Science.gov

Sample records for 5s rrna system

  1. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  2. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  3. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  4. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  5. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  6. Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA.

    PubMed

    Bullerwell, Charles E; Schnare, Murray N; Gray, Michael W

    2003-03-01

    Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.

  7. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  8. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

    2001-01-01

    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  9. Direct 5S rRNA assay for monitoring mixed-culture bioprocesses

    SciTech Connect

    Stoner, D.L.; Bulmer, D.K.; Ward, T.E.

    1996-06-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis in denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the general Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. 40 refs., 12 figs., 1 tab.

  10. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  11. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    PubMed

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  12. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  13. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  14. Identification of the gene encoding the 5S ribosomal RNA maturase in Bacillus subtilis: mature 5S rRNA is dispensable for ribosome function.

    PubMed Central

    Condon, C; Brechemier-Baey, D; Beltchev, B; Grunberg-Manago, M; Putzer, H

    2001-01-01

    Over 25 years ago, Pace and coworkers described an activity called RNase M5 in Bacillus subtilis cell extracts responsible for 5S ribosomal RNA maturation (Sogin & Pace, Nature, 1974, 252:598-600). Here we show that RNase M5 is encoded by a gene of previously unknown function that is highly conserved among the low G + C gram-positive bacteria. We propose that the gene be named rnmV. The rnmV gene is nonessential. B. subtilis strains lacking RNase M5 do not make mature 5S rRNA, indicating that this process is not necessary for ribosome function. 5S rRNA precursors can, however, be found in both free and translating ribosomes. In contrast to RNase E, which cleaves the Escherichia coli 5S precursor in a single-stranded region, which is then trimmed to yield mature 5S RNA, RNase M5 cleaves the B. subtilis equivalent in a double-stranded region to yield mature 5S rRNA in one step. For the most part, eubacteria contain one or the other system for 5S rRNA production, with an imperfect division along gram-negative and gram-positive lines. A potential correlation between the presence of RNase E or RNase M5 and the single- or double-stranded nature of the predicted cleavage sites is explored. PMID:11233981

  15. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  16. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    PubMed

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level.

  17. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    PubMed

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis.

  18. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  19. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  20. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    PubMed

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  1. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    PubMed

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  2. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria.

    PubMed

    Smirnov, Alexandre; Tarassov, Ivan; Mager-Heckel, Anne-Marie; Letzelter, Michel; Martin, Robert P; Krasheninnikov, Igor A; Entelis, Nina

    2008-04-01

    RNA import into mitochondria is a widespread phenomenon. Studied in details for yeast, protists, and plants, it still awaits thorough investigation for human cells, in which the nuclear DNA-encoded 5S rRNA is imported. Only the general requirements for this pathway have been described, whereas specific protein factors needed for 5S rRNA delivery into mitochondria and its structural determinants of import remain unknown. In this study, a systematic analysis of the possible role of human 5S rRNA structural elements in import was performed. Our experiments in vitro and in vivo show that two distinct regions of the human 5S rRNA molecule are needed for its mitochondrial targeting. One of them is located in the proximal part of the helix I and contains a conserved uncompensated G:U pair. The second and most important one is associated with the loop E-helix IV region with several noncanonical structural features. Destruction or even destabilization of these sites leads to a significant decrease of the 5S rRNA import efficiency. On the contrary, the beta-domain of the 5S rRNA was proven to be dispensable for import, and thus it can be deleted or substituted without affecting the 5S rRNA importability. This finding was used to demonstrate that the 5S rRNA can function as a vector for delivering heterologous RNA sequences into human mitochondria. 5S rRNA-based vectors containing a substitution of a part of the beta-domain by a foreign RNA sequence were shown to be much more efficiently imported in vivo than the wild-type 5S rRNA.

  3. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    PubMed

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA.

  4. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  5. Release of ribosome-bound 5S rRNA upon cleavage of the phosphodiester bond between nucleotides A54 and A55 in 5S rRNA.

    PubMed

    Holmberg, L; Nygård, O

    2000-11-01

    Reticulocyte lysates contain ribosome-bound and free populations of 5S RNA. The free population is sensitive to nuclease cleavage in the internal loop B, at the phosphodiester bond connecting nucleotides A54 and A55. Similar cleavage sites were detected in 5S rRNA in 60S subunits and 80S ribosomes. However, 5S rRNA in reticulocyte polysomes is insensitive to cleavage unless ribosomes are salt-washed. This suggests that a translational factor protects the backbone surrounding A54 from cleavage in polysomes. Upon nuclease treatment of mouse 60S subunits or reticulocyte lysates a small population of ribosomes released its 5S rRNA together with ribosomal protein L5. Furthermore, rRNA sequences from 5.8S, 28S and 18S rRNA were released. In 18S rRNA the sequences mainly originate from the 630 loop and stem (helix 18) in the 5' domain, whereas in 28S rRNA a majority of fragments is derived from helices 47 and 81 in domains III and V, respectively. We speculate that this type of rRNA-fragmentation may mimic a ribosome degradation pathway.

  6. Triphosphate residues at the 5' ends of rRNA precursor and 5S RNA from Dictyostelium discoideum.

    PubMed Central

    Batts-Young, B; Lodish, H F

    1978-01-01

    We present here direct evidence for the preservation of a transcriptional initiation sequence in a eukaryotic rRNA precursor: the 5'-end group for precursor to 17S rRNA (p17S RNA) from Dictyostelium discoideum is identified as the triphosphate residue pppA-. We also show that mature 5S RNA form Dictyostelium bears a different triphosphate residue, pppG-. In contrast, we find no evidence for more than one phosphate at the 5' end of the 25S rRNA precursor (p25S RNA). These observations indicate that synthesis of the large ribosomal RNAs of Dictyostelium begins with the 5'-terminal sequence of the p17S RNA, and that 5S RNA transcription must be initiated independently, despite the close association of the 5S and rRNA coding segments. Images PMID:204930

  7. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  8. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    PubMed

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  9. Seasonal dynamics of bacterioplankton community structure in a eutrophic lake as determined by 5S rRNA analysis.

    PubMed

    Höfle, M G; Haas, H; Dominik, K

    1999-07-01

    Community structure of bacterioplankton was studied during the major growth season for phytoplankton (April to October) in the epilimnion of a temperate eutrophic lake (Lake Plusssee, northern Germany) by using comparative 5S rRNA analysis. Estimates of the relative abundances of single taxonomic groups were made on the basis of the amounts of single 5S rRNA bands obtained after high-resolution electrophoresis of RNA directly from the bacterioplankton. Full-sequence analysis of single environmental 5S rRNAs enabled the identification of single taxonomic groups of bacteria. Comparison of partial 5S rRNA sequences allowed the detection of changes of single taxa over time. Overall, the whole bacterioplankton community showed two to eight abundant (>4% of the total 5S rRNA) taxa. A distinctive seasonal succession was observed in the taxonomic structure of this pelagic community. A rather-stable community structure, with seven to eight different taxonomic units, was observed beginning in April during the spring phytoplankton bloom. A strong reduction in this diversity occurred at the beginning of the clear-water phase (early May), when only two to four abundant taxa were observed, with one taxon dominating (up to 72% of the total 5S rRNA). The community structure during summer stagnation (June and July) was characterized by frequent changes of different dominating taxa. During late summer, a dinoflagellate bloom (Ceratium hirudinella) occurred, with Comamonas acidovorans (beta-subclass of the class Proteobacteria) becoming the dominant bacterial species (average abundance of 43% of the total 5S rRNA). Finally, the seasonal dynamics of the community structure of bacterioplankton were compared with the abundances of other major groups of the aquatic food web, such as phyto- and zooplankton, revealing that strong grazing pressure by zooplankton can reduce microbial diversity substantially in pelagic environments.

  10. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  11. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  12. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  13. Characterization of a novel association between two trypanosome-specific proteins and 5S rRNA.

    PubMed

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC.

  14. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  15. Chromosomal localization of 5S rRNA gene loci and the implications for relationships within the Allium complex.

    PubMed

    Lee, S H; Do, G S; Seo, B B

    1999-01-01

    Chromosomal localizations and distribution patterns of the 5S rRNA genes by means of fluorescence in-situ hybridization in diploid Allium species could help to classify species into chromosome types and aid in determining relationships among genomes. All eleven diploid species were classified into five types, A to E. Species of type A showed a pair of 5S rRNA signals on the short arm of chromosome 5 and two pairs of signals on both arms of chromosome 7. Species of types B and C showed one pair and two pairs of signals on the short arm of chromosome 7, respectively. Type D species showed two pairs of signals on the satellite region of the short arm and a pair of signals on the long arm of chromosome 7. Type E species showed three distinct 5S rRNA gene loci signals on the short arm of chromosome 7. Information on chromosomal localization of 5S rRNA gene loci and distribution patterns within chromosomes in diploid Allium species could help to infer the pathway of origin of the three kinds of alloploid species. Data indicate that A. wakegi is an allopolyploid with genomes of types B and C, and A. deltoide-fistulosum is an allotetraploid derived from a natural hybridization between different species within chromosome type A. Results indicate that A. senescens is an allopolyploid with type B chromosomes and an unidentified chromosomal type. PMID:10328620

  16. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  17. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  18. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed Central

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-01-01

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  19. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period.

  20. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  1. Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

    PubMed Central

    Carol, P; Rozier, C; Lazaro, E; Ballesta, J P; Mache, R

    1993-01-01

    The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain. Images PMID:8441674

  2. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  3. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  4. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    PubMed

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  5. A 5 S rRNA gene is present in the mitochondrial genome of the protist Reclinomonas americana but is absent from red algal mitochondrial DNA.

    PubMed

    Lang, B F; Goff, L J; Gray, M W

    1996-09-01

    Except in the case of land plants, mitochondrial ribosomes apparently lack a 5 S rRNA species, even though this small RNA is a component of all prokaryotic, chloroplast and eukaryotic cytosol ribosomes. In plants, the mitochondrial 5 S rRNA is encoded by mtDNA and differs in sequence from the 5 S rRNA specified by plant nuclear and chloroplast genomes. A distinctive 5 S rRNA component has not been found in the mitochondrial ribosomes of non-plant eukaryotes and, with the notable exception of the chlorophycean alga, Prototheca wickerhamii, a 5 S rRNA gene has not been identified in those non-plant mtDNAs characterized to date. Here, we report the presence of a 5 S rRNA gene in the mtDNA of the heterotrophic flagellate Reclinomonas americana. This unicellular eukaryote is a member of the jakobid flagellates, an early-diverging group of protists that share ultrastructural characteristics with the retortamonads, primitive protists that lack mitochondria. We report sequence data from the mtDNAs of the red algae Porphyra purpurea and Gracilariopsis lemaneiformis, which we use to evaluate a recent claim that a 5 S rRNA gene exists in the mtDNA of a third rhodophyte alga, Chondrus crispus. Our results lead us to the opposite conclusion: that a 5 S rRNA gene is not encoded by red algal mtDNA. In view of the accumulating evidence favoring a monophyletic origin of the mitochondrial genome, it is likely that a 5 S rRNA gene was present in an ancestral proto-mitochondrial genome, and that contemporary mtDNA-encoded 5 S rRNA genes have all descended from this ancestral gene. Considering the highly restricted phylogenetic distribution of identified mtDNA-encoded 5 S rRNA genes, it follows that the mitochondrial 5 S rRNA gene must have been lost multiple times during evolutionary diversification of the eukaryotic lineage.

  6. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  7. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment. PMID:22724546

  8. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

  9. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    PubMed

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  10. What does the 5S rRNA multigene family tell us about the origin of the annual Triticeae (Poaceae)?

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2013-05-01

    We have investigated the complex relationships among the annual genera within the tribe Triticeae through phylogenetic analyses of the 5S rRNA multigene family. Cloned sequences were assigned to groups of orthologous sequences, called unit classes, that were subjected to several analyses including BLAST (Basic Local Alignment Search Tool) searches to assess possible ancestral relationships with perennial genera; phylogenetic analyses using parsimony (Pars), maximum likelihood (ML), and Bayesian methods; and minimum reticulation networks from the Pars, ML, and Bayesian trees. In this study, we included genera with both annual and perennial species, such as Dasypyrum, Hordeum, and Secale. BLAST pointed to Pseudoroegneria (carrier of the St genome) and possibly Thinopyrum (carrier of the J genome) as the potential next of kin. However, Thinopyrum and Pseudoroegneria have never fallen together on the individual trees with the former generally associated with Crithopsis, Aegilops, Triticum, and Dasypyrum, while the latter is usually associated with the rest of the genera within Triticeae. The "long" unit classes placed Dasypyrum breviaristatum together with Dasypyrum villosum, whereas the "short" unit classes put them far apart on the trees. None of the gene trees alone was able to summarize the complex relationships among the genera, in line with previous results in the Triticeae. However, the application of tools designed to display phylogenetic networks was able to depict the complex links among the genera based on the short and the long gene trees, including the close link between Thinopyrum and Pseudoroegneria suggested by the phylogenetic analyses. In addition, our analyses provide support for the hypothesis that at least some annual Triticeae taxa are derived from their perennial relatives. PMID:23789993

  11. A novel association between two trypanosome-specific factors and the conserved L5-5S rRNA complex.

    PubMed

    Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis.

  12. Natural Microbial Community Compositions Compared by a Back-Propagating Neural Network and Cluster Analysis of 5S rRNA

    PubMed Central

    Noble, P. A.; Bidle, K. D.; Fletcher, M.

    1997-01-01

    The community compositions of free-living and particle-associated bacteria in the Chesapeake Bay estuary were analyzed by comparing banding patterns of stable low-molecular-weight RNA (SLMW RNA) which include 5S rRNA and tRNA molecules. By analyzing images of autoradiographs of SLMW RNAs on polyacrylamide gels, band intensities of 5S rRNA were converted to binary format for transmission to a back-propagating neural network (NN). The NN was trained to relate binary input to sample stations, collection times, positions in the water column, and sample types (e.g., particle-associated versus free-living communities). Dendrograms produced by using Euclidean distance and average and Ward's linkage methods on data of three independently trained NNs yielded the following results. (i) Community compositions of Chesapeake Bay water samples varied both seasonally and spatially. (ii) Although there was no difference in the compositions of free-living and particle-associated bacteria in the summer, these community types differed significantly in the winter. (iii) In the summer, most bay samples had a common 121-nucleotide 5S rRNA molecule. Although this band occurred in the top water of midbay samples, it did not occur in particle-associated communities of bottom-water samples. (iv) Regardless of the season, midbay samples had the greatest variety of 5S rRNA sizes. The utility of NNs for interpreting complex banding patterns in electrophoresis gels was demonstrated. PMID:16535593

  13. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  14. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    PubMed

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  15. Interaction of ribosomal proteins S5, S6, S11, S12, S18 and S21 with 16 S rRNA.

    PubMed

    Stern, S; Powers, T; Changchien, L M; Noller, H F

    1988-06-20

    We have examined the effects of assembly of ribosomal proteins S5, S6, S11, S12, S18 and S21 on the reactivities of residues in 16 S rRNA towards chemical probes. The results show that S6, S18 and S11 interact with the 690-720 and 790 loop regions of 16 S rRNA in a highly co-operative manner, that is consistent with the previously defined assembly map relationships among these proteins. The results also indicate that these proteins, one of which (S18) has previously been implicated as a component of the ribosomal P-site, interact with residues near some of the recently defined P-site (class II tRNA protection) nucleotides in 16 S rRNA. In addition, assembly of protein S12 has been found to result in the protection of residues in both the 530 stem/loop and the 900 stem regions; the latter group is closely juxtaposed to a segment of 16 S rRNA recently shown to be protected from chemical probes by streptomycin. Interestingly, both S5 and S12 appear to protect, to differing degrees, a well-defined set of residues in the 900 stem/loop and 5'-terminal regions. These observations are discussed in terms of the effects of S5 and S12 on streptomycin binding, and in terms of the class III tRNA protection found in the 900 stem of 16 S rRNA. Altogether these results show that many of the small subunit proteins, which have previously been shown to be functionally important, appear to be associated with functionally implicated segments of 16 S rRNA.

  16. Species identification of Crassostrea and Ostrea oysters by polymerase chain reaction amplification of the 5S rRNA gene.

    PubMed

    Cross, Ismael; Rebordinos, Laureana; Diaz, Edgardo

    2006-01-01

    A specific multiplex polymerase chain reaction (PCR) was developed for the identification of Crassostrea angulata, C. gigas, Ostrea edulis, and O. stentina oyster species. Universal primers were used for the amplification of complete repetition units of 5S rDNA in each of the 4 species. The alignment of the obtained sequences was the basis for the specific design of species-specific primers (ED1, ED2, ST1, ST2, CR1, and CR2) located in the nontranscribed spacer regions. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed identification of Crassostrea and Ostrea species. A multiplex PCR with a set of the 6 designed primers showed that they did not interfere with each other and bound specifically to the DNA target. This genetic marker can be very useful for traceability of the species, application in the management of oyster cultures, and conservation of the genetic resources of the species. PMID:16512239

  17. Cocrystallizing natural RNA with its unnatural mirror image: biochemical and preliminary X-ray diffraction analysis of a 5S rRNA A-helix racemate

    SciTech Connect

    Förster, Charlotte; Brauer, Arnd B. E.; Lehmann, Daniel; Borowski, Tordis; Brode, Svenja; Fürste, Jens P.; Perbandt, Markus; Betzel, Christian

    2007-10-01

    A 5S rRNA A-helix 7-mer oligonucleotide was chemically synthesized both as d-RNA and as l-RNA, biochemically investigated, crystallized as a stochiometric racemate and examined by X-ray diffraction. Chemically synthesized RNAs with the unnatural l-configuration possess enhanced in vivo stability and nuclease resistance, which is a highly desirable property for pharmacological applications. For a structural comparison, both l- and d-RNA oligonucleotides of a shortened Thermus flavus 5S rRNA A-helix were chemically synthesized. The enantiomeric RNA duplexes were stochiometrically cocrystallized as a racemate, which enabled analysis of the d- and l-RNA enantiomers in the same crystals. In addition to a biochemical investigation, diffraction data were collected to 3.0 Å resolution using synchrotron radiation. The crystals belonged to space group P3{sub 1}21, with unit-cell parameters a = b = 35.59, c = 135.30 Å, γ = 120° and two molecules per asymmetric unit.

  18. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  19. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

  20. Regulation of the rplY gene encoding 5S rRNA binding protein L25 in Escherichia coli and related bacteria.

    PubMed

    Aseev, Leonid V; Bylinkina, Natalia S; Boni, Irina V

    2015-05-01

    Ribosomal protein (r-protein) L25 is one of the three r-proteins (L25, L5, L18) that interact with 5S rRNA in eubacteria. Specific binding of L25 with a certain domain of 5S r-RNA, a so-called loop E, has been studied in detail, but information about regulation of L25 synthesis has remained totally lacking. In contrast to the rplE (L5) and rplR (L18) genes that belong to the polycistronic spc-operon and are regulated at the translation level by r-protein S8, the rplY (L25) gene forms an independent transcription unit. The main goal of this work was to study the regulation of the rplY expression in vivo. We show that the rplY promoter is down-regulated by ppGpp and its cofactor DksA in response to amino acid starvation. At the level of translation, the rplY expression is subjected to the negative feedback control. The 5'-untranslated region of the rplY mRNA comprises specific sequence/structure features, including an atypical SD-like sequence, which are highly conserved in a subset of gamma-proteobacterial families. Despite the lack of a canonical SD element, the rplY'-'lacZ single-copy reporter showed unusually high translation efficiency. Expression of the rplY gene in trans decreased the translation yield, indicating the mechanism of autogenous repression. Site-directed mutagenesis of the rplY 5' UTR revealed an important role of the conserved elements in the translation control. Thus, the rplY expression regulation represents one more example of regulatory pathways that control ribosome biogenesis in Escherichia coli and related bacteria.

  1. Mutations in TFIIIA that increase stability of the TFIIIA-5 S rRNA gene complex: unusual effects on the kinetics of complex assembly and dissociation.

    PubMed

    Brady, Kristina L; Ponnampalam, Stephen N; Bumbulis, Michael J; Setzer, David R

    2005-07-22

    We have identified four mutations in Xenopus TFIIIA that increase the stability of TFIIIA-5 S rRNA gene complexes. In each case, the mutation has a relatively modest effect on equilibrium binding affinity. In three cases, these equilibrium binding effects can be ascribed primarily to decreases in the rate constant for protein-DNA complex dissociation. In the fourth case, however, a substitution of phenylalanine for the wild-type leucine at position 148 in TFIIIA results in much larger compensating changes in the kinetics of complex assembly and dissociation. The data support a model in which a relatively unstable population of complexes with multi-component dissociation kinetics forms rapidly; complexes then undergo a slow conformational change that results in very stable, kinetically homogeneous TFIIIA-DNA complexes. The L148F mutant protein acts as a particularly potent transcriptional activator when it is fused to the VP16 activation domain and expressed in yeast cells. Substitution of L148 to tyrosine or tryptophan produces an equally strong transcriptional activator. Substitution to histidine results in genetic and biochemical effects that are more modest than, but similar to, those observed with the L148F mutation. We propose that an amino acid with a planar side chain at position 148 can intercalate between adjacent base pairs in the intermediate element of the 5 S rRNA gene. Intercalation occurs slowly but results in a very stable DNA-protein complex. These results suggest that transcriptional activation by a cis-acting sequence element is largely dependent on the kinetic, rather than the thermodynamic, stability of the complex formed with an activator protein. Thus, transcriptional activation is dependent in large part on the lifetime of the activator-DNA complex rather than on binding site occupancy at steady state. Introduction of intercalating amino acids into zinc finger proteins may be a useful tool for producing artificial transcription factors with

  2. Regulation of the rplY gene encoding 5S rRNA binding protein L25 in Escherichia coli and related bacteria

    PubMed Central

    Aseev, Leonid V.; Bylinkina, Natalia S.; Boni, Irina V.

    2015-01-01

    Ribosomal protein (r-protein) L25 is one of the three r-proteins (L25, L5, L18) that interact with 5S rRNA in eubacteria. Specific binding of L25 with a certain domain of 5S r-RNA, a so-called loop E, has been studied in detail, but information about regulation of L25 synthesis has remained totally lacking. In contrast to the rplE (L5) and rplR (L18) genes that belong to the polycistronic spc-operon and are regulated at the translation level by r-protein S8, the rplY (L25) gene forms an independent transcription unit. The main goal of this work was to study the regulation of the rplY expression in vivo. We show that the rplY promoter is down-regulated by ppGpp and its cofactor DksA in response to amino acid starvation. At the level of translation, the rplY expression is subjected to the negative feedback control. The 5′-untranslated region of the rplY mRNA comprises specific sequence/structure features, including an atypical SD-like sequence, which are highly conserved in a subset of gamma-proteobacterial families. Despite the lack of a canonical SD element, the rplY’-‘lacZ single-copy reporter showed unusually high translation efficiency. Expression of the rplY gene in trans decreased the translation yield, indicating the mechanism of autogenous repression. Site-directed mutagenesis of the rplY 5′ UTR revealed an important role of the conserved elements in the translation control. Thus, the rplY expression regulation represents one more example of regulatory pathways that control ribosome biogenesis in Escherichia coli and related bacteria. PMID:25749694

  3. Cytogenetic characterization by in situ hybridization techniques and molecular analysis of 5S rRNA genes of the European hazelnut (Corylus avellana).

    PubMed

    Falistocco, E; Marconi, G

    2013-03-01

    The European hazelnut (Corylus avellana L.) is widespread in Europe, where it has been cultivated for centuries. Despite progress in genetics, most of the cytogenetic aspects of this species have been overlooked. The aim of this study was to fill in this gap and obtain basic information on the chromosome structure of this species. Karyomorphological analysis confirmed the chromosome number 2n = 22 and showed that, despite their apparent uniformity, the chromosomes could be separated into three groups of different size: large (L), medium (M), and small (S). As a first step towards the physical mapping of the hazelnut chromosomes, we applied FISH to localize the position of rRNA genes (rDNA). The sites of 45S and 5S rDNA enabled us to identify two chromosome pairs belonging, respectively, to the L and S groups. The self-GISH procedure revealed that repetitive DNA is concentrated in the pericentromeric regions of the chromosomes, as with other species with rather small genomes. The analysis of 5S rDNA repeats offered additional information on the hazelnut genome by obtaining the whole sequence of the transcribed region so far unpublished. The overall results constitute a substantial advance in hazelnut cytogenetics. Further investigation of other species of Corylus could be an effective approach to understanding the phylogenesis of the genus and resolving taxonomic problems.

  4. Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells.

    PubMed

    Wang, Xinyu; Ren, Yanli; Wang, Zhiqiong; Xiong, Xiangyu; Han, Sichong; Pan, Wenting; Chen, Hongwei; Zhou, Liqing; Zhou, Changchun; Yuan, Qipeng; Yang, Ming

    2015-12-21

    5S rRNA plays an important part in ribosome biology and is over-expression in multiple cancers. In this study, we found that 5S rRNA is a direct target of miR-150 and miR-383 in esophageal squamous cell carcinoma (ESCC). Overexpression of miR-150 and miR-383 inhibited ESCC cell proliferation in vitro and in vivo. Moreover, 5S rRNA silencing by miR-150 and miR-383 might intensify rpL11-c-Myc interaction, which attenuated role of c-Myc as an oncogenic transcriptional factor and dysregulation of multiple c-Myc target genes. Taken together, our results highlight the involvement of miRNAs in ribosomal regulation during tumorigenesis.

  5. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    PubMed

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends.

  6. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides

    PubMed Central

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S.; McBee, Megan E.; Dedon, Peter C.

    2015-01-01

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. PMID:25539917

  7. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    PubMed

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria.

  8. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. PMID:25261903

  9. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps.

  10. Chromosomal localization of the 18S-28S and 5S rRNA genes and (TTAGGG)n sequences of butterfly lizards (Leiolepis belliana belliana and Leiolepis boehmei, Agamidae, Squamata).

    PubMed

    Srikulnath, Kornsorn; Uno, Yoshinobu; Matsubara, Kazumi; Thongpan, Amara; Suputtitada, Saowanee; Apisitwanich, Somsak; Nishida, Chizuko; Matsuda, Yoichi

    2011-10-01

    Chromosomal mapping of the butterfly lizards Leiolepis belliana belliana and L. boehmei was done using the 18S-28S and 5S rRNA genes and telomeric (TTAGGG)n sequences. The karyotype of L. b. belliana was 2n = 36, whereas that of L. boehmei was 2n = 34. The 18S-28S rRNA genes were located at the secondary constriction of the long arm of chromosome 1, while the 5S rRNA genes were found in the pericentromeric region of chromosome 6 in both species. Hybridization signals for the (TTAGGG)n sequence were observed at the telomeric ends of all chromosomes, as well as interstitially at the same position as the 18S-28S rRNA genes in L. boehmei. This finding suggests that in L. boehmei telomere-to-telomere fusion probably occurred between chromosome 1 and a microchromosome where the 18S-28S rRNA genes were located or, alternatively, at the secondary constriction of chromosome 1. The absence of telomeric sequence signals in chromosome 1 of L. b. belliana suggested that its chromosomes may have only a few copies of the (TTAGGG)n sequence or that there may have been a gradual loss of the repeat sequences during chromosomal evolution.

  11. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    PubMed

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes.

  12. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    PubMed

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes. PMID:26835745

  13. Molecular characterization and chromosomal mapping of the 5S rRNA gene in Solea senegalensis: a new linkage to the U1, U2, and U5 small nuclear RNA genes.

    PubMed

    Manchado, Manuel; Zuasti, Eugenia; Cross, Ismael; Merlo, Alejandro; Infante, Carlos; Rebordinos, Laureana

    2006-01-01

    Some units of the 5S rDNA of Solea senegalensis were amplified by PCR and sequenced. Three main PCR products (227, 441, and 2166 bp) were identified. The 227- and 441-bp fragments were characterized by highly divergent nontranscribed spacer sequences (referred to as NTS-I and NTS-II) that were 109 and 324 bp long, respectively, yet their coding sequences were nearly identical. The 2166-bp 5S rDNA unit was composed of two 5S rRNA genes separated by NTS-I and followed by a 1721-bp spacer containing the U2, U5, and U1 small nuclear RNA genes (snRNAs). They were inverted and arranged in the transcriptional direction opposite that of the 5S rRNA gene. This simultaneous linkage of 3 different snRNAs had never been observed before. The PCR products were used as probes in fluorescence in situ hybridization experiments to locate the corresponding loci on the chromosomes of S. senegalensis. A major 5S rDNA chromosomal site was located along most of the short arm of a submetacentric pair, while a minor site was detected near the centromeric region of an acrocentric pair.

  14. Comparative calorimetric studies on the dynamic conformation of plant 5S rRNA. I. Thermal unfolding pattern of lupin seeds and wheat germ 5S rRNAs, also in the presence of magnesium and sperminium cations.

    PubMed Central

    Barciszewski, J; Bratek-Wiewiórowska, M D; Górnicki, P; Naskret-Barciszewska, M; Wiewiórowski, M; Zielenkiewicz, A; Zielenkiewicz, W

    1988-01-01

    An attempt has been made to correlate differential scanning calorimetry melting profiles of 5S rRNAs from lupin seeds (L.s.) and wheat germ (W.g.) with their structure. It is suggested that the observed differences in thermal unfolding are due to differences in RNA nucleotide sequence and as a consequence in higher order structures. Interesting effects induced by magnesium cation, perprotonated and permethylated sperminium tetracations are discussed. It is suggested that the difference in the stabilizing effect of the three cations results from different mode of their interactions with RNA. "Pure" electrostatic interactions expected for permethylated tetracations are rather weak due to the steric hindrance around each positively charged nitrogen atom. Electrostatic interactions of the other two cations are significantly enhanced by coordination bonding for magnesium and by hydrogen bonding for protonated sperminium cation. PMID:3340550

  15. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central

    2012-01-01

    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  16. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  17. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    PubMed Central

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  18. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    NASA Astrophysics Data System (ADS)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-03-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

  19. Design and performance of a 1 MW-5 s high temperature superconductor magnetic energy storage system

    NASA Astrophysics Data System (ADS)

    Morandi, Antonio; Gholizad, Babak; Fabbri, Massimo

    2016-01-01

    The feasibility of a 1 MW-5 s superconducting magnetic energy storage (SMES) system based on state-of-the-art high-temperature superconductor (HTS) materials is investigated in detail. Both YBCO coated conductors and MgB2 are considered. A procedure for the electromagnetic design of the coil is introduced and the final layout is arrived at and compared for the two materials. The choice of the inductance of the coil is carried out as part of the design procedure. Both low-field (3 T) and high-field (8 T) designs are considered for the YBCO. AC losses during a complete charge/discharge cycle at full power are estimated and the cooling power needed for continuous operation is derived. The power conditioning system and control algorithms needed to carry out various operations are discussed in detail. Performances of the SMES system during voltage sag compensation, load leveling and power factor correction are investigated by means of numerical simulation.

  20. 5S clavam biosynthesis is controlled by an atypical two-component regulatory system in Streptomyces clavuligerus.

    PubMed

    Kwong, Thomas; Zelyas, Nathan J; Cai, Hui; Tahlan, Kapil; Wong, Annie; Jensen, Susan E

    2012-09-01

    Streptomyces clavuligerus produces a collection of five clavam metabolites, including the clinically important β-lactamase inhibitor clavulanic acid, as well as four structurally related metabolites called 5S clavams. The paralogue gene cluster of S. clavuligerus is one of three clusters of genes for the production of these clavam metabolites. A region downstream of the cluster was analyzed, and snk, res1, and res2, encoding elements of an atypical two-component regulatory system, were located. Mutation of any one of the three genes had no effect on clavulanic acid production, but snk and res2 mutants produced no 5S clavams, whereas res1 mutants overproduced 5S clavams. Reverse transcriptase PCR analyses showed that transcription of cvm7p (which encodes a transcriptional activator of 5S clavam biosynthesis) and 5S clavam biosynthetic genes was eliminated in snk and in res2 mutants but that snk and res2 transcription was unaffected in a cvm7p mutant. Both snk and res2 mutants could be complemented by introduction of cvm7p under the control of an independently regulated promoter. In vitro assays showed that Snk can autophosphorylate and transfer its phosphate group to both Res1 and Res2, and Snk-H365, Res1-D52, and Res2-D52 were identified as the phosphorylation sites for the system. Dephosphorylation assays indicated that Res1 stimulates dephosphorylation of Res2∼P. These results suggest a regulatory cascade in which Snk and Res2 form a two-component system controlling cvm7p transcription, with Res1 serving as a checkpoint to modulate phosphorylation levels. Cvm7P then activates transcription of 5S clavam biosynthetic genes.

  1. Chaperoning 5S RNA assembly.

    PubMed

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit.

  2. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  3. Project 5S: A Safe Stepping Stone into the Solar System

    NASA Technical Reports Server (NTRS)

    Brophy, John; Culick, Fred; Dimotakis, Paul; Friedman, Louis

    2012-01-01

    The human exploration program, at least in NASA, has been directed to move beyond the Moon and travel on a flexible path into the solar system. Reaching a Near-Earth Asteroid (NEA) is a major human space flight goal but such missions have tight times and life-support requirements that require huge steps from current capabilities. An objective between the Moon and a NEA is needed. Example interim objectives are the Lagrangian points in either the Sun-Earth or Earth-Moon (EM) system. The nearest of these points beyond the Moon is E-M L2. The Lagrangian points are empty (as far as we know). As objectives for human flight,it has been argued that they suffer from a lack of public interest and of meaningful objectives for astronaut operations. To provide a physical target, a robotic spacecraft could retrieve a small NEA and bring it to a Lagrangian or other nearer-Earth point to be accessed and utilized for human-mission objectives. This paper reports on the results of a recently completed study of an asteroid retrieval mission sponsored by the Keck Institute for Space Studies (KISS) at the California Institute of Technology. The study included an evaluation of potential targets, mission objectives, mission and system design, and potential capture mechanisms. The study concluded that, while challenging, there are no fundamental show stoppers and that such a mission would be possible with technology expected to be available in this decade. The final destination selected (for safety and mission operations) was high lunar orbit. Two options for target selection are considered: (i) retrieving a small (7 meter) NEA with a mass of order 500,000 kg, and (ii) taking a similar size boulder of a large known carbonaceous NEA. Several areas of technology and program requirements were identified, but the most important conclusion was that this approach enables meeting a goal of humans going to a NEA by the mid-2020s. The advantages and benefits for human exploration are considerable

  4. Chromosomal mapping of repetitive DNAs in Gobionellus oceanicus and G. stomatus (Gobiidae; Perciformes): A shared XX/XY system and an unusual distribution of 5S rDNA sites on the Y chromosome.

    PubMed

    Lima-Filho, Paulo A; Amorim, Karlla D J; Cioffi, Marcelo B; Bertollo, Luiz A C; Molina, Wagner F

    2014-01-01

    With nearly 2,000 species, Gobiidae is the most specious family of the vertebrates. This high level of speciation is accompanied by conspicuous karyotypic modifications, where the role of repetitive sequences remains largely unknown. This study analyzed the karyotype of 2 species of the genus Gobionellus and mapped 18S and 5S ribosomal RNA genes and (CA)15 microsatellite sequences onto their chromosomes. G. oceanicus (2n = 56; ♂ 12 metacentrics (m) + 4 submetacentrics (sm) + 1 subtelocentric (st) + 39 acrocentrics (a); ♀ 12m + 4sm + 2st + 38a) and G. stomatus (2n = 56; ♂ 20m + 14sm + 1st + 21a; ♀ 20m + 14sm + 2st + 20a) possess the highest diploid chromosome number among the Gobiidae and have different karyotypes. Both species share an XX/XY sex chromosome system with a large subtelocentric X and a small acrocentric Y chromosome which is rich in (CA)15 sequences and bears 5S rRNA sites. Although coding and noncoding repetitive DNA sequences may be involved in the genesis or differentiation of the sex chromosomes, the exclusive presence of 5S rDNA sites on the Y, but not on the X chromosome of both species, represents a novelty in fishes. In summary, the karyotypic differences, as well as new data on the sex chromosome systems in these 2 Gobiidae species, confirm the high chromosomal dynamism observed in this family.

  5. Abundant 5S rRNA-like transcripts encoded by the mitochondrial genome in amoebozoa.

    PubMed

    Bullerwell, Charles E; Burger, Gertraud; Gott, Jonatha M; Kourennaia, Olga; Schnare, Murray N; Gray, Michael W

    2010-05-01

    5S rRNAs are ubiquitous components of prokaryotic, chloroplast, and eukaryotic cytosolic ribosomes but are apparently absent from mitochondrial ribosomes (mitoribosomes) of many eukaryotic groups including animals and fungi. Nevertheless, a clearly identifiable, mitochondrion-encoded 5S rRNA is present in Acanthamoeba castellanii, a member of Amoebozoa. During a search for additional mitochondrial 5S rRNAs, we detected small abundant RNAs in other members of Amoebozoa, namely, in the lobose amoeba Hartmannella vermiformis and in the myxomycete slime mold Physarum polycephalum. These RNAs are encoded by mitochondrial DNA (mtDNA), cosediment with mitoribosomes in glycerol gradients, and can be folded into a secondary structure similar to that of bona fide 5S rRNAs. Further, in the mtDNA of another slime mold, Didymium nigripes, we identified a region that in sequence, potential secondary structure, and genomic location is similar to the corresponding region encoding the Physarum small RNA. A mtDNA-encoded small RNA previously identified in Dictyostelium discoideum is here shown to share several characteristics with known 5S rRNAs. Again, we detected genes encoding potential homologs of this RNA in the mtDNA of three other species of the genus Dictyostelium as well as in a related genus, Polysphondylium. Taken together, our results indicate a widespread occurrence of small, abundant, mtDNA-encoded RNAs with 5S rRNA-like structures that are associated with the mitoribosome in various amoebozoan taxa. Our working hypothesis is that these novel small abundant RNAs represent radically divergent mitochondrial 5S rRNA homologs. We posit that currently unrecognized 5S-like RNAs may exist in other mitochondrial systems in which a conventional 5S rRNA cannot be identified.

  6. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  7. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces.

  8. Estimating 3D L5/S1 moments and ground reaction forces during trunk bending using a full-body ambulatory inertial motion capture system.

    PubMed

    Faber, G S; Chang, C C; Kingma, I; Dennerlein, J T; van Dieën, J H

    2016-04-11

    Inertial motion capture (IMC) systems have become increasingly popular for ambulatory movement analysis. However, few studies have attempted to use these measurement techniques to estimate kinetic variables, such as joint moments and ground reaction forces (GRFs). Therefore, we investigated the performance of a full-body ambulatory IMC system in estimating 3D L5/S1 moments and GRFs during symmetric, asymmetric and fast trunk bending, performed by nine male participants. Using an ambulatory IMC system (Xsens/MVN), L5/S1 moments were estimated based on the upper-body segment kinematics using a top-down inverse dynamics analysis, and GRFs were estimated based on full-body segment accelerations. As a reference, a laboratory measurement system was utilized: GRFs were measured with Kistler force plates (FPs), and L5/S1 moments were calculated using a bottom-up inverse dynamics model based on FP data and lower-body kinematics measured with an optical motion capture system (OMC). Correspondence between the OMC+FP and IMC systems was quantified by calculating root-mean-square errors (RMSerrors) of moment/force time series and the interclass correlation (ICC) of the absolute peak moments/forces. Averaged over subjects, L5/S1 moment RMSerrors remained below 10Nm (about 5% of the peak extension moment) and 3D GRF RMSerrors remained below 20N (about 2% of the peak vertical force). ICCs were high for the peak L5/S1 extension moment (0.971) and vertical GRF (0.998). Due to lower amplitudes, smaller ICCs were found for the peak asymmetric L5/S1 moments (0.690-0.781) and horizontal GRFs (0.559-0.948). In conclusion, close correspondence was found between the ambulatory IMC-based and laboratory-based estimates of back load. PMID:26795123

  9. Estimating 3D L5/S1 moments and ground reaction forces during trunk bending using a full-body ambulatory inertial motion capture system.

    PubMed

    Faber, G S; Chang, C C; Kingma, I; Dennerlein, J T; van Dieën, J H

    2016-04-11

    Inertial motion capture (IMC) systems have become increasingly popular for ambulatory movement analysis. However, few studies have attempted to use these measurement techniques to estimate kinetic variables, such as joint moments and ground reaction forces (GRFs). Therefore, we investigated the performance of a full-body ambulatory IMC system in estimating 3D L5/S1 moments and GRFs during symmetric, asymmetric and fast trunk bending, performed by nine male participants. Using an ambulatory IMC system (Xsens/MVN), L5/S1 moments were estimated based on the upper-body segment kinematics using a top-down inverse dynamics analysis, and GRFs were estimated based on full-body segment accelerations. As a reference, a laboratory measurement system was utilized: GRFs were measured with Kistler force plates (FPs), and L5/S1 moments were calculated using a bottom-up inverse dynamics model based on FP data and lower-body kinematics measured with an optical motion capture system (OMC). Correspondence between the OMC+FP and IMC systems was quantified by calculating root-mean-square errors (RMSerrors) of moment/force time series and the interclass correlation (ICC) of the absolute peak moments/forces. Averaged over subjects, L5/S1 moment RMSerrors remained below 10Nm (about 5% of the peak extension moment) and 3D GRF RMSerrors remained below 20N (about 2% of the peak vertical force). ICCs were high for the peak L5/S1 extension moment (0.971) and vertical GRF (0.998). Due to lower amplitudes, smaller ICCs were found for the peak asymmetric L5/S1 moments (0.690-0.781) and horizontal GRFs (0.559-0.948). In conclusion, close correspondence was found between the ambulatory IMC-based and laboratory-based estimates of back load.

  10. Space shuttle/food system study. Package feasibility study, modifications 3S, 4C and 5S

    NASA Technical Reports Server (NTRS)

    1974-01-01

    An optimum feeding system for the space shuttle was presented. This system consisted of all rehydratable type foods which were enclosed in a 4 in. x 4 in. x 1 in. flexible package. A feasibility follow-on study was conducted, and two acceptable, feasible prototypes for this package are described.

  11. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  12. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  13. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    PubMed

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  14. Phylogenetic analysis and the evolution of the 18S rRNA gene typing system of Acanthamoeba.

    PubMed

    Fuerst, Paul A; Booton, Gregory C; Crary, Monica

    2015-01-01

    Species of Acanthamoeba were first described using morphological characters including cyst structure and cytology of nuclear division. More than 20 nominal species were proposed using these methods. Morphology, especially cyst shape and size, has proven to be plastic and dependent upon culture conditions. The DNA sequence of the nuclear small-subunit (18S) rRNA, the Rns gene, has become the most widely accepted method for rapid diagnosis and classification of Acanthamoeba. The Byers-Fuerst lab first proposed an Rns typing system in 1996. Subsequent refinements, with an increasing DNA database and analysis of diagnostic fragments within the gene, have become widely accepted by the Acanthamoeba research community. The development of the typing system, including its current state of implementation is illustrated by three cases: (i) the division between sequence types T13 and T16; (ii) the diversity within sequence supertype T2/T6, and (iii) verification of a new sequence type, designated T20. Molecular studies make clear the disconnection between phylogenetic relatedness and species names, as applied for the genus Acanthamoeba. Future reconciliation of genetic types with species names must become a priority, but the possible shortcomings of the use of a single gene when reconstructing the evolutionary history of the acanthamoebidae must also be resolved. PMID:25284310

  15. The GA motif: an RNA element common to bacterial antitermination systems, rRNA, and eukaryotic RNAs.

    PubMed Central

    Winkler, W C; Grundy, F J; Murphy, B A; Henkin, T M

    2001-01-01

    Two different transcription termination control mechanisms, the T box and S box systems, are used to regulate transcription of many bacterial aminoacyl-tRNA synthetase, amino acid biosynthesis, and amino acid transport genes. Both of these regulatory mechanisms involve an untranslated mRNA leader region capable of adopting alternate structural conformations that result in transcription termination or transcription elongation into the downstream region. Comparative analyses revealed a small RNA secondary structural element, designated the GA motif, that is highly conserved in both T box and S box leader sequences. The motif consists of two short helices separated by an asymmetric internal loop, with highly conserved GA dinucleotide sequences on either side of the internal loop. Site-directed mutagenesis of this motif in model T and S box leader sequences indicated that it is essential for transcriptional regulation in both systems. This motif is similar to the binding site of yeast ribosomal protein L30, the Snu13p binding sites found in U4 snRNA and box C/D snoRNAs, and two elements in 23S rRNA. PMID:11497434

  16. Phylogenetic analysis and the evolution of the 18S rRNA gene typing system of Acanthamoeba.

    PubMed

    Fuerst, Paul A; Booton, Gregory C; Crary, Monica

    2015-01-01

    Species of Acanthamoeba were first described using morphological characters including cyst structure and cytology of nuclear division. More than 20 nominal species were proposed using these methods. Morphology, especially cyst shape and size, has proven to be plastic and dependent upon culture conditions. The DNA sequence of the nuclear small-subunit (18S) rRNA, the Rns gene, has become the most widely accepted method for rapid diagnosis and classification of Acanthamoeba. The Byers-Fuerst lab first proposed an Rns typing system in 1996. Subsequent refinements, with an increasing DNA database and analysis of diagnostic fragments within the gene, have become widely accepted by the Acanthamoeba research community. The development of the typing system, including its current state of implementation is illustrated by three cases: (i) the division between sequence types T13 and T16; (ii) the diversity within sequence supertype T2/T6, and (iii) verification of a new sequence type, designated T20. Molecular studies make clear the disconnection between phylogenetic relatedness and species names, as applied for the genus Acanthamoeba. Future reconciliation of genetic types with species names must become a priority, but the possible shortcomings of the use of a single gene when reconstructing the evolutionary history of the acanthamoebidae must also be resolved.

  17. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  18. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling

    PubMed Central

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.

    2015-01-01

    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  19. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.

    PubMed

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S

    2015-01-01

    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.

  20. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.

    PubMed

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S

    2015-01-01

    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  1. Uncultured bacterial diversity in a seawater recirculating aquaculture system revealed by 16S rRNA gene amplicon sequencing.

    PubMed

    Lee, Da-Eun; Lee, Jinhwan; Kim, Young-Mog; Myeong, Jeong-In; Kim, Kyoung-Ho

    2016-04-01

    Bacterial diversity in a seawater recirculating aquaculture system (RAS) was investigated using 16S rRNA amplicon sequencing to understand the roles of bacterial communities in the system. The RAS was operated at nine different combinations of temperature (15°C, 20°C, and 25°C) and salinity (20‰, 25‰, and 32.5‰). Samples were collected from five or six RAS tanks (biofilters) for each condition. Fifty samples were analyzed. Proteobacteria and Bacteroidetes were most common (sum of both phyla: 67.2% to 99.4%) and were inversely proportional to each other. Bacteria that were present at an average of ≥ 1% included Actinobacteria (2.9%) Planctomycetes (2.0%), Nitrospirae (1.5%), and Acidobacteria (1.0%); they were preferentially present in packed bed biofilters, mesh biofilters, and maturation biofilters. The three biofilters showed higher diversity than other RAS tanks (aerated biofilters, floating bed biofilters, and fish tanks) from phylum to operational taxonomic unit (OTU) level. Samples were clustered into several groups based on the bacterial communities. Major taxonomic groups related to family Rhodobacteraceae and Flavobacteriaceae were distributed widely in the samples. Several taxonomic groups like [Saprospiraceae], Cytophagaceae, Octadecabacter, and Marivita showed a cluster-oriented distribution. Phaeobacter and Sediminicola-related reads were detected frequently and abundantly at low temperature. Nitrifying bacteria were detected frequently and abundantly in the three biofilters. Phylogenetic analysis of the nitrifying bacteria showed several similar OTUs were observed widely through the biofilters. The diverse bacterial communities and the minor taxonomic groups, except for Proteobacteria and Bacteroidetes, seemed to play important roles and seemed necessary for nitrifying activity in the RAS, especially in packed bed biofilters, mesh biofilters, and maturation biofilters. PMID:27033205

  2. Uncultured bacterial diversity in a seawater recirculating aquaculture system revealed by 16S rRNA gene amplicon sequencing.

    PubMed

    Lee, Da-Eun; Lee, Jinhwan; Kim, Young-Mog; Myeong, Jeong-In; Kim, Kyoung-Ho

    2016-04-01

    Bacterial diversity in a seawater recirculating aquaculture system (RAS) was investigated using 16S rRNA amplicon sequencing to understand the roles of bacterial communities in the system. The RAS was operated at nine different combinations of temperature (15°C, 20°C, and 25°C) and salinity (20‰, 25‰, and 32.5‰). Samples were collected from five or six RAS tanks (biofilters) for each condition. Fifty samples were analyzed. Proteobacteria and Bacteroidetes were most common (sum of both phyla: 67.2% to 99.4%) and were inversely proportional to each other. Bacteria that were present at an average of ≥ 1% included Actinobacteria (2.9%) Planctomycetes (2.0%), Nitrospirae (1.5%), and Acidobacteria (1.0%); they were preferentially present in packed bed biofilters, mesh biofilters, and maturation biofilters. The three biofilters showed higher diversity than other RAS tanks (aerated biofilters, floating bed biofilters, and fish tanks) from phylum to operational taxonomic unit (OTU) level. Samples were clustered into several groups based on the bacterial communities. Major taxonomic groups related to family Rhodobacteraceae and Flavobacteriaceae were distributed widely in the samples. Several taxonomic groups like [Saprospiraceae], Cytophagaceae, Octadecabacter, and Marivita showed a cluster-oriented distribution. Phaeobacter and Sediminicola-related reads were detected frequently and abundantly at low temperature. Nitrifying bacteria were detected frequently and abundantly in the three biofilters. Phylogenetic analysis of the nitrifying bacteria showed several similar OTUs were observed widely through the biofilters. The diverse bacterial communities and the minor taxonomic groups, except for Proteobacteria and Bacteroidetes, seemed to play important roles and seemed necessary for nitrifying activity in the RAS, especially in packed bed biofilters, mesh biofilters, and maturation biofilters.

  3. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA.

  4. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system

    PubMed Central

    Jenior, Matthew L.; Koumpouras, Charles C.; Westcott, Sarah L.; Highlander, Sarah K.

    2016-01-01

    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina’s MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3–V5, V1–V3, V1–V5, V1–V6, and V1–V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1–V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina’s MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting. PMID:27069806

  5. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system.

    PubMed

    Schloss, Patrick D; Jenior, Matthew L; Koumpouras, Charles C; Westcott, Sarah L; Highlander, Sarah K

    2016-01-01

    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina's MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3-V5, V1-V3, V1-V5, V1-V6, and V1-V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1-V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina's MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting. PMID:27069806

  6. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system.

    PubMed

    Schloss, Patrick D; Jenior, Matthew L; Koumpouras, Charles C; Westcott, Sarah L; Highlander, Sarah K

    2016-01-01

    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina's MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3-V5, V1-V3, V1-V5, V1-V6, and V1-V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1-V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina's MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting.

  7. Two sequence classes of kinetoplastid 5S ribosomal RNA gene revealed among bodonid spliced leader RNA gene arrays.

    PubMed

    Santana, D M; Lukes, J; Sturm, N R; Campbell, D A

    2001-11-13

    The spliced leader RNA genes of Bodo saltans, Cryptobia helicis and Dimastigella trypaniformis were analyzed as molecular markers for additional taxa within the suborder Bodonina. The non-transcribed spacer regions were distinctive for each organism, and 5S rRNA genes were present in Bodo and Dimastigella but not in C. helicis. Two sequence classes of 5S rRNA were evident from analysis of the bodonid genes. The two classes of 5S rRNA genes were found in other Kinetoplastids independent of co-localization with the spliced leader RNA gene.

  8. Bacterial community variations in an alfalfa-rice rotation system revealed by 16S rRNA gene 454-pyrosequencing.

    PubMed

    Lopes, Ana R; Manaia, Célia M; Nunes, Olga C

    2014-03-01

    Crop rotation is a practice harmonized with the sustainable rice production. Nevertheless, the implications of this empirical practice are not well characterized, mainly in relation to the bacterial community composition and structure. In this study, the bacterial communities of two adjacent paddy fields in the 3rd and 4th year of the crop rotation cycle and of a nonseeded subplot were characterized before rice seeding and after harvesting, using 454-pyrosequencing of the 16S rRNA gene. Although the phyla Acidobacteria, Proteobacteria, Chloroflexi, Actinobacteria and Bacteroidetes predominated in all the samples, there were variations in relative abundance of these groups. Samples from the 3rd and 4th years of the crop rotation differed on the higher abundance of groups of presumable aerobic bacteria and of presumable anaerobic and acidobacterial groups, respectively. Members of the phylum Nitrospira were more abundant after rice harvest than in the previously sampled period. Rice cropping was positively correlated with the abundance of members of the orders Acidobacteriales and 'Solibacterales' and negatively with lineages such as Chloroflexi 'Ellin6529'. Studies like this contribute to understand variations occurring in the microbial communities in soils under sustainable rice production, based on real-world data.

  9. Ultraviolet damage and nucleosome folding of the 5S ribosomal RNA gene.

    SciTech Connect

    Liu, X; Mann, David B.; Suquet, C; Springer, David L. ); Smerdon, Michael J.

    2000-01-25

    The Xenopus borealis somatic 5S ribosomal RNA gene was used as a model system to determine the mutual effects of nucleosome folding and formation of ultraviolet (UV) photoproducts (primarily cis-syn cyclobutane pyrimidine dimers, or CPDs) in chromatin. We analyzed the preferred rotational and translational settings of 5S rDNA on the histone octamer surface after induction of up to 0.8 CPD/nucleosome core (2.5 kJ/m(2) UV dose). DNase I and hydroxyl radical footprints indicate that UV damage at these levels does not affect the average rotational setting of the 5S rDNA molecules. Moreover, a combination of nuclease trimming and restriction enzyme digestion indicates the preferred translational positions of the histone octamer are not affected by this level of UV damage. We also did not observe differences in the UV damage patterns of irradiated 5S rDNA before or after nucleosome formation, indicating there is little difference in the inhibition of nucleosome folding by specific CPD sites in the 5S rRNA gene. Conversely, nucleosome folding significantly restricts CPD formation at all sites in the three helical turns of the nontranscribed strand located in the dyad axis region of the nucleosome, where DNA is bound exclusively by the histone H3-H4 tetramer. Finally, modulation of the CPD distribution in a 14 nt long pyrimidine tract correlates with its rotational setting on the histone surface, when the strong sequence bias for CPD formation in this tract is minimized by normalization. These results help establish the mutual roles of histone binding and UV photoproducts on their formation in chromatin.

  10. RAPID DETECTION OF MICROORGANISMS USING 5S RRNA SPECIFIC MOLECULAR BEACONS. (R825354)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  11. 5S RRNA GENE DELETIONS CAUSE AN UNEXPECTEDLY HIGH FITNESS LOSS IN ESCHERICHIA COLI. (R825354)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  12. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    PubMed

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  13. IDENTIFICATION OF ACTIVE BACTERIAL COMMUNITIES IN A MODEL DRINKING WATER BIOFILM SYSTEM USING 16S RRNA-BASED CLONE LIBRARIES

    EPA Science Inventory

    Recent phylogenetic studies have used DNA as the target molecule for the development of environmental 16S rDNA clone libraries. As DNA may persist in the environment, DNA-based libraries cannot be used to identify metabolically active bacteria in water systems. In this study, a...

  14. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  15. Genetic investigations in immigration cases and frequencies of DNA fragments of the VNTR systems D2S44, D5S43, D7S21, D7S22, and D12S11 in Turks.

    PubMed

    Hansen, H E; Morling, N

    1993-06-01

    We have included investigations of the DNA polymorphism of variable numbers of tandem repeat (VNTR) regions with restriction fragment length polymorphism (RFLP) in the genetic evaluations in immigrant cases. HinfI-digested DNA was separated by electrophoresis in agarose gels and hybridized with radiolabelled probes detecting the VNTR systems D2S44 (YNH24), D5S43 (MS8), D7S21 (MS31), D7S22 (g3), and D12S11 (MS43a). We used the matching criterion for paternity testing for the parent/child comparisons, i.e. non-match if the intra gel difference exceeded 1.25 mm. A total of 43 immigration cases involving mainly Turks were investigated with DNA technique in parallel with investigations of 10-15 conventional systems. One man was excluded from paternity by both conventional and DNA investigations. Non-exclusion was observed with both conventional and DNA systems in 97 putative mother/child pairs and in 96 putative father/child pairs. In a putative father/child combination with non-exclusion in 18 genetic systems, a single genetic inconsistency ('exclusion') in D7S21 (MS31) was observed. The frequency distributions of HinfI digested DNA fragments of the five VNTR systems in 105 Turks are presented.

  16. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    PubMed

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-01

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  17. Isothermal sections of the quasi-ternary systems Ag2S(Se)-Ga2S(Se)3-In2S(Se)3 at 820 K and the physical properties of the ternary phases Ga5.5In4.5S15, Ga6In4Se15 and Ga5.5In4.5S15:Er3+, Ga6In4Se15:Er3+

    NASA Astrophysics Data System (ADS)

    Ivashchenko, I. A.; Danyliuk, I. V.; Gulay, L. D.; Halyan, V. V.; Olekseyuk, I. D.

    2016-05-01

    Isothermal sections of the quasi-ternary systems Ag2S(Se)-Ga2S(Se)3-In2S(Se)3 at 820 K were compared. Along the 50 mol% Ag2S(Se), both systems feature continuous solid solutions with the chalcopyrite structure. Along the 17 mol% Ag2S(Se), the interactions at the AgIn5S(Se)8-"AgGa5S(Se)8" sections are different. In the Ag2S-Ga2S3-In2S3 system the existence of the layered phase AgGaxIn5-xS8, 2.25≤x≤2.85, was confirmed (S.G. P63mc). The Ag2Se-Ga2Se3-In2Se3 system features the formation of solid solution (up to 53 mol% Ga2Se3) based on AgIn5Se8 (S.G. P-42m). Crystal structure, atomic coordinates were determined by powder diffraction method for samples from the homogeneity region of AgIn5Se8. Specific conductivities of the crystals Ga6In4Se15 (1.33·10-6 Ω-1 m-1), Ga5.94In3.96Er0.1Se15 (3.17·10-6 Ω-1 m-1), Ga5.5In4.5S15 (7.94·10-6 Ω-1 m-1), Ga5.46In4.47Er0.07S15 (1·10-9 Ω-1 m-1) were measured at room temperature. Optical absorption and photoconductivity spectra were recorded in the range 400-760 nm. The introduction of erbium leads to an increase in the absorption coefficient and to the appearance of absorption bands at 530, 660, 810, 980, 1530 nm.

  18. Quantification of Hyphomicrobium Populations in Activated Sludge from an Industrial Wastewater Treatment System as Determined by 16S rRNA Analysis

    PubMed Central

    Layton, A. C.; Karanth, P. N.; Lajoie, C. A.; Meyers, A. J.; Gregory, I. R.; Stapleton, R. D.; Taylor, D. E.; Sayler, G. S.

    2000-01-01

    The bacterial community structure of the activated sludge from a 25 million-gal-per-day industrial wastewater treatment plant was investigated using rRNA analysis. 16S ribosomal DNA (rDNA) libraries were created from three sludge samples taken on different dates. Partial rRNA gene sequences were obtained for 46 rDNA clones, and nearly complete 16S rRNA sequences were obtained for 18 clones. Seventeen of these clones were members of the beta subdivision, and their sequences showed high homology to sequences of known bacterial species as well as published 16S rDNA sequences from other activated sludge sources. Sixteen clones belonged to the alpha subdivision, 7 of which showed similarity to Hyphomicrobium species. This cluster was chosen for further studies due to earlier work on Hyphomicrobium sp. strain M3 isolated from this treatment plant. A nearly full-length 16S rDNA sequence was obtained from Hyphomicrobium sp. strain M3. Phylogenetic analysis revealed that Hyphomicrobium sp. strain M3 was 99% similar to Hyphomicrobium denitrificans DSM 1869T in Hyphomicrobium cluster II. Three of the cloned sequences from the activated sludge samples also grouped with those of Hyphomicrobium cluster II, with a 96% sequence similarity to that of Hyphomicrobium sp. strain M3. The other four cloned sequences from the activated sludge sample were more closely related to those of the Hyphomicrobium cluster I organisms (95 to 97% similarity). Whole-cell fluorescence hybridization of microorganisms in the activated sludge with genus-specific Hyphomicrobium probe S-G-Hypho-1241-a-A-19 enhanced the visualization of Hyphomicrobium and revealed that Hyphomicrobium appears to be abundant both on the outside of flocs and within the floc structure. Dot blot hybridization of activated sludge samples from 1995 with probes designed for Hyphomicrobium cluster I and Hyphomicrobium cluster II indicated that Hyphomicrobium cluster II-positive 16S rRNA dominated over Hyphomicrobium cluster I

  19. 5 S and 5.8 S ribosomal RNA sequences and protist phylogenetics.

    PubMed

    Walker, W F

    1985-01-01

    More than 100 5 S 5.8 S rRNA sequences from protists, including fungi, are known. Through a combination of quantitative treeing and special consideration of "signature' nucleotide combinations, the most significant phylogenetic implications of these data are emphasized. Also, limitations of the data for phylogenetic inferences are discussed and other significant data are brought to bear on the inferences obtained. 5 S sequences from red algae are seen as the most isolated among eukaryotics. A 5 S sequence lineage consisting of oomycetes, euglenoids, most protozoa, most slime molds and perhaps dinoflagellates and mesozoa is defined. Such a lineage is not evident from 5.8 S rRNA or cytochrome c sequence data. 5 S sequences from Ascomycota and Basidiomycota are consistent with the proposal that each is derived from a mycelial form with a haploid yeast phase and simple septal pores, probably most resembling present Taphrinales. 5 S sequences from Chytridiomycota and Zygomycota are not clearly distinct from each other and suggest that a major lineage radiation occurred in the early history of each. Qualitative biochemical data clearly supports a dichotomy between an Ascomycota-Basidiomycota lineage and a Zygomycota-Chytridiomycota lineage.

  20. Generalized oscillator strengths for 5s, 5s{sup '}, and 5p excitations of krypton

    SciTech Connect

    Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing

    2003-06-01

    The absolute generalized oscillator strengths (GOSs) for 5s, 5s{sup '}, 5p [5/2]{sub 3,2}, 5p [3/2]{sub 1,2}, and 5p [1/2]{sub 0} transitions of krypton have been determined in a large K{sup 2} region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s{sup '} transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s{sup '} transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)].

  1. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    PubMed

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  2. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  3. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules

    PubMed Central

    Valach, Matus; Burger, Gertraud; Gray, Michael W.; Lang, B. Franz

    2014-01-01

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. PMID:25429974

  4. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    PubMed

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator.

  5. 16S rRNA gene sequencing versus the API 20 NE system and the VITEK 2 ID-GNB card for identification of nonfermenting Gram-negative bacteria in the clinical laboratory.

    PubMed

    Bosshard, P P; Zbinden, R; Abels, S; Böddinghaus, B; Altwegg, M; Böttger, E C

    2006-04-01

    Over a period of 26 months, we have evaluated in a prospective fashion the use of 16S rRNA gene sequencing as a means of identifying clinically relevant isolates of nonfermenting gram-negative bacilli (non-Pseudomonas aeruginosa) in the microbiology laboratory. The study was designed to compare phenotypic with molecular identification. Results of molecular analyses were compared with two commercially available identification systems (API 20 NE, VITEK 2 fluorescent card; bioMérieux, Marcy l'Etoile, France). By 16S rRNA gene sequence analyses, 92% of the isolates were assigned to species level and 8% to genus level. Using API 20 NE, 54% of the isolates were assigned to species and 7% to genus level, and 39% of the isolates could not be discriminated at any taxonomic level. The respective numbers for VITEK 2 were 53%, 1%, and 46%, respectively. Fifteen percent and 43% of the isolates corresponded to species not included in the API 20 NE and VITEK 2 databases, respectively. We conclude that 16S rRNA gene sequencing is an effective means for the identification of clinically relevant nonfermenting gram-negative bacilli. Based on our experience, we propose an algorithm for proper identification of nonfermenting gram-negative bacilli in the diagnostic laboratory.

  6. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array.

  7. {upsilon}(5S) Results from CLEO

    SciTech Connect

    Pavlunin, Victor

    2006-07-11

    Using the CLEO detector at the Cornell Electron Storage Ring, we have observed the Bs meson in e+e- annihilation at the {upsilon}(5S) resonance. We have fully reconstructed 14 candidates consistent with Bs decays into final states with a J/{psi} or a D{sub s}{sup (*)-}. The probability that this is a background fluctuation is less than 8 x 10-10. We have established that Bs production proceeds predominantly through the creation of B{sub s}*B-bar{sub s}* pairs with {sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) =0[ .11{sub -0.03}{sup +0.04}(stat) {+-} 0.02(syst)] nb. The following limits are set: {sigma}(e{sup +}e{sup -} {yields} B{sub s}B-bar{sub s})/{sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) < 0.16 and [{sigma}(e{sup +}e{sup -} {yields} B{sub s}B-bar{sub s}*) + {sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s})]/{sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) < 0.16 (90% CL). In a separate analysis, by comparing production rates of D{sub s}{sup +} mesons in {upsilon}(5S) and {upsilon}(4S) decays, an estimate of the ratio of B{sub s}{sup (*)} B-bar{sub s}{sup (*)} to the total bb-bar quark pair production at the {upsilon}(5S) energy of (16 {+-} 3 {+-} 6)% is obtained.

  8. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    PubMed

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production.

  9. Quantitative detection of previously characterized syntrophic bacteria in anaerobic wastewater treatment systems by sequence-specific rRNA cleavage method.

    PubMed

    Narihiro, Takashi; Terada, Takeshi; Ohashi, Akiko; Kamagata, Yoichi; Nakamura, Kazunori; Sekiguchi, Yuji

    2012-05-01

    Quantitative monitoring method of two important trophic groups of bacteria in methanogenic communities was established and applied to six different anaerobic processes. The method we employed was based upon our previous sequence-specific rRNA cleavage method that allows quantification of rRNA of target groups so that the populations reflecting in situ activity could be determined. We constructed a set of scissor probes targeting the Chloroflexi group known as 'semi-syntrophic' heterotrophic bacteria and fatty acid-oxidizing syntrophs to determine their relative abundance in the processes. By using the method, we found that several reactors harbored a large amount of organisms belonging to the phylum Chloroflexi accounting for up to 20% of the total prokaryotic populations. Propionate-oxidizing syntrophs, Syntrophobacter, Smithella and Pelotomaculum were also found to be significant comprising up to 3.9% of the total populations, but their distribution is highly dependent on the process examined. This is the first clear, non-PCR based quantitative evidence that those organisms play active roles under in situ methanogenic conditions.

  10. Cytogenetic mapping of 5S and 18S rRNAs and H3 histone genes in 4 ancient Proscopiidae grasshopper species: contribution to understanding the evolutionary dynamics of multigene families.

    PubMed

    Cabral-de-Mello, D C; Martins, C; Souza, M J; Moura, R C

    2011-01-01

    This paper reports on the chromosomal location of 18S rRNA, 5S rRNA and H3 histone multigene families in 4 species of a relatively ancient and diversified group of grasshoppers belonging to the family Proscopiidae. The 5S rRNA and H3 histone genes were highly conserved in the number of sites and chromosomal position in the 4th chromosome pair in all species analyzed, whereas the 18S rRNA genes showed slightly more variation because they were present on one or 2 chromosome pairs, depending on the species. The 5S and 18S rRNA gene families occurred in different chromosomes; in contrast, H3 histone and 5S rRNA genes co-localized in the same chromosomal position, with an apparently interspersed organization. Considering that the Proscopiidae family is a relatively ancient group compared with the Acrididae family, the association of the H3 histone and 5S rRNA multigene families can represent a basal condition for grasshoppers, although more research is needed on other representatives of this insect group to confirm this statement. The presence of such an association of 5S rDNA and H3 histone in mussels and arthropods (beetles, grasshoppers and crustaceans) suggests that this linked configuration could represent an ancestral pattern for invertebrates. These results provide new insights into the understanding of the genome organization and the evolution of multigene families in grasshoppers and in insects as a whole.

  11. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    PubMed

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  12. Fresh-water planarias and a marine planaria are relatively dissimilar in the 5S rRNA sequences.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S; Takai, M

    1983-01-25

    The nucleotide sequences from fresh-water Dugesia japonica and marine Planocera reticulata have been determined. The similarity between these two species is only 69%. The Planocera sequence reveals nearly 80% similarity (72-81%) to the sequences of multicellular animals, while the Dugesia sequences are considerably different from them (66-73%).

  13. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status.

  14. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. PMID:23933480

  15. Evolutionary dynamics of the 5S rDNA gene family in the mussel Mytilus: mixed effects of birth-and-death and concerted evolution.

    PubMed

    Freire, Ruth; Arias, Alberto; Insua, Ana M; Méndez, Josefina; Eirín-López, José M

    2010-05-01

    In higher eukaryotes, the gene family encoding the 5S ribosomal RNA (5S rRNA) has been used (together with histones) to showcase the archetypal example of a gene family subject to concerted evolution. However, recent studies have revealed conspicuous features challenging the predictions of this model, including heterogeneity of repeat units, the presence of functional 5S gene variants as well as the existence of 5S rDNA divergent pseudogenes lacking traces of homogenization. In the present work, we have broadened the scope in the evolutionary study of ribosomal gene families by studying the 5S rRNA family in mussels, a model organism which stands out among other animals due to the heterogeneity it displays regarding sequence and organization. To this end, 48 previously unknown 5S rDNA units (coding and spacer regions) were sequenced in five mussel species, leading to the characterization of two new types of units (referred to here as small-beta 5S rDNA and gamma-5S rDNA) coexisting in the genome with alpha and beta rDNA units. The intense genetic dynamics of this family is further supported by the first description of an association between gamma-5S rDNA units and tRNA genes. Molecular evolutionary and phylogenetic analyses revealed an extensive lack of homology among spacer sequences belonging to different rDNA types, suggesting the presence of independent evolutionary pathways leading to their differentiation. Overall, our results suggest that the long-term evolution of the 5S rRNA gene family in mussels is most likely mediated by a mixed mechanism involving the generation of genetic diversity through birth-and-death, followed by a process of local homogenization resulting from concerted evolution in order to maintain the genetic identities of the different 5S units, probably after their transposition to independent chromosomal locations.

  16. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    PubMed

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  17. Molecular organization of the 5S rDNA gene type II in elasmobranchs

    PubMed Central

    Castro, Sergio I.; Hleap, Jose S.; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    ABSTRACT The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  18. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  19. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.

    2016-01-01

    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  20. The nucleotide sequences of 5S rRNAs from a sea-cucumber, a starfish and a sea-urchin.

    PubMed Central

    Ohama, T; Hori, H; Osawa, S

    1983-01-01

    The nucleotide sequences of 5S rRNA from three echinoderms, a sea-cucumber Stichopus oshimae, a starfish Asterina pectinifera and a sea-urchin Hemicentrotus pulcherrimus have been determined. These 5S rRNAs are all 120 nucleotides long. The echinoderm sequences are more related to the sequences of proterostomes animals such as mollusc, annelids and some others (87% identity on average) than to those of vertebrates (82% identity on average). PMID:6878041

  1. RAPID and HTML5's potential

    NASA Technical Reports Server (NTRS)

    Torosyan, David

    2012-01-01

    Just as important as the engineering that goes into building a robot is the method of interaction, or how human users will use the machine. As part of the Human-System Interactions group (Conductor) at JPL, I explored using a web interface to interact with ATHLETE, a prototype lunar rover. I investigated the usefulness of HTML 5 and Javascript as a telemetry viewer as well as the feasibility of having a rover communicate with a web server. To test my ideas I built a mobile-compatible website and designed primarily for an Android tablet. The website took input from ATHLETE engineers, and upon its completion I conducted a user test to assess its effectiveness.

  2. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    PubMed

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  3. Novel Approach to Quantitative Detection of Specific rRNA in a Microbial Community, Using Catalytic DNA

    PubMed Central

    Suenaga, Hikaru; Liu, Rui; Shiramasa, Yuko; Kanagawa, Takahiro

    2005-01-01

    We developed a novel method for the quantitative detection of the 16S rRNA of a specific bacterial species in the microbial community by using deoxyribozyme (DNAzyme), which possesses the catalytic function to cleave RNA in a sequence-specific manner. A mixture of heterogeneous 16S rRNA containing the target 16S rRNA was incubated with a species-specific DNAzyme. The cleaved target 16S rRNA was separated from the intact 16S rRNA by electrophoresis, and then their amounts were compared for the quantitative detection of target 16S rRNA. This method was used to determine the abundance of the 16S rRNA of a filamentous bacterium, Sphaerotilus natans, in activated sludge, which is a microbial mixture used in wastewater treatment systems. The result indicated that this DNAzyme-based approach would be applicable to actual microbial communities. PMID:16085888

  4. Higher-order structure of rRNA

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  5. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  6. Taxonomy of 5 S ribosomal RNA by the linguistic technique: probing with mitochondrial and mammalian sequences.

    PubMed

    Guimarães, R C; Trifonov, E N; Lagunez-Otero, J

    1997-09-01

    Linguistic similarities and dissimilarities between 5 S rRNA sequences allowed taxonomical separation of species and classes. Comparisons with the molecule from mammals distinguished fungi and plants from protists and animals. Similarities to mammalians progressively increased from protists to invertebrates and to somatic-type molecules of the vertebrates lineage. In this, deviations were detected in avian, oocyte type, and pseudogene sequences. Among bacteria, actinobacteria were most similar to the mammalians, which could be related to the high frequency of associations among members of these groups. Some archaebacterial species most similar to the mammalians belonged to the Thermoproteales and Halobacteria groups. Comparisons with the soybean mitochondrial molecule revealed high internal homogeneity among plant mitochondria. The eubacterial groups most similar to it were Thermus and Rhodobacteria gamma-1 and alpha-2. Other procedures have already indicated similarities of Rhodobacteria alpha to mitochondria but the linguistic similarities were on the average higher with the first two groups.

  7. Ribosomal protein-dependent orientation of the 16 S rRNA environment of S15.

    PubMed

    Jagannathan, Indu; Culver, Gloria M

    2004-01-30

    Ribosomal protein S15 binds specifically to the central domain of 16 S ribosomal RNA (16 S rRNA) and directs the assembly of four additional proteins to this domain. The central domain of 16 S rRNA along with these five proteins form the platform of the 30 S subunit. Previously, directed hydroxyl radical probing from Fe(II)-S15 in small ribonucleoprotein complexes was used to study assembly of the central domain of 16 S rRNA. Here, this same approach was used to understand the 16 S rRNA environment of Fe(II)-S15 in 30 S subunits and to determine the ribosomal proteins that are involved in forming the mature S15-16 S rRNA environment. We have identified additional sites of Fe(II)-S15-directed cleavage in 30S subunits compared to the binary complex of Fe(II)-S15/16 S rRNA. Along with novel targets in the central domain, sites within the 5' and 3' minor domains are also cleaved. This suggests that during the course of 30S subunit assembly these elements are positioned in the vicinity of S15. Besides the previously determined role for S8, roles for S5, S6+S18, and S16 in altering the 16 S rRNA environment of S15 were established. These studies reveal that ribosomal proteins can alter the assembly of regions of the 30 S subunit from a considerable distance and influence the overall conformation of this ribonucleoprotein particle.

  8. Molecular cloning and characterization of an rRNA operon in Streptomyces lividans TK21.

    PubMed Central

    Suzuki, Y; Ono, Y; Nagata, A; Yamada, T

    1988-01-01

    The number of rRNA genes in Streptomyces lividans was examined by Southern hybridization. Randomly labeled 23 and 16S rRNAs were hybridized with BamHI, BglII, PstI, SalI, or XhoI digests of S. lividans TK21 DNA. BamHi, BglII, SalI and XhoI digests yielded six radioactive bands each for the 23 and 16S rRNAs, whereas PstI digests gave one band for the 23S rRNA and one high-intensity band and six low-density bands for the 16S rRNA. The 7.4-kilobase-pair BamHI fragment containing one of the rRNA gene clusters was cloned into plasmid pBR322. The hybrid plasmid, pSLTK1, was characterized by physical mapping, Southern hybridization, and electron microscopic analysis of the R loops formed between pSLTK1 and the 23 and 16S rRNAs. There were at least six rRNA genes in S. lividans TK21. The 16 and 23S rRNA genes were estimated to be about 1.40 and 3.17 kilobase pairs, respectively. The genes for the rRNAs were aligned in the sequence 16S-23S-5S. tRNA genes were not found in the spacer region or in the context of the rRNA genes. The G + C content of the spacer region was calculated to be approximately 58%, in contrast to 73% for the chromosome as a whole. Images PMID:2832372

  9. Pressure broadening and line shifting of atomic strontium 5s{sup 2} {sup 1}S{sub 0}{yields}5s5p {sup 3}P{sub 1} and 5s5p {sup 3}P{sub 0,1,2}{yields}5s6s {sup 3}S{sub 1} absorption transitions induced by noble-gas collisions

    SciTech Connect

    Holtgrave, Jeremy C.; Wolf, Paul J.

    2005-07-15

    The broadening and shifting of spectral lines induced by collisions with the five noble gases in both the intercombination 5s{sup 2} {sup 1}S{sub 0}{yields}5s5p {sup 3}P{sub 1} system and the triplet 5s5p {sup 3}P{sub 0,1,2}{yields}5s6s {sup 3}S{sub 1} manifold of Sr are studied using tunable dye laser absorption spectroscopy. Cross sections for impact broadening and line shifting are determined from an examination of the spectral line profiles. These results are utilized in an analysis to compute difference potentials modeled by the Lennard-Jones (6-12) potential and the coefficients C{sub 6} and C{sub 12} derived from this analysis are reported.

  10. High-Resolution Infrared Spectroscopy of Carbon-Sulfur Chains: II. C_5S and SC_5S

    NASA Astrophysics Data System (ADS)

    Thorwirth, Sven; Salomon, Thomas; Dudek, John B.

    2016-06-01

    Unbiased high-resolution infrared survey scans of the ablation products from carbon-sulfur targets in the 2100 to 2150 cm-1 regime reveal two bands previously not observed in the gas phase. On the basis of comparison against laboratory matrix-isolation work and new high-level quantum-chemical calculations these bands are attributed to the linear C_5S and SC_5S clusters. While polar C_5S was studied earlier using Fourier-transform microwave techniques, the present work marks the first gas-phase spectroscopic detection of SC_5S. H. Wang, J. Szczepanski, P. Brucat, and M. Vala 2005, Int. J. Quant. Chem. 102, 795 Y. Kasai, K. Obi, Y. Ohshima, Y. Hirahara, Y. Endo, K. Kawaguchi, and A. Murakami 1993, ApJ 410, L45 V. D. Gordon, M. C. McCarthy, A. J. Apponi, and P. Thaddeus 2001, ApJS 134, 311

  11. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  12. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  13. Enterococcus faecium PBP5-S/R, the missing link between PBP5-S and PBP5-R.

    PubMed

    Pietta, Ester; Montealegre, Maria Camila; Roh, Jung Hyeob; Cocconcelli, Pier Sandro; Murray, Barbara E

    2014-11-01

    During a study to investigate the evolution of ampicillin resistance in Enterococcus faecium, we observed that a number of E. faecium strains, mainly from the recently described subclade A2, showed PBP5 sequences in between PBP5-S and PBP5-R. These hybrid PBP5-S/R patterns reveal a progression of amino acid changes from the S form to the R form of this protein; however, these changes do not strictly correlate with changes in ampicillin MICs.

  14. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.

    PubMed

    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa

    2011-03-01

    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained.

  15. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.

    PubMed

    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa

    2011-03-01

    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained. PMID:21429462

  16. TFIIIA binds to different domains of 5S RNA and the Xenopus borealis 5S RNA gene.

    PubMed Central

    Sands, M S; Bogenhagen, D F

    1987-01-01

    We have established the conditions for the reassociation of 5S RNA and TFIIIA to form 7S particles. We tested the ability of altered 5S RNAs to bind TFIIIA, taking advantage of the slower mobility of 7S particles compared with free 5S RNA in native polyacrylamide gels. Linker substitution mutants were constructed encompassing the entire gene, including the intragenic control region. In vitro transcripts of the linker substitution mutants were tested for their ability to bind TFIIIA to form 7S ribonucleoprotein particles. Altered 5S RNAs with base changes in or around helices IV and V, which would interfere with the normal base pairing of that region, showed decreased ability to bind TFIIIA. The transcripts of some mutant genes that were efficiently transcribed (greater than 50% of wild-type efficiency) failed to bind TFIIIA in this gel assay. In contrast, the RNA synthesized from a poorly transcribed mutant, LS 86/97, in which residues 87 to 96 of the RNA were replaced in the single-stranded loop at the base of helix V, bound TFIIIA well. The data indicate that TFIIIA binds to different domains in the 5S RNA gene and 5S RNA. Images PMID:3431548

  17. Trans-splicing and RNA editing of LSU rRNA in Diplonema mitochondria

    PubMed Central

    Valach, Matus; Moreira, Sandrine; Kiethega, Georgette N.; Burger, Gertraud

    2014-01-01

    Mitochondrial ribosomal RNAs (rRNAs) often display reduced size and deviant secondary structure, and sometimes are fragmented, as are their corresponding genes. Here we report a mitochondrial large subunit rRNA (mt-LSU rRNA) with unprecedented features. In the protist Diplonema, the rnl gene is split into two pieces (modules 1 and 2, 534- and 352-nt long) that are encoded by distinct mitochondrial chromosomes, yet the rRNA is continuous. To reconstruct the post-transcriptional maturation pathway of this rRNA, we have catalogued transcript intermediates by deep RNA sequencing and RT-PCR. Gene modules are transcribed separately. Subsequently, transcripts are end-processed, the module-1 transcript is polyuridylated and the module-2 transcript is polyadenylated. The two modules are joined via trans-splicing that retains at the junction ∼26 uridines, resulting in an extent of insertion RNA editing not observed before in any system. The A-tail of trans-spliced molecules is shorter than that of mono-module 2, and completely absent from mitoribosome-associated mt-LSU rRNA. We also characterize putative antisense transcripts. Antisense-mono-modules corroborate bi-directional transcription of chromosomes. Antisense-mt-LSU rRNA, if functional, has the potential of guiding concomitantly trans-splicing and editing of this rRNA. Together, these findings open a window on the investigation of complex regulatory networks that orchestrate multiple and biochemically diverse post-transcriptional events. PMID:24259427

  18. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  19. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  20. L5-S1 Laparoscopic Anterior Interbody Fusion

    PubMed Central

    Zeni, Tallal M.; Phillips, Frank M.; Mathur, Sameer; Zografakis, John G.; Moore, Ronald M.; Laguna, Luis E.

    2006-01-01

    Objective: We evaluated our experience with laparoscopic L5-S1 anterior lumbar interbody fusion (ALIF). Methods: This represents a retrospective analysis of consecutive patients who underwent L5-S1 laparoscopic ALIF between February 1998 and August 2003. Results: Twenty-eight patients underwent L5-S1 LAIF (15 males and 13 females). The mean age was 43 years (range, 26 to 67). Mean operative time was 225 minutes (range, 137 to 309 minutes). No conversions to an open procedure were necessary. Twenty-four (85.7%) patients underwent successful bilateral cage placement. Four patients (14.3%) in whom only a single cage could be placed underwent supplementary posterior pedicle screw placement. Mean length of stay (LOS) was 4.1 days (range, 2 to 15). Two patients underwent reoperation subacutely secondary to symptomatic lateral displacement of the cage. One patient developed radiculopathy 6 months postoperatively and required reoperation. One patient developed a small bowel obstruction secondary to adhesions to the cage requiring laparoscopic reoperation. Fusion was achieved in all patients. Visual analogue scale scores for back pain were significantly improved from 8.6±0.8 to 2.8±0.8 (P<0.0001) at 1 year. Conclusion: L5-S1 LAIF is feasible and safe with all the advantages of minimally invasive surgery. Fusion rates and pain improvement were comparable to those with an open repair. PMID:17575763

  1. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron.

    PubMed Central

    MacKay, R M; Salgado, D; Bonen, L; Stackebrandt, E; Doolittle, W F

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are (formula: see text), respectively. Specific phylogenetic relationships of P. denitrificans with purple non-sulphur bacteria, and of Prochloron with cyanobacteria are demonstrated, and unique features of potential secondary structure are described. PMID:7099971

  2. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.

    PubMed

    Rozier, C; Mache, R

    1984-10-11

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  3. Functional domains of the Xenopus laevis 5S gene promoter.

    PubMed Central

    Pieler, T; Oei, S L; Hamm, J; Engelke, U; Erdmann, V A

    1985-01-01

    To study the fine structure of the Xenopus laevis somatic 5S gene internal control region, we have created 15 different transversions using mutagenic oligonucleotide primers. The effects of these mutations on 5S DNA transcription in vitro as well as on stable complex formation with transcription factor TF III A and TF III C in crude nuclear extracts were analyzed. Mutations in the common class III 5' promoter element (nucleotides 50-61 in the 5S gene) interfere with transcription activity and stable complex formation whenever they contradict the tDNA box A consensus sequence. The second promoter element is defined by a major sequence block (nucleotides 80-89, box C) and two additional internal residues (70 and 71) at a distance of roughly one helical turn from both the major 3' and 5' control sequences; these two 3' elements contain the primary TF III A binding domain. The remaining nucleotides (62-69 and 71-79) when mutated do not interfere with transcription activity or factor binding and thus they constitute two spacer elements within a symmetrically structured 5S gene promoter. An increase in the relative spacing of box A and box C by insertion of 3 bp between nucleotides 66 and 67 leads to a drastic reduction in transcription activity and the ability to form a stable complex with TF III A and/or TF III C. Thus, accurate spacing is essential for the proper orientation of TF III A on 5S DNA and/or TF III C binding. Images Fig. 1. Fig. 3. Fig. 4. PMID:3004969

  4. 10. GIRDER APPROACH ON YORKTOWN SIDE, SHOWING PIERS 8S5S (LEFT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. GIRDER APPROACH ON YORKTOWN SIDE, SHOWING PIERS 8S-5S (LEFT TO RIGHT), AND FLOORBEAM/STRINGER SYSTEM. VIEW LOOKING NORTH. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

  5. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  6. Molecular characterization and physical mapping of two classes of 5S rDNA in the genomes of Gymnotus sylvius and G. inaequilabiatus (Gymnotiformes, Gymnotidae).

    PubMed

    Scacchetti, P C; Alves, J C P; Utsunomia, R; Claro, F L; de Almeida Toledo, L F; Oliveira, C; Foresti, F

    2012-01-01

    The nucleotide sequences of the 5S rRNA multigene family and their distribution across the karyotypes in 2 species of Gymnotiformes, genus Gymnotus (G. sylvius and G. inaequilabiatus) were investigated by means of fluorescence in situ hybridization (FISH). The results showed the existence of 2 distinct classes of 5S rDNA sequences in both species: class I and class II. A high conservative pattern of the codifying region of the 5S rRNA gene was identified, contrasting with significant alterations detected in the nontranscribed spacer (NTS). The presence of TATA-like sequences along the NTS of both species was an expected occurrence, since such sequences have been associated with the regulation of the gene expression. FISH using 5S rDNA class I and class II probes revealed that both gene classes were collocated in the same chromosome pair in the genome of G. sylvius, while in that of G. inaequilabiatus, class II appeared more disperse than class I.

  7. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  8. Chromosome mapping of 18S rDNA and 5S rDNA by dual-color fluorescence in situ hybridization in the half-smooth tongue sole (Cynoglossus semilaevis).

    PubMed

    Jiang, L; Jiang, J; Liu, J; Yuan, J; Chen, Y; Zhang, Q; Wang, X

    2014-12-18

    Half-smooth tongue sole (Cynoglossus semilaevis) is an important aquaculture flatfish in China. Cytogenetic analysis has revealed that its sex determination system is female heterogametic (ZZ/ZW). The W chromosome is morphologically larger and has been considered evolutionarily younger than any other chromosome in the set. However, the genetic origin and evolution process of this neo-chromosome remains unclear. In this study, 2 tandem arrays of rRNA genes were chosen to address this question. Both the major rDNA (18S rDNA) and the minor rDNA (5S rDNA) were located on the C. semilaevis chromosomes by fluorescence in situ hybridization (FISH). Six 18S rDNA signals were observed on the centromeric regions of 3 pairs of autosomes in both males and females. In females, there was an additional 18S rDNA signal mapping to the telomeric region of the W chromosome long arm. With respect to the 5S rDNA, 12 signals were mapped to the centromeric regions of six pairs of autosomes. Two-color FISH further confirmed that the two pairs of the 5S rDNA signals were correspondingly located at the same positions of the same autosomes as those of the 18S rDNA signals. These results allowed us to speculate about the evolution process of the W chromosome. Chromosome fusions and repetitive sequence accumulations might have occurred in C. semilaevis. The synteny and non-synteny of C. semilaevis 18S rDNA and 5S rDNA might imply the original and evolutionary characteristics of this species. These findings will facilitate studies on karyotype evolution of the order Pleuronectiformes.

  9. Eukaryotic origins: string analysis of 5S ribosomal RNA sequences from some relevant organisms.

    PubMed

    Nanney, D L; Mobley, D O; Preparata, R M; Meyer, E B; Simon, E M

    1991-04-01

    Using the PHYLOGEN tree-forming programs, we evaluate the published 5S rRNA sequences in certain of the files in the Berlin DataBank in an attempt to identify the connection between archaebacteria and the eukaryotic protists. These programs are based on methods of string analysis developed by Sankoff and others. Their discriminatory power is derived from their continuous realignment of sequences through repeated assessment of insertions and deletions as well as substitutions. The programs demonstrate that even these small molecules (ca. 120 bases) retain substantial records of evolutionary events that occurred over a billion years ago. The eukaryotes seem to have been derived from ancestors near the common origins of the halobacterial and Methanococcales groups. Identifying what might have been a primordial eukaryote is more difficult because several of the species considered as early derivatives from the common root are isolated species with large genetic differences from each other and from all other extant forms that have been sequenced. The ameboid, flagellated, and ciliated protists seem to have emerged nearly simultaneously from an ancient cluster, but the sarcodinid protozoa have preference as the group of most ancient origin. The euglenozoa and the ciliates are of later derivation. Our ability to tease plausible trees from such small molecules suggests that the mode of analysis rather than the size of the molecule is often a major limitation in the reconstruction of acceptable ancient phylogenics.(ABSTRACT TRUNCATED AT 250 WORDS)

  10. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics.

  11. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  12. Karyotypic diversification in Mytilus mussels (Bivalvia: Mytilidae) inferred from chromosomal mapping of rRNA and histone gene clusters

    PubMed Central

    2014-01-01

    Background Mussels of the genus Mytilus present morphologically similar karyotypes that are presumably conserved. The absence of chromosome painting probes in bivalves makes difficult verifying this hypothesis. In this context, we comparatively mapped ribosomal RNA and histone gene families on the chromosomes of Mytilus edulis, M. galloprovincialis, M. trossulus and M. californianus by fluorescent in situ hybridization (FISH). Results Major rRNA, core and linker histone gene clusters mapped to different chromosome pairs in the four taxa. In contrast, minor rRNA gene clusters showed a different behavior. In all Mytilus two of the 5S rDNA clusters mapped to the same chromosome pair and one of them showed overlapping signals with those corresponding to one of the histone H1 gene clusters. The overlapping signals on mitotic chromosomes became a pattern of alternate 5S rRNA and linker histone gene signals on extended chromatin fibers. Additionally, M. trossulus showed minor and major rDNA clusters on the same chromosome pair. Conclusion The results obtained suggest that at least some of the chromosomes bearing these sequences are orthologous and that chromosomal mapping of rRNA and histone gene clusters could be a good tool to help deciphering some of the many unsolved questions in the systematic classification of Mytilidae. PMID:25023072

  13. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  14. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease.

  15. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    PubMed Central

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  16. 5S rDNA genome regions of Lens species.

    PubMed

    Fernández, M; Ruiz, M L; Linares, C; Fominaya, A; Pérez de la Vega, M

    2005-10-01

    The length variability of the nontranscribed spacer (NTS) of the 5S rDNA repeats was analyzed in species of the genus Lens by means of PCR amplification. The NTS ranged from approximately 227 to approximately 952 bp. The polymorphism detected was higher than previous NTS polymorphisms described in this genus. Three NTS length variants from Lens culinaris subsp. culinaris and 2 from Lens culinaris subsp. orientalis were sequenced. The culinaris NTS fragment lengths were 239, 371, and 838 bp, whereas the orientalis ones were 472 bp and 506 bp, respectively. As a result of sequence similarities, 2 families of sequences were distinguished, 1 including the sequences of 838 and 506 bp, and others with the sequences of 239, 371, and 472 bp. The 1st family was characterized by the presence of a repeated sequence designated A, whereas the 2nd family showed a single A sequence and other repeated sequences designated B, C, and D. The presence of an (AT)n microsatellite was also observed in the 2nd family of sequences. The fragments, which included the 239-bp and 838-bp NTS sequences, as well as the intergenic spacer (IGS) of the 18S-5.8S-26S ribosomal DNA also from L. culinaris subsp. culinaris, were used to localize the nucleolar organizer region (NOR) and the 5S rDNA loci in the chromosomes of several species of the genus Lens by means of fluorescence in situ hybridization (FISH). The selective hybridization of the 2 NTS probes allowed us to distinguish between different 5S rDNA chromosomal loci.

  17. Adaptation of the S-5-S pendulum seismometer for measurement of rotational ground motion

    NASA Astrophysics Data System (ADS)

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-10-01

    The Russian electrodynamic seismometer model S-5-S has been adapted for the measurement of rotational ground motion. The mechanical system of the original S-5-S seismometer consists of electrodynamic sensing and damping transducer coils mounted on an asymmetrical double-arm pendulum. This pendulum is suspended on a footing using two pairs of crossed flat springs, which operate as the axis of rotation. The pendulum is stabilised by an additional spring. The S-5-S can be used either as a vertical or as a horizontal sensor. The adaptation of the S-5-S seismometer described below involves removal of the additional spring and installation of an additional mass on the damping arm. Strain gauge angle sensors are installed on one pair of the crossed flat springs. The main dynamic parameters of the rotational seismometer created in this way, i.e. the natural period and damping, are controlled electronically by feedback currents proportional to the angular displacement and angular velocity, both fed to the damping transducer coil. This new seismometer, named the S-5-SR, enables measurement of the rotational component of ground motion around the horizontal or the vertical axes. The output signal from this S-5-SR seismometer can be proportional either to rotational displacement or rotational velocity.

  18. Proteins associated with rRNA in the Escherichia coli ribosome.

    PubMed

    Bernabeu, C; Vazquez, D; Ballesta, J P

    1978-04-27

    Ribosomal proteins located near the rRNA have been identified by cross linking to [14C]spermine with 1,5-difluoro-2,4-dinitrobenzene. The polyamine binds to double-stranded rRNA; those proteins showing radioactivity covalently bound after treatment with the bifunctional reagent should therefore be located in the vicinity of these regions of rRNA. Six proteins from the small subunit, S4, S5, S9, S18, S19 and S20 and ten proteins from the large subunit L2, L6, L13, L14, L16, L17, L18, L19, L22 and L27 preferentially take up the label. The results obtained with three proteins from the large subunit, L6, L16 and L27, show a high degree of variability that could reflect differences of conformation in the subunit population. Several proteins were drastically modified by the cross-linking agent but were not detected in the two-dimensional gel electrophoresis (e.g., S1, S11, S21, L7, L8 and L12) and therefore could not be studied.

  19. Organization, structure, and variability of the rRNA operon of the Whipple's disease bacterium (Tropheryma whippelii).

    PubMed

    Maiwald, M; von Herbay, A; Lepp, P W; Relman, D A

    2000-06-01

    Whipple's disease is a systemic disorder associated with a cultivation-resistant, poorly characterized actinomycete, Tropheryma whippelii. We determined a nearly complete rRNA operon sequence of T. whippelii from specimens from 3 patients with Whipple's disease, as well as partial operon sequences from 43 patients. Variability was observed in the 16S-23S rRNA spacer sequences, leading to the description of five distinct sequence types. One specimen contained two spacer sequence types, raising the possibility of a double infection. Secondary structure models for the primary rRNA transcript and mature rRNAs revealed rare or unique features.

  20. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    PubMed Central

    2010-01-01

    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  1. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  2. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    PubMed Central

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  3. rRNA operons and genome size of 'Candidatus Liberibacter americanus', a bacterium associated with citrus huanglongbing in Brazil.

    PubMed

    Wulff, N A; Eveillard, S; Foissac, X; Ayres, A J; Bové, J-M

    2009-08-01

    Huanglongbing is one of the most severe diseases of citrus worldwide and is associated with 'Candidatus (Ca.) Liberibacter africanus' in Africa, 'Ca. Liberibacter asiaticus' in Asia and the Americas (Brazil, USA and Cuba) and 'Ca. Liberibacter americanus' (Lam) in Brazil. In the absence of axenic cultures, genetic information on liberibacters is scarce. The sequences of the entire 23S rRNA and 5S rRNA genes from Lam have now been obtained, using a consensus primer designed on known tRNAMet sequences of rhizobia. The size of the Lam genome was determined by PFGE, using Lam-infected periwinkle plants for bacterial enrichment, and was found to be close to 1.31 Mbp. In order to determine the number of ribosomal operons on the Lam genome, probes designed to detect the 16S rRNA gene and the 3' end of the 23S rRNA gene were developed and used for Southern hybridization with I-CeuI-treated genomic DNA. Our results suggest that there are three ribosomal operons in a circular genome. Lam is the first liberibacter species for which such data are available.

  4. Repumping and spectroscopy of laser-cooled Sr atoms using the (5s5p)3P2-(5s4d)3D2 transition

    NASA Astrophysics Data System (ADS)

    Mickelson, P. G.; Martinez de Escobar, Y. N.; Anzel, P.; De Salvo, B. J.; Nagel, S. B.; Traverso, A. J.; Yan, M.; Killian, T. C.

    2009-12-01

    We describe repumping and spectroscopy of laser-cooled strontium (Sr) atoms using the (5s5p)3P2-(5s4d)3D2 transition. Atom number in a magneto-optical trap is enhanced by driving this transition because Sr atoms that have decayed into the (5s5p)3P2 dark state are repumped back into the (5s2)1S0 ground state. Spectroscopy of 84Sr, 86Sr, 87Sr and 88Sr improves the value of the (5s5p)3P2-(5s4d)3D2 transition frequency and determines the isotope shifts for the transition accurately enough to guide laser-cooling experiments with less abundant isotopes.

  5. Magnetization reversal phenomena in (Cr0.70Ti0.30)5S6

    NASA Astrophysics Data System (ADS)

    Hashimoto, Satoshi; Matsuda, Yuji; Sato, Tetsuya; Anzai, Shuichiro

    2005-12-01

    Magnetization reversal phenomena (MRP) along magnetic order-order transitions have recently been reported on impurity-doped magnetic systems. Because imperfect long-range magnetic order exists in these systems, it is expected that a systematic investigation of MRP will give physical information on thermomagnetic processes of magnetic systems in the range from the micro- to nanoscales. As a typical order-order transition (a state doubly modulated by helical and canting orders to a collinear ferrimagnetic state) has been known to occur on Cr5S6 at a transition temperature Tt, we investigate the magnetizations of (Cr0.70Ti0.30)5S6 on heating and cooling runs in various magnetic fields. At 20Oe, the field-cooled magnetization just below the Curie temperature has a positive sign; the sign turns negative below the compensation temperature TCM (first step) and finally returns to positive below Tt (second step). The first-step MRP observed in this system is explained by the potential barriers resulting from anisotropy energy when the preferred direction of collinear ferrimagnetic moment reverses. The proposed mechanism for second-step MRP is the pinning effect caused by the impurity atoms (Ti) in the helical long-range-order chains. Comparing other examples of MRPs, we discuss the roles of local impurity centers in the thermomagnetic process in magnetic order-order transitions.

  6. rRNA Gene Expression of Abundant and Rare Activated-Sludge Microorganisms and Growth Rate Induced Micropollutant Removal.

    PubMed

    Vuono, David C; Regnery, Julia; Li, Dong; Jones, Zackary L; Holloway, Ryan W; Drewes, Jörg E

    2016-06-21

    The role of abundant and rare taxa in modulating the performance of wastewater-treatment systems is a critical component of making better predictions for enhanced functions such as micropollutant biotransformation. In this study, we compared 16S rRNA genes (rDNA) and rRNA gene expression of taxa in an activated-sludge-treatment plant (sequencing batch membrane bioreactor) at two solids retention times (SRTs): 20 and 5 days. These two SRTs were used to influence the rates of micropollutant biotransformation and nutrient removal. Our results show that rare taxa (<1%) have disproportionally high ratios of rRNA to rDNA, an indication of higher protein synthesis, compared to abundant taxa (≥1%) and suggests that rare taxa likely play an unrecognized role in bioreactor performance. There were also significant differences in community-wide rRNA expression signatures at 20-day SRT: anaerobic-oxic-anoxic periods were the primary driver of rRNA similarity. These results indicate differential expression of rRNA at high SRTs, which may further explain why high SRTs promote higher rates of micropollutant biotransformation. An analysis of micropollutant-associated degradation genes via metagenomics and direct measurements of a suite of micropollutants and nutrients further corroborates the loss of enhanced functions at 5-day SRT operation. This work advances our knowledge of the underlying ecosystem properties and dynamics of abundant and rare organisms associated with enhanced functions in engineered systems. PMID:27196630

  7. Essential role of conserved DUF177A protein in plastid 23S rRNA accumulation and plant embryogenesis

    PubMed Central

    Yang, Jiani; Suzuki, Masaharu; McCarty, Donald R.

    2016-01-01

    DUF177 proteins are nearly universally conserved in bacteria and plants except the Chlorophyceae algae. Thus far, duf177 mutants in bacteria have not established a function. In contrast, duf177a mutants have embryo lethal phenotypes in maize and Arabidopsis. In maize inbred W22, duf177a mutant embryos arrest at an early transition stage, whereas the block is suppressed in the B73 inbred background, conditioning an albino seedling phenotype. Background-dependent embryo lethal phenotypes are characteristic of maize plastid gene expression mutants. Consistent with the plastid gene expression hypothesis, quantitative real-time PCR revealed a significant reduction of 23S rRNA in an Escherichia coli duf177 knockout. Plastid 23S rRNA contents of duf177a mutant tissues were also markedly reduced compared with the wild-type, whereas plastid 16S, 5S, and 4.5S rRNA contents were less affected, indicating that DUF177 is specifically required for accumulation of prokaryote-type 23S rRNA. An AtDUF177A–green fluorescent protein (GFP) transgene controlled by the native AtDUF177A promoter fully complemented the Arabidopsis atduf177a mutant. Transient expression of AtDUF177A–GFP in Nicotiana benthamiana leaves showed that the protein was localized in chloroplasts. The essential role of DUF177A in chloroplast–ribosome formation is reminiscent of IOJAP, another highly conserved ribosome-associated protein, suggesting that key mechanisms controlling ribosome formation in plastids evolved from non-essential pathways for regulation of the prokaryotic ribosome. PMID:27574185

  8. Ultraviolet light-induced crosslinking reveals a unique region of local tertiary structure in potato spindle tuber viroid and HeLa 5S RNA

    SciTech Connect

    Branch, A.D.; Benenfeld, B.J.; Robertson, H.D.

    1985-10-01

    The positions of intramolecular crosslinks induced by irradiation with ultraviolet light were mapped into potato spindle tuber viroid RNA and HeLa 5S rRNA. Crosslinking in each of these molecules occurred at a single major site, which was located by RNA fingerprinting and secondary analysis. Various lines of evidence suggest that these crosslinks identify a previously undescribed element of local tertiary structure common to these two widely divergent RNA molecules: (i) both crosslinks occur in an identical eight-base context, with the sequence 5 GGGAA 3 on one side and the sequence 5 UAC 3 on the other; (ii) both crosslinks connect bases that are not thought to be involved in conventional hydrogen bonding, within regions usually depicted as single-stranded loops flanked by short helical segments; and (iii) both crosslinks connect a purine and a pyrimidine residue, and both may generate the same G-U dimer. Furthermore, it is likely that the crosslinking site is of functional significance because it is located within the most highly conserved region of the viroid sequence and involves bases that are essentially invariant among eukaryotic 5S rRNA molecules.

  9. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq

    2015-01-01

    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  10. Two spatially separated phases in semiconducting Rb0.8Fe1.5S2

    DOE PAGES

    Wang, Meng; Tian, Wei; Valdivia, P.; Chi, Songxue; Bourret-Courchesne, E.; Dai, Pengcheng; Birgeneau, R. J.

    2014-09-26

    We report neutron scattering and transport measurements on semiconducting Rb0.8Fe1.5S2, a compound isostructural and isoelectronic to the well-studied A0.8FeySe2(A = K, Rb, Cs, Tl/K) superconducting systems. Both resistivity and DC susceptibility measurements reveal a magnetic phase transition at T = 275 K. Neutron diffraction studies show that the 275 K transition originates from a phase with rhombic iron vacancy order which exhibits an in-plane stripe antiferromagnetic ordering below 275 K. In addition, the stripe antiferromagnetic phase interdigitates mesoscopically with an ubiquitous phase with √5 x√5 iron vacancy order. This phase has a magnetic transition at TN = 425 K andmore » an iron vacancy order-disorder transition at TS = 600 K. These two different structural phases are closely similar to those observed in the isomorphous Se materials. Based on the close similarities of the in-plane antiferromagnetic structures, moments sizes, and ordering temperatures in semiconducting Rb0.8Fe1.5S2 and K0.81Fe1.58Se2, we argue that the in-plane antiferromagnetic order arises from strong coupling between local moments. Superconductivity, previously observed in the A0.8FeySe2₋ zSz system, is absent in A0.8Fe1.5S2, which has a semiconducting ground state. We discuss the implied relationship between stripe and block antiferromagnetism and superconductivity in these materials as well as a strategy for further investigation.« less

  11. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    PubMed

    Zhang, Chenyu; Kuspa, Adam

    2009-01-01

    Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA) is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial protein synthesis in D

  12. Towards a phylogeny of the genus Vibrio based on 16S rRNA sequences.

    PubMed

    Dorsch, M; Lane, D; Stackebrandt, E

    1992-01-01

    The inter- and intrageneric relationships of the genus Vibrio were investigated by performing a comparative analysis of the 16S rRNAs of 10 species, including four pathogenic representatives. The results of immunological and 5S rRNA studies were confirmed in that the genus is a neighboring taxon of the family Enterobacteriaceae. With regard to the intrageneric structure, Vibrio alginolyticus, Vibrio campbellii, Vibrio natriegens, Vibrio harveyi, Vibrio proteolyticus, Vibrio parahaemolyticus, and Vibrio vulnificus form the core of the genus, while Vibrio (Listonella) anguillarum, Vibrio diazotrophicus, and Vibrio hollisae are placed on the outskirts of the genus. Variable regions around positions 80, 180, and 450 could be used as target sites for genus- and species-specific oligonucleotide probes and polymerase chain reaction primers to be used in molecular identification.

  13. Promoter of the Mycoplasma pneumoniae rRNA operon.

    PubMed Central

    Hyman, H C; Gafny, R; Glaser, G; Razin, S

    1988-01-01

    RNA transcripts starting from the 5' end of the single Mycoplasma pneumoniae rRNA operon were analyzed by several methods. By primer extension analysis a start site was found 62 nucleotides upstream from the start site of the 16S rRNA. This site was preceded by a putative Pribnow box; however, a defined -35 recognition region was absent. The cloned rRNA operon was transcribed in vitro by using purified RNA polymerase of Escherichia coli. A single start site could be demonstrated within a few nucleotides of the start site found by primer extension analysis of M. pneumoniae transcripts. When fragments from the cloned operon were used as hybridization probes, S1 nuclease mapping yielded a single transcript extending approximately 193 nucleotides upstream from the 16S rRNA start site. The region surrounding this endpoint did not resemble any known promoter sequence. Dot blot hybridization of M. pneumoniae RNA to three oligonucleotides consisting of nucleotides -5 to -21, -38 to -54, and -112 to -132 (from the start of the 16S rRNA gene) indicated that most rRNA transcripts were processed at the stem site preceding the 16S rRNA gene. The majority of the longer precursor transcripts, extending beyond this point, did not extend further upstream to an oligonucleotide consisting of nucleotides -112 to -132. It was concluded that transcription of the rRNA operon of M. pneumoniae is initiated by a single promoter. The nucleotide sequence of the region is presented. Images PMID:2838465

  14. Detection and identification of mycobacteria by amplification of rRNA.

    PubMed

    Böddinghaus, B; Rogall, T; Flohr, T; Blöcker, H; Böttger, E C

    1990-08-01

    Oligonucleotides specific at a genus, group, or species level were defined by a systematic comparison of small-subunit rRNA sequences from Mycobacterium tuberculosis, M. bovis, M. africanum, M. bovis BCG, M. avium, M. kansasii, M. marinum, M. gastri, M. chelonae, M. smegmatis, M. terrae, M. nonchromogenicum, M. xenopi, M. malmoense, M. szulgai, M. scrofulaceum, M. fortuitum, M. gordonae, M. intracellulare, M. simiae, M. flavescens, M. paratuberculosis, M. sphagni, M. cookii, M. komossense, M. phlei, and M. farcinica. On the basis of the defined oligonucleotides, the polymerase chain reaction technique was explored to develop a sensitive taxon-specific detection system for mycobacteria. By using M. tuberculosis as a model system, fewer than 10 bacteria could be reliably detected by this kind of assay. These results suggest that amplification of rRNA sequences by the polymerase chain reaction may provide a highly sensitive and specific tool for the direct detection of microorganisms without the need for prior cultivation.

  15. Homologous genes for mouse 4.5S hybRNA are found in all eukaryotes and their low molecular weight RNA transcripts intermolecularly hybridize with eukaryotic 18S ribosomal RNAs.

    PubMed

    Trinh-Rohlik, Q; Maxwell, E S

    1988-07-11

    Previous work has reported the isolation and sequencing of a mouse low molecular weight RNA species designated 4.5S hybridizing RNA or hybRNA because of its ability to intermolecularly hybridize with mouse mRNA and 18S rRNA sequences. Using synthetic DNA oligonucleotide probes we have examined the conservation of this gene sequence and its expression as a lmwRNA transcript across evolution. Southern blot analysis has shown that homologous genes of single or low copy number are found in all eukaryotes examined as well as in E. coli. Northern blot analysis has demonstrated 4.5S hybRNA transcription in all mouse tissues as well as expression in yeast and Xenopus laevis as lmwRNAs of approximately 130 and 100 nucleotides, respectively, as compared with mouse/rat/hamster species of approximately 87 nucleotides. Yeast and X. laevis 4.5S hybRNA homologs, isolated by hybrid-selection, were shown by Northern blot analysis to intermolecularly hybridize with homologous as well as heterologous 18S rRNA sequences. The conservation of 4.5S hybRNA homologous genes and their expression as lmwRNA transcripts with common intermolecular RNA:RNA hybridization capabilities in fungi, amphibians, and mammals argues for a common, conserved and required biological function for this lmwRNA in all eukaryotes and potential utilization of its intermolecular RNA:RNA hybridization capabilities to carry out this function.

  16. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium

    NASA Astrophysics Data System (ADS)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.

    2014-07-01

    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  17. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.

    PubMed

    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B

    2016-07-01

    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex.

  18. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.

    PubMed

    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B

    2016-07-01

    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex. PMID:26974236

  19. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    PubMed Central

    2010-01-01

    Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s) occurring in 39.6% of the analyzed individuals (both male and female) were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH) was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs) enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement. PMID:20051104

  20. Quantitative Northern Blot Analysis of Mammalian rRNA Processing.

    PubMed

    Wang, Minshi; Pestov, Dimitri G

    2016-01-01

    Assembly of eukaryotic ribosomes is an elaborate biosynthetic process that begins in the nucleolus and requires hundreds of cellular factors. Analysis of rRNA processing has been instrumental for studying the mechanisms of ribosome biogenesis and effects of stress conditions on the molecular milieu of the nucleolus. Here, we describe the quantitative analysis of the steady-state levels of rRNA precursors, applicable to studies in mammalian cells and other organisms. We include protocols for gel electrophoresis and northern blotting of rRNA precursors using procedures optimized for the large size of these RNAs. We also describe the ratio analysis of multiple precursors, a technique that facilitates the accurate assessment of changes in the efficiency of individual pre-rRNA processing steps. PMID:27576717

  1. The terminal balls characteristic of eukaryotic rRNA transcription units in chromatin spreads are rRNA processing complexes.

    PubMed

    Mougey, E B; O'Reilly, M; Osheim, Y; Miller, O L; Beyer, A; Sollner-Webb, B

    1993-08-01

    When spread chromatin is visualized by electron microscopy, active rRNA genes have a characteristic Christmas tree appearance: From a DNA "trunk" extend closely packed "branches" of nascent transcripts whose ends are decorated with terminal "balls." These terminal balls have been known for more than two decades, are shown in most biology textbooks, and are reported in hundreds of papers, yet their nature has remained elusive. Here, we show that a rRNA-processing signal in the 5'-external transcribed spacer (ETS) of the Xenopus laevis ribosomal primary transcript forms a large, processing-related complex with factors of the Xenopus oocyte, analogous to 5' ETS processing complexes found in other vertebrate cell types. Using mutant rRNA genes, we find that the same rRNA residues are required for this biochemically defined complex formation and for terminal ball formation, analyzed electron microscopically after injection of these cloned genes into Xenopus oocytes. This, plus other presented evidence, implies that rRNA terminal balls in Xenopus, and by inference, also in the multitude of other species where they have been observed, are the ultrastructural visualization of an evolutionarily conserved 5' ETS processing complex that forms on the nascent rRNA.

  2. Control of rRNA transcription in Escherichia coli.

    PubMed Central

    Condon, C; Squires, C; Squires, C L

    1995-01-01

    The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

  3. A tandem array of 5S ribosomal RNA genes in Pythium irregulare.

    PubMed

    Belkhiri, A; Intengan, H; Klassen, G R

    1997-02-28

    The 5S ribosomal RNA genes of the oomycete Pythium irregulare exist in tandem arrays unlinked to the rDNA repeat unit. A clone with a 9.2-kb insert containing an array of 5S genes was identified in a lambda genomic library and was characterized by restriction mapping and partial sequencing. The array consisted of 9 apparently identical 5S genes and their spacers in tandem, followed by a diverged 5S-like sequence that is likely to be a pseudogene. This gene arrangement, although almost universal in plants and animals, is rare in fungi and protists.

  4. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  5. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  6. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  7. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  8. A search for the Bs meson in Υ(5S) decays

    NASA Astrophysics Data System (ADS)

    Shipsey, Ian

    2004-05-01

    The CLEO III detector has recorded approximately 0.5 fb-1 of e^+ e^- annihilation data at the Υ(5S) resonance. Using this data sample, we have searched for fully reconstructed Bs mesons in the reaction Υ(5S) arrow B_s^(*) barB_s^(*)

  9. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  10. Climatic controls on drainage basin topography - a synopsis of the western Andean flanks between 15.5 S and 41.5 S lat

    NASA Astrophysics Data System (ADS)

    Rehak, K.; Strecker, M. R.; Echtler, H. P.; Bookhagen, B.

    2007-12-01

    Topography in tectonically active mountain ranges is determined by the interplay between tectonics and climate. Due to the complexity of natural systems it is difficult to evaluate tectonic versus climatic contributions to the long- term landscape evolution. Previous studies suggest that rainfall and its variability strongly influence the morphology of river profiles and mountain ranges. However, it is still controversially discussed how drainage basins reflect tectonic and climatic processes. The Andean Cordillera provides a unique natural setting for studying the relationship between climate, tectonics, and topography. The Andes host various climatic zones with pronounced differences in rainfall regimes. In the central to southern western Andes, climate ranges from hyperarid in the Atacama Desert, 22 to 23°S lat, with a mean annual rainfall of ~ 5 mm/yr to year-round humid conditions south of Valdivia, ~ 40°S lat, with more than 2500 mm/yr. This zonation is controlled by hemisphere-scale atmospheric circulation patterns. With the exception of a northward shift of the Southern Hemisphere Westerlies during glacials the overall precipitation pattern has remained stable on the west coast of South America. The shelf width is reasonably constant along the margin. Uplift rate and lithology vary non-systematically and do not correlate with climatic parameters. Here, we present an analysis of 120 drainage basins along the watershed of the western Andean flank between 15.5 S and 41.5 S lat, using SRTMV3-90m data and a high-resolution rainfall dataset (TRMM 5x5 km). The basins comprise drainage areas of 1 to ~ 30 x 103 km2 and were split into subsets according to position and size. For each basin, we extracted 21 geometry, relief, and climate parameters in order to unravel the determinants of drainage-basin morphology. Our data shows that river-profile concavity and slope, hypsometric integral, basin maximum and mean elevation decrease with increasing rainfall and

  11. Nucleation by rRNA Dictates the Precision of Nucleolus Assembly.

    PubMed

    Falahati, Hanieh; Pelham-Webb, Bobbie; Blythe, Shelby; Wieschaus, Eric

    2016-02-01

    Membrane-less organelles are intracellular compartments specialized to carry out specific cellular functions. There is growing evidence supporting the possibility that such organelles form as a new phase, separating from cytoplasm or nucleoplasm. However, a main challenge to such phase separation models is that the initial assembly, or nucleation, of the new phase is typically a highly stochastic process and does not allow for the spatiotemporal precision observed in biological systems. Here, we investigate the initial assembly of the nucleolus, a membrane-less organelle involved in different cellular functions including ribosomal biogenesis. We demonstrate that the nucleolus formation is precisely timed in D. melanogaster embryos and follows the transcription of rRNA. We provide evidence that transcription of rRNA is necessary for overcoming the highly stochastic nucleation step in the formation of the nucleolus, through a seeding mechanism. In the absence of rDNA, the nucleolar proteins studied are able to form high-concentration assemblies. However, unlike the nucleolus, these assemblies are highly variable in number, location, and time at which they form. In addition, quantitative study of the changes in the nucleoplasmic concentration and distribution of these nucleolar proteins in the wild-type embryos is consistent with the role of rRNA in seeding the nucleolus formation. PMID:26776729

  12. The 5S lean method as a tool of industrial management performances

    NASA Astrophysics Data System (ADS)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  13. Identifications of 5{{s}_{1/2}}-5{{p}_{3/2}} and 5{{s}^{2}}-5s5p EUV transitions of promethium-like Pt, Ir, Os and Re

    NASA Astrophysics Data System (ADS)

    Bekker, H.; Versolato, O. O.; Windberger, A.; Oreshkina, N. S.; Schupp, R.; Baumann, T. M.; Harman, Z.; Keitel, C. H.; Schmidt, P. O.; Ullrich, J.; Crespo López-Urrutia, J. R.

    2015-07-01

    We investigated Pm-, Nd-, and Pr-like spectra in the extreme ultra-violet region around 20 nm of Pt, Ir, Os, and Re (Z = 78-75) produced in the Heidelberg electron beam ion trap. Identification of the transitions was supported by several theoretical calculations, including collisional radiative modeling of the observed spectra. Special attention is given to the identifications of the alkaline-like 5{{s}1/2}-5{{p}3/2} resonance lines in promethium-like highly charged ions. Previous identifications of these lines have been tentative at best due to disagreements with theory and doubts about the experimental charge state identifications. Our experimental results for the 5{{s}1/2}-5{{p}3/2} wavelengths are accurate at the 0.005%-level. Understanding the level-structure of ions near the 4f-5s level crossing is of particular importance for future searches of a possible fine-structure constant variation, and new optical clocks.

  14. Theoretical study on the adsorption of carbon dioxide on individual and alkali-metal doped MOF-5s

    NASA Astrophysics Data System (ADS)

    Ha, Nguyen Thi Thu; Lefedova, O. V.; Ha, Nguyen Ngoc

    2016-01-01

    Density functional theory (DFT) calculations were performed to investigate the adsorption of carbon dioxide (CO2) on metal-organic framework (MOF-5) and alkali-metal (Li, K, Na) doped MOF-5s. The adsorption energy calculation showed that metal atom adsorption is exothermic in MOF-5 system. Moreover, alkali-metal doping can significantly improve the adsorption ability of carbon dioxide on MOF-5. The best influence is observed for Li-doping.

  15. Chemical accessibility of the 4.5S RNA in spinach chloroplast ribosomes.

    PubMed Central

    Kumagai, I; Bartsch, M; Subramanian, A R; Erdmann, V A

    1983-01-01

    We have examined the accessibility to diethylpyrocarbonate of spinach chloroplast 4.5S ribosomal RNA when free and when it is part of the ribosomal structure. The modifications in free 4.5S RNA were found mostly in single-stranded regions of the secondary structure model proposed in our previous paper (Kumagai, I. et al. (1982) J.B.C. 257, 12924-28): adenines at positions 17, 19, 33, 36, 54, 55, 60, 64, 68, 72, 77, 86 and 87 were identified as the reactive residues. On the other hand, in 4.5S RNA in 70S ribosomes or 50S subunits, adenine 33 was exclusively modified, and its reactivity was much higher than in free 4.5S RNA. This highly accessible A33 of spinach 4.5S RNA is located within a characteristic seven nucleotide sequence, which is found in the 4.5S rRNAs from spinach, tobacco and a fern but deleted in 4.5S RNAs from maize and wheat. Images PMID:6828382

  16. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio

    2008-01-04

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  17. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  18. Primary structure of the 5 S subunit of transcarboxylase as deduced from the genomic DNA sequence.

    PubMed

    Thornton, C G; Kumar, G K; Shenoy, B C; Haase, F C; Phillips, N F; Park, V M; Magner, W J; Hejlik, D P; Wood, H G; Samols, D

    1993-09-13

    Transcarboxylase from Propionibacterium shermanii is a complex biotin-containing enzyme composed of 30 polypeptides of three different types. It is composed of six dimeric outer subunits associated with a central cylindrical hexameric subunit through 12 biotinyl subunits; three outer subunits on each face of the central hexamer. Each outer dimer is termed a 5 S subunit which associates with two biotinyl subunits. The enzyme catalyzes a two-step reaction in which methylmalonyl-CoA and pyruvate form propionyl-CoA and oxalacetate, the 5 S subunit specifically catalyzing one of these reactions. We report here the cloning, sequencing and expression of the monomer of the 5 S subunit. The gene was identified by matching amino acid sequences derived from isolated authentic 5 S peptides with the deduced sequence of an open reading frame present on a cloned P. shermanii genomic fragment known to contain the gene encoding the 1.3 S biotinyl subunit. The cloned 5 S gene encodes a protein of 519 amino acids, M(r) 57,793. The deduced sequence shows regions of extensive homology with that of pyruvate carboxylase and oxalacetate decarboxylase, two enzymes which catalyze the same or reverse reaction. A fragment was subcloned into pUC19 in an orientation such that the 5 S open reading frame could be expressed from the lac promoter of the vector. Crude extracts prepared from these cells contained an immunoreactive band on Western blots which co-migrated with authentic 5 S and were fully active in catalyzing the 5 S partial reaction. We conclude that we have cloned, sequenced and expressed the monomer of the 5 S subunit and that the expressed product is catalytically active. PMID:8365490

  19. Angular distribution of Xe 5s. -->. epsilonp photoelectrons: Disagreement between experiment and theory

    SciTech Connect

    Fahlman, A.; Carlson, T.A.; Krause, M.O.

    1983-04-11

    The angular asymmetry parameter ..beta.. for the Xe 5s..-->..epsilonp photoelectrons has been studied with use of synchrotron radiation (h..nu.. = 28--65 eV). The present results show that the relativistic random-phase approximation theory does not satisfactorily describe the Xe 5s photoionization process close to the Cooper minimum and thus require a renewed theoretical approach. The 5s partial photoionization cross section was obtained over the same photon region and the results agree with experimental values found in the literature.

  20. Abridged 5S rDNA units in sea beet (Beta vulgaris subsp. maritima).

    PubMed

    Turner, Daniel J; Brown, Terence A

    2005-04-01

    Amplification by polymerase chain reaction of the 5S rDNA repeat units of Beta vulgaris subsp. maritima resulted in a 350-bp product corresponding to the full-length 5S unit, but also revealed 4 abridged unit classes, each with a deletion that removed most of the spacer and 12-76 bp of the coding sequence. Each abridged type lacks at least 1 of the conserved elements involved in transcription of the 5S gene, and so appear to be nonfunctional. Network analysis revealed that the abridged units are evolving in the same manner as the full-length versions.

  1. Comparison of 16S rRNA sequencing with biochemical testing for species-level identification of clinical isolates of Neisseria spp.

    PubMed

    Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia

    2014-08-01

    We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.

  2. 104. JOB NO. 1347F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    104. JOB NO. 1347-F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD MOTOR COMPANY; LONGITUDINAL SECTION AND TRUSS DETAILS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  3. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    PubMed

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-11-11

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  4. Interaction of Xenopus TFIIIC with the TFIIIA.5 S RNA gene complex.

    PubMed

    Keller, H J; Romaniuk, P J; Gottesfeld, J M

    1992-09-01

    The general transcription factor TFIIIC is necessary for transcription initiation by RNA polymerase III. TFIIIC binds predominantly to the B-Block promoter element, which is present in tRNA genes, several viral RNA genes and repetitive DNA elements, and to the TFIIIA.DNA complex on 5 S RNA genes. Here we report a characterization of Xenopus laevis TFIIIC and its interaction with the TFIIIA.5 S RNA gene complex. A polypeptide with apparent molecular mass of 85 kDa was specifically cross-linked to a B-Block oligonucleotide by UV light. This polypeptide was present in the partially purified TFIIIC fraction and in a complex with a B-Block double-stranded oligonucleotide isolated by nondenaturing gel electrophoresis. TFIIIC.TFIIIA.DNA gel mobility shift complexes were obtained using B-Block DNA affinity-purified TFIIIC and buffer conditions employing low Mg2+ (1 mM) and high dithiothreitol (7 mM) concentrations. Three TFIIIC.TFIIIA.5 S RNA gene complexes were observed by gel mobility shift analysis. One of these complexes was resistant to dissociation by the addition of competing DNA, but the formation of all three complexes was prevented by the inclusion of excess specific competitor DNA in the initial binding reactions. The apparent affinity of TFIIIC for the TFIIIA.5 S DNA complex was 5-fold higher for the somatic-type 5 S RNA gene than for the oocyte-type 5 S RNA gene. Mutations near the 5' boundary of the TFIIIA binding site alter the DNase I footprint of the TFIIIA.DNA complex and reduce the affinity of TFIIIA-mutant 5 S gene complexes for TFIIIC. Differences in TFIIIC affinity for the two classes of 5 S RNA genes may play a role in the developmental regulation of these gene families. PMID:1517247

  5. Satellite DNA derived from 5S rDNA in Physalaemus cuvieri (Anura, Leiuperidae).

    PubMed

    Vittorazzi, S E; Lourenço, L B; Del-Grande, M L; Recco-Pimentel, S M

    2011-01-01

    In the present study, we describe for the first time a family of 190-bp satellite DNA related to 5S rDNA in anurans and the existence of 2 forms of 5S rDNA, type I (201 bp) and type II (690 bp). The sequences were obtained from genomic DNA of Physalaemus cuvieri from Palmeiras, State of Bahia, Brazil. Analysis of the nucleotide sequence revealed that the satellite DNA obtained by digestion with EcoRI, called PcP190EcoRI, is 70% similar to the coding region of type I 5S rDNA and 66% similar to the coding region of type II 5S rDNA. Membrane hybridization and PCR amplification of the sequence showed that PcP190EcoRI is tandemly repeated. The satellite DNA as well as type I and type II 5S rDNA were localized in P. cuvieri chromosomes by fluorescent in situ hybridization. The PcP190EcoRI sequence was found in the centromeres of chromosomes 1-5 and in the pericentromeric region of chromosome 3. Type I 5S rDNA was detected in chromosome 3, coincident with the site of PcP190EcoRI. Type II 5S rDNA was located interstitially in the long arm of chromosome 5. None of these sequences co-localized with nucleolar organizer regions. Our data suggests that this satellite DNA originates from the 5S ribosomal multigene family, probably by gene duplication, nucleotide divergence and sequence dispersion in the genome.

  6. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  7. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  8. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  9. Structural polymorphism in the major groove of a 5S RNA gene complements the zinc finger domains of transcription factor IIIA.

    PubMed Central

    Huber, P W; Morii, T; Mei, H Y; Barton, J K

    1991-01-01

    Metal complexes that bind to DNA on the basis of shape-selection have been used to map the conformational features of the DNA binding site for transcription factor IIIA. Conformationally distinct segments are detected on the 5S rRNA gene that correspond closely to the binding sites identified for the individual zinc finger domains of the protein. The local conformations are characterized by a major groove opened because of a change in base pair inclination and/or displacement at a central 5'-pyrimidine-purine-3' step, flanked by a widened minor groove, as would arise at the junctions between alternating B- and A-like DNA segments. Docking experiments with a consensus structure of a zinc finger reveal that the mixed A-B binding site accommodates the peptide domain better than either canonical B- or A-DNA helices. The close structural matching of the conformational variations in the 5S rDNA both to the proposed sites of zinc finger binding and to the shape of an individual zinc finger domain points to DNA structural polymorphism as providing an important determinant in recognition. In particular, shape selection in the 5' half of the internal control region may orient the multiple finger domains. Images PMID:1961749

  10. Intraspecific 16S rRNA gene diversity among clinical isolates of Neisseria species.

    PubMed

    Mechergui, Arij; Achour, Wafa; Hassen, Assia Ben

    2014-05-01

    In the present work, nearly the entire 16S rRNA gene sequences of 46 clinical samples of Neisseria spp. were determined, and the aligned sequences were analyzed to investigate the diversity of 16S rRNA genes in each commensal Neisseria species. Two 16S rRNA types were identified in two Neisseria sicca strains, three 16S rRNA types in five Neisseria macacae strains, fourteen 16S rRNA types in twenty Neisseria flavescens isolates, and fourteen 16S rRNA types in nineteen Neisseria mucosa isolates. The number of nucleotides that were different between 16S rRNA sequences within specie ranged from 1 to 15. We found high intraspecific sequence variation in 16S rRNA genes of Neisseria spp. strains.

  11. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    PubMed Central

    Suslu, Hikmet Turan; Celikoglu, Erhan; Borekcı, Ali; Hıcdonmez, Tufan; Suslu, Hüsnü

    2011-01-01

    Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches. PMID:23125496

  12. A Neurospora crassa ribosomal protein gene, homologous to yeast CRY1, contains sequences potentially coordinating its transcription with rRNA genes.

    PubMed Central

    Tyler, B M; Harrison, K

    1990-01-01

    We have isolated and sequenced a Neurospora crassa ribosomal protein gene (designated crp-2) strongly homologous to the rp59 gene (CRY1) of yeast and the S14 ribosomal protein gene of mammals. The inferred sequence of the crp-2 protein is more homologous (83%) to the mammalian S14 sequence than to the yeast rp59 sequence (69%). The gene has three intervening sequences (IVSs) two of which are offset 7 bp from the position of IVSs in the mammalian genes. None correspond to the position of the IVS in the yeast gene. Crp-2 was mapped by RFLP analysis to the right arm of linkage group III. The 5' region of the gene contains three copies of a sequence, the Ribo box, previously shown to be required for transcription of both 5S and 40S rRNA genes. We speculate that the Ribo box may coordinate ribosomal protein and rRNA gene transcription. Images PMID:1977135

  13. Chromosomal localization of rDNA genes and genomic organization of 5S rDNA in Oreochromis mossambicus, O. urolepis hornorum and their hybrid.

    PubMed

    Zhu, Hua Ping; Lu, Mai Xin; Gao, Feng Ying; Huang, Zhang Han; Yang, Li Ping; Gui, Jian Fang

    2010-08-01

    In this study, classical and molecular cytogenetic analyses were performed in tilapia fishes, Oreochromis mossambicus (XX/XY sex determination system), O. urolepis hornorum (WZ/ZZ sex determination system) and their hybrid by crossing O. mossambicus female x O. u. hornorum male. An identical karyotype ((2n = 44, NF (total number of chromosomal arms) = 50) was obtained from three examined tilapia samples. Genomic organization analysis of 5S rDNA revealed two different types of 5S rDNA sequences, 5S type I and 5S type II. Moreover, fluorescence in situ hybridization (FISH) with 5S rDNA probes showed six positive fluorescence signals on six chromosomes of all the analysed metaphases from the three tilapia samples. Subsequently, 45S rDNA probes were also prepared, and six positive fluorescence signals were observed on three chromosome pairs in all analysed metaphases of the three tilapia samples. The correlation between 45 rDNA localization and nucleolar organizer regions (NORs) was confirmed by silver nitrate staining in tilapia fishes. Further, different chromosomal localizations of 5S rDNA and 45S rDNA were verified by two different colour FISH probes. Briefly, the current data provide an insights for hybridization projects and breeding improvement of tilapias.

  14. Formation of Tertiary Interactions during rRNA GTPase Center Folding.

    PubMed

    Rau, Michael J; Welty, Robb; Tom Stump, W; Hall, Kathleen B

    2015-08-28

    The 60-nt GTPase center (GAC) of 23S rRNA has a phylogenetically conserved secondary structure with two hairpin loops and a 3-way junction. It folds into an intricate tertiary structure upon addition of Mg(2+) ions, which is stabilized by the L11 protein in cocrystal structures. Here, we monitor the kinetics of its tertiary folding and Mg(2+)-dependent intermediate states by observing selected nucleobases that contribute specific interactions to the GAC tertiary structure in the cocrystals. The fluorescent nucleobase 2-aminopurine replaced three individual adenines, two of which make long-range stacking interactions and one that also forms hydrogen bonds. Each site reveals a unique response to Mg(2+) addition and temperature, reflecting its environmental change from secondary to tertiary structure. Stopped-flow fluorescence experiments revealed that kinetics of tertiary structure formation upon addition of MgCl2 are also site specific, with local conformational changes occurring from 5 ms to 4s and with global folding from 1 to 5s. Site-specific substitution with (15)N-nucleobases allowed observation of stable hydrogen bond formation by NMR experiments. Equilibrium titration experiments indicate that a stable folding intermediate is present at stoichiometric concentrations of Mg(2+) and suggest that there are two initial sites of Mg(2+) ion association. PMID:26210661

  15. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  16. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  17. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  18. rrnDB: documenting the number of rRNA and tRNA genes in bacteria and archaea.

    PubMed

    Lee, Zarraz May-Ping; Bussema, Carl; Schmidt, Thomas M

    2009-01-01

    A dramatic exception to the general pattern of single-copy genes in bacterial and archaeal genomes is the presence of 1-15 copies of each ribosomal RNA encoding gene. The original version of the Ribosomal RNA Database (rrnDB) cataloged estimates of the number of 16S rRNA-encoding genes; the database now includes the number of genes encoding each of the rRNAs (5S, 16S and 23S), an internally transcribed spacer region, and the number of tRNA genes. The rrnDB has been used largely by microbiologists to predict the relative rate at which microbial populations respond to favorable growth conditions, and to interpret 16S rRNA-based surveys of microbial communities. To expand the functionality of the rrnDB (http://ribosome.mmg.msu.edu/rrndb/index.php), the search engine has been redesigned to allow database searches based on 16S rRNA gene copy number, specific organisms or taxonomic subsets of organisms. The revamped database also computes average gene copy numbers for any collection of entries selected. Curation tools now permit rapid updates, resulting in an expansion of the database to include data for 785 bacterial and 69 archaeal strains. The rrnDB continues to serve as the authoritative, curated source that documents the phylogenetic distribution of rRNA and tRNA genes in microbial genomes.

  19. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.

    PubMed

    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A

    2008-01-01

    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  20. Interactions of aminoglycoside antibiotics with rRNA.

    PubMed

    Trylska, Joanna; Kulik, Marta

    2016-08-15

    Aminoglycoside antibiotics are protein synthesis inhibitors applied to treat infections caused mainly by aerobic Gram-negative bacteria. Due to their adverse side effects they are last resort antibiotics typically used to combat pathogens resistant to other drugs. Aminoglycosides target ribosomes. We describe the interactions of aminoglycoside antibiotics containing a 2-deoxystreptamine (2-DOS) ring with 16S rRNA. We review the computational studies, with a focus on molecular dynamics (MD) simulations performed on RNA models mimicking the 2-DOS aminoglycoside binding site in the small ribosomal subunit. We also briefly discuss thermodynamics of interactions of these aminoglycosides with their 16S RNA target. PMID:27528743

  1. Growth rate regulation of rRNA content of a marine Synechococcus (cyanobacterium) strain

    SciTech Connect

    Binder, B.J.; Liu, Y.C.

    1998-09-01

    The relationship between growth rate and rRNA content in a marine Synechococcus strain was examined. A combination of flow cytometry and whole-cell hybridization with fluorescently labeled 16S rRNA-targeted oligonucleotide probes was used to measure the rRNA content of Synechococcus strain WH8101 cells grown at a range of light-limited growth rates. The sensitivity of this approach was sufficient for the analysis of rRNA even in very slowly growing Synechococcus cells. The relationship between growth rate and cellular rRNA content comprised three phases: (1) at low growth rates, rRNA cell{sup {minus}1} remained approximately constant; (2) at intermediate rates, rRNA cell{sup {minus}1} increased proportionally with growth rate; and (3) at the highest, light-saturated rates, rRNA cell{sup {minus}1} dropped abruptly. Total cellular RNA was well correlated with the probe-based measure of rRNA and varied in a similar manner with growth rate. Mean cell volume and rRNA concentration were related to growth rate in a manner similar to rRNA cell{sup {minus}1}, although the overall magnitude linear increase in ribosome efficiency with increasing growth rate, which is consistent with the prevailing prokaryotic model at low growth rates. Taken together, these results support the notion that measurements of cellular rRNA content might be useful for estimating in situ growth rates in natural Synechococcus populations.

  2. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  3. Strong nondipole effect created by multielectron correlation in 5s photoionization of xenon

    SciTech Connect

    Ricz, S.; Koever, A.; Varga, D.; Ricsoka, T.; Sankari, R.; Jurvansuu, M.; Nikkinen, J.; Aksela, H.; Aksela, S.

    2003-01-01

    The angular distribution of the Xe 5s photoelectrons was measured in the 90-225 eV photon energy range using linearly polarized synchrotron radiation. The experimentally determined angular distribution parameters were compared with theoretical values obtained from calculations based on the random-phase approximation and the time-dependent density-functional theory. Experiment shows that the dipole ({beta}) and nondipole ({gamma}) parameters vary strongly as a function of the photon energy, in accordance with calculations that account for the interchannel coupling. Nondipole effects observed clearly in experiment confirm the role of multielectron correlation in describing the 5s photoionization of Xe far from the ionization threshold.

  4. The radiative lifetime of the 5S(0)2 metastable level of O(2+)

    NASA Technical Reports Server (NTRS)

    Johnson, B. C.; Smith, P. L.; Knight, R. D.

    1984-01-01

    The radiative lifetime of the 5S(0)2 metastable level of O(2+) was measured as 1.22 + or - 0.08 ms at the 90 percent confidence level by observing the time dependence of the spontaneous emission from metastable ions created and stored in a cylindrical radio-frequency ion trap. The intersystem line emission 2s(2)2p(2) 3P - 2s2p(3) 5S(0) was observed at 1660.8 and 1666.2 A. Discrepancies between measured and calculated values indicate that certain calculated transition probabilities for intersystem lines may be less reliable than previously believed.

  5. The nucleotide sequences of 5S rRNAs from three ciliated protozoa.

    PubMed Central

    Kumazaki, T; Hori, H; Osawa, S; Mita, T; Higashinakagawa, T

    1982-01-01

    The nucleotide sequences of 5S rRNAs from three ciliated protozoa, Paramecium tetraurelia, Tetrahymena thermophila and Blepharisma japonicum have been determined. All of them are 120 nucleotides long and the sequence of probable tRNA binding site of position 41-44 is GAAC which is characteristic of the plant 5S rRNAs. The sequence similarity percents are 87% (Paramecium/Tetrahymena), 86% (Paramecium/Blepharisma) and 79% (Tetrahymena/Blepharisma), suggesting a close relationship of these three ciliates. PMID:7122243

  6. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    PubMed

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  7. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  8. Chromosomal organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the evolutionary dynamics of multigene families and heterochromatin

    PubMed Central

    2011-01-01

    Background Scarabaeinae beetles show a high level of macro-chromosomal variability, although the karyotypic organization of heterochromatin and multigene families (rDNAs and histone genes) is poorly understood in this group. To better understand the chromosomal organization and evolution in this group, we analyzed the karyotypes, heterochromatin distribution and chromosomal locations of the rRNAs and histone H3 genes in beetles belonging to eight tribes from the Scarabaeinae subfamily (Coleoptera, Scarabaeidae). Results The number of 18S rRNA gene (a member of the 45S rDNA unit) sites varied from one to 16 and were located on the autosomes, sex chromosomes or both, although two clusters were most common. Comparison of the 45S rDNA cluster number and the diploid numbers revealed a low correlation value. However, a comparison between the number of 45S rDNA sites per genome and the quantity of heterochromatin revealed (i) species presenting heterochromatin restricted to the centromeric/pericentromeric region that contained few rDNA sites and (ii) species with a high quantity of heterochromatin and a higher number of rDNA sites. In contrast to the high variability for heterochromatin and 45S rDNA cluster, the presence of two clusters (one bivalent cluster) co-located on autosomal chromosomes with the 5S rRNA and histone H3 genes was highly conserved. Conclusions Our results indicate that the variability of the 45S rDNA chromosomal clusters is not associated with macro-chromosomal rearrangements but are instead related to the spread of heterochromatin. The data obtained also indicate that both heterochromatin and the 45S rDNA loci could be constrained by similar evolutionary forces regulating spreading in the distinct Scarabaeinae subfamily lineages. For the 5S rRNA and the histone H3 genes, a similar chromosomal organization could be attributed to their association/co-localization in the Scarabaeinae karyotypes. These data provide evidence that different evolutionary

  9. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON QSAR

    EPA Science Inventory

    Dyer, S.D., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to predict HC5's Based on QSARs (Abstract). To be presented at the SETAC Europe 14th Annual Meeting: Environmental Science Solution: A Pan-European Perspective, 18-...

  10. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica.

  11. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON MINIMAL DATA

    EPA Science Inventory

    Dyer, S., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to Predict HC5's Based on Minimal Data (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portland, OR. 1 p. (ERL,GB R1013).

  12. The 5-S RNA . protein complex from an extreme halophile, Halobacterium cutirubrum. Purification and characterization.

    PubMed

    Smith, N; Matheson, A T; Yaguchi, M; Willick, G E; Nazar, R N

    1978-09-01

    A 5-S RNA . protein complex has been isolated from the 50-S ribosomal subunit of an extreme halophile, Halobacterium cutirubrum. The 50-S ribosomal subunit from the extreme halophile requires 3.4 M K+ and 100 mM Mg2+ for stability. However, if the high K+ concentration is maintained but the Mg2+ concentration lowered to 0.3 mM, the 5-S RNA . protein complex is selectively extracted from the subunit. After being purified on an Agarose 0.5-m column the complex had a molecular weight of about 80000 and contained 5-S RNA and two proteins, HL13 and HL19, with molecular weights (by sedimentation equilibrium) of 18700 and 18000, respectively. No ATPase or GTPase activity could be detected in the 5-S RNA . protein complex. The amino acid composition and electrophoretic mobility on polyacrylamide gels indicated both proteins were much more acidic than the equivalent from Escherichia coli or Bacillus stearothermophilus. Partial amino acid sequence data suggest HL13 is homologous to EL18 and HL19 to EL5.

  13. Characterization of Ffh of Mycobacterium tuberculosis and its interaction with 4.5S RNA.

    PubMed

    Palaniyandi, Kannan; Veerasamy, Malini; Narayanan, Sujatha

    2012-10-12

    Signal recognition particle (SRP) mediates targeting of proteins to appropriate cellular compartments, which is an important process in all living organisms. In prokaryotes, SRP consists of Ffh, a protein, and 4.5S RNA that recognizes signal peptide emerging from ribosomes. The SRP (Ffh) of one the most successful intracellular pathogen, Mycobacterium tuberculosis, has been investigated with respect to biochemical properties. In the present study, Ffh of M. tuberculosis was overexpressed and was confirmed to be a GTPase using thin layer chromatography and malachite green assay. The GTP binding ability was confirmed by GTP overlay assay. The 4.5S RNA sequence of M. tuberculosis was synthesized by in vitro transcription assay. The interaction between Ffh and 4.5S RNA was confirmed by overlay assay and RNA gel shift assay. The results show that the biochemical properties of M. tuberculosis Ffh have been conserved, and this is the first report that shows the interaction of components of SRP in M. tuberculosis, namely Ffh protein and 4.5S RNA.

  14. Nucleolar association and transcriptional inhibition through 5S rDNA in mammals.

    PubMed

    Fedoriw, Andrew M; Starmer, Joshua; Yee, Della; Magnuson, Terry

    2012-01-01

    Changes in the spatial positioning of genes within the mammalian nucleus have been associated with transcriptional differences and thus have been hypothesized as a mode of regulation. In particular, the localization of genes to the nuclear and nucleolar peripheries is associated with transcriptional repression. However, the mechanistic basis, including the pertinent cis- elements, for such associations remains largely unknown. Here, we provide evidence that demonstrates a 119 bp 5S rDNA can influence nucleolar association in mammals. We found that integration of transgenes with 5S rDNA significantly increases the association of the host region with the nucleolus, and their degree of association correlates strongly with repression of a linked reporter gene. We further show that this mechanism may be functional in endogenous contexts: pseudogenes derived from 5S rDNA show biased conservation of their internal transcription factor binding sites and, in some cases, are frequently associated with the nucleolus. These results demonstrate that 5S rDNA sequence can significantly contribute to the positioning of a locus and suggest a novel, endogenous mechanism for nuclear organization in mammals.

  15. Relativistic effects on interchannel coupling in atomic photoionization: The photoelectron angular distribution of Xe 5s

    SciTech Connect

    Hemmers, O.; Manson, S. T.; Sant'Anna, M. M.; Focke, P.; Wang, H.; Sellin, I. A.; Lindle, D. W.

    2001-08-01

    Measurements of the photoelectron angular-distribution asymmetry parameter {beta} for Xe 5s photoionization have been performed in the 80--200 eV photon-energy region. The results show a substantial deviation from the nonrelativistic value of {beta}=2 and provide a clear signature of significant relativistic effects in interchannel coupling.

  16. 12. PIERS 5S AND 4S, SHOWING TRANSITION AT 4S FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. PIERS 5S AND 4S, SHOWING TRANSITION AT 4S FROM GIRDER SPAN TO 'SUSPENDED' TRUSS SPAN AT U0. VIEW LOOKING WEST. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

  17. An efficient synthetic approach to 6,5'-(S)- and 6,5'-(R)-cyclouridine.

    PubMed

    Theile, Christopher S; McLaughlin, Larry W

    2012-06-01

    Here we present new routes for the efficient syntheses of 6,5'-(S)- and 6,5'-(R)-cyclouridine. The syntheses utilize readily accessible uridine as a starting material. This route to the R diastereomer is significantly more efficient than previous synthetic efforts, allowing us to obtain large amounts of pure material for future biological testing.

  18. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  19. Biosynthesis of resorcylic acid lactone (5S)-5-hydroxylasiodiplodin in Lasiodiplodia theobromae.

    PubMed

    Kashima, Takasumi; Takahashi, Kosaku; Matsuura, Hideyuki; Nabeta, Kensuke

    2009-11-01

    An administration study of (2)H-labeled precursors showed that the 9-hydroxydecanoyl unit, the acyl intermediate of lasiodiplodin (1), was also the intermediate of (5S)-5-hydroxylasiodiplodin (2) in Lasiodiplodia theobromae. The incorporation of [O-methyl-(2)H(3)]-lasiodiplodin (6) into 2 indicated that hydroxylation at C-5 occurred after cyclization. PMID:19897901

  20. Photodissociation dynamics of superexcited O2: Dissociation channels O(5S) vs. O(3S)

    NASA Astrophysics Data System (ADS)

    Zhou, Yiyong; Meng, Qingnan; Mo, Yuxiang

    2014-07-01

    The photodissociation dynamics of O2, O2 + hυ → O(3P) + O(2p3(4S)3s, 3S/5S), has been studied by combining the XUV laser pump / UV laser probe and velocity map imaging methods in the photon energy range 14.64-15.20 eV. The fragment yield spectra of O(3S) and O(5S) and their velocity map images have been recorded using the state-selective (1+1) REMPI method to detect the fragments. The fragment yield spectra show resolved fine structure that arises from the predissociated Rydberg states I, I' and I″ (3ΠΩ = 0,1,2). The branching ratios between the two decay channels have been measured by one-photon ionization of the fragments O(3S) and O(5S) simultaneously. It is surprising to find that the dissociation cross sections for the production of O(5S) are larger than, or comparable to, those of O(3S) for the I and I' states, while the cross sections for the production of O(5S) are smaller than those of O(3S) for the I″ state. All fragments O(5S) arise from perpendicular transitions, which provides direct experimental evidence about the symmetry assignments of the states I, I' and I″ excited in this energy region. Although most of the fragments O(3S) arise from perpendicular transitions, some of them are from parallel transitions. Based on the calculated ab initio potential energy curves, we propose that the neutral dissociation into O(3P) + O(3S) occurs mainly via the interaction of the Rydberg states I, I', and I″ with the vibrational continuum of the diabatic 83Πu state (1π _u^{ - 1} (a^4 {Π}_u {)3}sσ _g ,^3 Π_u), while the neutral dissociation into O(3P) + O(5S) occurs mainly via the interaction of Rydberg states I, I', and I″ with the diabatic 73Πu (1π _g^{ - 1} (X^2 {Π}_g {)3}p{σ }_u ,^3 Π_u).

  1. Transcription factor IIIA induced bending of the Xenopus somatic 5S gene promoter.

    PubMed

    Schroth, G P; Cook, G R; Bradbury, E M; Gottesfeld, J M

    1989-08-10

    Transcription factor IIIA (TFIIIA), the canonical zinc-finger protein, is a protein of relative molecular mass 39,000 (39K) that is required for transcription of 5S-ribosomal subunit genes in Xenopus. It binds in a sequence-specific manner to the internal control region of the 5S gene (see Fig. 1) and facilitates transcription of the gene by RNA polymerase III. It also binds to the 5S gene product to form a 7S ribonucleoprotein particle. In oocytes the 7S particle acts as a storage form of the RNA to be utilized later in development. TFIIIA binds to DNA through its 30 K N-terminal domain, which contains nine zinc-fingers. TFIIIA was the first protein described to have this type of DNA binding motif, but numerous other proteins have now been shown to have zinc-finger domains. A structure for a single zinc-finger from the yeast protein ADR1, was recently proposed based on two-dimensional NMR data (ref. 8), and a similar structure was proposed based on comparison with crystal structures of other metalloproteins. Although models for the interaction of TFIIIA with the 5S-ribosomal gene DNA have been proposed, based on nuclease digestion and methylation interference data, little precise structural information is available for TFIIIA and the physical basis for the interaction of zinc-fingers with DNA is not understood. Using both circular permutation and circularization assays we provide convincing biochemical evidence that TFIIIA bends the DNA at the internal promoter of the 5S gene.

  2. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  3. Functional Specialization of Domains Tandemly Duplicated Witin 16S rRNA Methyltransferase RsmC

    SciTech Connect

    Sunita,S.; Purta, E.; Durawa, M.; Tkaczuk, K.; Swaathi, J.; Bujnicki, J.; Sivaraman, J.

    2007-01-01

    RNA methyltransferases (MTases) are important players in the biogenesis and regulation of the ribosome, the cellular machine for protein synthesis. RsmC is a MTase that catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (SAM) to G1207 of 16S rRNA. Mutations of G1207 have dominant lethal phenotypes in Escherichia coli, underscoring the significance of this modified nucleotide for ribosome function. Here we report the crystal structure of E. coli RsmC refined to 2.1 Angstroms resolution, which reveals two homologous domains tandemly duplicated within a single polypeptide. We characterized the function of the individual domains and identified key residues involved in binding of rRNA and SAM, and in catalysis. We also discovered that one of the domains is important for the folding of the other. Domain duplication and subfunctionalization by complementary degeneration of redundant functions (in particular substrate binding versus catalysis) has been reported for many enzymes, including those involved in RNA metabolism. Thus, RsmC can be regarded as a model system for functional streamlining of domains accompanied by the development of dependencies concerning folding and stability.

  4. Thickness-Dependent and Magnetic-Field-Driven Suppression of Antiferromagnetic Order in Thin V5S8 Single Crystals.

    PubMed

    Hardy, Will J; Yuan, Jiangtan; Guo, Hua; Zhou, Panpan; Lou, Jun; Natelson, Douglas

    2016-06-28

    With materials approaching the 2D limit yielding many exciting systems with intriguing physical properties and promising technological functionalities, understanding and engineering magnetic order in nanoscale, layered materials is generating keen interest. One such material is V5S8, a metal with an antiferromagnetic ground state below the Néel temperature TN ∼ 32 K and a prominent spin-flop signature in the magnetoresistance (MR) when H∥c ∼ 4.2 T. Here we study nanoscale-thickness single crystals of V5S8, focusing on temperatures close to TN and the evolution of material properties in response to systematic reduction in crystal thickness. Transport measurements just below TN reveal magnetic hysteresis that we ascribe to a metamagnetic transition, the first-order magnetic-field-driven breakdown of the ordered state. The reduction of crystal thickness to ∼10 nm coincides with systematic changes in the magnetic response: TN falls, implying that antiferromagnetism is suppressed; and while the spin-flop signature remains, the hysteresis disappears, implying that the metamagnetic transition becomes second order as the thickness approaches the 2D limit. This work demonstrates that single crystals of magnetic materials with nanometer thicknesses are promising systems for future studies of magnetism in reduced dimensionality and quantum phase transitions.

  5. Transformation of tetrahymena thermophila with hypermethylated rRNA genes

    SciTech Connect

    Karrer, K.M.; Yao, M.C.

    1988-04-01

    The extrachromosomal rRNA genes (rDNA) of Tetrahymena thermophila contain 0.4% N/sup 6/-methyladenine. C3 strain rDNA was isolated, hypermethylated in vitro, and microinjected into B strain host cells. Clonal cell lines were established, and transformants were selected on the basis of resistance to paromomycin, conferred by the injected rDNA. The effects of methylation by three enzymes which methylate the sequence 5'-NAT-3'', the dam, EcoRI, and ClaI methylases, were tested. Hypermethylation of the injected rDNA had no effect on transformation efficiency relative to mock-methylated controls. The injected C3 strain rDNA efficiently replaced host rDNA as the major constituent of the population of rDNA molecules. Hypermethylation of the injected DNA was not maintained through 20 to 25 cell generations.

  6. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    PubMed

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

  7. 5S program to reduce change-over time on forming department (case study on CV Piranti Works temanggung)

    NASA Astrophysics Data System (ADS)

    Rosiana Dewi, Septika; Setiawan, Budi; P, Susatyo Nugroho W.

    2013-06-01

    Productivity is one aspect that determines the success of a company in the competitive world of business. There are seven main types of activities that do not have value-added in manufacturing processes such as overproduction, waiting time, transportation, excess inventory, unnecessary motion and defects. The whole activity is a waste (waste) that can cause harm to the Company. Therefore, in production activities is important to pay attention so that the objectives of production productivity can be achieved. Problems experienced by CV Piranti Works is a production target is not achieved resulting in a lost sale raises the cost of which can cause harm to the Company. From the analysis conducted major known cause of the problem is the length of time required for changeover. This is supported by the high non-value added activity in the changeover activities. Lean Manufacturing is an approach to make system more efficient by reducing waste. This study refers to the book compiled by Takashi Osada (2004) and several other references. In this research used method 5S (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) for the of forming departement. The purpose of this research is to design a work environment using the 5S method (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) and make arrangement of equipment and working tool cabinet design with TRIZ methods. From these results, is expected to eliminate or reduce of non-value added activity and improved the changeover time so as to meet production targets completion of the company.

  8. New screening software shows that most recent large 16S rRNA gene clone libraries contain chimeras.

    PubMed

    Ashelford, Kevin E; Chuzhanova, Nadia A; Fry, John C; Jones, Antonia J; Weightman, Andrew J

    2006-09-01

    A new computer program, called Mallard, is presented for screening entire 16S rRNA gene libraries of up to 1,000 sequences for chimeras and other artifacts. Written in the Java computer language and capable of running on all major operating systems, the program provides a novel graphical approach for visualizing phylogenetic relationships among 16S rRNA gene sequences. To illustrate its use, we analyzed most of the large libraries of cloned bacterial 16S rRNA gene sequences submitted to the public repository during 2005. Defining a large library as one containing 100 or more sequences of 1,200 bases or greater, we screened 25 of the 28 libraries and found that all but three contained substantial anomalies. Overall, 543 anomalous sequences were found. The average anomaly content per clone library was 9.0%, 4% higher than that previously estimated for the public repository overall. In addition, 90.8% of anomalies had characteristic chimeric patterns, a rise of 25.4% over that found previously. One library alone was found to contain 54 chimeras, representing 45.8% of its content. These figures far exceed previous estimates of artifacts within public repositories and further highlight the urgent need for all researchers to adequately screen their libraries prior to submission. Mallard is freely available from our website at http://www.cardiff.ac.uk/biosi/research/biosoft/.

  9. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences

    PubMed Central

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-01-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences. PMID:26943621

  10. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences.

    PubMed

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-07-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences. PMID:26943621

  11. Further resolving the phylogeny of Myxogastria (slime molds) based on COI and SSU rRNA genes.

    PubMed

    Liu, Q Sh; Yan, Sh Zh; Chen, Sh L

    2015-01-01

    To date, molecular systematics of Myxogastria has been based primarily on small subunit ribosomal RNA (SSU rRNA) and elongation factor 1-alpha (EF-1α) genes. To establish a natural classification system for the organisms, we examined phylogenetic relationships among myxogastrian species using cytochrome c oxidase subunit I (COL) and SSU rRNA genes. Twenty new sequences were obtained, including 10 COI and 10 SSU rRNA sequences, were compared with sequences of related species from GenBank in order to construct phylogenic trees. The analysis of the two data sets supported the modern phylogeny of myxogastria: orders Liceida and Trichiida formed a sister group at the most basal clade, while orders Stemonitida and Physarida formed a close group, and order Echinostelida was a sister group to Stemonitida and Physarida. However, the partial COI sequences were too conserved to resolve of the branches in Stemonitida and Physarida. In addition, we also deemed the specific edited mRNA events of COI sequences in myxogastrian species.

  12. Filtering and ranking techniques for automated selection of high-quality 16S rRNA gene sequences.

    PubMed

    De Smet, Wim; De Loof, Karel; De Vos, Paul; Dawyndt, Peter; De Baets, Bernard

    2013-12-01

    StrainInfo has augmented its type strain and species/subspecies passports with a recommendation for a high-quality 16S rRNA gene sequence available from the public sequence databases. These recommendations are generated by an automated pipeline that collects all candidate 16S rRNA gene sequences for a prokaryotic type strain, filters out low-quality sequences and retains a high-quality sequence from the remaining pool. Due to thorough automation, recommendations can be renewed daily using the latest updates of the public sequence databases and the latest species descriptions. We discuss the quality criteria constructed to filter and rank available 16S rRNA gene sequences, and show how a partially ordered set (poset) ranking algorithm can be applied to solve the multi-criteria ranking problem of selecting the best candidate sequence. The proof of concept of the recommender system is validated by comparing the results of automated selection with an expert selection made in the All-Species Living Tree Project. Based on these validation results, the pipeline may reliably be applied for non-type strains and developed further for the automated selection of housekeeping genes.

  13. Further resolving the phylogeny of Myxogastria (slime molds) based on COI and SSU rRNA genes.

    PubMed

    Liu, Q Sh; Yan, Sh Zh; Chen, Sh L

    2015-01-01

    To date, molecular systematics of Myxogastria has been based primarily on small subunit ribosomal RNA (SSU rRNA) and elongation factor 1-alpha (EF-1α) genes. To establish a natural classification system for the organisms, we examined phylogenetic relationships among myxogastrian species using cytochrome c oxidase subunit I (COL) and SSU rRNA genes. Twenty new sequences were obtained, including 10 COI and 10 SSU rRNA sequences, were compared with sequences of related species from GenBank in order to construct phylogenic trees. The analysis of the two data sets supported the modern phylogeny of myxogastria: orders Liceida and Trichiida formed a sister group at the most basal clade, while orders Stemonitida and Physarida formed a close group, and order Echinostelida was a sister group to Stemonitida and Physarida. However, the partial COI sequences were too conserved to resolve of the branches in Stemonitida and Physarida. In addition, we also deemed the specific edited mRNA events of COI sequences in myxogastrian species. PMID:25857192

  14. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences.

    PubMed

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-07-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences.

  15. Physical mapping of 5S rDNA in two species of Knifefishes: Gymnotus pantanal and Gymnotus paraguensis (Gymnotiformes).

    PubMed

    da Silva, M; Matoso, D A; Vicari, M R; de Almeida, M C; Margarido, V P; Artoni, R F

    2011-01-01

    Physical mapping of 5S rDNA in 2 species of knifefishes, Gymnotuspantanal and G. paraguensis (Gymnotiformes), was performed using fluorescence in situ hybridization with a 5S rDNA probe. The 5S rDNA PCR product from the genomes of both species was also sequenced and aligned to determine non-transcribed spacer sequences (NTS). Both species under study had different patterns of 5S rDNA gene cluster distribution. While in the karyotype of G. pantanal two 5S rDNA-bearing pairs were observed, the karyotype of G. paraguensis possessed as many as 19 such pairs. Such multiplication of 5S rDNA gene clusters might be caused by the involvement of transposable elements because the NTS of G. paraguensis was 400 bp long with high identity (90%) with a mobile transposable element called Tc1-like transposon, described from the cyprinid fish Labeo rohita.

  16. Minimally invasive L5-S1 oblique lumbar interbody fusion with anterior plate.

    PubMed

    Pham, Martin H; Jakoi, Andre M; Hsieh, Patrick C

    2016-07-01

    Lumbar interbody fusion is an important technique for the treatment of degenerative disc disease and degenerative scoliosis. The oblique lumbar interbody fusion (OLIF) establishes a minimally invasive retroperitoneal exposure anterior to the psoas and lumbar plexus. In this video case presentation, the authors demonstrate the techniques of the OLIF at L5-S1 performed on a 69-year-old female with degenerative scoliosis as one component of an overall strategy for her deformity correction. The video can be found here: https://youtu.be/VMUYWKLAl0g . PMID:27364428

  17. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  18. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  19. Identification by 16S rRNA gene sequencing of an Actinomyces hongkongensis isolate recovered from a patient with pelvic actinomycosis.

    PubMed

    Flynn, A N; Lyndon, C A; Church, D L

    2013-08-01

    A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software.

  20. Bacteria evade immune recognition via TLR13 and binding of their 23S rRNA by MLS antibiotics by the same mechanisms

    PubMed Central

    Hochrein, Hubertus; Kirschning, Carsten J.

    2013-01-01

    The immune system recognizes pathogens and other danger by means of pattern recognition receptors. Recently, we have demonstrated that the orphan Toll-like receptor 13 (TLR13) senses a defined sequence of the bacterial rRNA and that bacteria use specific mechanisms to evade macrolide lincosamide streptogramin (MLS) antibiotics detection via TLR13. PMID:23802068

  1. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing.

    PubMed

    Mehetre, Gajanan T; Paranjpe, Aditi; Dastager, Syed G; Dharne, Mahesh S

    2016-02-25

    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche.

  2. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  3. Nucleolar Assembly of the Rrna Processing Machinery in Living Cells

    PubMed Central

    Savino, Tulia Maria; Gébrane-Younès, Jeannine; De Mey, Jan; Sibarita, Jean-Baptiste; Hernandez-Verdun, Danièle

    2001-01-01

    To understand how nuclear machineries are targeted to accurate locations during nuclear assembly, we investigated the pathway of the ribosomal RNA (rRNA) processing machinery towards ribosomal genes (nucleolar organizer regions [NORs]) at exit of mitosis. To follow in living cells two permanently transfected green fluorescence protein–tagged nucleolar proteins, fibrillarin and Nop52, from metaphase to G1, 4-D time-lapse microscopy was used. In early telophase, fibrillarin is concentrated simultaneously in prenucleolar bodies (PNBs) and NORs, whereas PNB-containing Nop52 forms later. These distinct PNBs assemble at the chromosome surface. Analysis of PNB movement does not reveal the migration of PNBs towards the nucleolus, but rather a directional flow between PNBs and between PNBs and the nucleolus, ensuring progressive delivery of proteins into nucleoli. This delivery appeared organized in morphologically distinct structures visible by electron microscopy, suggesting transfer of large complexes. We propose that the temporal order of PNB assembly and disassembly controls nucleolar delivery of these proteins, and that accumulation of processing complexes in the nucleolus is driven by pre-rRNA concentration. Initial nucleolar formation around competent NORs appears to be followed by regroupment of the NORs into a single nucleolus 1 h later to complete the nucleolar assembly. This demonstrates the formation of one functional domain by cooperative interactions between different chromosome territories. PMID:11381093

  4. Analysis of 5S rDNA organization and variation in polyploid hybrids from crosses of different fish subfamilies.

    PubMed

    Qin, Qinbo; He, Weiguo; Liu, Shaojun; Wang, Jing; Xiao, Jun; Liu, Yun

    2010-07-15

    In this article, sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) were conducted in red crucian carp (RCC), blunt snout bream (BSB), and their polyploid offspring. Three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) of RCC were characterized by distinct NTS types (designated NTS-I, II, and III for the 83, 220, and 357 bp monomers, respectively). In BSB, only one monomeric 5S rDNA was observed (designated class IV: 188 bp), which was characterized by one NTS type (designated NTS-IV: 68 bp). In the polyploid offspring, the tetraploid (4nRB) hybrids partially inherited 5S rDNA classes from their female parent (RCC); however, they also possessed a unique 5S rDNA sequence (designated class I-L: 203 bp) with a novel NTS sequence (designated NTS-I-L: 83 bp). The characteristic paternal 5S rDNA sequences (class IV) were not observed. The 5S rDNA of triploid (3nRB) hybrids was completely inherited from the parental species, and generally preserved the parental 5S rDNA structural organization. These results first revealed the influence of polyploidy on the organization and evolution of the multigene family of 5S rDNA of fish, and are also useful in clarifying aspects of vertebrate genome evolution.

  5. Electron-correlation-induced interchange of lifetime broadenings of 5s{sup -1} multiplet states in atomic Cs

    SciTech Connect

    Partanen, L.; Holappa, M.; Aksela, H.; Aksela, S.; Schulz, J.

    2009-10-15

    The lifetime broadenings of the most intense 5s photolines of Cs were studied. The aim of this study was to understand the origin of the remarkable differences in the lifetime widths of different 5s{sup -1} multiplet states. The 5s photoelectron spectra of the 6s{yields}6p{sub 1/2,3/2} laser-excited states are presented in the binding energy region of 30-34 eV showing the main 5s photolines of the ground state and laser-excited states as well as the 5s5p{sup 6}6p shakeup satellites. The lifetime widths of the states were determined. The Hartree-Fock calculations were carried out to predict the 5s photoelectron spectrum. The lifetime broadenings of the 5s photolines were found to be due to the transition rates of the subsequent Coster-Kronig transitions to the 5s{sup 2}5p{sup 5} states. It was found that a straightforward single-configuration explanation cannot be given for the lifetime differences. Instead, electron correlation plays an essential role and the lifetime broadenings were found to be predicted well only when configuration interaction between the 5s{sup -1} and 5p{sup -2}5d configurations is taking into account.

  6. Bottomonium physics at Υ(4S, 5S, 6S) energies with the Belle detector

    NASA Astrophysics Data System (ADS)

    Tamponi, Umberto

    2016-08-01

    The description of quarkonia as pure quark anti-quark bound states has been recently challenged by the observation of charged states in both the charmonium and bottomonium region and large violations of the heavy quark spin symmetry in hadronic transitions. All these effects can be ascribable to non-negligible contributions from the light quark degrees of freedom in the description of both charmonia and bottomonia. We will report the most recent experimental measurements performed by the Belle collaboration in the Y(4S), Y(5S) and Y(6S) regions, including the measurement of the ratio σ[e+e- → bb̅]/σ[e+e- → μ+ μ- ], the search for neutral states near the B0B̅0 threshold, the first observation of the transition ϒ(4S) → ηhb (lP) and the study of the η transitions at the ϒ(5S) energy. The contribution to the study of the structure of these states coming from the measurement of hadronic transitions will be discussed.

  7. Structural Preservation Percutaneous Endoscopic Lumbar Interlaminar Discectomy for L5-S1 Herniated Nucleus Pulposus

    PubMed Central

    Jang, Jee-Soo; Jang, Il-Tae

    2016-01-01

    Objective. Structures such as ligamentum flavum, annulus, and lamina play an important role in the segmental function. We proposed the surgical technique for achieving the sufficient preservation of segmental structures, in spite of sufficient removal of pathologic disc in the L5-S1 using the ligamentum flavum splitting and sealing technique. Methods. We retrospectively analyzed 80 cases that underwent percutaneous endoscopic lumbar discectomy for L5-S1 herniated nucleus pulposus, using the ligamentum flavum splitting and sealing technique between January 2011 and June 2013. Outcomes were assessed using VAS (leg, back), MacNab's criteria, and the immediate postoperative MRI for all patients. Structural preservation was classified as complete, sufficient, and incomplete. Results. The surgical results are as follows: 65 cases were complete, 15 cases were sufficient, and 0 cases were incomplete. The VAS was decreased at the last follow-up (leg: from 7.91 ± 0.73 to 1.15 ± 0.62; back: from 5.15 ± 0.71 to 1.19 ± 0.75). A favorable outcome (excellent or good outcome by MacNab's criteria) was achieved in 77 patients (96.25%). During the follow-up period, 2 cases (2.5%) of recurrence have occurred. Conclusion. According to the result, we could obtain the favorable clinical and radiological outcomes while simultaneously removing pathologic discs using the ligamentum flavum splitting and annular fissure sealing technique. PMID:27803927

  8. Strategies used by pathogenic and nonpathogenic mycobacteria to synthesize rRNA.

    PubMed Central

    Gonzalez-y-Merchand, J A; Garcia, M J; Gonzalez-Rico, S; Colston, M J; Cox, R A

    1997-01-01

    One rRNA operon of all mycobacteria studied so far is located downstream from a gene thought to code for the enzyme UDP-N-acetylglucosamine carboxyvinyl transferase (UNAcGCT), which is important to cell wall synthesis. This operon has been designated rrnAf for fast-growing mycobacteria and rrnAs for slow growers. We have investigated the upstream sequences and promoter activities of rrnA operons of typical fast growers which also possess a second rrn (rrnBf) operon and of the rrnA operons of the fast growers Mycobacterium abscessus and Mycobacterium chelonae, which each have a single rrn operon per genome. These fast growers have a common strategy for increasing the efficiency of transcription of their rrnA operons, thereby increasing the cells' potential for ribosome synthesis. This strategy involves the use of multiple (three to five) promoters which may have arisen through successive duplication events. Thus we have identified a hypervariable multiple promoter region (HMPR) located between the UNAcGCT gene and the 16S rRNA coding region. Two promoters, P1 and PCL1, appear to play pivotal roles in mycobacterial rRNA synthesis; they are present in all of the species examined and are the only promoters used for rRNA synthesis by the pathogenic slow growers. P1 is located within the coding region of the UNAcGCT gene, and PCL1 has a characteristic sequence that is related to but distinct from that of the additional promoters. In fast-growing species, P1 and PCL1 produce less than 10% of rRNA transcripts, so the additional promoters found in the HMPR are important in increasing the potential for rRNA synthesis during rapid growth. In contrast, rrnB operons appear to be regulated by a single promoter; because less divergence has taken place, rrnB appears to be younger than rrnA. PMID:9371439

  9. PCR-Independent Detection of Bacterial Species-Specific 16S rRNA at 10 fM by a Pore-Blockage Sensor

    PubMed Central

    Esfandiari, Leyla; Wang, Siqing; Wang, Siqi; Banda, Anisha; Lorenzini, Michael; Kocharyan, Gayane; Monbouquette, Harold G.; Schmidt, Jacob J.

    2016-01-01

    A PCR-free, optics-free device is used for the detection of Escherichia coli (E. coli) 16S rRNA at 10 fM, which corresponds to ~100–1000 colony forming units/mL (CFU/mL) depending on cellular rRNA levels. The development of a rapid, sensitive, and cost-effective nucleic acid detection platform is sought for the detection of pathogenic microbes in food, water and body fluids. Since 16S rRNA sequences are species specific and are present at high copy number in viable cells, these nucleic acids offer an attractive target for microbial pathogen detection schemes. Here, target 16S rRNA of E. coli at 10 fM concentration was detected against a total RNA background using a conceptually simple approach based on electromechanical signal transduction, whereby a step change reduction in ionic current through a pore indicates blockage by an electrophoretically mobilized bead-peptide nucleic acid probe conjugate hybridized to target nucleic acid. We investigated the concentration detection limit for bacterial species-specific 16S rRNA at 1 pM to 1 fM and found a limit of detection of 10 fM for our device, which is consistent with our previous finding with single-stranded DNA of similar length. In addition, no false positive responses were obtained with control RNA and no false negatives with target 16S rRNA present down to the limit of detection (LOD) of 10 fM. Thus, this detection scheme shows promise for integration into portable, low-cost systems for rapid detection of pathogenic microbes in food, water and body fluids. PMID:27455337

  10. PCR-Independent Detection of Bacterial Species-Specific 16S rRNA at 10 fM by a Pore-Blockage Sensor.

    PubMed

    Esfandiari, Leyla; Wang, Siqing; Wang, Siqi; Banda, Anisha; Lorenzini, Michael; Kocharyan, Gayane; Monbouquette, Harold G; Schmidt, Jacob J

    2016-07-22

    A PCR-free, optics-free device is used for the detection of Escherichia coli (E. coli) 16S rRNA at 10 fM, which corresponds to ~100-1000 colony forming units/mL (CFU/mL) depending on cellular rRNA levels. The development of a rapid, sensitive, and cost-effective nucleic acid detection platform is sought for the detection of pathogenic microbes in food, water and body fluids. Since 16S rRNA sequences are species specific and are present at high copy number in viable cells, these nucleic acids offer an attractive target for microbial pathogen detection schemes. Here, target 16S rRNA of E. coli at 10 fM concentration was detected against a total RNA background using a conceptually simple approach based on electromechanical signal transduction, whereby a step change reduction in ionic current through a pore indicates blockage by an electrophoretically mobilized bead-peptide nucleic acid probe conjugate hybridized to target nucleic acid. We investigated the concentration detection limit for bacterial species-specific 16S rRNA at 1 pM to 1 fM and found a limit of detection of 10 fM for our device, which is consistent with our previous finding with single-stranded DNA of similar length. In addition, no false positive responses were obtained with control RNA and no false negatives with target 16S rRNA present down to the limit of detection (LOD) of 10 fM. Thus, this detection scheme shows promise for integration into portable, low-cost systems for rapid detection of pathogenic microbes in food, water and body fluids.

  11. Analysis of 23S rRNA genes in metagenomes - a case study from the Global Ocean Sampling Expedition.

    PubMed

    Yilmaz, Pelin; Kottmann, Renzo; Pruesse, Elmar; Quast, Christian; Glöckner, Frank Oliver

    2011-09-01

    As an evolutionary marker, 23S ribosomal RNA (rRNA) offers more diagnostic sequence stretches and greater sequence variation than 16S rRNA. However, 23S rRNA is still not as widely used. Based on 80 metagenome samples from the Global Ocean Sampling (GOS) Expedition, the usefulness and taxonomic resolution of 23S rRNA were compared to those of 16S rRNA. Since 23S rRNA is approximately twice as large as 16S rRNA, twice as many 23S rRNA gene fragments were retrieved from the GOS reads than 16S rRNA gene fragments, with 23S rRNA gene fragments being generally about 100bp longer. Datasets for 16S and 23S rRNA sequences revealed similar relative abundances for major marine bacterial and archaeal taxa. However, 16S rRNA sequences had a better taxonomic resolution due to their significantly larger reference database. Reevaluation of the specificity of previously published PCR amplification primers and group specific fluorescence in situ hybridization probes on this metagenomic set of non-amplified 23S rRNA sequences revealed that out of 16 primers investigated, only two had more than 90% target group coverage. Evaluations of two probes, BET42a and GAM42a, were in accordance with previous evaluations, with a discrepancy in the target group coverage of the GAM42a probe when evaluated against the GOS metagenomic dataset.

  12. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    PubMed

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  13. Strong nondipole effects in low-energy photoionization of the 5s and 5p subshells of xenon

    SciTech Connect

    Johnson, W. R.; Cheng, K. T.

    2001-02-01

    Large nondipole effects are predicted in the angular distribution of photoelectrons from the 5s and 5p subshells of xenon for photon energies below 200 eV. The nondipole parameter {gamma}{sub 5s} exhibits a dispersion-curve variation near the first minimum of the 5s cross section at 35 eV, reaching a minimum value of -0.8 near 40 eV. Rapid variation of {gamma}{sub 5s} is also found near the second minimum of the 5s cross section at 150 eV, where {gamma}{sub 5s} reaches a maximum value of 1.2. Smaller, but significant, nondipole effects are also found in the parameter {zeta}{sub 5p}={gamma}{sub 5p}+3{delta}{sub 5p}, which has a maximum value of 0.15 near 50 eV, and a second maximum value of 0.18 near 160 eV. The higher energy maxima in {gamma}{sub 5s} and {zeta}{sub 5p} arise from correlation enhanced by shape resonances in the 4p{yields}f quadrupole photoionization channels. These predictions are based on relativistic random-phase approximation calculations in which excitations from 5p, 5s, 4d, 4p, and 4s subshells are coupled.

  14. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  15. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    NASA Astrophysics Data System (ADS)

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  16. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA.

    PubMed

    Kumke, Katrin; Macas, Jiří; Fuchs, Jörg; Altschmied, Lothar; Kour, Jasmeet; Dhar, Manoj K; Houben, Andreas

    2016-01-01

    B chromosomes are supernumerary dispensable parts of the karyotype which appear in some individuals of some populations in some species. Using advanced sequencing technology, we in silico characterized the high-copy DNA composition of Plantago lagopus with and without B chromosomes. The nuclear genome (2.46 pg/2C) was found to be relatively rich in repetitive sequences, with highly and moderately repeated elements making up 68% of the genome. Besides a centromere-specific marker, we identified a B-specific satellite and a repeat enriched in polymorphic A chromosome segments. The B-specific tandem repeat PLsatB originated from sequence amplification including 5S rDNA fragments. PMID:27173804

  17. The FERRUM project: Experimental transition probabilities from highly excited even 5s levels in Cr ii

    NASA Astrophysics Data System (ADS)

    Engström, L.; Lundberg, H.; Nilsson, H.; Hartman, H.; Bäckström, E.

    2014-10-01

    We report lifetime measurements of the five levels in the 3d4(a5D)5s e6D term in Cr ii at an energy around 83 000 cm-1, and log(gf) values for 38 transitions from the investigated levels. The lifetimes are obtained using time-resolved, laser-induced fluorescence on ions from a laser-produced plasma. Since the levels have the same parity as the low-lying states directly populated in the plasma, we used a two-photon excitation scheme. This process is greatly facilitated by the presence of the 3d4(a5D)4p z6F levels at roughly half the energy difference. The f-values are obtained by combining the experimental lifetimes with branching fractions derived using relative intensities from a hollow cathode lamp recorded with a Fourier transform spectrometer.

  18. Direct lateral interbody fusion (DLIF) at the lumbosacral junction L5-S1.

    PubMed

    Shirzadi, Ali; Birch, Kurtis; Drazin, Doniel; Liu, John C; Acosta, Frank

    2012-07-01

    The direct lateral interbody fusion (DLIF), a minimally invasive lateral approach for placement of an interbody fusion device, does not require nerve root retraction or any contact with the great vessels and can lead to short operative times with little blood loss. Due to anatomical restrictions, this procedure has not been used at the lumbosacral (L5-S1) junction. Lumbosacral transitional vertebrae (LSTV), a structural anomaly of the lumbosacral spine associated with low back pain, can result in a level being wrongly identified pre-operatively due to misnumbering of the vertebral levels. To our knowledge, use of the DLIF graft in this patient is the first report of an interbody fusion graft being placed at the disc space between the LSTV and S1 via the transpsoas route. We present a review of the literature regarding the LSTV variation as well as the lateral placement of interbody fusion grafts at the lumbosacral junction.

  19. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    SciTech Connect

    Vilkas, M J; Ishikawa, Y; Trabert, E

    2008-02-29

    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  20. Phylogenetic relationships among diploid Aegilops species inferred from 5S rDNA units.

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2009-10-01

    Relationships among the currently recognized 11 diploid species within the genus Aegilops have been investigated. Sequence similarity analysis, based upon 363 sequenced 5S rDNA clones from 44 accessions plus 15 sequences retrieved from GenBank, depicted two unit classes labeled the long AE1 and short AE1. Several different analytical methods were applied to infer relationships within haplomes, between haplomes and among the species, including maximum parsimony and maximum likelihood analyses of consensus sequences, "total evidence" phylogeny analysis and "matrix representation with parsimony" analysis. None were able to depict suites of markers or unit classes that could discern among the seven haplomes as is observed among established haplomes in other genera within the tribe Triticeae; however, most species could be separated when displayed on gene trees. These results suggest that the haplomes currently recognized are so refined that they may be relegated as sub-haplomes or haplome variants. Amblyopyrum shares the same 5S rDNA unit classes with the diploid Aegilops species suggesting that it belongs within the latter. Comparisons of the Aegilops sequences with those of Triticum showed that the long AE1 unit class of Ae. tauschii shared the clade with the equivalent long D1 unit class, i.e., the putative D haplome donor, but the short AE1 unit class did not. The long AE1 unit class but not the short, of Ae. speltoides and Ae. searsii both share the clade with the previously identified long {S1 and long G1 unit classes meaning that both Aegilops species can be equally considered putative B haplome donors to tetraploid Triticum species. The semiconserved nature of the nontranscribed spacer in Aegilops and in Triticeae in general is discussed in view that it may have originated by processes of incomplete gene conversion or biased gene conversion or birth-and-death evolution.

  1. Measurement of {Upsilon}(5S) decays to B{sup 0} and B{sup +} mesons

    SciTech Connect

    Drutskoy, A.; Kinoshita, K.; Schwartz, A. J.; Adachi, I.; Haba, J.; Itoh, R.; Iwasaki, Y.; Katayama, N.; Kichimi, H.; Krokovny, P.; Nakao, M.; Nishida, S.; Sakai, Y.; Sumisawa, K.; Trabelsi, K.; Tsuboyama, T.; Uno, S.; Wicht, J.; Aihara, H.; Aulchenko, V.

    2010-06-01

    Decays of the {Upsilon}(5S) resonance to channels with B{sup +} and B{sup 0} mesons are studied using a 23.6 fb{sup -1} data sample collected with the Belle detector at the KEKB asymmetric-energy e{sup +}e{sup -} collider. Fully reconstructed B{sup +{yields}}J/{psi}K{sup +}, B{sup 0{yields}}J/{psi}K*{sup 0}, B{sup +{yields}}D{sup 0{pi}+}, and B{sup 0{yields}}D{sup -{pi}+} decays are used to obtain the charged and neutral B production rates per bb event, f(B{sup +})=(72.1{sub -3.8}{sup +3.9{+-}}5.0)% and f(B{sup 0})=(77.0{sub -5.6}{sup +5.8{+-}}6.1)%. Assuming equal rates to B{sup +} and B{sup 0} mesons in all channels produced at the {Upsilon}(5S) energy, we measure the fractions for transitions to two-body and three-body channels with B meson pairs, f(BB)=(5.5{sub -0.9}{sup +1.0{+-}}0.4)%, f(BB*+B*B)=(13.7{+-}1.3{+-}1.1)%, f(B*B*)=(37.5{sub -1.9}{sup +2.1{+-}}3.0)%, f(BB{pi})=(0.0{+-}1.2{+-}0.3)%, f(BB*{pi}+B*B{pi})=(7.3{sub -2.1}{sup +2.3{+-}}0.8)%, and f(B*B*{pi})=(1.0{sub -1.3}{sup +1.4{+-}}0.4)%. The latter three fractions are obtained assuming isospin conservation.

  2. Measuring B{sub s} width difference at the {Upsilon}(5s) using quantum entanglement

    SciTech Connect

    Atwood, David; Soni, Amarjit

    2010-08-01

    About 90% of B{sub s}B{sub s} pairs produced at the {Upsilon}(5s) resonance are initially B{sub s}{sup *}B{sub s}{sup *} pairs which decay radiatively to B{sub s}B{sub s}. This implies that the B{sub s}B{sub s} pair will then be in an eigenstate of charge conjugation (i.e. C=-1) and therefore in an entangled state. This allows for a determination of {Delta}{Gamma}{sub s}/{Gamma}{sub s} and the CP phase using a number of possible correlations between the decays of the two B{sub s} mesons. In particular, we consider the time integrated correlation, the time ordering asymmetry, and the time ordering-charge asymmetry, which in addition to time ordering distinguishes B{sub s} from B{sub s}, for various combinations of final states. With the statistics of about O(10{sup 7}-10{sup 8}) {Upsilon}(5s) events available at B factories, we find that the time ordering asymmetry between suitably defined hadronic and flavor specific (tagging) decays offers a promising method for determining the width difference. The corresponding time ordering-charge asymmetry can also bound the mixing phase. Similar observables involving exclusive decays are also considered. At the super B factories with O(50) times greater luminosity time ordering and time ordering-charge asymmetries between inclusive and exclusive modes may also provide additional bounds on the phases in those decays.

  3. Observation of B{sub s} Production at the {upsilon}(5S) Resonance

    SciTech Connect

    Bonvicini, G.; Cinabro, D.; Dubrovin, M.; Lincoln, A.; Bornheim, A.; Pappas, S.P.; Weinstein, A.; Asner, D.M.; Edwards, K.W.; Briere, R.A.; Chen, G.P.; Chen, J.; Ferguson, T.; Tatishvili, G.; Vogel, H.; Watkins, M.E.; Rosner, J.L.; Adam, N.E.; Alexander, J.P.; Berkelman, K.

    2006-01-20

    Using the CLEO detector at the Cornell Electron Storage Ring, we have observed the B{sub s} meson in e{sup +}e{sup -} annihilation at the {upsilon}(5S) resonance. We find 14 candidates consistent with B{sub s} decays into final states with a J/{psi} or a D{sub s}{sup (*)-}. The probability that we have observed a background fluctuation is less than 8x10{sup -10}. We have established that at the energy of the {upsilon}(5S) resonance B{sub s} production proceeds predominantly through the creation of B{sub s}*B{sub s}* pairs. We find {sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s}*)=[0.11{sub -0.03}{sup +0.04}(stat){+-}0.02(syst)] nb, and set the following limits: {sigma}(e{sup +}e{sup -}{yields}B{sub s}B{sub s})/{sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s}*)<0.16 and [{sigma}(e{sup +}e{sup -}{yields}B{sub s}B{sub s}*)+{sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s})]/{sigma}(e{sup +}e{sup -}{yields}B{sub s}*= B{sub s}*)<0.16 (90% C.L.). The mass of the B{sub s}* meson is measured to be M{sub B{sub s}}{sub *}=[5.414{+-}0.001(stat){+-}0.003(syst)] GeV/c{sup 2}.

  4. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy.

    PubMed

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure-sample entropy (SampEn)-and a more recently proposed complexity measure-distribution entropy (DistEn)-were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol.

  5. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    PubMed Central

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  6. Direct detection of 16S rRNA in soil extracts by using oligonucleotide microarrays.

    PubMed

    Small, J; Call, D R; Brockman, F J; Straub, T M; Chandler, D P

    2001-10-01

    We report on the development and validation of a simple microarray method for the direct detection of intact 16S rRNA from unpurified soil extracts. Total RNAs from Geobacter chapellei and Desulfovibrio desulfuricans were hybridized to an oligonucleotide array consisting of universal and species-specific 16S rRNA probes. PCR-amplified products from Geobacter and Desulfovibrio were easily and specifically detected under a range of hybridization times, temperatures, and buffers. However, reproducible, specific hybridization and detection of intact rRNA could be accomplished only by using a chaperone-detector probe strategy. With this knowledge, assay conditions were developed for rRNA detection using a 2-h hybridization time at room temperature. Hybridization specificity and signal intensity were enhanced using fragmented RNA. Formamide was required in the hybridization buffer in order to achieve species-specific detection of intact rRNA. With the chaperone detection strategy, we were able to specifically hybridize and detect G. chapellei 16S rRNA directly from a total-RNA soil extract, without further purification or removal of soluble soil constituents. The detection sensitivity for G. chapellei 16S rRNA in soil extracts was at least 0.5 microg of total RNA, representing approximately 7.5 x 10(6) Geobacter cell equivalents of RNA. These results suggest that it is now possible to apply microarray technology to the direct detection of microorganisms in environmental samples, without using PCR. PMID:11571176

  7. Sequence arrangement of the rRNA genes of the dipteran Sarcophaga bullata.

    PubMed

    French, C K; Fouts, D L; Manning, J E

    1981-06-11

    Velocity sedimentation studies of RNA of Sarcophaga bullata show that the major rRNA species have sedimentation values of 26S and 18S. Analysis of the rRNA under denaturing conditions indicates that there is a hidden break centrally located in the 26S rRNA species. Saturation hybridization studies using total genomic DNA and rRNA show that 0.08% of the nuclear DNA is occupied by rRNA coding sequences and that the average repetition frequency of these coding sequences is approximately 144. The arrangement of the rRNA genes and their spacer sequences on long strands of purified rDNA was determined by the examination of the structure of rRNa:DNA hybrids in the electron microscope. Long DNA strands contain several gene sets (18S + 26S) with one repeat unit containing the following sequences in order given: (a) An 18S gene of length 2.12 kb, (b) an internal transcribed spacer of length 2.01 kb, which contains a short sequence that may code for a 5.8S rRNA, (c) A 26S gene of length 4.06 kb which, in 20% of the cases, contains an intron with an average length of 5.62 kb, and (d) an external spacer of average length of 9.23 kb.

  8. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells

    PubMed Central

    Cao, Weibiao

    2016-01-01

    Mechanisms of the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA. PMID:26901778

  9. Selecting rRNA binding sites for the ribosomal proteins L4 and L6 from randomly fragmented rRNA: application of a method called SERF.

    PubMed

    Stelzl, U; Spahn, C M; Nierhaus, K H

    2000-04-25

    Two-thirds of the 54 proteins of the Escherichia coli ribosome interact directly with the rRNAs, but the rRNA binding sites of only a very few proteins are known. We present a method (selection of random RNA fragments; SERF) that can identify the minimal binding region for proteins within ribonucleo-protein complexes such as the ribosome. The power of the method is exemplified with the ribosomal proteins L4 and L6. Binding sequences are identified for both proteins and characterized by phosphorothioate footprinting. Surprisingly, the binding region of L4, a 53-nt rRNA fragment of domain I of 23S rRNA, can simultaneously and independently bind L24, one of the two assembly initiator proteins of the large subunit.

  10. Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group.

    SciTech Connect

    Bayvkin, S. G.; Lysov, Y. P.; Zakhariev, V.; Kelly, J. J.; Jackman, J.; Stahl, D. A.; Cherni, A.; Engelhardt Inst. of Molecular Biology; Loyola Univ.; Johns Hopkins Univ.; Univ. of Washington

    2004-08-01

    In order to determine if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30 gyrB sequences for B. cereus group strains with published 16S rRNA sequences. Our findings indicated that the three most common species of the B. cereus group, B. cereus, Bacillus thuringiensis, and Bacillus mycoides, were each heterogeneous in all three gene sequences, while all analyzed strains of Bacillus anthracis were found to be homogeneous. Based on analysis of 16S and 23S rRNA sequence variations, the microorganisms within the B. cereus group were divided into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, and these seven subgroups were further organized into two distinct clusters. This classification of the B. cereus group conflicts with current taxonomic groupings, which are based on phenotypic traits. The presence of B. cereus strains in six of the seven subgroups and the presence of B. thuringiensis strains in three of the subgroups do not support the proposed unification of B. cereus and B. thuringiensis into one species. Analysis of the available phenotypic data for the strains included in this study revealed phenotypic traits that may be characteristic of several of the subgroups. Finally, our results demonstrated that rRNA and gyrB sequences may be used for discriminating B. anthracis from other microorganisms in the B. cereus group.

  11. The nature of Z_b states from a combined analysis of Upsilon (5S)rightarrow h_b(mP) π ^+ π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π

    NASA Astrophysics Data System (ADS)

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-03-01

    With a combined analysis of data on Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π in an effective field theory approach, we determine resonance parameters of Z_b states in two scenarios. In one scenario we assume that Z_b states are pure molecular states, while in the other one we assume that Z_b states contain compact components. We find that the present data favor that there should be some compact components inside Z_b^{(' )} associated with the molecular components. By fitting the invariant mass spectra of Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{*}π , we determine that the probability of finding the compact components in Z_b states may be as large as about 40 %.

  12. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  13. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  14. Domain I of 23S rRNA competes with a paused transcription complex for ribosomal protein L4 of Escherichia coli.

    PubMed Central

    Zengel, J M; Lindahl, L

    1993-01-01

    Ribosomal protein L4 of Escherichia coli regulates expression of its own eleven gene S10 operon both by inhibiting translation and by stimulating premature termination of transcription. Both regulatory processes presumably involve L4 recognition of the S10 leader RNA. To help define L4's regulatory target, we have investigated the protein's cognate target on 23S rRNA. Binding of L4 to various fragments of the 23S rRNA was monitored by determining their ability to sequester L4 in an in vitro transcription system and thereby eliminate the protein's effect on transcription. Using this approach we identified a region of about 110 bases within domain I of 23S rRNA which binds L4. A two base deletion within this region, close to the base to which L4 has been cross-linked in intact 50S subunits, eliminates L4 binding. These results also confirm the prediction of the autogenous control model, that L4 bound to its target on rRNA is not active in regulating transcription of the S10 operon. Images PMID:7685080

  15. Nuclear ribosome biogenesis mediated by the DIM1A rRNA dimethylase is required for organized root growth and epidermal patterning in Arabidopsis.

    PubMed

    Wieckowski, Yana; Schiefelbein, John

    2012-07-01

    Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development.

  16. Nuclear rRNA transcript processing versus internal transcribed spacer secondary structure.

    PubMed

    Coleman, Annette W

    2015-03-01

    rRNA is one of the few universal features of life, making it uniquely suited to assess phylogenetic relationships. The processing of the initial polycistronic rRNA transcript is also a conserved process, involving numerous cleavage events and the generation of secondary structures. The secondary structure of the internal transcribed spacer (ITS) regions of nuclear rRNA transcripts are well known for a wide variety of eukaryotes and have been used to aid in the alignment of these sequences for phylogenetic comparisons. By contrast, study of the processing of the initial rRNA transcripts has been largely limited to yeast, mice, rats, and humans. Here I examine the known cleavage sites in the two ITS regions and their positions relative to the secondary structure. A better understanding of the conservation of secondary structures and cleavage sites within the ITS regions will improve evolutionary inferences based on these sequences.

  17. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage.

  18. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  19. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  20. Hard X-ray XAFS beamline, BL5S1, at AichiSR

    NASA Astrophysics Data System (ADS)

    Tabuchi, M.; Asakura, H.; Morimoto, H.; Watanabe, N.; Takeda, Y.

    2016-05-01

    A XAFS beamline, BL5S1, had been operated at Aichi Synchrotron Radiation Center, Japan since March 2013. The beamline was designed for the measurements in the energy range from 5 to 20 keV. The photon flux of 6 x 1010 at around 9 keV and beam spot size of 0.5 x 0.3 mm at sample position are as good as designed. For the standard transmission XAFS measurement, both of the step- and quick- scan modes are available. Energy resolution at around 9keV is good enough to discuss the energy shift of the order of 0.1 eV or higher even when the measurements are conducted in the quick-scan mode. With several kinds of detectors for fluorescence and/or CEY detection mode measurements, and various kinds of sample holders which are supported by the XAFS measurement software, users easily obtain spectra for their samples. Such a standard, well operated and easy to access XAFS beamline must be very important to broaden the base of the XAFS society further.

  1. Potentials for modeling cold collisions between Na (3S) and Rb (5S) atoms

    SciTech Connect

    Pashov, A.; Docenko, O.; Tamanis, M.; Ferber, R.; Knoeckel, H.; Tiemann, E.

    2005-12-15

    The experimental characterization of the electronic states correlated to the asymptote of ground state Na (3S) and Rb (5S) atoms was expanded by spectroscopic data on a {sup 3}{sigma}{sup +} state levels using a high resolution Fourier transform spectroscopy technique. The hyperfine splitting of the a {sup 3}{sigma}{sup +} state levels was partially resolved and analyzed for both Na {sup 85}Rb and Na {sup 87}Rb isotopomers. Transitions to high lying levels of the a {sup 3}{sigma}{sup +} and X {sup 1}{sigma}{sup +} states were recorded simultaneously which enables one to determine long range parameters of the molecular potentials. Coupled channels calculations based on the Fourier grid method were finally applied for deriving accurate potential energy curves of the a {sup 3}{sigma}{sup +} and X {sup 1}{sigma}{sup +} states capable of a reliable description of cold collisions between Na and Rb atoms in their ground states. Scattering lengths and Feshbach resonances were calculated for some quantum states.

  2. Dynamics and rRNA transcriptional activity of lactococci and lactobacilli during Cheddar cheese ripening.

    PubMed

    Desfossés-Foucault, Émilie; LaPointe, Gisèle; Roy, Denis

    2013-08-16

    Cheddar cheese is a complex ecosystem where both the bacterial population and the cheese making process contribute to flavor and texture development. The aim of this study was to use molecular methods to evaluate the impact of milk heat treatment and ripening temperature on starter lactococci and non-starter lactic acid bacteria (NSLAB) throughout ripening of Cheddar cheese. Eight Cheddar cheese batches were manufactured (four with thermized and four with pasteurized milk) and ripened at 4, 7 and 12°C to analyze the bacterial composition and rRNA transcriptional activity reflecting the ability of lactococci and lactobacilli to synthesize proteins. Abundance and rRNA transcription of lactococci and lactobacilli were quantified after DNA and RNA extraction by using quantitative PCR (qPCR) and reverse transcription-quantitative PCR (RT-qPCR) targeting the 16S rRNA gene, respectively. Results showed that lactococci remained dominant throughout ripening, although 16S rRNA genome and cDNA copies/g of cheese decreased by four and two log copy numbers, respectively. Abundance and rRNA transcription of Lactobacillus paracasei, Lactobacillus buchneri/parabuchneri, Lactobacillus rhamnosus, Lactobacillus brevis, and Lactobacillus coryniformis as well as total lactobacilli were also estimated using specific 16S rRNA primers. L. paracasei and L. buchneri/parabuchneri concomitantly grew in cheese made from thermized milk at 7 and 12°C, although L. paracasei displayed the most rRNA transcription among Lactobacillus species. This work showed that rRNA transcriptional activity of lactococci decreased throughout ripening and supports the usefulness of RNA analysis to assess which bacterial species have the ability to synthesize proteins during ripening, and could thereby contribute to cheese quality. PMID:23850855

  3. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  4. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    PubMed

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  5. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae.

    PubMed

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-02-27

    Methylation of ribose sugars at the 2'-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2'-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5' central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D' box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications.

  6. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus. PMID:26959315

  7. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  8. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus.

    PubMed

    Caradonna, Fabio; Bellavia, Daniele; Clemente, Ann Maria; Sisino, Giorgia; Barbieri, Rainer

    2007-09-01

    In this paper the chromosomal localization and molecular cloning and characterization of three 5S rDNA clusters of 700 bp (base pairs), 900 bp, and 950 bp in the sea urchin Paracentrotus lividus are reported. Southern blot hybridization demonstrated the existence of three 5S rDNA repeats of differing length in the P. lividus genome. Fluorescence in situ hybridization analysis, performed in parallel on both haploid and diploid metaphases and interphase nuclei using different 5S rDNA units as probes, localized these 5S rDNA clusters in 3 different pairs of P. lividus chromosomes. This is the first complete gene mapping not only in a sea urchin but also in the phylum of echinoderms as a whole. PMID:17893727

  9. Chromosomal localization of 18S and 5S rDNA using FISH in the genus Tor (Pisces, Cyprinidae).

    PubMed

    Singh, Mamta; Kumar, Ravindra; Nagpure, N S; Kushwaha, B; Gond, Indramani; Lakra, W S

    2009-12-01

    Dual color fluorescence in situ hybridization (FISH) was performed to study the simultaneous chromosomal localization of 18S and 5S ribosomal genes in the genus Tor for the first time. The 18S and 5S rDNAs in four Tor species were amplified, sequenced and mapped on the metaphase chromosomes. The number and distribution of 18S and 5S rDNA clusters were examined on metaphase chromosome spreads using FISH. The specimens of T. chelynoides, T. putitora and T. progeneius showed six bright fluorescent signals of 18S rDNA and T. tor exhibited ten such signals. The 5S rDNA signals were present only on one pair of chromosomes in all the four Tor species. Ag-NORs were observed on two pairs of chromosomes in T. chelynoides, T. putitora, T. progeneius and four pairs in T. tor. Comparison of the observed 18S rDNA FISH signals and Ag-NORs strongly suggested a possible inactivation of NORs localized at the telomeres of a subtelocentric and telocentric chromosome pairs in all four species. The 5S rDNA contained an identical 120 bp long coding region and 81 bp long highly divergent non-transcribed spacers in all species examined. 18S and 5S rDNA sequencing and chromosomal localization can be a useful genetic marker in species identification as well as phylogenetic and evolutionary studies.

  10. Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

    NASA Technical Reports Server (NTRS)

    Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

    1985-01-01

    The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

  11. Localized frustration and binding-induced conformational change in recognition of 5S RNA by TFIIIA zinc finger.

    PubMed

    Tan, Cheng; Li, Wenfei; Wang, Wei

    2013-12-19

    Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.

  12. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    SciTech Connect

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D.

    2008-01-30

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  13. Discrimination of Bacillus anthracis and Closely Related Microorganisms by Analysis of 16S and 23S rRNA with Oligonucleotide Microarray

    PubMed Central

    Bavykin, Sergei G.; Mikhailovich, Vladimir M.; Zakharyev, Vladimir M.; Lysov, Yuri p.; Kelly, John J.; Alferov, Oleg S.; Gavin, Igor M.; Kukhtin, Alexander V.; Jackman, Joany; Stahl, David A.; Chandler, Darrell; Mirzabekov, Andrei D.

    2009-01-01

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 minutes. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead

  14. Formation of nucleolar polymorphisms in trisomic chickens and subsequent microevolution of rRNA gene clusters in diploids.

    PubMed

    Delany, M E; Muscarella, D E; Bloom, S E

    1991-01-01

    Variations in nucleolar size are common in animals and man, yet the basis and significance of this variation are not well understood. In this report, we describe the generation de novo of individuals that express nucleolar size variations (polymorphisms) and the underlying basis for this phenotype in a vertebrate animal system (Gallus domesticus). Individuals that express nucleolar size polymorphisms were produced from mating chickens trisomic for the nucleolar organizer (NO) chromosome; 10%-18% of progeny demonstrated nucleolar polymorphisms. These progeny were incorporated into a diploid genetic line in which the polymorphic trait was observed to segregate in Mendelian fashion. An even more dramatic nucleolar size polymorphism (one macro- plus one micronucleolus) evolved in one diploid family over the course of only two generations. These individuals were used to ascertain that the polymorphic-nucleoli phenotype was expressed in tissues derived from the three primary embryonic cell layers in embryos and neonates. Image analysis was conducted on cells of these birds to quantitate the size differences between macro- and micronucleoli (5 mu2 versus 1 mu2, respectively). Finally, these birds were studied with the technique of in situ hybridization, which showed that gene number differences between homologous NO chromosomes (i.e., heterozygosity for rRNA gene copy number), underlies the polymorphic-nucleoli phenotype. Thus, the chicken emerges as an experimental system through which heterozygosity for the rRNA gene copy number can be induced, easily identified, transmitted, and expressed in all somatic tissues.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2061593

  15. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    PubMed Central

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this region. Linker scanning and deletion mutations in the upstream element, located between nucleotides -156 and -107, cause a three- to fivefold reduction in transcription. Under certain reaction conditions, such as the presence of a high ratio of protein to template or supplementation of the reaction with partially purified protein fractions, sequences upstream of the core element can have an even greater effect (20- to 50-fold) on RNA polymerase I transcription. Primer extension analysis showed that RNA synthesized from all of these mutant templates is initiated at the correct in vivo start site. To examine the functional relationship between the core and the upstream region, mutant promoters were constructed that alter the orientation, distance, or multiplicity of these control elements relative to each other. The upstream control element appears to function in only one orientation, and its position relative to the core is constrained within a fairly narrow region. Moreover, multiple core elements in close proximity to each other have an inhibitory effect on transcription. Images PMID:3785147

  16. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  17. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  18. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  19. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  20. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  1. Transcription of the Drosophila melanogaster 5S RNA gene requires an upstream promoter and four intragenic sequence elements

    SciTech Connect

    Sharp, S.J.; Garcia, A.D.

    1988-03-01

    Linker-scanning (LS) mutations were constructed spanning the length of the Drosophila melanogaster 5S RNA gene. In vitro transcription analysis of the LS 5S DNAs revealed five transcription control regions. One control region essential for the transcription initiation was identified in the 5'-flanking sequence. The major sequence determinants of this upstream promoter region were located between coordinates -39 and -26 (-30 region), but important sequences extended to the transcription start site at position 1. Since mutations in the upstream promoter did not alter the ability of 5S DNA to sequester transcription factors into a stable transcription complex, it appears that this control region involved the interaction of RNA polymerase III. Active 5S DNA transcription additionally required the four intragenic control regions (ICRs) located between coordinates 3 and 18 (ICR I), 37 and 44 (ICR II), 48 and 61 (ICR III), and 78 and 98 (ICR IV). LS mutations in each ICR decreased the ability of 5S DNA to sequester transcription factors. ICR III, ICR IV, and the spacer sequence between were similar in sequence and position to the determinant elements of the multipartite ICR of Xenopus 5S DNA. The importance of ICR III and ICR IV in transcription initiation and in sequestering transcription factors suggests the presence of an activity in D. melanogaster similar to transcription factor TFIIIA of Xenopus laevis and HeLa cells. Transcription initiation of Drosophila 5S DNA was not eliminated by LS mutations in the spacer region even though these mutations reduced the ability of the TFIIIA-like activity to bind.

  2. Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

    PubMed

    Galián, José A; Rosato, Marcela; Rosselló, Josep A

    2014-03-01

    Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

  3. Contrasting patterns of the 5S and 45S rDNA evolutions in the Byblis liniflora complex (Byblidaceae).

    PubMed

    Fukushima, Kenji; Imamura, Kaori; Nagano, Katsuya; Hoshi, Yoshikazu

    2011-03-01

    To clarify the evolutionary dynamics of ribosomal RNA genes (rDNAs) in the Byblis liniflora complex (Byblidaceae), we investigated the 5S and 45S rDNA genes through (1) chromosomal physical mapping by fluorescence in situ hybridization (FISH) and (2) phylogenetic analyses using the nontranscribed spacer of 5S rDNA (5S-NTS) and the internal transcribed spacer of 45S rDNA (ITS). In addition, we performed phylogenetic analyses based on rbcL and trnK intron. The complex was divided into 2 clades: B. aquatica-B. filifolia and B. guehoi-B. liniflora-B. rorida. Although members of the complex had conservative symmetric karyotypes, they were clearly differentiated on chromosomal rDNA distribution patterns. The sequence data indicated that ITS was almost homogeneous in all taxa in which two or four 45S rDNA arrays were frequently found at distal regions of chromosomes in the somatic karyotype. ITS homogenization could have been prompted by relatively distal 45S rDNA positions. In contrast, 2-12 5S rDNA arrays were mapped onto proximal/interstitial regions of chromosomes, and some paralogous 5S-NTS were found in the genomes harboring 4 or more arrays. 5S-NTS sequence type-specific FISH analysis showed sequence heterogeneity within and between some 5S rDNA arrays. Interlocus homogenization may have been hampered by their proximal location on chromosomes. Chromosomal location may have affected the contrasting evolutionary dynamics of rDNAs in the B. liniflora complex.

  4. Bacterial characterization of Beijing drinking water by flow cytometry and MiSeq sequencing of the 16S rRNA gene.

    PubMed

    Liu, Tingting; Kong, Weiwen; Chen, Nan; Zhu, Jing; Wang, Jingqi; He, Xiaoqing; Jin, Yi

    2016-02-01

    Flow cytometry (FCM) and 16S rRNA gene sequencing data are commonly used to monitor and characterize microbial differences in drinking water distribution systems. In this study, to assess microbial differences in drinking water distribution systems, 12 water samples from different sources water (groundwater, GW; surface water, SW) were analyzed by FCM, heterotrophic plate count (HPC), and 16S rRNA gene sequencing. FCM intact cell concentrations varied from 2.2 × 10(3) cells/mL to 1.6 × 10(4) cells/mL in the network. Characteristics of each water sample were also observed by FCM fluorescence fingerprint analysis. 16S rRNA gene sequencing showed that Proteobacteria (76.9-42.3%) or Cyanobacteria (42.0-3.1%) was most abundant among samples. Proteobacteria were abundant in samples containing chlorine, indicating resistance to disinfection. Interestingly, Mycobacterium, Corynebacterium, and Pseudomonas, were detected in drinking water distribution systems. There was no evidence that these microorganisms represented a health concern through water consumption by the general population. However, they provided a health risk for special crowd, such as the elderly or infants, patients with burns and immune-compromised people exposed by drinking. The combined use of FCM to detect total bacteria concentrations and sequencing to determine the relative abundance of pathogenic bacteria resulted in the quantitative evaluation of drinking water distribution systems. Knowledge regarding the concentration of opportunistic pathogenic bacteria will be particularly useful for epidemiological studies.

  5. Scalar resonance contributions to the dipion transition rates of {upsilon}(4S,5S) in the rescattering model

    SciTech Connect

    Meng Ce; Chao, K.-T.

    2008-04-01

    In order to explain the observed unusually large dipion transition rates of {upsilon}(10870), the scalar resonance contributions in the rescattering model to the dipion transitions of {upsilon}(4S) and {upsilon}(5S) are studied. Since the imaginary part of the rescattering amplitude is expected to be dominant, the large ratios of the transition rates of {upsilon}(10870), which is identified with {upsilon}(5S), to that of {upsilon}(4S) can be understood as mainly coming from the difference between the p values in their decays into open bottom channels, and the ratios are estimated numerically to be about 200-600 with reasonable choices of parameters. The absolute and relative rates of {upsilon}(5S){yields}{upsilon}(1S,2S,3S){pi}{sup +}{pi}{sup -} and {upsilon}(5S){yields}{upsilon}(1S)K{sup +}K{sup -} are roughly consistent with data. We emphasize that the dipion transitions observed for some of the newly discovered Y states associated with charmonia may have similar features to the dipion transitions of {upsilon}(5S). Measurements on the dipion transitions of {upsilon}(6S) could provide further tests for this mechanism.

  6. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing

    PubMed Central

    Mehetre, Gajanan T.; Paranjpe, Aditi; Dastager, Syed G.

    2016-01-01

    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. PMID:26950332

  7. Mechanisms underlying the evolution and maintenance of functionally heterogeneous 18S rRNA genes in Apicomplexans.

    PubMed

    Rooney, Alejandro P

    2004-09-01

    In many species of the protist phylum Apicomplexa, ribosomal RNA (rRNA) gene copies are structurally and functionally heterogeneous, owing to distinct requirements for rRNA-expression patterns at different developmental stages. The genomic mechanisms underlying the maintenance of this system over long-term evolutionary history are unclear. Therefore, the aim of this study was to investigate what processes underlie the long-term evolution of apicomplexan 18S genes in representative species. The results show that these genes evolve according to a birth-and-death model under strong purifying selection, thereby explaining how divergent 18S genes are generated over time while continuing to maintain their ability to produce fully functional rRNAs. In addition, it was found that Cryptosporidium parvum undergoes a rapid form of birth-and-death evolution that may facilitate host-specific adaptation, including that of type I and II strains found in humans. This represents the first case in which an rRNA gene family has been found to evolve under the birth-and-death model. PMID:15175411

  8. Performance of 18S rRNA in littorinid phylogeny (Gastropoda: Caenogastropoda).

    PubMed

    Winnepenninckx, B M; Reid, D G; Backeljau, T

    1998-11-01

    In the past, 18S rRNA sequences have proved to be very useful for tracing ancient divergences but were rarely used for resolving more recent ones. Moreover, it was suggested that the molecule does not contain useful information to resolve divergences which took place during less than 40 Myr. The present paper takes littorinid phylogeny as a case study to reevaluate the utility of the molecule for resolving recent divergences. Two data sets for nine species of the snail family Littorinidae were analyzed, both separately and combined. One data set comprised 7 new complete 18S rRNA sequences aligned with 2 published littorinid sequences; the other comprised 12 morphological, 1 biochemical, and 2 18S rRNA secondary structure characters. On the basis of its ability to confirm generally accepted relationships and the congruence of results derived from the different data sets, it is concluded that 18S rRNA sequences do contain information to resolve "rapid" cladogenetic events, provided that they occurred in the not too distant past. 18S rRNA sequences yielded support for (1) the branching order (L. littorea, (L. obtusata, (L. saxatilis, L. compressa))) and (2) the basal position of L. striata in the Littorina clade. PMID:9797409

  9. Decreases in average bacterial community rRNA operon copy number during succession

    PubMed Central

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-01-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  10. Depletion of ribosomal protein S19 causes a reduction of rRNA synthesis

    PubMed Central

    Juli, Giada; Gismondi, Angelo; Monteleone, Valentina; Caldarola, Sara; Iadevaia, Valentina; Aspesi, Anna; Dianzani, Irma; Proud, Christopher G.; Loreni, Fabrizio

    2016-01-01

    Ribosome biogenesis plays key roles in cell growth by providing increased capacity for protein synthesis. It requires coordinated production of ribosomal proteins (RP) and ribosomal RNA (rRNA), including the processing of the latter. Here, we show that, the depletion of RPS19 causes a reduction of rRNA synthesis in cell lines of both erythroid and non-erythroid origin. A similar effect is observed upon depletion of RPS6 or RPL11. The deficiency of RPS19 does not alter the stability of rRNA, but instead leads to an inhibition of RNA Polymerase I (Pol I) activity. In fact, results of nuclear run-on assays and ChIP experiments show that association of Pol I with the rRNA gene is reduced in RPS19-depleted cells. The phosphorylation of three known regulators of Pol I, CDK2, AKT and AMPK, is altered during ribosomal stress and could be involved in the observed downregulation. Finally, RNA from patients with Diamond Blackfan Anemia (DBA), shows, on average, a lower level of 47S precursor. This indicates that inhibition of rRNA synthesis could be one of the molecular alterations at the basis of DBA. PMID:27734913

  11. 18S rRNA secondary structure and phylogenetic position of Peloridiidae (Insecta, hemiptera).

    PubMed

    Ouvrard, D; Campbell, B C; Bourgoin, T; Chan, K L

    2000-09-01

    A secondary structure model for 18S rRNA of peloridiids, relict insects with a present-day circumantarctic distribution, is constructed using comparative sequence analysis, thermodynamic folding, a consensus method using 18S rRNA models of other taxa, and support of helices based on compensatory substitutions. Results show that probable in vivo configuration of 18S rRNA is not predictable using current free-energy models to fold the entire molecule concurrently. This suggests that refinements in free-energy minimization algorithms are needed. Molecular phylogenetic datasets were created using 18S rRNA nucleotide alignments produced by CLUSTAL and rigorous interpretation of homologous position based on certain secondary substructures. Phylogenetic analysis of a hemipteran data matrix of 18S rDNA sequences placed peloridiids sister to Heteroptera. Resolution of affiliations between the three main euhemipteran lineages was unresolved. The peloridiid 18S RNA model presented here provides the most accurate template to date for aligning homologous nucleotides of hemipteran taxa. Using folded 18S rRNA to infer homology of character as morpho-molecular structures or nucleotides and scoring particular sites or substructures is discussed. PMID:10991793

  12. Decreases in average bacterial community rRNA operon copy number during succession.

    PubMed

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  13. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    PubMed

    Orsi, William; Biddle, Jennifer F; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  14. Novel essential gene Involved in 16S rRNA processing in Escherichia coli.

    PubMed

    Kurata, Tatsuaki; Nakanishi, Shinobu; Hashimoto, Masayuki; Taoka, Masato; Yamazaki, Yukiko; Isobe, Toshiaki; Kato, Jun-ichi

    2015-02-27

    Biogenesis of ribosomes is a complex process mediated by many factors. While its transcription proceeds, ribosomal RNA (rRNA) folds itself into a characteristic three-dimensional structure through interaction with ribosomal proteins, during which its ends are processed. Here, we show that the essential protein YqgF, a RuvC family protein with an RNase-H-like motif, is involved in the processing of pre-16S rRNA during ribosome maturation. Indeed, pre-16S rRNA accumulated in cells of a temperature-sensitive yqgF mutant (yqgF(ts)) cultured at a non-permissive temperature. In addition, purified YqgF was shown to process the 5' end of pre-16S rRNA within 70S ribosomes in vitro. Mass spectrometry analysis of the total proteins in the yqgF(ts) mutant cells showed that the expression of genes containing multiple Shine-Dalgarno-like sequences was observed to be lower than in wild type. These results are interpreted to indicate that YqgF is involved in a novel enzymic activity necessary for the processing of pre-16S rRNA, thereby affecting elongation of translation.

  15. Sequence and phylogenetic analysis of SSU rRNA gene of five microsporidia.

    PubMed

    Dong, ShiNan; Shen, ZhongYuan; Xu, Li; Zhu, Feng

    2010-01-01

    The complete small subunit rRNA (SSU rRNA) gene sequences of five microsporidia including Nosema heliothidis, and four novel microsporidia isolated from Pieris rapae, Phyllobrotica armta, Hemerophila atrilineata, and Bombyx mori, respectively, were obtained by PCR amplification, cloning, and sequencing. Two phylogenetic trees based on SSU rRNA sequences had been constructed by using Neighbor-Joining of Phylip software and UPGMA of MEGA4.0 software. The taxonomic status of four novel microsporidia was determined by analysis of phylogenetic relationship, length, G+C content, identity, and divergence of the SSU rRNA sequences. The results showed that the microsporidia isolated from Pieris rapae, Phyllobrotica armta, and Hemerophila atrilineata have close phylogenetic relationship with the Nosema, while another microsporidium isolated from Bombyx mori is closely related to the Endoreticulatus. So, we temporarily classify three novel species of microsporidia to genus Nosema, as Nosema sp. PR, Nosema sp. PA, Nosema sp. HA. Another is temporarily classified into genus Endoreticulatus, as Endoreticulatus sp. Zhenjiang. The result indicated as well that it is feasible and valuable to elucidate phylogenetic relationships and taxonomic status of microsporidian species by analyzing information from SSU rRNA sequences of microsporidia. PMID:19768503

  16. Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces

    PubMed Central

    Orsi, William; Biddle, Jennifer F.; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface. PMID:23418556

  17. Application of PRECEDE-PROCEED model to tackle problems identified with diarrhoea burden among under-5s in Botswana.

    PubMed

    Popoola, Tosin; Mchunu, Gugu

    2015-05-01

    Diarrhoea has been identified as the second leading cause of mortality among under-5s and also claims more life than HIV, measles and malaria combined together in the same category of population. This article is a combination of literature review and personal experience of lessons learnt from past diarrhoea outbreaks in Botswana that caused significant rate of mortality among under-5s. The paper used literature review to identify contributory factors to diarrhoea burden among under-5s in Botswana and applied a community health nursing framework (PRECEDE-PROCEED) to tackle the problems identified. The study revealed that Botswana mothers are lacking in knowledge related to exclusive breastfeeding, prevention and treatment of diarrhoea disease. The paper recommends that health-care workers in Botswana be sensitized on current diarrhoea management to tailor their health education methods appropriately. PMID:26125574

  18. Xe 5s,5p correlation satellites in the region of strong interchannel interactions, 28--75 eV

    SciTech Connect

    Fahlman, A.; Krause, M.O.; Carlson, T.A.; Svensson, A.

    1984-08-01

    The Xe 5s,5p photoelectron satellite spectrum has been studied in the photon-energy range from 28 to 75 eV with the aid of synchrotron radiation. This range includes the Xe 5s Cooper minimum, and the cross sections and angular distribution data demonstrate the importance of the strong two-electron channels in the region where the 5s cross section is small. Although the behavior of the satellites was not recorded over the 4d maximum, the data near 75 eV show an enhancement in the cross section in that region. The data underline the need of including the two-electron channels explicitly in the theory over a wide photon-energy range.

  19. Application of PRECEDE-PROCEED model to tackle problems identified with diarrhoea burden among under-5s in Botswana.

    PubMed

    Popoola, Tosin; Mchunu, Gugu

    2015-05-01

    Diarrhoea has been identified as the second leading cause of mortality among under-5s and also claims more life than HIV, measles and malaria combined together in the same category of population. This article is a combination of literature review and personal experience of lessons learnt from past diarrhoea outbreaks in Botswana that caused significant rate of mortality among under-5s. The paper used literature review to identify contributory factors to diarrhoea burden among under-5s in Botswana and applied a community health nursing framework (PRECEDE-PROCEED) to tackle the problems identified. The study revealed that Botswana mothers are lacking in knowledge related to exclusive breastfeeding, prevention and treatment of diarrhoea disease. The paper recommends that health-care workers in Botswana be sensitized on current diarrhoea management to tailor their health education methods appropriately.

  20. Dissociative excitation of the N(+)(5S) state by electron impact on N2 - Excitation function and quenching

    NASA Technical Reports Server (NTRS)

    Erdman, P. W.; Zipf, E. C.

    1986-01-01

    Metastable N(+)(5S) ions were produced in the laboratory by dissociative excitation of N2 with energetic electrons. The resulting radiative decay of the N(+)(5S) state was observed with sufficient resolution to completely resolve the doublet from the nearby N2 molecular radiation. The excitation function was measured from threshold to 500 eV. The cross section peaks at a high electron energy and also exhibits a high threshold energy both of which are typical of dissociative excitation-ionization processes. This finding complicates the explanation of electron impact on N2 as the mechanism for the source of the 2145 A 'auroral mystery feature' by further increasing the required peak cross section. It is suggested that the apparent N(+)(5S) quenching in auroras may be an artifact due to the softening of the electron energy spectrum in the auroral E region.

  1. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location. PMID:27334092

  2. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

  3. The human 18S rRNA base methyltransferases DIMT1L and WBSCR22-TRMT112 but not rRNA modification are required for ribosome biogenesis

    PubMed Central

    Zorbas, Christiane; Nicolas, Emilien; Wacheul, Ludivine; Huvelle, Emmeline; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2015-01-01

    At the heart of the ribosome lie rRNAs, whose catalytic function in translation is subtly modulated by posttranscriptional modifications. In the small ribosomal subunit of budding yeast, on the 18S rRNA, two adjacent adenosines (A1781/A1782) are N6-dimethylated by Dim1 near the decoding site, and one guanosine (G1575) is N7-methylated by Bud23-Trm112 at a ridge between the P- and E-site tRNAs. Here we establish human DIMT1L and WBSCR22-TRMT112 as the functional homologues of yeast Dim1 and Bud23-Trm112. We report that these enzymes are required for distinct pre-rRNA processing reactions leading to synthesis of 18S rRNA, and we demonstrate that in human cells, as in budding yeast, ribosome biogenesis requires the presence of the modification enzyme rather than its RNA-modifying catalytic activity. We conclude that a quality control mechanism has been conserved from yeast to human by which binding of a methyltransferase to nascent pre-rRNAs is a prerequisite to processing, so that all cleaved RNAs are committed to faithful modification. We further report that 18S rRNA dimethylation is nuclear in human cells, in contrast to yeast, where it is cytoplasmic. Yeast and human ribosome biogenesis thus have both conserved and distinctive features. PMID:25851604

  4. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae

    PubMed Central

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-01-01

    Methylation of ribose sugars at the 2′-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2′-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5′ central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D′ box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  5. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  6. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    PubMed

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  7. PCR-based method for targeting 16S-23S rRNA intergenic spacer regions among Vibrio species

    PubMed Central

    2010-01-01

    Background The genus Vibrio is a diverse group of Gram-negative bacteria comprised of 74 species. Furthermore, the genus has and is expected to continue expanding with the addition of several new species annually. Consequently, it is of paramount importance to have a method which is able to reliably and efficiently differentiate the numerous Vibrio species. Results In this study, a novel and rapid polymerase chain reaction (PCR)-based intergenic spacer (IGS)-typing system for vibrios was developed that is based on the well-known IGS regions located between the 16S and 23S rRNA genes on the bacterial chromosome. The system was optimized to resolve heteroduplex formation as well as to take advantage of capillary gel electrophoresis technology such that reproducible analyses could be achieved in a rapid manner. System validation was achieved through testing of 69 archetypal Vibrio strains, representing 48 Vibrio species, from which an 'IGS-type' profile database was generated. These data, presented here in several cluster analyses, demonstrated successful differentiation of the 69 type strains showing that this PCR-based fingerprinting method easily discriminates bacterial strains at the species level among Vibrio. Furthermore, testing 36 strains each of V. parahaemolyticus and V. vulnificus, important food borne pathogens, isolated from a variety of geographical locations with the IGS-typing method demonstrated distinct IGS-typing patterns indicative of subspecies divergence in both populations making this technique equally useful for intraspecies differentiation, as well. Conclusion This rapid, reliable and efficient IGS-typing system, especially in combination with 16S rRNA gene sequencing, has the capacity to not only discern and identify vibrios at the species level but, in some cases, at the sub-species level, as well. This procedure is particularly well-suited for preliminary species identification and, lends itself nicely to epidemiological investigations

  8. Chromosomal mapping of rRNA genes, core histone genes and telomeric sequences in Brachidontes puniceus and Brachidontes rodriguezi (Bivalvia, Mytilidae)

    PubMed Central

    2010-01-01

    Background Chromosome rearrangements are an important part of the speciation process in many taxa. The study of chromosome evolution in bivalves is hampered by the absence of clear chromosomal banding patterns and the similarity in both chromosome size and morphology. For this reason, obtaining good chromosome markers is essential for reliable karyotypic comparisons. To begin this task, the chromosomes of the mussels Brachidontes puniceus and B. rodriguezi were studied by means of fluorochrome staining and fluorescent in situ hybridization (FISH). Results Brachidontes puniceus and B. rodriguezi both have 2n = 32 chromosomes but differing karyotype composition. Vertebrate-type telomeric sequences appear at both ends of every single chromosome. B. puniceus presents a single terminal major rRNA gene cluster on a chromosome pair while B. rodriguezi shows two. Both mussels present two 5S rDNA and two core histone gene clusters intercalary located on the long arms of two chromosome pairs. Double and triple-FISH experiments demonstrated that one of the 5S rDNA and one of the major rDNA clusters appear on the same chromosome pair in B. rodriguezi but not in B. puniceus. On the other hand, the second 5S rDNA cluster is located in one of the chromosome pairs also bearing one of the core histone gene clusters in the two mussel species. Conclusion Knowledge of the chromosomal distribution of these sequences in the two species of Brachidontes is a first step in the understanding of the role of chromosome changes on bivalve evolution. PMID:21143946

  9. Diagnostic assay for Helicobacter hepaticus based on nucleotide sequence of its 16S rRNA gene.

    PubMed Central

    Battles, J K; Williamson, J C; Pike, K M; Gorelick, P L; Ward, J M; Gonda, M A

    1995-01-01

    Conserved primers were used to PCR amplify 95% of the Helicobacter hepaticus 16S rRNA gene. Its sequence was determined and aligned to those of related bacteria, enabling the selection of primers to highly diverged regions of the 16S rRNA gene and an oligonucleotide probe for the development of a PCR-liquid hybridization assay. This assay was shown to be both sensitive and specific for H. hepaticus 16S rRNA gene sequences. PMID:7542270

  10. Phylogeny of protostome worms derived from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade.

  11. rRNA sequence comparison of Beauveria bassiana, Tolypocladium cylindrosporum, and Tolypocladium extinguens.

    PubMed

    Rakotonirainy, M S; Dutertre, M; Brygoo, Y; Riba, G

    1991-01-01

    Five strains of Tolypocladium cylindrosporum, one strain of Tolypocladium extinguens, and nine strains of Beauveria bassiana were analyzed using a rapid rRNA sequencing technique. The sequences of two highly variable domains (D1 and D2) located at the 5' end of the 28S-like rRNA molecule were determined. The phylogenetic tree computed from the absolute number of nucleotide differences shows the separation between the genus Beauveria and the genus Tolypocladium and points out that T. cylindrosporum and T. extinguens probably do not belong to the same genus.

  12. Evaluation of nucleic acid sequence based amplification using fluorescence resonance energy transfer (FRET-NASBA) in quantitative detection of Aspergillus 18S rRNA.

    PubMed

    Park, Chulmin; Kwon, Eun-Young; Shin, Na-Young; Choi, Su-Mi; Kim, Si-Hyun; Park, Sun Hee; Lee, Dong-Gun; Choi, Jung-Hyun; Yoo, Jin-Hong

    2011-01-01

    We attempted to apply fluorescence resonance energy transfer technology to nucleic acid sequence-based amplification (FRET-NASBA) on the platform of the LightCycler system to detect Aspergillus species. Primers and probes for the Aspergillus 18S rRNA were newly designed to avoid overlapping with homologous sequences of human 18s rRNA. NASBA using molecular beacon (MB) showed non-specific results which have been frequently observed from controls, although it showed higher sensitivity (10(-2) amol) than the FRET. FRET-NASBA showed a sensitivity of 10(-1) amol and a high fidelity of reproducibility from controls. As FRET technology was successfully applied to the NASBA assay, it could contribute to diverse development of the NASBA assay. These results suggest that FRET-NASBA could replace previous NASBA techniques in the detection of Aspergillus.

  13. Chromosome-specific NOR inactivation explains selective rRNA gene silencing and dosage control in Arabidopsis

    PubMed Central

    Chandrasekhara, Chinmayi; Mohannath, Gireesha; Blevins, Todd; Pontvianne, Frederic; Pikaard, Craig S.

    2016-01-01

    In eukaryotes, scores of excess ribosomal RNA (rRNA) genes are silenced by repressive chromatin modifications. Given the near sequence identity of rRNA genes within a species, it is unclear how specific rRNA genes are reproducibly chosen for silencing. Using Arabidopsis thaliana ecotype (strain) Col-0, a systematic search identified sequence polymorphisms that differ between active and developmentally silenced rRNA gene subtypes. Recombinant inbred mapping populations derived from three different ecotype crosses were then used to map the chromosomal locations of silenced and active RNA gene subtypes. Importantly, silenced and active rRNA gene subtypes are not intermingled. All silenced rRNA gene subtypes mapped to the nucleolus organizer region (NOR) on chromosome 2 (NOR2). All active rRNA gene subtypes mapped to NOR4. Using an engineered A. thaliana line in which a portion of Col-0 chromosome 4 was replaced by sequences of another ecotype, we show that a major rRNA gene subtype silenced at NOR2 is active when introgressed into the genome at NOR4. Collectively, these results reveal that selective rRNA gene silencing is not regulated gene by gene based on mechanisms dependent on subtle gene sequence variation. Instead, we propose that a subchromosomal silencing mechanism operates on a multimegabase scale to inactivate NOR2. PMID:26744421

  14. snoU6 and 5S RNAs are not reliable miRNA reference genes in neuronal differentiation.

    PubMed

    Lim, Q E; Zhou, L; Ho, Y K; Wan, G; Too, H P

    2011-12-29

    Accurate profiling of microRNAs (miRNAs) is an essential step for understanding the functional significance of these small RNAs in both physiological and pathological processes. Quantitative real-time PCR (qPCR) has gained acceptance as a robust and reliable transcriptomic method to profile subtle changes in miRNA levels and requires reference genes for accurate normalization of gene expression. 5S and snoU6 RNAs are commonly used as reference genes in microRNA quantification. It is currently unknown if these small RNAs are stably expressed during neuronal differentiation. Panels of miRNAs have been suggested as alternative reference genes to 5S and snoU6 in various physiological contexts. To test the hypothesis that miRNAs may serve as stable references during neuronal differentiation, the expressions of eight miRNAs, 5S and snoU6 RNAs in five differentiating neuronal cell types were analyzed using qPCR. The stabilities of the expressions were evaluated using two complementary statistical approaches (geNorm and Normfinder). Expressions of 5S and snoU6 RNAs were stable under some but not all conditions of neuronal differentiation and thus are not suitable reference genes. In contrast, a combination of three miRNAs (miR-103, miR-106b and miR-26b) allowed accurate expression normalization across different models of neuronal differentiation.

  15. Peak shifts due to B{sup (*)}-B{sup (*)} rescattering in {upsilon}(5S) dipion transitions

    SciTech Connect

    Meng Ce; Chao Kuangta

    2008-08-01

    We study the energy distributions of dipion transitions {upsilon}(5S) to {upsilon}(1S,2S,3S){pi}{sup +}{pi}{sup -} in the final-state rescattering model. Since the {upsilon}(5S) is well above the open bottom thresholds, the dipion transitions are expected to mainly proceed through the real processes {upsilon}(5S){yields}B{sup (*)}B{sup (*)} and B{sup (*)}B{sup (*)}{yields}{upsilon}(1S,2S,3S){pi}{sup +}{pi}{sup -}. We find that the energy distributions of {upsilon}(1S,2S,3S){pi}{sup +}{pi}{sup -} markedly differ from that of {upsilon}(5S){yields}B{sup (*)}B{sup (*)}. In particular, the resonance peak will be pushed up by about 7-20 MeV for these dipion transitions relative to the main hadronic decay modes. These predictions can be used to test the final-state rescattering mechanism in hadronic transitions for heavy quarkonia above the open flavor thresholds.

  16. Contralateral interlaminar approach for intraforaminal lumbar degenerative disease with special emphasis on L5-S1 level: A technical note

    PubMed Central

    Zekaj, Edvin; Menghetti, Claudia; Saleh, Christian; Isidori, Alessandra; Bona, Alberto R.; Aimar, Enrico; Servello, Domenico

    2016-01-01

    Background: Intraforaminal disc herniations at the L5-S1 level are extremely surgically challenging lesions. Intracanal approaches frequently require partial or total facetectomy, which may lead to instability. Solely extraforaminal approaches may offer limited visualization of the more medial superiorly exiting and inferiorly exiting nerve roots; this approach is also more complicated at L5-S1 due to the often large L5 transverse process and the iliac wing. Methods: Nine patients with intraforaminal L5-S1 disc herniations, foraminal stenosis, or synovial cysts underwent contralateral interlaminar approaches for lesion resection. Preoperative and postoperative visual analog scale scores were evaluated, and complications were reviewed. Results: All 9 patients demonstrated immediate postoperative clinical improvement. None of the patients exhibited complications and none developed instability or neuropathic disorders. Conclusions: Although the number of cases in our sample was very small (9 in total), the contralateral interlaminar approach appeared to effectively address multiple degenerative L5-S1 foraminal pathologies. Large studies are needed to further evaluate the pros and cons of this approach. PMID:27713854

  17. Rapid detection of rRNA group I pseudomonads in contaminated metalworking fluids and biofilm formation by fluorescent in situ hybridization.

    PubMed

    Saha, Ratul; Donofrio, Robert S; Goeres, Darla M; Bagley, Susan T

    2012-05-01

    Metalworking fluids (MWFs), used in different machining operations, are highly prone to microbial degradation. Microbial communities present in MWFs lead to biofilm formation in the MWF systems, which act as a continuous source of contamination. Species of rRNA group I Pseudomonas dominate in contaminated MWFs. However, their actual distribution is typically underestimated when using standard culturing techniques as most fail to grow on the commonly used Pseudomonas Isolation Agar. To overcome this, fluorescent in situ hybridization (FISH) was used to study their abundance along with biofilm formation by two species recovered from MWFs, Pseudomonas fluorescens MWF-1 and the newly described Pseudomonas oleovorans subsp. lubricantis. Based on 16S rRNA sequences, a unique fluorescent molecular probe (Pseudo120) was designed targeting a conserved signature sequence common to all rRNA group I Pseudomonas. The specificity of the probe was evaluated using hybridization experiments with whole cells of different Pseudomonas species. The probe's sensitivity was determined to be 10(3) cells/ml. It successfully detected and enumerated the abundance and distribution of Pseudomonas indicating levels between 3.2 (± 1.1) × 10(6) and 5.0 (± 2.3) × 10(6) cells/ml in four different industrial MWF samples collected from three different locations. Biofilm formation was visualized under stagnant conditions using high and low concentrations of cells for both P. fluorescens MWF-1 and P. oleovorans subsp. lubricantis stained with methylene blue and Pseudo120. On the basis of these observations, this molecular probe can be successfully be used in the management of MWF systems to monitor the levels and biofilm formation of rRNA group I pseudomonads. PMID:22042232

  18. Atypical processing in domain III of 23S rRNA of Rhizobium leguminosarum ATCC 10004(T) at a position homologous to an rRNA fragmentation site in protozoa.

    PubMed

    Klein, Franziska; Samorski, Regina; Klug, Gabriele; Evguenieva-Hackenberg, Elena

    2002-06-01

    For still unknown reasons, the 23S rRNA of many alpha-Proteobacteria shows a unique fragmentation pattern compared to other bacteria. The 23S rRNA processing involves RNase III and additional, yet unidentified enzymes. The alpha-proteobacterium Rhizobium leguminosarum ATCC 10004(T) possesses two fragmentation sites in its 23S rRNA. The first one harbors an intervening sequence in helix 9 which is cleaved by RNase III. We demonstrate that the mature 5' end of the resulting 2.6-kb rRNA fragment is generated by additional removal of helix 10. A fraction of the 2.6-kb rRNA is further processed in domain III, giving rise to two 1.3-kb rRNA fragments. We mapped the domain III fragmentation site and found it to be at a position which has only been reported for trypanosomatid protozoa. This fragmentation site is also unique in that it lacks an intervening sequence. We found that the simultaneous occurrence of 2.6-kb and 1.3-kb rRNA fragments is not due to interoperonal sequence differences but rather reflects slow processing. The different characteristics of the two fragmentation sites in the 23S rRNA suggest that they are processed by different mechanisms. Interestingly, the amount of 2.6-kb rRNA varies during culture growth. We observed a transient increase in the relative amount of 2.6-kb rRNA fragments during the first hours after inoculation, which points to changes in the ratio of rRNA synthesis rate to domain III processing rate during the growth of a culture.

  19. Unexpected Accumulation of ncm5U and ncm5s2U in a trm9 Mutant Suggests an Additional Step in the Synthesis of mcm5U and mcm5s2U

    PubMed Central

    Chen, Changchun; Huang, Bo; Anderson, James T.; Byström, Anders S.

    2011-01-01

    Background Transfer RNAs are synthesized as a primary transcript that is processed to produce a mature tRNA. As part of the maturation process, a subset of the nucleosides are modified. Modifications in the anticodon region often modulate the decoding ability of the tRNA. At position 34, the majority of yeast cytosolic tRNA species that have a uridine are modified to 5-carbamoylmethyluridine (ncm5U), 5-carbamoylmethyl-2′-O-methyluridine (ncm5Um), 5-methoxycarbonylmethyl-uridine (mcm5U) or 5-methoxycarbonylmethyl-2-thiouridine (mcm5s2U). The formation of mcm5 and ncm5 side chains involves a complex pathway, where the last step in formation of mcm5 is a methyl esterification of cm5 dependent on the Trm9 and Trm112 proteins. Methodology and Principal Findings Both Trm9 and Trm112 are required for the last step in formation of mcm5 side chains at wobble uridines. By co-expressing a histidine-tagged Trm9p together with a native Trm112p in E. coli, these two proteins purified as a complex. The presence of Trm112p dramatically improves the methyltransferase activity of Trm9p in vitro. Single tRNA species that normally contain mcm5U or mcm5s2U nucleosides were isolated from trm9Δ or trm112Δ mutants and the presence of modified nucleosides was analyzed by HPLC. In both mutants, mcm5U and mcm5s2U nucleosides are absent in tRNAs and the major intermediates accumulating were ncm5U and ncm5s2U, not the expected cm5U and cm5s2U. Conclusions Trm9p and Trm112p function together at the final step in formation of mcm5U in tRNA by using the intermediate cm5U as a substrate. In tRNA isolated from trm9Δ and trm112Δ strains, ncm5U and ncm5s2U nucleosides accumulate, questioning the order of nucleoside intermediate formation of the mcm5 side chain. We propose two alternative explanations for this observation. One is that the intermediate cm5U is generated from ncm5U by a yet unknown mechanism and the other is that cm5U is formed before ncm5U and mcm5U. PMID:21687733

  20. Beyond 16S rRNA Community Profiling: Intra-Species Diversity in the Gut Microbiota

    PubMed Central

    Ellegaard, Kirsten M.; Engel, Philipp

    2016-01-01

    Interactions with microbes affect many aspects of animal biology, including immune system development, nutrition and health. In vertebrates, the gut microbiota is dominated by a small subset of phyla, but the species composition within these phyla is typically not conserved. Moreover, several recent studies have shown that bacterial species in the gut are composed of a multitude of strains, which frequently co-exist in their host, and may be host-specific. However, since the study of intra-species diversity is challenging, particularly in the setting of complex, host-associated microbial communities, our current understanding of the distribution, evolution and functional relevance of intra-species diversity in the gut is scarce. In order to unravel how genomic diversity translates into phenotypic diversity, community analyses going beyond 16S rRNA profiling, in combination with experimental approaches, are needed. Recently, the honeybee has emerged as a promising model for studying gut bacterial communities, particularly in terms of strain-level diversity. Unlike most other invertebrates, the honeybee gut is colonized by a remarkably consistent and specific core microbiota, which is dominated by only eight bacterial species. As for the vertebrate gut microbiota, these species are composed of highly diverse strains suggesting that similar evolutionary forces shape gut community structures in vertebrates and social insects. In this review, we outline current knowledge on the evolution and functional relevance of strain diversity within the gut microbiota, including recent insights gained from mammals and other animals such as the honeybee. We discuss methodological approaches and propose possible future avenues for studying strain diversity in complex bacterial communities. PMID:27708630

  1. 16S rRNA Gene Survey of Microbial Communities in Winogradsky Columns

    PubMed Central

    Rundell, Ethan A.; Banta, Lois M.; Ward, Doyle V.; Watts, Corey D.; Birren, Bruce; Esteban, David J.

    2014-01-01

    A Winogradsky column is a clear glass or plastic column filled with enriched sediment. Over time, microbial communities in the sediment grow in a stratified ecosystem with an oxic top layer and anoxic sub-surface layers. Winogradsky columns have been used extensively to demonstrate microbial nutrient cycling and metabolic diversity in undergraduate microbiology labs. In this study, we used high-throughput 16s rRNA gene sequencing to investigate the microbial diversity of Winogradsky columns. Specifically, we tested the impact of sediment source, supplemental cellulose source, and depth within the column, on microbial community structure. We found that the Winogradsky columns were highly diverse communities but are dominated by three phyla: Proteobacteria, Bacteroidetes, and Firmicutes. The community is structured by a founding population dependent on the source of sediment used to prepare the columns and is differentiated by depth within the column. Numerous biomarkers were identified distinguishing sample depth, including Cyanobacteria, Alphaproteobacteria, and Betaproteobacteria as biomarkers of the soil-water interface, and Clostridia as a biomarker of the deepest depth. Supplemental cellulose source impacted community structure but less strongly than depth and sediment source. In columns dominated by Firmicutes, the family Peptococcaceae was the most abundant sulfate reducer, while in columns abundant in Proteobacteria, several Deltaproteobacteria families, including Desulfobacteraceae, were found, showing that different taxonomic groups carry out sulfur cycling in different columns. This study brings this historical method for enrichment culture of chemolithotrophs and other soil bacteria into the modern era of microbiology and demonstrates the potential of the Winogradsky column as a model system for investigating the effect of environmental variables on soil microbial communities. PMID:25101630

  2. Accurate, rapid taxonomic classification of fungal large-subunit rRNA genes.

    PubMed

    Liu, Kuan-Liang; Porras-Alfaro, Andrea; Kuske, Cheryl R; Eichorst, Stephanie A; Xie, Gary

    2012-03-01

    Taxonomic and phylogenetic fingerprinting based on sequence analysis of gene fragments from the large-subunit rRNA (LSU) gene or the internal transcribed spacer (ITS) region is becoming an integral part of fungal classification. The lack of an accurate and robust classification tool trained by a validated sequence database for taxonomic placement of fungal LSU genes is a severe limitation in taxonomic analysis of fungal isolates or large data sets obtained from environmental surveys. Using a hand-curated set of 8,506 fungal LSU gene fragments, we determined the performance characteristics of a naïve Bayesian classifier across multiple taxonomic levels and compared the classifier performance to that of a sequence similarity-based (BLASTN) approach. The naïve Bayesian classifier was computationally more rapid (>460-fold with our system) than the BLASTN approach, and it provided equal or superior classification accuracy. Classifier accuracies were compared using sequence fragments of 100 bp and 400 bp and two different PCR primer anchor points to mimic sequence read lengths commonly obtained using current high-throughput sequencing technologies. Accuracy was higher with 400-bp sequence reads than with 100-bp reads. It was also significantly affected by sequence location across the 1,400-bp test region. The highest accuracy was obtained across either the D1 or D2 variable region. The naïve Bayesian classifier provides an effective and rapid means to classify fungal LSU sequences from large environmental surveys. The training set and tool are publicly available through the Ribosomal Database Project.

  3. Molecular Diagnosis of Actinomadura madurae Infection by 16S rRNA Deep Sequencing

    PubMed Central

    SenGupta, Dhruba J.; Hoogestraat, Daniel R.; Cummings, Lisa A.; Bryant, Bronwyn H.; Natividad, Catherine; Thielges, Stephanie; Monsaas, Peter W.; Chau, Mimosa; Barbee, Lindley A.; Rosenthal, Christopher; Cookson, Brad T.; Hoffman, Noah G.

    2013-01-01

    Next-generation DNA sequencing can be used to catalog individual organisms within complex, polymicrobial specimens. Here, we utilized deep sequencing of 16S rRNA to implicate Actinomadura madurae as the cause of mycetoma in a diabetic patient when culture and conventional molecular methods were overwhelmed by overgrowth of other organisms. PMID:24108607

  4. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples. PMID:25343859

  5. Duplex-specific nuclease efficiently removes rRNA for prokaryotic RNA-seq.

    PubMed

    Yi, Hana; Cho, Yong-Joon; Won, Sungho; Lee, Jong-Eun; Jin Yu, Hyung; Kim, Sujin; Schroth, Gary P; Luo, Shujun; Chun, Jongsik

    2011-11-01

    Next-generation sequencing has great potential for application in bacterial transcriptomics. However, unlike eukaryotes, bacteria have no clear mechanism to select mRNAs over rRNAs; therefore, rRNA removal is a critical step in sequencing-based transcriptomics. Duplex-specific nuclease (DSN) is an enzyme that, at high temperatures, degrades duplex DNA in preference to single-stranded DNA. DSN treatment has been successfully used to normalize the relative transcript abundance in mRNA-enriched cDNA libraries from eukaryotic organisms. In this study, we demonstrate the utility of this method to remove rRNA from prokaryotic total RNA. We evaluated the efficacy of DSN to remove rRNA by comparing it with the conventional subtractive hybridization (Hyb) method. Illumina deep sequencing was performed to obtain transcriptomes from Escherichia coli grown under four growth conditions. The results clearly showed that our DSN treatment was more efficient at removing rRNA than the Hyb method was, while preserving the original relative abundance of mRNA species in bacterial cells. Therefore, we propose that, for bacterial mRNA-seq experiments, DSN treatment should be preferred to Hyb-based methods.

  6. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin

    PubMed Central

    Chahine, Sarah; Okafor, Darius; Ong, Ana C.; Maybank, Rosslyn; Kwak, Yoon I.; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2015-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  7. Occurrence of fragmented 16S rRNA in an obligate bacterial endosymbiont of Paramecium caudatum.

    PubMed Central

    Springer, N; Ludwig, W; Amann, R; Schmidt, H J; Görtz, H D; Schleifer, K H

    1993-01-01

    The phylogenetic position of Caedibacter caryophila, a so far noncultured killer symbiont of Paramecium caudatum, was elucidated by comparative sequence analysis of in vitro amplified 16S rRNA genes (rDNA). C. caryophila is a member of the alpha subclass of the Proteobacteria phylum. Within this subclass C. caryophila is moderately related to Holospora obtusa, which is another obligate endosymbiont of Paramecium caudatum, and to Rickettsia. A 16S rRNA targeted specific hybridization probe was designed and used for in situ detection of C. caryophila within its host cell. Comparison of the 16S rDNA primary structure of C. caryophila with homologous sequences from other bacteria revealed an unusual insertion of 194 base pairs within the 5'-terminal part of the corresponding gene. The intervening sequence is not present in mature 16S rRNA of C. caryophila. It was demonstrated that C. caryophila contained fragmented 16S rRNA. Images Fig. 5 Fig. 6 PMID:8234331

  8. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples.

  9. Unequal Crossing over at the Rrna Tandon as a Source of Quantitative Genetic Variation in Drosophila

    PubMed Central

    Frankham, R.; Briscoe, D. A.; Nurthen, R. K.

    1980-01-01

    Abdominal bristle selection lines (three high and three low) and controls were founded from a marked homozygous line to measure the contribution of sex-linked "mutations" to selection response. Two of the low lines exhibited a period of rapid response to selection in females, but not in males. There were corresponding changes in female variance, in heritabilities in females, in the sex ratio (a deficiency of females) and in fitness, as well as the appearance of a mutant phenotype in females of one line. All of these changes were due to bb alleles (partial deficiencies for the rRNA tandon) in the X chromosomes of these lines, while the Y chromosomes remained wild-type bb+. We argue that the bb alleles arose by unequal crossing over in the rRNA tandon.—A prediction of this hypothesis is that further changes can occur in the rRNA tandon as selection is continued. This has now been shown to occur.—Our minimum estimate of the rate of occurrence of changes at the rRNA tandon is 3 x 10-4. As this is substantially higher than conventional mutation rates, the questions of the mechanisms and rates of origin of new quantitative genetic variation require careful re-examination. PMID:7439683

  10. Quantitative Analysis of rRNA Modifications Using Stable Isotope Labeling and Mass Spectrometry

    PubMed Central

    2015-01-01

    Post-transcriptional RNA modifications that are introduced during the multistep ribosome biogenesis process are essential for protein synthesis. The current lack of a comprehensive method for a fast quantitative analysis of rRNA modifications significantly limits our understanding of how individual modification steps are coordinated during biogenesis inside the cell. Here, an LC-MS approach has been developed and successfully applied for quantitative monitoring of 29 out of 36 modified residues in the 16S and 23S rRNA from Escherichia coli. An isotope labeling strategy is described for efficient identification of ribose and base methylations, and a novel metabolic labeling approach is presented to allow identification of MS-silent pseudouridine modifications. The method was used to measure relative abundances of modified residues in incomplete ribosomal subunits compared to a mature 15N-labeled rRNA standard, and a number of modifications in both 16S and 23S rRNA were present in substoichiometric amounts in the preribosomal particles. The RNA modification levels correlate well with previously obtained profiles for the ribosomal proteins, suggesting that RNA is modified in a schedule comparable to the association of the ribosomal proteins. Importantly, this study establishes an efficient workflow for a global monitoring of ribosomal modifications that will contribute to a better understanding of mechanisms of RNA modifications and their impact on intracellular processes in the future. PMID:24422502

  11. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing.

    PubMed

    Dhawan, B; Sebastian, S; Malhotra, R; Kapil, A; Gautam, D

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  12. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin.

    PubMed

    McGann, Patrick; Chahine, Sarah; Okafor, Darius; Ong, Ana C; Maybank, Rosslyn; Kwak, Yoon I; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2016-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  13. Ribosome origins: The relative age of 23S rRNA Domains

    NASA Astrophysics Data System (ADS)

    Hury, James; Nagaswamy, Uma; Larios-Sanz, Maia; Fox, George E.

    2006-08-01

    The modern ribosome and its component RNAs are quite large and it is likely that at an earlier time they were much smaller. Hence, not all regions of the modern ribosomal RNAs (rRNA) are likely to be equally old. In the work described here, it is hypothesized that the oldest regions of the RNAs will usually be highly integrated into the machinery. When this is the case, an examination of the interconnectivity between local RNA regions can provide insight to the relative age of the various regions. Herein, we describe an analysis of all known long-range RNA/RNA interactions within the 23S rRNA and between the 23S rRNA and the 16S rRNA in order to assess the interconnectivity between the usual Domains as defined by secondary structure. Domain V, which contains the peptidyl transferase center is centrally located, extensively connected, and therefore likely to be the oldest region. Domain IV and Domain II are extensively interconnected with both themselves and Domain V. A portion of Domain IV is also extensively connected with the 30S subunit and hence Domain IV may be older than Domain II. These results are consistent with other evidence relating to the relative age of RNA regions. Although the relative time of addition of the GTPase center can not be reliably deduced it is pointed out that the development of this may have dramatically affected the progenotes that preceded the last common ancestor.

  14. Distribution of rRNA introns in the three-dimensional structure of the ribosome.

    PubMed

    Jackson, Scott; Cannone, Jamie; Lee, Jung; Gutell, Robin; Woodson, Sarah

    2002-10-11

    More than 1200 introns have been documented at over 150 unique sites in the small and large subunit ribosomal RNA genes (as of February 2002). Nearly all of these introns are assigned to one of four main types: group I, group II, archaeal and spliceosomal. This sequence information has been organized into a relational database that is accessible through the Comparative RNA Web Site (http://www.rna.icmb.utexas.edu/) While the rRNA introns are distributed across the entire tree of life, the majority of introns occur within a few phylogenetic groups. We analyzed the distributions of rRNA introns within the three-dimensional structures of the 30S and 50S ribosomes. Most sites in rRNA genes that contain introns contain only one type of intron. While the intron insertion sites occur at many different coordinates, the majority are clustered near conserved residues that form tRNA binding sites and the subunit interface. Contrary to our expectations, many of these positions are not accessible to solvent in the mature ribosome. The correlation between the frequency of intron insertions and proximity of the insertion site to functionally important residues suggests an association between intron evolution and rRNA function.

  15. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    PubMed

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  16. Study on the anatomy of the lumbosacral anterior great vessels pertinent to L5/S1 anterior interbody surgery with computer tomography angiography.

    PubMed

    Liu, Liehua; Liang, Yong; Zhou, Qiang; Zhang, Hong; Wang, Haoming; Li, Songtao; Zhao, Chen; Hou, Tianyong; Liu, Ling

    2014-12-01

    We investigate the anatomy of the lumbosacral anterior great vessels using computer tomography (CT) angiography before L5/S1 anterior interbody surgery. Sixty-two adult patients were selected. The location of the abdominal aortic bifurcation and common iliac venous confluence in the lumbar vertebrae and the anatomic parameters of the iliac vascular space (e.g., distances from the included angle vertex of the iliac vascular space to the median sagittal plane and to the inferior boundary of L5 and distances between the left and right iliac vessels on the inferior boundary of L5 and on the superior boundary of S1) were analysed. Overall, 67.73% of the 62 cases had an abdominal aortic bifurcation located at L4 and L4/5 intervertebral disc; 61.29%, the common iliac venous confluence located at L5. The four distances mentioned above were 0.98 cm ± 0.38 cm, 2.01 cm ± 1.26 cm, 3.11 cm ± 1.35 cm and 4.34 cm ± 1.10 cm, respectively. A classification system of types A, B and C was developed. The calculated L5/S1 intervertebral space exposure percentages of types A, B and C were 32.21%, 82.58% and 54.68%, respectively. During L5/S1 anterior interbody surgery, type B intervertebral discs can be exposed conveniently, preventing injury of the iliac vessels, which was also observed in 54.68% and 32.21% of the type C and type A discs, respectively. Because the type A intervertebral disc has minimal exposure, the risk of iliac vascular injury is relatively high in these patients.

  17. Comparative analyses of phenotypic methods and 16S rRNA, khe, rpoB genes sequencing for identification of clinical isolates of Klebsiella pneumoniae.

    PubMed

    He, Yanxia; Guo, Xianguang; Xiang, Shifei; Li, Jiao; Li, Xiaoqin; Xiang, Hui; He, Jinlei; Chen, Dali; Chen, Jianping

    2016-07-01

    The present work aimed to evaluate 16S rRNA, khe and rpoB gene sequencing for the identification of Klebsiella pneumoniae in comparison with phenotypic methods. Fifteen clinical isolates were examined, which were initially identified as K. pneumoniae subsp. pneumoniae using the automated VITEK 32 system in two hospitals in Enshi City, China. Their identity was further supported by conventional phenotypic methods on the basis of morphological and biochemical characteristics. Using Bayesian phylogenetic analyses and haplotypes network reconstruction, 13 isolates were identified as K. pneumoniae, whereas the other two isolates (K19, K24) were classified as Shigella sp. and Enterobacter sp., respectively. Of the three genes, 16S rRNA and khe gene could discriminate the clinical isolates at the genus level, whereas rpoB could discriminate Klebsiella at the species and even subspecies level. Overall, the gene tree based on rpoB is more compatible with the currently accepted classification of Klebsiella than those based on 16S rRNA and khe genes, showing that rpoB can be a powerful tool for identification of K. pneumoniae isolates. Above all, our study challenges the utility of khe as a species-specific marker for identification of K. pneumoniae.

  18. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.

    PubMed

    Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

    2016-01-01

    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA

  19. Contrasting evolutionary patterns of 28S and ITS rRNA genes reveal high intragenomic variation in Cephalenchus (Nematoda): Implications for species delimitation.

    PubMed

    Pereira, Tiago José; Baldwin, James Gordon

    2016-05-01

    Concerted evolution is often assumed to be the evolutionary force driving multi-family genes, including those from ribosomal DNA (rDNA) repeat, to complete homogenization within a species, although cases of non-concerted evolution have been also documented. In this study, sequence variation of 28S and ITS ribosomal RNA (rRNA) genes in the genus Cephalenchus is assessed at three different levels, intragenomic, intraspecific, and interspecific. The findings suggest that not all Cephalenchus species undergo concerted evolution. High levels of intraspecific polymorphism, mostly due to intragenomic variation, are found in Cephalenchus sp1 (BRA-01). Secondary structure analyses of both rRNA genes and across different species show a similar substitution pattern, including mostly compensatory (CBC) and semi-compensatory (SBC) base changes, thus suggesting the functionality of these rRNA copies despite the variation found in some species. This view is also supported by low sequence variation in the 5.8S gene in relation to the flanking ITS-1 and ITS-2 as well as by the existence of conserved motifs in the former gene. It is suggested that potential cross-fertilization in some Cephalenchus species, based on inspection of female reproductive system, might contribute to both intragenomic and intraspecific polymorphism of their rRNA genes. These results reinforce the potential implications of intragenomic and intraspecific genetic diversity on species delimitation, especially in biodiversity studies based solely on metagenetic approaches. Knowledge of sequence variation will be crucial for accurate species diversity estimation using molecular methods.

  20. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing.

    PubMed Central

    Schmidt, T M; DeLong, E F; Pace, N R

    1991-01-01

    The phylogenetic diversity of an oligotrophic marine picoplankton community was examined by analyzing the sequences of cloned ribosomal genes. This strategy does not rely on cultivation of the resident microorganisms. Bulk genomic DNA was isolated from picoplankton collected in the north central Pacific Ocean by tangential flow filtration. The mixed-population DNA was fragmented, size fractionated, and cloned into bacteriophage lambda. Thirty-eight clones containing 16S rRNA genes were identified in a screen of 3.2 x 10(4) recombinant phage, and portions of the rRNA gene were amplified by polymerase chain reaction and sequenced. The resulting sequences were used to establish the identities of the picoplankton by comparison with an established data base of rRNA sequences. Fifteen unique eubacterial sequences were obtained, including four from cyanobacteria and eleven from proteobacteria. A single eucaryote related to dinoflagellates was identified; no archaebacterial sequences were detected. The cyanobacterial sequences are all closely related to sequences from cultivated marine Synechococcus strains and with cyanobacterial sequences obtained from the Atlantic Ocean (Sargasso Sea). Several sequences were related to common marine isolates of the gamma subdivision of proteobacteria. In addition to sequences closely related to those of described bacteria, sequences were obtained from two phylogenetic groups of organisms that are not closely related to any known rRNA sequences from cultivated organisms. Both of these novel phylogenetic clusters are proteobacteria, one group within the alpha subdivision and the other distinct from known proteobacterial subdivisions. The rRNA sequences of the alpha-related group are nearly identical to those of some Sargasso Sea picoplankton, suggesting a global distribution of these organisms. Images PMID:2066334

  1. Evidence for autophagy-dependent pathways of rRNA turnover in Arabidopsis.

    PubMed

    Floyd, Brice E; Morriss, Stephanie C; MacIntosh, Gustavo C; Bassham, Diane C

    2015-01-01

    Ribosomes account for a majority of the cell's RNA and much of its protein and represent a significant investment of cellular resources. The turnover and degradation of ribosomes has been proposed to play a role in homeostasis and during stress conditions. Mechanisms for the turnover of rRNA and ribosomal proteins have not been fully elucidated. We show here that the RNS2 ribonuclease and autophagy participate in RNA turnover in Arabidopsis thaliana under normal growth conditions. An increase in autophagosome formation was seen in an rns2-2 mutant, and this increase was dependent on the core autophagy genes ATG9 and ATG5. Autophagosomes and autophagic bodies in rns2-2 mutants contain RNA and ribosomes, suggesting that autophagy is activated as an attempt to compensate for loss of rRNA degradation. Total RNA accumulates in rns2-2, atg9-4, atg5-1, rns2-2 atg9-4, and rns2-2 atg5-1 mutants, suggesting a parallel role for autophagy and RNS2 in RNA turnover. rRNA accumulates in the vacuole in rns2-2 mutants. Vacuolar accumulation of rRNA was blocked by disrupting autophagy via an rns2-2 atg5-1 double mutant but not by an rns2-2 atg9-4 double mutant, indicating that ATG5 and ATG9 function differently in this process. Our results suggest that autophagy and RNS2 are both involved in homeostatic degradation of rRNA in the vacuole.

  2. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection

    PubMed Central

    2011-01-01

    Background The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. Results The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. Conclusions These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection. PMID:22004418

  3. Nucleolin Is Required for DNA Methylation State and the Expression of rRNA Gene Variants in Arabidopsis thaliana

    PubMed Central

    Pontvianne, Frédéric; Abou-Ellail, Mohamed; Douet, Julien; Comella, Pascale; Matia, Isabel; Chandrasekhara, Chinmayi; DeBures, Anne; Blevins, Todd; Cooke, Richard; Medina, Francisco J.; Tourmente, Sylvette; Pikaard, Craig S.; Sáez-Vásquez, Julio

    2010-01-01

    In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1). Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre–rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis. PMID:21124873

  4. A Tale of Two Lines: Searching for the 5s - 5p Resonance Lines in Pm-like Ion Spectra

    SciTech Connect

    Trabert, E; Vilkas, M J; Ishikawa, Y

    2008-10-24

    Highly charged ions in the promethium sequence have been suggested to show spectral features resembling the alkali sequence ions. Guided by calculations, the 5s-5p resonance lines have been sought in a variety of experiments. In the light of the most extensive calculations of Pm-like ions yet, applying relativistic multi-reference Moeller-Plesset second-order perturbation theory, the experimental evidence is reviewed and the line identification problem assessed.

  5. Foraminoplastic transfacet epidural endoscopic approach for removal of intraforaminal disc herniation at the L5-S1 level

    PubMed Central

    Kaczmarczyk, Jacek; Nowakowski, Andrzej; Sulewski, Adam

    2014-01-01

    Transforaminal endoscopic disc removal in the L5-S1 motion segment of the lumbar spine creates a technical challenge due to anatomical reasons and individual variability. The majority of surgeons prefer a posterior classical or minimally invasive approach. There is only one foraminoplastic modification of the technique in the literature so far. In this paper we present a new technique with a foraminoplastic transfacet approach that may be suitable in older patients with advanced degenerative disease of the spine. PMID:24729817

  6. The nuclear 5S RNAs from chicken, rat and man. U5 RNAs are encoded by multiple genes.

    PubMed

    Krol, A; Gallinaro, H; Lazar, E; Jacob, M; Branlant, C

    1981-02-25

    Preparations of chicken, rat and human nuclear 5S RNA contain two sets of molecules. The set with the lowest electrophoretic mobility (5Sa) contains RNAs identical or closely related to ribosomal 5S RNA from the corresponding animal species. In HeLa cells and rat brain, we only detected an RNA identical to the ribosomal 5S RNA. In hen brain and liver, we found other species differing by a limited number of substitutions. The results suggest that mutated 5S genes may be expressed differently according to the cell type. The set with the highest mobility corresponds to U5 RNA. In both rat brain and HeLa cells, U5 RNA was found to be composed of 4 and 5 different molecules respectively (U5A, U5B1-4) differing by a small number of substitutions or insertions. In hen brain, no U5B was detected but U5A' differing from U5A by the absence of the 3'-terminal adenosine. All the U5 RNAs contain the same set of modified nucleotides. They also have the same secondary structure which consists of two hairpins joined together by a 17 nucleotide long single-stranded region. The 3' half of the molecule has a compact conformation. Together, the results suggest that U5 RNAs are transcribed from a multigene family and that mutated genes may be expressed as far as secondary structure is conserved. The conformation of U5 RNA is likely to be related to its function and it is of interest to mention that several similarities of structure are found between U5 and U1A RNA.

  7. Describing a new syndrome in L5-S1 disc herniation: Sexual and sphincter dysfunction without pain and muscle weakness

    PubMed Central

    Akca, Nezih; Ozdemir, Bulent; Kanat, Ayhan; Batcik, Osman Ersagun; Yazar, Ugur; Zorba, Orhan Unal

    2014-01-01

    Context: Little seems to be known about the sexual dysfunction (SD) in lumbar intervertebral disc herniation. Aims: Investigation of sexual and sphincter dysfunction in patient with lumbar disc hernitions. Settings and Design: A retrospective analysis. Materials and Methods: Sexual and sphincter dysfunction in patients admitted with lumbar disc herniations between September 2012-March 2014. Statistical Analysis Used: Statistical analysis was performed using the Predictive Analytics SoftWare (PASW) Statistics 18.0 for Windows (Statistical Package for the Social Sciences, SPSS Inc., Chicago, Illinois). The statistical significance was set at P < 0.05. The Wilcoxon signed ranks test was used to evaluate the difference between patients. Results: Four patients with sexual and sphincter dysfunction were found, including two women and two men, aged between 20 and 52 years. All of them admitted without low back pain. In addition, on neurological examination, reflex and motor deficit were not found. However, almost all patients had perianal sensory deficit and sexual and sphincter dysfunction. Magnetic resonance imaging (MRI) of three patients displayed a large extruded disc fragment at L5-S1 level on the left side. In fourth patient, there were not prominent disc herniations. There was not statistically significant difference between pre-operative and post-operative sexual function, anal-urethral sphincter function, and perianal sensation score. A syndrome in L5-S1 disc herniation with sexual and sphincter dysfunction without pain and muscle weakness was noted. We think that it is crucial for neurosurgeons to early realise that paralysis of the sphincter and sexual dysfunction are possible in patients with lumbar L5-S1 disc disease. Conclusion: A syndrome with perianal sensory deficit, paralysis of the sphincter, and sexual dysfunction may occur in patients with lumbar L5-S1 disc disease. The improvement of perianal sensory deficit after surgery was counteracted by a trend

  8. Minimally Invasive Transforaminal Lumbar Interbody Fusion at L5-S1 through a Unilateral Approach: Technical Feasibility and Outcomes.

    PubMed

    Choi, Won-Suh; Kim, Jin-Sung; Ryu, Kyeong-Sik; Hur, Jung-Woo; Seong, Ji-Hoon

    2016-01-01

    Background. Minimally invasive spinal transforaminal lumbar interbody fusion (MIS-TLIF) at L5-S1 is technically more demanding than it is at other levels because of the anatomical and biomechanical traits. Objective. To determine the clinical and radiological outcomes of MIS-TLIF for treatment of single-level spinal stenosis low-grade isthmic or degenerative spondylolisthesis at L5-S1. Methods. Radiological data and electronic medical records of patients who underwent MIS-TLIF between May 2012 and December 2014 were reviewed. Fusion rate, cage position, disc height (DH), disc angle (DA), disc slope angle, segmental lordotic angle (SLA), lumbar lordotic angle (LLA), and pelvic parameters were assessed. For functional assessment, the visual analogue scale (VAS), Oswestry disability index (ODI), and patient satisfaction rate (PSR) were utilized. Results. A total of 21 levels in 21 patients were studied. DH, DA, SLA, and LLA had increased from their preoperative measures at the final follow-up. Fusion rate was 86.7% (18/21) at 12 months' follow-up. The most common cage position was anteromedial (15/21). The mean VAS scores for back and leg pain mean ODI scores improved significantly at the final follow-up. PSR was 88%. Cage subsidence was observed in 33.3% (7/21). Conclusions. The clinical and radiologic outcomes after MIS-TLIF at L5-S1 in patients with spinal stenosis or spondylolisthesis are generally favorable. PMID:27433472

  9. Minimally Invasive Transforaminal Lumbar Interbody Fusion at L5-S1 through a Unilateral Approach: Technical Feasibility and Outcomes

    PubMed Central

    Choi, Won-Suh; Kim, Jin-Sung; Ryu, Kyeong-Sik; Hur, Jung-Woo; Seong, Ji-Hoon

    2016-01-01

    Background. Minimally invasive spinal transforaminal lumbar interbody fusion (MIS-TLIF) at L5-S1 is technically more demanding than it is at other levels because of the anatomical and biomechanical traits. Objective. To determine the clinical and radiological outcomes of MIS-TLIF for treatment of single-level spinal stenosis low-grade isthmic or degenerative spondylolisthesis at L5-S1. Methods. Radiological data and electronic medical records of patients who underwent MIS-TLIF between May 2012 and December 2014 were reviewed. Fusion rate, cage position, disc height (DH), disc angle (DA), disc slope angle, segmental lordotic angle (SLA), lumbar lordotic angle (LLA), and pelvic parameters were assessed. For functional assessment, the visual analogue scale (VAS), Oswestry disability index (ODI), and patient satisfaction rate (PSR) were utilized. Results. A total of 21 levels in 21 patients were studied. DH, DA, SLA, and LLA had increased from their preoperative measures at the final follow-up. Fusion rate was 86.7% (18/21) at 12 months' follow-up. The most common cage position was anteromedial (15/21). The mean VAS scores for back and leg pain mean ODI scores improved significantly at the final follow-up. PSR was 88%. Cage subsidence was observed in 33.3% (7/21). Conclusions. The clinical and radiologic outcomes after MIS-TLIF at L5-S1 in patients with spinal stenosis or spondylolisthesis are generally favorable. PMID:27433472

  10. Characterization and physical mapping of 18S and 5S ribosomal genes in Indian major carps (Pisces, Cyprinidae).

    PubMed

    Ravindra Kumar; Kushwaha, Basdeo; Nagpure, Naresh S

    2013-06-01

    Characterization of the major (18S) and minor (5S) ribosomal RNA genes were carried out in three commercially important Indian major carp (IMC) species, viz. Catla catla, Labeo rohita and Cirrhinus mrigala along with their physical localizations using dual colour fluorescence in situ hybridization. The diploid chromosome number in the above carps was confirmed to be 50 with inter-species karyo-morphological variations. The 18S rDNA signals were observed on 3 pair of chromosomes in C. catla and L. rohita, and two pairs in C. mrigala. The 5S rDNA signal was found on single pair of chromosome in all the species with variation in their position on chromosomes. The sequencing of 18S rDNA generated 1804, 1805 and 1805 bp long fragments, respectively, in C. catla, L. rohita and C. mrigala with more than 98% sequence identity among them. Similarly, sequencing of 5S rDNA generated 191 bp long fragments in the three species with 100% identity in coding region and 23.2% overall variability in non-transcribed spacer region. Thus, these molecular markers could be used as species-specific markers for taxonomic identification and might help in understanding the genetic diversity, genome organization and karyotype evolution of these species.

  11. Active community profiling via capillary electrophoresis single-strand conformation polymorphism analysis of amplified 16S rRNA and 16S rRNA genes.

    PubMed

    Hiibel, Sage R; Pruden, Amy; Crimi, Barbara; Reardon, Kenneth F

    2010-12-01

    Here, we report the validation and advancement of a high-throughput method for fingerprinting the active members of a microbial community. This method, termed active community profiling (ACP), provides information about both the composition and the activity of mixed microbial cultures via comparative measurements of amplified 16S rRNA (RNA) and 16S rRNA genes (DNA). Capillary electrophoresis is used to resolve single-strand conformation polymorphisms of polymerase chain reaction (PCR) and reverse transcription PCR (RT-PCR) products, producing electropherograms representative of the community structure. Active members of the community are distinguished by elevated RNA:DNA peak area ratios. Chemostat experiments with defined populations were conducted to validate the ACP approach. Using a pure culture of Escherichia coli, a direct correlation was found between the growth rate and the RNA:DNA peak ratio. In a second validation experiment, a binary culture of E. coli and Pseudomonas putida was subjected to a controlled environmental change consisting of a shift to anaerobic conditions. ACP revealed the expected cessation of growth of P. putida, an obligate aerobe, while the corresponding DNA-only analysis indicated no change in the culture. Finally, ACP was applied to a complex microbial community, and a novel binning approach was demonstrated for integrating the RNA and DNA electropherograms. ACP thus represents a significant advance from traditional DNA-based profiling techniques, which do not distinguish active from inactive or dead cells, and is well suited for high-throughput community analysis.

  12. Rapid differentiation of Francisella species and subspecies by fluorescent in situ hybridization targeting the 23S rRNA

    PubMed Central

    2010-01-01

    Background Francisella (F.) tularensis is the causative agent of tularemia. Due to its low infectious dose, ease of dissemination and high case fatality rate, F. tularensis was the subject in diverse biological weapons programs and is among the top six agents with high potential if misused in bioterrorism. Microbiological diagnosis is cumbersome and time-consuming. Methods for the direct detection of the pathogen (immunofluorescence, PCR) have been developed but are restricted to reference laboratories. Results The complete 23S rRNA genes of representative strains of F. philomiragia and all subspecies of F. tularensis were sequenced. Single nucleotide polymorphisms on species and subspecies level were confirmed by partial amplification and sequencing of 24 additional strains. Fluorescent In Situ Hybridization (FISH) assays were established using species- and subspecies-specific probes. Different FISH protocols allowed the positive identification of all 4 F. philomiragia strains, and more than 40 F. tularensis strains tested. By combination of different probes, it was possible to differentiate the F. tularensis subspecies holarctica, tularensis, mediasiatica and novicida. No cross reactivity with strains of 71 clinically relevant bacterial species was observed. FISH was also successfully applied to detect different F. tularensis strains in infected cells or tissue samples. In blood culture systems spiked with F. tularensis, bacterial cells of different subspecies could be separated within single samples. Conclusion We could show that FISH targeting the 23S rRNA gene is a rapid and versatile method for the identification and differentiation of F. tularensis isolates from both laboratory cultures and clinical samples. PMID:20205957

  13. Analysis of 16S-23S rRNA Intergenic Spacer Regions of Vibrio cholerae and Vibrio mimicus

    PubMed Central

    Chun, Jongsik; Huq, Anwarul; Colwell, Rita R.

    1999-01-01

    Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3′ end of the 16S and the 5′ end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae. PMID:10224020

  14. A short fragment of 23S rRNA containing the binding sites for two ribosomal proteins, L24 and L4, is a key element for rRNA folding during early assembly.

    PubMed Central

    Stelzl, U; Nierhaus, K H

    2001-01-01

    Previously we described an in vitro selection variant abbreviated SERF (in vitro selection from random rRNA fragments) that identifies protein binding sites within large RNAs. With this method, a small rRNA fragment derived from the 23S rRNA was isolated that binds simultaneously and independently the ribosomal proteins L4 and L24 from Escherichia coli. Until now the rRNA structure within the ternary complex L24-rRNA-L4 could not be studied due to the lack of an appropriate experimental strategy. Here we tackle the issue by separating the various complexes via native gel-electrophoresis and analyzing the rRNA structure by in-gel iodine cleavage of phosphorothioated RNA. The results demonstrate that during the transition from either the L4 or L24 binary complex to the ternary complex the structure of the rRNA fragment changes significantly. The identified protein binding sites are in excellent agreement with the recently reported crystal structure of the 50S subunit. Because both proteins play a prominent role in early assembly of the large subunit, the results suggest that the identified rRNA fragment is a key element for the folding of the 23S RNA during early assembly. The introduced in-gel cleavage method should be useful when an RNA structure within mixed populations of different but related complexes should be studied. PMID:11345438

  15. A short fragment of 23S rRNA containing the binding sites for two ribosomal proteins, L24 and L4, is a key element for rRNA folding during early assembly.

    PubMed

    Stelzl, U; Nierhaus, K H

    2001-04-01

    Previously we described an in vitro selection variant abbreviated SERF (in vitro selection from random rRNA fragments) that identifies protein binding sites within large RNAs. With this method, a small rRNA fragment derived from the 23S rRNA was isolated that binds simultaneously and independently the ribosomal proteins L4 and L24 from Escherichia coli. Until now the rRNA structure within the ternary complex L24-rRNA-L4 could not be studied due to the lack of an appropriate experimental strategy. Here we tackle the issue by separating the various complexes via native gel-electrophoresis and analyzing the rRNA structure by in-gel iodine cleavage of phosphorothioated RNA. The results demonstrate that during the transition from either the L4 or L24 binary complex to the ternary complex the structure of the rRNA fragment changes significantly. The identified protein binding sites are in excellent agreement with the recently reported crystal structure of the 50S subunit. Because both proteins play a prominent role in early assembly of the large subunit, the results suggest that the identified rRNA fragment is a key element for the folding of the 23S RNA during early assembly. The introduced in-gel cleavage method should be useful when an RNA structure within mixed populations of different but related complexes should be studied.

  16. Two linear regression models predicting cumulative dynamic L5/S1 joint moment during a range of lifting tasks based on static postures.

    PubMed

    Xu, Xu; Chang, Chien-Chi; Lu, Ming-Lun

    2012-01-01

    Previous studies have indicated that cumulative L5/S1 joint load is a potential risk factor for low back pain. The assessment of cumulative L5/S1 joint load during a field study is challenging due to the difficulty of continuously monitoring the dynamic joint load. This study proposes two regression models predicting cumulative dynamic L5/S1 joint moment based on the static L5/S1 joint moment of a lifting task at lift-off and set-down and the lift duration. Twelve men performed lifting tasks at varying lifting ranges and asymmetric angles in a laboratory environment. The cumulative L5/S1 joint moment was calculated from continuous dynamic L5/S1 moments as the reference for comparison. The static L5/S1 joint moments at lift-off and set-down were measured for the two regression models. The prediction error of the cumulative L5/S1 joint moment was 21 ± 14 Nm × s (12% of the measured cumulative L5/S1 joint moment) and 14 ± 9 Nm × s (8%) for the first and the second models, respectively. Practitioner Summary: The proposed regression models may provide a practical approach for predicting the cumulative dynamic L5/S1 joint loading of a lifting task for field studies since it requires only the lifting duration and the static moments at the lift-off and/or set-down instants of the lift.

  17. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples.

    PubMed

    Dollive, Serena; Peterfreund, Gregory L; Sherrill-Mix, Scott; Bittinger, Kyle; Sinha, Rohini; Hoffmann, Christian; Nabel, Christopher S; Hill, David A; Artis, David; Bachman, Michael A; Custers-Allen, Rebecca; Grunberg, Stephanie; Wu, Gary D; Lewis, James D; Bushman, Frederic D

    2012-07-03

    Eukaryotic microorganisms are important but understudied components of the human microbiome. Here we present a pipeline for analysis of deep sequencing data on single cell eukaryotes. We designed a new 18S rRNA gene-specific PCR primer set and compared a published rRNA gene internal transcribed spacer (ITS) gene primer set. Amplicons were tested against 24 specimens from defined eukaryotes and eight well-characterized human stool samples. A software pipeline https://sourceforge.net/projects/brocc/ was developed for taxonomic attribution, validated against simulated data, and tested on pyrosequence data. This study provides a well-characterized tool kit for sequence-based enumeration of eukaryotic organisms in human microbiome samples.

  18. A renaissance for the pioneering 16S rRNA gene

    SciTech Connect

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  19. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment

    PubMed Central

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  20. Methodology of protistan discovery: from rRNA detection to quality scanning electron microscope images.

    PubMed

    Stoeck, Thorsten; Fowle, William H; Epstein, Slava S

    2003-11-01

    Each year, thousands of new protistan 18S rRNA sequences are detected in environmental samples. Many of these sequences are molecular signatures of new protistan species, classes, and/or kingdoms that have never been seen before. The main goal of this study was to enable visualization of these novel organisms and to conduct quality ultrastructural examination. We achieved this goal by modifying standard procedures for cell fixation, fluorescence in situ hybridization, and scanning electron microscopy (SEM) and by making these methodologies work in concert. As a result, the same individual cell can now be detected by 18S rRNA-targeted fluorochrome-labeled probes and then viewed by SEM to reveal its diagnostic morphological characteristics. The method was successfully tested on a wide range of protists (alveolates, stramenopiles, kinetoplastids, and cryptomonads). The new methodology thus opens a way for fine microscopy studies of many organisms previously known exclusively by their 18S rRNA sequences.

  1. Properties of small rRNA methyltransferase RsmD: Mutational and kinetic study

    PubMed Central

    Sergeeva, Olga V.; Prokhorova, Irina V.; Ordabaev, Yerdos; Tsvetkov, Philipp O.; Sergiev, Petr V.; Bogdanov, Alexey A.; Makarov, Alexander A.; Dontsova, Olga A.

    2012-01-01

    Ribosomal RNA modification is accomplished by a variety of enzymes acting on all stages of ribosome assembly. Among rRNA methyltransferases of Escherichia coli, RsmD deserves special attention. Despite its minimalistic domain architecture, it is able to recognize a single target nucleotide G966 of the 16S rRNA. RsmD acts late in the assembly process and is able to modify a completely assembled 30S subunit. Here, we show that it possesses superior binding properties toward the unmodified 30S subunit but is unable to bind a 30S subunit modified at G966. RsmD is unusual in its ability to withstand multiple amino acid substitutions of the active site. Such efficiency of RsmD may be useful to complete the modification of a 30S subunit ahead of the 30S subunit’s involvement in translation. PMID:22535590

  2. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    PubMed

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general.

  3. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    SciTech Connect

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  4. Reverse transcription and polymerase chain reaction amplification of rRNA for detection of Helicobacter species.

    PubMed

    Engstrand, L; Nguyen, A M; Graham, D Y; el-Zaatari, F A

    1992-09-01

    Sequence data on Helicobacter pylori 16S rRNA were used to select two 22-base oligonucleotide primers for use in a polymerase chain reaction (PCR) for detection of H. pylori. H. pylori cells were treated with lysis buffer, boiled, and chloroform extracted. Reverse transcription of rRNA was followed by PCR amplification (RT-PCR) of the synthesized cDNA and 16S rRNA gene. The amplified PCR products were analyzed by agarose gel electrophoresis and Southern blotting. Using ethidium bromide-stained agarose gels, we were able to detect the expected 500-bp DNA fragment from as few as two H. pylori organisms per reaction. The specificity of the RT-PCR assay was tested with 27 clinical isolates and related reference strains; although the number of bacterial cells used per reaction was 10(5)-fold greater than the number of H. pylori organisms used, amplification was detected only with bacteria in the same genus, H. cinaedi and H. mustelae. Ten H. pylori organisms per biopsy specimen were detected on agarose gels when organisms were added to samples prepared from a processed colon biopsy sample. RT-PCR results were consistent with urea breath test and culture results in 14 of 15 gastric biopsy specimens; the specificity was 100%. RT-PCR of rRNA from H. pylori increased the sensitivity of pathogen detection at least 25- to 50-fold compared with that of previous PCR assays. This low level of detection by RT-PCR assay may prove to be well suited for verifying eradication following therapy. PMID:1383268

  5. Characterization of Xanthomonas campestris Pathovars by rRNA Gene Restriction Patterns

    PubMed Central

    Berthier, Yvette; Verdier, Valérie; Guesdon, Jean-Luc; Chevrier, Danièle; Denis, Jean-Baptiste; Decoux, Guy; Lemattre, Monique

    1993-01-01

    Genomic DNA of 191 strains of the family Pseudomonadaceae, including 187 strains of the genus Xanthomonas, was cleaved by EcoRI endonuclease. After hybridization of Southern transfer blots with 2-acetylamino-fluorene-labelled Escherichia coli 16+23S rRNA probe, 27 different patterns were obtained. The strains are clearly distinguishable at the genus, species, and pathovar levels. The variability of the rRNA gene restriction patterns was determined for four pathovars of Xanthomonas campestris species. The 16 strains of X. campestris pv. begoniae analyzed gave only one pattern. The variability of rRNA gene restriction patterns of X. campestris pv. manihotis strains could be related to ecotypes. In contrast, the variability of patterns observed for X. campestris pv. malvacearum was not correlated with pathogenicity or with the geographical origins of the strains. The highest degree of variability of DNA fingerprints was observed within X. campestris pv. dieffenbachiae, which is pathogenic to several hosts of the Araceae family. In this case, variability was related to both host plant and pathogenicity. Images PMID:16348894

  6. Phylogenetic analysis based evolutionary study of 16S rRNA in known Pseudomonas sp

    PubMed Central

    Adhikari, Arindam; Nandi, Suvodip; Bhattacharya, Indrabrata; Roy, Mithu De; Mandal, Tanusri; Dutta, Subrata

    2015-01-01

    Molecular evolution analysis of 16S rRNA sequences of native Pseudomonas strains and different fluorescent pseudomonads were conducted on the basis of Molecular Evolutionary Genetics Analysis version 5.2 (MEGA5.2). Topological evaluations show common origin for native strains with other known strains with available sequences at GenBank database. Phylogenetic affiliation of different Pseudomonas sp based on 16S rRNA gene shows that molecular divergence contributes to the genetic diversity of Pseudomonas sp. Result indicate direct dynamic interactions with the rhizospheric pathogenic microbial community. The selection pressure acting on 16S rRNA gene was related to the nucleotide diversity of Pseudomonas sp in soil rhizosphere community among different agricultural crops. Besides, nucleotide diversity among the whole population was very low and tajima test statistic value (D) was also slightly positive (Tajima׳s test statistics D value 0.351). This data indicated increasing trends of infection of soil-borne pathogens under gangetic-alluvial regions of West Bengal due to high degree of nucleotide diversity with decreased population of plant growth promoting rhizobacteria like fluorescent Pseudomonads in soil. PMID:26664032

  7. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    PubMed

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  8. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  9. An rRNA variable region has an evolutionarily conserved essential role despite sequence divergence.

    PubMed Central

    Sweeney, R; Chen, L; Yao, M C

    1994-01-01

    Regions extremely variable in size and sequence occur at conserved locations in eukaryotic rRNAs. The functional importance of one such region was determined by gene reconstruction and replacement in Tetrahymena thermophila. Deletion of the D8 region of the large-subunit rRNA inactivates T. thermophila rRNA genes (rDNA): transformants containing only this type of rDNA are unable to grow. Replacement with an unrelated sequence of similar size or a variable region from a different position in the rRNA also inactivated the rDNA. Mutant rRNAs resulting from such constructs were present only in precursor forms, suggesting that these rRNAs are deficient in either processing or stabilization of the mature form. Replacement with D8 regions from three other organisms restored function, even though the sequences are very different. Thus, these D8 regions share an essential functional feature that is not reflected in their primary sequences. Similar tertiary structures may be the quality these sequences share that allows them to function interchangeably. Images PMID:8196658

  10. Inositol pyrophosphates regulate RNA polymerase I-mediated rRNA transcription in Saccharomyces cerevisiae.

    PubMed

    Thota, Swarna Gowri; Unnikannan, C P; Thampatty, Sitalakshmi R; Manorama, R; Bhandari, Rashna

    2015-02-15

    Ribosome biogenesis is an essential cellular process regulated by the metabolic state of a cell. We examined whether inositol pyrophosphates, energy-rich derivatives of inositol that act as metabolic messengers, play a role in ribosome synthesis in the budding yeast, Saccharomyces cerevisiae. Yeast strains lacking the inositol hexakisphosphate (IP6) kinase Kcs1, which is required for the synthesis of inositol pyrophosphates, display increased sensitivity to translation inhibitors and decreased protein synthesis. These phenotypes are reversed on expression of enzymatically active Kcs1, but not on expression of the inactive form. The kcs1Δ yeast cells exhibit reduced levels of ribosome subunits, suggesting that they are defective in ribosome biogenesis. The rate of rRNA synthesis, the first step of ribosome biogenesis, is decreased in kcs1Δ yeast strains, suggesting that RNA polymerase I (Pol I) activity may be reduced in these cells. We determined that the Pol I subunits, A190, A43 and A34.5, can accept a β-phosphate moiety from inositol pyrophosphates to undergo serine pyrophosphorylation. Although there is impaired rRNA synthesis in kcs1Δ yeast cells, we did not find any defect in recruitment of Pol I on rDNA, but observed that the rate of transcription elongation was compromised. Taken together, our findings highlight inositol pyrophosphates as novel regulators of rRNA transcription.

  11. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    PubMed Central

    Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  12. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  13. The Role of 16S rRNA Gene Sequencing in Confirmation of Suspected Neonatal Sepsis.

    PubMed

    El Gawhary, Somaia; El-Anany, Mervat; Hassan, Reem; Ali, Doaa; El Gameel, El Qassem

    2016-02-01

    Different molecular assays for the detection of bacterial DNA in the peripheral blood represented a diagnostic tool for neonatal sepsis. We targeted to evaluate the role of 16S rRNA gene sequencing to screen for bacteremia to confirm suspected neonatal sepsis (NS) and compare with risk factors and septic screen testing. Sixty-two neonates with suspected NS were enrolled. White blood cells count, I/T ratio, C-reactive protein, blood culture and 16S rRNA sequencing were performed. Blood culture was positive in 26% of cases, and PCR was positive in 26% of cases. Evaluation of PCR for the diagnosis of NS showed sensitivity 62.5%, specificity 86.9%, PPV 62.5%, NPV 86.9% and accuracy of 79.7%. 16S rRNA PCR increased the sensitivity of detecting bacterial DNA in newborns with signs of sepsis from 26 to 35.4%, and its use can be limited to cases with the most significant risk factors and positive septic screen.

  14. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    PubMed

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-11-13

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

  15. Rare Events of Intragenus and Intraspecies Horizontal Transfer of the 16S rRNA Gene.

    PubMed

    Tian, Ren-Mao; Cai, Lin; Zhang, Wei-Peng; Cao, Hui-Luo; Qian, Pei-Yuan

    2015-07-27

    Horizontal gene transfer (HGT) of operational genes has been widely reported in prokaryotic organisms. However, informational genes such as those involved in transcription and translation processes are very difficult to be horizontally transferred, as described by Woese's complexity hypothesis. Here, we analyzed all of the completed prokaryotic genome sequences (2,143 genomes) in the NCBI (National Center for Biotechnology Information) database, scanned for genomes with high intragenomic heterogeneity of 16S rRNA gene copies, and explored potential HGT events of ribosomal RNA genes based on the phylogeny, genomic organization, and secondary structures of the ribosomal RNA genes. Our results revealed 28 genomes with relatively high intragenomic heterogeneity of multiple 16S rRNA gene copies (lowest pairwise identity <98.0%), and further analysis revealed HGT events and potential donors of the heterogeneous copies (such as HGT from Chlamydia suis to Chlamydia trachomatis) and mutation events of some heterogeneous copies (such as Streptococcus suis JS14). Interestingly, HGT of the 16S rRNA gene only occurred at intragenus or intraspecies levels, which is quite different from the HGT of operational genes. Our results improve our understanding regarding the exchange of informational genes.

  16. Microdecompression for Extraforaminal L5-S1 Disc Herniation; The Significance of Concomitant Foraminal Disc Herniation for Postoperative Leg Pain

    PubMed Central

    Lee, Dong Yeob

    2008-01-01

    Objective To analyze the relationship of concomitant foraminal lumbar disc herniation (FLDH) with postoperative leg pain after microdecompression for extraforaminal lumbar disc herniation (EFLDH) at the L5-S1 level. Methods Sixty-five patients who underwent microdecompression for symptomatic EFLDH at the L5-S1 level were enrolled. According to the severity of accompanying FLDH, EFLDH was classified into four categories (Class I : no FLDH; Class II : mild to moderate FLDH confined within a lateral foraminal zone; Class III : severe FLDH extending to a medial foraminal zone; Class IV : Class III with intracanalicular disc herniation). The incidence of postoperative leg pain, dysesthesia, analgesic medication, epidural block, and requirement for revision surgery due to leg pain were evaluated and compared at three months after initial surgery. Results The incidences of postoperative leg pain and dysesthesia were 36.9% and 26.1%, respectively. Pain medication and epidural block was performed on 40% and 41.5%, respectively. Revision surgery was recommended in six patients (9.2%) due to persistent leg pain. The incidences of leg pain, dysesthesia, and requirement for epidural block were higher in Class III/IV, compared with Class I/II. The incidence of requirement for analgesic medication was significantly higher in Class III/IV, compared with Class I/II (p=0.02, odds ratio=9.82). All patients who required revision surgery due to persistent leg pain were included in Class III/IV. Conclusion Concomitant FLDH seems related to postoperative residual leg pain after microdecompression for EFLDH at the L5-S1 level. PMID:19096652

  17. Measurement of the photoionization cross section of the 5S{sub 1/2} state of rubidium

    SciTech Connect

    Lowell, J.R.; Northup, T.; Patterson, B.M.; Takekoshi, T.; Knize, R.J.

    2002-12-01

    We report the measurement of the photoionization cross section for the 5S{sub 1/2} state of rubidium, using atoms confined in a magneto-optical trap. A single-photon rate at {lambda}=266 nm was found by monitoring the decay of trap fluorescence after exposure to ionizing radiation from a quadrupled Nd:YVO{sub 4} laser. In order to eliminate excited-state ionization, the photoionization and trapping lasers were alternately chopped, so that only ground-state atoms were ionized. We determine that the photoionization cross section at {lambda}=266 nm is {sigma}=1.7(2)x10{sup -20} cm{sup 2}.

  18. In Vivo Production of Small Recombinant RNAs Embedded in a 5S rRNA-Derived Protective Scaffold.

    PubMed

    Stepanov, Victor G; Fox, George E

    2015-01-01

    Preparative synthesis of RNA is a challenging task that is usually accomplished using either chemical or enzymatic polymerization of ribonucleotides in vitro. Herein, we describe an alternative approach in which RNAs of interest are expressed as a fusion with a 5S rRNA-derived scaffold. The scaffold provides protection against cellular ribonucleases resulting in cellular accumulations comparable to those of regular ribosomal RNAs. After isolation of the chimeric RNA from the cells, the scaffold can be removed if necessary by deoxyribozyme-catalyzed cleavage followed by preparative electrophoretic separation of the cleavage reaction products. The protocol is designed for sustained production of high quality RNA on the milligram scale.

  19. Intragenomic heterogeneity of the 16S rRNA-23S rRNA internal transcribed spacer among Pseudomonas syringae and Pseudomonas fluorescens strains.

    PubMed

    Milyutina, Irina A; Bobrova, Vera K; Matveeva, Eugenia V; Schaad, Norman W; Troitsky, Alexey V

    2004-10-01

    The 16S-23S rRNA internal transcribed spacer regions (ITS1) from 14 strains of Pseudomonas syringae and P. fluorescens were sequenced. ITS1 exhibited significant sequence variability among different operons within a single genome. From 1 to 4 types of ITS1 were found in individual genomes of the P. syringae and P. fluorescens strains. A total of eight ITS1 types were identified among strains studied. The ITS1 nucleotide sequences consisted of conserved blocks including, among others, a stem-forming region of box B, tRNAIle and tRNAAla genes and several variable blocks. The differences in the variable regions were mostly due to insertions and/or deletions of nucleotide blocks. The intragenomic heterogeneity of ITS1 was brought about by different combinations of variable blocks, which possibly have resulted from recombination and horizontal transfer.

  20. Structural and functional exchangeability of 5 S RNA species from the eubacterium E.coli and the thermoacidophilic archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Teixidò, J; Altamura, S; Londei, P; Amils, R

    1989-01-01

    The role of 5 S RNA within the large ribosomal subunit of the extremely thermophilic archaebacterium Sulfolobus solfataricus has been analysed by means of in vitro reconstitution procedures. It is shown that Sulfolobus 50 S subunits reconstituted in the absence of 5 S RNA are inactive in protein synthesis and lack 2-3 ribosomal proteins. Furthermore, it has been determined that in the course of the in vitro assembly process Sulfolobus 5 S RNA can be replaced by the correspondent RNA species of E.coli; Sulfolobus reconstituted particles containing the eubacterial 5 S molecule are stable and active in polypeptide synthesis at high temperatures. Images PMID:2493632

  1. Absolute photoabsorption cross sections of Sr I from the 5s ionization threshold to the 5p threshold

    NASA Astrophysics Data System (ADS)

    Chu, C. C.; Fung, H. S.; Wu, H. H.; Yih, T. S.

    1998-09-01

    We have measured the absolute photoabsorption cross sections of Sr I from its 5s ionization threshold up to the 0953-4075/31/17/010/img1 thresholds. The spectrum includes the Sr I 0953-4075/31/17/010/img2, 0953-4075/31/17/010/img3, 0953-4075/31/17/010/img4 and 0953-4075/31/17/010/img5 doubly excited series which converge to the 0953-4075/31/17/010/img6 or 0953-4075/31/17/010/img1 series limits. Synchrotron radiation, from the 1 m Seya-Namioka beam line of the Synchrotron Radiation Research Center at Hsin-Chu, Taiwan, was used as the background continuum. The absolute column density was determined by measuring simultaneously the temperature distribution profiles and the total pressure in a heatpipe. Absolute cross sections were obtained using the Beer-Lambert law. The measured absolute cross section for the 5s ionization threshold was 0953-4075/31/17/010/img8. At the most significant autoionizing resonance, 0953-4075/31/17/010/img9 around 0953-4075/31/17/010/img10, the absolute cross section was measured as 0953-4075/31/17/010/img11. The absolute cross sections presented here are larger than those based on saturated vapour-pressure data, and less than those based on the f-value measurements. All the absolute cross sections in this work are compared with both recent experiments and

  2. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).

    PubMed

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  3. Li(V0.5Ti0.5)S2 as a 1 V lithium intercalation electrode

    NASA Astrophysics Data System (ADS)

    Clark, Steve J.; Wang, Da; Armstrong, A. Robert; Bruce, Peter G.

    2016-03-01

    Graphite, the dominant anode in rechargeable lithium batteries, operates at ~0.1 V versus Li+/Li and can result in lithium plating on the graphite surface, raising safety concerns. Titanates, for example, Li4Ti5O12, intercalate lithium at~1.6 V versus Li+/Li, avoiding problematic lithium plating at the expense of reduced cell voltage. There is interest in 1 V anodes, as this voltage is sufficiently high to avoid lithium plating while not significantly reducing cell potential. The sulfides, LiVS2 and LiTiS2, have been investigated as possible 1 V intercalation electrodes but suffer from capacity fading, large 1st cycle irreversible capacity or polarization. Here we report that the 50/50 solid solution, Li1+x(V0.5Ti0.5)S2, delivers a reversible capacity to store charge of 220 mAhg-1 (at 0.9 V), 99% of theoretical, at a rate of C/2, retaining 205 mAhg-1 at C-rate (92% of theoretical). Rate capability is excellent with 200 mAhg-1 at 3C. C-rate is discharge in 1 h. Polarization is low, 100 mV at C/2. To the best of our knowledge, the properties/performances of Li(V0.5Ti0.5)S2 exceed all previous 1 V electrodes.

  4. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).

    PubMed

    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F

    2014-11-14

    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera.

  5. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    PubMed Central

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  6. Design and Experimental Application of a Novel Non-Degenerate Universal Primer Set that Amplifies Prokaryotic 16S rRNA Genes with a Low Possibility to Amplify Eukaryotic rRNA Genes

    PubMed Central

    Mori, Hiroshi; Maruyama, Fumito; Kato, Hiromi; Toyoda, Atsushi; Dozono, Ayumi; Ohtsubo, Yoshiyuki; Nagata, Yuji; Fujiyama, Asao; Tsuda, Masataka; Kurokawa, Ken

    2014-01-01

    The deep sequencing of 16S rRNA genes amplified by universal primers has revolutionized our understanding of microbial communities by allowing the characterization of the diversity of the uncultured majority. However, some universal primers also amplify eukaryotic rRNA genes, leading to a decrease in the efficiency of sequencing of prokaryotic 16S rRNA genes with possible mischaracterization of the diversity in the microbial community. In this study, we compared 16S rRNA gene sequences from genome-sequenced strains and identified candidates for non-degenerate universal primers that could be used for the amplification of prokaryotic 16S rRNA genes. The 50 identified candidates were investigated to calculate their coverage for prokaryotic and eukaryotic rRNA genes, including those from uncultured taxa and eukaryotic organelles, and a novel universal primer set, 342F-806R, covering many prokaryotic, but not eukaryotic, rRNA genes was identified. This primer set was validated by the amplification of 16S rRNA genes from a soil metagenomic sample and subsequent pyrosequencing using the Roche 454 platform. The same sample was also used for pyrosequencing of the amplicons by employing a commonly used primer set, 338F-533R, and for shotgun metagenomic sequencing using the Illumina platform. Our comparison of the taxonomic compositions inferred by the three sequencing experiments indicated that the non-degenerate 342F-806R primer set can characterize the taxonomic composition of the microbial community without substantial bias, and is highly expected to be applicable to the analysis of a wide variety of microbial communities. PMID:24277737

  7. Design and experimental application of a novel non-degenerate universal primer set that amplifies prokaryotic 16S rRNA genes with a low possibility to amplify eukaryotic rRNA genes.

    PubMed

    Mori, Hiroshi; Maruyama, Fumito; Kato, Hiromi; Toyoda, Atsushi; Dozono, Ayumi; Ohtsubo, Yoshiyuki; Nagata, Yuji; Fujiyama, Asao; Tsuda, Masataka; Kurokawa, Ken

    2014-01-01

    The deep sequencing of 16S rRNA genes amplified by universal primers has revolutionized our understanding of microbial communities by allowing the characterization of the diversity of the uncultured majority. However, some universal primers also amplify eukaryotic rRNA genes, leading to a decrease in the efficiency of sequencing of prokaryotic 16S rRNA genes with possible mischaracterization of the diversity in the microbial community. In this study, we compared 16S rRNA gene sequences from genome-sequenced strains and identified candidates for non-degenerate universal primers that could be used for the amplification of prokaryotic 16S rRNA genes. The 50 identified candidates were investigated to calculate their coverage for prokaryotic and eukaryotic rRNA genes, including those from uncultured taxa and eukaryotic organelles, and a novel universal primer set, 342F-806R, covering many prokaryotic, but not eukaryotic, rRNA genes was identified. This primer set was validated by the amplification of 16S rRNA genes from a soil metagenomic sample and subsequent pyrosequencing using the Roche 454 platform. The same sample was also used for pyrosequencing of the amplicons by employing a commonly used primer set, 338F-533R, and for shotgun metagenomic sequencing using the Illumina platform. Our comparison of the taxonomic compositions inferred by the three sequencing experiments indicated that the non-degenerate 342F-806R primer set can characterize the taxonomic composition of the microbial community without substantial bias, and is highly expected to be applicable to the analysis of a wide variety of microbial communities.

  8. Role of DNA-Dependent RNA Polymerase III in the Transcription of the tRNA and 5S RNA Genes

    PubMed Central

    Weinmann, Roberto; Roeder, Robert G.

    1974-01-01

    Mouse myeloma cells have previously been shown (L. B. Schwartz, V. E. F. Sklar, J. A. Jaehning, R. Weinmann & R. G. Roeder, submitted for publication) to contain two chromatographically distinct forms of RNA polymerase III (designated IIIA and IIIB). The enzymes are unaffected by low α-amanitin concentrations which completely inhibit RNA polymerase II, but they exhibit characteristic inhibition curves (identical for IIIA and IIIB) at higher toxin concentrations. RNA polymerase I was unaffected at all α-amanitin concentrations tested. Myeloma RNA polymerases II, IIIA, and IIIB appear to be inhibited by the same mechanism, since the toxin rapidly blocks chain elongation by each enzyme. The characteristic α-amanitin sensitivity of RNA polymerase III has been employed in studies of the function(s) of the class III RNA polymerases. Isolated myeloma nuclei and nucleoli contińue to synthesize RNA via the endogenous RNA polymerases when incubated in vitro. With nuclei, newly synthesized 4S precursor (pre-4S) and 5S RNA species were detected by electrophoretic analysis either of the total nuclear RNA or of the RNA released into the supernatant during incubation. The synthesis of both pre-4S and 5S RNA species was inhibited by α-amanitin, but only at high concentrations; and the α-amanitin inhibition curves for these RNAs were identical to those obtained for solubilized RNA polymerases IIIA and IIIB. In control experiments it was shown that the endogenous RNA polymerase II activity of isolated nuclei was inhibited by α-amanitin concentrations similar to those required to inhibit purified enzyme II. However, 40-50% of the endogenous activity of nuclei and 100% of the endogenous activity of purified nucleoli was completely resistant to the high α-amanitin concentrations necessary to inhibit the RNA polymerase III activities. These experiments rule out nonspecific inhibitory effects in the endogenous systems. These results unequivocally demonstrate the role of RNA

  9. Identification of Actinomyces meyeri actinomycosis in middle ear and mastoid by 16S rRNA analysis.

    PubMed

    Kakuta, Risako; Hidaka, Hiroshi; Yano, Hisakazu; Miyazaki, Hiromitsu; Suzaki, Hiroshi; Nakamura, Yasuhiro; Kanamori, Hajime; Endo, Shiro; Hirakata, Yoichi; Kaku, Mitsuo; Kobayashi, Toshimitsu

    2013-08-01

    Actinomycosis of the middle ear and mastoid is extremely rare. Here, we report a unique case of actinomycosis of the middle ear and mastoid caused by Actinomyces meyeri diagnosed by 16S rRNA gene sequence analysis.

  10. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

    1992-01-01

    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  11. Uniting the classification of cultured and uncultured bacteria and archaea using 16S rRNA gene sequences.

    PubMed

    Yarza, Pablo; Yilmaz, Pelin; Pruesse, Elmar; Glöckner, Frank Oliver; Ludwig, Wolfgang; Schleifer, Karl-Heinz; Whitman, William B; Euzéby, Jean; Amann, Rudolf; Rosselló-Móra, Ramon

    2014-09-01

    Publicly available sequence databases of the small subunit ribosomal RNA gene, also known as 16S rRNA in bacteria and archaea, are growing rapidly, and the number of entries currently exceeds 4 million. However, a unified classification and nomenclature framework for all bacteria and archaea does not yet exist. In this Analysis article, we propose rational taxonomic boundaries for high taxa of bacteria and archaea on the basis of 16S rRNA gene sequence identities and suggest a rationale for the circumscription of uncultured taxa that is compatible with the taxonomy of cultured bacteria and archaea. Our analyses show that only nearly complete 16S rRNA sequences give accurate measures of taxonomic diversity. In addition, our analyses suggest that most of the 16S rRNA sequences of the high taxa will be discovered in environmental surveys by the end of the current decade.

  12. RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

    PubMed

    Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

    2009-07-01

    RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

  13. Measurements of the Exclusive Decays of the {upsilon}(5S) to B Meson Final States and Improved B{sub s}* Mass Measurement

    SciTech Connect

    Aquines, O.; Li, Z.; Lopez, A.; Mendez, H.; Ramirez, J.; Huang, G.S.; Miller, D.H.; Pavlunin, V.; Sanghi, B.; Shipsey, I.P.J.; Xin, B.; Adams, G.S.; Anderson, M.; Cummings, J.P.; Danko, I.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C.S.

    2006-04-21

    Using 420 pb{sup -1} of data collected on the {upsilon}(5S) resonance with the CLEO III detector, we reconstruct B mesons in 25 exclusive decay channels to measure or set upper limits on the decay rate of {upsilon}(5S) into B meson final states. We measure the inclusive B cross section to be {sigma}({upsilon}(5S){yields}BB(X))=(0.177{+-}0.030{+-}0.016) nb and make the first measurements of the production rates of {sigma}({upsilon}(5S){yields}B*B*)=(0.131{+-}0.025{+-}0.014) nb and {sigma}({upsilon}(5S){yields}BB*)=(0.043{+-}0.016{+-}0.006) nb, respectively. We set 90% confidence level limits of {sigma}({upsilon}(5S){yields}BB)<0.038 nb, {sigma}({upsilon}(5S){yields}B{sup (*)}B{sup (*)}{pi})<0.055 nb and {sigma}({upsilon}(5S){yields}BB{pi}{pi})<0.024 nb. We also extract the most precise value of the B{sub s}* mass to date, M(B{sub s}*)=(5411.7{+-}1.6{+-}0.6) MeV/c{sup 2}.

  14. Identification of bovine Neospora parasites by PCR amplification and specific small-subunit rRNA sequence probe hybridization.

    PubMed

    Ho, M S; Barr, B C; Marsh, A E; Anderson, M L; Rowe, J D; Tarantal, A F; Hendrickx, A G; Sverlow, K; Dubey, J P; Conrad, P A

    1996-05-01

    Neospora is a newly recognized genus of pathogenic coccidia, closely related to Toxoplasma gondii, that can cause abortion or congenital disease in a variety of domestic animal hosts. On the basis of the small-subunit rRNA gene sequences of Neospora spp. and other apicomplexa coccidia, oligonucleotide primers COC-1 and COC-2 were used for PCR amplification of conserved sequences of approximately 300 bp in size. A Neospora-specific chemiluminescent probe hybridized to Southern blots of amplification products from Neospora DNA but not to Southern blots with amplified DNA from the other coccidian parasites tested. A Toxoplasma-specific probe whose sequence differed from that of the probe for Neospora spp. by a single base pair was used to distinguish these parasites by specific Southern blot hybridization. The PCR system detected as few as one Neospora tachyzoite in the culture medium or five tachyzoites in samples of whole blood or amniotic fluid spiked with Neospora parasites. In addition, Neospora PCR products were successfully amplified from whole blood and amniotic fluid samples of experimentally infected bovine and rhesus macaque fetuses. These results indicate that this PCR and probe hybridization system could be a valuable adjunct to serology and immunohistochemistry for the diagnosis of Neospora infections in bovine or primate fetuses.

  15. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes.

    PubMed

    Soni, Dharmendra Kumar; Dubey, Suresh Kumar

    2014-12-01

    The discrimination between Listeria monocytogenes and Listeria species has been detected. The 16S rRNA and hlyA were PCR amplified with set of oligonucleotide primers with flank 1,500 and 456 bp fragments, respectively. Based on the differences in 16S rRNA and hlyA genes, a total 80 isolates from different environmental, food and clinical samples confirmed it to be L. monocytogenes. The 16S rRNA sequence similarity suggested that the isolates were similar to the previously reported ones from different habitats by others. The phylogenetic interrelationships of the genus Listeria were investigated by sequencing of 16S rRNA and hlyA gene. The 16S rRNA sequence indicated that genus Listeria is comprised of following closely related but distinct lines of descent, one is the L. monocytogenes species group (including L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) and other, the species L. grayi, L. rocourtiae and L. fleischmannii. The phylogenetic tree based on hlyA gene sequence clearly differentiates between the L. monocytogenes, L. ivanovii and L. seeligeri. In the present study, we identified 80 isolates of L. monocytogenes originating from different clinical, food and environmental samples based on 16S rRNA and hlyA gene sequence similarity.

  16. Interaction of TIF-90 and filamin A in the regulation of rRNA synthesis in leukemic cells.

    PubMed

    Nguyen, Le Xuan Truong; Chan, Steven M; Ngo, Tri Duc; Raval, Aparna; Kim, Kyeong Kyu; Majeti, Ravindra; Mitchell, Beverly S

    2014-07-24

    The transcription initiation factor I (TIF-IA) is an important regulator of the synthesis of ribosomal RNA (rRNA) through its facilitation of the recruitment of RNA polymerase I (Pol I) to the ribosomal DNA promoter. Activation of the phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) pathway, which occurs commonly in acute myelogenous leukemia, enhances rRNA synthesis through TIF-IA stabilization and phosphorylation. We have discovered that TIF-IA coexists with a splicing isoform, TIF-90, which is expressed preferentially in the nucleolus and at higher levels in proliferating and transformed hematopoietic cells. TIF-90 interacts directly with Pol I to increase rRNA synthesis as a consequence of Akt activation. Furthermore, TIF-90 binds preferentially to a 90-kDa cleavage product of the actin binding protein filamin A (FLNA) that inhibits rRNA synthesis. Increased expression of TIF-90 overcomes the inhibitory effect of this cleavage product and stimulates rRNA synthesis. Because activated Akt also reduces FLNA cleavage, these results indicate that activated Akt and TIF-90 function in parallel to increase rRNA synthesis and, as a consequence, cell proliferation in leukemic cells. These results provide evidence that the direct targeting of Akt would be an effective therapy in acute leukemias in which Akt is activated.

  17. Ln3I5(S2N2)(S2)(THF)10 - a new type of molecular compounds.

    PubMed

    Fagin, A A; Fukin, G K; Cherkasov, A V; Shestakov, A F; Pushkarev, A P; Balashova, T V; Maleev, A A; Bochkarev, M N

    2016-03-21

    Unprecedented complexes of the composition Ln3I5(S2N2)(S2)(THF)10 were obtained in the reactions of neodymium and dysprosium iodide-nitrides with sulfur. The inorganic core of the molecules contains the cyclic fragments Ln(μ-S2)Ln, LnSNSN and LnSN. Ten of the fourteen atoms of the core are coplanar, the remaining four S2 and I2 atoms lie in the other two orthogonal planes. The dysprosium complex upon excitation with UV light exhibits the metal-centered luminescence characteristic of the Dy(3+) ion. Geometric parameters of the molecules, computational data, electron spectroscopy and fluorescence suggest the existence of some conjugation in the mentioned heterocycles. PMID:26842841

  18. Appearance and evolution of the specific chromosomal rearrangements associated with malignant transformation of mouse m5S cells

    SciTech Connect

    Kodama, S.; Okumura, Y.; Komatsu, K.; Sasaki, M.S. )

    1991-06-01

    Chromosomal alterations were studied during the acquisition of malignant phenotypes in two karyotypically distinct cells isolated from transformed foci induced by x-irradiation in mouse m5S cells. Because the transformants, despite foci origin, showed low ability to grow in agar, they were cultured in vitro with serial transfer schedules to allow further cell generations and assayed for anchorage independence (AI) at each passage level. The AI frequency increased with the cell doubling numbers. Chromosome analysis showed that a focus was one cell origin, but the transformants showed karyotypic instability during cell proliferation, giving rise to the rearrangements clustered in the distal region of the specific chromosomes. These rearrangements appeared to be directed toward the acquisition of malignant phenotypes. Analysis of the types and sites of rearrangements indicated that a mechanism exists that induces frequent rearrangements of the specific region of a chromosome during the process of transformation into the malignant state.

  19. Fission properties of the 1. 5-s spontaneous fission activity produced in bombardmentof /sup 248/Cm with /sup 18/O

    SciTech Connect

    Hoffman, D.C.; Lee, D.; Ghiorso, A.; Nurmia, M.J.; Aleklett, K.; Leino, M.

    1981-08-01

    We have measured the mass and kinetic-energy distributions of fragments from the spontaneous fission of a 1.5-s activity produced in bombardments of /sup 248/Cm with 95-MeV /sup 18/O ions. Its spontaneous fission decay exhibits a very symmetric, narrow (full width at half maximum = 12 mass units) mass distribution, a very high total kinetic energy of 234 +- 2 MeV, and increasing total kinetic energy with increasingly symmetric mass division. Based on its half-life and the similarity of its fission properties to the unique fission properties so far only observed for /sup 258/Fm and /sup 259/Fm, the most likely assignment of this activity is to the known /sup 259/Fm. However, assignment to some as yet undiscovered neutron-rich heavy element isotope such as /sup 260/Md cannot be unequivocally excluded.

  20. High pressure Raman study of layered Mo0.5W0.5S2 ternary compound

    NASA Astrophysics Data System (ADS)

    Kim, Joon-Seok; Moran, Samuel T.; Nayak, Avinash P.; Pedahzur, Shahar; Ruiz, Itzel; Ponce, Gabriela; Rodriguez, Daniela; Henny, Joanna; Liu, Jin; Lin, Jung-Fu; Akinwande, Deji

    2016-06-01

    Ternary two-dimensional (2D) transition metal dichalcogenide compounds exhibit a tunable electronic structure allowing for control of the interlayer and the intralayer atomic displacement to efficiently tune their physical and electronic properties. Using a diamond anvil cell, hydrostatic pressure was applied to Mo0.5W0.5S2 up to 40 GPa in order to study the optical phonon vibrational modes. Analysis of the high-pressure Raman spectra shows that the two in-plane E2g modes resembling that of pristine MoS2 and WS2, as well as disorder-activated longitudinal acoustic phonon mode, are hardened and suppressed as pressure increases. The two A1g modes of the ternary compound that resemble the A1g modes of pristine MoS2 and WS2, displayed similar Raman shifts to the pristine compounds as pressure increases. A Raman peak at 470 cm-1 that is close to A1g peaks emerges at ˜8 GPa, which represents a disorder-activated pressure-induced out-of-plane Raman mode observed only in the ternary compound under high pressure. At pressures above ˜30 GPa, a Raman peak at approximately 340 cm-1 is observed, signifying additional disorder-activated vibration mode. Our results reveal the enhanced interactions in the structural and vibrational behavior of the MoS2 and WS2 domains in the Mo0.5W0.5S2 compound under hydrostatic pressure. These results could have implications in understanding the electronic, optical, and structural properties of the new 2D ternary compound materials under extreme mechanical conditions.

  1. Analysis, optimization and verification of Illumina-generated 16S rRNA gene amplicon surveys.

    PubMed

    Nelson, Michael C; Morrison, Hilary G; Benjamino, Jacquelynn; Grim, Sharon L; Graf, Joerg

    2014-01-01

    The exploration of microbial communities by sequencing 16S rRNA genes has expanded with low-cost, high-throughput sequencing instruments. Illumina-based 16S rRNA gene sequencing has recently gained popularity over 454 pyrosequencing due to its lower costs, higher accuracy and greater throughput. Although recent reports suggest that Illumina and 454 pyrosequencing provide similar beta diversity measures, it remains to be demonstrated that pre-existing 454 pyrosequencing workflows can transfer directly from 454 to Illumina MiSeq sequencing by simply changing the sequencing adapters of the primers. In this study, we modified 454 pyrosequencing primers targeting the V4-V5 hyper-variable regions of the 16S rRNA gene to be compatible with Illumina sequencers. Microbial communities from cows, humans, leeches, mice, sewage, and termites and a mock community were analyzed by 454 and MiSeq sequencing of the V4-V5 region and MiSeq sequencing of the V4 region. Our analysis revealed that reference-based OTU clustering alone introduced biases compared to de novo clustering, preventing certain taxa from being observed in some samples. Based on this we devised and recommend an analysis pipeline that includes read merging, contaminant filtering, and reference-based clustering followed by de novo OTU clustering, which produces diversity measures consistent with de novo OTU clustering analysis. Low levels of dataset contamination with Illumina sequencing were discovered that could affect analyses that require highly sensitive approaches. While moving to Illumina-based sequencing platforms promises to provide deeper insights into the breadth and function of microbial diversity, our results show that care must be taken to ensure that sequencing and processing artifacts do not obscure true microbial diversity. PMID:24722003

  2. Multi-site-specific 16S rRNA Methyltransferase RsmF from Thermus thermophilus

    SciTech Connect

    Demirci, H.; Larsen, L; Hansen, T; Rasmussen, A; Cadambi, A; Gregory, S; Kirpekar, F; Jogl, G

    2010-01-01

    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m{sup 5}C) modifications in 16S rRNA of Thermus thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m{sup 5}C967. In contrast to E. coli RsmF, which introduces a single m{sup 5}C1407 modification, T. thermophilus RsmF modifies three positions, generating m{sup 5}C1400 and m{sup 5}C1404 in addition to m{sup 5}C1407. These three residues are clustered near the decoding site of the ribosome, but are situated in distinct structural contexts, suggesting a requirement for flexibility in the RsmF active site that is absent from the E. coli enzyme. Two of these residues, C1400 and C1404, are sufficiently buried in the mature ribosome structure so as to require extensive unfolding of the rRNA to be accessible to RsmF. In vitro, T. thermophilus RsmF methylates C1400, C1404, and C1407 in a 30S subunit substrate, but only C1400 and C1404 when naked 16S rRNA is the substrate. The multispecificity of T. thermophilus RsmF is potentially explained by three crystal structures of the enzyme in a complex with cofactor S-adenosyl-methionine at up to 1.3 {angstrom} resolution. In addition to confirming the overall structural similarity to E. coli RsmF, these structures also reveal that key segments in the active site are likely to be dynamic in solution, thereby expanding substrate recognition by T. thermophilus RsmF.

  3. Comparative analysis of dinoflagellate chloroplast genomes reveals rRNA and tRNA genes

    PubMed Central

    Barbrook, Adrian C; Santucci, Nicole; Plenderleith, Lindsey J; Hiller, Roger G; Howe, Christopher J

    2006-01-01

    Background Peridinin-containing dinoflagellates have a highly reduced chloroplast genome, which is unlike that found in other chloroplast containing organisms. Genome reduction appears to be the result of extensive transfer of genes to the nuclear genome. Unusually the genes believed to be remaining in the chloroplast genome are found on small DNA 'minicircles'. In this study we present a comparison of sets of minicircle sequences from three dinoflagellate species. Results PCR was used to amplify several minicircles from Amphidinium carterae so that a homologous set of gene-containing minicircles was available for Amphidinium carterae and Amphidinium operculatum, two apparently closely related peridinin-containing dinoflagellates. We compared the sequences of these minicircles to determine the content and characteristics of their chloroplast genomes. We also made comparisons with minicircles which had been obtained from Heterocapsa triquetra, another peridinin-containing dinoflagellate. These in silico comparisons have revealed several genetic features which were not apparent in single species analyses. The features include further protein coding genes, unusual rRNA genes, which we show are transcribed, and the first examples of tRNA genes from peridinin-containing dinoflagellate chloroplast genomes. Conclusion Comparative analysis of minicircle sequences has allowed us to identify previously unrecognised features of dinoflagellate chloroplast genomes, including additional protein and RNA genes. The chloroplast rRNA gene sequences are radically different from those in other organisms, and in many ways resemble the rRNA genes found in some highly reduced mitochondrial genomes. The retention of certain tRNA genes in the dinoflagellate chloroplast genome has important implications for models of chloroplast-mitochondrion interaction. PMID:17123435

  4. Analysis, Optimization and Verification of Illumina-Generated 16S rRNA Gene Amplicon Surveys

    PubMed Central

    Nelson, Michael C.; Morrison, Hilary G.; Benjamino, Jacquelynn; Grim, Sharon L.; Graf, Joerg

    2014-01-01

    The exploration of microbial communities by sequencing 16S rRNA genes has expanded with low-cost, high-throughput sequencing instruments. Illumina-based 16S rRNA gene sequencing has recently gained popularity over 454 pyrosequencing due to its lower costs, higher accuracy and greater throughput. Although recent reports suggest that Illumina and 454 pyrosequencing provide similar beta diversity measures, it remains to be demonstrated that pre-existing 454 pyrosequencing workflows can transfer directly from 454 to Illumina MiSeq sequencing by simply changing the sequencing adapters of the primers. In this study, we modified 454 pyrosequencing primers targeting the V4-V5 hyper-variable regions of the 16S rRNA gene to be compatible with Illumina sequencers. Microbial communities from cows, humans, leeches, mice, sewage, and termites and a mock community were analyzed by 454 and MiSeq sequencing of the V4-V5 region and MiSeq sequencing of the V4 region. Our analysis revealed that reference-based OTU clustering alone introduced biases compared to de novo clustering, preventing certain taxa from being observed in some samples. Based on this we devised and recommend an analysis pipeline that includes read merging, contaminant filtering, and reference-based clustering followed by de novo OTU clustering, which produces diversity measures consistent with de novo OTU clustering analysis. Low levels of dataset contamination with Illumina sequencing were discovered that could affect analyses that require highly sensitive approaches. While moving to Illumina-based sequencing platforms promises to provide deeper insights into the breadth and function of microbial diversity, our results show that care must be taken to ensure that sequencing and processing artifacts do not obscure true microbial diversity. PMID:24722003

  5. Phylogeny of the Centrohelida inferred from SSU rRNA, tubulins, and actin genes.

    PubMed

    Sakaguchi, Miako; Nakayama, Takeshi; Hashimoto, Tetsuo; Inouye, Isao

    2005-12-01

    Amoeboid protists are major targets of recent molecular phylogeny in connection with reconstruction of global phylogeny of eukaryotes as well as the search for the root of eukaryotes. The Centrohelida are one of the major groups of Heliozoa, classified in the Actinopodida, whose evolutionary position is not well understood. To clarify the relationships between the Centrohelida and other eukaryotes, we sequenced SSU rRNA, alpha-tubulin, and beta-tubulin genes from a centroheliozoan protist, Raphidiophrys contractilis. The SSU rRNA phylogeny showed that the Centrohelida are not closely related to other heliozoan groups, Actinophryida, Desmothoracida, or Taxopodida. Maximum likelihood analyses of the combined phylogeny using a concatenate model for an alpha- + beta-tubulin + actin data set, and a separate model for SSU rRNA, alpha- and beta-tubulin, and actin gene data sets revealed the best tree, in which the Centrohelida have a closer relationship to Rhodophyta than to other major eukaryotic groups. However, both weighted Shimodaira-Hasegawa and approximately unbiased tests for the concatenate protein phylogeny did not reject alternative trees in which Centrohelida were constrained to be sisters to the Amoebozoa. Moreover, alternative trees in which Centrohelida were placed at the node branching before and after Amoebozoa or Viridiplantae were not rejected by the WSH tests. These results narrowed the possibilities for the position of Centrohelida to a sister to the Rhodophyta, to the Amoebozoa, or to an independent branch between the branchings of Amoebozoa and Rhodophyta (or possibly Plantae) at the basal position within the bikonts clade in the eukaryotic tree.

  6. Bacillus nanhaiisediminis sp. nov., an alkalitolerant member of Bacillus rRNA group 6.

    PubMed

    Zhang, Jianli; Wang, Jiewei; Song, Fei; Fang, Caiyuan; Xin, Yuhua; Zhang, Yabo

    2011-05-01

    A Gram-stain-positive, rod-shaped bacterium, designated strain NH3(T), was isolated from a sediment sample from the South China Sea and was subjected to a polyphasic taxonomic study. The isolate grew optimally at 37 °C and pH 9. Strain NH3(T) had cell-wall peptidoglycan based on meso-diaminopimelic acid and MK-7 as the predominant menaquinone. The cellular fatty acid profile included significant amounts of iso-C(15 : 0) and iso-C(14 : 0). The major polar lipids were phosphatidylethanolamine, phosphatidylglycerol and diphosphatidylglycerol. The DNA G+C content of strain NH3(T) was 40.3 mol%. Phylogenetic analysis of the 16S rRNA gene sequence revealed that strain NH3(T) was a member of rRNA group 6 of the genus Bacillus, which includes alkalitolerant, alkaliphilic and halotolerant species. The closest phylogenetic relatives were Bacillus akibai 1139(T) (96.82 % 16S rRNA gene sequence similarity), B. pseudofirmus DSM 8715(T) (96.76 %), B. okhensis Kh10-101(T) (96.76 %) and B. alkalidiazotrophicus MS 6(T) (96.47 %). Strain NH3(T) could be distinguished from these phylogenetically close neighbours based on a number of phenotypic properties. On the basis of phenotypic and chemotaxonomic characteristics and phylogenetic data, we conclude that strain NH3(T) ( = CGMCC 1.10116(T)  = JCM 16507(T)) merits classification as the type strain of a novel species, for which the name Bacillus nanhaiisediminis sp. nov. is proposed.

  7. Greengenes, a Chimera-checked 16S rRNA gene database and workbenchcompatible with ARB

    SciTech Connect

    DeSantis, Todd Z.; Hugenholtz, Philip; Larsen, Neils; Rojas,Mark; Brodie, Eoin L.; Keller, Keith; Huber, Thomas; Dalevi, Daniel; Hu,Ping; Andersen, Gary L.

    2006-04-10

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that in congruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3 percent of environmental sequences and 0.2 percent of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  8. Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

    NASA Technical Reports Server (NTRS)

    Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1991-01-01

    Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

  9. Evolutionary diversity of eukaryotic small-subunit rRNA genes.

    PubMed

    Sogin, M L; Elwood, H J; Gunderson, J H

    1986-03-01

    The small-subunit rRNA gene sequences of the flagellated protists Euglena gracilis and Trypanosoma brucei were determined and compared to those of other eukaryotes. A phylogenetic tree was constructed in which the earliest branching among the eukaryotes is represented by E. gracilis. The E. gracilis divergence far antedates a period of massive evolutionary radiation that gave rise to the plants, animals, fungi, and certain groups of protists such as ciliates and the acanthamoebae. The genetic diversity in this collection of eukaryotes is seen to exceed that displayed within either the eubacterial or the archaebacterial lines of descent.

  10. Novel Acanthamoeba 18S rRNA gene sequence type from an environmental isolate.

    PubMed

    Magnet, A; Henriques-Gil, N; Galván-Diaz, A L; Izquiedo, F; Fenoy, S; del Aguila, C

    2014-08-01

    The free-living amoebae, Acanthamoeba, can act as opportunistic parasites on a wide range of vertebrates and are becoming a serious threat to human health due to the resistance of their cysts to harsh environmental conditions, disinfectants, some water treatment practices, and their ubiquitous distribution. Subgenus classification based on morphology is being replaced by a classification based on the sequences of the 18S rRNA gene with a total of 18 different genotypes (T1-T18). A new environmental strain of Acanthamoeba isolated from a waste water treatment plant is presented in this study as a candidate for the description of the novel genotype T19 after phylogenetic analysis.

  11. Comparison of MALDI-TOF MS, Housekeeping Gene Sequencing, and 16S rRNA Gene Sequencing for Identification of Aeromonas Clinical Isolates

    PubMed Central

    Shin, Hee Bong; Yoon, Jihoon; Lee, Yangsoon; Kim, Myung Sook

    2015-01-01

    Purpose The genus Aeromonas is a pathogen that is well known to cause severe clinical illnesses, ranging from gastroenteritis to sepsis. Accurate identification of A. hydrophila, A. caviae, and A. veronii is important for the care of patients. However, species identification remains difficult using conventional methods. The aim of this study was to compare the accuracy of different methods of identifying Aeromonas at the species level: a biochemical method, matrix-assisted laser desorption ionization mass spectrometry-time of flight (MALDI-TOF MS), 16S rRNA sequencing, and housekeeping gene sequencing (gyrB, rpoB). Materials and Methods We analyzed 65 Aeromonas isolates recovered from patients at a university hospital in Korea between 1996 and 2012. The isolates were recovered from frozen states and tested using the following four methods: a conventional biochemical method, 16S rRNA sequencing, housekeeping gene sequencing with phylogenetic analysis, and MALDI-TOF MS. Results The conventional biochemical method and 16S rRNA sequencing identified Aeromonas at the genus level very accurately, although species level identification was unsatisfactory. MALDI-TOF MS system correctly identified 60 (92.3%) isolates at the species level and an additional four (6.2%) at the genus level. Overall, housekeeping gene sequencing with phylogenetic analysis was found to be the most accurate in identifying Aeromonas at the species level. Conclusion The most accurate method of identification of Aeromonas to species level is by housekeeping gene sequencing, although high cost and technical difficulty hinder its usage in clinical settings. An easy-to-use identification method is needed for clinical laboratories, for which MALDI-TOF MS could be a strong candidate. PMID:25684008

  12. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.

    PubMed

    Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

    2016-01-01

    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA

  13. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment

    PubMed Central

    Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

    2016-01-01

    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in

  14. Intragenomic heterogeneity and intergenomic recombination among Vibrio parahaemolyticus 16S rRNA genes.

    PubMed

    Harth, Erika; Romero, Jaime; Torres, Rafael; Espejo, Romilio T

    2007-08-01

    Vibrio parahaemolyticus is a marine bacterium bearing 11 copies of ribosomal operons. In some strains, such as RIMD2210633, the genome includes identical copies of 16S rRNA genes (rrs). However, it is known that other strains of the species, such as strains ATCC 17802 and RIMD2210856, show conspicuous intragenomic rrs heterogeneity. The extent and diversity of the rrs heterogeneity in V. parahaemolyticus were studied in further detail by characterization of the rrs copies in environmental isolates belonging to 21 different genotype groups. Thirteen of these groups showed intragenomic heterogeneity, containing altogether 16 sequences differing within a 25 bp segment of their rrs. These sequences grouped into four clusters differing in at least four nucleotide sites. Some isolates contained rrs alleles from up to three different clusters. Each segment sequence conserved the stem-loop characteristic of the 16S rRNA structure of this 25 bp sequence. The double-stranded stem sequence was quite variable, but almost every variation had a compensatory change to maintain seven to eight paired bases. Conversely, the single-strand loop sequence was conserved. The results may be explained as a consequence of recombination among rrs evolving in different bacteria. The results suggest that intergenomic rrs recombination is very high in V. parahaemolyticus and that it occurs solely among Vibrio species. This high rrs homologous intergenomic recombination could be an effective mechanism to maintain intragenomic rrs cohesion, mediating the dispersal of the most abundant rrs version among the 11 intragenomic loci. PMID:17660428

  15. A network of assembly factors is involved in remodeling rRNA elements during preribosome maturation

    PubMed Central

    Baßler, Jochen; Paternoga, Helge; Holdermann, Iris; Thoms, Matthias; Granneman, Sander; Barrio-Garcia, Clara; Nyarko, Afua; Stier, Gunter; Clark, Sarah A.; Schraivogel, Daniel; Kallas, Martina; Beckmann, Roland; Tollervey, David

    2014-01-01

    Eukaryotic ribosome biogenesis involves ∼200 assembly factors, but how these contribute to ribosome maturation is poorly understood. Here, we identify a network of factors on the nascent 60S subunit that actively remodels preribosome structure. At its hub is Rsa4, a direct substrate of the force-generating ATPase Rea1. We show that Rsa4 is connected to the central protuberance by binding to Rpl5 and to ribosomal RNA (rRNA) helix 89 of the nascent peptidyl transferase center (PTC) through Nsa2. Importantly, Nsa2 binds to helix 89 before relocation of helix 89 to the PTC. Structure-based mutations of these factors reveal the functional importance of their interactions for ribosome assembly. Thus, Rsa4 is held tightly in the preribosome and can serve as a “distribution box,” transmitting remodeling energy from Rea1 into the developing ribosome. We suggest that a relay-like factor network coupled to a mechano-enzyme is strategically positioned to relocate rRNA elements during ribosome maturation. PMID:25404745

  16. PCR-based diversity estimates of artificial and environmental 18S rRNA gene libraries.

    PubMed

    Potvin, Marianne; Lovejoy, Connie

    2009-01-01

    Environmental clone libraries constructed using small subunit ribosomal RNA (rRNA) or other gene-specific primers have become the standard molecular approach for identifying microorganisms directly from their environment. This technique includes an initial polymerase chain reaction (PCR) amplification step of a phylogenetically useful marker gene using universal primers. Although it is acknowledged that such primers introduce biases, there have been few studies if any to date systematically examining such bias in eukaryotic microbes. We investigated some implications of such bias by constructing clone libraries using several universal primer pairs targeting rRNA genes. Firstly, we constructed artificial libraries using a known mix of small cultured pelagic arctic algae with representatives from five major lineages and secondly we investigated environmental samples using several primer pairs. No primer pair retrieved all of the original algae in the artificial clone libraries and all showed a favorable bias toward the dinoflagellate Polarella glacialis and a bias against the prasinophyte Micromonas and a pennate diatom. Several other species were retrieved by only one primer pair tested. Despite this, sequences from nine environmental libraries were diverse and contained representatives from all major eukaryotic clades expected in marine samples. Further, libraries from the same sample grouped together using Bray-Curtis clustering, irrespective of primer pairs. We conclude that environmental PCR-based techniques are sufficient to compare samples, but the total diversity will probably always be underestimated and relative abundance estimates should be treated with caution.

  17. Greengenes: 16S rRNA Database and Workbench Compatible with ARB

    DOE Data Explorer

    DeSantis, T. Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie, E. L.; Keller, K.; Huber, T.; Dalevi, D. Hu, P. Andersen, G. L.

    Greengenes was developed, as the abstract of an AEM reprint states, to "addresse limitations of public repositories by providing chimera screening, standard alignment, and taxonomic classification using multiple published taxonomies. It was found that there is incongruent taxonomic nomenclature among curators even at the phylum level. Putative chimeras were identified in 3% of environmental sequences and in 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages in the Archaea and Bacteria....Greengenes is also a functional workbench to assist in analysis of user-generated 16S rRNA gene sequences. Batches of sequencing reads can be uploaded for quality-based trimming and creation of multiple-sequence alignments (9). Three types of non-MSA similarity searches are also available, seed extension by BLAST (1), similarity based on shared 7-mers by a tool called Simrank, and a direct degenerative pattern match for probe/primer evaluation. Results are displayed using user-preferred taxonomic nomenclature and can be saved between sessions. [Taken from DeSantis, T. Z., P. Hugenholtz, N. Larsen, M. Rojas, E. L. Brodie, K. Keller, T. Huber, D. Dalevi, P. Hu, and G. L. Andersen. 2006. Greengenes, a Chimera-Checked 16S rRNA Gene Database and Workbench Compatible with ARB. Appl Environ Microbiol 72:5069-72, pages 1 and 3] (Specialized Interface)

  18. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-08-24

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon.

  19. A network of assembly factors is involved in remodeling rRNA elements during preribosome maturation.

    PubMed

    Baßler, Jochen; Paternoga, Helge; Holdermann, Iris; Thoms, Matthias; Granneman, Sander; Barrio-Garcia, Clara; Nyarko, Afua; Lee, Woonghee; Stier, Gunter; Clark, Sarah A; Schraivogel, Daniel; Kallas, Martina; Beckmann, Roland; Tollervey, David; Barbar, Elisar; Sinning, Irmi; Hurt, Ed

    2014-11-24

    Eukaryotic ribosome biogenesis involves ∼200 assembly factors, but how these contribute to ribosome maturation is poorly understood. Here, we identify a network of factors on the nascent 60S subunit that actively remodels preribosome structure. At its hub is Rsa4, a direct substrate of the force-generating ATPase Rea1. We show that Rsa4 is connected to the central protuberance by binding to Rpl5 and to ribosomal RNA (rRNA) helix 89 of the nascent peptidyl transferase center (PTC) through Nsa2. Importantly, Nsa2 binds to helix 89 before relocation of helix 89 to the PTC. Structure-based mutations of these factors reveal the functional importance of their interactions for ribosome assembly. Thus, Rsa4 is held tightly in the preribosome and can serve as a "distribution box," transmitting remodeling energy from Rea1 into the developing ribosome. We suggest that a relay-like factor network coupled to a mechano-enzyme is strategically positioned to relocate rRNA elements during ribosome maturation.

  20. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  1. Comparison of two approaches for the classification of 16S rRNA gene sequences.

    PubMed

    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan

    2014-10-01

    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods.

  2. Detection of bacterial 16S rRNA using a molecular beacon-based X sensor.

    PubMed

    Gerasimova, Yulia V; Kolpashchikov, Dmitry M

    2013-03-15

    We demonstrate how a long structurally constrained RNA can be analyzed in homogeneous solution at ambient temperatures with high specificity using a sophisticated biosensor. The sensor consists of a molecular beacon probe as a signal reporter and two DNA adaptor strands, which have fragments complementary to the reporter and to the analyzed RNA. One adaptor strand uses its long RNA-binding arm to unwind the RNA secondary structure. Second adaptor strand with a short RNA-binding arm hybridizes only to a completely complementary site, thus providing high recognition specificity. Overall the three-component sensor and the target RNA form a four-stranded DNA crossover (X) structure. Using this sensor, Escherichia coli16S rRNA was detected in real time with the detection limit of ~0.17 nM. The high specificity of the analysis was proven by differentiating Bacillus subtilis from E. coli 16S rRNA sequences. The sensor responds to the presence of the analyte within seconds.

  3. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation

    PubMed Central

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G.; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S. Kundhavai; Klaholz, Bruno P.; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  4. Potential applications of next generation DNA sequencing of 16S rRNA gene amplicons in microbial water quality monitoring.

    PubMed

    Vierheilig, J; Savio, D; Ley, R E; Mach, R L; Farnleitner, A H; Reischer, G H

    2015-01-01

    The applicability of next generation DNA sequencing (NGS) methods for water quality assessment has so far not been broadly investigated. This study set out to evaluate the potential of an NGS-based approach in a complex catchment with importance for drinking water abstraction. In this multi-compartment investigation, total bacterial communities in water, faeces, soil, and sediment samples were investigated by 454 pyrosequencing of bacterial 16S rRNA gene amplicons to assess the capabilities of this NGS method for (i) the development and evaluation of environmental molecular diagnostics, (ii) direct screening of the bulk bacterial communities, and (iii) the detection of faecal pollution in water. Results indicate that NGS methods can highlight potential target populations for diagnostics and will prove useful for the evaluation of existing and the development of novel DNA-based detection methods in the field of water microbiology. The used approach allowed unveiling of dominant bacterial populations but failed to detect populations with low abundances such as faecal indicators in surface waters. In combination with metadata, NGS data will also allow the identification of drivers of bacterial community composition during water treatment and distribution, highlighting the power of this approach for monitoring of bacterial regrowth and contamination in technical systems. PMID:26606090

  5. Potential applications of next generation DNA sequencing of 16S rRNA gene amplicons in microbial water quality monitoring.

    PubMed

    Vierheilig, J; Savio, D; Ley, R E; Mach, R L; Farnleitner, A H; Reischer, G H

    2015-01-01

    The applicability of next generation DNA sequencing (NGS) methods for water quality assessment has so far not been broadly investigated. This study set out to evaluate the potential of an NGS-based approach in a complex catchment with importance for drinking water abstraction. In this multi-compartment investigation, total bacterial communities in water, faeces, soil, and sediment samples were investigated by 454 pyrosequencing of bacterial 16S rRNA gene amplicons to assess the capabilities of this NGS method for (i) the development and evaluation of environmental molecular diagnostics, (ii) direct screening of the bulk bacterial communities, and (iii) the detection of faecal pollution in water. Results indicate that NGS methods can highlight potential target populations for diagnostics and will prove useful for the evaluation of existing and the development of novel DNA-based detection methods in the field of water microbiology. The used approach allowed unveiling of dominant bacterial populations but failed to detect populations with low abundances such as faecal indicators in surface waters. In combination with metadata, NGS data will also allow the identification of drivers of bacterial community composition during water treatment and distribution, highlighting the power of this approach for monitoring of bacterial regrowth and contamination in technical systems.

  6. Case of Localized Recombination in 23S rRNA Genes from Divergent Bradyrhizobium Lineages Associated with Neotropical Legumes

    PubMed Central

    Parker, Matthew A.

    2001-01-01

    Enzyme electrophoresis and rRNA sequencing were used to analyze relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legumes (Clitoria javitensis, Erythrina costaricensis, Rhynchosia pyramidalis, and Desmodium axillare) growing on Barro Colorado Island (BCI), Panama. Bacteria with identical multilocus allele profiles were commonly found in association with two or more legume genera. Among the 16 multilocus genotypes (electrophoretic types [ETs]) detected, six ETs formed a closely related cluster that included isolates from all four legume taxa. Bacteria from two other BCI legumes (Platypodium and Machaerium) sampled in a previous study were also identical to certain ETs in this group. Isolates from different legume genera that had the same ET had identical nucleotide sequences for both a 5′ portion of the 23S rRNA and the nearly full-length 16S rRNA genes. These results suggest that Bradyrhizobium genotypes with low host specificity may be prevalent in this tropical forest. Parsimony analysis of 16S rRNA sequence variation indicated that most isolates were related to Bradyrhizobium japonicum USDA 110, although one ET sampled from C. javitensis had a 16S rRNA gene highly similar to that of Bradyrhizobium elkanii USDA 76. However, this isolate displayed a mosaic structure within the 5′ 23S rRNA region: one 84-bp segment was identical to that of BCI isolate Pe1-3 (a close relative of B. japonicum USDA 110, based on 16S rRNA data), while an adjacent 288-bp segment matched that of B. elkanii USDA 76. This mosaic structure is one of the first observations suggesting recombination in nature between Bradyrhizobium isolates related to B. japonicum versus B. elkanii. PMID:11319084

  7. Case of localized recombination in 23S rRNA genes from divergent bradyrhizobium lineages associated with neotropical legumes.

    PubMed

    Parker, M A

    2001-05-01

    Enzyme electrophoresis and rRNA sequencing were used to analyze relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legumes (Clitoria javitensis, Erythrina costaricensis, Rhynchosia pyramidalis, and Desmodium axillare) growing on Barro Colorado Island (BCI), Panama. Bacteria with identical multilocus allele profiles were commonly found in association with two or more legume genera. Among the 16 multilocus genotypes (electrophoretic types [ETs]) detected, six ETs formed a closely related cluster that included isolates from all four legume taxa. Bacteria from two other BCI legumes (Platypodium and Machaerium) sampled in a previous study were also identical to certain ETs in this group. Isolates from different legume genera that had the same ET had identical nucleotide sequences for both a 5' portion of the 23S rRNA and the nearly full-length 16S rRNA genes. These results suggest that Bradyrhizobium genotypes with low host specificity may be prevalent in this tropical forest. Parsimony analysis of 16S rRNA sequence variation indicated that most isolates were related to Bradyrhizobium japonicum USDA 110, although one ET sampled from C. javitensis had a 16S rRNA gene highly similar to that of Bradyrhizobium elkanii USDA 76. However, this isolate displayed a mosaic structure within the 5' 23S rRNA region: one 84-bp segment was identical to that of BCI isolate Pe1-3 (a close relative of B. japonicum USDA 110, based on 16S rRNA data), while an adjacent 288-bp segment matched that of B. elkanii USDA 76. This mosaic structure is one of the first observations suggesting recombination in nature between Bradyrhizobium isolates related to B. japonicum versus B. elkanii.

  8. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  9. Modified Method of rRNA Structure Analysis Reveals Novel Characteristics of Box C/D RNA Analogues.

    PubMed

    Filippova, J A; Stepanov, G A; Semenov, D V; Koval, O A; Kuligina, E V; Rabinov, I V; Richter, V A

    2015-01-01

    Ribosomal RNA (rRNA) maturation is a complex process that involves chemical modifications of the bases or sugar residues of specific nucleotides. One of the most abundant types of rRNA modifications, ribose 2'-O-methylation, is guided by ribonucleoprotein complexes containing small nucleolar box C/D RNAs. Since the majority of 2'-O-methylated nucleotides are located in the most conserved regions of rRNA that comprise functionally important centers of the ribosome, an alteration in a 2'-O-methylation profile can affect ribosome assembly and function. One of the key approaches for localization of 2'-O-methylated nucleotides in long RNAs is a method based on the termination of reverse transcription. The current study presents an adaptation of this method for the use of fluorescently labeled primers and analysis of termination products by capillary gel electrophoresis on an automated genetic analyzer. The developed approach allowed us to analyze the influence of the synthetic analogues of box C/D RNAs on post-transcriptional modifications of human 28S rRNA in MCF-7 cells. It has been established that the transfection of MCF-7 cells with a box C/D RNA analogue leads to an enhanced modification level of certain native sites of 2'-O-methylation in the target rRNA. The observed effect of synthetic RNAs on the 2'-O-methylation of rRNA in human cells demonstrates a path towards targeted regulation of rRNA post-transcriptional maturation. The described approach can be applied in the development of novel diagnostic methods for detecting diseases in humans. PMID:26085946

  10. Identification and absolute configuration of dihydroxy-arachidonic acids formed by oxygenation of 5S-HETE by native and aspirin-acetylated COX-2.

    PubMed

    Mulugeta, Surafel; Suzuki, Takashi; Hernandez, Noemi Tejera; Griesser, Markus; Boeglin, William E; Schneider, Claus

    2010-03-01

    Biosynthesis of the prostaglandin endoperoxide by the cyclooxygenase (COX) enzymes is accompanied by formation of a small amount of 11R-hydroxyeicosatetraenoic acid (HETE), 15R-HETE, and 15S-HETE as by-products. Acetylation of COX-2 by aspirin abrogates prostaglandin synthesis and triggers formation of 15R-HETE as the sole product of oxygenation of arachidonic acid. Here, we investigated the formation of by-products of the transformation of 5S-HETE by native COX-2 and by aspirin-acetylated COX-2 using HPLC-ultraviolet, GC-MS, and LC-MS analysis. 5S,15S- dihydroxy (di)HETE, 5S,15R-diHETE, and 5S,11R-diHETE were identified as by-products of native COX-2, in addition to the previously described di-endoperoxide (5S,15S-dihydroxy-9S,11R,8S,12S-diperoxy-6E,13E-eicosadienoic acid) as the major oxygenation product. 5S,15R-diHETE was the only product formed by aspirin-acetylated COX-2. Both 5,15-diHETE and 5,11-diHETE were detected in CT26 mouse colon carcinoma cells as well as in lipopolysaccharide-activated RAW264.7 cells incubated with 5S-HETE, and their formation was attenuated in the presence of the COX-2 specific inhibitor, NS-398. Aspirin-treated CT26 cells gave 5,15-diHETE as the most prominent product formed from 5S-HETE. 5S,15S-diHETE has been described as a product of the cross-over of 5-lipoxygenase (5-LOX) and 15-LOX activities in elicited rat mononuclear cells and human leukocytes, and our studies implicate cross-over of the 5-LOX and COX-2 pathways as an additional biosynthetic route.

  11. Radiation-modified structure of Ge25Sb15S60 and Ge35Sb5S60 glasses.

    PubMed

    Kavets