant GTpsiC sequence of tRNAs. Images PMID:6453331

  20. Shifts of microbial community structure in soils of a photovoltaic plant observed using tag-encoded pyrosequencing of 16S rRNA.

    PubMed

    Wu, Shijin; Li, Yuan; Wang, Penghua; Zhong, Li; Qiu, Lequan; Chen, Jianmeng

    2016-04-01

    The environmental risk of fluoride and chloride pollution is pronounced in soils adjacent to solar photovoltaic sites. The elevated levels of fluoride and chloride in these soils have had significant impacts on the population size and overall biological activity of the soil microbial communities. The microbial community also plays an essential role in remediation of these soils. Questions remain as to how the fluoride and chloride contamination and subsequent remediation at these sites have impacted the population structure of the soil microbial communities. We analyzed the microbial communities in soils collected from close to a solar photovoltaic enterprise by pyrosequencing of the 16S rRNA tag. In addition, we used multivariate statistics to identity the relationships shared between sequence diversity and heterogeneity in the soil environment. The overall microbial communities were surprisingly diverse, harboring a wide variety of taxa and sharing significant correlations with different degrees of fluoride and chloride contamination. The contaminated soils harbored abundant bacteria that were probably resistant to the high acidity, high fluoride and chloride concentration, and high osmotic pressure environment. The dominant genera were Sphingomonas, Subgroup_6_norank, Clostridium sensu stricto, Nitrospira, Rhizomicrobium, and Acidithiobacillus. The results of this study provide new information regarding a previously uncharacterized ecosystem and show the value of high-throughput sequencing in the study of complex ecosystems. PMID:26695154

  1. Correspondence regarding Ballana et al., "Mitochondrial 12S rRNA gene mutations affect RNA secondary structure and lead to variable penetrance in hearing impairment".

    PubMed

    Abreu-Silva, R S; Batissoco, A C; Lezirovitz, K; Romanos, J; Rincon, D; Auricchio, M T B M; Otto, P A; Mingroni-Netto, R C

    2006-05-12

    Ballana et al. [E. Ballana, E. Morales, R. Rabionet, B. Montserrat, M. Ventayol, O. Bravo, P. Gasparini, X. Estivill, Mitochondrial 12S rRNA gene mutations affect RNA secondary structure and lead to variable penetrance in hearing impairment, Biochem. Biophys. Res. Commun. 341 (2006) 950-957] detected a T1291C mutation segregating in a Cuban pedigree with hearing impairment. They interpreted it as probably pathogenic, based on family history, RNA conformation prediction and its absence in a control group of 95 Spanish subjects. We screened a sample of 203 deaf subjects and 300 hearing controls (110 "European-Brazilians" and 190 "African-Brazilians") for the mitochondrial mutations A1555G and T1291C. Five deaf subjects had the T1291C substitution, three isolated cases and two familial cases. In the latter, deafness was paternally inherited or segregated with the A1555G mutation. This doesn't support the hypothesis of T1291C mutation being pathogenic. Two "African-Brazilian" controls also had the T1291C substitution. Six of the seven T1291C-carriers (five deaf and two controls) had mitochondrial DNA of African origin, belonging to macrohaplogroup L1/L2. Therefore, these data point to T1291C substitution as most probably an African non-pathogenic polymorphism. PMID:16574076

  2. The 16S rRNA binding site of Thermus thermophilus ribosomal protein S15: comparison with Escherichia coli S15, minimum site and structure.

    PubMed

    Serganov, A A; Masquida, B; Westhof, E; Cachia, C; Portier, C; Garber, M; Ehresmann, B; Ehresmann, C

    1996-11-01

    Binding of Escherichia coli and Thermus thermophilus ribosomal proteins S15 to a 16S ribosomal RNA fragment from T. thermophilus (nt 559-753) has been investigated in detail by extensive deletion analysis, filter-binding assays, gel mobility shift, structure probing, footprinting with chemical, enzymatic, and hydroxyl radical probes. Both S15 proteins recognize two distinct sites. The first one maps in the bottom of helix 638-655/717-734 (H22) and in the three-way junction between helix 560-570/737-747 (H20), helix 571-600/606-634 (H21), and H22. The second is located in a conserved purine-rich region in the center of H22. The first site provides a higher contribution to the free energy of binding than the second one, and both are required for efficient binding. A short RNA fragment of 56 nt containing these elements binds S15 with high affinity. The structure of the rRNA is constrained by the three-way junction and requires both magnesium and S15 to be stabilized. A 3D model, derived by computer modeling with the use of experimental data, suggests that the bound form adopts a Y-shaped conformation, with a quasi-coaxial stacking of H22 on H20, and H21 forming an acute angle with H22. In this model, S15 binds to the shallow groove of the RNA on the exterior side of the Y-shaped structure, making contact with the two sites, which are separated by one helix turn. PMID:8903343

  3. The influence of different land uses on the structure of archaeal communities in Amazonian anthrosols based on 16S rRNA and amoA genes.

    PubMed

    Taketani, Rodrigo Gouvêa; Tsai, Siu Mui

    2010-05-01

    Soil from the Amazonian region is usually regarded as unsuitable for agriculture because of its low organic matter content and low pH; however, this region also contains extremely rich soil, the Terra Preta Anthrosol. A diverse archaeal community usually inhabits acidic soils, such as those found in the Amazon. Therefore, we hypothesized that this community should be sensitive to changes in the environment. Here, the archaeal community composition of Terra Preta and adjacent soil was examined in four different sites in the Brazilian Amazon under different anthropic activities. The canonical correspondence analysis of terminal restriction fragment length polymorphisms has shown that the archaeal community structure was mostly influenced by soil attributes that differentiate the Terra Preta from the adjacent soil (i.e., pH, sulfur, and organic matter). Archaeal 16S rRNA gene clone libraries indicated that the two most abundant genera in both soils were Candidatus nitrosphaera and Canditatus nitrosocaldus. An ammonia monoxygenase gene (amoA) clone library analysis indicated that, within each site, there was no significant difference between the clone libraries of Terra Preta and adjacent soils. However, these clone libraries indicated there were significant differences between sites. Quantitative PCR has shown that Terra Preta soils subjected to agriculture displayed a higher number of amoA gene copy numbers than in adjacent soils. On the other hand, soils that were not subjected to agriculture did not display significant differences on amoA gene copy numbers between Terra Preta and adjacent soils. Taken together, our findings indicate that the overall archaeal community structure in these Amazonian soils is determined by the soil type and the current land use. PMID:20204349

  4. 5S RRNA GENE DELETIONS CAUSE AN UNEXPECTEDLY HIGH FITNESS LOSS IN ESCHERICHIA COLI. (R825354)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  5. High-resolution Mn K -edge x-ray emission and absorption spectroscopy study of the electronic and local structure of the three different phases in N d0.5S r0.5Mn O3

    NASA Astrophysics Data System (ADS)

    Lafuerza, S.; García, J.; Subías, G.; Blasco, J.; Glatzel, P.

    2016-05-01

    N d0.5S r0.5Mn O3 is particularly representative of mixed-valent manganites since their three characteristic macroscopic phases (charge-ordered insulator, ferromagnetic-metallic, and paramagnetic insulator) appear at different temperatures. We here report a complete x-ray emission and absorption spectroscopy (XES-XAS) study of N d0.5S r0.5Mn O3 as a function of temperature to investigate the electronic and local structure changes of the Mn atom in these three phases. Compared with the differences in the XES-XAS spectra between N d0.5S r0.5Mn O3 and the single-valent reference compounds NdMn O3 (M n3 + ) and Sr/CaMn O3 (M n4 + ), only modest changes have been obtained across the magnetoelectrical transitions. The XES spectra, including both the Mn Kα and Kβ emission lines, have mainly shown a subtle decrease in the local spin density accompanying the passage to the ferromagnetic-metallic phase. For the same phase, the small intensity variations in the pre-edge region of the high-resolution XAS spectra reflect an increase of the p -d mixing. The analysis of these XAS spectra imply a charge segregation between the two different Mn sites far from one electron, being in intermediate valences M n+3.5 ±δ /2(δ <0.2 e -) for all the phases. Our results indicate that the spin, charge, and geometrical structure of the Mn atom hardly change among the three macroscopic phases demonstrating the strong competition between the ferromagnetic conductor and the charge-ordered insulator behaviors in the manganites.

  6. Community Structure and Diversity of Biofilms from a Beer Bottling Plant as Revealed Using 16S rRNA Gene Clone Libraries†

    PubMed Central

    Timke, Markus; Wang-Lieu, Ngoc Quynh; Altendorf, Karlheinz; Lipski, André

    2005-01-01

    The microbial composition of biofilms from a beer bottling plant was analyzed by a cultivation independent analysis of the 16S rRNA genes. Clone libraries were differentiated by amplified 16S rRNA gene restriction analysis and representative clones from each group were sequenced. The diversity of the clone libraries was comparable with the diversity found for environmental samples. No evidences for the presence of strictly anaerobic taxa or important beer spoilers were found, indicating that biofilms developed for more than 6 months at the plant formed no appropriate habitat for those microorganisms. The genus Methylobacterium was one of the dominating groups of the clone libraries. The size of this population was assessed by fluorescence in situ hybridization and fatty acid analysis. In addition, considerable numbers of clones were assigned to uncultivated organisms. PMID:16204578

  7. The Structure of Free L11 and Functional Dynamics of L11 in Free, L11-rRNA(58nt) Binary and L11-rRNA(58nt)-thiostrepton Ternary Complexes

    PubMed Central

    Lee, Donghan; Walsh, Joseph D.; Yu, Ping; Markus, Michelle A.; Choli-Papadopoulou, Theodora; Schwieters, Charles D.; Krueger, Susan; Draper, David E.; Wang, Yun-Xing

    2007-01-01

    Summary The L11 binding site is one of the most important functional sites in the ribosome. The N-terminal domain of L11 has been implicated as a “reversible switch” in facilitating the coordinated movements associated with EF-G–driven GTP hydrolysis. The “reversible switch” mechanism has been hypothesized to require conformational flexibility involving re-orientation and re-positioning of the two L11 domains, and warrants a close examination of the structure and dynamics of L11. Here we report the solution structure of free L11, and relaxation studies of free L11, L11complexed to its 58 nt RNA recognition site, and L11 in a ternary complex with the RNA and thiostrepton antibiotic. The binding site of thiostrepton on L11 was also defined by analysis of structural and dynamics data and chemical shift mapping. The conclusions of this work are as follows: First, the binding of L11 to RNA leads to sizable conformation changes in the regions flanking the linker and in the hinge area that links a β-sheets and a 310-helix-turn-helix element in the N-terminus. Concurrently, the change in the relative orientation may lead to re-positioning of the N-terminus, as implied by a decrease of radius of gyration from 18.5 Å to 16.2 Å. Second, the regions, which undergo large conformation changes, exhibit motions on ms-μs or ns-ps time scales. Third, binding of thiostrepton results in more rigid conformations near the linker (Thr71) and near its putative binding site (Leu12). Lastly, conformational changes in the putative thiostrepton binding site are implicated by the re-emergence of cross-correlation peaks in the spectrum of the ternary complex, which were missing in that of the binary complex. Our combined analysis of both the chemical shift perturbation and dynamics data clearly indicates that thiostrepton binds to a pocket involving residues in the 310-helix in L11. PMID:17292917

  8. UV light-induced DNA lesions cause dissociation of yeast RNA polymerases-I and establishment of a specialized chromatin structure at rRNA genes

    PubMed Central

    Tremblay, Maxime; Charton, Romain; Wittner, Manuel; Levasseur, Geneviève; Griesenbeck, Joachim; Conconi, Antonio

    2014-01-01

    The cytotoxicity of UV light-induced DNA lesions results from their interference with transcription and replication. DNA lesions arrest elongating RNA polymerases, an event that triggers transcription-coupled nucleotide excision repair. Since arrested RNA polymerases reduce the accessibility of repair factors to DNA lesions, they might be displaced. The fate of arrested RNA polymerases-II at DNA lesions has been extensively studied, yielding partially contradictory results. Considerably less is known about RNA polymerases-I that transcribe nucleosomes-depleted rRNA genes at very high rate. To investigate the fate of arrested RNA polymerases-I at DNA lesions, chromatin-immunoprecipitation, electron microscopy, transcription run-on, psoralen-cross-linking and chromatin-endogenous cleavage were employed. We found that RNA polymerases-I density increased at the 5′-end of the gene, likely due to continued transcription initiation followed by elongation and pausing/release at the first DNA lesion. Most RNA polymerases-I dissociated downstream of the first DNA lesion, concomitant with chromatin closing that resulted from deposition of nucleosomes. Although nucleosomes were deposited, the high mobility group-box Hmo1 (component of actively transcribed rRNA genes) remained associated. After repair of DNA lesions, Hmo1 containing chromatin might help to restore transcription elongation and reopening of rRNA genes chromatin. PMID:24097442

  9. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs

    PubMed Central

    Fischer, Martin A.; Güllert, Simon; Neulinger, Sven C.; Streit, Wolfgang R.; Schmitz, Ruth A.

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  10. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs.

    PubMed

    Fischer, Martin A; Güllert, Simon; Neulinger, Sven C; Streit, Wolfgang R; Schmitz, Ruth A

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  11. Mineral Type and Solution Chemistry Affect the Structure and Composition of Actively Growing Bacterial Communities as Revealed by Bromodeoxyuridine Immunocapture and 16S rRNA Pyrosequencing.

    PubMed

    Kelly, L C; Colin, Y; Turpault, M-P; Uroz, S

    2016-08-01

    Understanding how minerals affect bacterial communities and their in situ activities in relation to environmental conditions are central issues in soil microbial ecology, as minerals represent essential reservoirs of inorganic nutrients for the biosphere. To determine the impact of mineral type and solution chemistry on soil bacterial communities, we compared the diversity, composition, and functional abilities of a soil bacterial community incubated in presence/absence of different mineral types (apatite, biotite, obsidian). Microcosms were prepared containing different liquid culture media devoid of particular essential nutrients, the nutrients provided only in the introduced minerals and therefore only available to the microbial community through mineral dissolution by biotic and/or abiotic processes. By combining functional screening of bacterial isolates and community analysis by bromodeoxyuridine DNA immunocapture and 16S rRNA gene pyrosequencing, we demonstrated that bacterial communities were mainly impacted by the solution chemistry at the taxonomic level and by the mineral type at the functional level. Metabolically active bacterial communities varied with solution chemistry and mineral type. Burkholderia were significantly enriched in the obsidian treatment compared to the biotite treatment and were the most effective isolates at solubilizing phosphorous or mobilizing iron, in all the treatments. A detailed analysis revealed that the 16S rRNA gene sequences of the OTUs or isolated strains assigned as Burkholderia in our study showed high homology with effective mineral-weathering bacteria previously recovered from the same experimental site. PMID:27138048

  12. 5S RNA sequence from the Philosamia silkworm: evidence for variable evolutionary rates in insect 5S RNA.

    PubMed Central

    Xian-Rong, G; Nicoghosian, K; Cedergren, R J

    1982-01-01

    The primary structure of 5S RNA isolated from the posterior silkgland of Philosamia cynthia ricini was determined using three in vitro labelling techniques. The derived sequence consists of 119 nucleotides and can be folded into the secondary structure model proposed for eukaryotic 5S RNAs. This 5S RNA differs from the Bombyx mori molecule in 9 positions and from the Drosophila melanogaster sequence in 14 positions. The comparison of evolutionary rates in insect 5S RNA with inferred rates in other eukaryotic phyla leads to the conclusion that 5S RNA evolution is not constant in different eukaryotic branches, a condition which must be taken into account in phylogenetic tree constructions. Images PMID:7145713

  13. Bacterial community structure in the intestinal ecosystem of rainbow trout (Oncorhynchus mykiss) as revealed by pyrosequencing-based analysis of 16S rRNA genes.

    PubMed

    Etyemez, Miray; Balcázar, José Luis

    2015-06-01

    In this study, we determined the diversity and composition of bacterial communities within the intestinal ecosystem of farmed rainbow trout (Oncorhynchus mykiss). Healthy rainbow trout, weighing between 520 and 750 g, were fed a commercial diet. Subsequently, genomic DNA was isolated from the intestinal mucus (n = 16 fish samples) and combined into groups of four fish samples each for pyrosequencing analysis of bacterial 16S rRNA genes. The results revealed that the most abundant operational taxonomic units (OTUs) were affiliated to the genera Acinetobacter, Cetobacterium, Pseudomonas, and Psychrobacter, and to a lesser extent, the genera Aeromonas, Clostridium, Deefgea, Flavobacterium, Neptuniibacter, and Mycoplasma. These findings could be used as a baseline for further studies about the role of bacterial communities in normal and altered host physiological states. PMID:25843896

  14. Radiation-modified structure of Ge{sub 25}Sb{sub 15}S{sub 60} and Ge{sub 35}Sb{sub 5}S{sub 60} glasses

    SciTech Connect

    Kavetskyy, T.

    2008-06-28

    Atomic structures of Ge{sub 25}Sb{sub 15}S{sub 60} and Ge{sub 35}Sb{sub 5}S{sub 60} glasses are investigated in the {gamma}-irradiated and annealed after {gamma}-irradiation states by means of high-energy synchrotron x-ray diffraction technique. The first sharp diffraction peak (FSDP) is detected at around 1.1 A{sup -1} in the structure factors of both alloys studied. The FSDP position is found to be stable for radiation/annealing treatment of the samples, while the FSDP intensity shows some changes between {gamma}-irradiated and annealed states. The peaks in the pair distribution functions observed between 2 and 4 A are related to the Ge-S, Ge-Sb, and Sb-Sb first neighbor correlations and Ge-Ge second neighbor correlations in the edge-shared GeS{sub 4/2} tetrahedra, and S-S and/or Ge-Ge second neighbor correlations in the corner-shared GeS{sub 4/2} tetrahedra. Three mechanisms of the radiation-/annealing-induced changes are discussed in the framework of coordination topological defect formation and bond-free solid angle concepts.

  15. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana.

    PubMed

    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D

    1992-03-15

    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  16. Structural Basis for the Methylation of G1405 in 16S rRNA by Aminoglycoside Resistance Methyltransferase Sgm from an Antibiotic Producer: a Diversity of Active Sites in m7G Methyltransferases

    SciTech Connect

    Husain, N.; Tkaczuk, K; Tulsidas, S; Kaminska, K; Cubrilo, S; Maravic -Vlahovicek, G; Bujnicki, J; Sivaraman, J

    2010-01-01

    Sgm (Sisomicin-gentamicin methyltransferase) from antibiotic-producing bacterium Micromonospora zionensis is an enzyme that confers resistance to aminoglycosides like gentamicin and sisomicin by specifically methylating G1405 in bacterial 16S rRNA. Sgm belongs to the aminoglycoside resistance methyltransferase (Arm) family of enzymes that have been recently found to spread by horizontal gene transfer among disease-causing bacteria. Structural characterization of Arm enzymes is the key to understand their mechanism of action and to develop inhibitors that would block their activity. Here we report the structure of Sgm in complex with cofactors S-adenosylmethionine (AdoMet) and S-adenosylhomocysteine (AdoHcy) at 2.0 and 2.1 {angstrom} resolution, respectively, and results of mutagenesis and rRNA footprinting, and protein-substrate docking. We propose the mechanism of methylation of G1405 by Sgm and compare it with other m{sup 7}G methyltransferases, revealing a surprising diversity of active sites and binding modes for the same basic reaction of RNA modification. This analysis can serve as a stepping stone towards developing drugs that would specifically block the activity of Arm methyltransferases and thereby re-sensitize pathogenic bacteria to aminoglycoside antibiotics.

  17. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    PubMed Central

    2010-01-01

    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  18. Structure and stability of variants of the sarcin-ricin loop of 28S rRNA: NMR studies of the prokaryotic SRL and a functional mutant.

    PubMed Central

    Seggerson, K; Moore, P B

    1998-01-01

    NMR has been used to examine the conformational properties of two variants of the sarcin-ricin loop (SRL) from eukaryotic 28S rRNA, which is essential for elongation factor interactions with the ribosome: (1) its bacterial homologue, which lacks two of the bases that flank the conserved 12-nt sequence in the middle of the SRL, but which is functionally equivalent, and (2) a functionally active variant of the eukaryotic SRL in which the bulged G within the conserved sequence is replaced by an A. The data indicate that, although the bacterial SRL is less stable than the eukaryotic SRL, its conformation is closely similar. Furthermore, even though replacement of the bulged G in the SRL with an A seriously destabilizes the center of the loop, its effect on the overall conformation of the SRL appears to be modest. In the course of this work, it was serendipitously discovered that at neutral pH, the C8 proton of the bulged G, in both PRO-SRL and E73, exchanges about 10 times faster than it does in GMP. PMID:9769095

  19. DNA extraction protocols cause differences in 16S rRNA amplicon sequencing efficiency but not in community profile composition or structure

    DOE PAGESBeta

    None

    2014-12-01

    The recent development of methods applying next-generation sequencing to microbial community characterization has led to the proliferation of these studies in a wide variety of sample types. Yet, variation in the physical properties of environmental samples demands that optimal DNA extraction techniques be explored for each new environment. The microbiota associated with many species of insects offer an extraction challenge as they are frequently surrounded by an armored exoskeleton, inhibiting disruption of the tissues within. In this study, we examine the efficacy of several commonly used protocols for extracting bacterial DNA from ants. While bacterial community composition recovered using Illuminamore » 16S rRNA amplicon sequencing was not detectably biased by any method, the quantity of bacterial DNA varied drastically, reducing the number of samples that could be amplified and sequenced. These results indicate that the concentration necessary for dependable sequencing is around 10,000 copies of target DNA per microliter. Exoskeletal pulverization and tissue digestion increased the reliability of extractions, suggesting that these steps should be included in any study of insect-associated microorganisms that relies on obtaining microbial DNA from intact body segments. Although laboratory and analysis techniques should be standardized across diverse sample types as much as possible, minimal modifications such as these will increase the number of environments in which bacterial communities can be successfully studied.« less

  20. DNA extraction protocols cause differences in 16S rRNA amplicon sequencing efficiency but not in community profile composition or structure

    SciTech Connect

    2014-12-01

    The recent development of methods applying next-generation sequencing to microbial community characterization has led to the proliferation of these studies in a wide variety of sample types. Yet, variation in the physical properties of environmental samples demands that optimal DNA extraction techniques be explored for each new environment. The microbiota associated with many species of insects offer an extraction challenge as they are frequently surrounded by an armored exoskeleton, inhibiting disruption of the tissues within. In this study, we examine the efficacy of several commonly used protocols for extracting bacterial DNA from ants. While bacterial community composition recovered using Illumina 16S rRNA amplicon sequencing was not detectably biased by any method, the quantity of bacterial DNA varied drastically, reducing the number of samples that could be amplified and sequenced. These results indicate that the concentration necessary for dependable sequencing is around 10,000 copies of target DNA per microliter. Exoskeletal pulverization and tissue digestion increased the reliability of extractions, suggesting that these steps should be included in any study of insect-associated microorganisms that relies on obtaining microbial DNA from intact body segments. Although laboratory and analysis techniques should be standardized across diverse sample types as much as possible, minimal modifications such as these will increase the number of environments in which bacterial communities can be successfully studied.

  1. DNA extraction protocols cause differences in 16S rRNA amplicon sequencing efficiency but not in community profile composition or structure

    PubMed Central

    Rubin, Benjamin E R; Sanders, Jon G; Hampton-Marcell, Jarrad; Owens, Sarah M; Gilbert, Jack A; Moreau, Corrie S

    2014-01-01

    The recent development of methods applying next-generation sequencing to microbial community characterization has led to the proliferation of these studies in a wide variety of sample types. Yet, variation in the physical properties of environmental samples demands that optimal DNA extraction techniques be explored for each new environment. The microbiota associated with many species of insects offer an extraction challenge as they are frequently surrounded by an armored exoskeleton, inhibiting disruption of the tissues within. In this study, we examine the efficacy of several commonly used protocols for extracting bacterial DNA from ants. While bacterial community composition recovered using Illumina 16S rRNA amplicon sequencing was not detectably biased by any method, the quantity of bacterial DNA varied drastically, reducing the number of samples that could be amplified and sequenced. These results indicate that the concentration necessary for dependable sequencing is around 10,000 copies of target DNA per microliter. Exoskeletal pulverization and tissue digestion increased the reliability of extractions, suggesting that these steps should be included in any study of insect-associated microorganisms that relies on obtaining microbial DNA from intact body segments. Although laboratory and analysis techniques should be standardized across diverse sample types as much as possible, minimal modifications such as these will increase the number of environments in which bacterial communities can be successfully studied. PMID:25257543

  2. Structural and functional studies of Bud23–Trm112 reveal 18S rRNA N7-G1575 methylation occurs on late 40S precursor ribosomes

    PubMed Central

    Létoquart, Juliette; Huvelle, Emmeline; Wacheul, Ludivine; Bourgeois, Gabrielle; Zorbas, Christiane; Graille, Marc; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2014-01-01

    The eukaryotic small ribosomal subunit carries only four ribosomal (r) RNA methylated bases, all close to important functional sites. N7-methylguanosine (m7G) introduced at position 1575 on 18S rRNA by Bud23–Trm112 is at a ridge forming a steric block between P- and E-site tRNAs. Here we report atomic resolution structures of Bud23–Trm112 in the apo and S-adenosyl-l-methionine (SAM)-bound forms. Bud23 and Trm112 interact through formation of a β-zipper involving main-chain atoms, burying an important hydrophobic surface and stabilizing the complex. The structures revealed that the coactivator Trm112 undergoes an induced fit to accommodate its methyltransferase (MTase) partner. We report important structural similarity between the active sites of Bud23 and Coffea canephora xanthosine MTase, leading us to propose and validate experimentally a model for G1575 coordination. We identify Bud23 residues important for Bud23–Trm112 complex formation and recruitment to pre-ribosomes. We report that though Bud23–Trm112 binds precursor ribosomes at an early nucleolar stage, m7G methylation occurs at a late step of small subunit biogenesis, implying specifically delayed catalytic activation. Finally, we show that Bud23–Trm112 interacts directly with the box C/D snoRNA U3-associated DEAH RNA helicase Dhr1 supposedly involved in central pseudoknot formation; this suggests that Bud23–Trm112 might also contribute to controlling formation of this irreversible and dramatic structural reorganization essential to overall folding of small subunit rRNA. Our study contributes important new elements to our understanding of key molecular aspects of human ribosomopathy syndromes associated with WBSCR22 (human Bud23) malfunction. PMID:25489090

  3. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  4. Nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi and their phylogenetic positions

    PubMed Central

    Komiya, Hiroyuki; Hasegawa, Masami; Takemura, Shosuke

    1983-01-01

    The nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi were determined by chemical and enzymatic gel methods. Their phylogenetic positions among metazoans were derived from the 5S rRNA sequences by a computer analysis based on the maximum parsimony principle. It was suggested that the sponge is closely related to several invertebrates and the tunicate has affinity to vertebrates rather than invertebrates. PMID:6835845

  5. Application of Locked Nucleic Acid (LNA) Oligonucleotide–PCR Clamping Technique to Selectively PCR Amplify the SSU rRNA Genes of Bacteria in Investigating the Plant-Associated Community Structures

    PubMed Central

    Ikenaga, Makoto; Sakai, Masao

    2014-01-01

    The simultaneous extraction of plant organelle (mitochondria and plastid) genes during the DNA extraction step is a major limitation in investigating the community structures of bacteria associated with plants because organelle SSU rRNA genes are easily amplified by PCR using primer sets that are specific to bacteria. To inhibit the amplification of organelle genes, the locked nucleic acid (LNA) oligonucleotide–PCR clamping technique was applied to selectively amplify bacterial SSU rRNA genes by PCR. LNA oligonucleotides, the sequences of which were complementary to mitochondria and plastid genes, were designed by overlapping a few bases with the annealing position of the bacterial primer and converting DNA bases into LNA bases specific to mitochondria and plastids at the shifted region from the 3′ end of the primer-binding position. PCR with LNA oligonucleotides selectively amplified the bacterial genes while inhibited that of organelle genes. Denaturing gradient gel electrophoresis (DGGE) analysis revealed that conventional amplification without LNA oligonucleotides predominantly generated DGGE bands from mitochondria and plastid genes with few bacterial bands. In contrast, additional bacterial bands were detected in DGGE patterns, the amplicons of which were prepared using LNA oligonucleotides. These results indicated that the detection of bacterial genes had been screened by the excessive amplification of the organelle genes. Sequencing of the bands newly detected by using LNA oligonucleotides revealed that their similarity to the known isolated bacteria was low, suggesting the potential to detect novel bacteria. Thus, application of the LNA oligonucleotide–PCR clamping technique was considered effective for the selective amplification of bacterial genes from extracted DNA containing plant organelle genes. PMID:25030190

  6. Internal Transcribed Spacer 2 (nu ITS2 rRNA) Sequence-Structure Phylogenetics: Towards an Automated Reconstruction of the Green Algal Tree of Life

    PubMed Central

    Buchheim, Mark A.; Keller, Alexander; Koetschan, Christian; Förster, Frank; Merget, Benjamin; Wolf, Matthias

    2011-01-01

    Background Chloroplast-encoded genes (matK and rbcL) have been formally proposed for use in DNA barcoding efforts targeting embryophytes. Extending such a protocol to chlorophytan green algae, though, is fraught with problems including non homology (matK) and heterogeneity that prevents the creation of a universal PCR toolkit (rbcL). Some have advocated the use of the nuclear-encoded, internal transcribed spacer two (ITS2) as an alternative to the traditional chloroplast markers. However, the ITS2 is broadly perceived to be insufficiently conserved or to be confounded by introgression or biparental inheritance patterns, precluding its broad use in phylogenetic reconstruction or as a DNA barcode. A growing body of evidence has shown that simultaneous analysis of nucleotide data with secondary structure information can overcome at least some of the limitations of ITS2. The goal of this investigation was to assess the feasibility of an automated, sequence-structure approach for analysis of IT2 data from a large sampling of phylum Chlorophyta. Methodology/Principal Findings Sequences and secondary structures from 591 chlorophycean, 741 trebouxiophycean and 938 ulvophycean algae, all obtained from the ITS2 Database, were aligned using a sequence structure-specific scoring matrix. Phylogenetic relationships were reconstructed by Profile Neighbor-Joining coupled with a sequence structure-specific, general time reversible substitution model. Results from analyses of the ITS2 data were robust at multiple nodes and showed considerable congruence with results from published phylogenetic analyses. Conclusions/Significance Our observations on the power of automated, sequence-structure analyses of ITS2 to reconstruct phylum-level phylogenies of the green algae validate this approach to assessing diversity for large sets of chlorophytan taxa. Moreover, our results indicate that objections to the use of ITS2 for DNA barcoding should be weighed against the utility of an automated

  7. The structure of Aquifex aeolicus ribosomal protein S8 reveals a unique subdomain that contributes to an extremely tight association with 16S rRNA.

    PubMed

    Menichelli, Elena; Edgcomb, Stephen P; Recht, Michael I; Williamson, James R

    2012-01-20

    The assembly of ribonucleoprotein complexes occurs under a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from Aquifex aeolicus (AS8) is unique in that there is a 41-residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually high affinity for the 16S ribosomal RNA, characterized by a picomolar dissociation constant that is approximately 26,000-fold tighter than the equivalent interaction from Escherichia coli. Deletion analysis demonstrated that binding to the minimal site on helix 21 occurred at the same nanomolar affinity found for other bacterial species. The additional affinity required the presence of a three-helix junction between helices 20, 21, and 22. The crystal structure of AS8 was solved, revealing the helix-loop-helix geometry of the unique AS8 insertion region, while the core of the molecule is conserved with known S8 structures. The AS8 structure was modeled onto the structure of the 30S ribosomal subunit from E. coli, suggesting the possibility that the unique subdomain provides additional backbone and side-chain contacts between the protein and an unpaired base within the three-way junction of helices 20, 21, and 22. Point mutations in the protein insertion subdomain resulted in a significantly reduced RNA binding affinity with respect to wild-type AS8. These results indicate that the AS8-specific subdomain provides additional interactions with the three-way junction that contribute to the extremely tight binding to ribosomal RNA. PMID:22079365

  8. Secondary structure analyses of the nuclear rRNA internal transcribed spacers and assessment of its phylogenetic utility across the Brassicaceae (mustards).

    PubMed

    Edger, Patrick P; Tang, Michelle; Bird, Kevin A; Mayfield, Dustin R; Conant, Gavin; Mummenhoff, Klaus; Koch, Marcus A; Pires, J Chris

    2014-01-01

    The internal transcribed spacers of the nuclear ribosomal RNA gene cluster, termed ITS1 and ITS2, are the most frequently used nuclear markers for phylogenetic analyses across many eukaryotic groups including most plant families. The reasons for the popularity of these markers include: 1.) Ease of amplification due to high copy number of the gene clusters, 2.) Available cost-effective methods and highly conserved primers, 3.) Rapidly evolving markers (i.e. variable between closely related species), and 4.) The assumption (and/or treatment) that these sequences are non-functional, neutrally evolving phylogenetic markers. Here, our analyses of ITS1 and ITS2 for 50 species suggest that both sequences are instead under selective constraints to preserve proper secondary structure, likely to maintain complete self-splicing functions, and thus are not neutrally-evolving phylogenetic markers. Our results indicate the majority of sequence sites are co-evolving with other positions to form proper secondary structure, which has implications for phylogenetic inference. We also found that the lowest energy state and total number of possible alternate secondary structures are highly significantly different between ITS regions and random sequences with an identical overall length and Guanine-Cytosine (GC) content. Lastly, we review recent evidence highlighting some additional problematic issues with using these regions as the sole markers for phylogenetic studies, and thus strongly recommend additional markers and cost-effective approaches for future studies to estimate phylogenetic relationships. PMID:24984034

  9. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. PMID:11779838

  10. Imprint of Ancient Evolution on rRNA Folding.

    PubMed

    Lanier, Kathryn A; Athavale, Shreyas S; Petrov, Anton S; Wartell, Roger; Williams, Loren Dean

    2016-08-23

    In a model describing the origin and evolution of the translation system, ribosomal RNA (rRNA) grew in size by accretion [Petrov, A. S., et al. (2015) History of the Ribosome and the Origin of Translation. Proc. Natl. Acad. Sci. U.S.A. 112, 15396-15401]. Large rRNAs were built up by iterative incorporation and encasement of small folded RNAs, in analogy with addition of new LEGOs onto the surface of a preexisting LEGO assembly. In this model, rRNA robustness in folding arises from inherited autonomy of local folding. We propose that rRNAs can be decomposed at various granularities, retaining folding mechanism and folding competence. To test these predictions, we disassembled Domain III of the large ribosomal subunit (LSU). We determined whether local rRNA structure, stability, and folding pathways are autonomous. Thermal melting, chemical footprinting, and circular dichroism were used to infer rules that govern folding of rRNA. We deconstructed Domain III of the LSU rRNA by mapping out its complex multistep melting pathway. We studied Domain III and two equal-size "sub-Domains" of Domain III. The combined results are consistent with a model in which melting transitions of Domain III are conserved upon cleavage into sub-Domains. Each of the eight melting transitions of Domain III corresponds in Tm and ΔH with a transition observed in one of the two isolated sub-Domains. The results support a model in which structure, stability, and folding mechanisms are dominated by local interactions and are unaffected by separation of the sub-Domains. Domain III rRNA is distinct from RNAs that form long-range cooperative interaction networks at early stages of folding or that do not fold reversibly. PMID:27428664

  11. Formation of Tertiary Interactions during rRNA GTPase Center Folding.

    PubMed

    Rau, Michael J; Welty, Robb; Tom Stump, W; Hall, Kathleen B

    2015-08-28

    The 60-nt GTPase center (GAC) of 23S rRNA has a phylogenetically conserved secondary structure with two hairpin loops and a 3-way junction. It folds into an intricate tertiary structure upon addition of Mg(2+) ions, which is stabilized by the L11 protein in cocrystal structures. Here, we monitor the kinetics of its tertiary folding and Mg(2+)-dependent intermediate states by observing selected nucleobases that contribute specific interactions to the GAC tertiary structure in the cocrystals. The fluorescent nucleobase 2-aminopurine replaced three individual adenines, two of which make long-range stacking interactions and one that also forms hydrogen bonds. Each site reveals a unique response to Mg(2+) addition and temperature, reflecting its environmental change from secondary to tertiary structure. Stopped-flow fluorescence experiments revealed that kinetics of tertiary structure formation upon addition of MgCl2 are also site specific, with local conformational changes occurring from 5 ms to 4s and with global folding from 1 to 5s. Site-specific substitution with (15)N-nucleobases allowed observation of stable hydrogen bond formation by NMR experiments. Equilibrium titration experiments indicate that a stable folding intermediate is present at stoichiometric concentrations of Mg(2+) and suggest that there are two initial sites of Mg(2+) ion association. PMID:26210661

  12. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. PMID:23933480

  13. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  14. Molecular phylogenetic studies on filarial parasites based on 5S ribosomal spacer sequences.

    PubMed

    Xie, H; Bain, O; Williams, S A

    1994-06-01

    This paper is the first large-scale molecular phylogenetic study on filarial parasites (family Onchocercidae) which includes 16 species of 6 genera: Brugia beaveri Ash et Little, 1962, B. buckleyi Dissanaike et Paramananthan, 1961; B. malayi (Brug, 1927) Buckley, 1960; B. pahangi (Buckley et Edeson, 1956) Buckley, 1960; B. patei (Buckley, Nelson et Heisch, 1958) Buckley, 1960; B. timori Partono et al, 1977; Wuchereria bancrofti (Cobbold, 1877) Seurat, 1921: W. kalimantani Palmieri. Purnomo, Dennis and Marwoto, 1980: Mansonella perstans (Manson, 1891) Eberhard et Orihel, 1984; loa loc, Stiles, 1905; Onchocerca volvulus (Leuckart, 1983) Railliet er Henry, 1910; O. ochengi Bwangamoi, 1969; O. gutturosa Neumann, 1910; Dirofilaria immitis (Leidy, 1856) Railliet e Henry, 1911; Acanthocheilonema viteae (Krepkogorskaya, 1933) Bain, Baker et Chabaud, 1982 and Litomosoides sigmodontis Chandler, 1931. 5S rRNA gene spacer region sequence data were collected by PCR, cloning and dideoxy sequencing. The 5S rRNA gene spacer region sequences were aligned and analyzed by maximum parsimony algorithms, distance methods and maximum likelihood methods to construct phylogenetic trees. Bootstrap analysis was used to test the robustness of the different phylogenetic reconstructions. The data indicated that 5S spacer region sequences are highly conserved within species yet differ significantly between species. Spliced leader sequences were observed in all of the 5S rDNA spacers with no sequence variation, although flanking region sequence and length heterogeneity was observed even within species. All of the various tree-building methods gave very similar results. This study identified four clades which are strongly supported by bootstrap analysis the Brugia clade; the Wuchereria clade; the Brugia-Wuchereria clade and the Onchocerca clade. The analyses indicated that L. sigmodontis and A. viteae may be the most primitive among the 16 species studied. The data did not show any close

  15. Analysis of the 5S RNA Pool in Arabidopsis thaliana: RNAs Are Heterogeneous and Only Two of the Genomic 5S Loci Produce Mature 5S RNA

    PubMed Central

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5′- and 3′-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. [EMBL accession nos: AF330825-AF331032; AF335777-AF335873.] PMID:11779838

  16. Crystal structure of (+)-N-[(1R,5S,6S,9S)-5-hydroxy-methyl-3,3,9-trimethyl-8-oxo-2,4,7-trioxabi-cyclo-[4.3.0]nonan-9-yl]acetamide.

    PubMed

    Oishi, Takeshi; Tsuzaki, Shun; Sugai, Tomoya; Sato, Takaaki; Chida, Noritaka

    2016-05-01

    In the title compound, C12H19NO6, the six-membered 1,3-dioxane ring adopts a chair-like conformation. The seat of this chair, containing two O atoms, is essentially planar, with a maximum deviation of 0.0021 (12) Å. The five-membered oxolane ring cis-fused to the 1,3-dioxane ring adopts an envelope form. The bridgehead C atom at the flap, which is bonded to the tetra-substituted C atom of the oxolane ring, deviates from the mean plane of other ring atoms by 0.539 (4) Å. In the crystal, classical O-H⋯O and N-H⋯O hydrogen bonds link the mol-ecules into a sheet structure enclosing an R 4 (4)(24) graph-set motif. Weak inter-molecular C-H⋯O inter-actions support the sheet formation. PMID:27308035

  17. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  18. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  19. The structure of Rpf2-Rrs1 explains its role in ribosome biogenesis.

    PubMed

    Kharde, Satyavati; Calviño, Fabiola R; Gumiero, Andrea; Wild, Klemens; Sinning, Irmgard

    2015-08-18

    The assembly of eukaryotic ribosomes is a hierarchical process involving about 200 biogenesis factors and a series of remodeling steps. The 5S RNP consisting of the 5S rRNA, RpL5 and RpL11 is recruited at an early stage, but has to rearrange during maturation of the pre-60S ribosomal subunit. Rpf2 and Rrs1 have been implicated in 5S RNP biogenesis, but their precise role was unclear. Here, we present the crystal structure of the Rpf2-Rrs1 complex from Aspergillus nidulans at 1.5 Å resolution and describe it as Brix domain of Rpf2 completed by Rrs1 to form two anticodon-binding domains with functionally important tails. Fitting the X-ray structure into the cryo-EM density of a previously described pre-60S particle correlates with biochemical data. The heterodimer forms specific contacts with the 5S rRNA, RpL5 and the biogenesis factor Rsa4. The flexible protein tails of Rpf2-Rrs1 localize to the central protuberance. Two helices in the Rrs1 C-terminal tail occupy a strategic position to block the rotation of 25S rRNA and the 5S RNP. Our data provide a structural model for 5S RNP recruitment to the pre-60S particle and explain why removal of Rpf2-Rrs1 is necessary for rearrangements to drive 60S maturation. PMID:26117542

  20. Thermus thermophilus 16S rRNA is transcribed from an isolated transcription unit.

    PubMed Central

    Hartmann, R K; Erdmann, V A

    1989-01-01

    A cloned 16S rRNA gene from the extreme thermophilic eubacterium Thermus thermophilus HB8 was used to characterize the in vivo expression of the 16S rRNA genes in this organism by nuclease S1 mapping. The gene represents an isolated transcription unit encoding solely 16S rRNA. Under exponential growth conditions, transcription was initiated at a single promoter, which represents the structural equivalent of Escherichia coli rrn P2 promoters. The promoter-leader region was very similar to the E. coli rrn P2 promoter-leader segment that is responsible for antitermination. The T. thermophilus leader region was approximately 85 nucleotides shorter than its E. coli P2 counterpart. Potential processing intermediates were correlated with a proposed secondary structure of T. thermophilus pre-16S rRNA. Images PMID:2722737

  1. Trans-splicing and RNA editing of LSU rRNA in Diplonema mitochondria

    PubMed Central

    Valach, Matus; Moreira, Sandrine; Kiethega, Georgette N.; Burger, Gertraud

    2014-01-01

    Mitochondrial ribosomal RNAs (rRNAs) often display reduced size and deviant secondary structure, and sometimes are fragmented, as are their corresponding genes. Here we report a mitochondrial large subunit rRNA (mt-LSU rRNA) with unprecedented features. In the protist Diplonema, the rnl gene is split into two pieces (modules 1 and 2, 534- and 352-nt long) that are encoded by distinct mitochondrial chromosomes, yet the rRNA is continuous. To reconstruct the post-transcriptional maturation pathway of this rRNA, we have catalogued transcript intermediates by deep RNA sequencing and RT-PCR. Gene modules are transcribed separately. Subsequently, transcripts are end-processed, the module-1 transcript is polyuridylated and the module-2 transcript is polyadenylated. The two modules are joined via trans-splicing that retains at the junction ∼26 uridines, resulting in an extent of insertion RNA editing not observed before in any system. The A-tail of trans-spliced molecules is shorter than that of mono-module 2, and completely absent from mitoribosome-associated mt-LSU rRNA. We also characterize putative antisense transcripts. Antisense-mono-modules corroborate bi-directional transcription of chromosomes. Antisense-mt-LSU rRNA, if functional, has the potential of guiding concomitantly trans-splicing and editing of this rRNA. Together, these findings open a window on the investigation of complex regulatory networks that orchestrate multiple and biochemically diverse post-transcriptional events. PMID:24259427

  2. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  3. Mouse Oocytes Transcribe Injected Xenopus 5S RNA Gene

    PubMed Central

    Brinster, Ralph L.; Chen, Howard Y.; Trumbauer, Myrna E.

    2016-01-01

    Transcripts produced after injection of the Xenopus 5S RNA gene into oocyte germinal vesicles of mice migrate electrophoretically with the 5S RNA marker, an indication that the gene is transcribed and processed with considerable accuracy, Approximately two 5S RNA molecules are transcribed per gene per hour. This system may be useful in studying DNA processing and gene regulation by the mammalian ovum and might be modified to allow permanent incorporation of specific genes into mice. PMID:7194505

  4. Renibacterium salmoninarum isolates from different sources possess two highly conserved copies of the rRNA operon .

    PubMed

    Grayson, T H; Alexander, S M; Cooper, L F; Gilpin, M L

    2000-07-01

    The nucleotide sequences of the rRNA genes and the 5' flanking region were determined for R. salmoninarum ATCC 33209T from overlapping products generated by PCR amplification from the genomic DNA. Comparison of the sequences with rRNA genes from a variety of bacteria demonstrated the close relatedness between R. salmoninarum and the high G+C group of the actinobacteria, in particular, Arthrobacter species. A regulatory element within the 5' leader of the rRNA operon was identical to an element, CL2, described for mycobacteria. PCR, DNA sequence analysis, and DNA hybridisation were performed to examine variation between isolates from diverse sources which represented the four 16S-23S rRNA intergenic spacer sequevars previously described for R. salmoninarum. Two 23S-5S rRNA intergenic spacer sequevars of identical length were found. DNA hybridisation using probes complementary to 23S rDNA and 16S rDNA identified two rRNA operons which were identical or nearly identical amongst 40 isolates sourced from a variety of countries. PMID:11016696

  5. Variable rRNA gene copies in extreme halobacteria

    SciTech Connect

    Sanz, J.L.; Marin, I.; Ramirez, L.; Amils, R. ); Abad, J.P.; Smith, C.L. )

    1988-08-25

    Using PFG electrophoresis techniques, the authors have examined the organization of rRNA gene in halobacterium species. The results show that the organization of rRNA genes among closely related halobacteria is quite heterogeneous. This contrasts with the high degree of conservation of rRNA sequence. The possible mechanism of such rRNA gene amplification and its evolutionary implications are discussed.

  6. Interplay of RNA Pol IV and ROS1 during post-embryonic 5S rDNA chromatin remodeling.

    PubMed

    Douet, Julien; Blanchard, Bertrand; Cuvillier, Claudine; Tourmente, Sylvette

    2008-12-01

    We have investigated the chromatin structure of 5S rDNA, a heterochromatic pericentromeric tandemly repeated family, at 2, 3, 4 and 5 days post-germination. Our results revealed a large-scale reorganization of 5S rDNA chromatin that occurs during the first days of development. Unexpectedly, there is a decondensation followed by a 're'condensation of 5S rDNA chromatin, to obtain almost mature nuclei 5 d post-germination. The reorganization of 5S rDNA chromatin is accompanied by a rapid and active demethylation of 5S rDNA mediated by the ROS1 (repressor of silencing 1) demethylase, whereas the plant-specific RNA polymerase IV (Pol IV) is essential to the 5S chromatin 're'condensation. In conclusion, Pol IV and ROS1 collaborate to unlock the 5S rDNA chromatin inherited from the seed, and establish adult features. PMID:18845569

  7. Mutations of mitochondrial 12S rRNA in gastric carcinoma and their significance

    PubMed Central

    Han, Cheng-Bo; Ma, Jia-Ming; Xin, Yan; Mao, Xiao-Yun; Zhao, Yu-Jie; Wu, Dong-Ying; Zhang, Su-Min; Zhang, Yu-Kui

    2005-01-01

    AIM: To detect the variations of mitochondrial 12S rRNA in patients with gastric carcinoma, and to study their significance and the relationship between these variations and the genesis of gastric carcinoma. METHODS: PCR amplified mitochondrial 12S rRNA of 44 samples including 22 from gastric carcinoma tissues and 22 from adjacent normal tissues, was detected by direct DNA sequencing. Then laser capture microdissection technique (LCM) was used to separate the cancerous cells and dysplasia cells with specific mutations. Denaturing high performance liquid chromatography (DHPLC) plus allele-specific PCR (AS-PCR), nest-PCR and polyacrylamide gel electrophoresis (PAGE) were used to further evaluate this mutant property and quantitative difference of mutant type between cancerous and dysplasia cells. Finally, RNAdraw biosoft was used to analyze the RNA secondary structure of mutant-type 12S rRNA. RESULTS: Compared with Mitomap database, some new variations were found, among which np652 G insertion and np716 T-G transversion were found only in cancerous tissues. There was a statistic difference in the frequency of 12S rRNA variation between intestinal type (12/17, 70.59%) and diffusive type (5/17, 29.41%) of gastric carcinoma (P<0.05). DHPLC analysis showed that 12S rRNA np652 G insertion and np716 T-G transversion were heteroplasmic mutations. The frequency of 12S rRNA variation in cancerous cells was higher than that in dysplasia cells (P<0.01). 12S rRNA np652 G insertion showed obviously negative effects on the stability of 12S rRNA secondary structure, while others such as T-G transversion did not. CONCLUSION: The mutations of mitochondrial 12S rRNA may be associated with the occurrence of intestinal-type gastric carcinoma. Most variations exist both in gastric carcinomas and in normal tissues, and they might not be the characteristics of tumors. However, np652 G insertion and np716 T-G transversion may possess some molecular significance in gastric carcinogenesis

  8. Karyotypic diversification in Mytilus mussels (Bivalvia: Mytilidae) inferred from chromosomal mapping of rRNA and histone gene clusters

    PubMed Central

    2014-01-01

    Background Mussels of the genus Mytilus present morphologically similar karyotypes that are presumably conserved. The absence of chromosome painting probes in bivalves makes difficult verifying this hypothesis. In this context, we comparatively mapped ribosomal RNA and histone gene families on the chromosomes of Mytilus edulis, M. galloprovincialis, M. trossulus and M. californianus by fluorescent in situ hybridization (FISH). Results Major rRNA, core and linker histone gene clusters mapped to different chromosome pairs in the four taxa. In contrast, minor rRNA gene clusters showed a different behavior. In all Mytilus two of the 5S rDNA clusters mapped to the same chromosome pair and one of them showed overlapping signals with those corresponding to one of the histone H1 gene clusters. The overlapping signals on mitotic chromosomes became a pattern of alternate 5S rRNA and linker histone gene signals on extended chromatin fibers. Additionally, M. trossulus showed minor and major rDNA clusters on the same chromosome pair. Conclusion The results obtained suggest that at least some of the chromosomes bearing these sequences are orthologous and that chromosomal mapping of rRNA and histone gene clusters could be a good tool to help deciphering some of the many unsolved questions in the systematic classification of Mytilidae. PMID:25023072

  9. Molecular dynamics simulations suggest that RNA three-way junctions can act as flexible RNA structural elements in the ribosome

    PubMed Central

    Beššeová, Ivana; Réblová, Kamila; Leontis, Neocles B.; Šponer, Jiří

    2010-01-01

    We present extensive explicit solvent molecular dynamics analysis of three RNA three-way junctions (3WJs) from the large ribosomal subunit: the 3WJ formed by Helices 90–92 (H90–H92) of 23S rRNA; the 3WJ formed by H42–H44 organizing the GTPase associated center (GAC) of 23S rRNA; and the 3WJ of 5S rRNA. H92 near the peptidyl transferase center binds the 3′-CCA end of amino-acylated tRNA. The GAC binds protein factors and stimulates GTP hydrolysis driving protein synthesis. The 5S rRNA binds the central protuberance and A-site finger (ASF) involved in bridges with the 30S subunit. The simulations reveal that all three 3WJs possess significant anisotropic hinge-like flexibility between their stacked stems and dynamics within the compact regions of their adjacent stems. The A-site 3WJ dynamics may facilitate accommodation of tRNA, while the 5S 3WJ flexibility appears to be essential for coordinated movements of ASF and 5S rRNA. The GAC 3WJ may support large-scale dynamics of the L7/L12-stalk region. The simulations reveal that H42–H44 rRNA segments are not fully relaxed and in the X-ray structures they are bent towards the large subunit. The bending may be related to L10 binding and is distributed between the 3WJ and the H42–H97 contact. PMID:20507916

  10. Tax4Fun: predicting functional profiles from metagenomic 16S rRNA data

    PubMed Central

    Aßhauer, Kathrin P.; Wemheuer, Bernd; Daniel, Rolf; Meinicke, Peter

    2015-01-01

    Motivation: The characterization of phylogenetic and functional diversity is a key element in the analysis of microbial communities. Amplicon-based sequencing of marker genes, such as 16S rRNA, is a powerful tool for assessing and comparing the structure of microbial communities at a high phylogenetic resolution. Because 16S rRNA sequencing is more cost-effective than whole metagenome shotgun sequencing, marker gene analysis is frequently used for broad studies that involve a large number of different samples. However, in comparison to shotgun sequencing approaches, insights into the functional capabilities of the community get lost when restricting the analysis to taxonomic assignment of 16S rRNA data. Results: Tax4Fun is a software package that predicts the functional capabilities of microbial communities based on 16S rRNA datasets. We evaluated Tax4Fun on a range of paired metagenome/16S rRNA datasets to assess its performance. Our results indicate that Tax4Fun provides a good approximation to functional profiles obtained from metagenomic shotgun sequencing approaches. Availability and implementation: Tax4Fun is an open-source R package and applicable to output as obtained from the SILVAngs web server or the application of QIIME with a SILVA database extension. Tax4Fun is freely available for download at http://tax4fun.gobics.de/. Contact: kasshau@gwdg.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25957349

  11. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  12. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  13. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    PubMed Central

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1–RpL5-N–RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1–RpL5–RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  14. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  15. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  16. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  17. Simple detection of the 5S ribosomal RNA of Pneumocystis carinii using in situ hybridisation.

    PubMed Central

    Kobayashi, M; Urata, T; Ikezoe, T; Hakoda, E; Uemura, Y; Sonobe, H; Ohtsuki, Y; Manabe, T; Miyagi, S; Miyoshi, I

    1996-01-01

    AIMS: To investigate the effectiveness of digoxigenin incorporated double stranded DNA probes produced by the polymerase chain reaction (PCR), for the detection of Pneumocystis carinii, using in situ hybridisation (ISH). METHODS: Formalin fixed, paraffin wax embedded sections of 26 human lung samples from 11 patients with P carinii pneumonia (PCP), and 15 with various types of fungal and viral pneumonia, were obtained during necropsy or transbronchial lung biopsy. Three additional PCP induced rat lung samples were also tested. PCR probes were prepared using the digoxigenin labelling mixture, and they were amplified from the DNA of a PCP induced rat lung after administration of dexamethasone, on the basis that 5S ribosomal RNA sequences are identical in human and rat P carinii. ISH was performed using this probe, and visualised using the digoxigenin nucleic acid detection kit. An immunohistochemical study using anti-human Pneumocystis monoclonal antibody was also carried out in parallel. RESULTS: ISH positively stained eight (of eight) lung necropsy specimens from patients with PCP, three (of three) transbronchial lung biopsy specimens from patients with PCP, and none of the three PCP induced rat lung specimens. In contrast, none of the specimens from patients with pneumonia caused by Aspergillus sp (n = 5), Candida sp (n = 4), Cryptococcus sp (n = 2), mucormycosis (n = 2), or cytomegalovirus (n = 2) were positive on ISH or immunohistochemistry. CONCLUSIONS: Using a digoxigenin labelled PCR probe for the entire 5S rRNA sequence in conjunction with conventional staining, ISH is highly reactive and specific for the diagnosis of PCP. Images PMID:9038753

  18. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    PubMed Central

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  19. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  20. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  1. Effects of base change mutations within an Escherichia coli ribosomal RNA leader region on rRNA maturation and ribosome formation

    PubMed Central

    Schäferkordt, Jan; Wagner, Rolf

    2001-01-01

    The effects of base change mutations in a highly conserved sequence (boxC) within the leader of bacterial ribosomal RNAs (rRNAs) was studied. The boxC sequence preceding the 16S rRNA structural gene constitutes part of the RNase III processing site, one of the first cleavage sites on the pathway to mature 16S rRNA. Moreover, rRNA leader sequences facilitate correct 16S rRNA folding, thereby assisting ribosomal subunit formation. Mutations in boxC cause cold sensitivity and result in 16S rRNA and 30S subunit deficiency. Strains in which all rRNA operons are replaced by mutant transcription units are viable. Thermodynamic studies by temperature gradient gel electrophoresis reveal that mutant transcripts have a different, less ordered structure. In addition, RNA secondary structure differences between mutant and wild-type transcripts were determined by chemical and enzymatic probing. Differences are found in the leader RNA sequence itself but also in structurally important regions of the mature 16S rRNA. A minor fraction of the rRNA transcripts from mutant operons is not processed by RNase III, resulting in a significantly extended precursor half-life compared to the wild-type. The boxC mutations also give rise to a new aberrant degradation product of 16S rRNA. This intermediate cannot be detected in strains lacking RNase III. Together the results indicate that the boxC sequence, although important for RNase III processing, is likely to serve additional functions by facilitating correct formation of the mature 16S rRNA structure. They also suggest that quality control steps are acting during ribosome biogenesis. PMID:11504877

  2. The structure of Rpf2–Rrs1 explains its role in ribosome biogenesis

    PubMed Central

    Kharde, Satyavati; Calviño, Fabiola R.; Gumiero, Andrea; Wild, Klemens; Sinning, Irmgard

    2015-01-01

    The assembly of eukaryotic ribosomes is a hierarchical process involving about 200 biogenesis factors and a series of remodeling steps. The 5S RNP consisting of the 5S rRNA, RpL5 and RpL11 is recruited at an early stage, but has to rearrange during maturation of the pre-60S ribosomal subunit. Rpf2 and Rrs1 have been implicated in 5S RNP biogenesis, but their precise role was unclear. Here, we present the crystal structure of the Rpf2–Rrs1 complex from Aspergillus nidulans at 1.5 Å resolution and describe it as Brix domain of Rpf2 completed by Rrs1 to form two anticodon-binding domains with functionally important tails. Fitting the X-ray structure into the cryo-EM density of a previously described pre-60S particle correlates with biochemical data. The heterodimer forms specific contacts with the 5S rRNA, RpL5 and the biogenesis factor Rsa4. The flexible protein tails of Rpf2–Rrs1 localize to the central protuberance. Two helices in the Rrs1 C-terminal tail occupy a strategic position to block the rotation of 25S rRNA and the 5S RNP. Our data provide a structural model for 5S RNP recruitment to the pre-60S particle and explain why removal of Rpf2–Rrs1 is necessary for rearrangements to drive 60S maturation. PMID:26117542

  3. Ribosome origins: The relative age of 23S rRNA Domains

    NASA Astrophysics Data System (ADS)

    Hury, James; Nagaswamy, Uma; Larios-Sanz, Maia; Fox, George E.

    2006-08-01

    The modern ribosome and its component RNAs are quite large and it is likely that at an earlier time they were much smaller. Hence, not all regions of the modern ribosomal RNAs (rRNA) are likely to be equally old. In the work described here, it is hypothesized that the oldest regions of the RNAs will usually be highly integrated into the machinery. When this is the case, an examination of the interconnectivity between local RNA regions can provide insight to the relative age of the various regions. Herein, we describe an analysis of all known long-range RNA/RNA interactions within the 23S rRNA and between the 23S rRNA and the 16S rRNA in order to assess the interconnectivity between the usual Domains as defined by secondary structure. Domain V, which contains the peptidyl transferase center is centrally located, extensively connected, and therefore likely to be the oldest region. Domain IV and Domain II are extensively interconnected with both themselves and Domain V. A portion of Domain IV is also extensively connected with the 30S subunit and hence Domain IV may be older than Domain II. These results are consistent with other evidence relating to the relative age of RNA regions. Although the relative time of addition of the GTPase center can not be reliably deduced it is pointed out that the development of this may have dramatically affected the progenotes that preceded the last common ancestor.

  4. Ellipsometry study of optical parameters of AgIn5S8 crystals

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2015-12-01

    AgIn5S8 crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2-6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn5S8 crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  5. [Analysis of 5S rDNA changes in synthetic allopolyploids Triticum x Aegilops].

    PubMed

    Shcherban', A B; Sergeeva, E M; Badaeva, E D; Salina, E A

    2008-01-01

    By the example of three synthetic allopolyploids: Aegilops sharonensis x Ae. umbellulata (2n =28), Triticum urartu x Ae. tauschii (2n =28), T. dicoccoides x Ae. tauschii (2n =42) the 5S rDNA changes at the early stage of allopolyploidization were investigated. Using fluorescent in situ hybridization (FISH), the quantitative changes affecting the separate loci of one of the parental genomes were revealed in plants of S3 generation of each hybrid combination. Souther hybridization with genomic DNA of allopolyploid T. urartu x Ae. tauschii (TMU38 x TQ27) revealed lower intensity of the fragments from Ae. tauschii compared with the T. urartu fragments. It may be confirmation of the reduction of signal on 1D chromosome that was revealed in this hybrid using FISH. Both appearance of a new 5S rDNA fragments and full disappearance of fragments from parental species were not showed by Southern hybridization, as well as PCR-analysis of 5-15 plants of S2-S3 generations. The changes were not found under comparison of primary structure of nine 5S rDNA sequences of allopolyploid TMU38 x TQ27 with analogous sequences from parental species genomes. The observable similarity by FISH results of one of the studied synthetic allopolyploids with natural allopolyploid of similar genome composition indicates the early formation of unique for each allopolyploid 5S rDNA organization. PMID:18856060

  6. Promoter of the Mycoplasma pneumoniae rRNA operon.

    PubMed Central

    Hyman, H C; Gafny, R; Glaser, G; Razin, S

    1988-01-01

    RNA transcripts starting from the 5' end of the single Mycoplasma pneumoniae rRNA operon were analyzed by several methods. By primer extension analysis a start site was found 62 nucleotides upstream from the start site of the 16S rRNA. This site was preceded by a putative Pribnow box; however, a defined -35 recognition region was absent. The cloned rRNA operon was transcribed in vitro by using purified RNA polymerase of Escherichia coli. A single start site could be demonstrated within a few nucleotides of the start site found by primer extension analysis of M. pneumoniae transcripts. When fragments from the cloned operon were used as hybridization probes, S1 nuclease mapping yielded a single transcript extending approximately 193 nucleotides upstream from the 16S rRNA start site. The region surrounding this endpoint did not resemble any known promoter sequence. Dot blot hybridization of M. pneumoniae RNA to three oligonucleotides consisting of nucleotides -5 to -21, -38 to -54, and -112 to -132 (from the start of the 16S rRNA gene) indicated that most rRNA transcripts were processed at the stem site preceding the 16S rRNA gene. The majority of the longer precursor transcripts, extending beyond this point, did not extend further upstream to an oligonucleotide consisting of nucleotides -112 to -132. It was concluded that transcription of the rRNA operon of M. pneumoniae is initiated by a single promoter. The nucleotide sequence of the region is presented. Images PMID:2838465

  7. Case of localized recombination in 23S rRNA genes from divergent bradyrhizobium lineages associated with neotropical legumes.

    PubMed

    Parker, M A

    2001-05-01

    Enzyme electrophoresis and rRNA sequencing were used to analyze relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legumes (Clitoria javitensis, Erythrina costaricensis, Rhynchosia pyramidalis, and Desmodium axillare) growing on Barro Colorado Island (BCI), Panama. Bacteria with identical multilocus allele profiles were commonly found in association with two or more legume genera. Among the 16 multilocus genotypes (electrophoretic types [ETs]) detected, six ETs formed a closely related cluster that included isolates from all four legume taxa. Bacteria from two other BCI legumes (Platypodium and Machaerium) sampled in a previous study were also identical to certain ETs in this group. Isolates from different legume genera that had the same ET had identical nucleotide sequences for both a 5' portion of the 23S rRNA and the nearly full-length 16S rRNA genes. These results suggest that Bradyrhizobium genotypes with low host specificity may be prevalent in this tropical forest. Parsimony analysis of 16S rRNA sequence variation indicated that most isolates were related to Bradyrhizobium japonicum USDA 110, although one ET sampled from C. javitensis had a 16S rRNA gene highly similar to that of Bradyrhizobium elkanii USDA 76. However, this isolate displayed a mosaic structure within the 5' 23S rRNA region: one 84-bp segment was identical to that of BCI isolate Pe1-3 (a close relative of B. japonicum USDA 110, based on 16S rRNA data), while an adjacent 288-bp segment matched that of B. elkanii USDA 76. This mosaic structure is one of the first observations suggesting recombination in nature between Bradyrhizobium isolates related to B. japonicum versus B. elkanii. PMID:11319084

  8. Optical characterization of CuIn5S8 crystals by ellipsometry measurements

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2016-04-01

    Optical properties of CuIn5S8 crystals grown by Bridgman method were investigated by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficients were obtained from the analysis of ellipsometry experiments performed in the 1.2-6.2 eV spectral region. Analysis of spectral dependence of the absorption coefficient revealed the existence of direct band gap transitions with energy 1.53 eV. Wemple-DiDomenico and Spitzer-Fan models were used to find the oscillator energy, dispersion energy, zero-frequency refractive index and high-frequency dielectric constant values. Structural properties of the CuIn5S8 crystals were investigated using X-ray diffraction and energy dispersive spectroscopy analysis.

  9. The phylogeny of intestinal porcine spirochetes (Serpulina species) based on sequence analysis of the 16S rRNA gene.

    PubMed Central

    Pettersson, B; Fellström, C; Andersson, A; Uhlén, M; Gunnarsson, A; Johansson, K E

    1996-01-01

    Four type or reference strains and twenty-two field strains of intestinal spirochetes isolated from Swedish pig herds were subjected to phylogenetic analysis based on 16S rRNA sequences. Almost complete (>95%) 16S rRNA sequences were obtained by solid-phase DNA sequencing of in vitro-amplified rRNA genes. The genotypic patterns were compared with a previously proposed biochemical classification scheme, comprising beta-hemolysis, indole production, hippurate hydrolysis, and alpha-galactosidase, alpha-glucosidase, and beta-glucosidase activities. Comparison of the small-subunit rRNA sequences showed that the strains of the genus Serpulina were closely related. Phylogenetic trees were constructed, and three clusters were observed. This was also confirmed by signature nucleotide analysis of the serpulinas. The indole-producing strains, including the strains of S. hyodysenteriae and some weakly beta-hemolytic Serpulina strains, formed one cluster. A second cluster comprised weakly beta-hemolytic strains that showed beta-galactosidase activity but lacked indole production and hippurate-hydrolyzing capacity. The second cluster contained two subclusters with similar phenotypic profiles. A third cluster involved strains that possessed a hippurate-hydrolyzing capacity which was distinct from that of the former two clusters, because of 17 unique nucleotide positions of the 16S rRNA gene. Interestingly, the strains of this third cluster were found likely to have a 16S rRNA structure in the V2 region of the molecule different from that of the serpulinas belonging to the other clusters. As a consequence of these findings, we propose that the intestinal spirochetes of this phenotype (i.e., P43/6/78-like strains) should be regarded as a separate Serpulina species. Furthermore, this cluster was found to be by far the most homogeneous one. In conclusion, the biochemical classification of porcine intestinal spirochetes was comparable to that by phylogenetic analysis based on 16S rRNA

  10. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  11. A renaissance for the pioneering 16S rRNA gene

    SciTech Connect

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  12. Sequences implicated in the processing of Thermus thermophilus HB8 23S rRNA.

    PubMed Central

    Hartmann, R K; Ulbrich, N; Erdmann, V A

    1987-01-01

    Nuclease S1 mapping analyses were performed in order to detect processing intermediates of pre-23S rRNA from Thermus thermophilus HB8. Two processing sites were identified downstream the start of transcription and several consecutive cleavage sites are associated with the mature 5'-end. In the 3'-flanking region one "primary" site and two cleavages which generate short-living intermediates were detected. A series of successive intermediates in the region of the mature 3'-end implies the existence of--in analogy to Escherichia coli--a 3'-exonucleolytic activity. The data were correlated with potential secondary structures within the pre-23S rRNA, which exhibit various repeated sequence elements. M13 sequencing data support the existence of one secondary structural element associated with the strong "primary" cleavage site in the 3'-flanking region. In T. thermophilus we can exclude the formation of an extended base-paired and precursor-specific stem enclosing the 23S rRNA which is inferred to mediate recognition by RNase III in E. coli. Images PMID:3313273

  13. rRNA Binding Sites and the Molecular Mechanism of Action of the Tetracyclines.

    PubMed

    Chukwudi, Chinwe U

    2016-08-01

    The tetracycline antibiotics are known to be effective in the treatment of both infectious and noninfectious disease conditions. The 16S rRNA binding mechanism currently held for the antibacterial action of the tetracyclines does not explain their activity against viruses, protozoa that lack mitochondria, and noninfectious conditions. Also, the mechanism by which the tetracyclines selectively inhibit microbial protein synthesis against host eukaryotic protein synthesis despite conservation of ribosome structure and functions is still questionable. Many studies have investigated the binding of the tetracyclines to the 16S rRNA using the small ribosomal subunit of different bacterial species, but there seems to be no agreement between various reports on the exact binding site on the 16S rRNA. The wide range of activity of the tetracyclines against a broad spectrum of bacterial pathogens, viruses, protozoa, and helminths, as well as noninfectious conditions, indicates a more generalized effect on RNA. In the light of recent evidence that the tetracyclines bind to various synthetic double-stranded RNAs (dsRNAs) of random base sequences, suggesting that the double-stranded structures may play a more important role in the binding of the tetracyclines to RNA than the specific base pairs, as earlier speculated, it is imperative to consider possible alternative binding modes or sites that could help explain the mechanisms of action of the tetracyclines against various pathogens and disease conditions. PMID:27246781

  14. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  15. Quantitative Northern Blot Analysis of Mammalian rRNA Processing.

    PubMed

    Wang, Minshi; Pestov, Dimitri G

    2016-01-01

    Assembly of eukaryotic ribosomes is an elaborate biosynthetic process that begins in the nucleolus and requires hundreds of cellular factors. Analysis of rRNA processing has been instrumental for studying the mechanisms of ribosome biogenesis and effects of stress conditions on the molecular milieu of the nucleolus. Here, we describe the quantitative analysis of the steady-state levels of rRNA precursors, applicable to studies in mammalian cells and other organisms. We include protocols for gel electrophoresis and northern blotting of rRNA precursors using procedures optimized for the large size of these RNAs. We also describe the ratio analysis of multiple precursors, a technique that facilitates the accurate assessment of changes in the efficiency of individual pre-rRNA processing steps. PMID:27576717

  16. Strengths and Limitations of 16S rRNA Gene Amplicon Sequencing in Revealing Temporal Microbial Community Dynamics

    PubMed Central

    Poretsky, Rachel; Rodriguez-R, Luis M.; Luo, Chengwei; Tsementzi, Despina; Konstantinidis, Konstantinos T.

    2014-01-01

    This study explored the short-term planktonic microbial community structure and resilience in Lake Lanier (GA, USA) while simultaneously evaluating the technical aspects of identifying taxa via 16S rRNA gene amplicon and metagenomic sequence data. 16S rRNA gene amplicons generated from four temporally discrete samples were sequenced with 454 GS-FLX-Ti yielding ∼40,000 rRNA gene sequences from each sample and representing ∼300 observed OTUs. Replicates obtained from the same biological sample clustered together but several biases were observed, linked to either the PCR or sequencing-preparation steps. In comparisons with companion whole-community shotgun metagenome datasets, the estimated number of OTUs at each timepoint was concordant, but 1.5 times and ∼10 times as many phyla and genera, respectively, were identified in the metagenomes. Our analyses showed that the 16S rRNA gene captures broad shifts in community diversity over time, but with limited resolution and lower sensitivity compared to metagenomic data. We also identified OTUs that showed marked shifts in abundance over four close timepoints separated by perturbations and tracked these taxa in the metagenome vs. 16S rRNA amplicon data. A strong summer storm had less of an effect on community composition than did seasonal mixing, which revealed a distinct succession of organisms. This study provides insights into freshwater microbial communities and advances the approaches for assessing community diversity and dynamics in situ. PMID:24714158

  17. Mutational analysis of the L1 binding site of 23S rRNA in Escherichia coli.

    PubMed Central

    Said, B; Cole, J R; Nomura, M

    1988-01-01

    The L11 ribosomal protein operon of Escherichia coli contains the genes for L11 and L1 and is feedback regulated by the translational repressor L1. Both the L1 binding site on 23S rRNA and the L1 repressor target site on L11 operon mRNA share similar proposed secondary structures and contain some primary sequence identity. Several site-directed mutations in the binding region of 23S rRNA were constructed and their effects on binding were examined. For in vitro analysis, a filter binding method was used. For in vivo analysis, a conditional expression system was used to overproduce a 23S rRNA fragment containing the L1 binding region, which leads to specific derepression of the synthesis of L11 and L1. Changes in the shared region of the 23S rRNA L1 binding site produced effects on L1 binding similar to those found previously in analysis of corresponding changes in the L11 operon mRNA target site. The results support the hypothesis that r-protein L1 interacts with both 23S rRNA and L11 operon mRNA by recognizing similar features on both RNAs. Images PMID:3060846

  18. Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

    NASA Technical Reports Server (NTRS)

    Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

    1985-01-01

    The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

  19. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    PubMed Central

    2010-01-01

    Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s) occurring in 39.6% of the analyzed individuals (both male and female) were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH) was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs) enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement. PMID:20051104

  20. Evolution of rRNA gene clusters and telomeric repeats during explosive genome repatterning in TATERILLUS X (Rodentia, Gerbillinae).

    PubMed

    Dobigny, G; Ozouf-Costaz, C; Bonillo, C; Volobouev, V

    2003-01-01

    A survey of 28S and 5S rRNA gene clusters, and telomeric repeats was performed using single and double FISH in the Taterillus genus (Rodentia, Muridae, Gerbillinae). Taterillus was previously demonstrated to have undergone a very recent and extensive chromosomal evolution. Our FISH results demonstrate that rRNA genes can vary in location and number irrespective of the phylogenetic relationships. Telomeric repeats were detected in pericentromeric and interstitial regions of several chromosomes, thus providing nonambiguous evolutionary footprints of Robertsonian and tandem translocation events. These footprints are discussed in reference to the molecular process of these karyotypical changes. Also, examples of colocation of rDNA clusters and telomeric repeats lend support to their possible involvement in nucleolus formation. Finally, the presence of rRNA genes, and the extensive amplification of telomeric repeats at specific loci within a double X-autosome translocated element which were not observed on the homologous Y1 and Y2, served as basis for an epigenomic hypothesis on X-autosome translocation viability in mammals. PMID:15004471

  1. Rare Events of Intragenus and Intraspecies Horizontal Transfer of the 16S rRNA Gene

    PubMed Central

    Tian, Ren-Mao; Cai, Lin; Zhang, Wei-Peng; Cao, Hui-Luo; Qian, Pei-Yuan

    2015-01-01

    Horizontal gene transfer (HGT) of operational genes has been widely reported in prokaryotic organisms. However, informational genes such as those involved in transcription and translation processes are very difficult to be horizontally transferred, as described by Woese’s complexity hypothesis. Here, we analyzed all of the completed prokaryotic genome sequences (2,143 genomes) in the NCBI (National Center for Biotechnology Information) database, scanned for genomes with high intragenomic heterogeneity of 16S rRNA gene copies, and explored potential HGT events of ribosomal RNA genes based on the phylogeny, genomic organization, and secondary structures of the ribosomal RNA genes. Our results revealed 28 genomes with relatively high intragenomic heterogeneity of multiple 16S rRNA gene copies (lowest pairwise identity <98.0%), and further analysis revealed HGT events and potential donors of the heterogeneous copies (such as HGT from Chlamydia suis to Chlamydia trachomatis) and mutation events of some heterogeneous copies (such as Streptococcus suis JS14). Interestingly, HGT of the 16S rRNA gene only occurred at intragenus or intraspecies levels, which is quite different from the HGT of operational genes. Our results improve our understanding regarding the exchange of informational genes. PMID:26220935

  2. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    PubMed

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general. PMID:26119842

  3. Multi-site-specific 16S rRNA Methyltransferase RsmF from Thermus thermophilus

    SciTech Connect

    Demirci, H.; Larsen, L; Hansen, T; Rasmussen, A; Cadambi, A; Gregory, S; Kirpekar, F; Jogl, G

    2010-01-01

    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m{sup 5}C) modifications in 16S rRNA of Thermus thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m{sup 5}C967. In contrast to E. coli RsmF, which introduces a single m{sup 5}C1407 modification, T. thermophilus RsmF modifies three positions, generating m{sup 5}C1400 and m{sup 5}C1404 in addition to m{sup 5}C1407. These three residues are clustered near the decoding site of the ribosome, but are situated in distinct structural contexts, suggesting a requirement for flexibility in the RsmF active site that is absent from the E. coli enzyme. Two of these residues, C1400 and C1404, are sufficiently buried in the mature ribosome structure so as to require extensive unfolding of the rRNA to be accessible to RsmF. In vitro, T. thermophilus RsmF methylates C1400, C1404, and C1407 in a 30S subunit substrate, but only C1400 and C1404 when naked 16S rRNA is the substrate. The multispecificity of T. thermophilus RsmF is potentially explained by three crystal structures of the enzyme in a complex with cofactor S-adenosyl-methionine at up to 1.3 {angstrom} resolution. In addition to confirming the overall structural similarity to E. coli RsmF, these structures also reveal that key segments in the active site are likely to be dynamic in solution, thereby expanding substrate recognition by T. thermophilus RsmF.

  4. Two spatially separated phases in semiconducting Rb0.8Fe1.5S2

    DOE PAGESBeta

    Wang, Meng; Tian, Wei; Valdivia, P.; Chi, Songxue; Bourret-Courchesne, E.; Dai, Pengcheng; Birgeneau, R. J.

    2014-09-26

    We report neutron scattering and transport measurements on semiconducting Rb0.8Fe1.5S2, a compound isostructural and isoelectronic to the well-studied A0.8FeySe2(A = K, Rb, Cs, Tl/K) superconducting systems. Both resistivity and DC susceptibility measurements reveal a magnetic phase transition at T = 275 K. Neutron diffraction studies show that the 275 K transition originates from a phase with rhombic iron vacancy order which exhibits an in-plane stripe antiferromagnetic ordering below 275 K. In addition, the stripe antiferromagnetic phase interdigitates mesoscopically with an ubiquitous phase with √5 x√5 iron vacancy order. This phase has a magnetic transition at TN = 425 K andmore » an iron vacancy order-disorder transition at TS = 600 K. These two different structural phases are closely similar to those observed in the isomorphous Se materials. Based on the close similarities of the in-plane antiferromagnetic structures, moments sizes, and ordering temperatures in semiconducting Rb0.8Fe1.5S2 and K0.81Fe1.58Se2, we argue that the in-plane antiferromagnetic order arises from strong coupling between local moments. Superconductivity, previously observed in the A0.8FeySe2₋ zSz system, is absent in A0.8Fe1.5S2, which has a semiconducting ground state. We discuss the implied relationship between stripe and block antiferromagnetism and superconductivity in these materials as well as a strategy for further investigation.« less

  5. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  6. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq

    2015-01-01

    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  7. SAXS investigation on the temperature dependence of the conformation of Carcinus aestuarii 5S hemocyanin subunit

    NASA Astrophysics Data System (ADS)

    Beltramini, M.; Di Muro, P.; Favilla, R.; La Monaca, A.; Mariani, P.; Sabatucci, A. L.; Salvato, B.; Solari, P. L.

    1999-01-01

    The small-angle X-ray scattering technique has been used to study the spatial distribution of a subunit isolated from Carcinus hemocyanin, in solution at pH 7.5 in the 20°C-40°C temperature range. From the obtained scattering profiles, two species with different gyration radius have been detected by Guinier approximation: one species with Rg1≈25 Å is assigned to the 75 kDa 5S subunit whereas a second species with Rg2≈48 Å, and accounting for ≈3% of the total protein, is attributed to the 450 kDa 16S hexamer. Whereas Rg2 decreases slightly (≈10%) and reversibly on increasing the temperature, Rg2 decreases more markedly (≈30%), but irreversibly. The scattering data have been analysed also on the basis of the impenetrable spheres model and by means of the distance distribution function: the temperature dependence of the geometrical dimensions of the particles is confirmed. In addition, for the 5S subunit also the cross-section gyration radius decreases appreciably (15%) and reversibly with temperature. These results are interpreted on the basis of temperature induced structural rearrangements among the three domains of 5S subunit leading to an increased compactness of the molecule and a more elongated form. In contrast, the effect on the hexamer is assigned to its irreversible dissociation to monomers. This interpretation agrees with the analysis of the distance distribution functions, calculated from the Fourier's transforms of the scattering curves at the different temperatures.

  8. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    NASA Astrophysics Data System (ADS)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-03-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

  9. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure.

    PubMed

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30-70 K in pressure range of 100-170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50-70 K in pressure range of 100-150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  10. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    PubMed Central

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  11. Robust Computational Analysis of rRNA Hypervariable Tag Datasets

    PubMed Central

    Sipos, Maksim; Jeraldo, Patricio; Chia, Nicholas; Qu, Ani; Dhillon, A. Singh; Konkel, Michael E.; Nelson, Karen E.; White, Bryan A.; Goldenfeld, Nigel

    2010-01-01

    Next-generation DNA sequencing is increasingly being utilized to probe microbial communities, such as gastrointestinal microbiomes, where it is important to be able to quantify measures of abundance and diversity. The fragmented nature of the 16S rRNA datasets obtained, coupled with their unprecedented size, has led to the recognition that the results of such analyses are potentially contaminated by a variety of artifacts, both experimental and computational. Here we quantify how multiple alignment and clustering errors contribute to overestimates of abundance and diversity, reflected by incorrect OTU assignment, corrupted phylogenies, inaccurate species diversity estimators, and rank abundance distribution functions. We show that straightforward procedural optimizations, combining preexisting tools, are effective in handling large () 16S rRNA datasets, and we describe metrics to measure the effectiveness and quality of the estimators obtained. We introduce two metrics to ascertain the quality of clustering of pyrosequenced rRNA data, and show that complete linkage clustering greatly outperforms other widely used methods. PMID:21217830

  12. Functional importance of individual rRNA 2′-O-ribose methylations revealed by high-resolution phenotyping

    PubMed Central

    Esguerra, Jonathan; Warringer, Jonas; Blomberg, Anders

    2008-01-01

    Ribosomal RNAs contain numerous modifications at specific nucleotides. Despite their evolutionary conservation, the functional role of individual 2′-O-ribose methylations in rRNA is not known. A distinct family of small nucleolar RNAs, box C/D snoRNAs, guides the methylating complex to specific rRNA sites. Using a high-resolution phenotyping approach, we characterized 20 box C/D snoRNA gene deletions for altered growth dynamics under a wide array of environmental perturbations, encompassing intraribosomal antibiotics, inhibitors of specific cellular features, as well as general stressors. Ribosome-specific antibiotics generated phenotypes indicating different and long-ranging structural effects of rRNA methylations on the ribosome. For all studied box C/D snoRNA mutants we uncovered phenotypes to extraribosomal growth inhibitors, most frequently reflected in alteration in growth lag (adaptation time). A number of strains were highly pleiotropic and displayed a great number of sensitive phenotypes, e.g., deletion mutants of snR70 and snR71, which both have clear human homologues, and deletion mutants of snR65 and snR68. Our data indicate that individual rRNA ribose methylations can play either distinct or general roles in the workings of the ribosome. PMID:18256246

  13. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei

    PubMed Central

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K. Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit

    2016-01-01

    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts. PMID:27142987

  14. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei.

    PubMed

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit

    2016-01-01

    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts. PMID:27142987

  15. Physical mapping of 5S and 18S-5.8S-26S RNA gene families in polyploid series of Cenchrus ciliaris Linnaeus, 1771 (Poaceae)

    PubMed Central

    Kharrat-Souissi, Amina; Siljak-Yakovlev, Sonja; Pustahija, Fatima; Chaieb, Mohamed

    2012-01-01

    Abstract The Buffelgrass (Cenchrus ciliaris L., Poaceae) is one of the most important pasturage grasses due to its high productivity and good forage qualities. This species possess a high adaptability to bioclimatic constraints of arid zones and may be used for the restoration of degraded arid ecosystems. Tunisian populations present three ploidy levels (4x, 5x and 6x) with a basic chromosome number x=9. This study reported for the first time the distribution of the ribosomal genes (rRNA) for pentaploid and hexaploid cytotypes of Cenchrus ciliaris. Molecular cytogenetic study using double fluorescence in situ hybridization has shown that the two rDNA families, 5S and 18S-5.8S-26S (18S), displayed intraspecific variation in number of loci among different ploidy levels. Each ploidy level was characterized by specific number of both 5S and 18S rDNA loci (two loci in tetraploid, five in pentaploid and six in hexaploid level). For three studied cytotypes (4x, 5x and 6x) all 5S rDNA loci were localized on the subcentromeric region of chromosomes, while 18S loci were situated on the telomeric region of short chromosome arms. Data of the FISH experiments show proportional increase of ribosomal loci number during polyploidization processes. PMID:24260668

  16. 5S Clavam Biosynthesis Is Controlled by an Atypical Two-Component Regulatory System in Streptomyces clavuligerus

    PubMed Central

    Kwong, Thomas; Zelyas, Nathan J.; Cai, Hui; Tahlan, Kapil; Wong, Annie

    2012-01-01

    Streptomyces clavuligerus produces a collection of five clavam metabolites, including the clinically important β-lactamase inhibitor clavulanic acid, as well as four structurally related metabolites called 5S clavams. The paralogue gene cluster of S. clavuligerus is one of three clusters of genes for the production of these clavam metabolites. A region downstream of the cluster was analyzed, and snk, res1, and res2, encoding elements of an atypical two-component regulatory system, were located. Mutation of any one of the three genes had no effect on clavulanic acid production, but snk and res2 mutants produced no 5S clavams, whereas res1 mutants overproduced 5S clavams. Reverse transcriptase PCR analyses showed that transcription of cvm7p (which encodes a transcriptional activator of 5S clavam biosynthesis) and 5S clavam biosynthetic genes was eliminated in snk and in res2 mutants but that snk and res2 transcription was unaffected in a cvm7p mutant. Both snk and res2 mutants could be complemented by introduction of cvm7p under the control of an independently regulated promoter. In vitro assays showed that Snk can autophosphorylate and transfer its phosphate group to both Res1 and Res2, and Snk-H365, Res1-D52, and Res2-D52 were identified as the phosphorylation sites for the system. Dephosphorylation assays indicated that Res1 stimulates dephosphorylation of Res2∼P. These results suggest a regulatory cascade in which Snk and Res2 form a two-component system controlling cvm7p transcription, with Res1 serving as a checkpoint to modulate phosphorylation levels. Cvm7P then activates transcription of 5S clavam biosynthetic genes. PMID:22751548

  17. Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

  18. Crystal structure of (4R,5S,6R)-6-azido-5-benz­yloxy-3,3,4-tri­fluoro­azepan-1-ium 2,2,2-tri­fluoro­acetate from synchrotron data

    PubMed Central

    Patel, Alpesh Ramanlal; Bhadbhade, Mohan M.; Liu, Fei

    2015-01-01

    The structure of the title compound, C15H16F6N4O3, was determined using synchrotron radiation on an extremely small crystal (0.015 × 0.01 × 0.01 mm). Although the diffraction was weak, leading to high residuals and a poor data-to-parameter ratio, the data allowed ready solution and refinement to reveal the entire structure. The solid-state structure is in accordance with the absolute configuration assigned based on that of the known starting material. The compound comprises a highly substituted seven-membered N-heterocyclic cation and a tri­fluoro­methane­sulfonate counter-anion. The title compound crystallizes with two independent cations (A and B) and anions (C and D) in the asymmetric unit. Two geminal F atoms, a single F atom, a benzyl ether and an azide group are substituted on consecutive C atoms between the NH2 and CH2 units of the azepan-1-ium ring system. The seven-membered rings adopt different conformations with the principal differences occurring in the CF2CHFCH2 segments of the ring systems. The geminal F atoms on the quaternary C atom exhibit essentially identical bond angles [109 (2) and 106 (2)°] in the two independent mol­ecules. The two mol­ecules associate as a dimeric unit via two C—H⋯F inter­actions. An extensive series of N—H⋯O, N—H⋯F, C—H⋯O, C—H⋯N, C—H⋯F and C—H⋯π contacts generate a three-dimensional network with cations and anions linked into ABCD repeat columns along a. PMID:26594511

  19. A Neurospora crassa ribosomal protein gene, homologous to yeast CRY1, contains sequences potentially coordinating its transcription with rRNA genes.

    PubMed Central

    Tyler, B M; Harrison, K

    1990-01-01

    We have isolated and sequenced a Neurospora crassa ribosomal protein gene (designated crp-2) strongly homologous to the rp59 gene (CRY1) of yeast and the S14 ribosomal protein gene of mammals. The inferred sequence of the crp-2 protein is more homologous (83%) to the mammalian S14 sequence than to the yeast rp59 sequence (69%). The gene has three intervening sequences (IVSs) two of which are offset 7 bp from the position of IVSs in the mammalian genes. None correspond to the position of the IVS in the yeast gene. Crp-2 was mapped by RFLP analysis to the right arm of linkage group III. The 5' region of the gene contains three copies of a sequence, the Ribo box, previously shown to be required for transcription of both 5S and 40S rRNA genes. We speculate that the Ribo box may coordinate ribosomal protein and rRNA gene transcription. Images PMID:1977135

  20. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation

    PubMed Central

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G.; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S. Kundhavai; Klaholz, Bruno P.; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  1. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  2. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4

    PubMed Central

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.

    2011-01-01

    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show this structural change depends only on 16S residues within the S4 binding site. SHAPE chemical-probing experiments showed that S4 strongly stabilizes the five-helix junction and helix 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in helix 16 that makes specific contacts with the S4 N-terminal extension, and a right angle motif between helices 3, 4 and 18, require a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of helix 3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  3. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.

    PubMed

    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A

    2008-01-01

    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  4. Determining Fungi rRNA Copy Number by PCR

    PubMed Central

    Black, Jonathan; Dean, Timothy; Byfield, Grace; Foarde, Karin; Menetrez, Marc

    2013-01-01

    The goal of this project is to improve the quantification of indoor fungal pollutants via the specific application of quantitative PCR (qPCR). Improvement will be made in the controls used in current qPCR applications. This work focuses on the use of two separate controls within a standard qPCR reaction. The first control developed was the internal standard control gene, benA. This gene encodes for β-tubulin and was selected based on its single-copy nature. The second control developed was the standard control plasmid, which contained a fragment of the ribosomal RNA (rRNA) gene and produced a specific PCR product. The results confirm the multicopy nature of the rRNA region in several filamentous fungi and show that we can quantify fungi of unknown genome size over a range of spore extractions by inclusion of these two standard controls. Advances in qPCR have led to extremely sensitive and quantitative methods for single-copy genes; however, it has not been well established that the rRNA can be used to quantitate fungal contamination. We report on the use of qPCR, combined with two controls, to identify and quantify indoor fungal contaminants with a greater degree of confidence than has been achieved previously. Advances in indoor environmental health have demonstrated that contamination of the built environment by the filamentous fungi has adverse impacts on the health of building occupants. This study meets the need for more accurate and reliable methods for fungal identification and quantitation in the indoor environment. PMID:23543828

  5. Crystal structure of (+)-N-[(1R,5S,6S,9S)-5-hydroxy­methyl-3,3,9-trimethyl-8-oxo-2,4,7-trioxabi­cyclo­[4.3.0]nonan-9-yl]acetamide

    PubMed Central

    Oishi, Takeshi; Tsuzaki, Shun; Sugai, Tomoya; Sato, Takaaki; Chida, Noritaka

    2016-01-01

    In the title compound, C12H19NO6, the six-membered 1,3-dioxane ring adopts a chair-like conformation. The seat of this chair, containing two O atoms, is essentially planar, with a maximum deviation of 0.0021 (12) Å. The five-membered oxolane ring cis-fused to the 1,3-dioxane ring adopts an envelope form. The bridgehead C atom at the flap, which is bonded to the tetra­substituted C atom of the oxolane ring, deviates from the mean plane of other ring atoms by 0.539 (4) Å. In the crystal, classical O—H⋯O and N—H⋯O hydrogen bonds link the mol­ecules into a sheet structure enclosing an R 4 4(24) graph-set motif. Weak inter­molecular C—H⋯O inter­actions support the sheet formation. PMID:27308035

  6. Interactions of aminoglycoside antibiotics with rRNA.

    PubMed

    Trylska, Joanna; Kulik, Marta

    2016-08-15

    Aminoglycoside antibiotics are protein synthesis inhibitors applied to treat infections caused mainly by aerobic Gram-negative bacteria. Due to their adverse side effects they are last resort antibiotics typically used to combat pathogens resistant to other drugs. Aminoglycosides target ribosomes. We describe the interactions of aminoglycoside antibiotics containing a 2-deoxystreptamine (2-DOS) ring with 16S rRNA. We review the computational studies, with a focus on molecular dynamics (MD) simulations performed on RNA models mimicking the 2-DOS aminoglycoside binding site in the small ribosomal subunit. We also briefly discuss thermodynamics of interactions of these aminoglycosides with their 16S RNA target. PMID:27528743

  7. Growth rate regulation of rRNA content of a marine Synechococcus (cyanobacterium) strain

    SciTech Connect

    Binder, B.J.; Liu, Y.C.

    1998-09-01

    The relationship between growth rate and rRNA content in a marine Synechococcus strain was examined. A combination of flow cytometry and whole-cell hybridization with fluorescently labeled 16S rRNA-targeted oligonucleotide probes was used to measure the rRNA content of Synechococcus strain WH8101 cells grown at a range of light-limited growth rates. The sensitivity of this approach was sufficient for the analysis of rRNA even in very slowly growing Synechococcus cells. The relationship between growth rate and cellular rRNA content comprised three phases: (1) at low growth rates, rRNA cell{sup {minus}1} remained approximately constant; (2) at intermediate rates, rRNA cell{sup {minus}1} increased proportionally with growth rate; and (3) at the highest, light-saturated rates, rRNA cell{sup {minus}1} dropped abruptly. Total cellular RNA was well correlated with the probe-based measure of rRNA and varied in a similar manner with growth rate. Mean cell volume and rRNA concentration were related to growth rate in a manner similar to rRNA cell{sup {minus}1}, although the overall magnitude linear increase in ribosome efficiency with increasing growth rate, which is consistent with the prevailing prokaryotic model at low growth rates. Taken together, these results support the notion that measurements of cellular rRNA content might be useful for estimating in situ growth rates in natural Synechococcus populations.

  8. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    PubMed

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  9. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  10. The specific isolation of complete 5S rDNA units from chromosome 1A of hexaploid, tetraploid, and diploid wheat species using PCR with head-to-head oriented primers.

    PubMed

    Van Campenhout, S; Stappen, J V; Volckaert, G

    2001-08-01

    The presence of 5S rDNA units on chromosome 1A of Triticum aestivum was shown by the development of a specific PCR test, using head-to-head oriented primers. This primer set allowed the amplification of complete 5S DNA units and was used to isolate SS-Rrna-A1 sequences from polyploid and diploid wheat species. Multiple-alignment and parsimony analyses of the 132 sequences divided the sequences into four types. The isolates from T. aestivum and the tetraploid species (T. dicoccoides, T. dicoccum, T durum, T. araraticum, and T timopheevi) were all of one type, which was shown to be closely related to the type mainly characteristic for T. urartu. The other two types were isolated exclusively from the diploid species T. monococcum, T aegilopoides, T. thaoudar, and T. sinskajae and the hexaploid species T. zhukovski. Triticum monococcum was the only species for which representatives of each of the four sequence types were found to be present. Further, we discuss the possible multicluster arrangement of the 5S-Rrna-A1 array. PMID:11550886

  11. Mutation analysis of 16S rRNA in patients with Rett syndrome.

    PubMed

    Armstrong, J; Pineda, M; Monrós, E

    2000-07-01

    Rett syndrome (RTT) is a progressive neurodevelopmental disorder that affects one in 10,000-15,000 females. RTT is mainly sporadic; familial cases have an estimated frequency of less than 1%. Before the recent identification of de novo dominant mutations in the X-linked MECP2 gene, many other hypotheses had been proposed to explain the particular pattern of inheritance and the phenotypic expression of the disease. The involvement of mitochondrial DNA had been investigated because of the structural and functional mitochondrial abnormalities evident in the patients. In 1997 the finding of mutations at 16S rRNA in several affected RTT females and their mothers was reported, suggesting that mitochondrial DNA might play a key role in the pathogenesis of RTT. To investigate the relevance of such mutations, we used the same methodologic approach to analyze RTT mitochondrial DNA in our series. No 16S rRNA alterations were evident in 27 Spanish patients with classic RTT. PMID:10963979

  12. The Unique 16S rRNA Genes of Piezophiles Reflect both Phylogeny and Adaptation▿ †

    PubMed Central

    Lauro, Federico M.; Chastain, Roger A.; Blankenship, Lesley E.; Yayanos, A. Aristides; Bartlett, Douglas H.

    2007-01-01

    In the ocean's most extreme depths, pressures of 70 to 110 megapascals prevent the growth of all but the most hyperpiezophilic (pressure-loving) organisms. The physiological adaptations required for growth under these conditions are considered to be substantial. Efforts to determine specific adaptations permitting growth at extreme pressures have thus far focused on relatively few γ-proteobacteria, in part due to the technical difficulties of obtaining piezophilic bacteria in pure culture. Here, we present the molecular phylogenies of several new piezophiles of widely differing geographic origins. Included are results from an analysis of the first deep-trench bacterial isolates recovered from the southern hemisphere (9.9-km depth) and of the first gram-positive piezophilic strains. These new data allowed both phylogenetic and structural 16S rRNA comparisons among deep-ocean trench piezophiles and closely related strains not adapted to high pressure. Our results suggest that (i) the Circumpolar Deep Water acts as repository for hyperpiezophiles and drives their dissemination to deep trenches in the Pacific Ocean and (ii) the occurrence of elongated helices in the 16S rRNA genes increases with the extent of adaptation to growth at elevated pressure. These helix changes are believed to improve ribosome function under deep-sea conditions. PMID:17158629

  13. Functional Specialization of Domains Tandemly Duplicated Witin 16S rRNA Methyltransferase RsmC

    SciTech Connect

    Sunita,S.; Purta, E.; Durawa, M.; Tkaczuk, K.; Swaathi, J.; Bujnicki, J.; Sivaraman, J.

    2007-01-01

    RNA methyltransferases (MTases) are important players in the biogenesis and regulation of the ribosome, the cellular machine for protein synthesis. RsmC is a MTase that catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (SAM) to G1207 of 16S rRNA. Mutations of G1207 have dominant lethal phenotypes in Escherichia coli, underscoring the significance of this modified nucleotide for ribosome function. Here we report the crystal structure of E. coli RsmC refined to 2.1 Angstroms resolution, which reveals two homologous domains tandemly duplicated within a single polypeptide. We characterized the function of the individual domains and identified key residues involved in binding of rRNA and SAM, and in catalysis. We also discovered that one of the domains is important for the folding of the other. Domain duplication and subfunctionalization by complementary degeneration of redundant functions (in particular substrate binding versus catalysis) has been reported for many enzymes, including those involved in RNA metabolism. Thus, RsmC can be regarded as a model system for functional streamlining of domains accompanied by the development of dependencies concerning folding and stability.

  14. Chromosomal Organization of Rrna Operons in Bacillus Subtilis

    PubMed Central

    Jarvis, E. D.; Widom, R. L.; LaFauci, G.; Setoguchi, Y.; Richter, I. R.; Rudner, R.

    1988-01-01

    Integrative mapping with vectors containing ribosomal DNA sequences were used to complete the mapping of the 10 rRNA gene sets in the endospore forming bacterium Bacillus subtilis. Southern hybridizations allowed the assignment of nine operons to distinct BclI restriction fragments and their genetic locus identified by transductional crosses. Nine of the ten rRNA gene sets are located between 0 and 70° on the genomic map. In the region surrounding cysA14, two sets of closely spaced tandem clusters are present. The first (rrnJ and rrnW) is located between purA16 and cysA14 closely linked to the latter; the second (rrnI, rrnH and rrnG) previously mapped within this area is located between attSPO2 and glpT6. The operons at or near the origin of replication (rrnO,rrnA and rrnJ,rrnW) represent ``hot spots'' of plasmid insertion. PMID:2465199

  15. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency.

    PubMed

    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa

    2016-05-01

    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2'-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2'-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA fromPyrococcus furiosus We find that the methylation efficacy at sites D and D' differ substantially, with substrate D' turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D' is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D' sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5'-end of the product. PMID:26925607

  16. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  17. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  18. A search for the Bs meson in Υ(5S) decays

    NASA Astrophysics Data System (ADS)

    Shipsey, Ian

    2004-05-01

    The CLEO III detector has recorded approximately 0.5 fb-1 of e^+ e^- annihilation data at the Υ(5S) resonance. Using this data sample, we have searched for fully reconstructed Bs mesons in the reaction Υ(5S) arrow B_s^(*) barB_s^(*)

  19. Selective Phylogenetic Analysis Targeted at 16S rRNA Genes of Thermophiles and Hyperthermophiles in Deep-Subsurface Geothermal Environments

    PubMed Central

    Kimura, Hiroyuki; Sugihara, Maki; Kato, Kenji; Hanada, Satoshi

    2006-01-01

    Deep-subsurface samples obtained by deep drilling are likely to be contaminated with mesophilic microorganisms in the drilling fluid, and this could affect determination of the community structure of the geothermal microflora using 16S rRNA gene clone library analysis. To eliminate possible contamination by PCR-amplified 16S rRNA genes from mesophiles, a combined thermal denaturation and enzyme digestion method, based on a strong correlation between the G+C content of the 16S rRNA gene and the optimum growth temperatures of most known prokaryotic cultures, was used prior to clone library construction. To validate this technique, hot spring fluid (76°C) and river water (14°C) were used to mimic a deep-subsurface sample contaminated with drilling fluid. After DNA extraction and PCR amplification of the 16S rRNA genes from individual samples separately, the amplified products from river water were observed to be denatured at 82°C and completely digested by exonuclease I (Exo I), while the amplified products from hot spring fluid remained intact after denaturation at 84°C and enzyme digestion with Exo I. DNAs extracted from the two samples were mixed and used as a template for amplification of the 16S rRNA genes. The amplified rRNA genes were denatured at 84°C and digested with Exo I before clone library construction. The results indicated that the 16S rRNA gene sequences from the river water were almost completely eliminated, whereas those from the hot spring fluid remained. PMID:16391020

  20. Efficient read-through of Tn9 and IS1 by RNA polymerase molecules that initiate at rRNA promoters.

    PubMed Central

    Siehnel, R J; Morgan, E A

    1983-01-01

    Transcription and translation are coupled in most Escherichia coli operons. As a consequence, ribosomes must be present on an mRNA molecule while transcription of the mRNA is in progress or else premature termination of transcription may result. This requirement is most clearly manifested when premature nonsense codons result in polarity in multicistronic operons. Polarity can also result from insertions of transposons and insertion sequences. However, since rRNA operons are not translated, some property of these operons must allow transcription to be uncoupled from translation. In this paper we demonstrate that transposon Tn9 and insertion sequence IS1 are nonpolar or incompletely polar in rRNA operons during normal growth. We also show that essentially all expression of rrn sequences distal to IS1 and Tn9 results from transcripts that originate at rRNA promoters. These results suggest either that rRNA operons possess some mechanism which reduces or prevents termination within rRNA operons or that Tn9 and IS1 can be very inefficient at blocking normal transcription. Insertions of Tn10 in rRNA operons are substantially but incompletely polar. We could not determine whether the residual downstream transcription observed results from promoters within Tn10 or from read-through of Tn10. We discuss the meaning of read-through of Tn9 and IS1 and the residual expression of genes downstream from Tn10 with regard to rRNA operon structure and previous experiments in which polarity of transposons or insertion sequences was observed in protein-encoding operons. Images PMID:6185465

  1. The 5S lean method as a tool of industrial management performances

    NASA Astrophysics Data System (ADS)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  2. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  3. EzEditor: a versatile sequence alignment editor for both rRNA- and protein-coding genes.

    PubMed

    Jeon, Yoon-Seong; Lee, Kihyun; Park, Sang-Cheol; Kim, Bong-Soo; Cho, Yong-Joon; Ha, Sung-Min; Chun, Jongsik

    2014-02-01

    EzEditor is a Java-based molecular sequence editor allowing manipulation of both DNA and protein sequence alignments for phylogenetic analysis. It has multiple features optimized to connect initial computer-generated multiple alignment and subsequent phylogenetic analysis by providing manual editing with reference to biological information specific to the genes under consideration. It provides various functionalities for editing rRNA alignments using secondary structure information. In addition, it supports simultaneous editing of both DNA sequences and their translated protein sequences for protein-coding genes. EzEditor is, to our knowledge, the first sequence editing software designed for both rRNA- and protein-coding genes with the visualization of biologically relevant information and should be useful in molecular phylogenetic studies. EzEditor is based on Java, can be run on all major computer operating systems and is freely available from http://sw.ezbiocloud.net/ezeditor/. PMID:24425826

  4. Typification of virulent and low virulence Babesia bigemina clones by 18S rRNA and rap-1c.

    PubMed

    Thompson, C; Baravalle, M E; Valentini, B; Mangold, A; Torioni de Echaide, S; Ruybal, P; Farber, M; Echaide, I

    2014-06-01

    The population structure of original Babesia bigemina isolates and reference strains with a defined phenotypic profile was assessed using 18S rRNA and rap-1c genes. Two reference strains, BbiS2P-c (virulent) and BbiS1A-c (low virulence), were biologically cloned in vitro. The virulence profile of the strains and clones was assessed in vivo. One fully virulent and one low-virulence clone were mixed in identical proportions to evaluate their growth efficiency in vitro. Each clone was differentiated by two microsatellites and the gene gp45. The 18S rRNA and rap-1c genes sequences from B. bigemina biological clones and their parental strains, multiplied exclusively in vivo or in vitro, were compared with strain JG-29. The virulence of clones derived from the BbiS2P-c strain was variable. Virulent clone Bbi9P1 grew more efficiently in vitro than did the low-virulence clone Bbi2A1. The haplotypes generated by the nucleotide polymorphism, localized in the V4 region of the 18S rRNA, allowed the identification of three genotypes. The rap-1c haplotypes allowed defining four genotypes. Parental and original strains were defined by multiple haplotypes identified in both genes. The rap-1c gene, analyzed by high-resolution melting (HRM), allowed discrimination between two genotypes according to their phenotype, and both were different from JG-29. B. bigemina biological clones made it possible to define the population structure of isolates and strains. The polymorphic regions of the 18S rRNA and rap-1c genes allowed the identification of different subpopulations within original B. bigemina isolates by the definition of several haplotypes and the differentiation of fully virulent from low virulence clones. PMID:24681200

  5. Reduced expression of the mouse ribosomal protein Rpl17 alters the diversity of mature ribosomes by enhancing production of shortened 5.8S rRNA

    PubMed Central

    Wang, Minshi; Parshin, Andrey V.; Shcherbik, Natalia; Pestov, Dimitri G.

    2015-01-01

    Processing of rRNA during ribosome assembly can proceed through alternative pathways but it is unclear whether this could affect the structure of the ribosome. Here, we demonstrate that shortage of a ribosomal protein can change pre-rRNA processing in a way that over time alters ribosome diversity in the cell. Reducing the amount of Rpl17 in mouse cells led to stalled 60S subunit maturation, causing degradation of most of the synthesized precursors. A fraction of pre-60S subunits, however, were able to complete maturation, but with a 5′-truncated 5.8S rRNA, which we named 5.8SC. The 5′ exoribonuclease Xrn2 is involved in the generation of both 5.8SC and the canonical long form of 5.8S rRNA. Ribosomes containing 5.8SC rRNA are present in various mouse and human cells and engage in translation. These findings uncover a previously undescribed form of mammalian 5.8S rRNA and demonstrate that perturbations in ribosome assembly can be a source of heterogeneity in mature ribosomes. PMID:25995445

  6. Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

    NASA Technical Reports Server (NTRS)

    Viscogliosi, E.; Edgcomb, V. P.; Gerbod, D.; Noel, C.; Delgado-Viscogliosi, P.; Sogin, M. L. (Principal Investigator)

    1999-01-01

    The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

  7. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  8. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio

    2008-01-04

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  9. Mouse nucleolin binds to 4.5S RNAh, a small noncoding RNA.

    PubMed

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAh is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAh is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAh-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAhin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAh-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAh recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAh was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus. PMID:17971306

  10. Exchange of Spacer Regions between Rrna Operons in Escherichia Coli

    PubMed Central

    Harvey, S.; Hill, C. W.

    1990-01-01

    The Escherichia coli rRNA operons each have one of two types of spacer separating the 16S and 23S coding regions. The spacers of four operons encode tRNA(Glu2) and the other three encode both tRNA(Ile) and tRNA(Ala 1 B). We have prepared a series of mutants in which the spacer region of a particular rrn operon has been replaced by the opposite type. Included among these were a mutant retaining only a single copy of the tRNA(Glu2) spacer (at rrnG) and another retaining only a single copy of the tRNA(Ile)-tRNA(Ala 1 B) spacer (at rrnA). While both mutants grew more slowly than controls, the mutant deficient in tRNA(Glu2) spacers was more severely affected. At a frequency of 6 X 10(-5), these mutants phenotypically reverted to faster growing types by increasing the copy number of the deficient spacer. In most of these phenotypic revertants, the deficient spacer type appeared in a rrn operon which previously contained the surplus type, bringing the ratio of spacer types closer to normal. In a few cases, these spacer changes were accompanied by an inversion of the chromosomal material between the donor and recipient rrn operons. Two examples of inversion of one-half of the E. coli chromosome between rrnG and rrnH were observed. The correlation of spacer change with inversion indicated that, in these particular cases, the change was due to an intrachromatid gene conversion event accompanied by a reciprocal crossover rather than reciprocal exchange between sister chromatids. PMID:2168847

  11. Microbial community of salt crystals processed from Mediterranean seawater based on 16S rRNA analysis.

    PubMed

    Baati, Houda; Guermazi, Sonda; Gharsallah, Neji; Sghir, Abdelghani; Ammar, Emna

    2010-01-01

    Phylogenetic analysis of 16S rRNA was used to investigate for the first time the structure of the microbial community that inhabits salt crystals retrieved from the bottom of a solar saltern, located in the coastal area of the Mediterranean Sea (Sfax, Tunisia). This community lives in an extremely salty environment of 250-310 g/L total dissolved salt. A total of 78 bacterial 16S rRNA clone sequences making up to 21 operational taxonomic units (OTUs), determined by the DOTUR program to 97% sequence similarity, was analyzed. These OTUs were affiliated to Bacteroidetes (71.4% of OTUs), and gamma-Proteobacteria and alpha-Proteobacteria (equally represented by 14.2% of the OTUs observed). The archaeal community composition appeared more diverse with 68 clones, resulting in 44 OTUs, all affiliated with the Euryarchaeota phylum. Of the bacterial and archaeal clones showing <97% 16S rRNA sequence identity with sequences in public databases, 47.6% and 84.1% respectively were novel clones. Both rarefaction curves and diversity measurements (Simpson, Shannon-Weaver, Chao) showed a more diverse archaeal than bacterial community at the Tunisian solar saltern pond. The analysis of an increasing clone's number may reveal additional local diversity. PMID:20130693

  12. A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

    PubMed

    Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W

    2000-12-01

    Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants. PMID:11249027

  13. 104. JOB NO. 1347F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    104. JOB NO. 1347-F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD MOTOR COMPANY; LONGITUDINAL SECTION AND TRUSS DETAILS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  14. Plastid 16S rRNA Gene Diversity among Eukaryotic Picophytoplankton Sorted by Flow Cytometry from the South Pacific Ocean

    PubMed Central

    Shi, Xiao Li; Lepère, Cécile; Scanlan, David J.; Vaulot, Daniel

    2011-01-01

    The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX), which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image. PMID:21552558

  15. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  16. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  17. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  18. Genomic organization and evolution of the 5S ribosomal DNA in Tilapiini fishes.

    PubMed

    Alves-Costa, F A; Wasko, A P; Oliveira, C; Foresti, F; Martins, C

    2006-05-01

    5S rDNA sequences present an intense dynamism and have proved to be valuable as genetic markers to distinguish closed related species and also in the understanding of the evolutionary dynamic of repetitive sequences in the genomes. In order to identify patterns of 5S rDNA organization and their evolution in the genome of fish species, such genomic segment was investigated in the tilapias Oreochromis niloticus and Tilapia rendalli, and in the hybrid O. urolepis hornorum x O. mossambicus. A dual 5S rDNA system was identified in the three analyzed tilapia samples. Although each 5S rDNA class was conserved among the three samples, a distinct 5S rDNA genome organization pattern could be evidenced for each sample. The presence of a dual 5S rDNA system seems to be a general trait among non-related teleost fish orders, suggesting that evolutionary events of duplication have occurred before the divergence of the main groups of teleost fishes. PMID:16850228

  19. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    PubMed Central

    Suslu, Hikmet Turan; Celikoglu, Erhan; Borekcı, Ali; Hıcdonmez, Tufan; Suslu, Hüsnü

    2011-01-01

    Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches. PMID:23125496

  20. Functional dichotomy in the 16S rRNA (m1A1408) methyltransferase family and control of catalytic activity via a novel tryptophan mediated loop reorganization

    PubMed Central

    Witek, Marta A.; Conn, Graeme L.

    2016-01-01

    Methylation of the bacterial small ribosomal subunit (16S) rRNA on the N1 position of A1408 confers exceptionally high-level resistance to a broad spectrum of aminoglycoside antibiotics. Here, we present a detailed structural and functional analysis of the Catenulisporales acidiphilia 16S rRNA (m1A1408) methyltransferase (‘CacKam’). The apo CacKam structure closely resembles other m1A1408 methyltransferases within its conserved SAM-binding fold but the region linking core β strands 6 and 7 (the ‘β6/7 linker’) has a unique, extended structure that partially occludes the putative 16S rRNA binding surface, and sequesters the conserved and functionally critical W203 outside of the CacKam active site. Substitution of conserved residues in the SAM binding pocket reveals a functional dichotomy in the 16S rRNA (m1A1408) methyltransferase family, with two apparently distinct molecular mechanisms coupling cosubstrate/ substrate binding to catalytic activity. Our results additionally suggest that CacKam exploits the W203-mediated remodeling of the β6/7 linker as a novel mechanism to control 30S substrate recognition and enzymatic turnover. PMID:26609134

  1. One-pot synthesis and visible light photocatalytic activity of monodispersed AgIn{sub 5}S{sub 8} microspheres

    SciTech Connect

    Li, Xiangqing; Wang, Lei; Wei, Dailong; Kang, Shizhao; Mu, Jin

    2013-02-15

    Graphical abstract: Display Omitted Highlights: ► Monodispersed AgIn{sub 5}S{sub 8} microspheres were prepared in a one-pot process. ► The process is environmental friendly. ► The AgIn{sub 5}S{sub 8} microspheres display high photocatalytic activity. -- Abstract: Monodispersed AgIn{sub 5}S{sub 8} microspheres were synthesized using a one-pot solution method and characterized with X-ray diffraction, UV–vis diffuse reflectance spectroscopy, scanning electron microscope, energy dispersive X-ray spectroscopy and N{sub 2} adsorption–desorption isotherm. The results indicated that the AgIn{sub 5}S{sub 8} microspheres were of cubic spinel structure and the mean diameter of about 0.5 μm. In addition, the visible light photocatalytic activity of AgIn{sub 5}S{sub 8} microspheres was also investigated at room temperature. The AgIn{sub 5}S{sub 8} microspheres showed very high photocatalytic activity for the degradation of methyl orange with a degradation efficiency of about 98% under visible light irradiation for 20 min.

  2. Frequency and spectrum of mitochondrial 12S rRNA variants in 440 Han Chinese hearing impaired pediatric subjects from two otology clinics

    PubMed Central

    2011-01-01

    Background Aminoglycoside ototoxicity is one of the common health problems. Mitochondrial 12S rRNA mutations are one of the important causes of aminoglycoside ototoxicity. However, the incidences of 12S rRNA mutations associated with aminoglycoside ototoxicity are less known. Methods A total of 440 Chinese pediatric hearing-impaired subjects were recruited from two otology clinics in the Ningbo and Wenzhou cities of Zhejiang Province, China. These subjects underwent clinical, genetic evaluation and molecular analysis of mitochondrial 12S rRNA. Resultant mtDNA variants were evaluated by structural and phylogenetic analysis. Results The study samples consisted of 227 males and 213 females. The age of all participants ranged from 1 years old to 18 years, with the median age of 9 years. Ninety-eight subjects (58 males and 40 females) had a history of exposure to aminoglycosides, accounting for 22.3% cases of hearing loss in this cohort. Molecular analysis of 12S rRNA gene identified 41 (39 known and 2 novel) variants. The incidences of the known deafness-associated 1555A > G, 1494C > T and 1095T > C mutations were 7.5%, 0.45% and 0.91% in this entire hearing-impaired subjects, respectively, and 21.4%, 2% and 2% among 98 subjects with aminoglycoside ototoxicity, respectively. The structural and phylogenetic evaluations showed that a novel 747A > G variant and known 839A > G, 1027A > G, 1310C > T and 1413T > C variants conferred increased sensitivity to aminoglycosides or nonsyndromic deafness as they were absent in 449 Chinese controls and localized at highly conserved nucleotides of this rRNA. However, other variants were polymorphisms. Of 44 subjects carrying one of definite or putative deafness-related 12S rRNA variants, only one subject carrying the 1413T > C variant harbored the 235DelC/299DelAT mutations in the GJB2 gene, while none of mutations in GJB2 gene was detected in other 43 subjects. Conclusions Mutations in mitochondrial 12S rRNA accounted for ~30% cases

  3. Slow formation of stable complexes during coincubation of minimal rRNA and ribosomal protein S4.

    PubMed

    Mayerle, Megan; Bellur, Deepti L; Woodson, Sarah A

    2011-09-23

    Ribosomal protein S4 binds and stabilizes a five-helix junction or five-way junction (5WJ) in the 5' domain of 16S ribosomal RNA (rRNA) and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and 5WJ reorganize their structures. We show that labile S4 complexes rearrange into stable complexes within a few minutes at 42 °C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show that this structural change depends only on 16S residues within the S4 binding site. SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension) chemical probing experiments showed that S4 strongly stabilizes 5WJ and the helix (H) 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in H16 that makes specific contacts with the S4 N-terminal extension, as well as a right-angle motif between H3, H4, and H18, requires a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of H3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  4. Chromosomal organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the evolutionary dynamics of multigene families and heterochromatin

    PubMed Central

    2011-01-01

    Background Scarabaeinae beetles show a high level of macro-chromosomal variability, although the karyotypic organization of heterochromatin and multigene families (rDNAs and histone genes) is poorly understood in this group. To better understand the chromosomal organization and evolution in this group, we analyzed the karyotypes, heterochromatin distribution and chromosomal locations of the rRNAs and histone H3 genes in beetles belonging to eight tribes from the Scarabaeinae subfamily (Coleoptera, Scarabaeidae). Results The number of 18S rRNA gene (a member of the 45S rDNA unit) sites varied from one to 16 and were located on the autosomes, sex chromosomes or both, although two clusters were most common. Comparison of the 45S rDNA cluster number and the diploid numbers revealed a low correlation value. However, a comparison between the number of 45S rDNA sites per genome and the quantity of heterochromatin revealed (i) species presenting heterochromatin restricted to the centromeric/pericentromeric region that contained few rDNA sites and (ii) species with a high quantity of heterochromatin and a higher number of rDNA sites. In contrast to the high variability for heterochromatin and 45S rDNA cluster, the presence of two clusters (one bivalent cluster) co-located on autosomal chromosomes with the 5S rRNA and histone H3 genes was highly conserved. Conclusions Our results indicate that the variability of the 45S rDNA chromosomal clusters is not associated with macro-chromosomal rearrangements but are instead related to the spread of heterochromatin. The data obtained also indicate that both heterochromatin and the 45S rDNA loci could be constrained by similar evolutionary forces regulating spreading in the distinct Scarabaeinae subfamily lineages. For the 5S rRNA and the histone H3 genes, a similar chromosomal organization could be attributed to their association/co-localization in the Scarabaeinae karyotypes. These data provide evidence that different evolutionary

  5. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  6. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  7. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  8. Subnuclear partitioning of rRNA genes between the nucleolus and nucleoplasm reflects alternative epiallelic states

    PubMed Central

    Pontvianne, Frederic; Blevins, Todd; Chandrasekhara, Chinmayi; Mozgová, Iva; Hassel, Christiane; Pontes, Olga M.F.; Tucker, Sarah; Mokroš, Petr; Muchová, Veronika; Fajkus, Jiří; Pikaard, Craig S.

    2013-01-01

    Eukaryotes can have thousands of 45S ribosomal RNA (rRNA) genes, many of which are silenced during development. Using fluorescence-activated sorting techniques, we show that active rRNA genes in Arabidopsis thaliana are present within sorted nucleoli, whereas silenced rRNA genes are excluded. DNA methyltransferase (met1), histone deacetylase (hda6), or chromatin assembly (caf1) mutants that disrupt silencing abrogate this nucleoplasmic–nucleolar partitioning. Bisulfite sequencing data indicate that active nucleolar rRNA genes are nearly completely demethylated at promoter CGs, whereas silenced genes are nearly fully methylated. Collectively, the data reveal that rRNA genes occupy distinct but changeable nuclear territories according to their epigenetic state. PMID:23873938

  9. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  10. Photoionization study of Xe 5s: ionization cross sections and photoelectron angular distributions

    NASA Astrophysics Data System (ADS)

    Aarthi, G.; Jose, J.; Deshmukh, S.; Radojevic, V.; Deshmukh, P. C.; Manson, S. T.

    2014-01-01

    We report studies of photoelectron angular distribution and cross-section for photoionization of xenon 5s electrons using the relativistic multiconfiguration Tamm-Dancoff (MCTD) approximation. We find that MCTD provides a significantly improved agreement with experiment, compared to some of the other relativistic many body approximations such as the relativistic random phase approximation and the relativistic random phase approximation with relaxation, over the entire photon energy region bracketing the near-threshold 5s Cooper minimum, from the 5s threshold up to about 70 eV. The MCTD results in the length form are in much better agreement with the experiment than those in the velocity form, suggesting residual correlations that must be of importance.

  11. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    PubMed

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  12. Direct detection of 16S rRNA in soil extracts by using oligonucleotide microarrays.

    PubMed

    Small, J; Call, D R; Brockman, F J; Straub, T M; Chandler, D P

    2001-10-01

    We report on the development and validation of a simple microarray method for the direct detection of intact 16S rRNA from unpurified soil extracts. Total RNAs from Geobacter chapellei and Desulfovibrio desulfuricans were hybridized to an oligonucleotide array consisting of universal and species-specific 16S rRNA probes. PCR-amplified products from Geobacter and Desulfovibrio were easily and specifically detected under a range of hybridization times, temperatures, and buffers. However, reproducible, specific hybridization and detection of intact rRNA could be accomplished only by using a chaperone-detector probe strategy. With this knowledge, assay conditions were developed for rRNA detection using a 2-h hybridization time at room temperature. Hybridization specificity and signal intensity were enhanced using fragmented RNA. Formamide was required in the hybridization buffer in order to achieve species-specific detection of intact rRNA. With the chaperone detection strategy, we were able to specifically hybridize and detect G. chapellei 16S rRNA directly from a total-RNA soil extract, without further purification or removal of soluble soil constituents. The detection sensitivity for G. chapellei 16S rRNA in soil extracts was at least 0.5 microg of total RNA, representing approximately 7.5 x 10(6) Geobacter cell equivalents of RNA. These results suggest that it is now possible to apply microarray technology to the direct detection of microorganisms in environmental samples, without using PCR. PMID:11571176

  13. Microbial Dark Matter: Unusual intervening sequences in 16S rRNA genes of candidate phyla from the deep subsurface

    SciTech Connect

    Jarett, Jessica; Stepanauskas, Ramunas; Kieft, Thomas; Onstott, Tullis; Woyke, Tanja

    2014-03-17

    The Microbial Dark Matter project has sequenced genomes from over 200 single cells from candidate phyla, greatly expanding our knowledge of the ecology, inferred metabolism, and evolution of these widely distributed, yet poorly understood lineages. The second phase of this project aims to sequence an additional 800 single cells from known as well as potentially novel candidate phyla derived from a variety of environments. In order to identify whole genome amplified single cells, screening based on phylogenetic placement of 16S rRNA gene sequences is being conducted. Briefly, derived 16S rRNA gene sequences are aligned to a custom version of the Greengenes reference database and added to a reference tree in ARB using parsimony. In multiple samples from deep subsurface habitats but not from other habitats, a large number of sequences proved difficult to align and therefore to place in the tree. Based on comparisons to reference sequences and structural alignments using SSU-ALIGN, many of these ?difficult? sequences appear to originate from candidate phyla, and contain intervening sequences (IVSs) within the 16S rRNA genes. These IVSs are short (39 - 79 nt) and do not appear to be self-splicing or to contain open reading frames. IVSs were found in the loop regions of stem-loop structures in several different taxonomic groups. Phylogenetic placement of sequences is strongly affected by IVSs; two out of three groups investigated were classified as different phyla after their removal. Based on data from samples screened in this project, IVSs appear to be more common in microbes occurring in deep subsurface habitats, although the reasons for this remain elusive.

  14. The antibiotics micrococcin and thiostrepton interact directly with 23S rRNA nucleotides 1067A and 1095A.

    PubMed Central

    Rosendahl, G; Douthwaite, S

    1994-01-01

    The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid-coded Escherichia coli 23S rRNAs with single mutations at positions 1067 or 1095 were expressed in vivo. Mutant ribosomes are functional in protein synthesis, although those with transversion mutations function less effectively. Antibiotics were bound under conditions where wild-type and mutant ribosomes compete in the same reaction for drug molecules; binding was analysed by allele-specific footprinting. Transversion mutations at 1067 reduce thiostrepton binding more than 1000-fold. The 1067G substitution gives a more modest decrease in thiostrepton binding. The changes at 1095 slightly, but significantly, lower the affinity of ribosomes for thiostrepton, again with the G mutation having the smallest effect. Micrococcin binding to ribosomes is reduced to a far greater extent than thiostrepton by all the 1067 and 1095 mutations. Extrapolating these results to growing cells, mutation of nucleotide 1067A confers resistance towards micrococcin and thiostrepton, while substitutions at 1095A confer micrococcin resistance, and increase tolerance towards thiostrepton. These data support an rRNA tertiary structure model in which 1067A and 1095A lie in close proximity, and are key components in the drug binding site. None of the mutations alters either the higher order rRNA structure or the binding of r-proteins. We therefore conclude that thiostrepton and micrococcin interact directly with 1067A and 1095A. Images PMID:8127673

  15. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    PubMed

    Cangelosi, G A; Brabant, W H

    1997-07-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA probes to measure steady-state cellular pre-16S rRNA pools during growth state transitions in Escherichia coli. Pre-16S rRNA became undetectable when cells entered the stationary phase on rich medium and was replenished upon restoration of favorable growth conditions. These fluctuations were of much greater magnitude than concurrent fluctuations in the mature 16S rRNA pool. The extent of pre-16S rRNA depletion depended upon the circumstances limiting growth. It was significantly more pronounced in carbon-energy-starved cells than in nitrogen-starved cells or in cells treated with energy uncouplers. In the presence of the transcriptional inhibitor rifampin, rates of pre-16S rRNA depletion in carbon-energy-starved cells and nitrogen-starved cells were similar, suggesting that the difference between these conditions resides primarily at the level of pre-rRNA synthesis. Chloramphenicol, which inhibits the final steps in rRNA maturation, halted pre-16S rRNA depletion under all conditions. The data show that E. coli cells continue to process pre-rRNA after growth and rrn operon transcription cease, leading to drainage of the pre-rRNA pool. This supports the feasibility of using pre-rRNA-targeted probes to monitor bacterial growth in natural systems, with the caveat that patterns of pre-rRNA depletion vary with the conditions limiting growth. PMID:9226253

  16. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON QSAR

    EPA Science Inventory

    Dyer, S.D., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to predict HC5's Based on QSARs (Abstract). To be presented at the SETAC Europe 14th Annual Meeting: Environmental Science Solution: A Pan-European Perspective, 18-...

  17. Sacrum fracture following L5-S1 stand-alone interbody fusion for isthmic spondylolisthesis.

    PubMed

    Phan, Kevin; Mobbs, Ralph J

    2015-11-01

    We report a 72-year-old man with a rare sacral fracture following stand-alone L5-S1 anterior lumbar interbody fusion for isthmic spondylolisthesis. The man underwent a minimally invasive management strategy using posterior percutaneous pedicle fixation and partial reduction of the deformity. We also discuss the current literature on fusion procedures for isthmic spondylolisthesis. PMID:26100158

  18. 5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO BRIDGE WITH EAST BRIDGE HOUSE IN RIGHT FOREGROUND. VIEW TO WEST. - MacArthur Bridge, Spanning Mississippi River on Highway 34 between IA & IL, Burlington, Des Moines County, IA

  19. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON MINIMAL DATA

    EPA Science Inventory

    Dyer, S., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to Predict HC5's Based on Minimal Data (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portland, OR. 1 p. (ERL,GB R1013).

  20. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  1. Adaptation of the S-5-S pendulum seismometer for measurement of rotational ground motion

    NASA Astrophysics Data System (ADS)

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-10-01

    The Russian electrodynamic seismometer model S-5-S has been adapted for the measurement of rotational ground motion. The mechanical system of the original S-5-S seismometer consists of electrodynamic sensing and damping transducer coils mounted on an asymmetrical double-arm pendulum. This pendulum is suspended on a footing using two pairs of crossed flat springs, which operate as the axis of rotation. The pendulum is stabilised by an additional spring. The S-5-S can be used either as a vertical or as a horizontal sensor. The adaptation of the S-5-S seismometer described below involves removal of the additional spring and installation of an additional mass on the damping arm. Strain gauge angle sensors are installed on one pair of the crossed flat springs. The main dynamic parameters of the rotational seismometer created in this way, i.e. the natural period and damping, are controlled electronically by feedback currents proportional to the angular displacement and angular velocity, both fed to the damping transducer coil. This new seismometer, named the S-5-SR, enables measurement of the rotational component of ground motion around the horizontal or the vertical axes. The output signal from this S-5-SR seismometer can be proportional either to rotational displacement or rotational velocity.

  2. Ribosomal Protein S14 of Saccharomyces cerevisiae Regulates Its Expression by Binding to RPS14B Pre-mRNA and to 18S rRNA

    PubMed Central

    Fewell, Sheara W.; Woolford, John L.

    1999-01-01

    Production of ribosomal protein S14 in Saccharomyces cerevisiae is coordinated with the rate of ribosome assembly by a feedback mechanism that represses expression of RPS14B. Three-hybrid assays in vivo and filter binding assays in vitro demonstrate that rpS14 directly binds to an RNA stem-loop structure in RPS14B pre-mRNA that is necessary for RPS14B regulation. Moreover, rpS14 binds to a conserved helix in 18S rRNA with approximately five- to sixfold-greater affinity. These results support the model that RPS14B regulation is mediated by direct binding of rpS14 either to its pre-mRNA or to rRNA. Investigation of these interactions with the three-hybrid system reveals two regions of rpS14 that are involved in RNA recognition. D52G and E55G mutations in rpS14 alter the specificity of rpS14 for RNA, as indicated by increased affinity for RPS14B RNA but reduced affinity for the rRNA target. Deletion of the C terminus of rpS14, where multiple antibiotic resistance mutations map, prevents binding of rpS14 to RNA and production of functional 40S subunits. The emetine-resistant protein, rpS14-EmRR, which contains two mutations near the C terminus of rpS14, does not bind either RNA target in the three-hybrid or in vitro assays. This is the first direct demonstration that an antibiotic resistance mutation alters binding of an r protein to rRNA and is consistent with the hypothesis that antibiotic resistance mutations can result from local alterations in rRNA structure. PMID:9858605

  3. Quantification of Hyphomicrobium Populations in Activated Sludge from an Industrial Wastewater Treatment System as Determined by 16S rRNA Analysis

    PubMed Central

    Layton, A. C.; Karanth, P. N.; Lajoie, C. A.; Meyers, A. J.; Gregory, I. R.; Stapleton, R. D.; Taylor, D. E.; Sayler, G. S.

    2000-01-01

    The bacterial community structure of the activated sludge from a 25 million-gal-per-day industrial wastewater treatment plant was investigated using rRNA analysis. 16S ribosomal DNA (rDNA) libraries were created from three sludge samples taken on different dates. Partial rRNA gene sequences were obtained for 46 rDNA clones, and nearly complete 16S rRNA sequences were obtained for 18 clones. Seventeen of these clones were members of the beta subdivision, and their sequences showed high homology to sequences of known bacterial species as well as published 16S rDNA sequences from other activated sludge sources. Sixteen clones belonged to the alpha subdivision, 7 of which showed similarity to Hyphomicrobium species. This cluster was chosen for further studies due to earlier work on Hyphomicrobium sp. strain M3 isolated from this treatment plant. A nearly full-length 16S rDNA sequence was obtained from Hyphomicrobium sp. strain M3. Phylogenetic analysis revealed that Hyphomicrobium sp. strain M3 was 99% similar to Hyphomicrobium denitrificans DSM 1869T in Hyphomicrobium cluster II. Three of the cloned sequences from the activated sludge samples also grouped with those of Hyphomicrobium cluster II, with a 96% sequence similarity to that of Hyphomicrobium sp. strain M3. The other four cloned sequences from the activated sludge sample were more closely related to those of the Hyphomicrobium cluster I organisms (95 to 97% similarity). Whole-cell fluorescence hybridization of microorganisms in the activated sludge with genus-specific Hyphomicrobium probe S-G-Hypho-1241-a-A-19 enhanced the visualization of Hyphomicrobium and revealed that Hyphomicrobium appears to be abundant both on the outside of flocs and within the floc structure. Dot blot hybridization of activated sludge samples from 1995 with probes designed for Hyphomicrobium cluster I and Hyphomicrobium cluster II indicated that Hyphomicrobium cluster II-positive 16S rRNA dominated over Hyphomicrobium cluster I

  4. Important role of the tetraloop region of 4.5S RNA in SRP binding to its receptor FtsY.

    PubMed Central

    Jagath, J R; Matassova, N B; de Leeuw, E; Warnecke, J M; Lentzen, G; Rodnina, M V; Luirink, J; Wintermeyer, W

    2001-01-01

    Binding of Escherichia coli signal recognition particle (SRP) to its receptor, FtsY, requires the presence of 4.5S RNA, although FtsY alone does not interact with 4.5S RNA. In this study, we report that the exchange of the GGAA tetraloop sequence in domain IV of 4.5S RNA for UUCG abolishes SRP-FtsY interaction, as determined by gel retardation and membrane targeting experiments, whereas replacements with other GNRA-type tetraloops have no effect. A number of other base exchanges in the tetraloop sequence have minor or intermediate inhibitory effects. Base pair disruptions in the stem adjacent to the tetraloop or replacement of the closing C-G base pair with G-C partially restored function of the otherwise inactive UUCG mutant. Chemical probing by hydroxyl radical cleavage of 4.5S RNA variants show that replacing GGAA with UUCG in the tetraloop sequence leads to structural changes both within the tetraloop and in the adjacent stem; the latter change is reversed upon reverting the C-G closing base pair to G-C. These results show that the SRP-FtsY interaction is strongly influenced by the structure of the tetraloop region of SRP RNA, in particular the tetraloop stem, and suggest that both SRP RNA and Ffh undergo mutual structural adaptation to form SRP that is functional in the interaction with the receptor, FtsY. PMID:11233986

  5. Specific interactions of the L10(L12)4 ribosomal protein complex with mRNA, rRNA, and L11.

    PubMed

    Iben, James R; Draper, David E

    2008-03-01

    Large ribosomal subunit proteins L10 and L12 form a pentameric protein complex, L10(L12) 4, that is intimately involved in the ribosome elongation cycle. Its contacts with rRNA or other ribosomal proteins have been only partially resolved by crystallography. In Escherichia coli, L10 and L12 are encoded from a single operon for which L10(L12) 4 is a translational repressor that recognizes a secondary structure in the mRNA leader. In this study, L10(L12) 4 was expressed from the moderate thermophile Bacillus stearothermophilus to quantitatively compare strategies for binding of the complex to mRNA and ribosome targets. The minimal mRNA recognition structure is widely distributed among bacteria and has the potential to form a kink-turn structure similar to one identified in the rRNA as part of the L10(L12) 4 binding site. Mutations in equivalent positions between the two sequences have similar effects on L10(L12) 4-RNA binding affinity and identify the kink-turn motif and a loop AA sequence as important recognition elements. In contrast to the larger rRNA structure, the mRNA apparently positions the kink-turn motif and loop for protein recognition without the benefit of Mg (2+)-dependent tertiary structure. The mRNA and rRNA fragments bind L10(L12) 4 with similar affinity ( approximately 10 (8) M (-1)), but fluorescence binding studies show that a nearby protein in the ribosome, L11, enhances L10(L12) 4 binding approximately 100-fold. Thus, mRNA and ribosome targets use similar RNA features, held in different structural contexts, to recognize L10(L12) 4, and the ribosome ensures the saturation of its L10(L12) 4 binding site by means of an additional protein-protein interaction. PMID:18247578

  6. Hadron physics potential of future high-luminosity B-factories at the ϒ(5S) and above

    NASA Astrophysics Data System (ADS)

    Drutskoy, A. G.; Guo, F.-K.; Llanes-Estrada, F. J.; Nefediev, A. V.; Torres-Rincon, J. M.

    2013-01-01

    We point out the physics opportunities of future high-luminosity B-factories at the ϒ(5 S) resonance and above. Currently the two B-factories, the SuperB factory in Tor Vergata, Italy and the Belle II factory in KEK, Japan, are under development and are expected to start operation in 2017 and 2016, respectively. In this paper we discuss numerous interesting investigations, which can be performed in the e + e - center-of-mass energy region from the ϒ(5 S) and up to 11.5GeV, where an efficient data taking operation should be possible with the planned B-factories. These studies include abundant Bs production and decay properties; independent confirmation and, if found, exhaustive exploration of Belle's claimed charged bottomonia; clarification of puzzles of interquarkonium dipion transitions; extraction of the light-quark mass ratio from hadronic ϒ(5 S) decays; analysis of quarkonium and exotic internal structure from open flavour decays, leading to severe SU(3) symmetry violations; clarification of whether a hybrid state has similar mass to the ϒ(5 S) bottomonium, making it a double state; searches for molecular/tetraquark states that should be more stable with heavy quarks; completion of the table of positive-parity BJ mesons and study of their basic properties; production of Λ _b bar Λ _b heavy baryon pairs, that, following weak decay, open vistas on the charmed baryon spectrum and new channels to study CP violation; confirmation or refutation of the deviation from pQCD of the pion transition form factor, by extending the Q2 reach of current analysis; and possibly reaching the threshold for the production of triply charmed baryons. If, in addition, the future colliders can be later upgraded to 12.5GeV, then the possibility of copious production of B_c bar B_c pairs opens, entailing new studies of CP violation and improved, independent tests of the CKM picture (through determination of V bc , and of effective theories for heavy quarks.

  7. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).

    PubMed

    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F

    2014-01-01

    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera. PMID:25501173

  8. High pressure Raman study of layered Mo0.5W0.5S2 ternary compound

    NASA Astrophysics Data System (ADS)

    Kim, Joon-Seok; Moran, Samuel T.; Nayak, Avinash P.; Pedahzur, Shahar; Ruiz, Itzel; Ponce, Gabriela; Rodriguez, Daniela; Henny, Joanna; Liu, Jin; Lin, Jung-Fu; Akinwande, Deji

    2016-06-01

    Ternary two-dimensional (2D) transition metal dichalcogenide compounds exhibit a tunable electronic structure allowing for control of the interlayer and the intralayer atomic displacement to efficiently tune their physical and electronic properties. Using a diamond anvil cell, hydrostatic pressure was applied to Mo0.5W0.5S2 up to 40 GPa in order to study the optical phonon vibrational modes. Analysis of the high-pressure Raman spectra shows that the two in-plane E2g modes resembling that of pristine MoS2 and WS2, as well as disorder-activated longitudinal acoustic phonon mode, are hardened and suppressed as pressure increases. The two A1g modes of the ternary compound that resemble the A1g modes of pristine MoS2 and WS2, displayed similar Raman shifts to the pristine compounds as pressure increases. A Raman peak at 470 cm-1 that is close to A1g peaks emerges at ˜8 GPa, which represents a disorder-activated pressure-induced out-of-plane Raman mode observed only in the ternary compound under high pressure. At pressures above ˜30 GPa, a Raman peak at approximately 340 cm-1 is observed, signifying additional disorder-activated vibration mode. Our results reveal the enhanced interactions in the structural and vibrational behavior of the MoS2 and WS2 domains in the Mo0.5W0.5S2 compound under hydrostatic pressure. These results could have implications in understanding the electronic, optical, and structural properties of the new 2D ternary compound materials under extreme mechanical conditions.

  9. Mitochondrial 12S rRNA A827G mutation is involved in the genetic susceptibility to aminoglycoside ototoxicity

    SciTech Connect

    Xing Guangqian; Chen Zhibin; Wei Qinjun; Tian Huiqin; Li Xiaolu; Zhou Aidong; Bu Xingkuan; Cao Xin . E-mail: caoxin@njmu.edu.cn

    2006-08-11

    We have analyzed the clinical and molecular characterization of a Chinese family with aminoglycoside-induced and non-syndromic hearing impairment. Clinical evaluations revealed that only those family members who had a history of exposure to aminoglycoside antibiotics subsequently developed hearing loss, suggesting mitochondrial genome involvement. Sequence analysis of the mitochondrial 12S rRNA and tRNA{sup Ser(UCN)} genes led to the identification of a homoplasmic A827G mutation in all maternal relatives, a mutation that was identified previously in a few sporadic patients and in another Chinese family with non-syndromic deafness. The pathogenicity of the A827G mutation is strongly supported by the occurrence of the same mutation in two independent families and several genetically unrelated subjects. The A827G mutation is located at the A-site of the mitochondrial 12S rRNA gene which is highly conserved in mammals. It is possible that the alteration of the tertiary or quaternary structure of this rRNA by the A827G mutation may lead to mitochondrial dysfunction, thereby playing a role in the pathogenesis of hearing loss and aminoglycoside hypersensitivity. However, incomplete penetrance of hearing impairment indicates that the A827G mutation itself is not sufficient to produce clinical phenotype but requires the involvement of modifier factors for the phenotypic expression. Indeed, aminoglycosides may contribute to the phenotypic manifestation of the A827G mutation in this family. In contrast with the congenital or early-onset hearing impairment in another Chinese family carrying the A827G mutation, three patients in this pedigree developed hearing loss only after use of aminoglycosides. This discrepancy likely reflects the difference of genetic backgrounds, either mitochondrial haplotypes or nuclear modifier genes, between two families.

  10. Role of conserved nucleotides in building the 16 S rRNA binding site for ribosomal protein S15.

    PubMed

    Serganov, A; Bénard, L; Portier, C; Ennifar, E; Garber, M; Ehresmann, B; Ehresmann, C

    2001-01-26

    Ribosomal protein S15 recognizes a highly conserved target on 16 S rRNA, which consists of two distinct binding regions. Here, we used extensive site-directed mutagenesis on a Escherichia coli 16 S rRNA fragment containing the S15 binding site, to investigate the role of conserved nucleotides in protein recognition and to evaluate the relative contribution of the two sites. The effect of mutations on S15 recognition was studied by measuring the relative binding affinity, RNA probing and footprinting. The crystallographic structure of the Thermus thermophilus complex allowed molecular modelling of the E. coli complex and facilitated interpretation of biochemical data. Binding is essentially driven by site 1, which includes a three-way junction constrained by a conserved base triple and cross-strand stacking. Recognition is based mainly on shape complementarity, and the role of conserved nucleotides is to maintain a unique backbone geometry. The wild-type base triple is absolutely required for protein interaction, while changes in the conserved surrounding nucleotides are partially tolerated. Site 2, which provides functional groups in a conserved G-U/G-C motif, contributes only modestly to the stability of the interaction. Binding to this motif is dependent on binding at site 1 and is allowed only if the two sites are in the correct relative orientation. Non-conserved bulged nucleotides as well as a conserved purine interior loop, although not directly involved in recognition, are used to provide an appropriate flexibility between the two sites. In addition, correct binding at the two sites triggers conformational adjustments in the purine interior loop and in a distal region, which are known to be involved for subsequent binding of proteins S6 and S18. Thus, the role of site 1 is to anchor S15 to the rRNA, while binding at site 2 is aimed to induce a cascade of events required for subunit assembly. PMID:11162092

  11. Regulation of Plasmodium yoelii Oocyst Development by Strain- and Stage-Specific Small-Subunit rRNA

    PubMed Central

    Qi, Yanwei; Zhu, Feng; Eastman, Richard T.; Fu, Young; Zilversmit, Martine; Pattaradilokrat, Sittiporn; Hong, Lingxian; Liu, Shengfa; McCutchan, Thomas F.; Pan, Weiqing; Xu, Wenyue

    2015-01-01

    ABSTRACT One unique feature of malaria parasites is the differential transcription of structurally distinct rRNA (rRNA) genes at different developmental stages: the A-type genes are transcribed mainly in asexual stages, whereas the S-type genes are expressed mostly in sexual or mosquito stages. Conclusive functional evidence of different rRNAs in regulating stage-specific parasite development, however, is still absent. Here we performed genetic crosses of Plasmodium yoelii parasites with one parent having an oocyst development defect (ODD) phenotype and another producing normal oocysts to identify the gene(s) contributing to the ODD. The parent with ODD—characterized as having small oocysts and lacking infective sporozoites—was obtained after introduction of a plasmid with a green fluorescent protein gene into the parasite genome and subsequent passages in mice. Quantitative trait locus analysis of genome-wide microsatellite genotypes of 48 progeny from the crosses linked an ~200-kb segment on chromosome 6 containing one of the S-type genes (D-type small subunit rRNA gene [D-ssu]) to the ODD. Fine mapping of the plasmid integration site, gene expression pattern, and gene knockout experiments demonstrated that disruption of the D-ssu gene caused the ODD phenotype. Interestingly, introduction of the D-ssu gene into the same parasite strain (self), but not into a different subspecies, significantly affected or completely ablated oocyst development, suggesting a stage- and subspecies (strain)-specific regulation of oocyst development by D-ssu. This study demonstrates that P. yoelii D-ssu is essential for normal oocyst and sporozoite development and that variation in the D-ssu sequence can have dramatic effects on parasite development. PMID:25759501

  12. New Site of Modification of 23S rRNA Associated with Clarithromycin Resistance of Helicobacter pylori Clinical Isolates

    PubMed Central

    Fontana, Carla; Favaro, Marco; Minelli, Silvia; Criscuolo, Anna Angela; Pietroiusti, Antonio; Galante, Alberto; Favalli, Cartesio

    2002-01-01

    Resistance of Helicobacter pylori to clarithromycin occurs with a prevalence ranging from 0 to 15%. This has an important clinical impact on dual and triple therapies, in which clarithromycin seems to be the better choice to achieve H. pylori eradication. In order to evaluate the possibility of new mechanisms of clarithromycin resistance, a PCR assay that amplified a portion of 23S rRNA from H. pylori isolates was used. Gastric tissue biopsy specimens from 230 consecutive patients were cultured for H. pylori isolation. Eighty-six gastric biopsy specimens yielded H. pylori-positive results, and among these 12 isolates were clarithromycin resistant. The latter were studied to detect mutations in the 23S rRNA gene. Sequence analysis of the 1,143-bp PCR product (portion of the 23S rRNA gene) did not reveal mutation such as that described at position 2142 to 2143. On the contrary, our findings show, for seven isolates, a T-to-C transition at position 2717. This mutation conferred a low level of resistance, equivalent to the MIC for the isolates, selected using the E-test as well as using the agar dilution method: 1 μg/ml. Moreover, T2717C transition is located in a highly conserved region of the 23S RNA associated with functional sites: domain VI. This fact has a strong effect on the secondary structure of the 23S RNA and on its interaction with macrolide. Mutation at position 2717 also generated an HhaI restriction site; therefore, restriction analysis of the PCR product also permits a rapid detection of resistant isolates. PMID:12435674

  13. Fine mapping of 28S rRNA sites specifically cleaved in cells undergoing apoptosis.

    PubMed Central

    Houge, G; Robaye, B; Eikhom, T S; Golstein, J; Mellgren, G; Gjertsen, B T; Lanotte, M; Døskeland, S O

    1995-01-01

    Bona fide apoptosis in rat and human leukemia cells, rat thymocytes, and bovine endothelial cells was accompanied by limited and specific cleavage of polysome-associated and monosome-associated 28S rRNA, with 18S rRNA being spared. Specific 28S rRNA cleavage was observed in all instances of apoptotic death accompanied by internucleosomal DNA fragmentation, with cleavage of 28S rRNA and of DNA being linked temporally. This indicates that 28S rRNA fragmentation may be as general a feature of apoptosis as internucleosomal DNA fragmentation and that concerted specific cleavage of intra- and extranuclear polynucleotides occurs in apoptosis. Apoptosis-associated cleavage sites were mapped to the 28S rRNA divergent domains D2, D6 (endothelial cells), and D8. The D2 cuts occurred in hairpin loop junctions considered to be buried in the intact ribosome, suggesting that this rRNA region becomes a target for RNase attack in apoptotic cells. D8 was cleaved in two exposed UU(U) sequences in bulge loops. Treatment with agents causing necrotic cell death or aging of cell lysates failed to produce any detectable limited D2 cleavage but did produce a more generalized cleavage in the D8 region. Of potential functional interest was the finding that the primary cuts in D2 exactly flanked a 0.3-kb hypervariable subdomain (D2c), allowing excision of the latter. The implication of hypervariable rRNA domains in apoptosis represents the first association of any functional process with these enigmatic parts of the ribosomes. PMID:7891700

  14. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  15. 1s2s2p2 5p3 5S transition in B ii

    NASA Astrophysics Data System (ADS)

    Mannervik, S.; Cederquist, H.; Martinson, I.; Brage, T.; Froese Fischer, C.

    1987-04-01

    An experimental and theoretical study has been made of the 1s2s2p2 5P-1s2p3 5S transition in B ii. The experimental wavelength and lifetime (1323.92+/-0.07 Å and 0.65+/-0.01 ns), determined by beam-foil spectroscopy, are more than five times more accurate than previous experimental results. Our theoretical data, from multiconfiguration Hartree-Fock calculations, 1311.6 Å and 0.601 ns, are in excellent agreement with previous theoretical predictions of Beck and Nicolaides [Phys. Lett. 61A, 227 (1977)]. We have also observed the 1s2p3 5S-1s2p23s 5P transition, at 857.7+/-0.2 Å, in accord with the theoretical value 859.1 Å.

  16. Extremely Acidophilic Protists from Acid Mine Drainage Host Rickettsiales-Lineage Endosymbionts That Have Intervening Sequences in Their 16S rRNA Genes

    PubMed Central

    Baker, Brett J.; Hugenholtz, Philip; Dawson, Scott C.; Banfield, Jillian F.

    2003-01-01

    During a molecular phylogenetic survey of extremely acidic (pH < 1), metal-rich acid mine drainage habitats in the Richmond Mine at Iron Mountain, Calif., we detected 16S rRNA gene sequences of a novel bacterial group belonging to the order Rickettsiales in the Alphaproteobacteria. The closest known relatives of this group (92% 16S rRNA gene sequence identity) are endosymbionts of the protist Acanthamoeba. Oligonucleotide 16S rRNA probes were designed and used to observe members of this group within acidophilic protists. To improve visualization of eukaryotic populations in the acid mine drainage samples, broad-specificity probes for eukaryotes were redesigned and combined to highlight this component of the acid mine drainage community. Approximately 4% of protists in the acid mine drainage samples contained endosymbionts. Measurements of internal pH of the protists showed that their cytosol is close to neutral, indicating that the endosymbionts may be neutrophilic. The endosymbionts had a conserved 273-nucleotide intervening sequence (IVS) in variable region V1 of their 16S rRNA genes. The IVS does not match any sequence in current databases, but the predicted secondary structure forms well-defined stem loops. IVSs are uncommon in rRNA genes and appear to be confined to bacteria living in close association with eukaryotes. Based on the phylogenetic novelty of the endosymbiont sequences and initial culture-independent characterization, we propose the name “Candidatus Captivus acidiprotistae.” To our knowledge, this is the first report of an endosymbiotic relationship in an extremely acidic habitat. PMID:12957940

  17. Pyrosequencing of mcrA and Archaeal 16S rRNA Genes Reveals Diversity and Substrate Preferences of Methanogen Communities in Anaerobic Digesters

    PubMed Central

    Wilkins, David; Lu, Xiao-Ying; Shen, Zhiyong; Chen, Jiapeng

    2014-01-01

    Methanogenic archaea play a key role in biogas-producing anaerobic digestion and yet remain poorly taxonomically characterized. This is in part due to the limitations of low-throughput Sanger sequencing of a single (16S rRNA) gene, which in the past may have undersampled methanogen diversity. In this study, archaeal communities from three sludge digesters in Hong Kong and one wastewater digester in China were examined using high-throughput pyrosequencing of the methyl coenzyme M reductase (mcrA) and 16S rRNA genes. Methanobacteriales, Methanomicrobiales, and Methanosarcinales were detected in each digester, indicating that both hydrogenotrophic and acetoclastic methanogenesis was occurring. Two sludge digesters had similar community structures, likely due to their similar design and feedstock. Taxonomic classification of the mcrA genes suggested that these digesters were dominated by acetoclastic methanogens, particularly Methanosarcinales, while the other digesters were dominated by hydrogenotrophic Methanomicrobiales. The proposed euryarchaeotal order Methanomassiliicoccales and the uncultured WSA2 group were detected with the 16S rRNA gene, and potential mcrA genes for these groups were identified. 16S rRNA gene sequencing also recovered several crenarchaeotal groups potentially involved in the initial anaerobic digestion processes. Overall, the two genes produced different taxonomic profiles for the digesters, while greater methanogen richness was detected using the mcrA gene, supporting the use of this functional gene as a complement to the 16S rRNA gene to better assess methanogen diversity. A significant positive correlation was detected between methane production and the abundance of mcrA transcripts in digesters treating sludge and wastewater samples, supporting the mcrA gene as a biomarker for methane yield. PMID:25381241

  18. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium

    NASA Astrophysics Data System (ADS)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.

    2014-07-01

    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  19. Accurate taxonomy assignments from 16S rRNA sequences produced by highly parallel pyrosequencers

    PubMed Central

    Liu, Zongzhi; DeSantis, Todd Z.; Andersen, Gary L.; Knight, Rob

    2008-01-01

    The recent introduction of massively parallel pyrosequencers allows rapid, inexpensive analysis of microbial community composition using 16S ribosomal RNA (rRNA) sequences. However, a major challenge is to design a workflow so that taxonomic information can be accurately and rapidly assigned to each read, so that the composition of each community can be linked back to likely ecological roles played by members of each species, genus, family or phylum. Here, we use three large 16S rRNA datasets to test whether taxonomic information based on the full-length sequences can be recaptured by short reads that simulate the pyrosequencer outputs. We find that different taxonomic assignment methods vary radically in their ability to recapture the taxonomic information in full-length 16S rRNA sequences: most methods are sensitive to the region of the 16S rRNA gene that is targeted for sequencing, but many combinations of methods and rRNA regions produce consistent and accurate results. To process large datasets of partial 16S rRNA sequences obtained from surveys of various microbial communities, including those from human body habitats, we recommend the use of Greengenes or RDP classifier with fragments of at least 250 bases, starting from one of the primers R357, R534, R798, F343 or F517. PMID:18723574

  20. Global determinants of mortality in under 5s: 10 year worldwide longitudinal study

    PubMed Central

    Nacher, Mathieu; Guihenneuc, Chantal; Tubert-Bitter, Pascale; Chavance, Michel

    2013-01-01

    Objective To assess at country level the association of mortality in under 5s with a large set of determinants. Design Longitudinal study. Setting 193 United Nations member countries, 2000-09. Methods Yearly data between 2000 and 2009 based on 12 world development indicators were used in a multivariable general additive mixed model allowing for non-linear relations and lag effects. Main outcome measure National rate of deaths in under 5s per 1000 live births Results The model retained the variables: gross domestic product per capita; percentage of the population having access to improved water sources, having access to improved sanitation facilities, and living in urban areas; adolescent fertility rate; public health expenditure per capita; prevalence of HIV; perceived level of corruption and of violence; and mean number of years in school for women of reproductive age. Most of these variables exhibited non-linear behaviours and lag effects. Conclusions By providing a unified framework for mortality in under 5s, encompassing both high and low income countries this study showed non-linear behaviours and lag effects of known or suspected determinants of mortality in this age group. Although some of the determinants presented a linear action on log mortality indicating that whatever the context, acting on them would be a pertinent strategy to effectively reduce mortality, others had a threshold based relation potentially mediated by lag effects. These findings could help designing efficient strategies to achieve maximum progress towards millennium development goal 4, which aims to reduce mortality in under 5s by two thirds between 1990 and 2015. PMID:24212105

  1. Evolution of compensatory substitutions through G.U intermediate state in Drosophila rRNA.

    PubMed Central

    Rousset, F; Pélandakis, M; Solignac, M

    1991-01-01

    It has often been suggested that the frequently observed Watson-Crick base-pair compensatory substitutions in RNA helical structures occur mainly through a slightly deleterious G.U intermediate state. We have scored base substitutions in a set of 82 related Drosophila species for the D1 and D2 variable domains of the large rRNA subunit. In all locations where a G-C in equilibrium with A-U compensatory base change occurred, a G.U pair has been observed in one or several species. As this dominant process implies two transitions, their rate was far higher in paired regions (92%) than in unpaired regions (47%). The other types of compensation were rarer and no intermediate states were observed. Most of the G.U base pairs observed in a species are not slightly deleterious. The rate of evolution of compensatory substitution is close to that predicted by a simple model of compensatory substitution through slightly deleterious or slightly advantageous G.U pairs, although some exceptions are presented. PMID:1946420

  2. Novel Approach to Quantitative Detection of Specific rRNA in a Microbial Community, Using Catalytic DNA

    PubMed Central

    Suenaga, Hikaru; Liu, Rui; Shiramasa, Yuko; Kanagawa, Takahiro

    2005-01-01

    We developed a novel method for the quantitative detection of the 16S rRNA of a specific bacterial species in the microbial community by using deoxyribozyme (DNAzyme), which possesses the catalytic function to cleave RNA in a sequence-specific manner. A mixture of heterogeneous 16S rRNA containing the target 16S rRNA was incubated with a species-specific DNAzyme. The cleaved target 16S rRNA was separated from the intact 16S rRNA by electrophoresis, and then their amounts were compared for the quantitative detection of target 16S rRNA. This method was used to determine the abundance of the 16S rRNA of a filamentous bacterium, Sphaerotilus natans, in activated sludge, which is a microbial mixture used in wastewater treatment systems. The result indicated that this DNAzyme-based approach would be applicable to actual microbial communities. PMID:16085888

  3. 16S rRNA Gene Survey of Microbial Communities in Winogradsky Columns

    PubMed Central

    Rundell, Ethan A.; Banta, Lois M.; Ward, Doyle V.; Watts, Corey D.; Birren, Bruce; Esteban, David J.

    2014-01-01

    A Winogradsky column is a clear glass or plastic column filled with enriched sediment. Over time, microbial communities in the sediment grow in a stratified ecosystem with an oxic top layer and anoxic sub-surface layers. Winogradsky columns have been used extensively to demonstrate microbial nutrient cycling and metabolic diversity in undergraduate microbiology labs. In this study, we used high-throughput 16s rRNA gene sequencing to investigate the microbial diversity of Winogradsky columns. Specifically, we tested the impact of sediment source, supplemental cellulose source, and depth within the column, on microbial community structure. We found that the Winogradsky columns were highly diverse communities but are dominated by three phyla: Proteobacteria, Bacteroidetes, and Firmicutes. The community is structured by a founding population dependent on the source of sediment used to prepare the columns and is differentiated by depth within the column. Numerous biomarkers were identified distinguishing sample depth, including Cyanobacteria, Alphaproteobacteria, and Betaproteobacteria as biomarkers of the soil-water interface, and Clostridia as a biomarker of the deepest depth. Supplemental cellulose source impacted community structure but less strongly than depth and sediment source. In columns dominated by Firmicutes, the family Peptococcaceae was the most abundant sulfate reducer, while in columns abundant in Proteobacteria, several Deltaproteobacteria families, including Desulfobacteraceae, were found, showing that different taxonomic groups carry out sulfur cycling in different columns. This study brings this historical method for enrichment culture of chemolithotrophs and other soil bacteria into the modern era of microbiology and demonstrates the potential of the Winogradsky column as a model system for investigating the effect of environmental variables on soil microbial communities. PMID:25101630

  4. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    PubMed

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  5. Phylogenetic relationships within caniform carnivores based on analyses of the mitochondrial 12S rRNA gene.

    PubMed

    Ledje, C; Arnason, U

    1996-12-01

    The complete 12S rRNA gene of 32 carnivore species, including four feliforms and 28 caniforms, was sequenced. The sequences were aligned on the basis of their secondary structures and used in phylogenetic analyses that addressed several evolutionary relationships within the Caniformia. The analyses showed an unresolved polytomy of the basic caniform clades; pinnipeds, mustelids, procyonids, skunks, Ailurus (lesser panda), ursids, and canids. The polytomy indicates a major diversification of caniforms during a relatively short period of time. The lesser panda was distinct from other caniforms, suggesting its inclusion in a monotypic family, Ailuridae. The giant panda and the bears were joined on the same branch. The skunks are traditionally included in the family Mustelidae. The present analysis, however, showed a less close molecular relationship between the skunks and the remaining Mustelidae (sensu stricto) than between Mustelidae (sensu stricto) and Procyonidae, making Mustelidae (sensu lato) paraphyletic. The results suggest that the skunks should be included in a separate family, Mephitidae. Within the Pinnipedia, the grouping of walrus, sea lions, and fur seals was strongly supported. Analyses of a combined set of 12S rRNA and cytochrome b data were generally consistent with the findings based on each gene. PMID:8995061

  6. Mechanisms underlying the evolution and maintenance of functionally heterogeneous 18S rRNA genes in Apicomplexans.

    PubMed

    Rooney, Alejandro P

    2004-09-01

    In many species of the protist phylum Apicomplexa, ribosomal RNA (rRNA) gene copies are structurally and functionally heterogeneous, owing to distinct requirements for rRNA-expression patterns at different developmental stages. The genomic mechanisms underlying the maintenance of this system over long-term evolutionary history are unclear. Therefore, the aim of this study was to investigate what processes underlie the long-term evolution of apicomplexan 18S genes in representative species. The results show that these genes evolve according to a birth-and-death model under strong purifying selection, thereby explaining how divergent 18S genes are generated over time while continuing to maintain their ability to produce fully functional rRNAs. In addition, it was found that Cryptosporidium parvum undergoes a rapid form of birth-and-death evolution that may facilitate host-specific adaptation, including that of type I and II strains found in humans. This represents the first case in which an rRNA gene family has been found to evolve under the birth-and-death model. PMID:15175411

  7. The RNA recognition motif of NIFK is required for rRNA maturation during cell cycle progression.

    PubMed

    Pan, Wen-An; Tsai, Hsin-Yue; Wang, Shun-Chang; Hsiao, Michael; Wu, Pei-Yu; Tsai, Ming-Daw

    2015-01-01

    Ribosome biogenesis governs protein synthesis. NIFK is transactivated by c-Myc, the key regulator of ribosome biogenesis. The biological function of human NIFK is not well established, except that it has been shown to interact with Ki67 and NPM1. Here we report that NIFK is required for cell cycle progression and participates in the ribosome biogenesis via its RNA recognition motif (RRM). We show that silencing of NIFK inhibits cell proliferation through a reversible p53-dependent G1 arrest, possibly by induction of the RPL5/RPL11-mediated nucleolar stress. Mechanistically it is the consequence of impaired maturation of 28S and 5.8S rRNA resulting from inefficient cleavage of internal transcribed spacer (ITS) 1, a critical step in the separation of pre-ribosome to small and large subunits. Complementation of NIFK silencing by mutants shows that RNA-binding ability of RRM is essential for the pre-rRNA processing and G1 progression. More specifically, we validate that the RRM of NIFK preferentially binds to the 5'-region of ITS2 rRNA likely in both sequence specific and secondary structure dependent manners. Our results show how NIFK is involved in cell cycle progression through RRM-dependent pre-rRNA maturation, which could enhance our understanding of the function of NIFK in cell proliferation, and potentially also cancer and ribosomopathies. PMID:25826659

  8. The RNA recognition motif of NIFK is required for rRNA maturation during cell cycle progression

    PubMed Central

    Pan, Wen-An; Tsai, Hsin-Yue; Wang, Shun-Chang; Hsiao, Michael; Wu, Pei-Yu; Tsai, Ming-Daw

    2015-01-01

    Ribosome biogenesis governs protein synthesis. NIFK is transactivated by c-Myc, the key regulator of ribosome biogenesis. The biological function of human NIFK is not well established, except that it has been shown to interact with Ki67 and NPM1. Here we report that NIFK is required for cell cycle progression and participates in the ribosome biogenesis via its RNA recognition motif (RRM). We show that silencing of NIFK inhibits cell proliferation through a reversible p53-dependent G1 arrest, possibly by induction of the RPL5/RPL11-mediated nucleolar stress. Mechanistically it is the consequence of impaired maturation of 28S and 5.8S rRNA resulting from inefficient cleavage of internal transcribed spacer (ITS) 1, a critical step in the separation of pre-ribosome to small and large subunits. Complementation of NIFK silencing by mutants shows that RNA-binding ability of RRM is essential for the pre-rRNA processing and G1 progression. More specifically, we validate that the RRM of NIFK preferentially binds to the 5′-region of ITS2 rRNA likely in both sequence specific and secondary structure dependent manners. Our results show how NIFK is involved in cell cycle progression through RRM-dependent pre-rRNA maturation, which could enhance our understanding of the function of NIFK in cell proliferation, and potentially also cancer and ribosomopathies. PMID:25826659

  9. Single methylation of 23S rRNA triggers late steps of 50S ribosomal subunit assembly.

    PubMed

    Arai, Taiga; Ishiguro, Kensuke; Kimura, Satoshi; Sakaguchi, Yuriko; Suzuki, Takeo; Suzuki, Tsutomu

    2015-08-25

    Ribosome biogenesis requires multiple assembly factors. In Escherichia coli, deletion of RlmE, the methyltransferase responsible for the 2'-O-methyluridine modification at position 2552 (Um2552) in helix 92 of the 23S rRNA, results in slow growth and accumulation of the 45S particle. We demonstrate that the 45S particle that accumulates in ΔrlmE is a genuine precursor that can be assembled into the 50S subunit. Indeed, 50S formation from the 45S precursor could be promoted by RlmE-mediated Um2552 formation in vitro. Ribosomal protein L36 (encoded by rpmJ) was completely absent from the 45S precursor in ΔrlmE, and we observed a strong genetic interaction between rlmE and rpmJ. Structural probing of 23S rRNA and high-salt stripping of 45S components revealed that RlmE-mediated methylation promotes interdomain interactions via the association between helices 92 and 71, stabilized by the single 2'-O-methylation of Um2552, in concert with the incorporation of L36, triggering late steps of 50S subunit assembly. PMID:26261349

  10. Single methylation of 23S rRNA triggers late steps of 50S ribosomal subunit assembly

    PubMed Central

    Arai, Taiga; Ishiguro, Kensuke; Kimura, Satoshi; Sakaguchi, Yuriko; Suzuki, Takeo; Suzuki, Tsutomu

    2015-01-01

    Ribosome biogenesis requires multiple assembly factors. In Escherichia coli, deletion of RlmE, the methyltransferase responsible for the 2′-O-methyluridine modification at position 2552 (Um2552) in helix 92 of the 23S rRNA, results in slow growth and accumulation of the 45S particle. We demonstrate that the 45S particle that accumulates in ΔrlmE is a genuine precursor that can be assembled into the 50S subunit. Indeed, 50S formation from the 45S precursor could be promoted by RlmE-mediated Um2552 formation in vitro. Ribosomal protein L36 (encoded by rpmJ) was completely absent from the 45S precursor in ΔrlmE, and we observed a strong genetic interaction between rlmE and rpmJ. Structural probing of 23S rRNA and high-salt stripping of 45S components revealed that RlmE-mediated methylation promotes interdomain interactions via the association between helices 92 and 71, stabilized by the single 2′-O-methylation of Um2552, in concert with the incorporation of L36, triggering late steps of 50S subunit assembly. PMID:26261349

  11. Bacterial community analysis of a gas-phase biotrickling filter for biogas mimics desulfurization through the rRNA approach.

    PubMed

    Maestre, Juan P; Rovira, R; Alvarez-Hornos, F J; Fortuny, M; Lafuente, J; Gamisans, X; Gabriel, D

    2010-08-01

    The bacterial composition of a lab-scale biotrickling filter (BTF) treating high loads of H(2)S was investigated by the rRNA approach. Two 16S rRNA gene clone libraries were established 42 and 189 d after reactor startup, while fluorescent in-situ hybridization (FISH) with DNA probes was performed throughout 260d of reactor operation. Diversity, community structure and metamorphosis were studied from reactor startup to fully-established pseudo-steady state operation at near neutral pH and at an inlet H(2)S concentration of 2000 ppmv (load of 55.6g H(2)S m(-3)h(-1)). In addition, FISH was used for assessing the spatial distribution of sulfur-oxidizing bacteria (SOB) along the length of the reactor under pseudo-steady state operation. A major shift in the diversity of the community was observed with the operating time, from a well-diverse community at startup to pseudo-steady state operation with a majority of retrieved sequences affiliated to SOB of the sulfur cycle including Thiothrix spp., Thiobacillus spp., and Sulfurimonas denitrificans. Although aerobic species were predominant along the BTF, a vertical stratification was encountered, in which facultative anaerobes had a major relative abundance in the inlet part of the BTF, where the sulfide to oxygen ratio was higher. The observed changes were related to the trophic properties of the community, the DO concentration, the accumulation of elemental sulfur and the operation at neutral pH. PMID:20554311

  12. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  13. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  14. Principles for understanding the accuracy of SHAPE-directed RNA structure modeling

    PubMed Central

    Leonard, Christopher W.; Hajdin, Christine E.; Karabiber, Fethullah; Mathews, David H.; Favorov, Oleg; Dokholyan, Nikolay V.; Weeks, Kevin M.

    2013-01-01

    Accurate RNA structure modeling is an important, incompletely solved, challenge. Single-nucleotide resolution SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension) yields an experimental measurement of local nucleotide flexibility that can be incorporated as pseudo-free energy change constraints to direct secondary structure predictions. Prior work from our laboratory has emphasized both the overall accuracy of this approach and the need for nuanced interpretation of some apparent discrepancies between modeled and accepted structures. Recent studies by Das and colleagues [Kladwang et al., Biochemistry 50:8049 (2011) and Nat. Chem. 3:954 (2011)], focused on analyzing six small RNAs, yielded poorer RNA secondary structure predictions than expected based on prior benchmarking efforts. To understand the features that led to these divergent results, we re-examined four RNAs yielding the poorest results in this recent work – tRNAPhe, the adenine and cyclic-di-GMP riboswitches, and 5S rRNA. Most of the errors reported by Das and colleagues reflected non-standard experiment and data processing choices, and selective scoring rules. For two RNAs, tRNAPhe and the adenine riboswitch, secondary structure predictions are nearly perfect if no experimental information is included but were rendered inaccurate by the Das and colleagues SHAPE data. When best practices were used, single-sequence SHAPE-directed secondary structure modeling recovered ~93% of individual base pairs and greater than 90% of helices in the four RNAs, essentially indistinguishable from the mutate-and-map approach with the exception of a single helix in the 5S rRNA. The field of experimentally-directed RNA secondary structure prediction is entering a phase focused on the most difficult prediction challenges. We outline five constructive principles for guiding this field forward. PMID:23316814

  15. A finite element model of the L4-L5-S1 human spine segment including the heterogeneity and anisotropy of the discs.

    PubMed

    Jaramillo, Hector E; Gómez, Lessby; García, Jose J

    2015-01-01

    With the aim to study disc degeneration and the risk of injury during occupational activities, a new finite element (FE) model of the L4-L5-S1 segment of the human spine was developed based on the anthropometry of a typical Colombian worker. Beginning with medical images, the programs CATIA and SOLIDWORKS were used to generate and assemble the vertebrae and create the soft structures of the segment. The software ABAQUS was used to run the analyses, which included a detailed model calibration using the experimental step-wise reduction data for the L4-L5 component, while the L5-S1 segment was calibrated in the intact condition. The range of motion curves, the intradiscal pressure and the lateral bulging under pure moments were considered for the calibration. As opposed to other FE models that include the L5-S1 disc, the model developed in this study considered the regional variations and anisotropy of the annulus as well as a realistic description of the nucleus geometry, which allowed an improved representation of experimental data during the validation process. Hence, the model can be used to analyze the stress and strain distributions in the L4-L5 and L5-S1 discs of workers performing activities such as lifting and carrying tasks. PMID:26415632

  16. Magic wavelengths for the 5 s -18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, E. A.; Norris, D. G.; Koller, S. B.; Wyllie, R.; Brown, R. C.; Porto, J. V.; Safronova, U. I.; Safronova, M. S.

    2015-03-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s -18 s transition of rubidium, and compare the calculation to experiment by measuring the light shift for atoms held in an optical dipole trap at a range of wavelengths near a calculated magic value.

  17. Nucleotide sequences of 5S ribosomal RNA from four oomycete and chytrid water molds.

    PubMed

    Walker, W F; Doolittle, W F

    1982-09-25

    The nucleotide sequences of the 5S rRNAs of the oomycete water molds Saprolegnia ferax and Pythium hydnosporum and of the chytrid water molds Blastocladiella simplex and Phlyctochytrium irregulare were determined by chemical and enzymatic partial degradation of 3' and 5' end-labelled molecules, followed by gel sequence analysis. The two oomycete sequences differed in 24 positions and the two chytrid sequences differed in 27 positions. These pairs differed in a mean of 44 positions. The chytrid sequences clearly most resemble the sequence from the zygomycete Phycomyces, while the oomycete sequences appear to be allied with those from protozoa and slime molds. PMID:6890670

  18. Minimally invasive L5-S1 oblique lumbar interbody fusion with anterior plate.

    PubMed

    Pham, Martin H; Jakoi, Andre M; Hsieh, Patrick C

    2016-07-01

    Lumbar interbody fusion is an important technique for the treatment of degenerative disc disease and degenerative scoliosis. The oblique lumbar interbody fusion (OLIF) establishes a minimally invasive retroperitoneal exposure anterior to the psoas and lumbar plexus. In this video case presentation, the authors demonstrate the techniques of the OLIF at L5-S1 performed on a 69-year-old female with degenerative scoliosis as one component of an overall strategy for her deformity correction. The video can be found here: https://youtu.be/VMUYWKLAl0g . PMID:27364428

  19. Refinement of the spinal muscular atrophy locus to the interval between D5S435 and MAP1B

    SciTech Connect

    Soares, V.M.; Brzustowicz, L.M.; Kleyn, P.W.; Knowles, J.A.; Palmer, D.A.; Asokan, S.; Penchaszadeh, G.K.; Gilliam, T.C. ); Munsat, T.L. )

    1993-02-01

    The childhood-onset SMA locus has been mapped to chromosome 5q13, in a region bounded by the proximal locus, D5S6, and the closely linked distal loci, D5S112 and MAP1B. We now describe a highly polymorphic, tightly linked microsatellite marker (D5S435) that is very likely the closet proximal marker to the SMA locus. Multipoint linkage analysis firmly establishes the following order of markers at 5q13; centromere-D5S76-D5S6-D5S435-MAP1B/D5S112-D5S39-telomere. The data indicate that SMA resides in an approximately 0.7-cM (range 01.-2.1) region between D5S435 and MAP1B. This finding reduces by approximately fourfold the genetic region that most likely harbors the SMA locus and will facilitate the physical mapping and cloning of the disease gene region. 24 refs., 3 figs., 1 tab.

  20. Decreases in average bacterial community rRNA operon copy number during succession.

    PubMed

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  1. Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

    PubMed Central

    Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

    1996-01-01

    Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

  2. The impact of transcriptional tuning on in vitro integrated rRNA transcription and ribosome construction

    PubMed Central

    Fritz, Brian R.; Jewett, Michael C.

    2014-01-01

    In vitro ribosome construction could enable studies of ribosome assembly and function, provide a route toward constructing minimal cells for synthetic biology, and permit the construction of ribosome variants with new functions. Toward these long-term goals, we recently reported on an integrated, one-pot ribosomal RNA synthesis (rRNA), ribosome assembly, and translation technology (termed iSAT) for the construction of Escherichia coli ribosomes in crude ribosome-free S150 extracts. Here, we aimed to improve the activity of iSAT through transcriptional tuning. Specifically, we increased transcriptional efficiency through 3′ modifications to the rRNA gene sequences, optimized plasmid and polymerase concentrations, and demonstrated the use of a T7-promoted rRNA operon for stoichiometrically balanced rRNA synthesis and native rRNA processing. Our modifications produced a 45-fold improvement in iSAT protein synthesis activity, enabling synthesis of 429 ± 15 nmol/l green fluorescent protein in 6 h batch reactions. Further, we show that the translational activity of ribosomes purified from iSAT reactions is about 20% the activity of native ribosomes purified directly from E. coli cells. Looking forward, we believe iSAT will enable unique studies to unravel the systems biology of ribosome biogenesis and open the way to new methods for making and studying ribosomal variants. PMID:24792158

  3. Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces

    PubMed Central

    Orsi, William; Biddle, Jennifer F.; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface. PMID:23418556

  4. Interactions between 23S rRNA and tRNA in the ribosomal E site.

    PubMed Central

    Bocchetta, M; Xiong, L; Shah, S; Mankin, A S

    2001-01-01

    Interactions between tRNA or its analogs and 23S rRNA in the large ribosomal subunit were analyzed by RNA footprinting and by modification-interference selection. In the E site, tRNA protected bases G2112, A2392, and C2394 of 23S rRNA. Truncated tRNA, lacking the anticodon stem-loop, protected A2392 and C2394, but not G2112, and tRNA derivatives with a shortened 3' end protected only G2112, but not A2392 or C2394. Modification interference revealed C2394 as the only accessible nucleotide in 23S rRNA whose modification interferes with binding of tRNA in the large ribosomal subunit E site. The results suggest a direct contact between A76 of tRNA A76 and C2394 of 23S rRNA. Protections at G2112 may reflect interaction of this 23S rRNA region with the tRNA central fold. PMID:11214181

  5. Sequence and phylogenetic analysis of SSU rRNA gene of five microsporidia.

    PubMed

    Dong, ShiNan; Shen, ZhongYuan; Xu, Li; Zhu, Feng

    2010-01-01

    The complete small subunit rRNA (SSU rRNA) gene sequences of five microsporidia including Nosema heliothidis, and four novel microsporidia isolated from Pieris rapae, Phyllobrotica armta, Hemerophila atrilineata, and Bombyx mori, respectively, were obtained by PCR amplification, cloning, and sequencing. Two phylogenetic trees based on SSU rRNA sequences had been constructed by using Neighbor-Joining of Phylip software and UPGMA of MEGA4.0 software. The taxonomic status of four novel microsporidia was determined by analysis of phylogenetic relationship, length, G+C content, identity, and divergence of the SSU rRNA sequences. The results showed that the microsporidia isolated from Pieris rapae, Phyllobrotica armta, and Hemerophila atrilineata have close phylogenetic relationship with the Nosema, while another microsporidium isolated from Bombyx mori is closely related to the Endoreticulatus. So, we temporarily classify three novel species of microsporidia to genus Nosema, as Nosema sp. PR, Nosema sp. PA, Nosema sp. HA. Another is temporarily classified into genus Endoreticulatus, as Endoreticulatus sp. Zhenjiang. The result indicated as well that it is feasible and valuable to elucidate phylogenetic relationships and taxonomic status of microsporidian species by analyzing information from SSU rRNA sequences of microsporidia. PMID:19768503

  6. 30S Subunit-Dependent Activation of the Sorangium cellulosum So ce56 Aminoglycoside Resistance-Conferring 16S rRNA Methyltransferase Kmr

    PubMed Central

    Savic, Miloje; Sunita, S.; Zelinskaya, Natalia; Desai, Pooja M.; Macmaster, Rachel; Vinal, Kellie

    2015-01-01

    Methylation of bacterial 16S rRNA within the ribosomal decoding center confers exceptionally high resistance to aminoglycoside antibiotics. This resistance mechanism is exploited by aminoglycoside producers for self-protection while functionally equivalent methyltransferases have been acquired by human and animal pathogenic bacteria. Here, we report structural and functional analyses of the Sorangium cellulosum So ce56 aminoglycoside resistance-conferring methyltransferase Kmr. Our results demonstrate that Kmr is a 16S rRNA methyltransferase acting at residue A1408 to confer a canonical aminoglycoside resistance spectrum in Escherichia coli. Kmr possesses a class I methyltransferase core fold but with dramatic differences in the regions which augment this structure to confer substrate specificity in functionally related enzymes. Most strikingly, the region linking core β-strands 6 and 7, which forms part of the S-adenosyl-l-methionine (SAM) binding pocket and contributes to base flipping by the m1A1408 methyltransferase NpmA, is disordered in Kmr, correlating with an exceptionally weak affinity for SAM. Kmr is unexpectedly insensitive to substitutions of residues critical for activity of other 16S rRNA (A1408) methyltransferases and also to the effects of by-product inhibition by S-adenosylhomocysteine (SAH). Collectively, our results indicate that adoption of a catalytically competent Kmr conformation and binding of the obligatory cosubstrate SAM must be induced by interaction with the 30S subunit substrate. PMID:25733511

  7. Intraspecific and Interspecific Variation in 5s RNA Genes Are Decoupled in Diploid Wheat Relatives

    PubMed Central

    Kellogg, E. A.; Appels, R.

    1995-01-01

    5S RNAs form part of the ribosome in most organisms. In some, e.g., prokaryotes and some fungi, the genes are part of the ribosomal operon, but in most eukaryotes they are in tandem arrays of hundreds to thousands of copies separate from the main ribosomal array. 5S RNA genes can be aligned across kingdoms. We were therefore surprised to find that, for 28 diploid species of the wheat tribe (Triticeae), nucleotide diversity within an array is up to 6.2% in the genes, not significantly different from that of the nontranscribed spacers. Rates of concerted evolution must therefore be insufficient to homogenize the entire array. Between species, there are significantly fewer fixed differences in the gene than would be expected, given the high within-species variation. In contrast, the amount of variation between species in the spacer is the same as or greater than that within individuals. This leads to a paradox. High variation within an individual suggests that there is little selection on any particular gene within an array. But conservation of the gene across species implies that polymorphisms are periodically eliminated at a rate approximately equal to or greater than that of speciation. Levels of intraspecific polymorphism and interspecific divergence are thus decoupled. This implies that selective mechanisms exist to eliminate mutations in the gene without also affecting the spacer. PMID:7635297

  8. Magnetization reversal phenomena in (Cr0.70Ti0.30)5S6

    NASA Astrophysics Data System (ADS)

    Hashimoto, Satoshi; Matsuda, Yuji; Sato, Tetsuya; Anzai, Shuichiro

    2005-12-01

    Magnetization reversal phenomena (MRP) along magnetic order-order transitions have recently been reported on impurity-doped magnetic systems. Because imperfect long-range magnetic order exists in these systems, it is expected that a systematic investigation of MRP will give physical information on thermomagnetic processes of magnetic systems in the range from the micro- to nanoscales. As a typical order-order transition (a state doubly modulated by helical and canting orders to a collinear ferrimagnetic state) has been known to occur on Cr5S6 at a transition temperature Tt, we investigate the magnetizations of (Cr0.70Ti0.30)5S6 on heating and cooling runs in various magnetic fields. At 20Oe, the field-cooled magnetization just below the Curie temperature has a positive sign; the sign turns negative below the compensation temperature TCM (first step) and finally returns to positive below Tt (second step). The first-step MRP observed in this system is explained by the potential barriers resulting from anisotropy energy when the preferred direction of collinear ferrimagnetic moment reverses. The proposed mechanism for second-step MRP is the pinning effect caused by the impurity atoms (Ti) in the helical long-range-order chains. Comparing other examples of MRPs, we discuss the roles of local impurity centers in the thermomagnetic process in magnetic order-order transitions.

  9. Molecular phylogeny of pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences.

    PubMed

    Li, ZiHui; Feng, XianMin; Lu, SiQi; Zhang, Fan; Wang, FengYun; Huang, Song

    2008-05-01

    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis. PMID:18785590

  10. Homology of the 3' terminal sequences of the 18S rRNA of Bombyx mori and the 16S rRNA of Escherchia coli.

    PubMed Central

    Samols, D R; Hagenbuchle, O; Gage, L P

    1979-01-01

    The terminal 220 base pairs (bp) of the gene for 18S rRNA and 18 bp of the adjoining spacer rDNA of the silkworm Bombyx mori have been sequenced. Comparison with the sequence of the 16S rRNA gene of Escherichia coli has shown that a region including 45 bp of the B. mori sequence at the 3' end is remarkably homologous with the 3' terminal E. coli sequence. Other homologies occur in the terminal regions of the 18S and 16S rRNAs, including a perfectly conserved stretch of 13 bp within a longer homology located 150--200 bp from the 3' termini. These homologies are the most extensive so far reported between prokaryotic and eukaryotic genomic DNA. Images PMID:390496

  11. Chromosome mapping of 18S rDNA and 5S rDNA by dual-color fluorescence in situ hybridization in the half-smooth tongue sole (Cynoglossus semilaevis).

    PubMed

    Jiang, L; Jiang, J; Liu, J; Yuan, J; Chen, Y; Zhang, Q; Wang, X

    2014-01-01

    Half-smooth tongue sole (Cynoglossus semilaevis) is an important aquaculture flatfish in China. Cytogenetic analysis has revealed that its sex determination system is female heterogametic (ZZ/ZW). The W chromosome is morphologically larger and has been considered evolutionarily younger than any other chromosome in the set. However, the genetic origin and evolution process of this neo-chromosome remains unclear. In this study, 2 tandem arrays of rRNA genes were chosen to address this question. Both the major rDNA (18S rDNA) and the minor rDNA (5S rDNA) were located on the C. semilaevis chromosomes by fluorescence in situ hybridization (FISH). Six 18S rDNA signals were observed on the centromeric regions of 3 pairs of autosomes in both males and females. In females, there was an additional 18S rDNA signal mapping to the telomeric region of the W chromosome long arm. With respect to the 5S rDNA, 12 signals were mapped to the centromeric regions of six pairs of autosomes. Two-color FISH further confirmed that the two pairs of the 5S rDNA signals were correspondingly located at the same positions of the same autosomes as those of the 18S rDNA signals. These results allowed us to speculate about the evolution process of the W chromosome. Chromosome fusions and repetitive sequence accumulations might have occurred in C. semilaevis. The synteny and non-synteny of C. semilaevis 18S rDNA and 5S rDNA might imply the original and evolutionary characteristics of this species. These findings will facilitate studies on karyotype evolution of the order Pleuronectiformes. PMID:25526196

  12. Magnesium ions mediate contacts between phosphoryl oxygens at positions 2122 and 2176 of the 23S rRNA and ribosomal protein L1.

    PubMed Central

    Drygin, D; Zimmermann, R A

    2000-01-01

    The complex of ribosomal protein L1 with 23S rRNA from Escherichia coli is of great interest because of the unique structural and functional aspects of this ribonucleoprotein domain. We have minimized the binding site for protein L1 on the 23S rRNA to nt 2120-2129, 2159-2162, and 2167-2178. This RNA fragment consists of two helices as well as an interconnecting loop of unknown structure. RNA molecules corresponding to the minimized L1 binding site, in which G, A, U, or C were individually replaced by their deoxyribo- (dN) or alpha-thio- (rNaS) analogs have been synthesized by T7 transcription in vitro and analyzed for their ability to bind protein L1. It has been demonstrated that the substitution of rNaS at position 2122 or 2176 decreases the affinity of the RNA for the protein in the presence of magnesium five- to tenfold, whereas the same changes have little effect on binding in the presence of manganese. This suggests that Rp oxygens in the phosphates preceding positions 2122 and 2176 are coordinated with Mg2+ and may participate in L1-23S rRNA interaction via magnesium bridges. We have also shown that this interaction is impaired by the presence of dC at position 2122 coupled with the presence of deoxyribonucleotide(s) at other positions in the RNA. This study demonstrates that the ribose-phosphate backbone of the helix encompassing nt 2120-2124/2174-2178 is intimately involved in the interaction of protein L1 with the 23S rRNA. In particular, we suggest that this helix is positioned in the cleft between the two domains of protein L1. PMID:11142372

  13. The human 18S rRNA base methyltransferases DIMT1L and WBSCR22-TRMT112 but not rRNA modification are required for ribosome biogenesis

    PubMed Central

    Zorbas, Christiane; Nicolas, Emilien; Wacheul, Ludivine; Huvelle, Emmeline; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2015-01-01

    At the heart of the ribosome lie rRNAs, whose catalytic function in translation is subtly modulated by posttranscriptional modifications. In the small ribosomal subunit of budding yeast, on the 18S rRNA, two adjacent adenosines (A1781/A1782) are N6-dimethylated by Dim1 near the decoding site, and one guanosine (G1575) is N7-methylated by Bud23-Trm112 at a ridge between the P- and E-site tRNAs. Here we establish human DIMT1L and WBSCR22-TRMT112 as the functional homologues of yeast Dim1 and Bud23-Trm112. We report that these enzymes are required for distinct pre-rRNA processing reactions leading to synthesis of 18S rRNA, and we demonstrate that in human cells, as in budding yeast, ribosome biogenesis requires the presence of the modification enzyme rather than its RNA-modifying catalytic activity. We conclude that a quality control mechanism has been conserved from yeast to human by which binding of a methyltransferase to nascent pre-rRNAs is a prerequisite to processing, so that all cleaved RNAs are committed to faithful modification. We further report that 18S rRNA dimethylation is nuclear in human cells, in contrast to yeast, where it is cytoplasmic. Yeast and human ribosome biogenesis thus have both conserved and distinctive features. PMID:25851604

  14. Differential association of HMG1 and linker histones B4 and H1 with dinucleosomal DNA: structural transitions and transcriptional repression.

    PubMed Central

    Ura, K; Nightingale, K; Wolffe, A P

    1996-01-01

    We examined the structural and functional consequences of incorporating either histone H1, histone B4 or HMG1 into a synthetic dinucleosome containing two 5S rRNA genes. We found that all three proteins bind to linker DNA, stabilizing an additional 20 bp from micrococcal nuclease digestion and restrict nucleosome mobility. Histone H1 has the highest-affinity interaction with the dinucleosome; histone B4 and HMG1 associate with significantly reduced affinities. We found that histone H1 binds to the dinucleosome template with a dissociation constant (KD) of 7.4 nM, whereas the KD is 45 nM for histone B4 and 300 nM for HMG1. The KDs for the interaction of these proteins with naked DNA are 18 nM for H1, 80 nM for B4 and 300 nM for HMG1. The differences in association of these proteins with the dinucleosome are reflected in the efficiency with which the different proteins repress transcription from the 5S rRNA genes. Thus, although all three proteins can contribute to the organization of chromatin, the stability of the structures they assemble will vary. Our results provide a molecular explanation for the transcriptional promiscuity of Xenopus early embryonic chromatin, which is enriched in HMG1 and linker histone B4, but deficient in histone H1. Images PMID:8890169

  15. Diversity of host species and strains of Pneumocystis carinii is based on rRNA sequences.

    PubMed Central

    Shah, J S; Pieciak, W; Liu, J; Buharin, A; Lane, D J

    1996-01-01

    We have amplified by PCR Pneumocystis carinii cytoplasmic small-subunit rRNA (variously referred to as 16S-like or 18S-like rRNA) genes from DNA extracted from bronchoalveolar lavage and induced sputum specimens from patients positive for P. carinii and from infected ferret lung tissue. The amplification products were cloned into pUC18, and individual clones were sequenced. Comparison of the determined sequences with each other and with published rat and partial human P.carinii small-subunit rRNA gene sequences reveals that, although all P. carinii small-subunit rRNAs are closely related (approximately 96% identity), small-subunit rRNA genes isolated from different host species (human, rat, and ferret) exhibit distinctive patterns of sequence variation. Two types of sequences were isolated from the infected ferret lung tissue, one as a predominant species and the other as a minor species. There was 96% identity between the two types. In situ hybridization of the infected ferret lung tissue with oligonucleotide probes specific for each type revealed that there were two distinct strains of P. carinii present in the ferret lung tissue. Unlike the ferret P. carinii isolates, the small-subunit rRNA gene sequences from different human P. carinii isolates have greater than 99% identity and are distinct from all rat and ferret sequences so far inspected or reported in the literature. Southern blot hybridization analysis of PCR amplification products from several additional bronchoalveolar lavage or induced sputum specimens from P. carinii-infected patients, using a 32P-labeled oligonucleotide probe specific for human P. carinii, also suggests that all of the human P. carinii isolates are identical. These findings indicate that human P. carinii isolates may represent a distinct species of P. carinii distinguishable from rat and ferret P. carinii on the basis of characterization of small-subunit rRNA gene sequences. PMID:8770515

  16. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  17. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy.

    PubMed

    Wang, Qiong; Garrity, George M; Tiedje, James M; Cole, James R

    2007-08-01

    The Ribosomal Database Project (RDP) Classifier, a naïve Bayesian classifier, can rapidly and accurately classify bacterial 16S rRNA sequences into the new higher-order taxonomy proposed in Bergey's Taxonomic Outline of the Prokaryotes (2nd ed., release 5.0, Springer-Verlag, New York, NY, 2004). It provides taxonomic assignments from domain to genus, with confidence estimates for each assignment. The majority of classifications (98%) were of high estimated confidence (> or = 95%) and high accuracy (98%). In addition to being tested with the corpus of 5,014 type strain sequences from Bergey's outline, the RDP Classifier was tested with a corpus of 23,095 rRNA sequences as assigned by the NCBI into their alternative higher-order taxonomy. The results from leave-one-out testing on both corpora show that the overall accuracies at all levels of confidence for near-full-length and 400-base segments were 89% or above down to the genus level, and the majority of the classification errors appear to be due to anomalies in the current taxonomies. For shorter rRNA segments, such as those that might be generated by pyrosequencing, the error rate varied greatly over the length of the 16S rRNA gene, with segments around the V2 and V4 variable regions giving the lowest error rates. The RDP Classifier is suitable both for the analysis of single rRNA sequences and for the analysis of libraries of thousands of sequences. Another related tool, RDP Library Compare, was developed to facilitate microbial-community comparison based on 16S rRNA gene sequence libraries. It combines the RDP Classifier with a statistical test to flag taxa differentially represented between samples. The RDP Classifier and RDP Library Compare are available online at http://rdp.cme.msu.edu/. PMID:17586664

  18. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae

    PubMed Central

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-01-01

    Methylation of ribose sugars at the 2′-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2′-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5′ central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D′ box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  19. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae.

    PubMed

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-02-27

    Methylation of ribose sugars at the 2'-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2'-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5' central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D' box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  20. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    PubMed Central

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  1. 16S rRNA Phylogenetic Investigation of the Candidate Division “Korarchaeota”

    PubMed Central

    Auchtung, Thomas A.; Takacs-Vesbach, Cristina D.; Cavanaugh, Colleen M.

    2006-01-01

    The environmental distribution and phylogeny of “Korarchaeota,” a proposed ancient archaeal division, was investigated by using the 16S rRNA gene framework. Korarchaeota-specific primers were designed based on previously published sequences and used to screen a variety of environments. Korarchaeota 16S rRNA genes were amplified exclusively from high temperature Yellowstone National Park hot springs and a 9°N East Pacific Rise deep-sea hydrothermal vent. Phylogenetic analyses of these and all available sequences suggest that Korarchaeota exhibit a high level of endemicity. PMID:16820509

  2. Phylogeny of protostome worms derived from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade. PMID:7659019

  3. In situ hybridization of phytoplankton using fluorescently labeled rRNA probes.

    PubMed

    Groben, René; Medlin, Linda

    2005-01-01

    Phytoplankton are one of the major components of ecosystem processes and play an important role in many biogeochemical cycles in the marine and freshwater environment. Despite their importance, many microalgae are poorly described and little is known of broad spatial and temporal scale trends in their abundance and distribution. Reasons for this are that microalgae are often small, lack distinct morphological features, and are unculturable, which make analyses difficult. It is now possible by using molecular biological techniques to advance our knowledge of aquatic biodiversity and to understand how biodiversity supports ecosystem structure, dynamics, and resilience. We present in this chapter a brief review of the progress that has been made in analyzing microalgae from populations to the species level. The described methods range from DNA fingerprinting techniques, such as random amplified polymorphic DNA (RAPD), amplified fragment length polymorphisms (AFLPs), and simple sequence repeats (SSRs), to microsatellites, which are used in population studies, to sequence analysis, which help to reconstruct the evolutionary history of organisms and to examine relationships at various taxonomic levels. Special emphasis is given to the application of molecular probes for the identification and characterization of microalgal taxa. The fast and secure identification of phytoplankton, especially of toxic species, is important from an ecological and economical point of view and whole-cell hybridization with specific fluorochrome-labeled probes followed by fluorescence microscopy or flow cytometry offers a fast method for this purpose. In this context, we present a detailed protocol for fluorescence in situ hybridization (FISH) of ribosomal RNA (rRNA) probes that can be applied to many algal cell types and discuss practical considerations of its use. PMID:15865974

  4. Comparative sequence analyses of the genes coding for 16S rRNA of Lactobacillus casei-related taxa.

    PubMed

    Mori, K; Yamazaki, K; Ishiyama, T; Katsumata, M; Kobayashi, K; Kawai, Y; Inoue, N; Shinano, H

    1997-01-01

    The primary structures of the 16S rRNA genes of the type strains of Lactobacillus casei and related taxa were determined by PCR DNA-sequencing methods. The sequences of Lactobacillus casei, Lactobacillus zeae, Lactobacillus paracasei, and Lactobacillus rhamnosus were different. The Knuc values ranged from 0.0040 to 0.0126. On the basis of the Knuc values and the levels of DNA-DNA relatedness among the strains of these species, the L. casei-related taxa should be classified in the following three species: L. zeae, which includes the type strains of L. zeae and L. casei; a species that includes the strains of L. paracasei and L. casei ATCC 334; and L. rhamnosus. PMID:8995801

  5. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    SciTech Connect

    Vilkas, M J; Ishikawa, Y; Trabert, E

    2008-02-29

    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  6. Solution-Based Processing of the Phase-Change Material KSb5S8

    SciTech Connect

    Mitzi,D.; Raoux, S.; Schrott, A.; Copel, M.; Kellock, A.; Jordan-Sweet, J.

    2006-01-01

    A hydrazine-based process for solution-depositing phase-change materials (PCMs) is demonstrated, using KSb{sub 5}S{sub 8} (KSS) as an example. The process involves dissolving the elemental metals and chalcogen in hydrazine at room temperature and spin-coating the solution onto a substrate, followed by a short low-temperature (T {<=} 250 C) anneal. The spin-coated KSS films, which range in thickness from 10 to 90 nm, are examined using variable temperature X-ray diffraction, medium energy ion scattering (MEIS), Rutherford backscattering spectroscopy (RBS), and scanning electron microscopy (SEM). The spin-coated KSS films exhibit a reversible amorphous-crystalline transition with a relatively high crystallization temperature ({approx}280 C). Selected other chalcogenide-based PCMs are also expected to be suitable for thin-film deposition using this approach.

  7. Minimally Invasive Approach For Extraforaminal Synovial Cyst L5-S1

    PubMed Central

    Torres Campa-Santamarina, Jose; Towne, Sara; Alimi, Marjan; Härtl, Roger

    2015-01-01

    Symptoms from synovial cysts are produced by neural compression in the spinal canal or the foramen. Few cases of extraforaminal synovial cyst have been published in the literature. This is a case report of a 65-year-old female who presented with a three-month history of sciatic pain and no relief with conservative treatment. MRI showed a left-sided extraforaminal synovial cyst at L5-S1 with compression of the L5 nerve root at the lateral portion of the foramen. Minimally invasive surgery for resection was performed using an extraforaminal tubular microscopic endoscopy-assisted approach. The patient improved clinically and remained symptom-free for the entire follow-up of 30 months. PMID:26623217

  8. Magic wavelengths for the 5 s - 18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, Elizabeth; Norris, David; Koller, Silvio; Wyllie, Robert; Brown, Roger; Porto, Trey; Safronova, Ulyana; Safronova, Marianna

    2015-05-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s - 18 s transition of rubidium near the 18 s - 6 p resonances. We compare the calculation to experiment by measuring the light shift for atoms held in a crossed optical dipole trap with wavelength tuned around the 18 s - 6p3 / 2 resonance at the experimentally convenient wavelength of 1064 nm.

  9. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    PubMed Central

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  10. Chromosome-specific NOR inactivation explains selective rRNA gene silencing and dosage control in Arabidopsis

    PubMed Central

    Chandrasekhara, Chinmayi; Mohannath, Gireesha; Blevins, Todd; Pontvianne, Frederic; Pikaard, Craig S.

    2016-01-01

    In eukaryotes, scores of excess ribosomal RNA (rRNA) genes are silenced by repressive chromatin modifications. Given the near sequence identity of rRNA genes within a species, it is unclear how specific rRNA genes are reproducibly chosen for silencing. Using Arabidopsis thaliana ecotype (strain) Col-0, a systematic search identified sequence polymorphisms that differ between active and developmentally silenced rRNA gene subtypes. Recombinant inbred mapping populations derived from three different ecotype crosses were then used to map the chromosomal locations of silenced and active RNA gene subtypes. Importantly, silenced and active rRNA gene subtypes are not intermingled. All silenced rRNA gene subtypes mapped to the nucleolus organizer region (NOR) on chromosome 2 (NOR2). All active rRNA gene subtypes mapped to NOR4. Using an engineered A. thaliana line in which a portion of Col-0 chromosome 4 was replaced by sequences of another ecotype, we show that a major rRNA gene subtype silenced at NOR2 is active when introgressed into the genome at NOR4. Collectively, these results reveal that selective rRNA gene silencing is not regulated gene by gene based on mechanisms dependent on subtle gene sequence variation. Instead, we propose that a subchromosomal silencing mechanism operates on a multimegabase scale to inactivate NOR2. PMID:26744421

  11. RNomics in Archaea reveals a further link between splicing of archaeal introns and rRNA processing

    PubMed Central

    Tang, Thean Hock; Rozhdestvensky, Timofey S.; d’Orval, Béatrice Clouet; Bortolin, Marie-Line; Huber, Harald; Charpentier, Bruno; Branlant, Christiane; Bachellerie, Jean-Pierre; Brosius, Jürgen; Hüttenhofer, Alexander

    2002-01-01

    The bulge–helix–bulge (BHB) motif recognised by the archaeal splicing endonuclease is also found in the long processing stems of archaeal rRNA precursors in which it is cleaved to generate pre-16S and pre-23S rRNAs. We show that in two species, Archaeoglobus fulgidus and Sulfolobus solfataricus, representatives from the two major archaeal kingdoms Euryarchaeota and Crenarchaeota, respectively, the pre-rRNA spacers cleaved at the BHB motifs surrounding pre-16S and pre-23S rRNAs subsequently become ligated. In addition, we present evidence that this is accompanied by circularisation of ribosomal pre-16S and pre-23S rRNAs in both species. These data reveal a further link between intron splicing and pre-rRNA processing in Archaea, which might reflect a common evolutionary origin of the two processes. One spliced RNA species designated 16S-D RNA, resulting from religation at the BHB motif of 16S pre-rRNA, is a highly abundant and stable RNA which folds into a three-stem structure interrupted by two single-stranded regions as assessed by chemical probing. It spans a region of the pre-rRNA 5′ external transcribed spacer exhibiting a highly conserved folding pattern in Archaea. Surprisingly, 16S-D RNA contains structural motifs found in archaeal C/D box small RNAs and binds to the L7Ae protein, a core component of archaeal C/D box RNPs. This supports the notion that it might have an important but still unknown role in pre-rRNA biogenesis or might even target RNA molecules other than rRNA. PMID:11842103

  12. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells

    PubMed Central

    Cao, Weibiao

    2016-01-01

    Mechanisms of the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA. PMID:26901778

  13. Contrasting evolutionary patterns of 28S and ITS rRNA genes reveal high intragenomic variation in Cephalenchus (Nematoda): Implications for species delimitation.

    PubMed

    Pereira, Tiago José; Baldwin, James Gordon

    2016-05-01

    Concerted evolution is often assumed to be the evolutionary force driving multi-family genes, including those from ribosomal DNA (rDNA) repeat, to complete homogenization within a species, although cases of non-concerted evolution have been also documented. In this study, sequence variation of 28S and ITS ribosomal RNA (rRNA) genes in the genus Cephalenchus is assessed at three different levels, intragenomic, intraspecific, and interspecific. The findings suggest that not all Cephalenchus species undergo concerted evolution. High levels of intraspecific polymorphism, mostly due to intragenomic variation, are found in Cephalenchus sp1 (BRA-01). Secondary structure analyses of both rRNA genes and across different species show a similar substitution pattern, including mostly compensatory (CBC) and semi-compensatory (SBC) base changes, thus suggesting the functionality of these rRNA copies despite the variation found in some species. This view is also supported by low sequence variation in the 5.8S gene in relation to the flanking ITS-1 and ITS-2 as well as by the existence of conserved motifs in the former gene. It is suggested that potential cross-fertilization in some Cephalenchus species, based on inspection of female reproductive system, might contribute to both intragenomic and intraspecific polymorphism of their rRNA genes. These results reinforce the potential implications of intragenomic and intraspecific genetic diversity on species delimitation, especially in biodiversity studies based solely on metagenetic approaches. Knowledge of sequence variation will be crucial for accurate species diversity estimation using molecular methods. PMID:26926945

  14. Comparison of bacterial communities in the Solimões and Negro River tributaries of the Amazon River based on small subunit rRNA gene sequences.

    PubMed

    Peixoto, J C C; Leomil, L; Souza, J V; Peixoto, F B S; Astolfi-Filho, S

    2011-01-01

    The microbiota of the Amazon River basin has been little studied. We compared the structure of bacterial communities of the Solimões and Negro Rivers, the main Amazon River tributaries, based on analysis of 16S rRNA gene sequences. Water was sampled with a 3-L Van Dorn collection bottle; samples were collected at nine different points/depths totaling 27 L of water from each river. Total DNA was extracted from biomass retained by a 0.22-μm filter after sequential filtration of the water through 0.8- and 0.22-μm filters. The 16S rRNA gene was amplified by PCR, cloned and sequenced, and the sequences were analyzed with the PHYLIP and DOTUR programs to obtain the operational taxonomic units (OTUs) and to calculate the diversity and richness indices using the SPADE program. Taxonomic affiliation was determined using the naive Bayesian rRNA Classifier of the RDP II (Ribosomal Database Project). We recovered 158 sequences from the Solimões River grouped into 103 OTUs, and 197 sequences from the Negro River library grouped into 90 OTUs by the DOTUR program. The Solimões River was found to have a greater diversity of bacterial genera, and greater estimated richness of 446 OTUs, compared with 242 OTUs from the Negro River, as calculated by ACE estimator. The Negro River has less bacterial diversity, but more 16S rRNA gene sequences belonging to the bacterial genus Polynucleobacter were detected; 56 sequences from this genus were found (about 30% of the total sequences). We suggest that a more in-depth investigation be made to elucidate the role played by these bacteria in the river environment. These differences in bacterial diversity between Solimões and Negro Rivers could be explained by differences in organic matter content and pH of the rivers. PMID:22183948

  15. Nucleolus-like bodies of fully-grown mouse oocytes contain key nucleolar proteins but are impoverished for rRNA.

    PubMed

    Shishova, Kseniya V; Lavrentyeva, Elena A; Dobrucki, Jurek W; Zatsepina, Olga V

    2015-01-15

    It is well known that fully-grown mammalian oocytes, rather than typical nucleoli, contain prominent but structurally homogenous bodies called "nucleolus-like bodies" (NLBs). NLBs accumulate a vast amount of material, but their biochemical composition and functions remain uncertain. To clarify the composition of the NLB material in mouse GV oocytes, we devised an assay to detect internal oocyte proteins with fluorescein-5-isothiocyanate (FITC) and applied the fluorescent RNA-binding dye acridine orange to examine whether NLBs contain RNA. Our results unequivocally show that, similarly to typical nucleoli, proteins and RNA are major constituents of transcriptionally active (or non-surrounded) NLBs as well as of transcriptionally silent (or surrounded) NLBs. We also show, by exposing fixed oocytes to a mild proteinase K treatment, that the NLB mass in oocytes of both types contains nucleolar proteins that are involved in all major steps of ribosome biogenesis, including rDNA transcription (UBF), early rRNA processing (fibrillarin), and late rRNA processing (NPM1/nucleophosmin/B23, nucleolin/C23), but none of the nuclear proteins tested, including SC35, NOBOX, topoisomerase II beta, HP1α, and H3. The ribosomal RPL26 protein was detected within the NLBs of NSN-type oocytes but is virtually absent from NLBs of SN-type oocytes. Taking into account that the major class of nucleolar RNA is ribosomal RNA (rRNA), we applied fluorescence in situ hybridization with oligonucleotide probes targeting 18S and 28S rRNAs. The results show that, in contrast to active nucleoli, NLBs of fully-grown oocytes are impoverished for the rRNAs, which is consistent with the absence of transcribed ribosomal genes in the NLB mass. Overall, the results of this study suggest that NLBs of fully-grown mammalian oocytes serve for storing major nucleolar proteins but not rRNA. PMID:25481757

  16. Eukaryotic rRNA Modification by Yeast 5-Methylcytosine-Methyltransferases and Human Proliferation-Associated Antigen p120

    PubMed Central

    Gaspar, Imre; Aigueperse, Christelle; Schaefer, Matthias; Kellner, Stefanie; Helm, Mark; Motorin, Yuri

    2015-01-01

    Modified nucleotide 5-methylcytosine (m5C) is frequently present in various eukaryotic RNAs, including tRNAs, rRNAs and in other non-coding RNAs, as well as in mRNAs. RNA:m5C-methyltranferases (MTases) Nop2 from S. cerevisiae and human proliferation-associated nucleolar antigen p120 are both members of a protein family called Nop2/NSUN/NOL1. Protein p120 is well-known as a tumor marker which is over-expressed in various cancer tissues. Using a combination of RNA bisulfite sequencing and HPLC-MS/MS analysis, we demonstrated here that p120 displays an RNA:m5C- MTase activity, which restores m5C formation at position 2870 in domain V of 25S rRNA in a nop2Δ yeast strain. We also confirm that yeast proteins Nop2p and Rcm1p catalyze the formation of m5C in domains V and IV, respectively. In addition, we do not find any evidence of m5C residues in yeast 18S rRNA. We also performed functional complementation of Nop2-deficient yeasts by human p120 and studied the importance of different sequence and structural domains of Nop2 and p120 for yeast growth and m5C-MTase activity. Chimeric protein formed by Nop2 and p120 fragments revealed the importance of Nop2 N-terminal domain for correct protein localization and its cellular function. We also validated that the presence of Nop2, rather than the m5C modification in rRNA itself, is required for pre-rRNA processing. Our results corroborate that Nop2 belongs to the large family of pre-ribosomal proteins and possesses two related functions in pre-rRNA processing: as an essential factor for cleavages and m5C:RNA:modification. These results support the notion of quality control during ribosome synthesis by such modification enzymes. PMID:26196125

  17. Molecular Diagnosis of Actinomadura madurae Infection by 16S rRNA Deep Sequencing

    PubMed Central

    SenGupta, Dhruba J.; Hoogestraat, Daniel R.; Cummings, Lisa A.; Bryant, Bronwyn H.; Natividad, Catherine; Thielges, Stephanie; Monsaas, Peter W.; Chau, Mimosa; Barbee, Lindley A.; Rosenthal, Christopher; Cookson, Brad T.; Hoffman, Noah G.

    2013-01-01

    Next-generation DNA sequencing can be used to catalog individual organisms within complex, polymicrobial specimens. Here, we utilized deep sequencing of 16S rRNA to implicate Actinomadura madurae as the cause of mycetoma in a diabetic patient when culture and conventional molecular methods were overwhelmed by overgrowth of other organisms. PMID:24108607

  18. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples. PMID:25343859

  19. Ribosomal Database Project: data and tools for high throughput rRNA analysis

    PubMed Central

    Cole, James R.; Wang, Qiong; Fish, Jordan A.; Chai, Benli; McGarrell, Donna M.; Sun, Yanni; Brown, C. Titus; Porras-Alfaro, Andrea; Kuske, Cheryl R.; Tiedje, James M.

    2014-01-01

    Ribosomal Database Project (RDP; http://rdp.cme.msu.edu/) provides the research community with aligned and annotated rRNA gene sequence data, along with tools to allow researchers to analyze their own rRNA gene sequences in the RDP framework. RDP data and tools are utilized in fields as diverse as human health, microbial ecology, environmental microbiology, nucleic acid chemistry, taxonomy and phylogenetics. In addition to aligned and annotated collections of bacterial and archaeal small subunit rRNA genes, RDP now includes a collection of fungal large subunit rRNA genes. RDP tools, including Classifier and Aligner, have been updated to work with this new fungal collection. The use of high-throughput sequencing to characterize environmental microbial populations has exploded in the past several years, and as sequence technologies have improved, the sizes of environmental datasets have increased. With release 11, RDP is providing an expanded set of tools to facilitate analysis of high-throughput data, including both single-stranded and paired-end reads. In addition, most tools are now available as open source packages for download and local use by researchers with high-volume needs or who would like to develop custom analysis pipelines. PMID:24288368

  20. Unequal Crossing over at the Rrna Tandon as a Source of Quantitative Genetic Variation in Drosophila

    PubMed Central

    Frankham, R.; Briscoe, D. A.; Nurthen, R. K.

    1980-01-01

    Abdominal bristle selection lines (three high and three low) and controls were founded from a marked homozygous line to measure the contribution of sex-linked "mutations" to selection response. Two of the low lines exhibited a period of rapid response to selection in females, but not in males. There were corresponding changes in female variance, in heritabilities in females, in the sex ratio (a deficiency of females) and in fitness, as well as the appearance of a mutant phenotype in females of one line. All of these changes were due to bb alleles (partial deficiencies for the rRNA tandon) in the X chromosomes of these lines, while the Y chromosomes remained wild-type bb+. We argue that the bb alleles arose by unequal crossing over in the rRNA tandon.—A prediction of this hypothesis is that further changes can occur in the rRNA tandon as selection is continued. This has now been shown to occur.—Our minimum estimate of the rate of occurrence of changes at the rRNA tandon is 3 x 10-4. As this is substantially higher than conventional mutation rates, the questions of the mechanisms and rates of origin of new quantitative genetic variation require careful re-examination. PMID:7439683

  1. 16S rRNA region based PCR protocol for identification and subtyping of Parvimonas micra

    PubMed Central

    Ota-Tsuzuki, C.; Brunheira, A.T.P.; Mayer, M.P.A.

    2008-01-01

    The present study established a PCR protocol in order to identify Parvimonas micra and to evaluate the intra-species diversity by PCR-RFLP of 16S rRNA partial sequence. The data indicated that the protocol was able to identify this species which could be clustered in five genotypes. PMID:24031274

  2. A Pol V–Mediated Silencing, Independent of RNA–Directed DNA Methylation, Applies to 5S rDNA

    PubMed Central

    Douet, Julien; Tutois, Sylvie; Tourmente, Sylvette

    2009-01-01

    The plant-specific RNA polymerases Pol IV and Pol V are essential to RNA–directed DNA methylation (RdDM), which also requires activities from RDR2 (RNA–Dependent RNA Polymerase 2), DCL3 (Dicer-Like 3), AGO4 (Argonaute), and DRM2 (Domains Rearranged Methyltransferase 2). RdDM is dedicated to the methylation of target sequences which include transposable elements, regulatory regions of several protein-coding genes, and 5S rRNA–encoding DNA (rDNA) arrays. In this paper, we have studied the expression of the 5S-210 transcript, a marker of silencing release at 5S RNA genes, to show a differential impact of RNA polymerases IV and V on 5S rDNA arrays during early development of the plant. Using a combination of molecular and cytological assays, we show that Pol IV, RDR2, DRM2, and Pol V, actors of the RdDM, are required to maintain a transcriptional silencing of 5S RNA genes at chromosomes 4 and 5. Moreover, we have shown a derepression associated to chromatin decondensation specific to the 5S array from chromosome 4 and restricted to the Pol V–loss of function. In conclusion, our results highlight a new role for Pol V on 5S rDNA, which is RdDM–independent and comes specifically at chromosome 4, in addition to the RdDM pathway. PMID:19834541

  3. Analysis of 5S rDNA arrays in Arabidopsis thaliana: physical mapping and chromosome-specific polymorphisms.

    PubMed

    Cloix, C; Tutois, S; Mathieu, O; Cuvillier, C; Espagnol, M C; Picard, G; Tourmente, S

    2000-05-01

    A physical map of a pericentromeric region of chromosome 5 containing a 5S rDNA locus and spanning approximately 1000 kb was established using the CIC YAC clones. Three 5S rDNA arrays were resolved in this YAC contig by PFGE analysis and we have mapped different types of sequences between these three blocks. 5S rDNA units from each of these three arrays of chromosome 5, and from chromosomes 3 and 4, were isolated by PCR. A total of 38 new DNA sequences were obtained. Two types of 5S rDNA repeated units exist: the major variant with 0.5-kb repeats and one with short repeats (251 bp) only detected on YAC 11A3 from chromosome 3. Although the 38 sequences displayed noticeable heterogeneity, we were able to group them according to their 5S array origin. The presence of 5S array-specific variants was confirmed with the restriction polymorphism study of all the YACs carrying 5S units. PMID:10810091

  4. The nature of Z_b states from a combined analysis of Upsilon (5S)rightarrow h_b(mP) π ^+ π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π

    NASA Astrophysics Data System (ADS)

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-03-01

    With a combined analysis of data on Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π in an effective field theory approach, we determine resonance parameters of Z_b states in two scenarios. In one scenario we assume that Z_b states are pure molecular states, while in the other one we assume that Z_b states contain compact components. We find that the present data favor that there should be some compact components inside Z_b^{(' )} associated with the molecular components. By fitting the invariant mass spectra of Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{*}π , we determine that the probability of finding the compact components in Z_b states may be as large as about 40 %.

  5. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress.

    PubMed

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L J

    2016-01-01

    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucleolar morphology. Remarkably, we find that uL5 (formerly RPL11) and uL18 (RPL5) are the strongest contributors to nucleolar integrity. Together with the 5S rRNA, they form the late-assembling central protuberance on mature 60S subunits, and act as an Hdm2 trap and p53 stabilizer. Other major contributors to p53 homeostasis are also strictly late-assembling large subunit r-proteins essential to nucleolar structure. The identification of the r-proteins that specifically contribute to maintaining nucleolar structure and p53 steady-state level provides insights into fundamental aspects of cell and cancer biology. PMID:27265389

  6. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress

    PubMed Central

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L. J.

    2016-01-01

    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucleolar morphology. Remarkably, we find that uL5 (formerly RPL11) and uL18 (RPL5) are the strongest contributors to nucleolar integrity. Together with the 5S rRNA, they form the late-assembling central protuberance on mature 60S subunits, and act as an Hdm2 trap and p53 stabilizer. Other major contributors to p53 homeostasis are also strictly late-assembling large subunit r-proteins essential to nucleolar structure. The identification of the r-proteins that specifically contribute to maintaining nucleolar structure and p53 steady-state level provides insights into fundamental aspects of cell and cancer biology. PMID:27265389

  7. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing.

    PubMed Central

    Schmidt, T M; DeLong, E F; Pace, N R

    1991-01-01

    The phylogenetic diversity of an oligotrophic marine picoplankton community was examined by analyzing the sequences of cloned ribosomal genes. This strategy does not rely on cultivation of the resident microorganisms. Bulk genomic DNA was isolated from picoplankton collected in the north central Pacific Ocean by tangential flow filtration. The mixed-population DNA was fragmented, size fractionated, and cloned into bacteriophage lambda. Thirty-eight clones containing 16S rRNA genes were identified in a screen of 3.2 x 10(4) recombinant phage, and portions of the rRNA gene were amplified by polymerase chain reaction and sequenced. The resulting sequences were used to establish the identities of the picoplankton by comparison with an established data base of rRNA sequences. Fifteen unique eubacterial sequences were obtained, including four from cyanobacteria and eleven from proteobacteria. A single eucaryote related to dinoflagellates was identified; no archaebacterial sequences were detected. The cyanobacterial sequences are all closely related to sequences from cultivated marine Synechococcus strains and with cyanobacterial sequences obtained from the Atlantic Ocean (Sargasso Sea). Several sequences were related to common marine isolates of the gamma subdivision of proteobacteria. In addition to sequences closely related to those of described bacteria, sequences were obtained from two phylogenetic groups of organisms that are not closely related to any known rRNA sequences from cultivated organisms. Both of these novel phylogenetic clusters are proteobacteria, one group within the alpha subdivision and the other distinct from known proteobacterial subdivisions. The rRNA sequences of the alpha-related group are nearly identical to those of some Sargasso Sea picoplankton, suggesting a global distribution of these organisms. Images PMID:2066334

  8. Origin and evolution of organisms as deduced from 5S ribosomal RNA sequences.

    PubMed

    Hori, H; Osawa, S

    1987-09-01

    A phylogenetic tree of most of the major groups of organisms has been constructed from the 352 5S ribosomal RNA sequences now available. The tree suggests that there are several major groups of eubacteria that diverged during the early stages of their evolution. Metabacteria (= archaebacteria) and eukaryotes separated after the emergence of eubacteria. Among eukaryotes, red algae emerged first; and, later, thraustochytrids (a Proctista group), ascomycetes (yeast), green plants (green algae and land plants), "yellow algae" (brown algae, diatoms, and chrysophyte algae), basidiomycetes (mushrooms and rusts), slime- and water molds, various protozoans, and animals emerged, approximately in that order. Three major types of photosynthetic eukaryotes--i.e., red algae (= Chlorophyll a group), green plants (Chl. a + b group) and yellow algae (Chl. a + c)--are remotely related to one another. Other photosynthetic unicellular protozoans--such as Cyanophora (Chl. a), Euglenophyta (Chl. a + b), Cryptophyta (Chl. a + c), and Dinophyta (Chl. a + c)--seem to have separated shortly after the emergence of the yellow algae. PMID:2452957

  9. Hard X-ray XAFS beamline, BL5S1, at AichiSR

    NASA Astrophysics Data System (ADS)

    Tabuchi, M.; Asakura, H.; Morimoto, H.; Watanabe, N.; Takeda, Y.

    2016-05-01

    A XAFS beamline, BL5S1, had been operated at Aichi Synchrotron Radiation Center, Japan since March 2013. The beamline was designed for the measurements in the energy range from 5 to 20 keV. The photon flux of 6 x 1010 at around 9 keV and beam spot size of 0.5 x 0.3 mm at sample position are as good as designed. For the standard transmission XAFS measurement, both of the step- and quick- scan modes are available. Energy resolution at around 9keV is good enough to discuss the energy shift of the order of 0.1 eV or higher even when the measurements are conducted in the quick-scan mode. With several kinds of detectors for fluorescence and/or CEY detection mode measurements, and various kinds of sample holders which are supported by the XAFS measurement software, users easily obtain spectra for their samples. Such a standard, well operated and easy to access XAFS beamline must be very important to broaden the base of the XAFS society further.

  10. Design and performance of a 1 MW-5 s high temperature superconductor magnetic energy storage system

    NASA Astrophysics Data System (ADS)

    Morandi, Antonio; Gholizad, Babak; Fabbri, Massimo

    2016-01-01

    The feasibility of a 1 MW-5 s superconducting magnetic energy storage (SMES) system based on state-of-the-art high-temperature superconductor (HTS) materials is investigated in detail. Both YBCO coated conductors and MgB2 are considered. A procedure for the electromagnetic design of the coil is introduced and the final layout is arrived at and compared for the two materials. The choice of the inductance of the coil is carried out as part of the design procedure. Both low-field (3 T) and high-field (8 T) designs are considered for the YBCO. AC losses during a complete charge/discharge cycle at full power are estimated and the cooling power needed for continuous operation is derived. The power conditioning system and control algorithms needed to carry out various operations are discussed in detail. Performances of the SMES system during voltage sag compensation, load leveling and power factor correction are investigated by means of numerical simulation.

  11. 16S rRNA genes reveal stratified open ocean bacterioplankton populations related to the Green Non-Sulfur bacteria.

    PubMed Central

    Giovannoni, S J; Rappé, M S; Vergin, K L; Adair, N L

    1996-01-01

    Microorganisms play an important role in the biogeochemistry of the ocean surface layer, but spatial and temporal structures in the distributions of specific bacterioplankton species are largely unexplored, with the exceptions of those organisms that can be detected by either autofluorescence or culture methods. The use of rRNA genes as genetic markers provides a tool by which patterns in the growth, distribution, and activity of abundant bacterioplankton species can be studied regardless of the ease with which they can be cultured. Here we report an unusual cluster of related 16S rRNA genes (SAR202, SAR263, SAR279, SAR287, SAR293, SAR307) cloned from seawater collected at 250 m in the Sargasso Sea in August 1991, when the water column was highly stratified and the deep chlorophyll maximum was located at a depth of 120 m. Phylogenetic analysis and an unusual 15-bp deletion confirmed that the genes were related to the Green Non-Sulfur phylum of the domain Bacteria. This is the first evidence that representatives of this phylum occur in the open ocean. Oligonucleotide probes were used to examine the distribution of the SAR202 gene cluster in vertical profiles (0-250 m) from the Atlantic and Pacific Oceans, and in discrete (monthly) time series (O and 200 m) (over 30 consecutive months in the Western Sargasso Sea. The data provide robust statistical support for the conclusion that the SAR202 gene cluster is proportionately most abundant at the lower boundary of the deep chlorophyll maximum (P = 2.33 x 10(-5)). These results suggest that previously unsuspected stratification of microbial populations may be a significant factor in the ecology of the ocean surface layer. Images Fig. 4 PMID:8755588

  12. Rhizobium sp. strain BN4 (a selenium oxyanion-reducing bacterium) 16S rRNA gene complete sequence

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1482 base pair 16S rRNA gene sequence methods in conjunction with other biochemical and morphological studies to confirm the identification of a bacterium (refer to as the BN4 strain) as a Rhizobium sp. The 16S rRNA gene sequence places it with the Rhizobium clade that includes R. d...

  13. Nucleolin is required for DNA methylation state and the expression of rRNA gene variants in Arabidopsis thaliana.

    PubMed

    Pontvianne, Frédéric; Abou-Ellail, Mohamed; Douet, Julien; Comella, Pascale; Matia, Isabel; Chandrasekhara, Chinmayi; Debures, Anne; Blevins, Todd; Cooke, Richard; Medina, Francisco J; Tourmente, Sylvette; Pikaard, Craig S; Sáez-Vásquez, Julio

    2010-11-01

    In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1). Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre-rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis. PMID:21124873

  14. Nucleolin Is Required for DNA Methylation State and the Expression of rRNA Gene Variants in Arabidopsis thaliana

    PubMed Central

    Pontvianne, Frédéric; Abou-Ellail, Mohamed; Douet, Julien; Comella, Pascale; Matia, Isabel; Chandrasekhara, Chinmayi; DeBures, Anne; Blevins, Todd; Cooke, Richard; Medina, Francisco J.; Tourmente, Sylvette; Pikaard, Craig S.; Sáez-Vásquez, Julio

    2010-01-01

    In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1). Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre–rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis. PMID:21124873

  15. Experimental investigation of the effect of indium content on the CuIn{sub 5}S{sub 8} electrodes using electrochemical impedance spectroscopy

    SciTech Connect

    Gannouni, M. Assaker, I. Ben; Chtourou, R.

    2015-01-15

    This paper reports on the use of electrochemical impedance spectroscopy to investigate the electrochemical behavior of spinel CuIn{sub 5}S{sub 8}/electrolyte interface. The CuIn{sub 5}S{sub 8} spinel films have been potentiostatically deposited onto indium tin oxide (ITO)-coated glass substrate. CuCl{sub 2} and InCl{sub 3} mixed solutions with different [Cu]/[In] ratios were used as cation precursor and Na{sub 2}S{sub 2}O{sub 3} as the anion precursor in acidic solution and at room temperature. The effect of the [Cu]/[In] ratio in the precursor solution on the structural, chemical stoichiometry, and morphological properties of prepared samples, as well as the electrochemical behavior of the CuIn{sub 5}S{sub 8}/electrolyte interface was investigated. The electrochemical impedance spectroscopy data have been modeled using an equivalent circuit approach. Several parameters such as, flat-band potential and free carrier concentration were determined by the change in the Mott–Schottky plots.

  16. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus. PMID:26959315

  17. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus.

    PubMed

    Caradonna, Fabio; Bellavia, Daniele; Clemente, Ann Maria; Sisino, Giorgia; Barbieri, Rainer

    2007-09-01

    In this paper the chromosomal localization and molecular cloning and characterization of three 5S rDNA clusters of 700 bp (base pairs), 900 bp, and 950 bp in the sea urchin Paracentrotus lividus are reported. Southern blot hybridization demonstrated the existence of three 5S rDNA repeats of differing length in the P. lividus genome. Fluorescence in situ hybridization analysis, performed in parallel on both haploid and diploid metaphases and interphase nuclei using different 5S rDNA units as probes, localized these 5S rDNA clusters in 3 different pairs of P. lividus chromosomes. This is the first complete gene mapping not only in a sea urchin but also in the phylum of echinoderms as a whole. PMID:17893727

  18. Guanine nucleotide metabolism in a mutant strain of Escherichia coli with a temperature sensitive lesion in rRNA synthesis.

    PubMed

    Harris, J S; Chaney, S G

    1978-12-21

    We have described a mutant of Escherichia coli (designated 2S142) which shows specific inhibition of rRNA synthesis at 42 degrees C. ppGpp levels increase at the restrictive temperature, as expected. However, when the cells are returned to 30 degrees C, rRNA synthesis resumes before ppGpp levels have returned to normal. Furthermore, when ppGpp levels are decreased by the addition of tetracycline or choramphenicol, rRNA synthesis does not resume at 42 degrees C. Also, a derivative of 2S142 with a temperature-sensitive G factor (which cannot synthesize either protein or ppGpp at 42 degrees C) shows identical kinetics of rRNA shut-off at 42 degrees C as 2S142. Thus, the elevated ppGpp levels in this mutant do not appear to be directly responsible for the cessation of rRNA synthesis at 42 degrees C. PMID:367439

  19. Conformation of 4.5S RNA in the signal recognition particle and on the 30S ribosomal subunit

    PubMed Central

    GU, SHAN-QING; JÖCKEL, JOHANNES; BEINKER, PHILIPP; WARNECKE, JENS; SEMENKOV, YURI P.; RODNINA, MARINA V.; WINTERMEYER, WOLFGANG

    2005-01-01

    The signal recognition particle (SRP) from Escherichia coli consists of 4.5S RNA and protein Ffh. It is essential for targeting ribosomes that are translating integral membrane proteins to the translocation pore in the plasma membrane. Independently of Ffh, 4.5S RNA also interacts with elongation factor G (EF-G) and the 30S ribosomal subunit. Here we use a cross-linking approach to probe the conformation of 4.5S RNA in SRP and in the complex with the 30S ribosomal subunit and to map the binding site. The UV-activatable cross-linker p-azidophenacyl bromide (AzP) was attached to positions 1, 21, and 54 of wild-type or modified 4.5S RNA. In SRP, cross-links to Ffh were formed from AzP in all three positions in 4.5S RNA, indicating a strongly bent conformation in which the 5′ end (position 1) and the tetraloop region (including position 54) of the molecule are close to one another and to Ffh. In ribosomal complexes of 4.5S RNA, AzP in both positions 1 and 54 formed cross-links to the 30S ribosomal subunit, independently of the presence of Ffh. The major cross-linking target on the ribosome was protein S7; minor cross-links were formed to S2, S18, and S21. There were no cross-links from 4.5S RNA to the 50S subunit, where the primary binding site of SRP is located close to the peptide exit. The functional role of 4.5S RNA binding to the 30S subunit is unclear, as the RNA had no effect on translation or tRNA translocation on the ribosome. PMID:16043501

  20. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene.

    PubMed

    Coêlho, Mariza M; Ferreira-Nozawa, Monica S; Nozawa, Sérgio R; Santos, André L W

    2011-10-01

    Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla), were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species. PMID:22215973

  1. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene

    PubMed Central

    Coêlho, Mariza M.; Ferreira-Nozawa, Monica S.; Nozawa, Sérgio R.; Santos, André L.W.

    2011-01-01

    Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla), were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species. PMID:22215973

  2. Evidence for 5S rDNA Horizontal Transfer in the toadfish Halobatrachus didactylus (Schneider, 1801) based on the analysis of three multigene families

    PubMed Central

    2012-01-01

    Background The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH). Results Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS) sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. Conclusions A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not in the Pleuronectiformes

  3. Materials Data on K(V5S8)3 (SG:2) by Materials Project

    DOE Data Explorer

    Kristin Persson

    2016-02-10

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  4. Materials Data on K(V5S8)2 (SG:13) by Materials Project

    DOE Data Explorer

    Kristin Persson

    2015-01-21

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  5. Materials Data on TlV5S8 (SG:5) by Materials Project

    DOE Data Explorer

    Kristin Persson

    2016-02-10

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  6. Materials Data on Y5S7 (SG:12) by Materials Project

    DOE Data Explorer

    Kristin Persson

    2014-11-02

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  7. Materials Data on NaCe5S8 (SG:82) by Materials Project

    SciTech Connect

    Kristin Persson

    2014-07-09

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  8. Materials Data on KCe5S8 (SG:82) by Materials Project

    SciTech Connect

    Kristin Persson

    2014-07-09

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  9. Materials Data on KSb5S8 (SG:7) by Materials Project

    SciTech Connect

    Kristin Persson

    2014-11-02

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  10. Materials Data on RbAg5S3 (SG:190) by Materials Project

    SciTech Connect

    Kristin Persson

    2014-11-02

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  11. Materials Data on TlAs5S8 (SG:14) by Materials Project

    SciTech Connect

    Kristin Persson

    2014-11-02

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  12. Materials Data on Nd6Nb5S16 (SG:38) by Materials Project

    SciTech Connect

    Kristin Persson

    2014-07-09

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  13. Materials Data on CsCu5S3 (SG:51) by Materials Project

    DOE Data Explorer

    Kristin Persson

    2014-07-09

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  14. Materials Data on AgH5S2O9 (SG:14) by Materials Project

    DOE Data Explorer

    Kristin Persson

    2016-02-05

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  15. Materials Data on Tb3In5S12 (SG:11) by Materials Project

    SciTech Connect

    Kristin Persson

    2014-11-02

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  16. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment.

    PubMed

    Kwasniewska, Jolanta; Jaskowiak, Joanna

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  17. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment

    PubMed Central

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  18. Rapid identification of Renibacterium salmoninarum using an oligonucleotide probe complementary to 16S rRNA.

    PubMed

    Mattsson, J G; Gersdorf, H; Jansson, E; Hongslo, T; Göbel, U B; Johansson, K E

    1993-02-01

    Bacterial kidney disease in salmonid fish is caused by the slow-growing Gram-positive rod, Renibacterium salmoninarum. The partial sequence of 16S rRNA from R. salmoninarum was determined and compared with published bacterial 16S rRNA sequences. From this sequence information, a 30-bases-long oligonucleotide was designed and used as a specific probe for identification of R. salmoninarum in filter hybridization experiments. Strong specific hybridization signals were observed for all strains of R. salmoninarum tested. Furthermore, no cross-hybridization could be seen against 22 other bacterial species, among them other salmonid fish pathogens. The detection limit for the probe in direct filter hybridization by the dot-blot technique was 2.5 x 10(4) bacteria. It was also possible to detect R. salmoninarum in clinical samples by direct filter hybridization. PMID:8455640

  19. Molecular systematics of hystricognath rodents: evidence from the mitochondrial 12S rRNA gene.

    PubMed

    Nedbal, M A; Allard, M W; Honeycutt, R L

    1994-09-01

    Nucleotide sequence variation among 22 representatives of 14 families of hystricognathid rodents was examined using an 814-bp region of the mitochondrial 12S ribosomal RNA (rRNA) gene composing domains I-III. The purpose of this study was twofold. First, the phylogenetic relationships among Old World phiomorph (primarily African) and New World caviomorph (primarily South American) families were investigated, with a special emphasis on testing hypotheses pertaining to the origin of New World families and the identification of major monophyletic groups. Second, divergence times derived from molecular data were compared to those suggested by the fossil record. The resultant 12S rRNA gene phylogeny, analyzed separately and in combination with other morphological and molecular data, supported a monophyletic Caviomorpha. This finding is counter to the idea of a multiple origin for the South American families. The most strongly supported relationships within the Caviomorpha were a monophyletic Octodontoidea (containing five families) and the placement of New World porcupines (family Erethizontidae) as the most divergent family. Although comparisons to other data were more equivocal, the most parsimonious 12S rRNA trees also supported a monophyletic Phiomorpha that could be subdivided into two major groups, a clade containing the Thryonomyoidea (Thryonomyidae and Petromuridae) plus Bathyergidae and the more divergent Hystricidae (Old World porcupines). No significant differences in rates of 12S rRNA gene divergence were observed for hystricognathids in comparison to other rodent groups. Although time since divergence estimates were influenced by the fossil dates chosen to calibrate absolute rates, the overall divergence times derived from both transversions only and Kimura corrected distances and calibrations using two independent dates revealed a divergence time between Old and New World groups dating in the Eocene. PMID:7820285

  20. Application of 12S rRNA gene for the identification of animal-derived drugs.

    PubMed

    Luo, Jiaoyang; Yan, Dan; Zhang, Da; Han, Yumei; Dong, Xiaoping; Yang, Yong; Deng, Kejun; Xiao, Xiaohe

    2011-01-01

    PURPOSE. Animal-derived drugs are the major source of biological products and traditional medicine, but they are often difficult to identify, causing confusion in the clinical application. Among these medicinal animals, a number of animal species are endangered, leading to the destruction of biodiversity. The identification of animal-derived drugs and their alternatives would be a first step toward biodiversity conservation and safe medication. Until now, no effective method for identifying animal-derived drugs has been demonstrated; DNA-based species identification presents a brand-new technique. METHODS. We designed primers to amplify a 523-bp fragment of 12S rRNA and generated sequences for 13 individuals within six medicinal animal species. We examined the efficiency of species recognition based on this sequence, and we also tested the taxonomic affiliations against the GenBank database. RESULTS. All the tested drugs were identified successfully, and a visible gap was found between the inter-specific and intra-specific variation. We further demonstrated the importance of data exploration in DNA-based species identification practice by examining the sequence characteristics of relative genera in GenBank. This region of the 12S rRNA gene had a 100% success rate of species recognition within the six medicinal animal species. CONCLUSIONS. We propose that the 12S rRNA locus might be universal for identifying animal-derived drugs and their adulterants. The development of 12S rRNA for indentifying animal-derived drugs that share a common gene target would contribute significantly to the clinical application of animal-derived drugs and the conservation of medicinal animal species. This article is open to POST-PUBLICATION REVIEW. Registered readers (see "For Readers") may comment by clicking on ABSTRACT on the issue's contents page. PMID:21906480

  1. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    SciTech Connect

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  2. Characterization of the genus Bifidobacterium by automated ribotyping and 16S rRNA gene sequences.

    PubMed

    Sakata, Shinji; Ryu, Chun Sun; Kitahara, Maki; Sakamoto, Mitsuo; Hayashi, Hidenori; Fukuyama, Masafumi; Benno, Yoshimi

    2006-01-01

    In order to characterize the genus Bifidobacterium, ribopatterns and approximately 500 bp (Escherichia coli positions 27 to 520) of 16S rRNA gene sequences of 28 type strains and 64 reference strains of the genus Bifidobacterium were determined. Ribopatterns obtained from Bifidobacterium strains were divided into nine clusters (clusters I-IX) with a similarity of 60%. Cluster V, containing 17 species, was further subdivided into 22 subclusters with a similarity of 90%. In the genus Bifidobacterium, four groups were shown according to Miyake et al.: (i) the Bifidobacterium longum infantis-longum-suis type group, (ii) the B. catenulatum-pseudocatenulatum group, (iii) the B. gallinarum-saeculare-pullorum group, and (iv) the B. coryneforme-indicum group, which showed higher than 97% similarity of the 16S rRNA gene sequences in each group. Using ribotyping analysis, unique ribopatterns were obtained from these species, and they could be separated by cluster analysis. Ribopatterns of six B. adolescentis strains were separated into different clusters, and also showed diversity in 16S rRNA gene sequences. B. adolescentis consisted of heterogeneous strains. The nine strains of B. pseudolongum subsp. pseudolongum were divided into five subclusters. Each type strain of B. pseudolongum subsp. pseudolongum and B. pseudolongum subsp. globosum and two intermediate groups, which were suggested by Yaeshima et al., consisted of individual clusters. B. animalis subsp. animalis and B. animalis subsp. lactis could not be separated by ribotyping using Eco RI. We conclude that ribotyping is able to provide another characteristic of Bifidobacterium strains in addition to 16S rRNA gene sequence phylogenetic analysis, and this information suggests that ribotyping analysis is a useful tool for the characterization of Bifidobacterium species in combination with other techniques for taxonomic characterization. PMID:16428867

  3. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    PubMed Central

    Kiryk, Anna; Sowodniok, Katharina; Kreiner, Grzegorz; Rodriguez-Parkitna, Jan; Sönmez, Aynur; Górkiewicz, Tomasz; Bierhoff, Holger; Wawrzyniak, Marcin; Janusz, Artur K.; Liss, Birgit; Konopka, Witold; Schütz, Günther; Kaczmarek, Leszek; Parlato, Rosanna

    2013-01-01

    Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer's disease (AD) and may play a role in dementia. Moreover, aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3, and dentate gyrus (DG). Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that 36 transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF) binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the DG a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving neuronal function. PMID:24273493

  4. Elucidating the role of C/D snoRNA in rRNA processing and modification in Trypanosoma brucei.

    PubMed

    Barth, Sarit; Shalem, Boaz; Hury, Avraham; Tkacz, Itai Dov; Liang, Xue-Hai; Uliel, Shai; Myslyuk, Inna; Doniger, Tirza; Salmon-Divon, Mali; Unger, Ron; Michaeli, Shulamit

    2008-01-01

    Most eukaryotic C/D small nucleolar RNAs (snoRNAs) guide 2'-O methylation (Nm) on rRNA and are also involved in rRNA processing. The four core proteins that bind C/D snoRNA in Trypanosoma brucei are fibrillarin (NOP1), NOP56, NOP58, and SNU13. Silencing of NOP1 by RNA interference identified rRNA-processing and modification defects that caused lethality. Systematic mapping of 2'-O-methyls on rRNA revealed the existence of hypermethylation at certain positions of the rRNA in the bloodstream form of the parasites, suggesting that this modification may assist the parasites in coping with the major temperature changes during cycling between their insect and mammalian hosts. The rRNA-processing defects of NOP1-depleted cells suggest the involvement of C/D snoRNA in trypanosome-specific rRNA-processing events to generate the small rRNA fragments. MRP RNA, which is involved in rRNA processing, was identified in this study in one of the snoRNA gene clusters, suggesting that trypanosomes utilize a combination of unique C/D snoRNAs and conserved snoRNAs for rRNA processing. PMID:17981991

  5. A Mutation in the 16S rRNA Decoding Region Attenuates the Virulence of Mycobacterium tuberculosis.

    PubMed

    Watanabe, Shinya; Matsumura, Kazunori; Iwai, Hiroki; Funatogawa, Keiji; Haishima, Yuji; Fukui, Chie; Okumura, Kayo; Kato-Miyazawa, Masako; Hashimoto, Masahito; Teramoto, Kanae; Kirikae, Fumiko; Miyoshi-Akiyama, Tohru; Kirikae, Teruo

    2016-08-01

    Mycobacterium tuberculosis contains a single rRNA operon that encodes targets for antituberculosis agents, including kanamycin. To date, only four mutations in the kanamycin binding sites of 16S rRNA have been reported in kanamycin-resistant clinical isolates. We hypothesized that another mutation(s) in the region may dramatically decrease M. tuberculosis viability and virulence. Here, we describe an rRNA mutation, U1406A, which was generated in vitro and confers resistance to kanamycin while highly attenuating M. tuberculosis virulence. The mutant showed decreased expression of 20% (n = 361) of mycobacterial proteins, including central metabolic enzymes, mycolic acid biosynthesis enzymes, and virulence factors such as antigen 85 complexes and ESAT-6. The mutation also induced three proteins, including KsgA (Rv1010; 16S rRNA adenine dimethyltransferase), which closely bind to the U1406A mutation site on the ribosome; these proteins were associated with ribosome maturation and translation initiation processes. The mutant showed an increase in 17S rRNA (precursor 16S rRNA) and a decrease in the ratio of 30S subunits to the 70S ribosomes, suggesting that the U1406A mutation in 16S rRNA attenuated M. tuberculosis virulence by affecting these processes. PMID:27245411

  6. gar2 is a nucleolar protein from Schizosaccharomyces pombe required for 18S rRNA and 40S ribosomal subunit accumulation.

    PubMed Central

    Gulli, M P; Girard, J P; Zabetakis, D; Lapeyre, B; Melese, T; Caizergues-Ferrer, M

    1995-01-01

    Several nucleolar proteins, such as nucleolin, NOP1/fibrillarin, SSB1, NSR1 and GAR1 share a common glycine and arginine rich structural motif called the GAR domain. To identify novel nucleolar proteins from fission yeast we screened Schizosaccharomyces pombe genomic DNA libraries with a probe encompassing the GAR structural motif. Here we report the identification and characterization of a S.pombe gene coding for a novel nucleolar protein, designated gar2. The structure of the fission yeast gar2 is reminiscent of that of nucleolin from vertebrates and NSR1 from Saccharomyces cerevisiae. In addition, like these proteins, gar2 has a nucleolar localisation. The disruption of the gar2+ gene affects normal cell growth, leads to an accumulation of 35S pre-rRNA and a decrease of mature 18S rRNA steady state levels. Moreover, ribosomal profiles of the mutant show an increase of free 60S ribosomal subunits and an absence of free 40S ribosomal subunits. gar2 is able to rescue a S.cerevisiae mutant lacking NSR1, thus establishing gar2 as a functional homolog of NSR1. We propose that gar2 helps the assembly of pre-ribosomal particles containing 18S rRNA. Images PMID:7596817

  7. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    PubMed Central

    Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  8. Details of gastropod phylogeny inferred from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Steiner, G; Backeljau, T; De Wachter, R

    1998-02-01

    Some generally accepted viewpoints on the phylogenetic relationships within the molluscan class Gastropoda are reassessed by comparing complete 18S rRNA sequences. Phylogenetic analyses were performed using the neighbor-joining and maximum parsimony methods. The previously suggested basal position of Archaeogastropoda, including Neritimorpha and Vetigastropoda, in the gastropod clade is confirmed. The present study also provides new molecular evidence for the monophyly of both Caenogastropoda and Euthyneura (Pulmonata and Opisthobranchia), making Prosobranchia paraphyletic. The relationships within Caenogastropoda and Euthyneura data turn out to be very unstable on the basis of the present 18S rRNA sequences. The present 18S rRNA data question, but are insufficient to decide on, muricacean (Neogastropoda), neotaenioglossan, pulmonate, or stylommatophoran monophyly. The analyses also focus on two systellommatophoran families, namely, Veronicellidae and Onchidiidae. It is suggested that Systellommatophora are not a monophyletic unit but, due to the lack of stability in the euthyneuran clade, their affinity to either Opisthobranchia or Pulmonata could not be determined. PMID:9479694

  9. Oligodeoxynucleotide probes for Campylobacter fetus and Campylobacter hyointestinalis based on 16S rRNA sequences.

    PubMed Central

    Wesley, I V; Wesley, R D; Cardella, M; Dewhirst, F E; Paster, B J

    1991-01-01

    Deoxyoligonucleotide probes were constructed for the identification of Campylobacter fetus and Campylobacter hyointestinalis based on 16S rRNA sequence data. Probes were targeted to hypervariable regions of 16S rRNA. Specificity of oligonucleotide probes was tested in a colony blot assay with type strains of 15 Campylobacter and Arcobacter species as well as in a slot blot format using genomic DNA extracted from field strains of C. fetus and C. hyointestinalis. Two oligonucleotides were constructed for C. fetus that hybridized with equal specificity with each of 57 biochemically confirmed isolates of C. fetus but not with any other Campylobacter species. The C. hyointestinalis probe reacted with 47 of 48 biochemically confirmed field isolates of C. hyointestinalis. In Southern blot hybridization of BglII digests of genomic DNA, the respective probes reacted within three restriction fragments of either C. hyointestinalis (7.2, 8.2, and 10.1 kb) or C. fetus (7.0, 7.7, and 9.0 kb). This suggests multiple copies of genes encoding 16S rRNA. Images PMID:1723076

  10. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    PubMed

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  11. Characterization of Xanthomonas campestris Pathovars by rRNA Gene Restriction Patterns

    PubMed Central

    Berthier, Yvette; Verdier, Valérie; Guesdon, Jean-Luc; Chevrier, Danièle; Denis, Jean-Baptiste; Decoux, Guy; Lemattre, Monique

    1993-01-01

    Genomic DNA of 191 strains of the family Pseudomonadaceae, including 187 strains of the genus Xanthomonas, was cleaved by EcoRI endonuclease. After hybridization of Southern transfer blots with 2-acetylamino-fluorene-labelled Escherichia coli 16+23S rRNA probe, 27 different patterns were obtained. The strains are clearly distinguishable at the genus, species, and pathovar levels. The variability of the rRNA gene restriction patterns was determined for four pathovars of Xanthomonas campestris species. The 16 strains of X. campestris pv. begoniae analyzed gave only one pattern. The variability of rRNA gene restriction patterns of X. campestris pv. manihotis strains could be related to ecotypes. In contrast, the variability of patterns observed for X. campestris pv. malvacearum was not correlated with pathogenicity or with the geographical origins of the strains. The highest degree of variability of DNA fingerprints was observed within X. campestris pv. dieffenbachiae, which is pathogenic to several hosts of the Araceae family. In this case, variability was related to both host plant and pathogenicity. Images PMID:16348894

  12. Molecular systematics of Volvocales (Chlorophyceae, Chlorophyta) based on exhaustive 18S rRNA phylogenetic analyses.

    PubMed

    Nakada, Takashi; Misawa, Kazuharu; Nozaki, Hisayoshi

    2008-07-01

    The taxonomy of Volvocales (Chlorophyceae, Chlorophyta) was traditionally based solely on morphological characteristics. However, because recent molecular phylogeny largely contradicts the traditional subordinal and familial classifications, no classification system has yet been established that describes the subdivision of Volvocales in a manner consistent with the phylogenetic relationships. Towards development of a natural classification system at and above the generic level, identification and sorting of hundreds of sequences based on subjective phylogenetic definitions is a significant step. We constructed an 18S rRNA gene phylogeny based on 449 volvocalean sequences collected using exhaustive BLAST searches of the GenBank database. Many chimeric sequences, which can cause fallacious phylogenetic trees, were detected and excluded during data collection. The results revealed 21 strongly supported primary clades within phylogenetically redefined Volvocales. Phylogenetic classification following PhyloCode was proposed based on the presented 18S rRNA gene phylogeny along with the results of previous combined 18S and 26S rRNA and chloroplast multigene analyses. PMID:18430591

  13. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  14. Nucleation by rRNA Dictates the Precision of Nucleolus Assembly.

    PubMed

    Falahati, Hanieh; Pelham-Webb, Bobbie; Blythe, Shelby; Wieschaus, Eric

    2016-02-01

    Membrane-less organelles are intracellular compartments specialized to carry out specific cellular functions. There is growing evidence supporting the possibility that such organelles form as a new phase, separating from cytoplasm or nucleoplasm. However, a main challenge to such phase separation models is that the initial assembly, or nucleation, of the new phase is typically a highly stochastic process and does not allow for the spatiotemporal precision observed in biological systems. Here, we investigate the initial assembly of the nucleolus, a membrane-less organelle involved in different cellular functions including ribosomal biogenesis. We demonstrate that the nucleolus formation is precisely timed in D. melanogaster embryos and follows the transcription of rRNA. We provide evidence that transcription of rRNA is necessary for overcoming the highly stochastic nucleation step in the formation of the nucleolus, through a seeding mechanism. In the absence of rDNA, the nucleolar proteins studied are able to form high-concentration assemblies. However, unlike the nucleolus, these assemblies are highly variable in number, location, and time at which they form. In addition, quantitative study of the changes in the nucleoplasmic concentration and distribution of these nucleolar proteins in the wild-type embryos is consistent with the role of rRNA in seeding the nucleolus formation. PMID:26776729

  15. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  16. Phylogenetic analysis of complete rRNA gene sequence of Nosema philosamiae isolated from the lepidopteran Philosamia cynthia ricini.

    PubMed

    Zhu, Feng; Shen, Zhongyuan; Xu, Xiaofang; Tao, Hengping; Dong, Shinan; Tang, Xudong; Xu, Li

    2010-01-01

    ABSTRACT. The microsporidian Nosema philosamiae is a pathogen that infects the eri-silkworm Philosamia cynthia ricini. The complete sequence of rRNA gene (4,314 bp) was obtained by polymerase chain reaction amplification with specific primers and sequencing. The sequence analysis showed that the organization of the rRNA of N. philosamiae was similar to the pattern of Nosema bombycis. Phylogenetic analysis of rRNA gene sequences revealed that N. philosamiae had a close relationship with other Nosema species, confirming that N. philosamiae is correctly assigned to the genus Nosema. PMID:20384905

  17. rRNA gene restriction patterns of Haemophilus influenzae biogroup aegyptius strains associated with Brazilian purpuric fever.

    PubMed Central

    Irino, K; Grimont, F; Casin, I; Grimont, P A

    1988-01-01

    The rRNA gene restriction patterns of 92 isolates of Haemophilus influenzae biogroup aegyptius, associated with conjunctivitis or Brazilian purpuric fever in the State of São Paulo, Brazil, were studied with 16 + 23S rRNA from Escherichia coli as a probe. All strains were classified into 15 patterns. Isolates from Brazilian purpuric fever cases were seen only in patterns 3 (most frequently) and 4 (rarely), whereas isolates from conjunctivitis were found in all 15 patterns. The study demonstrated that rRNA from E. coli can serve as a probe for molecular epidemiology. Images PMID:2459153

  18. Effects of induction of rRNA overproduction on ribosomal protein synthesis and ribosome subunit assembly in Escherichia coli.

    PubMed Central

    Yamagishi, M; Nomura, M

    1988-01-01

    Overproduction of rRNA was artificially induced in Escherichia coli cells to test whether the synthesis of ribosomal protein (r-protein) is normally repressed by feedback regulation. When rRNA was overproduced more than twofold from a hybrid plasmid carrying the rrnB operon fused to the lambda pL promoter (pL-rrnB), synthesis of individual r-proteins increased by an average of about 60%. This demonstrates that the synthesis of r-proteins is repressed under normal conditions. The increase of r-protein production, however, for unknown reasons, was not as great as the increase in rRNA synthesis and resulted in an imbalance between the amounts of rRNA and r-protein synthesis. Therefore, only a small (less than 20%) increase in the synthesis of complete 30S and 50S ribosome subunits was detected, and a considerable fraction of the excess rRNA was degraded. Lack of complete cooperativity in the assembly of ribosome subunits in vivo is discussed as a possible explanation for the absence of a large stimulation of ribosome synthesis observed under these conditions. In addition to the induction of intact rRNA overproduction from the pL-rrnB operon, the effects of unbalanced overproduction of each of the two large rRNAs, 16S rRNA and 23S rRNA, on r-protein synthesis were examined using pL-rrnB derivatives carrying a large deletion in either the 23S rRNA gene or the 16S rRNA gene. Operon-specific derepression after 23S or 16S rRNA overproduction correlated with the overproduction of rRNA containing the target site for the operon-specific repressor r-protein. These results are discussed to explain the apparent coupling of the assembly of one ribosomal subunit with that of the other which was observed in earlier studies on conditionally lethal mutants with defects in ribosome assembly. PMID:3053641

  19. Sequencing of 16S rRNA reveals a distinct salivary microbiome signature in Behçet's disease.

    PubMed

    Coit, Patrick; Mumcu, Gonca; Ture-Ozdemir, Filiz; Unal, Ali Ugur; Alpar, Ugur; Bostanci, Nagihan; Ergun, Tulin; Direskeneli, Haner; Sawalha, Amr H

    2016-08-01

    Behçet's disease (BD) is characterized by recurrent oro-genital ulcers, mucocutaneous lesions, and serious organ involvement. We investigated the salivary microbiome in BD using high-throughput sequencing of the 16S rRNA V4 region. Stimulated saliva samples were collected from 31 BD patients and 15 healthy controls, and in 9 BD patients, a second saliva sample was collected following dental and periodontal treatment. Sequence analysis identified a total of 908 operational taxonomic units (OTUs) present across all samples. Patients had a microbial community structure that is significantly less diverse than healthy controls. The most overabundant species in BD was Haemophilus parainfluenzae, while the most depleted included Alloprevotella rava and species in the genus Leptotrichia. Periodontal treatment improved oral health indices in BD but had no short-term effect on bacterial community structure. Neither the BD-associated genetic risk locus within the HLA-B/MICA region nor being on immunosuppressive medications explained the differences between patients and controls. PMID:27283393

  20. Application of PRECEDE-PROCEED model to tackle problems identified with diarrhoea burden among under-5s in Botswana.

    PubMed

    Popoola, Tosin; Mchunu, Gugu

    2015-05-01

    Diarrhoea has been identified as the second leading cause of mortality among under-5s and also claims more life than HIV, measles and malaria combined together in the same category of population. This article is a combination of literature review and personal experience of lessons learnt from past diarrhoea outbreaks in Botswana that caused significant rate of mortality among under-5s. The paper used literature review to identify contributory factors to diarrhoea burden among under-5s in Botswana and applied a community health nursing framework (PRECEDE-PROCEED) to tackle the problems identified. The study revealed that Botswana mothers are lacking in knowledge related to exclusive breastfeeding, prevention and treatment of diarrhoea disease. The paper recommends that health-care workers in Botswana be sensitized on current diarrhoea management to tailor their health education methods appropriately. PMID:26125574

  1. Xenopus transcription factor IIIA binds primarily at junctions between double helical stems and internal loops in oocyte 5S RNA.

    PubMed Central

    Christiansen, J; Brown, R S; Sproat, B S; Garrett, R A

    1987-01-01

    RNases and chemical probes were used to study the accessibility of each nucleotide of 5S RNA in the native and reconstituted 7S particle from Xenopus laevis oocytes. RNase or chemically treated 5S RNA from intact 7S particles was isolated and analysed using an oligodeoxynucleotide primer and reverse transcriptase. The results were superimposed on a cylindrical projection of an RNA double helix and the protection effects were shown to cluster at two regions on the molecular surface. A three-dimensional model is proposed for the 7S particle in which protein-RNA contacts occur mainly in the major groove of 5S RNA. Images Fig. 1. Fig. 2. PMID:3582366

  2. Transsacral transdiscal L5-S1 screws for the management of high-grade spondylolisthesis in an adolescent.

    PubMed

    Palejwala, Ali; Fridley, Jared; Jea, Andrew

    2016-06-01

    The surgical management of high-grade spondylolisthesis in adolescents remains a controversial issue. Because the basic procedure, posterolateral fusion, is associated with a significant rate of pseudarthrosis and listhesis progression, there is a pressing need for alternative surgical techniques. In the present report, the authors describe the case of an adolescent patient with significant low-back pain who was found to have Grade IV spondylolisthesis at L5-S1 that was treated with transsacral transdiscal screw fixation. Bilateral pedicle screws were placed starting from the top of the S-1 pedicle, across the L5-S1 intervertebral disc space, and into the L-5 body. At 14 months after surgery, the patient had considerable improvement in his pain and radiographic fusion across L5-S1. The authors conclude that transsacral transdiscal pedicle screws may serve as an efficacious and safe option for the correction of high-grade spondylolisthesis in adolescent patients. PMID:26894520

  3. Dissociative excitation of the N(+)(5S) state by electron impact on N2 - Excitation function and quenching

    NASA Technical Reports Server (NTRS)

    Erdman, P. W.; Zipf, E. C.

    1986-01-01

    Metastable N(+)(5S) ions were produced in the laboratory by dissociative excitation of N2 with energetic electrons. The resulting radiative decay of the N(+)(5S) state was observed with sufficient resolution to completely resolve the doublet from the nearby N2 molecular radiation. The excitation function was measured from threshold to 500 eV. The cross section peaks at a high electron energy and also exhibits a high threshold energy both of which are typical of dissociative excitation-ionization processes. This finding complicates the explanation of electron impact on N2 as the mechanism for the source of the 2145 A 'auroral mystery feature' by further increasing the required peak cross section. It is suggested that the apparent N(+)(5S) quenching in auroras may be an artifact due to the softening of the electron energy spectrum in the auroral E region.

  4. On comparing two structured RNA multiple alignments.

    PubMed

    Patel, Vandanaben; Wang, Jason T L; Setia, Shefali; Verma, Anurag; Warden, Charles D; Zhang, Kaizhong

    2010-12-01

    We present a method, called BlockMatch, for aligning two blocks, where a block is an RNA multiple sequence alignment with the consensus secondary structure of the alignment in Stockholm format. The method employs a quadratic-time dynamic programming algorithm for aligning columns and column pairs of the multiple alignments in the blocks. Unlike many other tools that can perform pairwise alignment of either single sequences or structures only, BlockMatch takes into account the characteristics of all the sequences in the blocks along with their consensus structures during the alignment process, thus being able to achieve a high-quality alignment result. We apply BlockMatch to phylogeny reconstruction on a set of 5S rRNA sequences taken from fifteen bacteria species. Experimental results showed that the phylogenetic tree generated by our method is more accurate than the tree constructed based on the widely used ClustalW tool. The BlockMatch algorithm is implemented into a web server, accessible at http://bioinformatics.njit.edu/blockmatch. A jar file of the program is also available for download from the web server. PMID:21121021

  5. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.

    PubMed

    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B

    2016-07-01

    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex. PMID:26974236

  6. Domain rearrangement of SRP protein Ffh upon binding 4.5S RNA and the SRP receptor FtsY

    PubMed Central

    BUSKIEWICZ, IWONA; KUBARENKO, ANDRIY; PESKE, FRANK; RODNINA, MARINA V.; WINTERMEYER, WOLFGANG

    2005-01-01

    The signal recognition particle (SRP) mediates membrane targeting of translating ribosomes displaying a signal-anchor sequence. In Escherichia coli, SRP consists of 4.5S RNA and a protein, Ffh, that recognizes the signal peptide emerging from the ribosome and the SRP receptor at the membrane, FtsY. In the present work, we studied the interactions between the NG and M domains in Ffh and their rearrangements upon complex formation with 4.5S RNA and/or FtsY. In free Ffh, the NG and M domains are facing one another in an orientation that allows cross-linking between positions 231 in the G domain and 377 in the M domain. There are binding interactions between the two domains, as the isolated domains form a strong complex. The interdomain contacts are disrupted upon binding of Ffh to 4.5S RNA, consuming a part of the total binding energy of 4.5S RNA-Ffh association that is roughly equivalent to the free energy of domain binding to each other. In the SRP particle, the NG domain binds to 4.5S RNA in a region adjacent to the binding site of the M domain. Ffh binding to FtsY also requires a reorientation of NG and M domains. These results suggest that in free Ffh, the binding sites for 4.5S RNA and FtsY are occluded by strong domain–domain interactions which must be disrupted for the formation of SRP or the Ffh-FtsY complex. PMID:15923378

  7. Domain rearrangement of SRP protein Ffh upon binding 4.5S RNA and the SRP receptor FtsY.

    PubMed

    Buskiewicz, Iwona; Kubarenko, Andriy; Peske, Frank; Rodnina, Marina V; Wintermeyer, Wolfgang

    2005-06-01

    The signal recognition particle (SRP) mediates membrane targeting of translating ribosomes displaying a signal-anchor sequence. In Escherichia coli, SRP consists of 4.5S RNA and a protein, Ffh, that recognizes the signal peptide emerging from the ribosome and the SRP receptor at the membrane, FtsY. In the present work, we studied the interactions between the NG and M domains in Ffh and their rearrangements upon complex formation with 4.5S RNA and/or FtsY. In free Ffh, the NG and M domains are facing one another in an orientation that allows cross-linking between positions 231 in the G domain and 377 in the M domain. There are binding interactions between the two domains, as the isolated domains form a strong complex. The interdomain contacts are disrupted upon binding of Ffh to 4.5S RNA, consuming a part of the total binding energy of 4.5S RNA-Ffh association that is roughly equivalent to the free energy of domain binding to each other. In the SRP particle, the NG domain binds to 4.5S RNA in a region adjacent to the binding site of the M domain. Ffh binding to FtsY also requires a reorientation of NG and M domains. These results suggest that in free Ffh, the binding sites for 4.5S RNA and FtsY are occluded by strong domain-domain interactions which must be disrupted for the formation of SRP or the Ffh-FtsY complex. PMID:15923378

  8. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location. PMID:27334092

  9. Identification of a 5S rDNA spacer type specific Triticum urartu and wheats containing the T. urartu genome.

    PubMed

    Allaby, R G; Brown, T A

    2000-04-01

    A PCR system was designed to amplify 5S spacer rDNA specifically from homeologous chromosome 1 in a variety of species representative of the Aegilops and Triticum genera. Two polymerase chain reaction (PCR) primer combinations were used, one of which appears to be apomorphic in nature and specific to chromosome 1A in Triticum urartu and tetraploid and hexaploid wheats containing the AA genome donated by T. urartu. The value of studying single repeat types to investigate the molecular evolution of 5S-rDNA arrays is considered. PMID:10791812

  10. Two-Dimensional Combinatorial Screening (2DCS) of a Bacterial rRNA A-site-like Motif Library: Defining Privileged Asymmetric Internal Loops that Bind Aminoglycosides

    PubMed Central

    Tran, Tuan; Disney, Matthew D.

    2010-01-01

    RNAs have diverse structures that are important for biological function. These structures include bulges and internal loops that can form tertiary contacts or serve as ligand binding sites. The most commonly exploited RNA drug target for small molecule intervention is the bacterial ribosome, more specifically the ribosomal RNA aminoacyl-tRNA site (rRNA A-site) which is a major target for the aminoglycoside class of antibiotics. The bacterial A-site is composed of a 1×1 nucleotide all-U internal loop and a 2×1 nucleotide all-A internal loop separated by a single GC base pair. Therefore, we probed the molecular recognition of a small library of four aminoglycosides for binding a 16384-member bacterial rRNA A-site-like internal loop library using Two-Dimensional Combinatorial Screening (2DCS). 2DCS is a microarray-based method that probes RNA and chemical spaces simultaneously. These studies sought to determine if aminoglycosides select their therapeutic target if given a choice of binding all possible internal loops derived from an A-site-like library. Results show that the bacterial rRNA A-site was not selected by any aminoglycoside. Analyses of selected sequences using the RNA Privileged Space Predictor (RNA-PSP) program show that each aminoglycoside preferentially binds different types of internal loops. For three of the aminoglycosides, 6″-azido-kanamycin A, 5-O-(2-azidoethyl) neamine, and 6″-azido-tobramycin, the selected internal loops bind with ~10-fold higher affinity than the bacterial rRNA A-site. The internal loops selected to bind 5″-azido-neomycin B bind with similar affinity as the therapeutic target. Selected internal loops that are unique for each aminoglycoside have dissociation constants ranging from 25 to 270 nM and are specific for the aminoglycoside they were selected to bind compared to the other arrayed aminoglycosides. These studies further establish a database of RNA motifs that are recognized by small molecules that could be used to

  11. Ribosome biogenesis factor Tsr3 is the aminocarboxypropyl transferase responsible for 18S rRNA hypermodification in yeast and humans

    PubMed Central

    Meyer, Britta; Wurm, Jan Philip; Sharma, Sunny; Immer, Carina; Pogoryelov, Denys; Kötter, Peter; Lafontaine, Denis L. J.; Wöhnert, Jens; Entian, Karl-Dieter

    2016-01-01

    The chemically most complex modification in eukaryotic rRNA is the conserved hypermodified nucleotide N1-methyl-N3-aminocarboxypropyl-pseudouridine (m1acp3Ψ) located next to the P-site tRNA on the small subunit 18S rRNA. While S-adenosylmethionine was identified as the source of the aminocarboxypropyl (acp) group more than 40 years ago the enzyme catalyzing the acp transfer remained elusive. Here we identify the cytoplasmic ribosome biogenesis protein Tsr3 as the responsible enzyme in yeast and human cells. In functionally impaired Tsr3-mutants, a reduced level of acp modification directly correlates with increased 20S pre-rRNA accumulation. The crystal structure of archaeal Tsr3 homologs revealed the same fold as in SPOUT-class RNA-methyltransferases but a distinct SAM binding mode. This unique SAM binding mode explains why Tsr3 transfers the acp and not the methyl group of SAM to its substrate. Structurally, Tsr3 therefore represents a novel class of acp transferase enzymes. PMID:27084949

  12. Ribosome biogenesis factor Tsr3 is the aminocarboxypropyl transferase responsible for 18S rRNA hypermodification in yeast and humans.

    PubMed

    Meyer, Britta; Wurm, Jan Philip; Sharma, Sunny; Immer, Carina; Pogoryelov, Denys; Kötter, Peter; Lafontaine, Denis L J; Wöhnert, Jens; Entian, Karl-Dieter

    2016-05-19

    The chemically most complex modification in eukaryotic rRNA is the conserved hypermodified nucleotide N1-methyl-N3-aminocarboxypropyl-pseudouridine (m(1)acp(3)Ψ) located next to the P-site tRNA on the small subunit 18S rRNA. While S-adenosylmethionine was identified as the source of the aminocarboxypropyl (acp) group more than 40 years ago the enzyme catalyzing the acp transfer remained elusive. Here we identify the cytoplasmic ribosome biogenesis protein Tsr3 as the responsible enzyme in yeast and human cells. In functionally impaired Tsr3-mutants, a reduced level of acp modification directly correlates with increased 20S pre-rRNA accumulation. The crystal structure of archaeal Tsr3 homologs revealed the same fold as in SPOUT-class RNA-methyltransferases but a distinct SAM binding mode. This unique SAM binding mode explains why Tsr3 transfers the acp and not the methyl group of SAM to its substrate. Structurally, Tsr3 therefore represents a novel class of acp transferase enzymes. PMID:27084949

  13. 23S rRNA gene-based enterococci community signatures in Lake Pontchartrain, Louisiana, USA, following urban runoff inputs after Hurricane Katrina.

    PubMed

    Bae, Hee-Sung; Hou, Aixin

    2013-02-01

    Little is known about the impacts of fecal polluted urban runoff inputs on the structure of enterococci communities in estuarine waters. This study employed a 23S rRNA gene-based polymerase chain reaction (PCR) assay with newly designed genus-specific primers, Ent127F-Ent907R, to determine the possible impacts of Hurricane Katrina floodwaters via the 17th Street Canal discharge on the community structure of enterococci in Lake Pontchartrain. A total of 94 phylotypes were identified through the restriction fragment length polymorphism (RFLP) screening of 494 clones while only 8 phylotypes occurred among 88 cultivated isolates. Sequence analyses of representative phylotypes and their temporal and spatial distribution in the lake and the canal indicated the Katrina floodwater input introduced a large portion of Enterococcus flavescens, Enterococcus casseliflavus, and Enterococcus dispar into the lake; typical fecal groups Enterococcus faecium, Enterococcus durans, Enterococcus hirae, and Enterococcus mundtii were detected primarily in the floodwater-impacted waters. This study provides a global picture of enterococci in estuarine waters impacted by Hurricane Katrina-derived urban runoff. It also demonstrates the culture-independent PCR approach using 23S rRNA gene as a molecular marker could be a good alternative in ecological studies of enterococci in natural environments to overcome the limitation of conventional cultivation methods. PMID:23269456

  14. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

    1992-01-01

    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  15. Targeting Species-Specific Low-Affinity 16S rRNA Binding Sites by Using Peptide Nucleic Acids for Detection of Legionellae in Biofilms

    PubMed Central

    Wilks, Sandra A.; Keevil, C. William

    2006-01-01

    Using fluorescence in situ hybridization to detect bacterial groups has several inherent limitations. DNA probes are generally used, targeting sites on the 16S rRNA. However, much of the 16S rRNA is highly conserved, with variable regions often located in inaccessible areas where secondary structures can restrict probe access. Here, we describe the use of peptide nucleic acid (PNA) probes as a superior alternative to DNA probes, especially when used for environmental samples. A complex bacterial genus (Legionella) was studied, and two probes were designed, one to detect all species and one targeted to Legionella pneumophila. These probes were developed from existing sequences and are targeted to low-binding-affinity sites on the 16S rRNA. In total, 47 strains of Legionella were tested. In all cases, the Legionella spp. PNA probe labeled cells strongly but did not bind to any non-Legionella species. Likewise, the specific L. pneumophila PNA probe labeled only strains of L. pneumophila. By contrast, the equivalent DNA probes performed poorly. To assess the applicability of this method for use on environmental samples, drinking-water biofilms were spiked with a known concentration of L. pneumophila bacteria. Quantifications of the L. pneumophila bacteria were compared using PNA hybridization and standard culture methods. The culture method quantified only 10% of the number of L. pneumophila bacteria found by PNA hybridization. This illustrates the value of this method for use on complex environmental samples, especially where cells may be in a viable but noncultivable state. PMID:16885298

  16. Characterization of Microbial Communities Found in the Human Vagina by Analysis of Terminal Restriction Fragment Length Polymorphisms of 16S rRNA Genes

    PubMed Central

    Coolen, Marco J. L.; Post, Eduard; Davis, Catherine C.; Forney, Larry J.

    2005-01-01

    To define and monitor the structure of microbial communities found in the human vagina, a cultivation-independent approach based on analyses of terminal restriction fragment length polymorphisms (T-RFLP) of 16S rRNA genes was developed and validated. Sixteen bacterial strains commonly found in the human vagina were used to construct model communities that were subsequently used to develop efficient means for the isolation of genomic DNA and an optimal strategy for T-RFLP analyses. The various genera in the model community could best be resolved by digesting amplicons made using bacterial primers 8f and 926r with HaeIII; fewer strains could be resolved using other primer-enzyme combinations, and no combination successfully distinguished certain species of the same genus. To demonstrate the utility of the approach, samples from five women that had been collected over a 2-month period were analyzed. Differences and similarities among the vaginal microbial communities of the women were readily apparent. The T-RFLP data suggest that the communities of three women were dominated by a single phylotype, most likely species of Lactobacillus. In contrast, the communities of two other women included numerically abundant populations that differed from Lactobacillus strains whose 16S rRNA genes had been previously determined. The T-RFLP profiles of samples from all the women were largely invariant over time, indicating that the kinds and abundances of the numerically dominant populations were relatively stable throughout two menstrual cycles. These findings show that T-RFLP of 16S rRNA genes can be used to compare vaginal microbial communities and gain information about the numerically dominant populations that are present. PMID:16332868

  17. Suspension Array Analysis of 16S rRNA from Fe- and SO42-Reducing Bacteria in Uranium-Contaminated Sediments Undergoing Bioremediation

    PubMed Central

    Chandler, Darrell P.; Jarrell, Ann E.; Roden, Eric R.; Golova, Julia; Chernov, Boris; Schipma, Matthew J.; Peacock, Aaron D.; Long, Philip E.

    2006-01-01

    A 16S rRNA-targeted tunable bead array was developed and used in a retrospective analysis of metal- and sulfate-reducing bacteria in contaminated subsurface sediments undergoing in situ U(VI) bioremediation. Total RNA was extracted from subsurface sediments and interrogated directly, without a PCR step. Bead array validation studies with total RNA derived from 24 isolates indicated that the behavior and response of the 16S rRNA-targeted oligonucleotide probes could not be predicted based on the primary nucleic acid sequence. Likewise, signal intensity (absolute or normalized) could not be used to assess the abundance of one organism (or rRNA) relative to the abundance of another organism (or rRNA). Nevertheless, the microbial community structure and dynamics through time and space and as measured by the rRNA-targeted bead array were consistent with previous data acquired at the site, where indigenous sulfate- and iron-reducing bacteria and near neighbors of Desulfotomaculum were the organisms that were most responsive to a change in injected acetate concentrations. Bead array data were best interpreted by analyzing the relative changes in the probe responses for spatially and temporally related samples and by considering only the response of one probe to itself in relation to a background (reference) environmental sample. By limiting the interpretation of the data in this manner and placing it in the context of supporting geochemical and microbiological analyses, we concluded that ecologically relevant and meaningful information can be derived from direct microarray analysis of rRNA in uncharacterized environmental samples, even with the current analytical uncertainty surrounding the behavior of individual probes on tunable bead arrays. PMID:16820459

  18. Molecular Evolution of Mycoplasma capricolum subsp. capripneumoniae Strains, Based on Polymorphisms in the 16S rRNA Genes

    PubMed Central

    Pettersson, Bertil; Bölske, Göran; Thiaucourt, François; Uhlén, Mathias; Johansson, Karl-Erik

    1998-01-01

    Mycoplasma capricolum subsp. capripneumoniae belongs to the so-called Mycoplasma mycoides cluster and is the causal agent of contagious caprine pleuropneumonia (CCPP). All members of the M. mycoides cluster have two rRNA operons. The sequences of the 16S rRNA genes of both rRNA operons from 20 strains of M. capricolum subsp. capripneumoniae of different geographical origins in Africa and Asia were determined. Nucleotide differences which were present in only one of the two operons (polymorphisms) were detected in 24 positions. The polymorphisms were not randomly distributed in the 16S rRNA genes, and some of them were found in regions of low evolutionary variability. Interestingly, 11 polymorphisms were found in all the M. capricolum subsp. capripneumoniae strains, thus defining a putative ancestor. A sequence length difference between the 16S rRNA genes in a poly(A) region and 12 additional polymorphisms were found in only one or some of the strains. A phylogenetic tree was constructed by comparative analysis of the polymorphisms, and this tree revealed two distinct lines of descent. The nucleotide substitution rate of strains within line II was up to 50% higher than within line I. A tree was also constructed from individual operonal 16S rRNA sequences, and the sequences of the two operons were found to form two distinct clades. The topologies of both clades were strikingly similar, which supports the use of 16S rRNA sequence data from homologous operons for phylogenetic studies. The strain-specific polymorphism patterns of the 16S rRNA genes of M. capricolum subsp. capripneumoniae may be used as epidemiological markers for CCPP. PMID:9573185

  19. rRNA Gene Expression of Abundant and Rare Activated-Sludge Microorganisms and Growth Rate Induced Micropollutant Removal.

    PubMed

    Vuono, David C; Regnery, Julia; Li, Dong; Jones, Zackary L; Holloway, Ryan W; Drewes, Jörg E

    2016-06-21

    The role of abundant and rare taxa in modulating the performance of wastewater-treatment systems is a critical component of making better predictions for enhanced functions such as micropollutant biotransformation. In this study, we compared 16S rRNA genes (rDNA) and rRNA gene expression of taxa in an activated-sludge-treatment plant (sequencing batch membrane bioreactor) at two solids retention times (SRTs): 20 and 5 days. These two SRTs were used to influence the rates of micropollutant biotransformation and nutrient removal. Our results show that rare taxa (<1%) have disproportionally high ratios of rRNA to rDNA, an indication of higher protein synthesis, compared to abundant taxa (≥1%) and suggests that rare taxa likely play an unrecognized role in bioreactor performance. There were also significant differences in community-wide rRNA expression signatures at 20-day SRT: anaerobic-oxic-anoxic periods were the primary driver of rRNA similarity. These results indicate differential expression of rRNA at high SRTs, which may further explain why high SRTs promote higher rates of micropollutant biotransformation. An analysis of micropollutant-associated degradation genes via metagenomics and direct measurements of a suite of micropollutants and nutrients further corroborates the loss of enhanced functions at 5-day SRT operation. This work advances our knowledge of the underlying ecosystem properties and dynamics of abundant and rare organisms associated with enhanced functions in engineered systems. PMID:27196630

  20. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes.

    PubMed

    Soni, Dharmendra Kumar; Dubey, Suresh Kumar

    2014-12-01

    The discrimination between Listeria monocytogenes and Listeria species has been detected. The 16S rRNA and hlyA were PCR amplified with set of oligonucleotide primers with flank 1,500 and 456 bp fragments, respectively. Based on the differences in 16S rRNA and hlyA genes, a total 80 isolates from different environmental, food and clinical samples confirmed it to be L. monocytogenes. The 16S rRNA sequence similarity suggested that the isolates were similar to the previously reported ones from different habitats by others. The phylogenetic interrelationships of the genus Listeria were investigated by sequencing of 16S rRNA and hlyA gene. The 16S rRNA sequence indicated that genus Listeria is comprised of following closely related but distinct lines of descent, one is the L. monocytogenes species group (including L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) and other, the species L. grayi, L. rocourtiae and L. fleischmannii. The phylogenetic tree based on hlyA gene sequence clearly differentiates between the L. monocytogenes, L. ivanovii and L. seeligeri. In the present study, we identified 80 isolates of L. monocytogenes originating from different clinical, food and environmental samples based on 16S rRNA and hlyA gene sequence similarity. PMID:25205124

  1. rRNA distribution during microspore development in anthers of Beta vulgaris L. quantitative in situ hybridization analysis.

    PubMed

    Majewska-Sawka, A; Rodriguez-Garcia, M I

    1996-04-01

    We related changes in the ultrastructural organization of the nucleoli with the results of quantitative in situ hybridizations to characterize rRNA metabolism during the development of microspore mother cells in the sugar beet anther (Beta vulgaris L.). In the course of meiotic prophase and early postmeiotic interphase the morphological characteristics of the nucleoli are typical of low or no transcriptional activity and a low rate of rRNA processing. However, we found evidence of an apparent increase in the relative numbers of 18 S rRNA transcripts in some stages of microsporogenesis. This was found in both the nucleoli and cytoplasm of pachytene meiocytes, and in later stages there was a spectacular accumulation of rRNA transcripts in nucleoli of the tetrad cells. Quantitative data are analyzed in the light of morphometric findings in the cell and their compartments to elucidate the degree to which changes in cell size are related to changes in labeling density and distribution. The results are discussed in terms of rRNA synthesis, transport and degradation as processes involved in the regulation of rRNA within microsporocytes and microspores. PMID:8718677

  2. Control by Phytochrome of Cytoplasmic Precursor rRNA Synthesis in the Cotyledons of Mustard Seedlings 1

    PubMed Central

    Thien, Wilfried; Schopfer, Peter

    1982-01-01

    The influence of phytochrome (high irradiance reaction; operationally, continuous far red light) on the incorporation of [3H]uridine into the cytoplasmic 2.5 megadalton precursor rRNA in the cotyledons of mustard (Sinapis alba L.) seedlings has been investigated. After irradiating 36-hour-old etiolated seedlings with 12 hours of far red light, the rate of incorporation is stimulated about 2-fold, leading to 50% labeling of the precursor rRNA pool about 15 minutes after the tracer has reached the nucleotide precursor pool. In the dark control, there is a significantly smaller pool of precursor rRNA which is half-saturated with label only after about 27 minutes. Since neither the specific radioactivity of the UTP pool nor the processing of the precursor rRNA demonstrate a corresponding light-dependent change, it is concluded that phytochrome mediates an increase of the transcription of the rRNA genes. This gene activation accounts for the increased accumulation of mature cytoplasmic rRNA during the course of photomorphogenesis of the cotyledons. PMID:16662362

  3. Charged bottomoniumlike states Z{sub b}(10610) and Z{sub b}(10650) and the {Upsilon}(5S){yields}{Upsilon}(2S){pi}{sup +}{pi}{sup -} decay

    SciTech Connect

    Chen Dianyong; Liu Xiang; Zhu Shilin

    2011-10-01

    Inspired by the newly observed two charged bottomoniumlike states, we consider the possible contribution from the intermediate Z{sub b}(10610) and Z{sub b}(10650) states to the {Upsilon}(5S){yields}{Upsilon}(2S){pi}{sup +}{pi}{sup -} decay process, which naturally explains Belle's previous observation of the anomalous {Upsilon}(2S){pi}{sup +}{pi}{sup -} production near the peak of {Upsilon}(5S) at {radical}(s)=10.87 GeV [K. F. Chen et al. (Belle Collaboration), Phys. Rev. Lett. 100, 112001 (2008)]. The resulting d{Gamma}({Upsilon}(5S){yields}{Upsilon}(2S){pi}{sup +}{pi}{sup -})/dm{sub {pi}}{sup +}{sub {pi}}{sup -} and d{Gamma}({Upsilon}(5S){yields}{Upsilon}(2S){pi}{sup +}{pi}{sup -})/dcos{theta} distributions agree with Belle's measurement after inclusion of these Z{sub b} states. This formalism also reproduces the Belle observation of the double-peak structure and its reflection in the {Upsilon}(2S){pi}{sup +} invariant mass spectrum of the {Upsilon}(5S){yields}{Upsilon}(2S){pi}{sup +}{pi}{sup -} decay.

  4. Simultaneous characterization of cellular RNA structure and function with in-cell SHAPE-Seq.

    PubMed

    Watters, Kyle E; Abbott, Timothy R; Lucks, Julius B

    2016-01-29

    Many non-coding RNAs form structures that interact with cellular machinery to control gene expression. A central goal of molecular and synthetic biology is to uncover design principles linking RNA structure to function to understand and engineer this relationship. Here we report a simple, high-throughput method called in-cell SHAPE-Seq that combines in-cell probing of RNA structure with a measurement of gene expression to simultaneously characterize RNA structure and function in bacterial cells. We use in-cell SHAPE-Seq to study the structure-function relationship of two RNA mechanisms that regulate translation in Escherichia coli. We find that nucleotides that participate in RNA-RNA interactions are highly accessible when their binding partner is absent and that changes in RNA structure due to RNA-RNA interactions can be quantitatively correlated to changes in gene expression. We also characterize the cellular structures of three endogenously expressed non-coding RNAs: 5S rRNA, RNase P and the btuB riboswitch. Finally, a comparison between in-cell and in vitro folded RNA structures revealed remarkable similarities for synthetic RNAs, but significant differences for RNAs that participate in complex cellular interactions. Thus, in-cell SHAPE-Seq represents an easily approachable tool for biologists and engineers to uncover relationships between sequence, structure and function of RNAs in the cell. PMID:26350218

  5. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)1

    PubMed Central

    Stenger, Brianna L.S.; Clark, Mark E.; Kváč, Martin; Khan, Eakalak; Giddings, Catherine W.; Dyer, Neil W.; Schultz, Jessie L.; McEvoy, John M.

    2015-01-01

    Cryptosporidium is an apicomplexan parasite that causes the disease cryptosporidiosis in humans, livestock, and other vertebrates. Much of the knowledge on Cryptosporidium diversity is derived from 18S rRNA gene (18S rDNA) phylogenies. Eukaryote genomes generally have multiple 18S rDNA copies that evolve in concert, which is necessary for the accurate inference of phylogenetic relationships. However, 18S rDNA copies in some genomes evolve by a birth-and-death process that can result in sequence divergence among copies. Most notably, divergent 18S rDNA paralogs in the apicomplexan Plasmodium share only 89–95% sequence similarity, encode structurally distinct rRNA molecules, and are expressed at different life cycle stages. In the present study, Cryptosporidium 18S rDNA was amplified from 28/72 (38.9%) eastern chipmunks (Tamias striatus). Phylogenetic analyses showed the co-occurrence of two 18S rDNA types, Type A and Type B, in 26 chipmunks, and Type B clustered with a sequence previously identified as Cryptosporidium chipmunk genotype II. Types A and B had a sister group relationship but shared less than 93% sequence similarity. In contrast, actin and heat shock protein 70 gene sequences were homogeneous in samples with both Types A and B present. It was therefore concluded that Types A and B are divergent 18S rDNA paralogs in Cryptosporidium chipmunk genotype II. Substitution patterns in Types A and B were consistent with functionally constrained evolution; however, Type B evolved more rapidly than Type A and had a higher G+C content (46.3% versus 41.0%). Oocysts of Cryptosporidium chipmunk genotype II measured 4.17 μm (3.73–5.04 μm) × 3.94 μm (3.50–4.98 μm) with a length-to-width ratio of 1.06 ± 0.06 μm, and infection occurred naturally in the jejunum, cecum, and colon of eastern chipmunks. The findings of this study have implications for the use of 18S rDNA sequences to infer phylogenetic relationships. PMID:25772204

  6. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus).

    PubMed

    Stenger, Brianna L S; Clark, Mark E; Kváč, Martin; Khan, Eakalak; Giddings, Catherine W; Dyer, Neil W; Schultz, Jessie L; McEvoy, John M

    2015-06-01

    Cryptosporidium is an apicomplexan parasite that causes the disease cryptosporidiosis in humans, livestock, and other vertebrates. Much of the knowledge on Cryptosporidium diversity is derived from 18S rRNA gene (18S rDNA) phylogenies. Eukaryote genomes generally have multiple 18S rDNA copies that evolve in concert, which is necessary for the accurate inference of phylogenetic relationships. However, 18S rDNA copies in some genomes evolve by a birth-and-death process that can result in sequence divergence among copies. Most notably, divergent 18S rDNA paralogs in the apicomplexan Plasmodium share only 89-95% sequence similarity, encode structurally distinct rRNA molecules, and are expressed at different life cycle stages. In the present study, Cryptosporidium 18S rDNA was amplified from 28/72 (38.9%) eastern chipmunks (Tamias striatus). Phylogenetic analyses showed the co-occurrence of two 18S rDNA types, Type A and Type B, in 26 chipmunks, and Type B clustered with a sequence previously identified as Cryptosporidium chipmunk genotype II. Types A and B had a sister group relationship but shared less than 93% sequence similarity. In contrast, actin and heat shock protein 70 gene sequences were homogeneous in samples with both Types A and B present. It was therefore concluded that Types A and B are divergent 18S rDNA paralogs in Cryptosporidium chipmunk genotype II. Substitution patterns in Types A and B were consistent with functionally constrained evolution; however, Type B evolved more rapidly than Type A and had a higher G+C content (46.3% versus 41.0%). Oocysts of Cryptosporidium chipmunk genotype II measured 4.17 μm (3.73-5.04 μm) × 3.94 μm (3.50-4.98 μm) with a length-to-width ratio of 1.06 ± 0.06 μm, and infection occurred naturally in the jejunum, cecum, and colon of eastern chipmunks. The findings of this study have implications for the use of 18S rDNA sequences to infer phylogenetic relationships. PMID:25772204

  7. Analysis, Optimization and Verification of Illumina-Generated 16S rRNA Gene Amplicon Surveys

    PubMed Central

    Nelson, Michael C.; Morrison, Hilary G.; Benjamino, Jacquelynn; Grim, Sharon L.; Graf, Joerg

    2014-01-01

    The exploration of microbial communities by sequencing 16S rRNA genes has expanded with low-cost, high-throughput sequencing instruments. Illumina-based 16S rRNA gene sequencing has recently gained popularity over 454 pyrosequencing due to its lower costs, higher accuracy and greater throughput. Although recent reports suggest that Illumina and 454 pyrosequencing provide similar beta diversity measures, it remains to be demonstrated that pre-existing 454 pyrosequencing workflows can transfer directly from 454 to Illumina MiSeq sequencing by simply changing the sequencing adapters of the primers. In this study, we modified 454 pyrosequencing primers targeting the V4-V5 hyper-variable regions of the 16S rRNA gene to be compatible with Illumina sequencers. Microbial communities from cows, humans, leeches, mice, sewage, and termites and a mock community were analyzed by 454 and MiSeq sequencing of the V4-V5 region and MiSeq sequencing of the V4 region. Our analysis revealed that reference-based OTU clustering alone introduced biases compared to de novo clustering, preventing certain taxa from being observed in some samples. Based on this we devised and recommend an analysis pipeline that includes read merging, contaminant filtering, and reference-based clustering followed by de novo OTU clustering, which produces diversity measures consistent with de novo OTU clustering analysis. Low levels of dataset contamination with Illumina sequencing were discovered that could affect analyses that require highly sensitive approaches. While moving to Illumina-based sequencing platforms promises to provide deeper insights into the breadth and function of microbial diversity, our results show that care must be taken to ensure that sequencing and processing artifacts do not obscure true microbial diversity. PMID:24722003

  8. Characterization of the Fecal Microbial Communities of Duroc Pigs Using 16S rRNA Gene Pyrosequencing

    PubMed Central

    Pajarillo, Edward Alain B.; Chae, Jong Pyo; Balolong, Marilen P.; Kim, Hyeun Bum; Seo, Kang-Seok; Kang, Dae-Kyung

    2015-01-01

    This study characterized the fecal bacterial community structure and inter-individual variation in 30-week-old Duroc pigs, which are known for their excellent meat quality. Pyrosequencing of the V1–V3 hypervariable regions of the 16S rRNA genes generated 108,254 valid reads and 508 operational taxonomic units at a 95% identity cut-off (genus level). Bacterial diversity and species richness as measured by the Shannon diversity index were significantly greater than those reported previously using denaturation gradient gel electrophoresis; thus, this study provides substantial information related to both known bacteria and the untapped portion of unclassified bacteria in the population. The bacterial composition of Duroc pig fecal samples was investigated at the phylum, class, family, and genus levels. Firmicutes and Bacteroidetes predominated at the phylum level, while Clostridia and Bacteroidia were most abundant at the class level. This study also detected prominent inter-individual variation starting at the family level. Among the core microbiome, which was observed at the genus level, Prevotella was consistently dominant, as well as a bacterial phylotype related to Oscillibacter valericigenes, a valerate producer. This study found high bacterial diversity and compositional variation among individuals of the same breed line, as well as high abundance of unclassified bacterial phylotypes that may have important functions in the growth performance of Duroc pigs. PMID:25656184

  9. Purification, crystallization and preliminary crystallographic analysis of the 16S rRNA methyltransferase RsmI from Escherichia coli

    PubMed Central

    Zhao, Mohan; Wang, Li; Zhang, Heng; Dong, Yuhui; Gong, Yong; Zhang, Linbo; Wang, Jian

    2014-01-01

    RsmI and RsmH are AdoMet-dependent methyltransferases that are responsible for the 2′-O-methylation and N 4-methylation of C1402 of Escherichia coli 16S rRNA, respectively. Modification of this site has been found to play a role in fine-tuning the shape and function of the P-site to increase the decoding fidelity. It is interesting to study the mechanism by which C1402 can be methylated by both RsmI and RsmH. The crystal structure of RsmH in complex with AdoMet and cytidine has recently been determined and provided some implications for N 4-methylation of this site. Here, the purification and crystallization of RsmI as well as its preliminary crystallographic analysis are reported. Co-crystallization of RsmI with AdoMet was carried out by the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 2.60 Å resolution on beamline 1W2B at BSRF. The crystal contained three molecules per asymmetric unit and belonged to space group C2, with unit-cell parameters a = 121.9, b = 152.5, c = 54.2 Å, β = 93.4°. PMID:25195904

  10. Bacterial community variations in an alfalfa-rice rotation system revealed by 16S rRNA gene 454-pyrosequencing.

    PubMed

    Lopes, Ana R; Manaia, Célia M; Nunes, Olga C

    2014-03-01

    Crop rotation is a practice harmonized with the sustainable rice production. Nevertheless, the implications of this empirical practice are not well characterized, mainly in relation to the bacterial community composition and structure. In this study, the bacterial communities of two adjacent paddy fields in the 3rd and 4th year of the crop rotation cycle and of a nonseeded subplot were characterized before rice seeding and after harvesting, using 454-pyrosequencing of the 16S rRNA gene. Although the phyla Acidobacteria, Proteobacteria, Chloroflexi, Actinobacteria and Bacteroidetes predominated in all the samples, there were variations in relative abundance of these groups. Samples from the 3rd and 4th years of the crop rotation differed on the higher abundance of groups of presumable aerobic bacteria and of presumable anaerobic and acidobacterial groups, respectively. Members of the phylum Nitrospira were more abundant after rice harvest than in the previously sampled period. Rice cropping was positively correlated with the abundance of members of the orders Acidobacteriales and 'Solibacterales' and negatively with lineages such as Chloroflexi 'Ellin6529'. Studies like this contribute to understand variations occurring in the microbial communities in soils under sustainable rice production, based on real-world data. PMID:24245591

  11. Purification, crystallization and preliminary crystallographic analysis of the 16S rRNA methyltransferase RsmI from Escherichia coli.

    PubMed

    Zhao, Mohan; Wang, Li; Zhang, Heng; Dong, Yuhui; Gong, Yong; Zhang, Linbo; Wang, Jian

    2014-09-01

    RsmI and RsmH are AdoMet-dependent methyltransferases that are responsible for the 2'-O-methylation and N(4)-methylation of C1402 of Escherichia coli 16S rRNA, respectively. Modification of this site has been found to play a role in fine-tuning the shape and function of the P-site to increase the decoding fidelity. It is interesting to study the mechanism by which C1402 can be methylated by both RsmI and RsmH. The crystal structure of RsmH in complex with AdoMet and cytidine has recently been determined and provided some implications for N(4)-methylation of this site. Here, the purification and crystallization of RsmI as well as its preliminary crystallographic analysis are reported. Co-crystallization of RsmI with AdoMet was carried out by the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 2.60 Å resolution on beamline 1W2B at BSRF. The crystal contained three molecules per asymmetric unit and belonged to space group C2, with unit-cell parameters a = 121.9, b = 152.5, c = 54.2 Å, β = 93.4°. PMID:25195904

  12. rRNA mutants in the yeast peptidyltransferase center reveal allosteric information networks and mechanisms of drug resistance

    PubMed Central

    Rakauskaitė, Rasa; Dinman, Jonathan D.

    2008-01-01

    To ensure accurate and rapid protein synthesis, nearby and distantly located functional regions of the ribosome must dynamically communicate and coordinate with one another through a series of information exchange networks. The ribosome is ∼2/3 rRNA and information should pass mostly through this medium. Here, two viable mutants located in the peptidyltransferase center (PTC) of yeast ribosomes were created using a yeast genetic system that enables stable production of ribosomes containing only mutant rRNAs. The specific mutants were C2820U (Escherichia coli C2452) and Ψ2922C (E. coli U2554). Biochemical and genetic analyses of these mutants suggest that they may trap the PTC in the ‘open’ or aa-tRNA bound conformation, decreasing peptidyl-tRNA binding. We suggest that these structural changes are manifested at the biological level by affecting large ribosomal subunit biogenesis, ribosomal subunit joining during initiation, susceptibility/resistance to peptidyltransferase inhibitors, and the ability of ribosomes to properly decode termination codons. These studies also add to our understanding of how information is transmitted both locally and over long distances through allosteric networks of rRNA–rRNA and rRNA–protein interactions. PMID:18203742

  13. Microbial Diversity in Deep-sea Methane Seep Sediments Presented by SSU rRNA Gene Tag Sequencing

    PubMed Central

    Nunoura, Takuro; Takaki, Yoshihiro; Kazama, Hiromi; Hirai, Miho; Ashi, Juichiro; Imachi, Hiroyuki; Takai, Ken

    2012-01-01

    Microbial community structures in methane seep sediments in the Nankai Trough were analyzed by tag-sequencing analysis for the small subunit (SSU) rRNA gene using a newly developed primer set. The dominant members of Archaea were Deep-sea Hydrothermal Vent Euryarchaeotic Group 6 (DHVEG 6), Marine Group I (MGI) and Deep Sea Archaeal Group (DSAG), and those in Bacteria were Alpha-, Gamma-, Delta- and Epsilonproteobacteria, Chloroflexi, Bacteroidetes, Planctomycetes and Acidobacteria. Diversity and richness were examined by 8,709 and 7,690 tag-sequences from sediments at 5 and 25 cm below the seafloor (cmbsf), respectively. The estimated diversity and richness in the methane seep sediment are as high as those in soil and deep-sea hydrothermal environments, although the tag-sequences obtained in this study were not sufficient to show whole microbial diversity in this analysis. We also compared the diversity and richness of each taxon/division between the sediments from the two depths, and found that the diversity and richness of some taxa/divisions varied significantly along with the depth. PMID:22510646

  14. Greengenes, a Chimera-checked 16S rRNA gene database and workbenchcompatible with ARB

    SciTech Connect

    DeSantis, Todd Z.; Hugenholtz, Philip; Larsen, Neils; Rojas,Mark; Brodie, Eoin L.; Keller, Keith; Huber, Thomas; Dalevi, Daniel; Hu,Ping; Andersen, Gary L.

    2006-04-10

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that in congruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3 percent of environmental sequences and 0.2 percent of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  15. Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

    NASA Technical Reports Server (NTRS)

    Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1991-01-01

    Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

  16. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment

    PubMed Central

    Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

    2016-01-01

    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in

  17. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.

    PubMed

    Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

    2016-01-01

    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA

  18. A transfer RNAArg gene of Pelargonium chloroplasts, but not a 5S RNA gene, is efficiently transcribed after injection into Xenopus oocyte nuclei.

    PubMed Central

    Hellmund, D; Metzlaff, M; Serfling, E

    1984-01-01

    We present the primary structure of a chloroplast tRNAArgACG gene of the plant, Pelargonium zonale, and its faithful expression in Xenopus oocyte nuclei. This tRNAArg gene is located 250 bp downstream of a 5S RNA gene within a cloned 5kb long ribosomal DNA segment (Fig. 1). The Pelargonium tRNAArg gene shares 97% and 86% sequence homology with tRNAArgACG genes of Spirodela oligorhiza and Euglena gracilis chloroplasts, respectively, and also extensive homology (70%) with the corresponding gene of E. coli. It lacks an intervening sequence and, like eukaryotic tRNA genes, does not code for the 3' terminal CCA nucleotides. Moreover, the chloroplast tRNAArg gene carries all the sequence elements essential for transcription by vertebrate RNA polymerase III since it is efficiently expressed in Xenopus oocyte nuclei, even in the presence of 1 microgram/ml alpha-amanitin. In Xenopus oocyte nuclei, no transcripts of the chloroplast 5S RNA gene were detected. Images PMID:6209611

  19. Transannular cyclization of (4S,5S)-germacrone-4,5-epoxide under basic conditions to yield eudesmane-type sesquiterpenes.

    PubMed

    Kuroyanagi, Masanori; Shirota, Osamu; Sekita, Setsuko

    2014-01-01

    Transannular cyclizations of germacrone-4,5-epoxide under acidic and thermal conditions have been reported in our previous study. However, this process gave the different and interesting results under basic conditions. (4S,5S)-Germacrone-4,5-epoxide (1) was treated under basic conditions to yield four products (2-5). Compound 2 was an isomer of 1--(4S,5S,9Z)-4,5-epoxygermacra-7(11),9-dien-8-one--and the remaining three compounds (3-5) were eudesmane-type derivatives. Compounds 4 and 5 are new compounds. The structures of the new compounds were determined using high resolution (HR)-MS, one dimensional (1D)-NMR, 2D-NMR and circular dichroism (CD) spectroscopic data. Products 3-5 had the same carbon skeleton as that of eudesmane-type compounds; however, these compounds showed different arrangement of isoprene units to the natural eudesmane-type sesquiterpenes. PMID:24990508

  20. CdTe(1-x)Se(x)/Cd0.5Zn0.5S core/shell quantum dots: core composition and property.

    PubMed

    Yang, Ping; Cao, Yongqiang; Li, Xiaoyu; Zhang, Ruili; Liu, Ning; Zhang, Yulan

    2014-08-01

    Alloy CdTe(1-x)Se(x) quantum dots (QDs) have been fabricated by an organic route using Cd, Te and Se precursors in a mixture of trioctylamine and octadecylphosphonic acid at 280 °C. The variation of photoluminescence (PL) peak wavelength of the CdTe(1-x)Se(x) QDs compared with CdTe QDs confirmed the formation of an alloy structure. The Se component drastically affected the stability of CdTe(1-x)Se(x) QDs. A Cd0.5Zn0.5S shell coating on CdTe(1-x)Se(x) cores was carried out using oleic acid as a capping agent. CdTe(1-x)Se(x)/Cd0.5Zn0.5S core/shell QDs revealed dark red PL while a yellow PL peak was observed for the CdTe(1-x)Se(x) cores. The PL efficiency of the core/shell QDs was drastically increased (less than 1% for the cores and up to 65% for the core/shell QDs). The stability of QDs in various buffer solutions was investigated. Core/shell QDs can be used for biological applications because of their high stability, tunable PL and high PL efficiency. PMID:23946281

  1. Vertical Distribution of Bacterial Communities in the Indian Ocean as Revealed by Analyses of 16S rRNA and nasA Genes.

    PubMed

    Jiang, Xuexia; Jiao, Nianzhi

    2016-09-01

    Bacteria play an important role in the marine biogeochemical cycles. However, research on the bacterial community structure of the Indian Ocean is scarce, particularly within the vertical dimension. In this study, we investigated the bacterial diversity of the pelagic, mesopelagic and bathypelagic zones of the southwestern Indian Ocean (50.46°E, 37.71°S). The clone libraries constructed by 16S rRNA gene sequence revealed that most phylotypes retrieved from the Indian Ocean were highly divergent from those retrieved from other oceans. Vertical differences were observed based on the analysis of natural bacterial community populations derived from the 16S rRNA gene sequences. Based on the analysis of the nasA gene sequences from GenBank database, a pair of general primers was developed and used to amplify the bacterial nitrate-assimilating populations. Environmental factors play an important role in mediating the bacterial communities in the Indian Ocean revealed by canonical correlation analysis. PMID:27407295

  2. Genome-wide analysis of small nucleolar RNAs of Leishmania major reveals a rich repertoire of RNAs involved in modification and processing of rRNA.

    PubMed

    Eliaz, Dror; Doniger, Tirza; Tkacz, Itai Dov; Biswas, Viplov Kumar; Gupta, Sachin Kumar; Kolev, Nikolay G; Unger, Ron; Ullu, Elisabetta; Tschudi, Christian; Michaeli, Shulamit

    2015-01-01

    Trypanosomatids are protozoan parasites and the causative agent of infamous infectious diseases. These organisms regulate their gene expression mainly at the post-transcriptional level and possess characteristic RNA processing mechanisms. In this study, we analyzed the complete repertoire of Leishmania major small nucleolar (snoRNA) RNAs by performing RNA-seq analysis on RNAs that were affinity-purified using the C/D snoRNA core protein, SNU13, and the H/ACA core protein, NHP2. This study revealed a large collection of C/D and H/ACA snoRNAs, organized in gene clusters generally containing both snoRNA types. Abundant snoRNAs were identified and predicted to guide trypanosome-specific rRNA cleavages. The repertoire of snoRNAs was compared to that of the closely related Trypanosoma brucei, and 80% of both C/D and H/ACA molecules were found to have functional homologues. The comparative analyses elucidated how snoRNAs evolved to generate molecules with analogous functions in both species. Interestingly, H/ACA RNAs have great flexibility in their ability to guide modifications, and several of the RNA species can guide more than one modification, compensating for the presence of single hairpin H/ACA snoRNA in these organisms. Placing the predicted modifications on the rRNA secondary structure revealed hypermodification regions mostly in domains which are modified in other eukaryotes, in addition to trypanosome-specific modifications. PMID:25970223

  3. Design and evaluation of universal 16S rRNA gene primers for high-throughput sequencing to simultaneously detect DAMO microbes and anammox bacteria.

    PubMed

    Lu, Yong-Ze; Ding, Zhao-Wei; Ding, Jing; Fu, Liang; Zeng, Raymond J

    2015-12-15

    To develop universal 16S rRNA gene primers for high-throughput sequencing for the simultaneous detection of denitrifying anaerobic methane oxidation (DAMO) archaea, DAMO bacteria, and anaerobic ammonium oxidation (anammox) bacteria, four published primer sets (PS2-PS5) were modified. The overall coverage of the four primer pairs was evaluated in silico with the Silva SSU r119 dataset. Based on the virtual evaluation, the two best primer pairs (PS4 and PS5) were selected for further verification. Illumina MiSeq sequencing of a freshwater sediment and a culture from a DAMO-anammox reactor using these two primer pairs revealed that PS5 (341b4F-806R) was the most promising universal primer pair. This pair of primers detected both archaea and bacteria with less bias than PS4. Furthermore, an anaerobic fermentation culture and a wastewater treatment plant culture were used to verify the accuracy of PS5. More importantly, it detected DAMO archaea, DAMO bacteria, and anammox bacteria simultaneously with no false positives appeared. This universal 16S rRNA gene primer pair extends the existing molecular tools for studying the community structures and distributions of DAMO microbes and their potential interactions with anammox bacteria in different environments. PMID:26454634

  4. HCV IRES interacts with the 18S rRNA to activate the 40S ribosome for subsequent steps of translation initiation

    PubMed Central

    Malygin, Alexey A.; Kossinova, Olga A.; Shatsky, Ivan N.; Karpova, Galina G.

    2013-01-01

    Previous analyses of complexes of 40S ribosomal subunits with the hepatitis C virus (HCV) internal ribosome entry site (IRES) have revealed contacts made by the IRES with ribosomal proteins. Here, using chemical probing, we show that the HCV IRES also contacts the backbone and bases of the CCC triplet in the 18S ribosomal RNA (rRNA) expansion segment 7. These contacts presumably provide interplay between IRES domain II and the AUG codon close to ribosomal protein S5, which causes a rearrangement of 18S rRNA structure in the vicinity of the universally conserved nucleotide G1639. As a result, G1639 becomes exposed and the corresponding site of the 40S subunit implicated in transfer RNA discrimination can select . These data are the first demonstration at nucleotide resolution of direct IRES–rRNA interactions and how they induce conformational transition in the 40S subunit allowing the HCV IRES to function without AUG recognition initiation factors. PMID:23873958

  5. In Situ Accessibility of Saccharomyces cerevisiae 26S rRNA to Cy3-Labeled Oligonucleotide Probes Comprising the D1 and D2 Domains

    PubMed Central

    Inácio, João; Behrens, Sebastian; Fuchs, Bernhard M.; Fonseca, Álvaro; Spencer-Martins, Isabel; Amann, Rudolf

    2003-01-01

    Fluorescence in situ hybridization (FISH) has proven to be most useful for the identification of microorganisms. However, species-specific oligonucleotide probes often fail to give satisfactory results. Among the causes leading to low hybridization signals is the reduced accessibility of the targeted rRNA site to the oligonucleotide, mainly for structural reasons. In this study we used flow cytometry to determine whole-cell fluorescence intensities with a set of 32 Cy3-labeled oligonucleotide probes covering the full length of the D1 and D2 domains in the 26S rRNA of Saccharomyces cerevisiae PYCC 4455T. The brightest signal was obtained with a probe complementary to positions 223 to 240. Almost half of the probes conferred a fluorescence intensity above 60% of the maximum, whereas only one probe could hardly detect the cells. The accessibility map based on the results obtained can be extrapolated to other yeasts, as shown experimentally with 27 additional species (14 ascomycetes and 13 basidiomycetes). This work contributes to a more rational design of species-specific probes for yeast identification and monitoring. PMID:12732564

  6. Analysis of 16S rRNA and mxaF genes revealing insights into Methylobacterium niche-specific plant association

    PubMed Central

    Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz

    2012-01-01

    The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant. PMID:22481887

  7. Simultaneous characterization of cellular RNA structure and function with in-cell SHAPE-Seq

    PubMed Central

    Watters, Kyle E.; Abbott, Timothy R.; Lucks, Julius B.

    2016-01-01

    Many non-coding RNAs form structures that interact with cellular machinery to control gene expression. A central goal of molecular and synthetic biology is to uncover design principles linking RNA structure to function to understand and engineer this relationship. Here we report a simple, high-throughput method called in-cell SHAPE-Seq that combines in-cell probing of RNA structure with a measurement of gene expression to simultaneously characterize RNA structure and function in bacterial cells. We use in-cell SHAPE-Seq to study the structure–function relationship of two RNA mechanisms that regulate translation in Escherichia coli. We find that nucleotides that participate in RNA–RNA interactions are highly accessible when their binding partner is absent and that changes in RNA structure due to RNA–RNA interactions can be quantitatively correlated to changes in gene expression. We also characterize the cellular structures of three endogenously expressed non-coding RNAs: 5S rRNA, RNase P and the btuB riboswitch. Finally, a comparison between in-cell and in vitro folded RNA structures revealed remarkable similarities for synthetic RNAs, but significant differences for RNAs that participate in complex cellular interactions. Thus, in-cell SHAPE-Seq represents an easily approachable tool for biologists and engineers to uncover relationships between sequence, structure and function of RNAs in the cell. PMID:26350218

  8. Greengenes: 16S rRNA Database and Workbench Compatible with ARB

    DOE Data Explorer

    DeSantis, T. Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie, E. L.; Keller, K.; Huber, T.; Dalevi, D. Hu, P. Andersen, G. L.

    Greengenes was developed, as the abstract of an AEM reprint states, to "addresse limitations of public repositories by providing chimera screening, standard alignment, and taxonomic classification using multiple published taxonomies. It was found that there is incongruent taxonomic nomenclature among curators even at the phylum level. Putative chimeras were identified in 3% of environmental sequences and in 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages in the Archaea and Bacteria....Greengenes is also a functional workbench to assist in analysis of user-generated 16S rRNA gene sequences. Batches of sequencing reads can be uploaded for quality-based trimming and creation of multiple-sequence alignments (9). Three types of non-MSA similarity searches are also available, seed extension by BLAST (1), similarity based on shared 7-mers by a tool called Simrank, and a direct degenerative pattern match for probe/primer evaluation. Results are displayed using user-preferred taxonomic nomenclature and can be saved between sessions. [Taken from DeSantis, T. Z., P. Hugenholtz, N. Larsen, M. Rojas, E. L. Brodie, K. Keller, T. Huber, D. Dalevi, P. Hu, and G. L. Andersen. 2006. Greengenes, a Chimera-Checked 16S rRNA Gene Database and Workbench Compatible with ARB. Appl Environ Microbiol 72:5069-72, pages 1 and 3] (Specialized Interface)

  9. PhylOPDb: a 16S rRNA oligonucleotide probe database for prokaryotic identification

    PubMed Central

    Jaziri, Faouzi; Parisot, Nicolas; Abid, Anis; Denonfoux, Jérémie; Ribière, Céline; Gasc, Cyrielle; Boucher, Delphine; Brugère, Jean-François; Mahul, Antoine; Hill, David R.C.; Peyretaillade, Eric; Peyret, Pierre

    2014-01-01

    In recent years, high-throughput molecular tools have led to an exponential growth of available 16S rRNA gene sequences. Incorporating such data, molecular tools based on target-probe hybridization were developed to monitor microbial communities within complex environments. Unfortunately, only a few 16S rRNA gene-targeted probe collections were described. Here, we present PhylOPDb, an online resource for a comprehensive phylogenetic oligonucleotide probe database. PhylOPDb provides a convivial and easy-to-use web interface to browse both regular and explorative 16S rRNA-targeted probes. Such probes set or subset could be used to globally monitor known and unknown prokaryotic communities through various techniques including DNA microarrays, polymerase chain reaction (PCR), fluorescent in situ hybridization (FISH), targeted gene capture or in silico rapid sequence identification. PhylOPDb contains 74 003 25-mer probes targeting 2178 genera including Bacteria and Archaea. Database URL: http://g2im.u-clermont1.fr/phylopdb/ PMID:24771669

  10. Tracking the interactions of rRNA processing proteins during nucleolar assembly in living cells.

    PubMed

    Angelier, Nicole; Tramier, Marc; Louvet, Emilie; Coppey-Moisan, Maïté; Savino, Tula M; De Mey, Jan R; Hernandez-Verdun, Danièle

    2005-06-01

    Reorganization of the nuclear machinery after mitosis is a fundamental but poorly understood process. Here, we investigate the recruitment of the nucleolar processing proteins in the nucleolus of living cells at the time of nucleus formation. We question the role of the prenucleolar bodies (PNBs), during migration of the processing proteins from the chromosome periphery to sites of rDNA transcription. Surprisingly, early and late processing proteins pass through the same PNBs as demonstrated by rapid two-color four-dimensional imaging and quantification, whereas a different order of processing protein recruitment into nucleoli is supported by differential sorting. Protein interactions along the recruitment pathway were investigated using a promising time-lapse analysis of fluorescence resonance energy transfer. For the first time, it was possible to detect in living cells the interactions between proteins of the same rRNA processing machinery in nucleoli. Interestingly interactions between such proteins also occur in PNBs but not at the chromosome periphery. The dynamics of these interactions suggests that PNBs are preassembly platforms for rRNA processing complexes. PMID:15814843

  11. The cytoplasmic mRNA degradation factor Pat1 is required for rRNA processing.

    PubMed

    Muppavarapu, Mridula; Huch, Susanne; Nissan, Tracy

    2016-04-01

    Pat1 is a key cytoplasmic mRNA degradation factor, the loss of which severely increases mRNA half-lives. Several recent studies have shown that Pat1 can enter the nucleus and can shuttle between the nucleus and the cytoplasm. As a result, many nuclear roles have been proposed for Pat1. In this study, we analyzed four previously suggested nuclear roles of Pat1 and show that Pat1 is not required for efficient pre-mRNA splicing or pre-mRNA decay in yeast. However, lack of Pat1 results in accumulation of pre-rRNA processing intermediates. Intriguingly, we identified a novel genetic relationship between Pat1 and the rRNA decay machinery, specifically the exosome and the TRAMP complex. While the pre-rRNA processing intermediates that accumulate in the pat1 deletion mutant are, at least to some extent, recognized as aberrant by the rRNA degradation machinery, it is unlikely that these accumulations are the cause of their synthetic sick relationship. Here, we show that the dysregulation of the levels of mRNAs related to ribosome biogenesis could be the cause of the accumulation of the pre-rRNA processing intermediates. Although our results support a role for Pat1 in transcription, they nevertheless suggest that the primary cause of the dysregulated mRNA levels is most likely due to Pat1's role in mRNA decapping and mRNA degradation. PMID:26918764

  12. Expansion of the aminoglycoside-resistance 16S rRNA (m1A1408) methyltransferase family: expression and functional characterization of four hypothetical enzymes of diverse bacterial origin

    PubMed Central

    Witek, Marta A.; Conn, Graeme L.

    2014-01-01

    The global dissemination, potential activity in diverse species and broad resistance spectrum conferred by the aminoglycoside-resistance ribosomal RNA methyltransferases make them a significant potential new threat to the efficacy of aminoglycoside antibiotics in the treatment of serious bacterial infections. The N1 methylation of adenosine 1408 (m1A1408) confers resistance to structurally diverse aminoglycosides, including kanamycin, neomycin and apramycin. The limited analyses to date of the enzymes responsible have identified common features but also potential differences in their molecular details of action. Therefore, with the goal of expanding the known 16S rRNA (m1A1408) methyltransferase family as a platform for developing a more complete mechanistic understanding, we report here the cloning, expression and functional analyses of four hypothetical aminoglycoside-resistance rRNA methyltransferases from recent genome sequences of diverse bacterial species. Each of the genes produced a soluble, folded protein with a secondary structure, as determined from circular dichroism (CD) spectra, consistent with enzymes for which high-resolution structures are available. For each enzyme, antibiotic minimum inhibitory concentration (MIC) assays revealed a resistance spectrum characteristic of the known 16S rRNA (m1A1408) methyltransferases and the modified nucleotide was confirmed by reverse transcription as A1408. In common with other family members, higher binding affinity for the methylation reaction by-product S-adenosylhomocysteine (SAH) than the cosubstrate S-adenosyl-L-methionine (SAM) was observed for three methyltransferases, while one unexpectedly showed no measurable affinity for SAH. Collectively, these results confirm each hypothetical enzyme is a functional 16S rRNA (m1A1408) methyltransferase but also point to further potential mechanistic variation within this enzyme family. PMID:24963996

  13. Photocarrier dynamics in transition metal dichalcogenide alloy Mo0.5W0.5S2.

    PubMed

    He, Jiaqi; He, Dawei; Wang, Yongsheng; Zhao, Hui

    2015-12-28

    We report a transient absorption study of photocarrier dynamics in transition metal dichalcogenide alloy, Mo0.5W0.5S2. Photocarriers were injected by a 400-nm pump pulse and detected by a 660-nm probe pulse. We observed a fast energy relaxation process of about 0.7 ps. The photocarrier lifetime is in the range of 50 - 100 ps, which weakly depends on the injected photocarrier density and is a few times shorter than MoS2 and WS2, reflecting the relatively lower crystalline quality of the alloy. Saturable absorption was also observed in Mo0.5W0.5S2, with a saturation energy fluence of 32 μJ cm(-2). These results provide important parameters on photocarrier properties of transition metal dichalcogenide alloys. PMID:26832001

  14. Analysis of the Precursor rRNA Fractions of Rapidly Growing Mycobacteria: Quantification by Methods That Include the Use of a Promoter (rrnA P1) as a Novel Standard†

    PubMed Central

    Menéndez, María del Carmen; Rebollo, María José; Núñez, María del Carmen; Cox, Robert A.; García, María Jesús

    2005-01-01

    Mycobacterial species are able to control rRNA production through variations in the number and strength of promoters controlling their rrn operons. Mycobacterium chelonae and M. fortuitum are members of the rapidly growing mycobacterial group. They carry a total of five promoters each, encoded, respectively, by one and two rrn operons per genome. Quantification of precursor rrn transcriptional products (pre-rrn) has allowed detection of different promoter usage during cell growth. Bacteria growing in several culture media with different nutrient contents were compared. Balanced to stationary phases were analyzed. Most promoters were found to be used at different levels depending on the stage of bacterial growth and the nutrient content of the culture medium. Some biological implications are discussed. Sequences of the several promoters showed motifs that could be correlated to their particular level of usage. A product corresponding to the first rrnA promoter in both species, namely, rrnA P1, was found to contribute at a low and near-constant level to pre-rRNA synthesis, regardless of the culture medium used and the stage of growth analyzed. This product was used as a standard to quantitate rRNA gene expression by real-time PCR when M. fortuitum infected macrophages. It was shown that this bacterium actively synthesizes rRNA during the course of infection and that one of its rrn operons is preferentially used under such conditions. PMID:15629925

  15. Theoretical study on the adsorption of carbon dioxide on individual and alkali-metal doped MOF-5s

    NASA Astrophysics Data System (ADS)

    Ha, Nguyen Thi Thu; Lefedova, O. V.; Ha, Nguyen Ngoc

    2016-01-01

    Density functional theory (DFT) calculations were performed to investigate the adsorption of carbon dioxide (CO2) on metal-organic framework (MOF-5) and alkali-metal (Li, K, Na) doped MOF-5s. The adsorption energy calculation showed that metal atom adsorption is exothermic in MOF-5 system. Moreover, alkali-metal doping can significantly improve the adsorption ability of carbon dioxide on MOF-5. The best influence is observed for Li-doping.

  16. Foraminoplastic transfacet epidural endoscopic approach for removal of intraforaminal disc herniation at the L5-S1 level

    PubMed Central

    Kaczmarczyk, Jacek; Nowakowski, Andrzej; Sulewski, Adam

    2014-01-01

    Transforaminal endoscopic disc removal in the L5-S1 motion segment of the lumbar spine creates a technical challenge due to anatomical reasons and individual variability. The majority of surgeons prefer a posterior classical or minimally invasive approach. There is only one foraminoplastic modification of the technique in the literature so far. In this paper we present a new technique with a foraminoplastic transfacet approach that may be suitable in older patients with advanced degenerative disease of the spine. PMID:24729817

  17. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  18. A Tale of Two Lines: Searching for the 5s - 5p Resonance Lines in Pm-like Ion Spectra

    SciTech Connect

    Trabert, E; Vilkas, M J; Ishikawa, Y

    2008-10-24

    Highly charged ions in the promethium sequence have been suggested to show spectral features resembling the alkali sequence ions. Guided by calculations, the 5s-5p resonance lines have been sought in a variety of experiments. In the light of the most extensive calculations of Pm-like ions yet, applying relativistic multi-reference Moeller-Plesset second-order perturbation theory, the experimental evidence is reviewed and the line identification problem assessed.

  19. Describing a new syndrome in L5-S1 disc herniation: Sexual and sphincter dysfunction without pain and muscle weakness

    PubMed Central

    Akca, Nezih; Ozdemir, Bulent; Kanat, Ayhan; Batcik, Osman Ersagun; Yazar, Ugur; Zorba, Orhan Unal

    2014-01-01

    Context: Little seems to be known about the sexual dysfunction (SD) in lumbar intervertebral disc herniation. Aims: Investigation of sexual and sphincter dysfunction in patient with lumbar disc hernitions. Settings and Design: A retrospective analysis. Materials and Methods: Sexual and sphincter dysfunction in patients admitted with lumbar disc herniations between September 2012-March 2014. Statistical Analysis Used: Statistical analysis was performed using the Predictive Analytics SoftWare (PASW) Statistics 18.0 for Windows (Statistical Package for the Social Sciences, SPSS Inc., Chicago, Illinois). The statistical significance was set at P < 0.05. The Wilcoxon signed ranks test was used to evaluate the difference between patients. Results: Four patients with sexual and sphincter dysfunction were found, including two women and two men, aged between 20 and 52 years. All of them admitted without low back pain. In addition, on neurological examination, reflex and motor deficit were not found. However, almost all patients had perianal sensory deficit and sexual and sphincter dysfunction. Magnetic resonance imaging (MRI) of three patients displayed a large extruded disc fragment at L5-S1 level on the left side. In fourth patient, there were not prominent disc herniations. There was not statistically significant difference between pre-operative and post-operative sexual function, anal-urethral sphincter function, and perianal sensation score. A syndrome in L5-S1 disc herniation with sexual and sphincter dysfunction without pain and muscle weakness was noted. We think that it is crucial for neurosurgeons to early realise that paralysis of the sphincter and sexual dysfunction are possible in patients with lumbar L5-S1 disc disease. Conclusion: A syndrome with perianal sensory deficit, paralysis of the sphincter, and sexual dysfunction may occur in patients with lumbar L5-S1 disc disease. The improvement of perianal sensory deficit after surgery was counteracted by a trend

  20. Minimally Invasive Transforaminal Lumbar Interbody Fusion at L5-S1 through a Unilateral Approach: Technical Feasibility and Outcomes

    PubMed Central

    Choi, Won-Suh; Kim, Jin-Sung; Ryu, Kyeong-Sik; Hur, Jung-Woo; Seong, Ji-Hoon

    2016-01-01

    Background. Minimally invasive spinal transforaminal lumbar interbody fusion (MIS-TLIF) at L5-S1 is technically more demanding than it is at other levels because of the anatomical and biomechanical traits. Objective. To determine the clinical and radiological outcomes of MIS-TLIF for treatment of single-level spinal stenosis low-grade isthmic or degenerative spondylolisthesis at L5-S1. Methods. Radiological data and electronic medical records of patients who underwent MIS-TLIF between May 2012 and December 2014 were reviewed. Fusion rate, cage position, disc height (DH), disc angle (DA), disc slope angle, segmental lordotic angle (SLA), lumbar lordotic angle (LLA), and pelvic parameters were assessed. For functional assessment, the visual analogue scale (VAS), Oswestry disability index (ODI), and patient satisfaction rate (PSR) were utilized. Results. A total of 21 levels in 21 patients were studied. DH, DA, SLA, and LLA had increased from their preoperative measures at the final follow-up. Fusion rate was 86.7% (18/21) at 12 months' follow-up. The most common cage position was anteromedial (15/21). The mean VAS scores for back and leg pain mean ODI scores improved significantly at the final follow-up. PSR was 88%. Cage subsidence was observed in 33.3% (7/21). Conclusions. The clinical and radiologic outcomes after MIS-TLIF at L5-S1 in patients with spinal stenosis or spondylolisthesis are generally favorable. PMID:27433472

  1. Temporal and tissue specific gene expression patterns of the zebrafish kinesin-1 heavy chain family, kif5s, during development

    PubMed Central

    Campbell, Philip D.; Marlow, Florence L.

    2013-01-01

    Homo- and heterodimers of Kif5 proteins form the motor domain of Kinesin-1, a major plus-end directed microtubule motor. Kif5s have been implicated in the intracellular transport of organelles, vesicles, proteins, and RNAs in many cell types. There are three mammalian KIF5s. KIF5A and KIF5C proteins are strictly neural in mouse whereas, KIF5B is ubiquitously expressed. Mouse knockouts indicate crucial roles for KIF5 in development and human mutations in KIF5A lead to the neurodegenerative disease Hereditary Spastic Paraplegia. However, the developmental functions and the extent to which individual kif5 functions overlap have not been elucidated. Zebrafish possess five kif5 genes: kif5Aa, kif5Ab, kif5Ba, kif5Bb, and kif5C. Here we report their tissue specific expression patterns in embryonic and larval stages. Specifically, we find that kif5As are strictly zygotic and exhibit neural-specific expression. In contrast, kif5Bs exhibit strong maternal contribution and are ubiquitously expressed. Lastly, kif5C exhibits weak maternal expression followed by enrichment in neural populations. In addition, kif5s show distinct expression domains in the larval retina. PMID:23684767

  2. Molecular dissection of the rDNA array and of the 5S rDNA gene in Meloidogyne artiellia: phylogenetic and diagnostic implications.

    PubMed

    Veronico, Pasqua; De Luca, Francesca; De Giorgi, Carla

    2004-06-01

    The sequence of a 13.423 nucleotide genomic fragment has been determined for the plant parasitic nematode Meloidogyne artiellia. It contains an entire rDNA cluster, the bordering intergenic regions and portions of the flanking coding regions. The sequence analysis of the rDNA repeats suggests homogeneity in M. artiellia, thus providing a further indication of the usefulness of these genes for the diagnostic identification of this species. The comparison of the secondary structures of the internal transcribed spacer 2 region in several Meloidogyne species indicates that RNA folding predictions can be used as a tool of potential diagnostic relevance. The other ribosomal gene, 5S rDNA, has been demonstrated to be functional and located near the trans-spliced leader sequences, in the same arrangement found in the distantly related nematode Caenorhabditis elegans but never in other Meloidogyne thus providing species-specific markers for the identification of several Thylenchida parasitic nematodes. PMID:15135452

  3. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.

    PubMed

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G

    2005-09-01

    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  4. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    SciTech Connect

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-15

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  5. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    NASA Astrophysics Data System (ADS)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  6. [Strategy of selecting 16S rRNA hypervariable regions for metagenome-phylogenetic marker genes based analysis].

    PubMed

    Zhang, Jun-yi; Zhu, Bing-chuan; Xu, Chao; Ding, Xiao; Li, Jun-feng; Zhang, Xue-gong; Lu, Zu-hong

    2015-11-01

    The advent of next generation sequencing technology enables parallel analysis of the whole microbial community from multiple samples. Particularly, sequencing 16S rRNA hypervariable tags has become the most efficient and cost-effective method for assessing microbial diversity. Due to its short read length of the 2nd-generation sequencing methods that cannot cover the full 16S rRNA genomic region, specific hypervariable regions or V-regions must be selected to act as the proxy. Over the past decade, selection of V-regions has not been consistent in assessing microbial diversity. Here we evaluated the current strategies of selecting 16S rRNA hypervariable regions for surveying microbial diversity. The environmental condition was considered as one of the important factors for selection of 16S rRNA hypervariable regions. We suggested that a pilot study to test different V-regions is required in bacterial diversity studies based on 16S rRNA genes. PMID:26915214

  7. RRNA and dnaK relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legume trees in Costa Rica.

    PubMed

    Parker, Matthew A

    2004-05-01

    Enzyme electrophoresis and sequencing of rRNA and dnaK genes revealed high genetic diversity among root nodule bacteria from the Costa Rican trees Andira inermis, Dalbergia retusa, Platymiscium pinnatum (Papilionoideae tribe Dalbergieae) and Lonchocarpus atropurpureus (Papilionoideae tribe Millettieae). A total of 21 distinct multilocus genotypes [ETs (electrophoretic types)] was found among the 36 isolates analyzed, and no ETs were shared in common by isolates from different legume hosts. However, three of the ETs from D. retusa were identical to Bradyrhizobium sp. isolates detected in prior studies of several other legume genera in both Costa Rica and Panama. Nearly full-length 16S rRNA sequences and partial 23S rRNA sequences confirmed that two isolates from D. retusa were highly similar or identical to Bradyrhizobium strains isolated from the legumes Erythrina and Clitoria (Papilionoideae tribe Phaseoleae) in Panama. rRNA sequences for five isolates from L. atropurpureus, P. pinnatum and A. inermis were not closely related to any currently known strains from Central America or elsewhere, but had affinities to the reference strains Bradyrhizobium japonicum USDA 110 (three isolates) or to B. elkanii USDA 76 (two isolates). A phylogenetic tree for 21 Bradyrhizobium strains based on 603 bp of the dnaK gene showed several significant conflicts with the rRNA tree, suggesting that genealogical relationships may have been altered by lateral gene transfer events. PMID:15214639

  8. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes.

    PubMed

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-06-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  9. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes

    PubMed Central

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-01-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  10. Group I introns are inherited through common ancestry in the nuclear-encoded rRNA of Zygnematales (Charophyceae).

    PubMed Central

    Bhattacharya, D; Surek, B; Rüsing, M; Damberger, S; Melkonian, M

    1994-01-01

    Group I introns are found in organellar genomes, in the genomes of eubacteria and phages, and in nuclear-encoded rRNAs. The origin and distribution of nuclear-encoded rRNA group I introns are not understood. To elucidate their evolutionary relationships, we analyzed diverse nuclear-encoded small-subunit rRNA group I introns including nine sequences from the green-algal order Zygnematales (Charophyceae). Phylogenetic analyses of group I introns and rRNA coding regions suggest that lateral transfers have occurred in the evolutionary history of group I introns and that, after transfer, some of these elements may form stable components of the host-cell nuclear genomes. The Zygnematales introns, which share a common insertion site (position 1506 relative to the Escherichia coli small-subunit rRNA), form one subfamily of group I introns that has, after its origin, been inherited through common ancestry. Since the first Zygnematales appear in the middle Devonian within the fossil record, the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding region for 350-400 million years. PMID:7937917

  11. METAXA2: improved identification and taxonomic classification of small and large subunit rRNA in metagenomic data.

    PubMed

    Bengtsson-Palme, Johan; Hartmann, Martin; Eriksson, Karl Martin; Pal, Chandan; Thorell, Kaisa; Larsson, Dan Göran Joakim; Nilsson, Rolf Henrik

    2015-11-01

    The ribosomal rRNA genes are widely used as genetic markers for taxonomic identification of microbes. Particularly the small subunit (SSU; 16S/18S) rRNA gene is frequently used for species- or genus-level identification, but also the large subunit (LSU; 23S/28S) rRNA gene is employed in taxonomic assignment. The METAXA software tool is a popular utility for extracting partial rRNA sequences from large sequencing data sets and assigning them to an archaeal, bacterial, nuclear eukaryote, mitochondrial or chloroplast origin. This study describes a comprehensive update to METAXA - METAXA2 - that extends the capabilities of the tool, introducing support for the LSU rRNA gene, a greatly improved classifier allowing classification down to genus or species level, as well as enhanced support for short-read (100 bp) and paired-end sequences, among other changes. The performance of METAXA2 was compared to other commonly used taxonomic classifiers, showing that METAXA2 often outperforms previous methods in terms of making correct predictions while maintaining a low misclassification rate. METAXA2 is freely available from http://microbiology.se/software/metaxa2/. PMID:25732605

  12. Spatial distribution of Escherichia coli in the mouse large intestine inferred from rRNA in situ hybridization.

    PubMed Central

    Poulsen, L K; Lan, F; Kristensen, C S; Hobolth, P; Molin, S; Krogfelt, K A

    1994-01-01

    Fluorescent oligonucleotide probes targeting rRNA were used to develop an in situ hybridization technique by which the spatial distribution of Escherichia coli in the large intestines of streptomycin-treated mice was determined. Single E. coli cells were identified in thin frozen sections from the large intestines by the use of a probe specific for E. coli 23S rRNA. Furthermore, the total bacterial population was visualized with an rRNA probe targeting the domain Bacteria. By this technique, all E. coli cells were seen embedded in the mucosal material overlying the epithelial cells of the large intestine, and no direct attachment to the epithelium was observed. Images PMID:7927805

  13. PCR primers to amplify 16S rRNA genes from cyanobacteria.

    PubMed Central

    Nübel, U; Garcia-Pichel, F; Muyzer, G

    1997-01-01

    We developed and tested a set of oligonucleotide primers for the specific amplification of 16S rRNA gene segments from cyanobacteria and plastids by PCR. PCR products were recovered from all cultures of cyanobacteria and diatoms that were checked but not from other bacteria and archaea. Gene segments selectively retrieved from cyanobacteria and diatoms in unialgal but nonaxenic cultures and from cyanobionts in lichens could be directly sequenced. In the context of growing sequence databases, this procedure allows rapid and phylogenetically meaningful identification without pure cultures or molecular cloning. We demonstrate the use of this specific PCR in combination with denaturing gradient gel electrophoresis to probe the diversity of oxygenic phototrophic microorganisms in cultures, lichens, and complex microbial communities. P