Science.gov

Sample records for 5s rrna transcription

  1. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  2. Accurate transcription of homologous 5S rRNA and tRNA genes and splicing of tRNA in vitro by soluble extracts of Neurospora.

    PubMed Central

    Tyler, B M; Giles, N H

    1984-01-01

    We have developed soluble extracts from Neurospora crassa capable of accurately and efficiently transcribing homologous 5S rRNA and tRNA genes. The extracts also appear to quantitatively end-process and splice the primary tRNA transcripts. Although the extracts could not transcribe a heterologous (yeast) 5S rRNA gene, they did transcribe a yeast tRNALeu gene and slowly process the transcripts. In addition, we have developed a novel strategy for rapidly sequencing uniformly labelled RNAs using base-specific ribonucleases. We have used this procedure to verify the identity of the in vitro transcripts and processing products. Images PMID:6235482

  3. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    PubMed

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  4. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    PubMed Central

    Durovic, P; Kutay, U; Schleper, C; Dennis, P P

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-coding sequence. This result suggests that the primary transcript of the 5S rRNA gene corresponds in length (within 1 or 2 nucleotides) to the mature 5S rRNA sequence found in 50S ribosomal subunits. Images PMID:8288546

  5. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  6. Evidence for the presence of 5S rRNA in mammalian mitochondria.

    PubMed

    Magalhães, P J; Andreu, A L; Schon, E A

    1998-09-01

    Mammalian mitochondrial ribosomes contain two prokaryotic-like rRNAs, 12S and 16S, both encoded by mitochondrial DNA. As opposed to cytosolic ribosomes, however, these ribosomes are not thought to contain 5S rRNA. For this reason, it has been unclear whether 5S rRNA, which can be detected in mitochondrial preparations, is an authentic organellar species imported from the cytosol or is merely a copurifying cytosol-derived contaminant. We now show that 5S rRNA is tightly associated with highly purified mitochondrial fractions of human and rat cells and that 5S rRNA transcripts derived from a synthetic gene transfected transiently into human cells are both expressed in vivo and present in highly purified mitochondria and mitoplasts. We conclude that 5S rRNA is imported into mammalian mitochondria, but its function there still remains to be clarified. PMID:9725900

  7. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  8. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families. PMID:25315165

  9. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  10. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  11. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  12. Diversity of 5S rRNA genes within individual prokaryotic genomes

    PubMed Central

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V.; Parsons, Tamasha; Yang, Liying; Gerz, Erika A.; Lee, Peng; Xiang, Charlie; Nossa, Carlos W.; Pei, Zhiheng

    2012-01-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1168 genomes from 779 unique species, 96 species exhibited >3% diversity. Twenty seven species with >10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there were tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. There is supplementary material. PMID:22765222

  13. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment. PMID:22724546

  14. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    PubMed

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  15. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  16. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  17. 5 S Rrna Is Involved in Fidelity of Translational Reading Frame

    PubMed Central

    Dinman, J. D.; Wickner, R. B.

    1995-01-01

    Chromosomal mutants (maintenance of frame = mof) in which the efficiency of -1 ribosomal frame-shifting is increased can be isolated using constructs in which lacZ expression is dependent upon a -1 shift of reading frame. We isolate a new mof mutation, mof9, in Saccharomyces cerevisiae and show that it is complemented by both single and multi-copy 5 S rDNA clones. Two independent insertion mutations in the rDNA locus (rDNA::LEU2 and rDNA::URA3) also display the Mof(-) phenotype and are also complemented by single and multi-copy 5 S rDNA clones. Mutant 5 S rRNAs expressed from a plasmid as 20-50% of total 5 S rRNA in a wild-type host also induced the Mof(-) phenotype. The increase in frameshifting is greatest when the lacZ reporter gene is expressed on a high copy, episomal vector. No differences were found in 5 S rRNA copy number or electrophoretic mobilities in mof9 strains. Both mof9 and rDNA::LEU2 increase the efficiency of +1 frameshifting as well but have no effect on readthrough of UAG or UAA termination codons, indicating that not all translational specificity is affected. These data suggest a role for 5 S rRNA in the maintenance of frame in translation. PMID:8536994

  18. Phylogenetic analysis of the genera Thiobacillus and Thiomicrospira by 5S rRNA sequences.

    PubMed Central

    Lane, D J; Stahl, D A; Olsen, G J; Heller, D J; Pace, N R

    1985-01-01

    5S rRNA nucleotide sequences from Thiobacillus neapolitanus, Thiobacillus ferrooxidans, Thiobacillus thiooxidans, Thiobacillus intermedius, Thiobacillus perometabolis, Thiobacillus thioparus, Thiobacillus versutus, Thiobacillus novellus, Thiobacillus acidophilus, Thiomicrospira pelophila, Thiomicrospira sp. strain L-12, and Acidiphilium cryptum were determined. A phylogenetic tree, based upon comparison of these and other related 5S rRNA sequences, is presented. The results place the thiobacilli, Thiomicrospira spp., and Acidiphilium spp. in the "purple photosynthetic" bacterial grouping which also includes the enteric, vibrio, pseudomonad, and other familiar eubacterial groups in addition to the purple photosynthetic bacteria. The genus Thiobacillus is not an evolutionarily coherent grouping but rather spans the full breadth of the purple photosynthetic bacteria. PMID:3924899

  19. Construction of the mycoplasma evolutionary tree from 5S rRNA sequence data.

    PubMed Central

    Rogers, M J; Simmons, J; Walker, R T; Weisburg, W G; Woese, C R; Tanner, R S; Robinson, I M; Stahl, D A; Olsen, G; Leach, R H

    1985-01-01

    The 5S rRNA sequences of eubacteria and mycoplasmas have been analyzed and a phylogenetic tree constructed. We determined the sequences of 5S rRNA from Clostridium innocuum, Acholeplasma laidlawii, Acholeplasma modicum, Anaeroplasma bactoclasticum, Anaeroplasma abactoclasticum, Ureaplasma urealyticum, Mycoplasma mycoides mycoides, Mycoplasma pneumoniae, and Mycoplasma gallisepticum. Analysis of these and published sequences shows that mycoplasmas form a coherent phylogenetic group that, with C. innocuum, arose as a branch of the low G+C Gram-positive tree, near the lactobacilli and streptococci. The initial event in mycoplasma phylogeny was formation of the Acholeplasma branch; hence, loss of cell wall probably occurred at the time of genome reduction to approximately to 1000 MDa. A subsequent branch produced the Spiroplasma. This branch appears to have been the origin of sterol-requiring mycoplasmas. During development of the Spiroplasma branch there were several independent genome reductions, each to approximately 500 MDa, resulting in Mycoplasma and Ureaplasma species. Mycoplasmas, particularly species with the smallest genomes, have high mutation rates, suggesting that they are in a state of rapid evolution. PMID:2579388

  20. Phylogenetic tree derived from bacterial, cytosol and organelle 5S rRNA sequences.

    PubMed Central

    Küntzel, H; Heidrich, M; Piechulla, B

    1981-01-01

    A phylogenetic tree was constructed by computer analysis of 47 completely determined 5S rRNA sequences. The wheat mitochondrial sequence is significantly more related to prokaryotic than to eukaryotic sequences, and its affinity to that of the thermophilic Gram-negative bacterium Thermus aquaticus is comparable to the affinity between Anacystis nidulans and chloroplastic sequences. This strongly supports the idea of an endosymbiotic origin of plant mitochondria. A comparison of the plant cytosol and chloroplast sub-trees suggests a similar rate of nucleotide substitution in nuclear genes and chloroplastic genes. Other features of the tree are a common precursor of protozoa and metazoa, which appears to be more related to the fungal than to the plant protosequence, and an early divergence of the archebacterial sequence (Halobacterium cutirubrum) from the prokaryotic branch. PMID:6785727

  1. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  2. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  3. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  4. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  5. Comparative structural analysis of eubacterial 5S rRNA by oxidation of adenines in the N-1 position.

    PubMed Central

    Pieler, T; Schreiber, A; Erdmann, V A

    1984-01-01

    Adenines in free 5S rRNA from Escherichia coli, Bacillus stearothermophilus and Thermus thermophilus have been oxidized at their N-1 position using monoperphthalic acid. The determination of the number of adenine 1-N-oxides was on the basis of UV spectroscopic data of the intact molecule. Identification of the most readily accessible nucleotides by sequencing gel analysis reveals that they are located in conserved positions within loops, exposed hairpin loops and single-base bulge loops. Implications for the structure and function of 5S rRNA will be discussed on the basis of this comparative analysis. Images PMID:6201825

  6. 5S rRNA sequences from four marine invertebrates and implications for base pairing models of metazoan sequences.

    PubMed

    Walker, W F; Doolittle, W F

    1983-08-11

    The nucleotide sequences of 5S rRNAs from the starfish Asterias vulgaris, the squid Illex illecebrosus, the sipunculid Phascolopsis gouldii and the jellyfish Aurelia aurita were determined. The sequence from Asterias lends support for one of two previous base pairing models for helix E in metazoan sequences. The Aurelia sequence differs by five nucleotides from that previously reported and does not violate the consensus secondary structure model for eukaryotic 5S rRNA. PMID:6136024

  7. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  8. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  9. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  10. Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

    PubMed Central

    Carol, P; Rozier, C; Lazaro, E; Ballesta, J P; Mache, R

    1993-01-01

    The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain. Images PMID:8441674

  11. Mutations in TFIIIA that increase stability of the TFIIIA-5 S rRNA gene complex: unusual effects on the kinetics of complex assembly and dissociation.

    PubMed

    Brady, Kristina L; Ponnampalam, Stephen N; Bumbulis, Michael J; Setzer, David R

    2005-07-22

    We have identified four mutations in Xenopus TFIIIA that increase the stability of TFIIIA-5 S rRNA gene complexes. In each case, the mutation has a relatively modest effect on equilibrium binding affinity. In three cases, these equilibrium binding effects can be ascribed primarily to decreases in the rate constant for protein-DNA complex dissociation. In the fourth case, however, a substitution of phenylalanine for the wild-type leucine at position 148 in TFIIIA results in much larger compensating changes in the kinetics of complex assembly and dissociation. The data support a model in which a relatively unstable population of complexes with multi-component dissociation kinetics forms rapidly; complexes then undergo a slow conformational change that results in very stable, kinetically homogeneous TFIIIA-DNA complexes. The L148F mutant protein acts as a particularly potent transcriptional activator when it is fused to the VP16 activation domain and expressed in yeast cells. Substitution of L148 to tyrosine or tryptophan produces an equally strong transcriptional activator. Substitution to histidine results in genetic and biochemical effects that are more modest than, but similar to, those observed with the L148F mutation. We propose that an amino acid with a planar side chain at position 148 can intercalate between adjacent base pairs in the intermediate element of the 5 S rRNA gene. Intercalation occurs slowly but results in a very stable DNA-protein complex. These results suggest that transcriptional activation by a cis-acting sequence element is largely dependent on the kinetic, rather than the thermodynamic, stability of the complex formed with an activator protein. Thus, transcriptional activation is dependent in large part on the lifetime of the activator-DNA complex rather than on binding site occupancy at steady state. Introduction of intercalating amino acids into zinc finger proteins may be a useful tool for producing artificial transcription factors with

  12. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  13. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    PubMed

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  14. mTOR associates with TFIIIC, is found at tRNA and 5S rRNA genes, and targets their repressor Maf1.

    PubMed

    Kantidakis, Theodoros; Ramsbottom, Ben A; Birch, Joanna L; Dowding, Sarah N; White, Robert J

    2010-06-29

    Synthesis of tRNA and 5S rRNA by RNA polymerase (pol) III is regulated by the mTOR pathway in mammalian cells. The mTOR kinase localizes to tRNA and 5S rRNA genes, providing an opportunity for direct control. Its presence at these sites can be explained by interaction with TFIIIC, a DNA-binding factor that recognizes the promoters of these genes. TFIIIC contains a TOR signaling motif that facilitates its association with mTOR. Maf1, a repressor that binds and inhibits pol III, is phosphorylated in a mTOR-dependent manner both in vitro and in vivo at serine 75, a site that contributes to its function as a transcriptional inhibitor. Proximity ligation assays confirm the interaction of mTOR with Maf1 and TFIIIC in nuclei. In contrast to Maf1 regulation in yeast, no evidence is found for nuclear export of Maf1 in response to mTOR signaling in HeLa cells. We conclude that mTOR associates with TFIIIC, is recruited to pol III-transcribed genes, and relieves their repression by Maf1. PMID:20543138

  15. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    PubMed Central

    Leontis, N B; Westhof, E

    1998-01-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  16. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  17. The impact of transcriptional tuning on in vitro integrated rRNA transcription and ribosome construction

    PubMed Central

    Fritz, Brian R.; Jewett, Michael C.

    2014-01-01

    In vitro ribosome construction could enable studies of ribosome assembly and function, provide a route toward constructing minimal cells for synthetic biology, and permit the construction of ribosome variants with new functions. Toward these long-term goals, we recently reported on an integrated, one-pot ribosomal RNA synthesis (rRNA), ribosome assembly, and translation technology (termed iSAT) for the construction of Escherichia coli ribosomes in crude ribosome-free S150 extracts. Here, we aimed to improve the activity of iSAT through transcriptional tuning. Specifically, we increased transcriptional efficiency through 3′ modifications to the rRNA gene sequences, optimized plasmid and polymerase concentrations, and demonstrated the use of a T7-promoted rRNA operon for stoichiometrically balanced rRNA synthesis and native rRNA processing. Our modifications produced a 45-fold improvement in iSAT protein synthesis activity, enabling synthesis of 429 ± 15 nmol/l green fluorescent protein in 6 h batch reactions. Further, we show that the translational activity of ribosomes purified from iSAT reactions is about 20% the activity of native ribosomes purified directly from E. coli cells. Looking forward, we believe iSAT will enable unique studies to unravel the systems biology of ribosome biogenesis and open the way to new methods for making and studying ribosomal variants. PMID:24792158

  18. Involvement of multiple basic amino acids in yeast ribosomal protein L1 in 5S rRNA recognition.

    PubMed

    Yeh, L C; Lee, J C

    1995-01-01

    The role of basic amino acid residues located at the C-terminal region of the yeast ribosomal protein L1 in 5S rRNA binding was characterized in vitro and in vivo. Mutant proteins containing single or multiple amino acid substitutions were generated by site-directed mutagenesis of the L1 gene carried on a plasmid. In vitro RNP formation was examined by production of the mutant protein in the presence of the RNA molecule. The thermostability of the resultant RNP was also studied. Effects of these mutations on cell viability and ribosome assembly were characterized by transformation of a conditional null L1 yeast mutant with the mutated L1 gene expressed from the plasmid. Substitution of any one of the lysine or arginine residue did not affect significantly RNA binding in vitro or cell growth in vivo. However, several mutant proteins with substitutions of two of these basic amino acids bound RNA weakly and the RNPs were less stable. Cells expressing these mutant proteins were lethal. Theoretical structural prediction of these amino acids further provided information regarding their collective contributions to RNA recognition and to interaction between the RNP and other components of the 60S ribosomal subunit. PMID:8643400

  19. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. PMID:23933480

  20. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  1. What does the 5S rRNA multigene family tell us about the origin of the annual Triticeae (Poaceae)?

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2013-05-01

    We have investigated the complex relationships among the annual genera within the tribe Triticeae through phylogenetic analyses of the 5S rRNA multigene family. Cloned sequences were assigned to groups of orthologous sequences, called unit classes, that were subjected to several analyses including BLAST (Basic Local Alignment Search Tool) searches to assess possible ancestral relationships with perennial genera; phylogenetic analyses using parsimony (Pars), maximum likelihood (ML), and Bayesian methods; and minimum reticulation networks from the Pars, ML, and Bayesian trees. In this study, we included genera with both annual and perennial species, such as Dasypyrum, Hordeum, and Secale. BLAST pointed to Pseudoroegneria (carrier of the St genome) and possibly Thinopyrum (carrier of the J genome) as the potential next of kin. However, Thinopyrum and Pseudoroegneria have never fallen together on the individual trees with the former generally associated with Crithopsis, Aegilops, Triticum, and Dasypyrum, while the latter is usually associated with the rest of the genera within Triticeae. The "long" unit classes placed Dasypyrum breviaristatum together with Dasypyrum villosum, whereas the "short" unit classes put them far apart on the trees. None of the gene trees alone was able to summarize the complex relationships among the genera, in line with previous results in the Triticeae. However, the application of tools designed to display phylogenetic networks was able to depict the complex links among the genera based on the short and the long gene trees, including the close link between Thinopyrum and Pseudoroegneria suggested by the phylogenetic analyses. In addition, our analyses provide support for the hypothesis that at least some annual Triticeae taxa are derived from their perennial relatives. PMID:23789993

  2. Natural Microbial Community Compositions Compared by a Back-Propagating Neural Network and Cluster Analysis of 5S rRNA

    PubMed Central

    Noble, P. A.; Bidle, K. D.; Fletcher, M.

    1997-01-01

    The community compositions of free-living and particle-associated bacteria in the Chesapeake Bay estuary were analyzed by comparing banding patterns of stable low-molecular-weight RNA (SLMW RNA) which include 5S rRNA and tRNA molecules. By analyzing images of autoradiographs of SLMW RNAs on polyacrylamide gels, band intensities of 5S rRNA were converted to binary format for transmission to a back-propagating neural network (NN). The NN was trained to relate binary input to sample stations, collection times, positions in the water column, and sample types (e.g., particle-associated versus free-living communities). Dendrograms produced by using Euclidean distance and average and Ward's linkage methods on data of three independently trained NNs yielded the following results. (i) Community compositions of Chesapeake Bay water samples varied both seasonally and spatially. (ii) Although there was no difference in the compositions of free-living and particle-associated bacteria in the summer, these community types differed significantly in the winter. (iii) In the summer, most bay samples had a common 121-nucleotide 5S rRNA molecule. Although this band occurred in the top water of midbay samples, it did not occur in particle-associated communities of bottom-water samples. (iv) Regardless of the season, midbay samples had the greatest variety of 5S rRNA sizes. The utility of NNs for interpreting complex banding patterns in electrophoresis gels was demonstrated. PMID:16535593

  3. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  4. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    PubMed Central

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387

  5. Thermus thermophilus 16S rRNA is transcribed from an isolated transcription unit.

    PubMed Central

    Hartmann, R K; Erdmann, V A

    1989-01-01

    A cloned 16S rRNA gene from the extreme thermophilic eubacterium Thermus thermophilus HB8 was used to characterize the in vivo expression of the 16S rRNA genes in this organism by nuclease S1 mapping. The gene represents an isolated transcription unit encoding solely 16S rRNA. Under exponential growth conditions, transcription was initiated at a single promoter, which represents the structural equivalent of Escherichia coli rrn P2 promoters. The promoter-leader region was very similar to the E. coli rrn P2 promoter-leader segment that is responsible for antitermination. The T. thermophilus leader region was approximately 85 nucleotides shorter than its E. coli P2 counterpart. Potential processing intermediates were correlated with a proposed secondary structure of T. thermophilus pre-16S rRNA. Images PMID:2722737

  6. Comparative analysis of the genes encoding 23S-5S rRNA intergenic spacer regions of Lactobacillus casei-related strains.

    PubMed

    Chen, H; Lim, C K; Lee, Y K; Chan, Y N

    2000-03-01

    In this study, investigations into the 23S-5S rRNA intergenic spacer regions (ISRs) of the Lactobacillus casei group were performed. A 1.6 kb fragment, from Lactobacillus paracasei strain ATCC 27092, containing part of the 5S rRNA gene (60 bp), the 5S-23S spacer region (198 bp) and part of the 23S rRNA gene (1295 bp) was cloned and sequenced (GenBank no. AF098107). This fragment was used as a probe to determine the rRNA restriction fragment length polymorphism (RFLP) patterns of nine strains belonging to the Lactobacillus casei group, along with four other non-Lactobacillus casei lactobacilli species. A pair of PCR primers, 23-Fl and 5-Ru, was designed and used for PCR amplification of the 23S-5S rRNA ISRs of these strains. The ISR length and sequence polymorphisms provided additional information for the taxonomic study of the Lactobacillus casei group. The spacer-length polymorphism of Lactobacillus rhamnosus was distinct from those of the other strains and this observation is consistent with the classification of Lactobacillus rhamnosus proposed by Mori et al. For all Lactobacillus casei and Lactobacillus paracasei strains, two major bands (approx. 250 and 170 bp in size) were obtained except in the case of Lactobacillus paracasei subsp. tolerans strain NCIMB 9709T, which yielded only one amplified product (250 bp). The sequencing data of the PCR products of seven well-characterized Lactobacillus casei and Lactobacillus paracasei strains revealed the presence of a 76/80 bp insertion/deletion with some random, single-base substitutions between the longer and shorter spacers for each respective strain. A few base variations were also detected within different strains in this group although the overall sequence similarity was very high (95.9-99.5%). The rRNA RFLP and the spacer sequence of Lactobacillus casei type strain ATCC 393T exhibited unique identities in this cluster. On the other hand, Lactobacillus casei strain ATCC 334 showed a high level of similarity

  7. Localization of 5S and 25S rRNA genes on somatic and meiotic chromosomes in Capsicum species of chili pepper.

    PubMed

    Kwon, Jin-Kyung; Kim, Byung-Dong

    2009-02-28

    The loci of the 5S and 45S rRNA genes were localized on chromosomes in five species of Capsicum, namely, annuum, chacoense, frutescens, baccatum, and chinense by FISH. The 5S rDNA was localized to the distal region of one chromosome in all species observed. The number of 45S rDNA loci varied among species; one in annuum, two in chacoense, frutescens, and chinense, and four in baccatum, with the exceptions that 'CM334' of annuum had three loci and 'tabasco' of frutescens had one locus. 'CM334'-derived BAC clones, 384B09 and 365P05, were screened with 5S rDNA as a probe, and BACs 278M03 and 262A23 were screened with 25S rDNA as a probe. Both ends of these BAC clones were sequenced. FISH with these BAC probes on pachytenes from 'CM334' plant showed one 5S rDNA locus and three 45S rDNA loci, consistent with the patterns on the somatic chromosomes. The 5S rDNA probe was also applied on extended DNA fibers to reveal that its coverage measured as long as 0.439 Mb in the pepper genome. FISH techniques applied on somatic and meiotic chromosomes and fibers have been established for chili to provide valuable information about the copy number variation of 45S rDNA and the actual physical size of the 5S rDNA in chili. PMID:19277503

  8. The karyotype and 5S rRNA genes from Spanish individuals of the bat species Rhinolophus hipposideros (Rhinolophidae; Chiroptera).

    PubMed

    Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio

    2008-11-01

    The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair. PMID:18066670

  9. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment.

    PubMed

    Kwasniewska, Jolanta; Jaskowiak, Joanna

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  10. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment

    PubMed Central

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  11. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  12. A Neurospora crassa ribosomal protein gene, homologous to yeast CRY1, contains sequences potentially coordinating its transcription with rRNA genes.

    PubMed Central

    Tyler, B M; Harrison, K

    1990-01-01

    We have isolated and sequenced a Neurospora crassa ribosomal protein gene (designated crp-2) strongly homologous to the rp59 gene (CRY1) of yeast and the S14 ribosomal protein gene of mammals. The inferred sequence of the crp-2 protein is more homologous (83%) to the mammalian S14 sequence than to the yeast rp59 sequence (69%). The gene has three intervening sequences (IVSs) two of which are offset 7 bp from the position of IVSs in the mammalian genes. None correspond to the position of the IVS in the yeast gene. Crp-2 was mapped by RFLP analysis to the right arm of linkage group III. The 5' region of the gene contains three copies of a sequence, the Ribo box, previously shown to be required for transcription of both 5S and 40S rRNA genes. We speculate that the Ribo box may coordinate ribosomal protein and rRNA gene transcription. Images PMID:1977135

  13. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    PubMed

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. PMID:26800847

  14. Physical and genetic maps of the Leptospira interrogans serovar icterohaemorrhagiae strain Ictero no.1 chromosome and sequencing of a 19-kb region of the genome containing the 5S rRNA gene.

    PubMed

    Takahashi, Y; Akase, K; Hirano, H; Fukunaga, M

    1998-07-17

    We report the construction of physical and genetic maps of the chromosome of Leptospira interrogans serovar icterohaemorrhagiae strain Ictero No.1 using pulsed-field gel electrophoresis of DNA fragments generated by digestion with enzymes SrfI, AscI, FseI, and NotI and using reciprocal hybridization. We also sequenced the 19-kilobase (kb) DNA segment including the one gene for 5S rRNA (rrf) of pathogenic Leptospira. The size of the chromosome of the strain Ictero No.1 was estimated to be 4673kb and was found to be similar to those of the chromosomes of the leptospira strains Verdun (serovar icterohaemorrhagiae) and RZ11 (serovar pomona). The strains Verdun and RZ11 carry a small 350-kb replicon (minichromosome), and the strain Ictero No.1 also contained the same kind of molecule together with the chromosome. The physical maps of the strains Ictero No.1 and Verdun were almost identical, as were the locations of the selected genes, except for the location of one of the 16S rRNA genes. Overall, the genetic organization appeared to be conserved within the serovar icterohaemorrhagiae strains. In the sequenced region, we identified 10 putative ORFs and one rrf sequence, and the transcription orientations were all the same. A homology search for the products deduced from the sequenced data revealed that the orf H exhibited high similarity to malic acid enzyme of Haemophilus influenzae and fumarate hydratase of Escherichia coli (orf J). The rest of the putative products encoded by ORFs in the sequenced region showed little similarity with the proteins contained in the databases and were considered to be unknown proteins. PMID:9666070

  15. Post-transcriptional Modifications Modulate rRNA Structure and Ligand Interactions.

    PubMed

    Jiang, Jun; Seo, Hyosuk; Chow, Christine S

    2016-05-17

    Post-transcriptional modifications play important roles in modulating the functions of RNA species. The presence of modifications in RNA may directly alter its interactions with binding partners or cause structural changes that indirectly affect ligand recognition. Given the rapidly growing list of modifications identified in noncoding and mRNAs associated with human disease, as well as the dynamic control over modifications involved in various physiological processes, it is imperative to understand RNA structural modulation by these modifications. Among the RNA species, rRNAs provide numerous examples of modification types located in differing sequence and structural contexts. In addition, the modified rRNA motifs participate in a wide variety of ligand interactions, including those with RNA, protein, and small molecules. In fact, several classes of antibiotics exert their effects on protein synthesis by binding to functionally important and highly modified regions of the rRNAs. These RNA regions often display conservation in sequence, secondary structure, tertiary interactions, and modifications, trademarks of ideal drug-targeting sites. Furthermore, ligand interactions with such regions often favor certain modification-induced conformational states of the RNA. Our laboratory has employed a combination of biophysical methods such as nuclear magnetic resonance spectroscopy (NMR), circular dichroism, and UV melting to study rRNA modifications in functionally important motifs, including helix 31 (h31) and helix h44 (h44) of the small subunit rRNA and helix 69 (H69) of the large subunit rRNA. The modified RNA oligonucleotides used in these studies were generated by solid-phase synthesis with a variety of phosphoramidite chemistries. The natural modifications were shown to impact thermal stability, dynamic behavior, and tertiary structures of the RNAs, with additive or cooperative effects occurring with multiple, clustered modifications. Taking advantage of the

  16. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. PMID:25261903

  17. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central

    2012-01-01

    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  18. Structural polymorphism in the major groove of a 5S RNA gene complements the zinc finger domains of transcription factor IIIA.

    PubMed Central

    Huber, P W; Morii, T; Mei, H Y; Barton, J K

    1991-01-01

    Metal complexes that bind to DNA on the basis of shape-selection have been used to map the conformational features of the DNA binding site for transcription factor IIIA. Conformationally distinct segments are detected on the 5S rRNA gene that correspond closely to the binding sites identified for the individual zinc finger domains of the protein. The local conformations are characterized by a major groove opened because of a change in base pair inclination and/or displacement at a central 5'-pyrimidine-purine-3' step, flanked by a widened minor groove, as would arise at the junctions between alternating B- and A-like DNA segments. Docking experiments with a consensus structure of a zinc finger reveal that the mixed A-B binding site accommodates the peptide domain better than either canonical B- or A-DNA helices. The close structural matching of the conformational variations in the 5S rDNA both to the proposed sites of zinc finger binding and to the shape of an individual zinc finger domain points to DNA structural polymorphism as providing an important determinant in recognition. In particular, shape selection in the 5' half of the internal control region may orient the multiple finger domains. Images PMID:1961749

  19. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    PubMed

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes. PMID:26835745

  20. Gradual reduction in rRNA transcription triggers p53 acetylation and apoptosis via MYBBP1A

    PubMed Central

    Kumazawa, Takuya; Nishimura, Kazuho; Katagiri, Naohiro; Hashimoto, Sayaka; Hayashi, Yuki; Kimura, Keiji

    2015-01-01

    The nucleolus, whose primary function is ribosome biogenesis, plays an essential role in p53 activation. Ribosome biogenesis is inhibited in response to cellular stress and several nucleolar proteins translocate from the nucleolus to the nucleoplasm, where they activate p53. In this study, we analysed precisely how impaired ribosome biogenesis regulates the activation of p53 by depleting nucleolar factors involved in rRNA transcription or rRNA processing. Nucleolar RNA content decreased when rRNA transcription was inhibited. In parallel with the reduced levels of nucleolar RNA content, the nucleolar protein Myb-binding protein 1 A (MYBBP1A) translocated to the nucleoplasm and increased p53 acetylation. The acetylated p53 enhanced p21 and BAX expression and induced apoptosis. In contrast, when rRNA processing was inhibited, MYBBP1A remained in the nucleolus and nonacetylated p53 accumulated, causing cell cycle arrest at the G1 phase by inducing p21 but not BAX. We propose that the nucleolus functions as a stress sensor to modulate p53 protein levels and its acetylation status, determining cell fate between cell cycle arrest and apoptosis by regulating MYBBP1A translocation. PMID:26044764

  1. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  2. Effects of single-base substitutions within the acanthamoeba castellanii rRNA promoter on transcription and on binding of transcription initiation factor and RNA polymerase I

    SciTech Connect

    Kownin, P.; Bateman, E.; Paule, M.R.

    1988-02-01

    Single-point mutations were introduced into the promoter region of the Acanthamoeba castellanii rRNA gene by chemical mutagen treatment of a single-stranded clone in vitro, followed by reverse transcription and cloning of the altered fragment. The promoter mutants were tested for transcription initiation factor (TIF) binding by a template commitment assay plus DNase I footprinting and for transcription by an in vitro runoff assay. Point mutations within the previously identified TIF interaction region (between -20 and -47, motifs A and B) indicated that TIF interacts most strongly with a sequence centered at -29 and less tightly with sequences upstream and downstream. Some alterations of the base sequence closer to the transcription start site (and outside the TIF-protected site) also significantly decrease specific RNA synthesis in vitro. These were within the region which is protected from DNAse I digestion by polymerase I, but these mutations did not detectably affect the binding of polymerase to the promoter.

  3. Genetic and cytogenetic analyses of the A genome of Triticum monococcum. VIII. Localization of rDNAs and characterization of 5S rRNA genes.

    PubMed

    Kim, N S; Kuspira, J; Armstrong, K; Bhambhani, R

    1993-02-01

    In situ hybridization with [3H]dCTP labelled pScT7 (5S rDNA) and pTa80 (18S + 26S rDNA) indicated that both hybridized to the terminal regions of two pairs of chromosomes in Triticum monococcum. When the hybridization was performed with a mixture of both probes, only two pairs of chromosome arms were labelled, which suggested that the loci of both genes were located in juxtaposition to one another. Both probes labelled one pair of sites more heavily than the other. Southern analysis of 5S with BamHI-digested DNA from 12 accessions of T. monococcum (including T. urartu) produced two superimposed ladders of approximate sizes of 500 and 330 bp, which differ from T. aestivum in which 500- and 420-bp ladders were found. The 500-bp ladder is derived from chromosome 5A (5SDna-A2) and the 330-bp ladder from chromosome 1A (5SDna-A1). The recognition site for SstI was present in the long spacer region but absent in the short spacer as in T. aestivum; however, unlike T. aestivum, there were HaeIII (GGCC) and HindIII (AAGCTT) recognition sites in the short spacer region. The TaqI recognition sites (TCGA) in the long and short spacer regions are probably more highly methylated in T. monococcum than in T. aestivum. The results have implications regarding the evolutionary changes that occurred in the A genome of the hexaploid compared with the diploid. PMID:18469972

  4. Mild Glucose Starvation Induces KDM2A-Mediated H3K36me2 Demethylation through AMPK To Reduce rRNA Transcription and Cell Proliferation

    PubMed Central

    Tanaka, Yuji; Yano, Hirohisa; Ogasawara, Sachiko; Yoshioka, Sho-ichi; Imamura, Hiromi; Okamoto, Kengo

    2015-01-01

    Environmental conditions control rRNA transcription. Previously, we found that serum and glucose deprivation induces KDM2A-mediated H3K36me2 demethylation in the rRNA gene (rDNA) promoter and reduces rRNA transcription in the human breast cancer cell line MCF-7. However, the molecular mechanism and biological significance are still unclear. In the present study, we found that glucose starvation alone induced the KDM2A-dependent reduction of rRNA transcription. The treatment of cells with 2-deoxy-d-glucose, an inhibitor of glycolysis, reduced rRNA transcription and H3K36me2 in the rDNA promoter, both of which were completely dependent on KDM2A in low concentrations of 2-deoxy-d-glucose, that is, mild starvation conditions. The mild starvation induced these KDM2A activities through AMP-activated kinase (AMPK) but did not affect another AMPK effector of rRNA transcription, TIF-IA. In the triple-negative breast cancer cell line MDA-MB-231, the mild starvation also reduced rRNA transcription in a KDM2A-dependent manner. We detected KDM2A in breast cancer tissues irrespective of their estrogen receptor, progesterone receptor, and HER2 status, including triple-negative cancer tissues. In both MCF-7 and MDA-MB-231 cells, mild starvation reduced cell proliferation, and KDM2A knockdown suppressed the reduction of cell proliferation. These results suggest that under mild glucose starvation AMPK induces KDM2A-dependent reduction of rRNA transcription to control cell proliferation. PMID:26416883

  5. Involvement of the transcriptional factor E2F1 in the regulation of the rRNA promoter

    SciTech Connect

    Ayrault, Olivier; Andrique, Laetitia; Seite, Paule . E-mail: paule.seite@univ-poitiers.fr

    2006-04-15

    p16{sup INK4a}-pRB-E2F and ARF-MDM2-p53 are two major tumor suppressor networks involved in cell proliferation control. The nucleolar ARF protein binds to MDM2 to activate the growth suppressive functions of p53, but can also exert its tumor suppressor activity independently of p53, through mechanisms involving other regulators: in that manner, p14{sup ARF} has been shown to inhibit the transcriptional activity of E2F1 in vitro, suggesting that the two pathways intersect with one another. More recently, ARF has been shown to inhibit ribosomal RNA processing, and to specifically interact with the rRNA promoter, suggesting a role in the regulation of both maturation and transcription processes. We show here that E2F1 can bind the rRNA promoter and modulate its activity through the interaction with two E2F1-binding sequences we have identified. The regulation of ribosome biogenesis appears as a major p53-independent process, which involves both ARF and E2F1 to control cell proliferation.

  6. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  7. E sub 1 BF is an essential RNA polymerase I transcription factor with an intrinsic protein kinase activity that can modulate rRNA gene transcription

    SciTech Connect

    Ji Zhang; Huifeng Niu; Jacob, S.T. )

    1991-10-01

    The authors previously described the purification and characterization of E{sub 1}BF, a rat rRNA gene core promoter-binding factor that consists of two polypeptides of 89 and 79 kDa. When this factor was incubated in the absence of any exogenous protein kinase under conditions optimal for protein phosphorylation, the 79-kDa polypeptide of E{sub 1}BF was selectively phosphorylated. The labeled phosphate could be removed from the E{sub 1}BF polypeptide by treatment with calf intestinal alkaline phosphatase or potato acid phosphatase. Elution of the protein from the E{sub 1}BF-promoter complex formed in an electrophoretic mobility-shift assay followed by incubation of the concentrated eluent with ({gamma}-{sup 32}P)ATP resulted in the selective labeling o the 79-kDa band. The E{sub 1}BF-associated protein kinase did not phosphorylate casein or histone H1. These data demonstrate that (1) polymerase I promoter-binding factor E{sub 1}BF contains an intrinsic substrate-specific protein kinase and (2) E{sub 1}BF is an essential polymerase I transcription factor that can modulate rRNA gene transcription by protein phosphorylation. Further, these studies have provided a direct means to identify a protein kinase or any other enzyme that can interact with a specific DNA sequence.

  8. Xenopus transcription factor IIIA binds primarily at junctions between double helical stems and internal loops in oocyte 5S RNA.

    PubMed Central

    Christiansen, J; Brown, R S; Sproat, B S; Garrett, R A

    1987-01-01

    RNases and chemical probes were used to study the accessibility of each nucleotide of 5S RNA in the native and reconstituted 7S particle from Xenopus laevis oocytes. RNase or chemically treated 5S RNA from intact 7S particles was isolated and analysed using an oligodeoxynucleotide primer and reverse transcriptase. The results were superimposed on a cylindrical projection of an RNA double helix and the protection effects were shown to cluster at two regions on the molecular surface. A three-dimensional model is proposed for the 7S particle in which protein-RNA contacts occur mainly in the major groove of 5S RNA. Images Fig. 1. Fig. 2. PMID:3582366

  9. Methanosarcina acetivorans 16S rRNA and transcription factor nucleotide fluctuation with implications in exobiology and pathology

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Marchese, P.; Hiciano, O.; Yao, H.; Lieberman, D.; Cheung, T.

    2008-08-01

    Cultures of the methane-producing archaea Methanosarcina, have recently been isolated from Alaskan sediments. It has been proposed that methanogens are strong candidates for exobiological life in extreme conditions. The spatial environmental gradients, such as those associated with the polygons on Mars' surface, could have been produced by past methanogenesis activity. The 16S rRNA gene has been used routinely to classify phenotypes. Using the fractal dimension of nucleotide fluctuation, a comparative study of the 16S rRNA nucleotide fluctuation in Methanosarcina acetivorans C2A, Deinococcus radiodurans, and E. coli was conducted. The results suggest that Methanosarcina acetivorans has the lowest fractal dimension, consistent with its ancestral position in evolution. Variation in fluctuation complexity was also detected in the transcription factors. The transcription factor B (TFB) was found to have a higher fractal dimension as compared to transcription factor E (TFE), consistent with the fact that a single TFB in Methanosarcina acetivorans can code three different TATA box proteins. The average nucleotide pair-wise free energy of the DNA repair genes was found to be highest for Methanosarcina acetivorans, suggesting a relatively weak bonding, which is consistent with its low prevalence in pathology. Multitasking capacity comparison of type-I and type-II topoisomerases has been shown to correlate with fractal dimension using the methicillin-resistant strain MRSA 252. The analysis suggests that gene adaptation in a changing chemical environment can be measured in terms of bioinformatics. Given that the radiation resistant Deinococcus radiodurans is a strong candidate for an extraterrestrial origin and that the cold temperature Psychrobacter cryohalolentis K5 can function in Siberian permafrost, the fractal dimension comparison in this study suggests that a chemical resistant methanogen could exist in extremely cold conditions (such as that which existed on early

  10. Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

    PubMed Central

    Tatti, Enrico; McKew, Boyd A.; Whitby, Corrine; Smith, Cindy J.

    2016-01-01

    Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with 'end-point' PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included. PMID:27341629

  11. Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonid fish, detected by nested reverse transcription-PCR of 16S rRNA sequences.

    PubMed Central

    Magnússon, H B; Fridjónsson, O H; Andrésson, O S; Benediktsdóttir, E; Gudmundsdóttir, S; Andrésdóttir, V

    1994-01-01

    An assay based on reverse transcription and nested PCR amplification of hypervariable regions within the 16S rRNA sequence was used to specifically detect Renibacterium salmoninarum, the slowly growing causative agent of bacterial kidney disease in salmonid fish. This assay detected 1 to 10 bacteria per sample and took 1 to 2 days to perform. The assay was used to detect R. salmoninarum in ovarian fluid obtained from naturally infected fish. The assay was unreliable when it was used to examine kidney tissue. Images PMID:7529017

  12. Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonid fish, detected by nested reverse transcription-PCR of 16S rRNA sequences.

    PubMed

    Magnússon, H B; Fridjónsson, O H; Andrésson, O S; Benediktsdóttir, E; Gudmundsdóttir, S; Andrésdóttir, V

    1994-12-01

    An assay based on reverse transcription and nested PCR amplification of hypervariable regions within the 16S rRNA sequence was used to specifically detect Renibacterium salmoninarum, the slowly growing causative agent of bacterial kidney disease in salmonid fish. This assay detected 1 to 10 bacteria per sample and took 1 to 2 days to perform. The assay was used to detect R. salmoninarum in ovarian fluid obtained from naturally infected fish. The assay was unreliable when it was used to examine kidney tissue. PMID:7529017

  13. Events during eucaryotic rRNA transcription initiation and elongation: Conversion from the closed to the open promoter complex requires nucleotide substrates

    SciTech Connect

    Bateman, E.; Paule, M.R.

    1988-05-01

    Chemical footprinting and topological analysis were carried out on the Acanthamoeba castellanii rRNA transcription initiation factor (TIF) and RNA polymerase I complexes with DNA during transcription initiation and elongation. The results show that the binding of TIF and polymerase to the promoter does not alter the supercoiling of the DNA template and the template does not become sensitive to modification by diethylpyro-carbonate, which can identify melted DNA regions. Thus, in contrast to bacterial RNA polymerase, the eucaryotic RNA polymerase I-promoter complex is in a closed configuration preceding addition of nucleotides in vitro. Initiation and 3'-O-methyl CTP-limited translocation by RNA polymerase I results in separation of the polymerase-TIF footprints, leaving the TIF footprint unaltered. In contrast, initiation and translocation result in a significant change in the conformation of the polymerase-DNA complex, culminating in an unwound DNA region of at least 10 base pairs.

  14. Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

    PubMed Central

    Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

    2015-01-01

    RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

  15. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  16. 5SRNAdb: an information resource for 5S ribosomal RNAs

    PubMed Central

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A.; Karlowski, Wojciech M.

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA–protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  17. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. PMID:11779838

  18. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  19. Mitochondrial Enzyme Rhodanese Is Essential for 5 S Ribosomal RNA Import into Human Mitochondria*

    PubMed Central

    Smirnov, Alexandre; Comte, Caroline; Mager-Heckel, Anne-Marie; Addis, Vanessa; Krasheninnikov, Igor A.; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan

    2010-01-01

    5 S rRNA is an essential component of ribosomes. In eukaryotic cells, it is distinguished by particularly complex intracellular traffic, including nuclear export and re-import. The finding that in mammalian cells 5 S rRNA can eventually escape its usual circuit toward nascent ribosomes to get imported into mitochondria has made the scheme more complex, and it has raised questions about both the mechanism of 5 S rRNA mitochondrial targeting and its function inside the organelle. Previously, we showed that import of 5 S rRNA into mitochondria requires unknown cytosolic proteins. Here, one of them was identified as mitochondrial thiosulfate sulfurtransferase, rhodanese. Rhodanese in its misfolded form was found to possess a strong and specific 5 S rRNA binding activity, exploiting sites found earlier to function as signals of 5 S rRNA mitochondrial localization. The interaction with 5 S rRNA occurs cotranslationally and results in formation of a stable complex in which rhodanese is preserved in a compact enzymatically inactive conformation. Human 5 S rRNA in a branched Mg2+-free form, upon its interaction with misfolded rhodanese, demonstrates characteristic functional traits of Hsp40 cochaperones implicated in mitochondrial precursor protein targeting, suggesting that it may use this mechanism to ensure its own mitochondrial localization. Finally, silencing of the rhodanese gene caused not only a proportional decrease of 5 S rRNA import but also a general inhibition of mitochondrial translation, indicating the functional importance of the imported 5 S rRNA inside the organelle. PMID:20663881

  20. Chromatin tethering effects of hNopp140 are involved in the spatial organization of nucleolus and the rRNA gene transcription

    PubMed Central

    Tsai, Yi-Tzang; Lin, Chen-I; Chen, Hung-Kai; Lee, Kuo-Ming; Hsu, Chia-Yi; Yang, Shun-Jen

    2008-01-01

    The short arms of five human acrocentric chromosomes contain ribosomal gene (rDNA) clusters where numerous mini-nucleoli arise at the exit of mitosis. These small nucleoli tend to coalesce into one or a few large nucleoli during interphase by unknown mechanisms. Here, we demonstrate that the N- and C-terminal domains of a nucleolar protein, hNopp140, bound respectively to α-satellite arrays and rDNA clusters of acrocentric chromosomes for nucleolar formation. The central acidic-and-basic repeated domain of hNopp140, possessing a weak self-self interacting ability, was indispensable for hNopp140 to build up a nucleolar round-shaped structure. The N- or the C-terminally truncated hNopp140 caused nucleolar segregation and was able to alter locations of the rDNA transcription, as mediated by detaching the rDNA repeats from the acrocentric α-satellite arrays. Interestingly, an hNopp140 mutant, made by joining the N- and C-terminal domains but excluding the entire central repeated region, induced nucleolar disruption and global chromatin condensation. Furthermore, RNAi knockdown of hNopp140 resulted in dispersion of the rDNA and acrocentric α-satellite sequences away from nucleolus that was accompanied by rDNA transcriptional silence. Our findings indicate that hNopp140, a scaffold protein, is involved in the nucleolar assembly, fusion, and maintenance. PMID:18253863

  1. Transcriptional and Post-Transcriptional Regulation of RNA Levels in Maize Mitochondria.

    PubMed Central

    Finnegan, PM; Brown, GG

    1990-01-01

    Relatively little is known about the mechanisms that govern the expression of plant mitochondrial genomes. We have addressed this problem by analyzing the transcriptional activity of different regions of the maize mitochondrial genome using both in vivo and isolated mitochondrial pulse-labeling systems. The regions examined included the protein genes atpA, atp6, and coxII, the 26S, 18S, and 5S rRNA genes, and sequences surrounding the rRNA genes. The rRNAs were found to be transcribed at rates fivefold to 10-fold higher than the protein genes. These rate differences are comparable with the differences in abundance of these species in the total or steady-state RNA population. Pulse-labeled RNA unexpectedly detected transcription of all regions examined, including approximately 21 kilobases of presumed noncoding sequences flanking the rRNA genes for which stable transcripts were not detected. The results obtained with RNA labeled for short pulses in vivo and in isolated mitochondria were similar, suggesting that isolated mitochondria provide a faithful run-on transcription assay. Our results indicate that the absence in total RNA of transcripts homologous to a given region of maize mitochondrial DNA does not necessarily exclude transcriptional activity of that region and that both transcriptional and post-transcriptional processes play important roles in maize mitochondrial genome expression. PMID:12354946

  2. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  3. Analysis of the 5S RNA Pool in Arabidopsis thaliana: RNAs Are Heterogeneous and Only Two of the Genomic 5S Loci Produce Mature 5S RNA

    PubMed Central

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5′- and 3′-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. [EMBL accession nos: AF330825-AF331032; AF335777-AF335873.] PMID:11779838

  4. 4.5S ribonucleic acid, a novel ribosome component in the chloroplasts of flowering plants.

    PubMed Central

    Bowman, C M; Dyer, T A

    1979-01-01

    A species of low-molecular-weight ribosomal RNA, referred to as '4.5S rRNA', was found in addition to 5S rRNA in the large subunit of chloroplast ribosomes of a wide range of flowering plants. It was shown by sequence analysis that several variants of this RNA may occur in a plant. Furthermore, although in most flowering plants the predominant variant contains about 100 nucleotides, in the broad bean it has less than 80. It seems, therefore, to be much more diverse in size and sequence than the other ribosomal RNA species. Like 5S rRNA , it does not contain modified nucleotides and it is also unusual in having an unphosphorylated 5'-end. It is apparently neither a homologue of cytosol 5.8S rRNA nor a fragment of 23S rRNA. Images Fig. 1. Fig. 3. Fig. 4. PMID:540035

  5. Divergent effects of oxidatively induced modification to the C8 of 2'-deoxyadenosine on transcription factor binding: 8,5'(S)-cyclo-2'-deoxyadenosine inhibits the binding of multiple sequence specific transcription factors, while 8-oxo-2'-deoxyadenosine increases binding of CREB and NF-kappa B to DNA.

    PubMed

    Abraham, Jessy; Brooks, Philip J

    2011-05-01

    DNA is exposed to endogenous and environmental factors that can form stable lesions. If not repaired, these lesions can lead to transcription/replication blocking or mutagenic bypass. Our previous work has focused on 8,5'-cyclopurine 2'-deoxyribonucleosides, a unique class of oxidatively induced DNA lesions that are specifically repaired by the NER pathway (see Brooks PJ [2008]: DNA Repair 7:1168-1179). Here we used EMSA to monitor the ability of sequence-specific transcription factors, HSF1, CREB, and NF-kappaB and "architectural" transcription factor, HMGA, to bind to their target sequences when 8, 5'(S)-cyclo-2'-deoxyadenosine (cyclo-dAdo) is present within their recognition sequences. For comparison, we also tested the effect of 8-oxo-7,8-dihydro-2'-deoxyadenosine (8-oxo-dAdo) in the same recognition sequences. The presence of a cyclo-dAdo lesion in the target sequence essentially eliminated the binding activity of HSF1, CREB, and NF-kappa B whereas HMGA retained some of its binding activity. In contrast, 8-oxo-dAdo had no obvious effect on the binding activity of HSF1 and HMGA in comparison to lesion-free DNA. Notably, though, CREB and NFκB binding increased when an 8-oxo-dAdo lesion was present in their target sequence. Competition EMSA showed about 2-3-fold increased affinity of both proteins for the 8-oxo-dAdo containing target sequence compared to lesion-free DNA. Molecular modeling of the lesions in the NF-kappaB sequence indicated that 8-oxo-dAdo may form an additional hydrogen bond with the protein, thereby strengthening the binding of NF-kappa B to its DNA target. The cyclo-dAdo lesion, in contrast, distorted the DNA structure, providing an explanation for the inhibition of NF-kappaB binding. PMID:20872830

  6. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  7. A role for the TATA-box-binding protein component of the transcription factor IID complex as a general RNA polymerase III transcription factor.

    PubMed Central

    White, R J; Jackson, S P; Rigby, P W

    1992-01-01

    The major class of vertebrate genes transcribed by RNA polymerase (EC 2.7.7.6) III, which includes 5S rRNA genes, tRNA genes, and the adenovirus VA genes, is characterized by split internal promoters and no absolute dependence upon specific upstream sequences. Fractionation experiments have shown that transcription of such genes requires two general RNA polymerase III-specific factors, TFIIIB and TFIIIC. We now demonstrate that a third general factor is also employed by these genes. This is the TATA-box-binding protein originally identified as being a component of the general RNA polymerase II transcription factor TFIID. This protein is involved in the transcription by RNA polymerase III of every template tested, even though the promoters of VA and most vertebrate tRNA and 5S rRNA genes do not contain recognizable TATA elements. Images PMID:1542692

  8. Mouse Oocytes Transcribe Injected Xenopus 5S RNA Gene

    PubMed Central

    Brinster, Ralph L.; Chen, Howard Y.; Trumbauer, Myrna E.

    2016-01-01

    Transcripts produced after injection of the Xenopus 5S RNA gene into oocyte germinal vesicles of mice migrate electrophoretically with the 5S RNA marker, an indication that the gene is transcribed and processed with considerable accuracy, Approximately two 5S RNA molecules are transcribed per gene per hour. This system may be useful in studying DNA processing and gene regulation by the mammalian ovum and might be modified to allow permanent incorporation of specific genes into mice. PMID:7194505

  9. Complete sequence and gene organization of the Nosema spodopterae rRNA gene.

    PubMed

    Tsai, Shu-Jen; Huang, Wei-Fone; Wang, Chung-Hsiung

    2005-01-01

    By sequencing the entire ribosomal RNA (rRNA) gene of Nosema spodopterae, we show here that its gene organization follows a pattern similar to the Nosema type species, Nosema bombycis, i.e. 5'-large subunit rRNA (2,497 bp)-internal transcribed spacer (185 bp)-small subunit rRNA (1,232 bp)-intergenic spacer (277 bp)-5S rRNA (114 bp)-3'. Gene sequences and the secondary structures of large subunit rRNA, small subunit rRNA, and 5S rRNA are compared with the known corresponding sequences and structures of closely related microsporidia. The results suggest that the Nosema genus may be heterogeneous and that the rRNA gene organization may be a useful characteristic for determining which species are closely related to the type species. PMID:15702980

  10. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA. PMID:21574431

  11. Patterns and regulation of ribosomal RNA transcription in Borrelia burgdorferi

    PubMed Central

    2011-01-01

    Background Borrelia burgdorferi contains one 16S and two tandem sets of 23S-5S ribosomal (r) RNA genes whose patterns of transcription and regulation are unknown but are likely to be critical for survival and persistence in its hosts. Results RT-PCR of B. burgdorferi N40 and B31 revealed three rRNA region transcripts: 16S rRNA-alanine transfer RNA (tRNAAla); tRNAIle; and both sets of 23S-5S rRNA. At 34°C, there were no differences in growth rate or in accumulation of total protein, DNA and RNA in B31 cultured in Barbour-Stoenner-Kelly (BSK)-H whether rabbit serum was present or not. At 23°C, B31 grew more slowly in serum-containing BSK-H than at 34°C. DNA per cell was higher in cells in exponential as compared to stationary phase at either temperature; protein per cell was similar at both temperatures in both phases. Similar amounts of rRNA were produced in exponential phase at both temperatures, and rRNA was down-regulated in stationary phase at either temperature. Interestingly, a relBbu deletion mutant unable to generate (p)ppGpp did not down-regulate rRNA at transition to stationary phase in serum-containing BSK-H at 34°C, similar to the relaxed phenotype of E. coli relA mutants. Conclusions We conclude that rRNA transcription in B. burgdorferi is complex and regulated both by growth phase and by the stringent response but not by temperature-modulated growth rate. PMID:21251259

  12. Promoter of the Mycoplasma pneumoniae rRNA operon.

    PubMed Central

    Hyman, H C; Gafny, R; Glaser, G; Razin, S

    1988-01-01

    RNA transcripts starting from the 5' end of the single Mycoplasma pneumoniae rRNA operon were analyzed by several methods. By primer extension analysis a start site was found 62 nucleotides upstream from the start site of the 16S rRNA. This site was preceded by a putative Pribnow box; however, a defined -35 recognition region was absent. The cloned rRNA operon was transcribed in vitro by using purified RNA polymerase of Escherichia coli. A single start site could be demonstrated within a few nucleotides of the start site found by primer extension analysis of M. pneumoniae transcripts. When fragments from the cloned operon were used as hybridization probes, S1 nuclease mapping yielded a single transcript extending approximately 193 nucleotides upstream from the 16S rRNA start site. The region surrounding this endpoint did not resemble any known promoter sequence. Dot blot hybridization of M. pneumoniae RNA to three oligonucleotides consisting of nucleotides -5 to -21, -38 to -54, and -112 to -132 (from the start of the 16S rRNA gene) indicated that most rRNA transcripts were processed at the stem site preceding the 16S rRNA gene. The majority of the longer precursor transcripts, extending beyond this point, did not extend further upstream to an oligonucleotide consisting of nucleotides -112 to -132. It was concluded that transcription of the rRNA operon of M. pneumoniae is initiated by a single promoter. The nucleotide sequence of the region is presented. Images PMID:2838465

  13. Nucleotide sequence of 5S ribosomal RNA from Aspergillus nidulans and Neurospora crassa.

    PubMed Central

    Piechulla, B; Hahn, U; McLaughlin, L W; Küntzel, H

    1981-01-01

    The nucleotide sequences of 5S rRNA molecules isolated from the cytosol and the mitochondria of the ascomycetes A. nidulans and N. crassa were determined by partial chemical cleavage of 3'-terminally labelled RNA. The sequence identity of the cytosolic and mitochondrial RNA preparations confirms the absence of mitochondrion-specific 5S rRNA in these fungi. The sequences of the two organisms differ in 35 positions, and each sequence differs from yeast 5S rRNA in 44 positions. Both molecules contain the sequence GCUC in place of GAAC or GAUY found in all other 5S rRNAs, indicating that this region is not universally involved in base-pairing to the invariant GTpsiC sequence of tRNAs. Images PMID:6453331

  14. Positive modulation of RNA polymerase III transcription by ribosomal proteins

    SciTech Connect

    Dieci, Giorgio; Carpentieri, Andrea; Amoresano, Angela; Ottonello, Simone

    2009-02-06

    A yeast nuclear fraction of unknown composition, named TFIIIE, was reported previously to enhance transcription of tRNA and 5S rRNA genes in vitro. We show that TFIIIE activity co-purifies with a specific subset of ribosomal proteins (RPs) which, as revealed by chromatin immunoprecipitation analysis, generally interact with tRNA and 5S rRNA genes, but not with a Pol II-specific promoter. Only Rpl6Ap and Rpl6Bp, among the tested RPs, were found associated to a TATA-containing tRNA{sup Ile}(TAT) gene. The RPL6A gene also emerged as a strong multicopy suppressor of a conditional mutation in the basal transcription factor TFIIIC, while RPL26A and RPL14A behaved as weak suppressors. The data delineate a novel extra-ribosomal role for one or a few RPs which, by influencing 5S rRNA and tRNA synthesis, could play a key role in the coordinate regulation of the different sub-pathways required for ribosome biogenesis and functionality.

  15. Identification of Sex and Female's Reproductive Stage in Commercial Fish Species through the Quantification of Ribosomal Transcripts in Gonads.

    PubMed

    Rojo-Bartolomé, Iratxe; Diaz de Cerio, Oihane; Diez, Guzman; Cancio, Ibon

    2016-01-01

    The estimation of maturity and sex of fish stocks in European waters is a requirement of the EU Data Collection Framework as part of the policy to improve fisheries management. On the other hand, research on fish biology is increasingly focused in molecular approaches, researchers needing correct identification of fish sex and reproductive stage without necessarily having in house the histological know-how necessary for the task. Taking advantage of the differential gene transcription occurring during fish sex differentiation and gametogenesis, the utility of 5S ribosomal RNA (5S rRNA) and General transcription factor IIIA (gtf3a) in the molecular identification of sex and gametogenic stage was tested in different economically-relevant fish species from the Bay of Biscay. Gonads of 9 fish species (, Atlantic, Atlantic-chub and horse mackerel, blue whiting, bogue, European anchovy, hake and pilchard and megrim), collected from local commercial fishing vessels were histologically sexed and 5S and 18S rRNA concentrations were quantified by capillary electrophoresis to calculate a 5S/18S rRNA index. Degenerate primers permitted cloning and sequencing of gtf3a fragments in 7 of the studied species. 5S rRNA and gtf3a transcript levels, together with 5S/18S rRNA index, distinguished clearly ovaries from testis in all of the studied species. The values were always higher in females than in males. 5S/18S rRNA index values in females were always highest when fish were captured in early phases of ovary development whilst, in later vitellogenic stages, the values decreased significantly. In megrim and European anchovy, where gonads in different oogenesis stages were obtained, the 5S/18S rRNA index identified clearly gametogenic stage. This approach, to the sexing and the quantitative non-subjective identification of the maturity stage of female fish, could have multiple applications in the study of fish stock dynamics, fish reproduction and fecundity and fish biology in

  16. The B-WICH chromatin-remodelling complex regulates RNA polymerase III transcription by promoting Max-dependent c-Myc binding.

    PubMed

    Sadeghifar, Fatemeh; Böhm, Stefanie; Vintermist, Anna; Östlund Farrants, Ann-Kristin

    2015-05-19

    The chromatin-remodelling complex B-WICH, comprised of William syndrome transcription factor, the ATPase SNF2h and nuclear myosin, specifically activates RNA polymerase III transcription of the 5S rRNA and 7SL genes. However, the underlying mechanism is unknown. Using high-resolution MN walking we demonstrate here that B-WICH changes the chromatin structure in the vicinity of the 5S rRNA and 7SL RNA genes during RNA polymerase III transcription. The action of B-WICH is required for the binding of the RNA polymerase machinery and the regulatory factors c-Myc at the 5S rRNA and 7SL RNA genes. In addition to the c-Myc binding site at the 5S genes, we have revealed a novel c-Myc and Max binding site in the intergenic spacer of the 5S rDNA. This region also contains a region remodelled by B-WICH. We demonstrate that c-Myc binds to both sites in a Max-dependent way, and thereby activate transcription by acetylating histone H3. The novel binding patterns of c-Myc and Max link transcription of 5S rRNA to the Myc/Max/Mxd network. Since B-WICH acts prior to c-Myc and other factors, we propose a model in which the B-WICH complex is required to maintain an open chromatin structure at these RNA polymerase III genes. This is a prerequisite for the binding of additional regulatory factors. PMID:25883140

  17. 5S RRNA GENE DELETIONS CAUSE AN UNEXPECTEDLY HIGH FITNESS LOSS IN ESCHERICHIA COLI. (R825354)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  18. Trans-splicing and RNA editing of LSU rRNA in Diplonema mitochondria

    PubMed Central

    Valach, Matus; Moreira, Sandrine; Kiethega, Georgette N.; Burger, Gertraud

    2014-01-01

    Mitochondrial ribosomal RNAs (rRNAs) often display reduced size and deviant secondary structure, and sometimes are fragmented, as are their corresponding genes. Here we report a mitochondrial large subunit rRNA (mt-LSU rRNA) with unprecedented features. In the protist Diplonema, the rnl gene is split into two pieces (modules 1 and 2, 534- and 352-nt long) that are encoded by distinct mitochondrial chromosomes, yet the rRNA is continuous. To reconstruct the post-transcriptional maturation pathway of this rRNA, we have catalogued transcript intermediates by deep RNA sequencing and RT-PCR. Gene modules are transcribed separately. Subsequently, transcripts are end-processed, the module-1 transcript is polyuridylated and the module-2 transcript is polyadenylated. The two modules are joined via trans-splicing that retains at the junction ∼26 uridines, resulting in an extent of insertion RNA editing not observed before in any system. The A-tail of trans-spliced molecules is shorter than that of mono-module 2, and completely absent from mitoribosome-associated mt-LSU rRNA. We also characterize putative antisense transcripts. Antisense-mono-modules corroborate bi-directional transcription of chromosomes. Antisense-mt-LSU rRNA, if functional, has the potential of guiding concomitantly trans-splicing and editing of this rRNA. Together, these findings open a window on the investigation of complex regulatory networks that orchestrate multiple and biochemically diverse post-transcriptional events. PMID:24259427

  19. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    PubMed Central

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  20. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  1. Identification of Sex and Female’s Reproductive Stage in Commercial Fish Species through the Quantification of Ribosomal Transcripts in Gonads

    PubMed Central

    Rojo-Bartolomé, Iratxe; Diaz de Cerio, Oihane; Diez, Guzman; Cancio, Ibon

    2016-01-01

    The estimation of maturity and sex of fish stocks in European waters is a requirement of the EU Data Collection Framework as part of the policy to improve fisheries management. On the other hand, research on fish biology is increasingly focused in molecular approaches, researchers needing correct identification of fish sex and reproductive stage without necessarily having in house the histological know-how necessary for the task. Taking advantage of the differential gene transcription occurring during fish sex differentiation and gametogenesis, the utility of 5S ribosomal RNA (5S rRNA) and General transcription factor IIIA (gtf3a) in the molecular identification of sex and gametogenic stage was tested in different economically-relevant fish species from the Bay of Biscay. Gonads of 9 fish species (, Atlantic, Atlantic-chub and horse mackerel, blue whiting, bogue, European anchovy, hake and pilchard and megrim), collected from local commercial fishing vessels were histologically sexed and 5S and 18S rRNA concentrations were quantified by capillary electrophoresis to calculate a 5S/18S rRNA index. Degenerate primers permitted cloning and sequencing of gtf3a fragments in 7 of the studied species. 5S rRNA and gtf3a transcript levels, together with 5S/18S rRNA index, distinguished clearly ovaries from testis in all of the studied species. The values were always higher in females than in males. 5S/18S rRNA index values in females were always highest when fish were captured in early phases of ovary development whilst, in later vitellogenic stages, the values decreased significantly. In megrim and European anchovy, where gonads in different oogenesis stages were obtained, the 5S/18S rRNA index identified clearly gametogenic stage. This approach, to the sexing and the quantitative non-subjective identification of the maturity stage of female fish, could have multiple applications in the study of fish stock dynamics, fish reproduction and fecundity and fish biology in

  2. Secondary structure and domain architecture of the 23S and 5S rRNAs

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hershkovits, Eli; Xue, Yuzhen; Waterbury, Chris C.; Hsiao, Chiaolong; Stepanov, Victor G.; Gaucher, Eric A.; Grover, Martha A.; Harvey, Stephen C.; Hud, Nicholas V.; Wartell, Roger M.; Fox, George E.; Williams, Loren Dean

    2013-01-01

    We present a de novo re-determination of the secondary (2°) structure and domain architecture of the 23S and 5S rRNAs, using 3D structures, determined by X-ray diffraction, as input. In the traditional 2° structure, the center of the 23S rRNA is an extended single strand, which in 3D is seen to be compact and double helical. Accurately assigning nucleotides to helices compels a revision of the 23S rRNA 2° structure. Unlike the traditional 2° structure, the revised 2° structure of the 23S rRNA shows architectural similarity with the 16S rRNA. The revised 2° structure also reveals a clear relationship with the 3D structure and is generalizable to rRNAs of other species from all three domains of life. The 2° structure revision required us to reconsider the domain architecture. We partitioned the 23S rRNA into domains through analysis of molecular interactions, calculations of 2D folding propensities and compactness. The best domain model for the 23S rRNA contains seven domains, not six as previously ascribed. Domain 0 forms the core of the 23S rRNA, to which the other six domains are rooted. Editable 2° structures mapped with various data are provided (http://apollo.chemistry.gatech.edu/RibosomeGallery). PMID:23771137

  3. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana.

    PubMed

    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D

    1992-03-15

    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  4. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  5. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  6. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  7. Regulation of Pol III Transcription by Nutrient and Stress Signaling Pathways

    PubMed Central

    Moir, Robyn D.; Willis, Ian M.

    2012-01-01

    Transcription by RNA polymerase III (pol III) is responsible for ~15% of total cellular transcription through the generation of small structured RNAs such as tRNA and 5S RNA. The coordinate synthesis of these molecules with ribosomal protein mRNAs and rRNA couples the production of ribosomes and their tRNA substrates and balances protein synthetic capacity with the growth requirements of the cell. Ribosome biogenesis in general and pol III transcription in particular is known to be regulated by nutrient availability, cell stress and cell cycle stage and is perturbed in pathological states. High throughput proteomic studies have catalogued modifications to pol III subunits, assembly, initiation and accessory factors but most of these modifications have yet to be linked to functional consequences. Here we review our current understanding of the major points of regulation in the pol III transcription apparatus, the targets of regulation and the signaling pathways known to regulate their function. PMID:23165150

  8. Nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi and their phylogenetic positions

    PubMed Central

    Komiya, Hiroyuki; Hasegawa, Masami; Takemura, Shosuke

    1983-01-01

    The nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi were determined by chemical and enzymatic gel methods. Their phylogenetic positions among metazoans were derived from the 5S rRNA sequences by a computer analysis based on the maximum parsimony principle. It was suggested that the sponge is closely related to several invertebrates and the tunicate has affinity to vertebrates rather than invertebrates. PMID:6835845

  9. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  10. Structure of a Neurospora RNA polymerase I promoter defined by transcription in vitro with homologous extracts.

    PubMed Central

    Tyler, B M; Giles, N H

    1985-01-01

    A Neurospora in vitro transcription system has been developed which specifically and efficiently initiates transcription of a cloned Neurospora crassa ribosomal RNA gene by RNA polymerase I. The initiation site of transcription (both in vitro and in vivo) appears to be located about 850 bp from the 5' end of mature 17S rRNA. However, the primary rRNA transcripts are normally cleaved very rapidly at a site 120-125 nt from the 5' end in vitro and in vivo. The nucleotide sequence surrounding the initiation site has been determined. The region from -16 to +9 exhibits partial homology to the corresponding sequences from a wide variety of organisms including yeast, but the most striking similarity is to the initiation region from Dictyostelium discoideum which displays 73% homology to the Neurospora sequence from -23 to +47. The Neurospora sequences from -96 to +97 have been shown to be sufficient for transcription. This region contains two sequences displaying 8/9 bp matches to elements of the 5S rDNA promoter. Images PMID:2989792

  11. Nucleolin is required for DNA methylation state and the expression of rRNA gene variants in Arabidopsis thaliana.

    PubMed

    Pontvianne, Frédéric; Abou-Ellail, Mohamed; Douet, Julien; Comella, Pascale; Matia, Isabel; Chandrasekhara, Chinmayi; Debures, Anne; Blevins, Todd; Cooke, Richard; Medina, Francisco J; Tourmente, Sylvette; Pikaard, Craig S; Sáez-Vásquez, Julio

    2010-11-01

    In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1). Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre-rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis. PMID:21124873

  12. Nucleolin Is Required for DNA Methylation State and the Expression of rRNA Gene Variants in Arabidopsis thaliana

    PubMed Central

    Pontvianne, Frédéric; Abou-Ellail, Mohamed; Douet, Julien; Comella, Pascale; Matia, Isabel; Chandrasekhara, Chinmayi; DeBures, Anne; Blevins, Todd; Cooke, Richard; Medina, Francisco J.; Tourmente, Sylvette; Pikaard, Craig S.; Sáez-Vásquez, Julio

    2010-01-01

    In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1). Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre–rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis. PMID:21124873

  13. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    PubMed

    Cangelosi, G A; Brabant, W H

    1997-07-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA probes to measure steady-state cellular pre-16S rRNA pools during growth state transitions in Escherichia coli. Pre-16S rRNA became undetectable when cells entered the stationary phase on rich medium and was replenished upon restoration of favorable growth conditions. These fluctuations were of much greater magnitude than concurrent fluctuations in the mature 16S rRNA pool. The extent of pre-16S rRNA depletion depended upon the circumstances limiting growth. It was significantly more pronounced in carbon-energy-starved cells than in nitrogen-starved cells or in cells treated with energy uncouplers. In the presence of the transcriptional inhibitor rifampin, rates of pre-16S rRNA depletion in carbon-energy-starved cells and nitrogen-starved cells were similar, suggesting that the difference between these conditions resides primarily at the level of pre-rRNA synthesis. Chloramphenicol, which inhibits the final steps in rRNA maturation, halted pre-16S rRNA depletion under all conditions. The data show that E. coli cells continue to process pre-rRNA after growth and rrn operon transcription cease, leading to drainage of the pre-rRNA pool. This supports the feasibility of using pre-rRNA-targeted probes to monitor bacterial growth in natural systems, with the caveat that patterns of pre-rRNA depletion vary with the conditions limiting growth. PMID:9226253

  14. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.

    2016-01-01

    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  15. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    PubMed Central

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding. PMID:11350033

  16. Molecular phylogenetic studies on filarial parasites based on 5S ribosomal spacer sequences.

    PubMed

    Xie, H; Bain, O; Williams, S A

    1994-06-01

    This paper is the first large-scale molecular phylogenetic study on filarial parasites (family Onchocercidae) which includes 16 species of 6 genera: Brugia beaveri Ash et Little, 1962, B. buckleyi Dissanaike et Paramananthan, 1961; B. malayi (Brug, 1927) Buckley, 1960; B. pahangi (Buckley et Edeson, 1956) Buckley, 1960; B. patei (Buckley, Nelson et Heisch, 1958) Buckley, 1960; B. timori Partono et al, 1977; Wuchereria bancrofti (Cobbold, 1877) Seurat, 1921: W. kalimantani Palmieri. Purnomo, Dennis and Marwoto, 1980: Mansonella perstans (Manson, 1891) Eberhard et Orihel, 1984; loa loc, Stiles, 1905; Onchocerca volvulus (Leuckart, 1983) Railliet er Henry, 1910; O. ochengi Bwangamoi, 1969; O. gutturosa Neumann, 1910; Dirofilaria immitis (Leidy, 1856) Railliet e Henry, 1911; Acanthocheilonema viteae (Krepkogorskaya, 1933) Bain, Baker et Chabaud, 1982 and Litomosoides sigmodontis Chandler, 1931. 5S rRNA gene spacer region sequence data were collected by PCR, cloning and dideoxy sequencing. The 5S rRNA gene spacer region sequences were aligned and analyzed by maximum parsimony algorithms, distance methods and maximum likelihood methods to construct phylogenetic trees. Bootstrap analysis was used to test the robustness of the different phylogenetic reconstructions. The data indicated that 5S spacer region sequences are highly conserved within species yet differ significantly between species. Spliced leader sequences were observed in all of the 5S rDNA spacers with no sequence variation, although flanking region sequence and length heterogeneity was observed even within species. All of the various tree-building methods gave very similar results. This study identified four clades which are strongly supported by bootstrap analysis the Brugia clade; the Wuchereria clade; the Brugia-Wuchereria clade and the Onchocerca clade. The analyses indicated that L. sigmodontis and A. viteae may be the most primitive among the 16 species studied. The data did not show any close

  17. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  18. Higher-order structure of rRNA

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  19. Secondary structure of Tetrahymena thermophilia 5S ribosomal RNA as revealed by enzymatic digestion and microdensitometric analysis.

    PubMed Central

    Sneath, B; Vary, C; Pavlakis, G; Vournakis, J

    1986-01-01

    The secondary structure of [32P] end-labeled 5S rRNA from Tetrahymena thermophilia (strain B) has been investigated using the enzymes S1 nuclease, cobra venom ribonuclease and T2 ribonuclease. The results, analyzed by scanning microdensitometry and illustrated by three-dimensional computer graphics, support the secondary structure model of Curtiss and Vournakis for 5S rRNA. Aberrent mobility of certain RNA fragments on sequencing gels was observed as regions of band compression. These regions are postulated to be caused by stable internal base-pairing. The molecule was probed with T2 RNase in neutral (pH 7.5) and acidic (pH 4.5) buffers and only minor structural differences were revealed. One of the helices was found to be susceptible to enzymatic attack by both the single-strand and double-strand specific enzymes. These observations are evidence for the existence of dynamic structural equilibria in 5S rRNA. Images PMID:3005972

  20. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-04-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  1. rRNA distribution during microspore development in anthers of Beta vulgaris L. quantitative in situ hybridization analysis.

    PubMed

    Majewska-Sawka, A; Rodriguez-Garcia, M I

    1996-04-01

    We related changes in the ultrastructural organization of the nucleoli with the results of quantitative in situ hybridizations to characterize rRNA metabolism during the development of microspore mother cells in the sugar beet anther (Beta vulgaris L.). In the course of meiotic prophase and early postmeiotic interphase the morphological characteristics of the nucleoli are typical of low or no transcriptional activity and a low rate of rRNA processing. However, we found evidence of an apparent increase in the relative numbers of 18 S rRNA transcripts in some stages of microsporogenesis. This was found in both the nucleoli and cytoplasm of pachytene meiocytes, and in later stages there was a spectacular accumulation of rRNA transcripts in nucleoli of the tetrad cells. Quantitative data are analyzed in the light of morphometric findings in the cell and their compartments to elucidate the degree to which changes in cell size are related to changes in labeling density and distribution. The results are discussed in terms of rRNA synthesis, transport and degradation as processes involved in the regulation of rRNA within microsporocytes and microspores. PMID:8718677

  2. Effects of base change mutations within an Escherichia coli ribosomal RNA leader region on rRNA maturation and ribosome formation

    PubMed Central

    Schäferkordt, Jan; Wagner, Rolf

    2001-01-01

    The effects of base change mutations in a highly conserved sequence (boxC) within the leader of bacterial ribosomal RNAs (rRNAs) was studied. The boxC sequence preceding the 16S rRNA structural gene constitutes part of the RNase III processing site, one of the first cleavage sites on the pathway to mature 16S rRNA. Moreover, rRNA leader sequences facilitate correct 16S rRNA folding, thereby assisting ribosomal subunit formation. Mutations in boxC cause cold sensitivity and result in 16S rRNA and 30S subunit deficiency. Strains in which all rRNA operons are replaced by mutant transcription units are viable. Thermodynamic studies by temperature gradient gel electrophoresis reveal that mutant transcripts have a different, less ordered structure. In addition, RNA secondary structure differences between mutant and wild-type transcripts were determined by chemical and enzymatic probing. Differences are found in the leader RNA sequence itself but also in structurally important regions of the mature 16S rRNA. A minor fraction of the rRNA transcripts from mutant operons is not processed by RNase III, resulting in a significantly extended precursor half-life compared to the wild-type. The boxC mutations also give rise to a new aberrant degradation product of 16S rRNA. This intermediate cannot be detected in strains lacking RNase III. Together the results indicate that the boxC sequence, although important for RNase III processing, is likely to serve additional functions by facilitating correct formation of the mature 16S rRNA structure. They also suggest that quality control steps are acting during ribosome biogenesis. PMID:11504877

  3. Comparative overview of RNA polymerase II and III transcription cycles, with focus on RNA polymerase III termination and reinitiation

    PubMed Central

    Arimbasseri, Aneeshkumar G; Rijal, Keshab; Maraia, Richard J

    2013-01-01

    In eukaryotes, RNA polymerase (RNAP) III transcribes hundreds of genes for tRNAs and 5S rRNA, among others, which share similar promoters and stable transcription initiation complexes (TIC), which support rapid RNAP III recycling. In contrast, RNAP II transcribes a large number of genes with highly variable promoters and interacting factors, which exert fine regulatory control over TIC lability and modifications of RNAP II at different transitional points in the transcription cycle. We review data that illustrate a relatively smooth continuity of RNAP III initiation-elongation-termination and reinitiation toward its function to produce high levels of tRNAs and other RNAs that support growth and development. PMID:25764110

  4. Organization of rRNA structural genes in the archaebacterium Thermoplasma acidophilum.

    PubMed Central

    Tu, J; Zillig, W

    1982-01-01

    In the archaebacterium Thermoplasma acidophilum, each of the structural genes for 5S, 16S and 23S rRNA occur once per genome. In contrast to those of eubacteria and eukaryotes, they appear unlinked. The distance between the 16S and the 23S rDNA is at least 7.5 Kb, that between 23S and 5S rDNA at least 6 Kb and that between 16S and 5S rDNA at least 1.5 Kb. No linkage between those genes has been found by the analysis of recombinant plasmids carrying Bam HI and Hind III rDNA fragments as by hybridizing those plasmids to fragments of Thermoplasma DNA generated by 6 individual restriction endonucleases, recognizing hexanucleotide sequences. Images PMID:7155894

  5. Modified Method of rRNA Structure Analysis Reveals Novel Characteristics of Box C/D RNA Analogues.

    PubMed

    Filippova, J A; Stepanov, G A; Semenov, D V; Koval, O A; Kuligina, E V; Rabinov, I V; Richter, V A

    2015-01-01

    Ribosomal RNA (rRNA) maturation is a complex process that involves chemical modifications of the bases or sugar residues of specific nucleotides. One of the most abundant types of rRNA modifications, ribose 2'-O-methylation, is guided by ribonucleoprotein complexes containing small nucleolar box C/D RNAs. Since the majority of 2'-O-methylated nucleotides are located in the most conserved regions of rRNA that comprise functionally important centers of the ribosome, an alteration in a 2'-O-methylation profile can affect ribosome assembly and function. One of the key approaches for localization of 2'-O-methylated nucleotides in long RNAs is a method based on the termination of reverse transcription. The current study presents an adaptation of this method for the use of fluorescently labeled primers and analysis of termination products by capillary gel electrophoresis on an automated genetic analyzer. The developed approach allowed us to analyze the influence of the synthetic analogues of box C/D RNAs on post-transcriptional modifications of human 28S rRNA in MCF-7 cells. It has been established that the transfection of MCF-7 cells with a box C/D RNA analogue leads to an enhanced modification level of certain native sites of 2'-O-methylation in the target rRNA. The observed effect of synthetic RNAs on the 2'-O-methylation of rRNA in human cells demonstrates a path towards targeted regulation of rRNA post-transcriptional maturation. The described approach can be applied in the development of novel diagnostic methods for detecting diseases in humans. PMID:26085946

  6. Efficient read-through of Tn9 and IS1 by RNA polymerase molecules that initiate at rRNA promoters.

    PubMed Central

    Siehnel, R J; Morgan, E A

    1983-01-01

    Transcription and translation are coupled in most Escherichia coli operons. As a consequence, ribosomes must be present on an mRNA molecule while transcription of the mRNA is in progress or else premature termination of transcription may result. This requirement is most clearly manifested when premature nonsense codons result in polarity in multicistronic operons. Polarity can also result from insertions of transposons and insertion sequences. However, since rRNA operons are not translated, some property of these operons must allow transcription to be uncoupled from translation. In this paper we demonstrate that transposon Tn9 and insertion sequence IS1 are nonpolar or incompletely polar in rRNA operons during normal growth. We also show that essentially all expression of rrn sequences distal to IS1 and Tn9 results from transcripts that originate at rRNA promoters. These results suggest either that rRNA operons possess some mechanism which reduces or prevents termination within rRNA operons or that Tn9 and IS1 can be very inefficient at blocking normal transcription. Insertions of Tn10 in rRNA operons are substantially but incompletely polar. We could not determine whether the residual downstream transcription observed results from promoters within Tn10 or from read-through of Tn10. We discuss the meaning of read-through of Tn9 and IS1 and the residual expression of genes downstream from Tn10 with regard to rRNA operon structure and previous experiments in which polarity of transposons or insertion sequences was observed in protein-encoding operons. Images PMID:6185465

  7. A Pol V–Mediated Silencing, Independent of RNA–Directed DNA Methylation, Applies to 5S rDNA

    PubMed Central

    Douet, Julien; Tutois, Sylvie; Tourmente, Sylvette

    2009-01-01

    The plant-specific RNA polymerases Pol IV and Pol V are essential to RNA–directed DNA methylation (RdDM), which also requires activities from RDR2 (RNA–Dependent RNA Polymerase 2), DCL3 (Dicer-Like 3), AGO4 (Argonaute), and DRM2 (Domains Rearranged Methyltransferase 2). RdDM is dedicated to the methylation of target sequences which include transposable elements, regulatory regions of several protein-coding genes, and 5S rRNA–encoding DNA (rDNA) arrays. In this paper, we have studied the expression of the 5S-210 transcript, a marker of silencing release at 5S RNA genes, to show a differential impact of RNA polymerases IV and V on 5S rDNA arrays during early development of the plant. Using a combination of molecular and cytological assays, we show that Pol IV, RDR2, DRM2, and Pol V, actors of the RdDM, are required to maintain a transcriptional silencing of 5S RNA genes at chromosomes 4 and 5. Moreover, we have shown a derepression associated to chromatin decondensation specific to the 5S array from chromosome 4 and restricted to the Pol V–loss of function. In conclusion, our results highlight a new role for Pol V on 5S rDNA, which is RdDM–independent and comes specifically at chromosome 4, in addition to the RdDM pathway. PMID:19834541

  8. Tamoxifen represses alcohol-induced transcription of RNA polymerase III-dependent genes in breast cancer cells

    PubMed Central

    Zhong, Qian; Shi, Ganggang; Zhang, Qingsong; Lu, Lei; Levy, Daniel; Zhong, Shuping

    2014-01-01

    Alcohol consumption in women has been associated with an increased risk of breast cancer, particular in estrogen receptor positive (ER+) cases. Deregulation of RNA polymerase III-dependent (Pol III) transcription enhances cellular tRNAs and 5S rRNA production, leading to an increase in translational capacity to promote cell transformation and tumor formation. Our recent studies demonstrated that alcohol induces Brf1 expression and Pol III gene transcription via ER. Here, we report that Tamoxifen (Tam) inhibits the induction of Brf1 and Pol III genes in ER+ breast cancer cells. Further analysis indicates that alcohol increases c-Jun expression to upregulate the transcription of Brf1 and Pol III genes, whereas Tam reduces c-Jun expression to repress the transcription of Brf1. Repression of cJun decreases cellular levels of ERα and Brf1. Alcohol-dependent increased occupancy of Brf1 in Pol III gene promoters is reduced by Tam. The repression of Brf1 and Pol III genes by Tam reduces alcohol-induced cell proliferation and colony formation. Together, these results indicate that Tam inhibits alcohol-induced Brf1 expression through c-Jun and ERα to downregulate Pol III gene transcription. Our studies uncover a new mechanism of Tam-treated ER+ breast cancer, by which Tam inhibits tumor growth through repressing Pol III gene transcription. PMID:25400119

  9. Renibacterium salmoninarum isolates from different sources possess two highly conserved copies of the rRNA operon .

    PubMed

    Grayson, T H; Alexander, S M; Cooper, L F; Gilpin, M L

    2000-07-01

    The nucleotide sequences of the rRNA genes and the 5' flanking region were determined for R. salmoninarum ATCC 33209T from overlapping products generated by PCR amplification from the genomic DNA. Comparison of the sequences with rRNA genes from a variety of bacteria demonstrated the close relatedness between R. salmoninarum and the high G+C group of the actinobacteria, in particular, Arthrobacter species. A regulatory element within the 5' leader of the rRNA operon was identical to an element, CL2, described for mycobacteria. PCR, DNA sequence analysis, and DNA hybridisation were performed to examine variation between isolates from diverse sources which represented the four 16S-23S rRNA intergenic spacer sequevars previously described for R. salmoninarum. Two 23S-5S rRNA intergenic spacer sequevars of identical length were found. DNA hybridisation using probes complementary to 23S rDNA and 16S rDNA identified two rRNA operons which were identical or nearly identical amongst 40 isolates sourced from a variety of countries. PMID:11016696

  10. 5S Clavam Biosynthesis Is Controlled by an Atypical Two-Component Regulatory System in Streptomyces clavuligerus

    PubMed Central

    Kwong, Thomas; Zelyas, Nathan J.; Cai, Hui; Tahlan, Kapil; Wong, Annie

    2012-01-01

    Streptomyces clavuligerus produces a collection of five clavam metabolites, including the clinically important β-lactamase inhibitor clavulanic acid, as well as four structurally related metabolites called 5S clavams. The paralogue gene cluster of S. clavuligerus is one of three clusters of genes for the production of these clavam metabolites. A region downstream of the cluster was analyzed, and snk, res1, and res2, encoding elements of an atypical two-component regulatory system, were located. Mutation of any one of the three genes had no effect on clavulanic acid production, but snk and res2 mutants produced no 5S clavams, whereas res1 mutants overproduced 5S clavams. Reverse transcriptase PCR analyses showed that transcription of cvm7p (which encodes a transcriptional activator of 5S clavam biosynthesis) and 5S clavam biosynthetic genes was eliminated in snk and in res2 mutants but that snk and res2 transcription was unaffected in a cvm7p mutant. Both snk and res2 mutants could be complemented by introduction of cvm7p under the control of an independently regulated promoter. In vitro assays showed that Snk can autophosphorylate and transfer its phosphate group to both Res1 and Res2, and Snk-H365, Res1-D52, and Res2-D52 were identified as the phosphorylation sites for the system. Dephosphorylation assays indicated that Res1 stimulates dephosphorylation of Res2∼P. These results suggest a regulatory cascade in which Snk and Res2 form a two-component system controlling cvm7p transcription, with Res1 serving as a checkpoint to modulate phosphorylation levels. Cvm7P then activates transcription of 5S clavam biosynthetic genes. PMID:22751548

  11. Variable rRNA gene copies in extreme halobacteria

    SciTech Connect

    Sanz, J.L.; Marin, I.; Ramirez, L.; Amils, R. ); Abad, J.P.; Smith, C.L. )

    1988-08-25

    Using PFG electrophoresis techniques, the authors have examined the organization of rRNA gene in halobacterium species. The results show that the organization of rRNA genes among closely related halobacteria is quite heterogeneous. This contrasts with the high degree of conservation of rRNA sequence. The possible mechanism of such rRNA gene amplification and its evolutionary implications are discussed.

  12. Differential association of HMG1 and linker histones B4 and H1 with dinucleosomal DNA: structural transitions and transcriptional repression.

    PubMed Central

    Ura, K; Nightingale, K; Wolffe, A P

    1996-01-01

    We examined the structural and functional consequences of incorporating either histone H1, histone B4 or HMG1 into a synthetic dinucleosome containing two 5S rRNA genes. We found that all three proteins bind to linker DNA, stabilizing an additional 20 bp from micrococcal nuclease digestion and restrict nucleosome mobility. Histone H1 has the highest-affinity interaction with the dinucleosome; histone B4 and HMG1 associate with significantly reduced affinities. We found that histone H1 binds to the dinucleosome template with a dissociation constant (KD) of 7.4 nM, whereas the KD is 45 nM for histone B4 and 300 nM for HMG1. The KDs for the interaction of these proteins with naked DNA are 18 nM for H1, 80 nM for B4 and 300 nM for HMG1. The differences in association of these proteins with the dinucleosome are reflected in the efficiency with which the different proteins repress transcription from the 5S rRNA genes. Thus, although all three proteins can contribute to the organization of chromatin, the stability of the structures they assemble will vary. Our results provide a molecular explanation for the transcriptional promiscuity of Xenopus early embryonic chromatin, which is enriched in HMG1 and linker histone B4, but deficient in histone H1. Images PMID:8890169

  13. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    PubMed Central

    Kiryk, Anna; Sowodniok, Katharina; Kreiner, Grzegorz; Rodriguez-Parkitna, Jan; Sönmez, Aynur; Górkiewicz, Tomasz; Bierhoff, Holger; Wawrzyniak, Marcin; Janusz, Artur K.; Liss, Birgit; Konopka, Witold; Schütz, Günther; Kaczmarek, Leszek; Parlato, Rosanna

    2013-01-01

    Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer's disease (AD) and may play a role in dementia. Moreover, aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3, and dentate gyrus (DG). Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that 36 transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF) binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the DG a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving neuronal function. PMID:24273493

  14. 5S RNA sequence from the Philosamia silkworm: evidence for variable evolutionary rates in insect 5S RNA.

    PubMed Central

    Xian-Rong, G; Nicoghosian, K; Cedergren, R J

    1982-01-01

    The primary structure of 5S RNA isolated from the posterior silkgland of Philosamia cynthia ricini was determined using three in vitro labelling techniques. The derived sequence consists of 119 nucleotides and can be folded into the secondary structure model proposed for eukaryotic 5S RNAs. This 5S RNA differs from the Bombyx mori molecule in 9 positions and from the Drosophila melanogaster sequence in 14 positions. The comparison of evolutionary rates in insect 5S RNA with inferred rates in other eukaryotic phyla leads to the conclusion that 5S RNA evolution is not constant in different eukaryotic branches, a condition which must be taken into account in phylogenetic tree constructions. Images PMID:7145713

  15. Control by Phytochrome of Cytoplasmic Precursor rRNA Synthesis in the Cotyledons of Mustard Seedlings 1

    PubMed Central

    Thien, Wilfried; Schopfer, Peter

    1982-01-01

    The influence of phytochrome (high irradiance reaction; operationally, continuous far red light) on the incorporation of [3H]uridine into the cytoplasmic 2.5 megadalton precursor rRNA in the cotyledons of mustard (Sinapis alba L.) seedlings has been investigated. After irradiating 36-hour-old etiolated seedlings with 12 hours of far red light, the rate of incorporation is stimulated about 2-fold, leading to 50% labeling of the precursor rRNA pool about 15 minutes after the tracer has reached the nucleotide precursor pool. In the dark control, there is a significantly smaller pool of precursor rRNA which is half-saturated with label only after about 27 minutes. Since neither the specific radioactivity of the UTP pool nor the processing of the precursor rRNA demonstrate a corresponding light-dependent change, it is concluded that phytochrome mediates an increase of the transcription of the rRNA genes. This gene activation accounts for the increased accumulation of mature cytoplasmic rRNA during the course of photomorphogenesis of the cotyledons. PMID:16662362

  16. Nucleation by rRNA Dictates the Precision of Nucleolus Assembly.

    PubMed

    Falahati, Hanieh; Pelham-Webb, Bobbie; Blythe, Shelby; Wieschaus, Eric

    2016-02-01

    Membrane-less organelles are intracellular compartments specialized to carry out specific cellular functions. There is growing evidence supporting the possibility that such organelles form as a new phase, separating from cytoplasm or nucleoplasm. However, a main challenge to such phase separation models is that the initial assembly, or nucleation, of the new phase is typically a highly stochastic process and does not allow for the spatiotemporal precision observed in biological systems. Here, we investigate the initial assembly of the nucleolus, a membrane-less organelle involved in different cellular functions including ribosomal biogenesis. We demonstrate that the nucleolus formation is precisely timed in D. melanogaster embryos and follows the transcription of rRNA. We provide evidence that transcription of rRNA is necessary for overcoming the highly stochastic nucleation step in the formation of the nucleolus, through a seeding mechanism. In the absence of rDNA, the nucleolar proteins studied are able to form high-concentration assemblies. However, unlike the nucleolus, these assemblies are highly variable in number, location, and time at which they form. In addition, quantitative study of the changes in the nucleoplasmic concentration and distribution of these nucleolar proteins in the wild-type embryos is consistent with the role of rRNA in seeding the nucleolus formation. PMID:26776729

  17. The 9S RNA precursor of Escherichia coli 5S RNA has three structural domains: implications for processing.

    PubMed Central

    Christiansen, J

    1988-01-01

    The secondary structure of the 9S RNA precursor to ribosomal 5S RNA in Escherichia coli has been determined using chemical reagents and ribonucleases in combination with a reverse transcription procedure. The 9S RNA precursor was generated in vitro by T7 RNA polymerase, and the rrnB operon terminator, T1, was able to terminate the in vitro transcript. The secondary structure model exhibits three structural domains corresponding to a 5' region, a mature region and a terminator region. The mature domain is structurally identical to 5S RNA, and the ribosomal proteins L18 and L25 are able to bind to the precursor. The processing endoribonuclease RNase E cleaves between the structural domains. Moreover, an intramolecular refolding of the nascent transcript must take place if the current view of RNase III processing stems is correct. Images PMID:3045757

  18. Karyotypic diversification in Mytilus mussels (Bivalvia: Mytilidae) inferred from chromosomal mapping of rRNA and histone gene clusters

    PubMed Central

    2014-01-01

    Background Mussels of the genus Mytilus present morphologically similar karyotypes that are presumably conserved. The absence of chromosome painting probes in bivalves makes difficult verifying this hypothesis. In this context, we comparatively mapped ribosomal RNA and histone gene families on the chromosomes of Mytilus edulis, M. galloprovincialis, M. trossulus and M. californianus by fluorescent in situ hybridization (FISH). Results Major rRNA, core and linker histone gene clusters mapped to different chromosome pairs in the four taxa. In contrast, minor rRNA gene clusters showed a different behavior. In all Mytilus two of the 5S rDNA clusters mapped to the same chromosome pair and one of them showed overlapping signals with those corresponding to one of the histone H1 gene clusters. The overlapping signals on mitotic chromosomes became a pattern of alternate 5S rRNA and linker histone gene signals on extended chromatin fibers. Additionally, M. trossulus showed minor and major rDNA clusters on the same chromosome pair. Conclusion The results obtained suggest that at least some of the chromosomes bearing these sequences are orthologous and that chromosomal mapping of rRNA and histone gene clusters could be a good tool to help deciphering some of the many unsolved questions in the systematic classification of Mytilidae. PMID:25023072

  19. Microsporidian Encephalitozoon cuniculi, a unicellular eukaryote with an unusual chromosomal dispersion of ribosomal genes and a LSU rRNA reduced to the universal core.

    PubMed Central

    Peyretaillade, E; Biderre, C; Peyret, P; Duffieux, F; Méténier, G; Gouy, M; Michot, B; Vivarès, C P

    1998-01-01

    Microsporidia are eukaryotic parasites lacking mitochondria, the ribosomes of which present prokaryote-like features. In order to better understand the structural evolution of rRNA molecules in microsporidia, the 5S and rDNA genes were investigated in Encephalitozoon cuniculi . The genes are not in close proximity. Non-tandemly arranged rDNA units are on every one of the 11 chromosomes. Such a dispersion is also shown in two other Encephalitozoon species. Sequencing of the 5S rRNA coding region reveals a 120 nt long RNA which folds according to the eukaryotic consensus structural shape. In contrast, the LSU rRNA molecule is greatly reduced in length (2487 nt). This dramatic shortening is essentially due to truncation of divergent domains, most of them being removed. Most variable stems of the conserved core are also deleted, reducing the LSU rRNA to only those structural features preserved in all living cells. This suggests that the E.cuniculi LSU rRNA performs only the basic mechanisms of translation. LSU rRNA phylogenetic analysis with the BASEML program favours a relatively recent origin of the fast evolving microsporidian lineage. Therefore, the prokaryote-like ribosomal features, such as the absence of ITS2, may be derived rather than primitive characters. PMID:9671812

  20. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    PubMed Central

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this region. Linker scanning and deletion mutations in the upstream element, located between nucleotides -156 and -107, cause a three- to fivefold reduction in transcription. Under certain reaction conditions, such as the presence of a high ratio of protein to template or supplementation of the reaction with partially purified protein fractions, sequences upstream of the core element can have an even greater effect (20- to 50-fold) on RNA polymerase I transcription. Primer extension analysis showed that RNA synthesized from all of these mutant templates is initiated at the correct in vivo start site. To examine the functional relationship between the core and the upstream region, mutant promoters were constructed that alter the orientation, distance, or multiplicity of these control elements relative to each other. The upstream control element appears to function in only one orientation, and its position relative to the core is constrained within a fairly narrow region. Moreover, multiple core elements in close proximity to each other have an inhibitory effect on transcription. Images PMID:3785147

  1. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  2. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  3. Analysis of the Precursor rRNA Fractions of Rapidly Growing Mycobacteria: Quantification by Methods That Include the Use of a Promoter (rrnA P1) as a Novel Standard†

    PubMed Central

    Menéndez, María del Carmen; Rebollo, María José; Núñez, María del Carmen; Cox, Robert A.; García, María Jesús

    2005-01-01

    Mycobacterial species are able to control rRNA production through variations in the number and strength of promoters controlling their rrn operons. Mycobacterium chelonae and M. fortuitum are members of the rapidly growing mycobacterial group. They carry a total of five promoters each, encoded, respectively, by one and two rrn operons per genome. Quantification of precursor rrn transcriptional products (pre-rrn) has allowed detection of different promoter usage during cell growth. Bacteria growing in several culture media with different nutrient contents were compared. Balanced to stationary phases were analyzed. Most promoters were found to be used at different levels depending on the stage of bacterial growth and the nutrient content of the culture medium. Some biological implications are discussed. Sequences of the several promoters showed motifs that could be correlated to their particular level of usage. A product corresponding to the first rrnA promoter in both species, namely, rrnA P1, was found to contribute at a low and near-constant level to pre-rRNA synthesis, regardless of the culture medium used and the stage of growth analyzed. This product was used as a standard to quantitate rRNA gene expression by real-time PCR when M. fortuitum infected macrophages. It was shown that this bacterium actively synthesizes rRNA during the course of infection and that one of its rrn operons is preferentially used under such conditions. PMID:15629925

  4. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  5. Simple detection of the 5S ribosomal RNA of Pneumocystis carinii using in situ hybridisation.

    PubMed Central

    Kobayashi, M; Urata, T; Ikezoe, T; Hakoda, E; Uemura, Y; Sonobe, H; Ohtsuki, Y; Manabe, T; Miyagi, S; Miyoshi, I

    1996-01-01

    AIMS: To investigate the effectiveness of digoxigenin incorporated double stranded DNA probes produced by the polymerase chain reaction (PCR), for the detection of Pneumocystis carinii, using in situ hybridisation (ISH). METHODS: Formalin fixed, paraffin wax embedded sections of 26 human lung samples from 11 patients with P carinii pneumonia (PCP), and 15 with various types of fungal and viral pneumonia, were obtained during necropsy or transbronchial lung biopsy. Three additional PCP induced rat lung samples were also tested. PCR probes were prepared using the digoxigenin labelling mixture, and they were amplified from the DNA of a PCP induced rat lung after administration of dexamethasone, on the basis that 5S ribosomal RNA sequences are identical in human and rat P carinii. ISH was performed using this probe, and visualised using the digoxigenin nucleic acid detection kit. An immunohistochemical study using anti-human Pneumocystis monoclonal antibody was also carried out in parallel. RESULTS: ISH positively stained eight (of eight) lung necropsy specimens from patients with PCP, three (of three) transbronchial lung biopsy specimens from patients with PCP, and none of the three PCP induced rat lung specimens. In contrast, none of the specimens from patients with pneumonia caused by Aspergillus sp (n = 5), Candida sp (n = 4), Cryptococcus sp (n = 2), mucormycosis (n = 2), or cytomegalovirus (n = 2) were positive on ISH or immunohistochemistry. CONCLUSIONS: Using a digoxigenin labelled PCR probe for the entire 5S rRNA sequence in conjunction with conventional staining, ISH is highly reactive and specific for the diagnosis of PCP. Images PMID:9038753

  6. Transcription of Trypanosoma brucei maxicircles

    SciTech Connect

    Michelotti, E.F.; Hajduk, S.L.

    1987-05-01

    Trypanosoma brucei is a protozoan parasite which developmentally regulates mitochondrial activity. In the mammal T. brucei produces ATP entirely by glycolysis while cytochrome mediated respiration resumes in the life-stage in the midgut of the insect vector. Using quantitative S1 nuclease protection assays two types of regulation of the steady state levels of the mitochondrial transcripts were found. Transcription of cytochrome b, cytochrome oxidase, and the rRNA genes is repressed in early bloodstream developmental stages, undergoes dramatic activation in later bloodstream stages, and finally a lesser activation in the insect developmental stage. Transcription of NADH dehydrogenase genes, however, is unregulated. Mitochondrial transcripts with a 5' triphosphate terminus, representing the site of transcription initiation, were capped using guanylyl transferase. The in vitro capped RNA hybridized to only one of eight mitochondrial restriction fragments on a Southern blot, however, hybridization of Southern blots with RNA from ..cap alpha..-/sup 32/P-UTP pulsed mitochondria labelled all restriction fragments equally. These results suggest that each DNA strand has a single promoter which directs the transcription of a full-length RNA which is subsequently processed. Different mitochondrial genes, despite being expressed on the same precursor RNA molecule, are independently regulated by both transcription initiation and RNA processing.

  7. Rare Events of Intragenus and Intraspecies Horizontal Transfer of the 16S rRNA Gene

    PubMed Central

    Tian, Ren-Mao; Cai, Lin; Zhang, Wei-Peng; Cao, Hui-Luo; Qian, Pei-Yuan

    2015-01-01

    Horizontal gene transfer (HGT) of operational genes has been widely reported in prokaryotic organisms. However, informational genes such as those involved in transcription and translation processes are very difficult to be horizontally transferred, as described by Woese’s complexity hypothesis. Here, we analyzed all of the completed prokaryotic genome sequences (2,143 genomes) in the NCBI (National Center for Biotechnology Information) database, scanned for genomes with high intragenomic heterogeneity of 16S rRNA gene copies, and explored potential HGT events of ribosomal RNA genes based on the phylogeny, genomic organization, and secondary structures of the ribosomal RNA genes. Our results revealed 28 genomes with relatively high intragenomic heterogeneity of multiple 16S rRNA gene copies (lowest pairwise identity <98.0%), and further analysis revealed HGT events and potential donors of the heterogeneous copies (such as HGT from Chlamydia suis to Chlamydia trachomatis) and mutation events of some heterogeneous copies (such as Streptococcus suis JS14). Interestingly, HGT of the 16S rRNA gene only occurred at intragenus or intraspecies levels, which is quite different from the HGT of operational genes. Our results improve our understanding regarding the exchange of informational genes. PMID:26220935

  8. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  9. Sequences implicated in the processing of Thermus thermophilus HB8 23S rRNA.

    PubMed Central

    Hartmann, R K; Ulbrich, N; Erdmann, V A

    1987-01-01

    Nuclease S1 mapping analyses were performed in order to detect processing intermediates of pre-23S rRNA from Thermus thermophilus HB8. Two processing sites were identified downstream the start of transcription and several consecutive cleavage sites are associated with the mature 5'-end. In the 3'-flanking region one "primary" site and two cleavages which generate short-living intermediates were detected. A series of successive intermediates in the region of the mature 3'-end implies the existence of--in analogy to Escherichia coli--a 3'-exonucleolytic activity. The data were correlated with potential secondary structures within the pre-23S rRNA, which exhibit various repeated sequence elements. M13 sequencing data support the existence of one secondary structural element associated with the strong "primary" cleavage site in the 3'-flanking region. In T. thermophilus we can exclude the formation of an extended base-paired and precursor-specific stem enclosing the 23S rRNA which is inferred to mediate recognition by RNase III in E. coli. Images PMID:3313273

  10. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  11. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  12. Transcriptional activation of RNA polymerase III-dependent genes by the human T-cell leukemia virus type 1 tax protein.

    PubMed Central

    Gottesfeld, J M; Johnson, D L; Nyborg, J K

    1996-01-01

    The human T-cell leukemia virus-encoded tax protein is a potent activator of many viral and cellular genes transcribed by RNA polymerase II. We find that both chromatin and cell extracts derived from human T-cell leukemia virus type 1-infected human T lymphocytes support higher levels of 5S rRNA and tRNA gene transcription than chromatin or extracts from uninfected T lymphocytes. The viral protein Tax was likely responsible for this higher level of class II gene transcription, as purified Tax was found to stimulate both genes when added to the uninfected cell extract or in reconstituted systems. Both limiting-component transcription assays and DNA binding assays identified the class III gene transcription factor TFIIIB as the principle target of Tax activity. Surprisingly, we find that Tax increases the effective concentration of active TFIIIB molecules. These data suggest that Tax stimulates RNA polymerase III-dependent gene expression by accelerating the rate and/or extent of transcription initiation complex assembly. PMID:8657153

  13. Adenovirus type 2 preferentially stimulates polymerase III transcription of Alu elements by relieving repression: a potential role for chromatin.

    PubMed Central

    Russanova, V R; Driscoll, C T; Howard, B H

    1995-01-01

    The number of Alu transcripts that accumulate in HeLa and other human cells is normally very low; however, infection with adenovirus type 5 increases the expression of Alu elements dramatically, indicating that the potential for polymerase III (pol III)-dependent Alu transcription in vivo is far greater than generally observed (B. Panning and J.R. Smiley, Mol. Cell. Biol. 13:3231-3244, 1993). In this study, we employed nuclear run-on in combination with a novel RNase H-based assay to investigate transcription from uninfected and adenovirus type 2-infected nuclei, as well as genomic DNAs from uninfected and infected cells. When performed in the presence of excess uninfected nuclear extract, such assays revealed that (i) the vast majority of transcriptionally competent Alu elements in nuclei are masked from the pol III transcriptional machinery and (ii) the induction of Alu expression upon adenovirus infection can be largely accounted for by an increased availability of these elements to the pol III transcription machinery. We also investigated the role of H1 histone for silencing of Alu genes and, in comparison, mouse B2 repetitive elements. Depletion of H1 led to an approximately 17-fold activation of B2 repetitive elements but did not change Alu transcription relative to that of constitutively expressed 5S rRNA genes. These results are consistent with the view that Alu repeats are efficiently sequestered by chromatin proteins, that such masking cannot be accounted for by nonspecific H1-dependent repression, and that adenovirus infection at least partially overrides the repressive mechanism(s). PMID:7623822

  14. Alteration of BRCA1 expression affects alcohol-induced transcription of RNA Pol III-dependent genes

    PubMed Central

    Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Lu, Lei; Levy, Daniel; Zhong, Shuping

    2014-01-01

    Emerging evidence has indicated that alcohol consumption is an established risk factor for breast cancer. Deregulation of RNA polymerase III (Pol III) transcription enhances cellular Pol III gene production, leading to an increase in translational capacity to promote cell transformation and tumor formation. We have reported that alcohol intake increases Pol III gene transcription to promote cell transformation and tumor formation in vitro and in vivo. Studies revealed that tumor suppressors, pRb, p53, PTEN and Maf1 repress the transcription of Pol III genes. BRCA1 is a tumor suppressor and its mutation is tightly related to breast cancer development. However, it is not clear whether BRCA1 expression affects alcohol-induced transcription of Pol III genes. At the present studies, we report that restoring BRCA1 in HCC 1937 cells, which is a BRCA1 deficient cell line, represses Pol III gene transcription. Expressing mutant or truncated BRCA1 in these cells does not affect the ability of repression on Pol III genes. Our analysis has demonstrated that alcohol induces Pol III gene transcription. More importantly, overexpression of BRCA1 in estrogen receptor positive (ER+) breast cancer cells (MCF-7) decreases the induction of tRNALeu and 5S rRNA genes by alcohol, whereas reduction of BRCA1 by its siRNA slightly increases the transcription of the class of genes. This suggests that BRCA1 is associated with alcohol-induced deregulation of Pol III genes. These studies for the first time demonstrate the role of BRCA1 in induction of Pol III genes by alcohol and uncover a novel mechanism of alcohol-associated breast cancer. PMID:25447904

  15. Mitochondrial m.1584A 12S m62A rRNA methylation in families with m.1555A>G associated hearing loss.

    PubMed

    O'Sullivan, Mary; Rutland, Paul; Lucas, Deirdre; Ashton, Emma; Hendricks, Sebastian; Rahman, Shamima; Bitner-Glindzicz, Maria

    2015-02-15

    The mitochondrial DNA mutation m.1555A>G predisposes to hearing loss following aminoglycoside antibiotic exposure in an idiosyncratic dose-independent manner. However, it may also cause maternally inherited hearing loss in the absence of aminoglycoside exposure or any other clinical features (non-syndromic hearing loss). Although m.1555A>G was identified as a cause of deafness more than twenty years ago, the pathogenic mechanism of this mutation of ribosomal RNA remains controversial. Different mechanistic concepts have been proposed. Most recently, evidence from cell lines and animal models suggested that patients with m.1555A>G may have more 12S rRNA N6, N6-dimethyladenosine (m(6) 2A) methylation than controls, so-called 'hypermethylation'. This has been implicated as a pathogenic mechanism of mitochondrial dysfunction but has yet to be validated in patients. 12S m(6) 2A rRNA methylation, by the mitochondrial transcription factor 1 (TFB1M) enzyme, occurs at two successive nucleotides (m.1584A and m.1583A) in close proximity to m.1555A>G. We examined m(6) 2A methylation in 14 patients with m.1555A>G, and controls, and found all detectable 12S rRNA transcripts to be methylated in both groups. Moreover, different RNA samples derived from the same patient (lymphocyte, fibroblast and lymphoblast) revealed that only transformed cells contained some unmethylated 12S rRNA transcripts, with all detectable 12S rRNA transcripts derived from primary samples m(6) 2A-methylated. Our data indicate that TFB1M 12S m(6) 2A rRNA hypermethylation is unlikely to be a pathogenic mechanism and may be an artefact of previous experimental models studied. We propose that RNA methylation studies in experimental models should be validated in primary clinical samples to ensure that they are applicable to the human situation. PMID:25305075

  16. De novo Synthesis and Assembly of rRNA into Ribosomal Subunits during Cold Acclimation in Escherichia coli.

    PubMed

    Piersimoni, Lolita; Giangrossi, Mara; Marchi, Paolo; Brandi, Anna; Gualerzi, Claudio O; Pon, Cynthia L

    2016-04-24

    During the cold adaptation that follows a cold stress, bacterial cells undergo many physiological changes and extensive reprogramming of their gene expression pattern. Bulk gene expression is drastically reduced, while a set of cold shock genes is selectively and transiently expressed. The initial stage of cold acclimation is characterized by the establishment of a stoichiometric imbalance of the translation initiation factors (IFs)/ribosomes ratio that contributes to the preferential translation of cold shock transcripts. Whereas de novo synthesis of the IFs following cold stress has been documented, nothing was known concerning the activity of the rrn operons during the cold acclimation period. In this work, we focus on the expression of the rrn operons and the fate of rRNA after temperature downshift. We demonstrate that in Escherichia coli, rRNA synthesis does not stop during the cold acclimation phase, but continues with greater contribution of the P2 compared to the P1 promoter and all seven rrn operons are active, although their expression levels change with respect to pre-stress conditions. Eight hours after the 37°→10°C temperature downshift, the newly transcribed rRNA represents up to 20% of total rRNA and is preferentially found in the polysomes. However, with respect to the de novo synthesis of the IFs, both rRNA transcription and maturation are slowed down drastically by cold stress, thereby accounting in part for the stoichiometric imbalance of the IFs/ribosomes. Overall, our data indicate that new ribosomes, which are possibly suitable to function at low temperature, are slowly assembled during cold acclimation. PMID:26953262

  17. Epigenetic repression of ribosomal RNA transcription by ROCK-dependent aberrant cytoskeletal organization

    PubMed Central

    Wu, Tse-Hsiang; Kuo, Yuan-Yeh; Lee, Hsiao-Hui; Kuo, Jean-Cheng; Ou, Meng-Hsin; Chang, Zee-Fen

    2016-01-01

    It is known that ribosomal RNA (rRNA) synthesis is regulated by cellular energy and proliferation status. In this study, we investigated rRNA gene transcription in response to cytoskeletal stress. Our data revealed that the cell shape constrained by isotropic but not elongated micropatterns in HeLa cells led to a significant reduction in rRNA transcription dependent on ROCK. Expression of a dominant-active form of ROCK also repressed rRNA transcription. Isotropic constraint and ROCK over-activation led to different types of aberrant F-actin organization, but their suppression effects on rRNA transcription were similarly reversed by inhibition of histone deacetylase (HDAC) or overexpression of a dominant negative form of Nesprin, which shields the signal transmitted from actin filament to the nuclear interior. We further showed that the binding of HDAC1 to the active fraction of rDNA genes is increased by ROCK over-activation, thus reducing H3K9/14 acetylation and suppressing transcription. Our results demonstrate an epigenetic control of active rDNA genes that represses rRNA transcription in response to the cytoskeletal stress. PMID:27350000

  18. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    PubMed Central

    2010-01-01

    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  19. A single base change in the Shine-Dalgarno region of 16S rRNA of Escherichia coli affects translation of many proteins.

    PubMed Central

    Jacob, W F; Santer, M; Dahlberg, A E

    1987-01-01

    A single base mutation was constructed at position 1538 of Escherichia coli 16S rRNA, changing a cytidine to a uridine. This position is in the Shine-Dalgarno region, thought to be involved in base-pairing to mRNA during initiation of protein synthesis. The mutation was constructed by using a synthetic oligodeoxynucleotide that differs in sequence by one base from the wild-type sequence of 16S rRNA. This oligonucleotide was used as a primer on single-stranded DNA of phage M13, into which was cloned a specific region of DNA encoding 16S rRNA. The mutation is lethal when expressed from the normal promoters of rRNA operons, P1 and P2, in a high-copy-number plasmid. Expression can be repressed by a temperature-sensitive repressor, cI857, in combination with the bacteriophage lambda PL promoter. Induction of transcription by temperature shift yields mutant 16S rRNA that is processed and assembled into functional ribosomal subunits. The presence of mutant ribosomes retards cell growth and dramatically alters incorporation of [35S]methionine into a large proportion of the cellular proteins. The change in level of synthesis of individual proteins correlates with the change in base-pairing between mutant rRNA and the Shine-Dalgarno region of the mRNA. Images PMID:2440027

  20. Inhibition of transcription factor IIIA-DNA interactions by xenobiotic metal ions.

    PubMed

    Hanas, J S; Gunn, C G

    1996-03-01

    Transcription factor IIIA (TFIIIA), a cysteine-rich regulatory protein, is the prototype for the largest known superfamily of eukaryotic transcription factors. Members of the TFIIIA superfamily contain Cys2His2 zinc finger domains responsible for nucleic acid binding. Xenobiotic metal ions, which lack known biological function, were previously used as probes for the structure and function of steroid hormone receptors which contain Cys2Cys2 zinc finger domains. Structural alterations in cysteine-rich regulatory proteins by such ions in vivo might potentiate carcinogenesis and other disease processes. In the present study cadmium and other xenobiotic metal ions were used to probe the structure and function of TFIIIA. The specific interaction of TFIIIA with the internal control region (ICR) of the 5S RNA gene, as assayed by DNase I protection, was inhibited by Cd2+ ion concentrations of > or = 0.1 microM. Aluminum ions were also found to inhibit the TFIIIA-5S RNA gene interaction, albeit at higher concentrations (> or = 5 microM). Inhibition by either metal ion was not readily reversible. Other xenobiotic metal ions, such as mercury or cesium, were not found to be inhibitory under these conditions. None of these ions at the concentrations used in this study affected the ability of DNase I to digest DNA or restriction enzymes to specifically cleave DNA. Preincubation of TFIIIA bound to 5S RNA with either Cd2+ or Al3+ resulted in subsequent DNA binding upon dilution and RNA removal, whereas preincubation of free TFIIIA with the metal ions resulted in inhibition of subsequent DNA binding. Because 5S rRNA also binds the TFIIIA zinc finger domains, these results indicate that the 5S RNA bound to TFIIIA protects the protein from metal inhibition and implicates the zinc fingers in the inhibition mechanism. The nature of the footprint inhibition indicates that the N-terminal fingers of TFIIIA are affected by the metal ions. Cd2+ and Al3+ ions also inhibited the ability of

  1. Inhibition of transcription factor IIIA-DNA interactions by xenobiotic metal ions.

    PubMed Central

    Hanas, J S; Gunn, C G

    1996-01-01

    Transcription factor IIIA (TFIIIA), a cysteine-rich regulatory protein, is the prototype for the largest known superfamily of eukaryotic transcription factors. Members of the TFIIIA superfamily contain Cys2His2 zinc finger domains responsible for nucleic acid binding. Xenobiotic metal ions, which lack known biological function, were previously used as probes for the structure and function of steroid hormone receptors which contain Cys2Cys2 zinc finger domains. Structural alterations in cysteine-rich regulatory proteins by such ions in vivo might potentiate carcinogenesis and other disease processes. In the present study cadmium and other xenobiotic metal ions were used to probe the structure and function of TFIIIA. The specific interaction of TFIIIA with the internal control region (ICR) of the 5S RNA gene, as assayed by DNase I protection, was inhibited by Cd2+ ion concentrations of > or = 0.1 microM. Aluminum ions were also found to inhibit the TFIIIA-5S RNA gene interaction, albeit at higher concentrations (> or = 5 microM). Inhibition by either metal ion was not readily reversible. Other xenobiotic metal ions, such as mercury or cesium, were not found to be inhibitory under these conditions. None of these ions at the concentrations used in this study affected the ability of DNase I to digest DNA or restriction enzymes to specifically cleave DNA. Preincubation of TFIIIA bound to 5S RNA with either Cd2+ or Al3+ resulted in subsequent DNA binding upon dilution and RNA removal, whereas preincubation of free TFIIIA with the metal ions resulted in inhibition of subsequent DNA binding. Because 5S rRNA also binds the TFIIIA zinc finger domains, these results indicate that the 5S RNA bound to TFIIIA protects the protein from metal inhibition and implicates the zinc fingers in the inhibition mechanism. The nature of the footprint inhibition indicates that the N-terminal fingers of TFIIIA are affected by the metal ions. Cd2+ and Al3+ ions also inhibited the ability of

  2. UV light-induced DNA lesions cause dissociation of yeast RNA polymerases-I and establishment of a specialized chromatin structure at rRNA genes

    PubMed Central

    Tremblay, Maxime; Charton, Romain; Wittner, Manuel; Levasseur, Geneviève; Griesenbeck, Joachim; Conconi, Antonio

    2014-01-01

    The cytotoxicity of UV light-induced DNA lesions results from their interference with transcription and replication. DNA lesions arrest elongating RNA polymerases, an event that triggers transcription-coupled nucleotide excision repair. Since arrested RNA polymerases reduce the accessibility of repair factors to DNA lesions, they might be displaced. The fate of arrested RNA polymerases-II at DNA lesions has been extensively studied, yielding partially contradictory results. Considerably less is known about RNA polymerases-I that transcribe nucleosomes-depleted rRNA genes at very high rate. To investigate the fate of arrested RNA polymerases-I at DNA lesions, chromatin-immunoprecipitation, electron microscopy, transcription run-on, psoralen-cross-linking and chromatin-endogenous cleavage were employed. We found that RNA polymerases-I density increased at the 5′-end of the gene, likely due to continued transcription initiation followed by elongation and pausing/release at the first DNA lesion. Most RNA polymerases-I dissociated downstream of the first DNA lesion, concomitant with chromatin closing that resulted from deposition of nucleosomes. Although nucleosomes were deposited, the high mobility group-box Hmo1 (component of actively transcribed rRNA genes) remained associated. After repair of DNA lesions, Hmo1 containing chromatin might help to restore transcription elongation and reopening of rRNA genes chromatin. PMID:24097442

  3. Point mutations in the 3' minor domain of 16S rRNA of E.coli.

    PubMed Central

    Jemiolo, D K; Zwieb, C; Dahlberg, A E

    1985-01-01

    Point mutations were produced near the 3' end of E. coli 16S rRNA by bisulfite mutagenesis in a 121 base loop-out (1385 to 1505) in a heteroduplex of wild type (pKK3535) and deletion mutant plasmids. Two highly conserved, single stranded regions flank an irregular helix (1409-1491) in the area studied. Only a single mutation was isolated in the flanking regions, a transition at C1402, (normally methylated on the base and ribose in rRNA). Mutations occurred throughout the irregular helix. All mutant rRNAs were processed and assembled into 30S subunits capable of interacting with 50S subunits. Growth rates ranged from faster to significantly slower than cells with the wild type transcript. In particular, mutations at C1467 or C1469 cause slow growth. These two transitions (in a bulge region within the helix) reduced the bulge by additional base pairing. PMID:3909106

  4. Quantitative Northern Blot Analysis of Mammalian rRNA Processing.

    PubMed

    Wang, Minshi; Pestov, Dimitri G

    2016-01-01

    Assembly of eukaryotic ribosomes is an elaborate biosynthetic process that begins in the nucleolus and requires hundreds of cellular factors. Analysis of rRNA processing has been instrumental for studying the mechanisms of ribosome biogenesis and effects of stress conditions on the molecular milieu of the nucleolus. Here, we describe the quantitative analysis of the steady-state levels of rRNA precursors, applicable to studies in mammalian cells and other organisms. We include protocols for gel electrophoresis and northern blotting of rRNA precursors using procedures optimized for the large size of these RNAs. We also describe the ratio analysis of multiple precursors, a technique that facilitates the accurate assessment of changes in the efficiency of individual pre-rRNA processing steps. PMID:27576717

  5. Quantification of Yeast and Bacterial Gene Transcripts in Retail Cheeses by Reverse Transcription-Quantitative PCR

    PubMed Central

    Straub, Cécile; Castellote, Jessie; Onesime, Djamila; Bonnarme, Pascal; Irlinger, Françoise

    2013-01-01

    The cheese microbiota contributes to a large extent to the development of the typical color, flavor, and texture of the final product. Its composition is not well defined in most cases and varies from one cheese to another. The aim of the present study was to establish procedures for gene transcript quantification in cheeses by reverse transcription-quantitative PCR. Total RNA was extracted from five smear-ripened cheeses purchased on the retail market, using a method that does not involve prior separation of microbial cells. 16S rRNA and malate:quinone oxidoreductase gene transcripts of Corynebacterium casei, Brevibacterium aurantiacum, and Arthrobacter arilaitensis and 26S rRNA and beta tubulin gene transcripts of Geotrichum candidum and Debaryomyces hansenii could be detected and quantified in most of the samples. Three types of normalization were applied: against total RNA, against the amount of cheese, and against a reference gene. For the first two types of normalization, differences of reverse transcription efficiencies from one sample to another were taken into account by analysis of exogenous control mRNA. No good correlation was found between the abundances of target mRNA or rRNA transcripts and the viable cell concentration of the corresponding species. However, in most cases, no mRNA transcripts were detected for species that did not belong to the dominant species. The applications of gene expression measurement in cheeses containing an undefined microbiota, as well as issues concerning the strategy of normalization and the assessment of amplification specificity, are discussed. PMID:23124230

  6. Babesia bovis: Transcriptional analysis of rRNA gene unit expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The complex life cycle of Babesia bovis includes erythrocytic stages in the bovine host and other stages occurring inside its common tick vector Rhipicephalus microplus. In related apicomplexa, changing environmental conditions affect the expression of ribosomal RNA, but it remained unknown whether ...

  7. Imprint of Ancient Evolution on rRNA Folding.

    PubMed

    Lanier, Kathryn A; Athavale, Shreyas S; Petrov, Anton S; Wartell, Roger; Williams, Loren Dean

    2016-08-23

    In a model describing the origin and evolution of the translation system, ribosomal RNA (rRNA) grew in size by accretion [Petrov, A. S., et al. (2015) History of the Ribosome and the Origin of Translation. Proc. Natl. Acad. Sci. U.S.A. 112, 15396-15401]. Large rRNAs were built up by iterative incorporation and encasement of small folded RNAs, in analogy with addition of new LEGOs onto the surface of a preexisting LEGO assembly. In this model, rRNA robustness in folding arises from inherited autonomy of local folding. We propose that rRNAs can be decomposed at various granularities, retaining folding mechanism and folding competence. To test these predictions, we disassembled Domain III of the large ribosomal subunit (LSU). We determined whether local rRNA structure, stability, and folding pathways are autonomous. Thermal melting, chemical footprinting, and circular dichroism were used to infer rules that govern folding of rRNA. We deconstructed Domain III of the LSU rRNA by mapping out its complex multistep melting pathway. We studied Domain III and two equal-size "sub-Domains" of Domain III. The combined results are consistent with a model in which melting transitions of Domain III are conserved upon cleavage into sub-Domains. Each of the eight melting transitions of Domain III corresponds in Tm and ΔH with a transition observed in one of the two isolated sub-Domains. The results support a model in which structure, stability, and folding mechanisms are dominated by local interactions and are unaffected by separation of the sub-Domains. Domain III rRNA is distinct from RNAs that form long-range cooperative interaction networks at early stages of folding or that do not fold reversibly. PMID:27428664

  8. Tracking the interactions of rRNA processing proteins during nucleolar assembly in living cells.

    PubMed

    Angelier, Nicole; Tramier, Marc; Louvet, Emilie; Coppey-Moisan, Maïté; Savino, Tula M; De Mey, Jan R; Hernandez-Verdun, Danièle

    2005-06-01

    Reorganization of the nuclear machinery after mitosis is a fundamental but poorly understood process. Here, we investigate the recruitment of the nucleolar processing proteins in the nucleolus of living cells at the time of nucleus formation. We question the role of the prenucleolar bodies (PNBs), during migration of the processing proteins from the chromosome periphery to sites of rDNA transcription. Surprisingly, early and late processing proteins pass through the same PNBs as demonstrated by rapid two-color four-dimensional imaging and quantification, whereas a different order of processing protein recruitment into nucleoli is supported by differential sorting. Protein interactions along the recruitment pathway were investigated using a promising time-lapse analysis of fluorescence resonance energy transfer. For the first time, it was possible to detect in living cells the interactions between proteins of the same rRNA processing machinery in nucleoli. Interestingly interactions between such proteins also occur in PNBs but not at the chromosome periphery. The dynamics of these interactions suggests that PNBs are preassembly platforms for rRNA processing complexes. PMID:15814843

  9. The cytoplasmic mRNA degradation factor Pat1 is required for rRNA processing.

    PubMed

    Muppavarapu, Mridula; Huch, Susanne; Nissan, Tracy

    2016-04-01

    Pat1 is a key cytoplasmic mRNA degradation factor, the loss of which severely increases mRNA half-lives. Several recent studies have shown that Pat1 can enter the nucleus and can shuttle between the nucleus and the cytoplasm. As a result, many nuclear roles have been proposed for Pat1. In this study, we analyzed four previously suggested nuclear roles of Pat1 and show that Pat1 is not required for efficient pre-mRNA splicing or pre-mRNA decay in yeast. However, lack of Pat1 results in accumulation of pre-rRNA processing intermediates. Intriguingly, we identified a novel genetic relationship between Pat1 and the rRNA decay machinery, specifically the exosome and the TRAMP complex. While the pre-rRNA processing intermediates that accumulate in the pat1 deletion mutant are, at least to some extent, recognized as aberrant by the rRNA degradation machinery, it is unlikely that these accumulations are the cause of their synthetic sick relationship. Here, we show that the dysregulation of the levels of mRNAs related to ribosome biogenesis could be the cause of the accumulation of the pre-rRNA processing intermediates. Although our results support a role for Pat1 in transcription, they nevertheless suggest that the primary cause of the dysregulated mRNA levels is most likely due to Pat1's role in mRNA decapping and mRNA degradation. PMID:26918764

  10. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    PubMed Central

    2010-01-01

    Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s) occurring in 39.6% of the analyzed individuals (both male and female) were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH) was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs) enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement. PMID:20051104

  11. Evolution of rRNA gene clusters and telomeric repeats during explosive genome repatterning in TATERILLUS X (Rodentia, Gerbillinae).

    PubMed

    Dobigny, G; Ozouf-Costaz, C; Bonillo, C; Volobouev, V

    2003-01-01

    A survey of 28S and 5S rRNA gene clusters, and telomeric repeats was performed using single and double FISH in the Taterillus genus (Rodentia, Muridae, Gerbillinae). Taterillus was previously demonstrated to have undergone a very recent and extensive chromosomal evolution. Our FISH results demonstrate that rRNA genes can vary in location and number irrespective of the phylogenetic relationships. Telomeric repeats were detected in pericentromeric and interstitial regions of several chromosomes, thus providing nonambiguous evolutionary footprints of Robertsonian and tandem translocation events. These footprints are discussed in reference to the molecular process of these karyotypical changes. Also, examples of colocation of rDNA clusters and telomeric repeats lend support to their possible involvement in nucleolus formation. Finally, the presence of rRNA genes, and the extensive amplification of telomeric repeats at specific loci within a double X-autosome translocated element which were not observed on the homologous Y1 and Y2, served as basis for an epigenomic hypothesis on X-autosome translocation viability in mammals. PMID:15004471

  12. Analysis of S. cerevisiae RNA Polymerase I Transcription In Vitro.

    PubMed

    Pilsl, Michael; Merkl, Philipp E; Milkereit, Philipp; Griesenbeck, Joachim; Tschochner, Herbert

    2016-01-01

    RNA polymerase I (Pol I) activity is crucial to provide cells with sufficient amounts of ribosomal RNA (rRNA). Synthesis of rRNA takes place in the nucleolus, is tightly regulated and is coordinated with synthesis and assembly of ribosomal proteins, finally resulting in the formation of mature ribosomes. Many studies on Pol I mechanisms and regulation in the model organism S. cerevisiae were performed using either complex in vitro systems reconstituted from more or less purified fractions or genetic analyses. While providing many valuable insights these strategies did not always discriminate between direct and indirect effects in transcription initiation and termination, when mutated forms of Pol I subunits or transcription factors were investigated. Therefore, a well-defined minimal system was developed which allows to reconstitute highly efficient promoter-dependent Pol I initiation and termination of transcription. Transcription can be initiated at a minimal promoter only in the presence of recombinant core factor and extensively purified initiation competent Pol I. Addition of recombinant termination factors triggers transcriptional pausing and release of the ternary transcription complex. This minimal system represents a valuable tool to investigate the direct impact of (lethal) mutations in components of the initiation and termination complexes on the mechanism and regulation of rRNA synthesis. PMID:27576713

  13. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  14. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq

    2015-01-01

    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  15. Preparation of Chromatin Templates to Study RNA Polymerase I Transcription In Vitro.

    PubMed

    Längst, Gernot

    2016-01-01

    Cellular DNA is packaged into chromatin, which is the substrate of all DNA-dependent processes in eukaryotes. The regulation of chromatin requires specialized enzyme activities to allow the access of sequence-specific binding proteins and RNA polymerases. In order to dissect chromatin-dependent features of transcription regulation in detail, in vitro systems to generate defined chromatin templates for transcription are required. I present a protocol that allows the assembly of nucleosomes on ribosomal RNA (rRNA) minigenes by salt gradient dialysis and subsequent sucrose gradient centrifugation. This procedure yields high nucleosome occupancy and high dynamic response in subsequent transcriptional analysis. It provides an invaluable tool to study rRNA gene transcription, as transcription on free DNA is clearly different from the more in vivo-like transcription on reconstituted chromatin templates. PMID:27576714

  16. Epstein-Barr virus induces cellular transcription factors to allow active expression of EBER genes by RNA polymerase III.

    PubMed

    Felton-Edkins, Zoë A; Kondrashov, Alexander; Karali, Dimitra; Fairley, Jennifer A; Dawson, Christopher W; Arrand, John R; Young, Lawrence S; White, Robert J

    2006-11-10

    The EBER genes of Epstein-Barr virus (EBV) are transcribed by RNA polymerase (pol) III to produce untranslated RNAs that are implicated in oncogenesis. These EBER transcripts are the most highly expressed viral gene products in EBV-transformed cells. We have identified changes to the cellular transcription machinery that may contribute to the high levels of EBER RNA. These include phosphorylation of ATF2, which interacts with EBER promoters. A second is induction of TFIIIC, a pol III-specific factor that activates EBER genes; all five subunits of TFIIIC are overexpressed in EBV-positive cells. In addition, EBV induces BDP1, a subunit of the pol III-specific factor TFIIIB. Although BDP1 is the only TFIIIB subunit induced by EBV, its induction is sufficient to stimulate EBER expression in vivo, implying a limiting function. The elevated levels of BDP1 and TFIIIC in EBV-positive cells stimulate production of tRNA, 7SL, and 5S rRNA. Abnormally high expression of these cellular pol III products may contribute to the ability of EBV to enhance growth potential. PMID:16956891

  17. Alternate rRNA secondary structures as regulators of translation.

    PubMed

    Feng, Shu; Li, Heng; Zhao, Jing; Pervushin, Konstantin; Lowenhaupt, Ky; Schwartz, Thomas U; Dröge, Peter

    2011-02-01

    Structural dynamics of large molecular assemblies are intricately linked to function. For ribosomes, macromolecular changes occur especially during mRNA translation and involve participation of ribosomal RNA. Without suitable probes specific to RNA secondary structure, however, elucidation of more subtle dynamic ribosome structure-function relationships, especially in vivo, remains challenging. Here we report that the Z-DNA- and Z-RNA-binding domain Zα, derived from the human RNA editing enzyme ADAR1-L, binds with high stability to specific rRNA segments of Escherichia coli and human ribosomes. Zα impaired in Z-RNA recognition does not associate with ribosomes. Notably, Zα(ADAR1)-ribosome interaction blocks translation in vitro and in vivo, with substantial physiological consequences. Our study shows that ribosomes can be targeted by a protein that specifically recognizes an alternate rRNA secondary structure, and suggests a new mechanism of translational regulation on the ribosome. PMID:21217697

  18. Robust Computational Analysis of rRNA Hypervariable Tag Datasets

    PubMed Central

    Sipos, Maksim; Jeraldo, Patricio; Chia, Nicholas; Qu, Ani; Dhillon, A. Singh; Konkel, Michael E.; Nelson, Karen E.; White, Bryan A.; Goldenfeld, Nigel

    2010-01-01

    Next-generation DNA sequencing is increasingly being utilized to probe microbial communities, such as gastrointestinal microbiomes, where it is important to be able to quantify measures of abundance and diversity. The fragmented nature of the 16S rRNA datasets obtained, coupled with their unprecedented size, has led to the recognition that the results of such analyses are potentially contaminated by a variety of artifacts, both experimental and computational. Here we quantify how multiple alignment and clustering errors contribute to overestimates of abundance and diversity, reflected by incorrect OTU assignment, corrupted phylogenies, inaccurate species diversity estimators, and rank abundance distribution functions. We show that straightforward procedural optimizations, combining preexisting tools, are effective in handling large () 16S rRNA datasets, and we describe metrics to measure the effectiveness and quality of the estimators obtained. We introduce two metrics to ascertain the quality of clustering of pyrosequenced rRNA data, and show that complete linkage clustering greatly outperforms other widely used methods. PMID:21217830

  19. Effects of Cr(III) and CR(VI) on nitrification inhibition as determined by SOUR, function-specific gene expression and 16S rRNA sequence analysis of wastewater nitrifying enrichments

    EPA Science Inventory

    The effect of Cr(III) and Cr(VI) on ammonia oxidation, the transcriptional responses of functional genes involved in nitrification and changes in 16S rRNA level sequences were examined in nitrifying enrichment cultures. The nitrifying bioreactor was operated as a continuous react...

  20. Demonstration of transcriptional regulation of specific genes by phytochrome action

    PubMed Central

    Silverthorne, Jane; Tobin, Elaine M.

    1984-01-01

    We have developed an in vitro transcription system that uses nuclei isolated from Lemna gibba G-3. The in vitro transcripts include sequences homologous to hybridization probes for the small subunit of ribulose-1,5-bisphosphate carboxylase [3-phospho-D-glycerate carboxy-lyase (dimerizing), EC 4.1.1.39], the light-harvesting chlorophyll a/b-protein, and rRNA. Light-harvesting chlorophyll a/b-protein sequences are transcribed to a greater extent in nuclei isolated from plants grown in darkness with 2 min of red light every 8 hr than in nuclei isolated from dark-treated plants. Furthermore, the amount of these transcripts measured in plants given a single minute of red light after dark treatment is increased over the amount measured in dark-treated plants. The effect of red light is at least partially reversible by 10 min of far-red light given immediately after the red light pulse. Transcription of both rRNA and small subunit sequences is also stimulated by a single minute of red light as compared to dark-treated tissue. However, the relative magnitudes of the increases compared to the dark levels are smaller than the increase seen for the chlorophyll a/b-protein, possibly because of the higher level of transcription of these sequences in the dark. The effect of red light on the transcription of small subunit and rRNA sequences is also reversible by immediate treatment with 10 min of far-red light. Pulse chase studies of dark-treated nuclei for up to 110 min do not show substantial turnover of in vitro labeled small subunit and chlorophyll a/b-protein transcripts. We therefore conclude that phytochrome action has induced specific changes in transcription of these genes. Images PMID:16593420

  1. Physical mapping of 5S and 18S-5.8S-26S RNA gene families in polyploid series of Cenchrus ciliaris Linnaeus, 1771 (Poaceae)

    PubMed Central

    Kharrat-Souissi, Amina; Siljak-Yakovlev, Sonja; Pustahija, Fatima; Chaieb, Mohamed

    2012-01-01

    Abstract The Buffelgrass (Cenchrus ciliaris L., Poaceae) is one of the most important pasturage grasses due to its high productivity and good forage qualities. This species possess a high adaptability to bioclimatic constraints of arid zones and may be used for the restoration of degraded arid ecosystems. Tunisian populations present three ploidy levels (4x, 5x and 6x) with a basic chromosome number x=9. This study reported for the first time the distribution of the ribosomal genes (rRNA) for pentaploid and hexaploid cytotypes of Cenchrus ciliaris. Molecular cytogenetic study using double fluorescence in situ hybridization has shown that the two rDNA families, 5S and 18S-5.8S-26S (18S), displayed intraspecific variation in number of loci among different ploidy levels. Each ploidy level was characterized by specific number of both 5S and 18S rDNA loci (two loci in tetraploid, five in pentaploid and six in hexaploid level). For three studied cytotypes (4x, 5x and 6x) all 5S rDNA loci were localized on the subcentromeric region of chromosomes, while 18S loci were situated on the telomeric region of short chromosome arms. Data of the FISH experiments show proportional increase of ribosomal loci number during polyploidization processes. PMID:24260668

  2. Species identification of oral viridans streptococci by restriction fragment polymorphism analysis of rRNA genes.

    PubMed Central

    Rudney, J D; Larson, C J

    1993-01-01

    Oral streptococci formerly classified as Streptococcus sanguis have been divided into six genetic groups. Methods to identify those species by genotype are needed. This study compared restriction fragment polymorphisms of rRNA genes (ribotypes) for seven S. gordonii, three S. sanguis, four S. oralis, three S. mitis, one S. crista, and seven S. parasanguis strains classified in previous DNA hybridization studies, as well as one clinical isolate. DNA was digested with HindIII, PvuII, HindIII and PvuII combined, EcoRI, BamHI, AatII, AlwNI, and DraII. DNA fragments were hybridized with a digoxigenin-labeled cDNA probe obtained by reverse transcription of Escherichia coli 16S and 23S rRNA. S. oralis, S. mitis, and S. parasanguis all showed an isolated 2,290-bp band in AatII ribotypes that was absent from S. gordonii, S. sanguis, and S. crista. The last three groups showed species-specific bands with AatII and also with PvuII. S. oralis could be distinguished from S. mitis and S. parasanguis in AlwNI and DraII ribotypes. S. mitis and S. parasanguis could not be distinguished, since they shared multiple bands in PvuII, AlwNI, and EcoRI patterns. The clinical isolate in the panel was very similar to S. sanguis by all enzymes used. Our findings suggest that ribotyping may be useful for genotypic identification of oral viridans streptococci. Initial digests of clinical isolates might be made with AatII, followed by PvuII or AlwNI. Isolates then could be identified by comparing ribotype patterns with those of reference strains. This approach could facilitate clinical studies of these newly defined species. Images PMID:7691875

  3. Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

  4. Nucleolus-like bodies of fully-grown mouse oocytes contain key nucleolar proteins but are impoverished for rRNA.

    PubMed

    Shishova, Kseniya V; Lavrentyeva, Elena A; Dobrucki, Jurek W; Zatsepina, Olga V

    2015-01-15

    It is well known that fully-grown mammalian oocytes, rather than typical nucleoli, contain prominent but structurally homogenous bodies called "nucleolus-like bodies" (NLBs). NLBs accumulate a vast amount of material, but their biochemical composition and functions remain uncertain. To clarify the composition of the NLB material in mouse GV oocytes, we devised an assay to detect internal oocyte proteins with fluorescein-5-isothiocyanate (FITC) and applied the fluorescent RNA-binding dye acridine orange to examine whether NLBs contain RNA. Our results unequivocally show that, similarly to typical nucleoli, proteins and RNA are major constituents of transcriptionally active (or non-surrounded) NLBs as well as of transcriptionally silent (or surrounded) NLBs. We also show, by exposing fixed oocytes to a mild proteinase K treatment, that the NLB mass in oocytes of both types contains nucleolar proteins that are involved in all major steps of ribosome biogenesis, including rDNA transcription (UBF), early rRNA processing (fibrillarin), and late rRNA processing (NPM1/nucleophosmin/B23, nucleolin/C23), but none of the nuclear proteins tested, including SC35, NOBOX, topoisomerase II beta, HP1α, and H3. The ribosomal RPL26 protein was detected within the NLBs of NSN-type oocytes but is virtually absent from NLBs of SN-type oocytes. Taking into account that the major class of nucleolar RNA is ribosomal RNA (rRNA), we applied fluorescence in situ hybridization with oligonucleotide probes targeting 18S and 28S rRNAs. The results show that, in contrast to active nucleoli, NLBs of fully-grown oocytes are impoverished for the rRNAs, which is consistent with the absence of transcribed ribosomal genes in the NLB mass. Overall, the results of this study suggest that NLBs of fully-grown mammalian oocytes serve for storing major nucleolar proteins but not rRNA. PMID:25481757

  5. Formation of Tertiary Interactions during rRNA GTPase Center Folding.

    PubMed

    Rau, Michael J; Welty, Robb; Tom Stump, W; Hall, Kathleen B

    2015-08-28

    The 60-nt GTPase center (GAC) of 23S rRNA has a phylogenetically conserved secondary structure with two hairpin loops and a 3-way junction. It folds into an intricate tertiary structure upon addition of Mg(2+) ions, which is stabilized by the L11 protein in cocrystal structures. Here, we monitor the kinetics of its tertiary folding and Mg(2+)-dependent intermediate states by observing selected nucleobases that contribute specific interactions to the GAC tertiary structure in the cocrystals. The fluorescent nucleobase 2-aminopurine replaced three individual adenines, two of which make long-range stacking interactions and one that also forms hydrogen bonds. Each site reveals a unique response to Mg(2+) addition and temperature, reflecting its environmental change from secondary to tertiary structure. Stopped-flow fluorescence experiments revealed that kinetics of tertiary structure formation upon addition of MgCl2 are also site specific, with local conformational changes occurring from 5 ms to 4s and with global folding from 1 to 5s. Site-specific substitution with (15)N-nucleobases allowed observation of stable hydrogen bond formation by NMR experiments. Equilibrium titration experiments indicate that a stable folding intermediate is present at stoichiometric concentrations of Mg(2+) and suggest that there are two initial sites of Mg(2+) ion association. PMID:26210661

  6. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.

    PubMed

    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A

    2008-01-01

    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  7. Determining Fungi rRNA Copy Number by PCR

    PubMed Central

    Black, Jonathan; Dean, Timothy; Byfield, Grace; Foarde, Karin; Menetrez, Marc

    2013-01-01

    The goal of this project is to improve the quantification of indoor fungal pollutants via the specific application of quantitative PCR (qPCR). Improvement will be made in the controls used in current qPCR applications. This work focuses on the use of two separate controls within a standard qPCR reaction. The first control developed was the internal standard control gene, benA. This gene encodes for β-tubulin and was selected based on its single-copy nature. The second control developed was the standard control plasmid, which contained a fragment of the ribosomal RNA (rRNA) gene and produced a specific PCR product. The results confirm the multicopy nature of the rRNA region in several filamentous fungi and show that we can quantify fungi of unknown genome size over a range of spore extractions by inclusion of these two standard controls. Advances in qPCR have led to extremely sensitive and quantitative methods for single-copy genes; however, it has not been well established that the rRNA can be used to quantitate fungal contamination. We report on the use of qPCR, combined with two controls, to identify and quantify indoor fungal contaminants with a greater degree of confidence than has been achieved previously. Advances in indoor environmental health have demonstrated that contamination of the built environment by the filamentous fungi has adverse impacts on the health of building occupants. This study meets the need for more accurate and reliable methods for fungal identification and quantitation in the indoor environment. PMID:23543828

  8. Interactions of aminoglycoside antibiotics with rRNA.

    PubMed

    Trylska, Joanna; Kulik, Marta

    2016-08-15

    Aminoglycoside antibiotics are protein synthesis inhibitors applied to treat infections caused mainly by aerobic Gram-negative bacteria. Due to their adverse side effects they are last resort antibiotics typically used to combat pathogens resistant to other drugs. Aminoglycosides target ribosomes. We describe the interactions of aminoglycoside antibiotics containing a 2-deoxystreptamine (2-DOS) ring with 16S rRNA. We review the computational studies, with a focus on molecular dynamics (MD) simulations performed on RNA models mimicking the 2-DOS aminoglycoside binding site in the small ribosomal subunit. We also briefly discuss thermodynamics of interactions of these aminoglycosides with their 16S RNA target. PMID:27528743

  9. Growth rate regulation of rRNA content of a marine Synechococcus (cyanobacterium) strain

    SciTech Connect

    Binder, B.J.; Liu, Y.C.

    1998-09-01

    The relationship between growth rate and rRNA content in a marine Synechococcus strain was examined. A combination of flow cytometry and whole-cell hybridization with fluorescently labeled 16S rRNA-targeted oligonucleotide probes was used to measure the rRNA content of Synechococcus strain WH8101 cells grown at a range of light-limited growth rates. The sensitivity of this approach was sufficient for the analysis of rRNA even in very slowly growing Synechococcus cells. The relationship between growth rate and cellular rRNA content comprised three phases: (1) at low growth rates, rRNA cell{sup {minus}1} remained approximately constant; (2) at intermediate rates, rRNA cell{sup {minus}1} increased proportionally with growth rate; and (3) at the highest, light-saturated rates, rRNA cell{sup {minus}1} dropped abruptly. Total cellular RNA was well correlated with the probe-based measure of rRNA and varied in a similar manner with growth rate. Mean cell volume and rRNA concentration were related to growth rate in a manner similar to rRNA cell{sup {minus}1}, although the overall magnitude linear increase in ribosome efficiency with increasing growth rate, which is consistent with the prevailing prokaryotic model at low growth rates. Taken together, these results support the notion that measurements of cellular rRNA content might be useful for estimating in situ growth rates in natural Synechococcus populations.

  10. Yeast Kre33 and human NAT10 are conserved 18S rRNA cytosine acetyltransferases that modify tRNAs assisted by the adaptor Tan1/THUMPD1

    PubMed Central

    Sharma, Sunny; Langhendries, Jean-Louis; Watzinger, Peter; Kötter, Peter; Entian, Karl-Dieter; Lafontaine, Denis L.J.

    2015-01-01

    The function of RNA is subtly modulated by post-transcriptional modifications. Here, we report an important crosstalk in the covalent modification of two classes of RNAs. We demonstrate that yeast Kre33 and human NAT10 are RNA cytosine acetyltransferases with, surprisingly, specificity toward both 18S rRNA and tRNAs. tRNA acetylation requires the intervention of a specific and conserved adaptor: yeast Tan1/human THUMPD1. In budding and fission yeasts, and in human cells, we found two acetylated cytosines on 18S rRNA, one in helix 34 important for translation accuracy and another in helix 45 near the decoding site. Efficient 18S rRNA acetylation in helix 45 involves, in human cells, the vertebrate-specific box C/D snoRNA U13, which, we suggest, exposes the substrate cytosine to modification through Watson–Crick base pairing with 18S rRNA precursors during small subunit biogenesis. Finally, while Kre33 and NAT10 are essential for pre-rRNA processing reactions leading to 18S rRNA synthesis, we demonstrate that rRNA acetylation is dispensable to yeast cells growth. The inactivation of NAT10 was suggested to suppress nuclear morphological defects observed in laminopathic patient cells through loss of microtubules modification and cytoskeleton reorganization. We rather propose the effects of NAT10 on laminopathic cells are due to reduced ribosome biogenesis or function. PMID:25653167

  11. Yeast Kre33 and human NAT10 are conserved 18S rRNA cytosine acetyltransferases that modify tRNAs assisted by the adaptor Tan1/THUMPD1.

    PubMed

    Sharma, Sunny; Langhendries, Jean-Louis; Watzinger, Peter; Kötter, Peter; Entian, Karl-Dieter; Lafontaine, Denis L J

    2015-02-27

    The function of RNA is subtly modulated by post-transcriptional modifications. Here, we report an important crosstalk in the covalent modification of two classes of RNAs. We demonstrate that yeast Kre33 and human NAT10 are RNA cytosine acetyltransferases with, surprisingly, specificity toward both 18S rRNA and tRNAs. tRNA acetylation requires the intervention of a specific and conserved adaptor: yeast Tan1/human THUMPD1. In budding and fission yeasts, and in human cells, we found two acetylated cytosines on 18S rRNA, one in helix 34 important for translation accuracy and another in helix 45 near the decoding site. Efficient 18S rRNA acetylation in helix 45 involves, in human cells, the vertebrate-specific box C/D snoRNA U13, which, we suggest, exposes the substrate cytosine to modification through Watson-Crick base pairing with 18S rRNA precursors during small subunit biogenesis. Finally, while Kre33 and NAT10 are essential for pre-rRNA processing reactions leading to 18S rRNA synthesis, we demonstrate that rRNA acetylation is dispensable to yeast cells growth. The inactivation of NAT10 was suggested to suppress nuclear morphological defects observed in laminopathic patient cells through loss of microtubules modification and cytoskeleton reorganization. We rather propose the effects of NAT10 on laminopathic cells are due to reduced ribosome biogenesis or function. PMID:25653167

  12. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    PubMed

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  13. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    PubMed

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  14. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  15. The specific isolation of complete 5S rDNA units from chromosome 1A of hexaploid, tetraploid, and diploid wheat species using PCR with head-to-head oriented primers.

    PubMed

    Van Campenhout, S; Stappen, J V; Volckaert, G

    2001-08-01

    The presence of 5S rDNA units on chromosome 1A of Triticum aestivum was shown by the development of a specific PCR test, using head-to-head oriented primers. This primer set allowed the amplification of complete 5S DNA units and was used to isolate SS-Rrna-A1 sequences from polyploid and diploid wheat species. Multiple-alignment and parsimony analyses of the 132 sequences divided the sequences into four types. The isolates from T. aestivum and the tetraploid species (T. dicoccoides, T. dicoccum, T durum, T. araraticum, and T timopheevi) were all of one type, which was shown to be closely related to the type mainly characteristic for T. urartu. The other two types were isolated exclusively from the diploid species T. monococcum, T aegilopoides, T. thaoudar, and T. sinskajae and the hexaploid species T. zhukovski. Triticum monococcum was the only species for which representatives of each of the four sequence types were found to be present. Further, we discuss the possible multicluster arrangement of the 5S-Rrna-A1 array. PMID:11550886

  16. Chromosomal Organization of Rrna Operons in Bacillus Subtilis

    PubMed Central

    Jarvis, E. D.; Widom, R. L.; LaFauci, G.; Setoguchi, Y.; Richter, I. R.; Rudner, R.

    1988-01-01

    Integrative mapping with vectors containing ribosomal DNA sequences were used to complete the mapping of the 10 rRNA gene sets in the endospore forming bacterium Bacillus subtilis. Southern hybridizations allowed the assignment of nine operons to distinct BclI restriction fragments and their genetic locus identified by transductional crosses. Nine of the ten rRNA gene sets are located between 0 and 70° on the genomic map. In the region surrounding cysA14, two sets of closely spaced tandem clusters are present. The first (rrnJ and rrnW) is located between purA16 and cysA14 closely linked to the latter; the second (rrnI, rrnH and rrnG) previously mapped within this area is located between attSPO2 and glpT6. The operons at or near the origin of replication (rrnO,rrnA and rrnJ,rrnW) represent ``hot spots'' of plasmid insertion. PMID:2465199

  17. A position-dependent transcription-activating domain in TFIIIA.

    PubMed

    Mao, X; Darby, M K

    1993-12-01

    Transcription of the Xenopus 5S RNA gene by RNA polymerase III requires the gene-specific factor TFIIIA. To identify domains within TFIIIA that are essential for transcriptional activation, we have expressed C-terminal deletion, substitution, and insertion mutants of TFIIIA in bacteria as fusions with maltose-binding protein (MBP). The MBP-TFIIIA fusion protein specifically binds to the 5S RNA gene internal control region and complements transcription in a TFIIIA-depleted oocyte nuclear extract. Random, cassette-mediated mutagenesis of the carboxyl region of TFIIIA, which is not required for promoter binding, has defined a 14-amino-acid region that is critical for transcriptional activation. In contrast to activators of RNA polymerase II, the activity of the TFIIIA activation domain is strikingly sensitive to its position relative to the DNA-binding domain. When the eight amino acids that separate the transcription-activating domain from the last zinc finger are deleted, transcriptional activity is lost. Surprisingly, diverse amino acids can replace these eight amino acids with restoration of full transcriptional activity, suggesting that the length and not the sequence of this region is important. Insertion of amino acids between the zinc finger region and the transcription-activating domain causes a reduction in transcription proportional to the number of amino acids introduced. We propose that to function, the transcription-activating domain of TFIIIA must be correctly positioned at a minimum distance from the DNA-binding domain. PMID:8246967

  18. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  19. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  20. A search for the Bs meson in Υ(5S) decays

    NASA Astrophysics Data System (ADS)

    Shipsey, Ian

    2004-05-01

    The CLEO III detector has recorded approximately 0.5 fb-1 of e^+ e^- annihilation data at the Υ(5S) resonance. Using this data sample, we have searched for fully reconstructed Bs mesons in the reaction Υ(5S) arrow B_s^(*) barB_s^(*)

  1. The 5S lean method as a tool of industrial management performances

    NASA Astrophysics Data System (ADS)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  2. The nuclear phenotypic plasticity observed in fish during rRNA regulation entails Cajal bodies dynamics

    SciTech Connect

    Alvarez, Marco; Nardocci, Gino; Thiry, Marc; Alvarez, Rodrigo; Reyes, Mauricio; Molina, Alfredo; Vera, M. Ines . E-mail: mvera@unab.cl

    2007-08-17

    Cajal bodies (CBs) are small mobile organelles found throughout the nucleoplasm of animal and plant cells. The dynamics of these organelles involves interactions with the nucleolus. The later has been found to play a substantial role in the compensatory response that evolved in eurythermal fish to adapt to the cyclic seasonal habitat changes, i.e., temperature and photoperiod. Contrary to being constitutive, rRNA synthesis is dramatically regulated between summer and winter, thus affecting ribosomal biogenesis which plays a central role in the acclimatization process. To examine whether CBs, up to now, never described in fish, were also sustaining the phenotypic plasticity observed in nuclei of fish undergoing seasonal acclimatization, we identified these organelles both, by transmission electronic microscopy and immunodetection with the marker protein p80-coilin. We found transcripts in all tissues analyzed. Furthermore we assessed that p80-coilin gene expression was always higher in summer-acclimatized fish when compared to that adapted to the cold season, indicating that p80-coilin expression is modulated upon seasonal acclimatization. Concurrently, CBs were more frequently found in summer-acclimatized carp which suggests that the organization of CBs is involved in adaptive processes and contribute to the phenotypic plasticity of fish cell nuclei observed concomitantly with profound reprogramming of nucleolar components and regulation of ribosomal rRNAs.

  3. Regulation of Plasmodium yoelii Oocyst Development by Strain- and Stage-Specific Small-Subunit rRNA

    PubMed Central

    Qi, Yanwei; Zhu, Feng; Eastman, Richard T.; Fu, Young; Zilversmit, Martine; Pattaradilokrat, Sittiporn; Hong, Lingxian; Liu, Shengfa; McCutchan, Thomas F.; Pan, Weiqing; Xu, Wenyue

    2015-01-01

    ABSTRACT One unique feature of malaria parasites is the differential transcription of structurally distinct rRNA (rRNA) genes at different developmental stages: the A-type genes are transcribed mainly in asexual stages, whereas the S-type genes are expressed mostly in sexual or mosquito stages. Conclusive functional evidence of different rRNAs in regulating stage-specific parasite development, however, is still absent. Here we performed genetic crosses of Plasmodium yoelii parasites with one parent having an oocyst development defect (ODD) phenotype and another producing normal oocysts to identify the gene(s) contributing to the ODD. The parent with ODD—characterized as having small oocysts and lacking infective sporozoites—was obtained after introduction of a plasmid with a green fluorescent protein gene into the parasite genome and subsequent passages in mice. Quantitative trait locus analysis of genome-wide microsatellite genotypes of 48 progeny from the crosses linked an ~200-kb segment on chromosome 6 containing one of the S-type genes (D-type small subunit rRNA gene [D-ssu]) to the ODD. Fine mapping of the plasmid integration site, gene expression pattern, and gene knockout experiments demonstrated that disruption of the D-ssu gene caused the ODD phenotype. Interestingly, introduction of the D-ssu gene into the same parasite strain (self), but not into a different subspecies, significantly affected or completely ablated oocyst development, suggesting a stage- and subspecies (strain)-specific regulation of oocyst development by D-ssu. This study demonstrates that P. yoelii D-ssu is essential for normal oocyst and sporozoite development and that variation in the D-ssu sequence can have dramatic effects on parasite development. PMID:25759501

  4. Correlative Light and Electron Microscopy of Nucleolar Transcription in Saccharomyces cerevisiae.

    PubMed

    Normand, Christophe; Berthaud, Maxime; Gadal, Olivier; Léger-Silvestre, Isabelle

    2016-01-01

    Nucleoli form around RNA polymerase I transcribed ribosomal RNA (rRNA) genes. The direct electron microscopy observation of rRNA genes after nucleolar chromatin spreading (Miller's spreads) constitutes to date the only system to quantitatively assess transcription at a single molecule level. However, the spreading procedure is likely generating artifact and despite being informative, these spread rRNA genes are far from their in vivo situation. The integration of the structural characterization of spread rRNA genes in the three-dimensional (3D) organization of the nucleolus would represent an important scientific achievement. Here, we describe a correlative light and electron microscopy (CLEM) protocol allowing detection of tagged-Pol I by fluorescent microscopy and high-resolution imaging of the nucleolar ultrastructural context. This protocol can be implemented in laboratories equipped with conventional fluorescence and electron microscopes and does not require sophisticated "pipeline" for imaging. PMID:27576708

  5. A Single Acetylation of 18 S rRNA Is Essential for Biogenesis of the Small Ribosomal Subunit in Saccharomyces cerevisiae*

    PubMed Central

    Ito, Satoshi; Akamatsu, Yu; Noma, Akiko; Kimura, Satoshi; Miyauchi, Kenjyo; Ikeuchi, Yoshiho; Suzuki, Takeo; Suzuki, Tsutomu

    2014-01-01

    Biogenesis of eukaryotic ribosome is a complex event involving a number of non-ribosomal factors. During assembly of the ribosome, rRNAs are post-transcriptionally modified by 2′-O-methylation, pseudouridylation, and several base-specific modifications, which are collectively involved in fine-tuning translational fidelity and/or modulating ribosome assembly. By mass-spectrometric analysis, we demonstrated that N4-acetylcytidine (ac4C) is present at position 1773 in the 18 S rRNA of Saccharomyces cerevisiae. In addition, we found an essential gene, KRE33 (human homolog, NAT10), that we renamed RRA1 (ribosomal RNA cytidine acetyltransferase 1) encoding an RNA acetyltransferase responsible for ac4C1773 formation. Using recombinant Rra1p, we could successfully reconstitute ac4C1773 in a model rRNA fragment in the presence of both acetyl-CoA and ATP as substrates. Upon depletion of Rra1p, the 23 S precursor of 18 S rRNA was accumulated significantly, which resulted in complete loss of 18 S rRNA and small ribosomal subunit (40 S), suggesting that ac4C1773 formation catalyzed by Rra1p plays a critical role in processing of the 23 S precursor to yield 18 S rRNA. When nuclear acetyl-CoA was depleted by inactivation of acetyl-CoA synthetase 2 (ACS2), we observed temporal accumulation of the 23 S precursor, indicating that Rra1p modulates biogenesis of 40 S subunit by sensing nuclear acetyl-CoA concentration. PMID:25086048

  6. Pyrosequencing of mcrA and Archaeal 16S rRNA Genes Reveals Diversity and Substrate Preferences of Methanogen Communities in Anaerobic Digesters

    PubMed Central

    Wilkins, David; Lu, Xiao-Ying; Shen, Zhiyong; Chen, Jiapeng

    2014-01-01

    Methanogenic archaea play a key role in biogas-producing anaerobic digestion and yet remain poorly taxonomically characterized. This is in part due to the limitations of low-throughput Sanger sequencing of a single (16S rRNA) gene, which in the past may have undersampled methanogen diversity. In this study, archaeal communities from three sludge digesters in Hong Kong and one wastewater digester in China were examined using high-throughput pyrosequencing of the methyl coenzyme M reductase (mcrA) and 16S rRNA genes. Methanobacteriales, Methanomicrobiales, and Methanosarcinales were detected in each digester, indicating that both hydrogenotrophic and acetoclastic methanogenesis was occurring. Two sludge digesters had similar community structures, likely due to their similar design and feedstock. Taxonomic classification of the mcrA genes suggested that these digesters were dominated by acetoclastic methanogens, particularly Methanosarcinales, while the other digesters were dominated by hydrogenotrophic Methanomicrobiales. The proposed euryarchaeotal order Methanomassiliicoccales and the uncultured WSA2 group were detected with the 16S rRNA gene, and potential mcrA genes for these groups were identified. 16S rRNA gene sequencing also recovered several crenarchaeotal groups potentially involved in the initial anaerobic digestion processes. Overall, the two genes produced different taxonomic profiles for the digesters, while greater methanogen richness was detected using the mcrA gene, supporting the use of this functional gene as a complement to the 16S rRNA gene to better assess methanogen diversity. A significant positive correlation was detected between methane production and the abundance of mcrA transcripts in digesters treating sludge and wastewater samples, supporting the mcrA gene as a biomarker for methane yield. PMID:25381241

  7. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  8. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio

    2008-01-04

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  9. Mouse nucleolin binds to 4.5S RNAh, a small noncoding RNA.

    PubMed

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAh is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAh is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAh-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAhin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAh-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAh recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAh was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus. PMID:17971306

  10. Exchange of Spacer Regions between Rrna Operons in Escherichia Coli

    PubMed Central

    Harvey, S.; Hill, C. W.

    1990-01-01

    The Escherichia coli rRNA operons each have one of two types of spacer separating the 16S and 23S coding regions. The spacers of four operons encode tRNA(Glu2) and the other three encode both tRNA(Ile) and tRNA(Ala 1 B). We have prepared a series of mutants in which the spacer region of a particular rrn operon has been replaced by the opposite type. Included among these were a mutant retaining only a single copy of the tRNA(Glu2) spacer (at rrnG) and another retaining only a single copy of the tRNA(Ile)-tRNA(Ala 1 B) spacer (at rrnA). While both mutants grew more slowly than controls, the mutant deficient in tRNA(Glu2) spacers was more severely affected. At a frequency of 6 X 10(-5), these mutants phenotypically reverted to faster growing types by increasing the copy number of the deficient spacer. In most of these phenotypic revertants, the deficient spacer type appeared in a rrn operon which previously contained the surplus type, bringing the ratio of spacer types closer to normal. In a few cases, these spacer changes were accompanied by an inversion of the chromosomal material between the donor and recipient rrn operons. Two examples of inversion of one-half of the E. coli chromosome between rrnG and rrnH were observed. The correlation of spacer change with inversion indicated that, in these particular cases, the change was due to an intrachromatid gene conversion event accompanied by a reciprocal crossover rather than reciprocal exchange between sister chromatids. PMID:2168847

  11. Intrageneric relationships of Enterococci as determined by reverse transcriptase sequencing of small-subunit rRNA.

    PubMed

    Williams, A M; Rodrigues, U M; Collins, M D

    1991-01-01

    The 16S ribosomal ribonucleic acid (rRNA) sequences of eleven Enterococcus species were determined by reverse transcription in an attempt to clarify their intrageneric relationships. Comparative analysis of the sequence data revealed the presence of several species groups within the genus. The species E. avium, E. malodoratus, E. pseudoavium and E. raffinosus formed a distinct group as did E. durans, E. faecium, E. hirae and E. mundtii and the pair of species E. casseliflavus and E. gallinarum. Of the remaining species, E. cecorum, E. columbae, E. faecalis and E. saccharolyticus formed distinct lines of descent within the genus, whereas E. solitarius displayed a closer affinity with Tetragenococcus halophilus than with other enterococcal species. PMID:1712504

  12. NMD3 regulates both mRNA and rRNA nuclear export in African trypanosomes via an XPOI-linked pathway.

    PubMed

    Bühlmann, Melanie; Walrad, Pegine; Rico, Eva; Ivens, Alasdair; Capewell, Paul; Naguleswaran, Arunasalam; Roditi, Isabel; Matthews, Keith R

    2015-05-19

    Trypanosomes mostly regulate gene expression through post-transcriptional mechanisms, particularly mRNA stability. However, much mRNA degradation is cytoplasmic such that mRNA nuclear export must represent an important level of regulation. Ribosomal RNAs must also be exported from the nucleus and the trypanosome orthologue of NMD3 has been confirmed to be involved in rRNA processing and export, matching its function in other organisms. Surprisingly, we found that TbNMD3 depletion also generates mRNA accumulation of procyclin-associated genes (PAGs), these being co-transcribed by RNA polymerase I with the procyclin surface antigen genes expressed on trypanosome insect forms. By whole transcriptome RNA-seq analysis of TbNMD3-depleted cells we confirm the regulation of the PAG transcripts by TbNMD3 and using reporter constructs reveal that PAG1 regulation is mediated by its 5'UTR. Dissection of the mechanism of regulation demonstrates that it is not dependent upon translational inhibition mediated by TbNMD3 depletion nor enhanced transcription. However, depletion of the nuclear export factors XPO1 or MEX67 recapitulates the effects of TbNMD3 depletion on PAG mRNAs and mRNAs accumulated in the nucleus of TbNMD3-depleted cells. These results invoke a novel RNA regulatory mechanism involving the NMD3-dependent nuclear export of mRNA cargos, suggesting a shared platform for mRNA and rRNA export. PMID:25873624

  13. 104. JOB NO. 1347F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    104. JOB NO. 1347-F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD MOTOR COMPANY; LONGITUDINAL SECTION AND TRUSS DETAILS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  14. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  15. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  16. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  17. Genomic organization and evolution of the 5S ribosomal DNA in Tilapiini fishes.

    PubMed

    Alves-Costa, F A; Wasko, A P; Oliveira, C; Foresti, F; Martins, C

    2006-05-01

    5S rDNA sequences present an intense dynamism and have proved to be valuable as genetic markers to distinguish closed related species and also in the understanding of the evolutionary dynamic of repetitive sequences in the genomes. In order to identify patterns of 5S rDNA organization and their evolution in the genome of fish species, such genomic segment was investigated in the tilapias Oreochromis niloticus and Tilapia rendalli, and in the hybrid O. urolepis hornorum x O. mossambicus. A dual 5S rDNA system was identified in the three analyzed tilapia samples. Although each 5S rDNA class was conserved among the three samples, a distinct 5S rDNA genome organization pattern could be evidenced for each sample. The presence of a dual 5S rDNA system seems to be a general trait among non-related teleost fish orders, suggesting that evolutionary events of duplication have occurred before the divergence of the main groups of teleost fishes. PMID:16850228

  18. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    PubMed Central

    Suslu, Hikmet Turan; Celikoglu, Erhan; Borekcı, Ali; Hıcdonmez, Tufan; Suslu, Hüsnü

    2011-01-01

    Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches. PMID:23125496

  19. Basic Mechanisms in RNA Polymerase I Transcription of the Ribosomal RNA Genes

    PubMed Central

    Goodfellow, Sarah J.; Zomerdijk, Joost C. B. M.

    2013-01-01

    RNA Polymerase (Pol) I produces ribosomal (r)RNA, an essential component of the cellular protein synthetic machinery that drives cell growth, underlying many fundamental cellular processes. Extensive research into the mechanisms governing transcription by Pol I has revealed an intricate set of control mechanisms impinging upon rRNA production. Pol I-specific transcription factors guide Pol I to the rDNA promoter and contribute to multiple rounds of transcription initiation, promoter escape, elongation and termination. In addition, many accessory factors are now known to assist at each stage of this transcription cycle, some of which allow the integration of transcriptional activity with metabolic demands. The organisation and accessibility of rDNA chromatin also impinge upon Pol I output, and complex mechanisms ensure the appropriate maintenance of the epigenetic state of the nucleolar genome and its effective transcription by Pol I. The following review presents our current understanding of the components of the Pol I transcription machinery, their functions and regulation by associated factors, and the mechanisms operating to ensure the proper transcription of rDNA chromatin. The importance of such stringent control is demonstrated by the fact that deregulated Pol I transcription is a feature of cancer and other disorders characterised by abnormal translational capacity. PMID:23150253

  20. Secondary structure of mouse 28S rRNA and general model for the folding of the large rRNA in eukaryotes.

    PubMed Central

    Michot, B; Hassouna, N; Bachellerie, J P

    1984-01-01

    We present a secondary structure model for the entire sequence of mouse 28S rRNA (1) which is based on an extensive comparative analysis of the available eukaryotic sequences, i.e. yeast (2, 3), Physarum polycephalum (4), Xenopus laevis (5) and rat (6). It has been derived with close reference to the models previously proposed for yeast 26S rRNA (2) and for prokaryotic 23S rRNA (7-9). Examination of the recently published eukaryotic sequences confirms that all pro- and eukaryotic large rRNAs share a largely conserved secondary structure core, as already apparent from the previous analysis of yeast 26S rRNA (2). These new comparative data confirm most features of the yeast model (2). They also provide the basis for a few modifications and for new proposals which extend the boundaries of the common structural core (now representing about 85% of E. coli 23S rRNA length) and bring new insights for tracing the structural evolution, in higher eukaryotes, of the domains which have no prokaryotic equivalent and are inserted at specific locations within the common structural core of the large subunit rRNA. PMID:6374617

  1. Chromosomal organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the evolutionary dynamics of multigene families and heterochromatin

    PubMed Central

    2011-01-01

    Background Scarabaeinae beetles show a high level of macro-chromosomal variability, although the karyotypic organization of heterochromatin and multigene families (rDNAs and histone genes) is poorly understood in this group. To better understand the chromosomal organization and evolution in this group, we analyzed the karyotypes, heterochromatin distribution and chromosomal locations of the rRNAs and histone H3 genes in beetles belonging to eight tribes from the Scarabaeinae subfamily (Coleoptera, Scarabaeidae). Results The number of 18S rRNA gene (a member of the 45S rDNA unit) sites varied from one to 16 and were located on the autosomes, sex chromosomes or both, although two clusters were most common. Comparison of the 45S rDNA cluster number and the diploid numbers revealed a low correlation value. However, a comparison between the number of 45S rDNA sites per genome and the quantity of heterochromatin revealed (i) species presenting heterochromatin restricted to the centromeric/pericentromeric region that contained few rDNA sites and (ii) species with a high quantity of heterochromatin and a higher number of rDNA sites. In contrast to the high variability for heterochromatin and 45S rDNA cluster, the presence of two clusters (one bivalent cluster) co-located on autosomal chromosomes with the 5S rRNA and histone H3 genes was highly conserved. Conclusions Our results indicate that the variability of the 45S rDNA chromosomal clusters is not associated with macro-chromosomal rearrangements but are instead related to the spread of heterochromatin. The data obtained also indicate that both heterochromatin and the 45S rDNA loci could be constrained by similar evolutionary forces regulating spreading in the distinct Scarabaeinae subfamily lineages. For the 5S rRNA and the histone H3 genes, a similar chromosomal organization could be attributed to their association/co-localization in the Scarabaeinae karyotypes. These data provide evidence that different evolutionary

  2. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  3. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  4. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  5. In vivo translation of a region within the rrnB 16S rRNA gene of Escherichia coli.

    PubMed Central

    Berg, K L; Squires, C L; Squires, C

    1987-01-01

    In this study we show that a segment of the Escherichia coli rrnB 16S gene can be translated in vivo. Other laboratories have previously reported that there are internal transcription and translation signals and open reading frames within the E. coli rrnB rRNA operon. Their studies revealed a translation start signal followed by a 252-base-pair open reading frame (ORF16) within the 16S gene and detected a promoter (p16) in the same general region by using in vitro RNA polymerase binding and transcription initiation assays. By using plasmid gene fusions of ORF16 to lacZ we showed that an ORF16'-'beta-galactosidase fusion protein was made in vivo. Transcripts encoding the fusion protein were expressed either from the rrnB p1p2 control region or from a hybrid trp-lac promoter (tacP), but the amount of expression was considerably less than for a lacZ control plasmid. We used fusions to the cat gene to show that p16 is one-half as active as lacP. Deletions were used to show that p16 is located within ORF16 and thus cannot promote a transcript encoding the ORF16 peptide. A comparison of sequences from different organisms shows that ORF16 and p16 lie in a highly conserved region of the procaryotic 16S RNA structure. The first 20 amino acids of ORF16 are conserved in most eubacterial and plant organellar sequences, and promoter activity has been detected in this region of the Caulobacter crescentus sequence by other workers. Images PMID:2435709

  6. Boosting transcription by transcription: enhancer-associated transcripts.

    PubMed

    Darrow, Emily M; Chadwick, Brian P

    2013-12-01

    Enhancers are traditionally viewed as DNA sequences located some distance from a promoter that act in cis and in an orientation-independent fashion to increase utilization of specific promoters and thereby regulate gene expression. Much progress has been made over the last decade toward understanding how these distant elements interact with target promoters, but how transcription is enhanced remains an object of active inquiry. Recent reports convey the prevalence and diversity of enhancer transcription and transcripts and support both as key factors with mechanistically distinct, but not mutually exclusive roles in enhancer function. Decoupling the causes and effects of transcription on the local chromatin landscape and understanding the role of enhancer transcripts in the context of long-range interactions are challenges that require additional attention. In this review, we focus on the possible functions of enhancer transcription by highlighting several recent enhancer RNA papers and, within the context of other enhancer studies, speculate on the role of enhancer transcription in regulating differential gene expression. PMID:24178450

  7. Subnuclear partitioning of rRNA genes between the nucleolus and nucleoplasm reflects alternative epiallelic states

    PubMed Central

    Pontvianne, Frederic; Blevins, Todd; Chandrasekhara, Chinmayi; Mozgová, Iva; Hassel, Christiane; Pontes, Olga M.F.; Tucker, Sarah; Mokroš, Petr; Muchová, Veronika; Fajkus, Jiří; Pikaard, Craig S.

    2013-01-01

    Eukaryotes can have thousands of 45S ribosomal RNA (rRNA) genes, many of which are silenced during development. Using fluorescence-activated sorting techniques, we show that active rRNA genes in Arabidopsis thaliana are present within sorted nucleoli, whereas silenced rRNA genes are excluded. DNA methyltransferase (met1), histone deacetylase (hda6), or chromatin assembly (caf1) mutants that disrupt silencing abrogate this nucleoplasmic–nucleolar partitioning. Bisulfite sequencing data indicate that active nucleolar rRNA genes are nearly completely demethylated at promoter CGs, whereas silenced genes are nearly fully methylated. Collectively, the data reveal that rRNA genes occupy distinct but changeable nuclear territories according to their epigenetic state. PMID:23873938

  8. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  9. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan.

    PubMed

    Martínez, Allyson K; Gordon, Emily; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M; Benedik, Michael J; Yanofsky, Charles; Mankin, Alexander S; Vazquez-Laslop, Nora; Sachs, Matthew S; Cruz-Vera, Luis R

    2014-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome's ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the concentration dependence of L-Trp-mediated tna operon induction, whereas the TnaC I19L change suppresses this phenotype, restoring the sensitivity of the translating A2058U mutant ribosome to free L-Trp. These findings suggest that interactions between TnaC residue I19 and 23S rRNA nucleotide A2058 contribute to the creation of a regulatory L-Trp binding site within the translating ribosome. PMID:24137004

  10. Dual function of C/D box small nucleolar RNAs in rRNA modification and alternative pre-mRNA splicing.

    PubMed

    Falaleeva, Marina; Pages, Amadis; Matuszek, Zaneta; Hidmi, Sana; Agranat-Tamir, Lily; Korotkov, Konstantin; Nevo, Yuval; Eyras, Eduardo; Sperling, Ruth; Stamm, Stefan

    2016-03-22

    C/D box small nucleolar RNAs (SNORDs) are small noncoding RNAs, and their best-understood function is to target the methyltransferase fibrillarin to rRNA (for example, SNORD27 performs 2'-O-methylation of A27 in 18S rRNA). Unexpectedly, we found a subset of SNORDs, including SNORD27, in soluble nuclear extract made under native conditions, where fibrillarin was not detected, indicating that a fraction of the SNORD27 RNA likely forms a protein complex different from canonical snoRNAs found in the insoluble nuclear fraction. As part of this previously unidentified complex,SNORD27 regulates the alternative splicing of the transcription factor E2F7p re-mRNA through direct RNA-RNA interaction without methylating the RNA, likely by competing with U1 small nuclear ribonucleoprotein (snRNP). Furthermore, knockdown of SNORD27 activates previously "silent" exons in several other genes through base complementarity across the entire SNORD27 sequence, not just the antisense boxes. Thus, some SNORDs likely function in both rRNA and pre-mRNA processing, which increases the repertoire of splicing regulators and links both processes. PMID:26957605

  11. Subcellular Partitioning of Transcription Factors in Bacillus subtilis

    PubMed Central

    Doherty, Geoff P.; Meredith, Donna H.; Lewis, Peter J.

    2006-01-01

    RNA polymerase (RNAP) requires the interaction of various transcription elongation factors to efficiently transcribe RNA. During transcription of rRNA operons, RNAP forms highly processive antitermination complexes by interacting with NusA, NusB, NusG, NusE, and possibly several unidentified factors to increase elongation rates to around twice those observed for mRNA. In previous work we used cytological assays with Bacillus subtilis to identify the major sites of rRNA synthesis within the cell, which are called transcription foci. Using this cytological assay, in conjunction with both quantitative native polyacrylamide gel electrophoresis and Western blotting, we investigated the total protein levels and the ratios of NusB and NusG to RNAP in both antitermination and mRNA transcription complexes. We determined that the ratio of RNAP to NusG was 1:1 in both antitermination and mRNA transcription complexes, suggesting that NusG plays important regulatory roles in both complexes. A ratio of NusB to RNAP of 1:1 was calculated for antitermination complexes with just a 0.3:1 ratio in mRNA complexes, suggesting that NusB is restricted to antitermination complexes. We also investigated the cellular abundance and subcellular localization of transcription restart factor GreA. We found no evidence which suggests that GreA is involved in antitermination complex formation and that it has a cellular abundance which is around twice that of RNAP. Surprisingly, we found that the vast majority of GreA is associated with RNAP, suggesting that there is more than one binding site for GreA on RNAP. These results indicate that transcription elongation complexes are highly dynamic and are differentially segregated within the nucleoid according to their functions. PMID:16707701

  12. Photoionization study of Xe 5s: ionization cross sections and photoelectron angular distributions

    NASA Astrophysics Data System (ADS)

    Aarthi, G.; Jose, J.; Deshmukh, S.; Radojevic, V.; Deshmukh, P. C.; Manson, S. T.

    2014-01-01

    We report studies of photoelectron angular distribution and cross-section for photoionization of xenon 5s electrons using the relativistic multiconfiguration Tamm-Dancoff (MCTD) approximation. We find that MCTD provides a significantly improved agreement with experiment, compared to some of the other relativistic many body approximations such as the relativistic random phase approximation and the relativistic random phase approximation with relaxation, over the entire photon energy region bracketing the near-threshold 5s Cooper minimum, from the 5s threshold up to about 70 eV. The MCTD results in the length form are in much better agreement with the experiment than those in the velocity form, suggesting residual correlations that must be of importance.

  13. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  14. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  15. Interaction of nucleolin with ribosomal RNA genes and its role in RNA polymerase I transcription

    PubMed Central

    Cong, Rong; Das, Sadhan; Ugrinova, Iva; Kumar, Sanjeev; Mongelard, Fabien; Wong, Jiemin; Bouvet, Philippe

    2012-01-01

    Nucleolin is a multi-functional nucleolar protein that is required for ribosomal RNA gene (rRNA) transcription in vivo, but the mechanism by which nucleolin modulates RNA polymerase I (RNAPI) transcription is not well understood. Nucleolin depletion results in an increase in the heterochromatin mark H3K9me2 and a decrease in H4K12Ac and H3K4me3 euchromatin histone marks in rRNA genes. ChIP-seq experiments identified an enrichment of nucleolin in the ribosomal DNA (rDNA) coding and promoter region. Nucleolin is preferentially associated with unmethylated rRNA genes and its depletion leads to the accumulation of RNAPI at the beginning of the transcription unit and a decrease in UBF along the coding and promoter regions. Nucleolin is able to affect the binding of transcription termination factor-1 on the promoter-proximal terminator T0, thus inhibiting the recruitment of TIP5 and HDAC1 and the establishment of a repressive heterochromatin state. These results reveal the importance of nucleolin for the maintenance of the euchromatin state and transcription elongation of rDNA. PMID:22859736

  16. Magnesium ions mediate contacts between phosphoryl oxygens at positions 2122 and 2176 of the 23S rRNA and ribosomal protein L1.

    PubMed Central

    Drygin, D; Zimmermann, R A

    2000-01-01

    The complex of ribosomal protein L1 with 23S rRNA from Escherichia coli is of great interest because of the unique structural and functional aspects of this ribonucleoprotein domain. We have minimized the binding site for protein L1 on the 23S rRNA to nt 2120-2129, 2159-2162, and 2167-2178. This RNA fragment consists of two helices as well as an interconnecting loop of unknown structure. RNA molecules corresponding to the minimized L1 binding site, in which G, A, U, or C were individually replaced by their deoxyribo- (dN) or alpha-thio- (rNaS) analogs have been synthesized by T7 transcription in vitro and analyzed for their ability to bind protein L1. It has been demonstrated that the substitution of rNaS at position 2122 or 2176 decreases the affinity of the RNA for the protein in the presence of magnesium five- to tenfold, whereas the same changes have little effect on binding in the presence of manganese. This suggests that Rp oxygens in the phosphates preceding positions 2122 and 2176 are coordinated with Mg2+ and may participate in L1-23S rRNA interaction via magnesium bridges. We have also shown that this interaction is impaired by the presence of dC at position 2122 coupled with the presence of deoxyribonucleotide(s) at other positions in the RNA. This study demonstrates that the ribose-phosphate backbone of the helix encompassing nt 2120-2124/2174-2178 is intimately involved in the interaction of protein L1 with the 23S rRNA. In particular, we suggest that this helix is positioned in the cleft between the two domains of protein L1. PMID:11142372

  17. A transfer RNAArg gene of Pelargonium chloroplasts, but not a 5S RNA gene, is efficiently transcribed after injection into Xenopus oocyte nuclei.

    PubMed Central

    Hellmund, D; Metzlaff, M; Serfling, E

    1984-01-01

    We present the primary structure of a chloroplast tRNAArgACG gene of the plant, Pelargonium zonale, and its faithful expression in Xenopus oocyte nuclei. This tRNAArg gene is located 250 bp downstream of a 5S RNA gene within a cloned 5kb long ribosomal DNA segment (Fig. 1). The Pelargonium tRNAArg gene shares 97% and 86% sequence homology with tRNAArgACG genes of Spirodela oligorhiza and Euglena gracilis chloroplasts, respectively, and also extensive homology (70%) with the corresponding gene of E. coli. It lacks an intervening sequence and, like eukaryotic tRNA genes, does not code for the 3' terminal CCA nucleotides. Moreover, the chloroplast tRNAArg gene carries all the sequence elements essential for transcription by vertebrate RNA polymerase III since it is efficiently expressed in Xenopus oocyte nuclei, even in the presence of 1 microgram/ml alpha-amanitin. In Xenopus oocyte nuclei, no transcripts of the chloroplast 5S RNA gene were detected. Images PMID:6209611

  18. Transcription in archaea

    NASA Technical Reports Server (NTRS)

    Kyrpides, N. C.; Ouzounis, C. A.; Woese, C. R. (Principal Investigator)

    1999-01-01

    Using the sequences of all the known transcription-associated proteins from Bacteria and Eucarya (a total of 4,147), we have identified their homologous counterparts in the four complete archaeal genomes. Through extensive sequence comparisons, we establish the presence of 280 predicted transcription factors or transcription-associated proteins in the four archaeal genomes, of which 168 have homologs only in Bacteria, 51 have homologs only in Eucarya, and the remaining 61 have homologs in both phylogenetic domains. Although bacterial and eukaryotic transcription have very few factors in common, each exclusively shares a significantly greater number with the Archaea, especially the Bacteria. This last fact contrasts with the obvious close relationship between the archaeal and eukaryotic transcription mechanisms per se, and in particular, basic transcription initiation. We interpret these results to mean that the archaeal transcription system has retained more ancestral characteristics than have the transcription mechanisms in either of the other two domains.

  19. Direct detection of 16S rRNA in soil extracts by using oligonucleotide microarrays.

    PubMed

    Small, J; Call, D R; Brockman, F J; Straub, T M; Chandler, D P

    2001-10-01

    We report on the development and validation of a simple microarray method for the direct detection of intact 16S rRNA from unpurified soil extracts. Total RNAs from Geobacter chapellei and Desulfovibrio desulfuricans were hybridized to an oligonucleotide array consisting of universal and species-specific 16S rRNA probes. PCR-amplified products from Geobacter and Desulfovibrio were easily and specifically detected under a range of hybridization times, temperatures, and buffers. However, reproducible, specific hybridization and detection of intact rRNA could be accomplished only by using a chaperone-detector probe strategy. With this knowledge, assay conditions were developed for rRNA detection using a 2-h hybridization time at room temperature. Hybridization specificity and signal intensity were enhanced using fragmented RNA. Formamide was required in the hybridization buffer in order to achieve species-specific detection of intact rRNA. With the chaperone detection strategy, we were able to specifically hybridize and detect G. chapellei 16S rRNA directly from a total-RNA soil extract, without further purification or removal of soluble soil constituents. The detection sensitivity for G. chapellei 16S rRNA in soil extracts was at least 0.5 microg of total RNA, representing approximately 7.5 x 10(6) Geobacter cell equivalents of RNA. These results suggest that it is now possible to apply microarray technology to the direct detection of microorganisms in environmental samples, without using PCR. PMID:11571176

  20. Cytoskeletal protein filamin A is a nucleolar protein that suppresses ribosomal RNA gene transcription.

    PubMed

    Deng, Wensheng; Lopez-Camacho, Cesar; Tang, Jen-Yang; Mendoza-Villanueva, Daniel; Maya-Mendoza, Apolinar; Jackson, Dean A; Shore, Paul

    2012-01-31

    Filamin A (FLNA) is an actin-binding protein with a well-established role in the cytoskeleton, where it determines cell shape and locomotion by cross-linking actin filaments. Mutations in FLNA are associated with a wide range of genetic disorders. Here we demonstrate a unique role for FLNA as a nucleolar protein that associates with the RNA polymerase I (Pol I) transcription machinery to suppress rRNA gene transcription. We show that depletion of FLNA by siRNAs increased rRNA expression, rDNA promoter activity and cell proliferation. Immunodepletion of FLNA from nuclear extracts resulted in a decrease in rDNA promoter-driven transcription in vitro. FLNA coimmunoprecipitated with the Pol I components actin, TIF-IA, and RPA40, and their occupancy of the rDNA promoter was increased in the absence of FLNA in vivo. The FLNA actin-binding domain is essential for the suppression of rRNA expression and for inhibiting recruitment of the Pol I machinery to the rDNA promoter. These findings reveal an additional role for FLNA as a regulator of rRNA gene expression and have important implications for our understanding of the role of FLNA in human disease. PMID:22307607

  1. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON QSAR

    EPA Science Inventory

    Dyer, S.D., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to predict HC5's Based on QSARs (Abstract). To be presented at the SETAC Europe 14th Annual Meeting: Environmental Science Solution: A Pan-European Perspective, 18-...

  2. Sacrum fracture following L5-S1 stand-alone interbody fusion for isthmic spondylolisthesis.

    PubMed

    Phan, Kevin; Mobbs, Ralph J

    2015-11-01

    We report a 72-year-old man with a rare sacral fracture following stand-alone L5-S1 anterior lumbar interbody fusion for isthmic spondylolisthesis. The man underwent a minimally invasive management strategy using posterior percutaneous pedicle fixation and partial reduction of the deformity. We also discuss the current literature on fusion procedures for isthmic spondylolisthesis. PMID:26100158

  3. 5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO BRIDGE WITH EAST BRIDGE HOUSE IN RIGHT FOREGROUND. VIEW TO WEST. - MacArthur Bridge, Spanning Mississippi River on Highway 34 between IA & IL, Burlington, Des Moines County, IA

  4. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON MINIMAL DATA

    EPA Science Inventory

    Dyer, S., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to Predict HC5's Based on Minimal Data (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portland, OR. 1 p. (ERL,GB R1013).

  5. [Analysis of 5S rDNA changes in synthetic allopolyploids Triticum x Aegilops].

    PubMed

    Shcherban', A B; Sergeeva, E M; Badaeva, E D; Salina, E A

    2008-01-01

    By the example of three synthetic allopolyploids: Aegilops sharonensis x Ae. umbellulata (2n =28), Triticum urartu x Ae. tauschii (2n =28), T. dicoccoides x Ae. tauschii (2n =42) the 5S rDNA changes at the early stage of allopolyploidization were investigated. Using fluorescent in situ hybridization (FISH), the quantitative changes affecting the separate loci of one of the parental genomes were revealed in plants of S3 generation of each hybrid combination. Souther hybridization with genomic DNA of allopolyploid T. urartu x Ae. tauschii (TMU38 x TQ27) revealed lower intensity of the fragments from Ae. tauschii compared with the T. urartu fragments. It may be confirmation of the reduction of signal on 1D chromosome that was revealed in this hybrid using FISH. Both appearance of a new 5S rDNA fragments and full disappearance of fragments from parental species were not showed by Southern hybridization, as well as PCR-analysis of 5-15 plants of S2-S3 generations. The changes were not found under comparison of primary structure of nine 5S rDNA sequences of allopolyploid TMU38 x TQ27 with analogous sequences from parental species genomes. The observable similarity by FISH results of one of the studied synthetic allopolyploids with natural allopolyploid of similar genome composition indicates the early formation of unique for each allopolyploid 5S rDNA organization. PMID:18856060

  6. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  7. Adaptation of the S-5-S pendulum seismometer for measurement of rotational ground motion

    NASA Astrophysics Data System (ADS)

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-10-01

    The Russian electrodynamic seismometer model S-5-S has been adapted for the measurement of rotational ground motion. The mechanical system of the original S-5-S seismometer consists of electrodynamic sensing and damping transducer coils mounted on an asymmetrical double-arm pendulum. This pendulum is suspended on a footing using two pairs of crossed flat springs, which operate as the axis of rotation. The pendulum is stabilised by an additional spring. The S-5-S can be used either as a vertical or as a horizontal sensor. The adaptation of the S-5-S seismometer described below involves removal of the additional spring and installation of an additional mass on the damping arm. Strain gauge angle sensors are installed on one pair of the crossed flat springs. The main dynamic parameters of the rotational seismometer created in this way, i.e. the natural period and damping, are controlled electronically by feedback currents proportional to the angular displacement and angular velocity, both fed to the damping transducer coil. This new seismometer, named the S-5-SR, enables measurement of the rotational component of ground motion around the horizontal or the vertical axes. The output signal from this S-5-SR seismometer can be proportional either to rotational displacement or rotational velocity.

  8. Chloroplast development at low temperatures requires a homolog of DIM1, a yeast gene encoding the 18S rRNA dimethylase.

    PubMed Central

    Tokuhisa, J G; Vijayan, P; Feldmann, K A; Browse, J A

    1998-01-01

    Poikilothermic organisms require mechanisms that allow survival at chilling temperatures (2 to 15 degreesC). We have isolated chilling-sensitive mutants of Arabidopsis, a plant that is very chilling resistant, and are characterizing them to understand the genes involved in chilling resistance. The T-DNA-tagged mutant paleface1 (pfc1) grows normally at 22 degrees C but at 5 degrees C exhibits a pattern of chilling-induced chlorosis consistent with a disruption of chloroplast development. Genomic DNA flanking the T-DNA was cloned and used to isolate wild-type genomic and cDNA clones. The PFC1 transcript is present at a low level in wild-type plants and was not detected in pfc1 plants. Wild-type Arabidopsis expressing antisense constructs of PFC1 grew normally at 22 degrees C but showed chilling-induced chlorosis, confirming that the gene is essential for low-temperature development of chloroplasts. The deduced amino acid sequence of PFC1 has identity with rRNA methylases found in bacteria and yeast that modify specific adenosines of pre-rRNA transcripts. The pfc1 mutant does not have these modifications in the small subunit rRNA of the plastid. PMID:9596631

  9. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

    PubMed

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

    2016-09-16

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. PMID:27530925

  10. B chromosomes showing active ribosomal RNA genes contribute insignificant amounts of rRNA in the grasshopper Eyprepocnemis plorans.

    PubMed

    Ruiz-Estévez, Mercedes; Badisco, Liesbeth; Broeck, Jozef Vanden; Perfectti, Francisco; López-León, María Dolores; Cabrero, Josefa; Camacho, Juan Pedro M

    2014-12-01

    The genetic inertness of supernumerary (B) chromosomes has recently been called into question after finding several cases of gene activity on them. The grasshopper Eyprepocnemis plorans harbors B chromosomes containing large amounts of ribosomal DNA (rDNA) units, some of which are eventually active, but the amount of rRNA transcripts contributed by B chromosomes, compared to those of the standard (A) chromosomes, is unknown. Here, we address this question by means of quantitative PCR (qPCR) for two different ITS2 amplicons, one coming from rDNA units located in both A and B chromosomes (ITS2(A+B)) and the other being specific to B chromosomes (ITS2(B)). We analyzed six body parts in nine males showing rDNA expression in their B chromosomes in the testis. Amplification of the ITS2(B) amplicon was successful in RNA extracted from all six body parts analyzed, but showed relative quantification (RQ) values four orders of magnitude lower than those obtained for the ITS(A+B) amplicon. RQ values differed significantly between body parts for the two amplicons, with testis, accessory gland and wing muscle showing threefold higher values than head, gastric cecum and hind leg. We conclude that the level of B-specific rDNA expression is extremely low even in individuals where B chromosome rDNA is not completely silenced. Bearing in mind that B chromosomes carry the largest rDNA cluster in the E. plorans genome, we also infer that the relative contribution of B chromosome rRNA genes to ribosome biogenesis is insignificant, at least in the body parts analyzed. PMID:24997085

  11. Dyskerin is required for tumor cell growth through mechanisms that are independent of its role in telomerase and only partially related to its function in precursor rRNA processing

    PubMed Central

    Alawi, Faizan; Lin, Ping

    2010-01-01

    Dyskerin is an essential nucleolar protein required for the biogenesis of ribonucleoproteins that incorporate H/ACA RNAs. Through binding to specific H/ACA RNAs, dyskerin exerts most of its influence in the cell. To that end, dyskerin is a core component of the telomerase complex and is required for normal telomere maintenance. Dyskerin is also required for post-transcriptional processing of precursor rRNA. Germline dyskerin mutations increase cancer susceptibility. Conversely, wild-type dyskerin is usually overexpressed and not mutated in sporadic cancers. However, the contributions of dyskerin to sporadic tumorigenesis are unknown. Described herein, we demonstrate that acute loss of dyskerin function by RNA interference significantly reduced steady-state levels of H/ACA RNAs, disrupted the morphology and inhibited anchorage-independent growth of telomerase-positive and telomerase-negative human cell lines. Unexpectedly, dyskerin depletion only transiently delayed rRNA maturation but with no appreciable effect on the levels of total 18S or 28S rRNA. Instead, while rRNA processing defects typically trigger p53-dependent G1 arrest, dyskerin-depleted cells accumulated in G2/M by a p53-independent mechanism, and this was associated with an accumulation of aberrant mitotic figures that were characterized by multi-polar spindles. Telomerase activity and the rate of rRNA processing are typically increased during neoplasia. However, our cumulative findings indicate that dyskerin contributes to tumor cell growth through mechanisms which do not require the presence of cellular telomerase activity, and which may be only partially dependent upon the protein’s role in rRNA processing. These data also reinforce the notion that loss and gain of dyskerin function may play important roles in tumorigenesis. PMID:21480387

  12. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  13. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  14. Fine mapping of 28S rRNA sites specifically cleaved in cells undergoing apoptosis.

    PubMed Central

    Houge, G; Robaye, B; Eikhom, T S; Golstein, J; Mellgren, G; Gjertsen, B T; Lanotte, M; Døskeland, S O

    1995-01-01

    Bona fide apoptosis in rat and human leukemia cells, rat thymocytes, and bovine endothelial cells was accompanied by limited and specific cleavage of polysome-associated and monosome-associated 28S rRNA, with 18S rRNA being spared. Specific 28S rRNA cleavage was observed in all instances of apoptotic death accompanied by internucleosomal DNA fragmentation, with cleavage of 28S rRNA and of DNA being linked temporally. This indicates that 28S rRNA fragmentation may be as general a feature of apoptosis as internucleosomal DNA fragmentation and that concerted specific cleavage of intra- and extranuclear polynucleotides occurs in apoptosis. Apoptosis-associated cleavage sites were mapped to the 28S rRNA divergent domains D2, D6 (endothelial cells), and D8. The D2 cuts occurred in hairpin loop junctions considered to be buried in the intact ribosome, suggesting that this rRNA region becomes a target for RNase attack in apoptotic cells. D8 was cleaved in two exposed UU(U) sequences in bulge loops. Treatment with agents causing necrotic cell death or aging of cell lysates failed to produce any detectable limited D2 cleavage but did produce a more generalized cleavage in the D8 region. Of potential functional interest was the finding that the primary cuts in D2 exactly flanked a 0.3-kb hypervariable subdomain (D2c), allowing excision of the latter. The implication of hypervariable rRNA domains in apoptosis represents the first association of any functional process with these enigmatic parts of the ribosomes. PMID:7891700

  15. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  16. 1s2s2p2 5p3 5S transition in B ii

    NASA Astrophysics Data System (ADS)

    Mannervik, S.; Cederquist, H.; Martinson, I.; Brage, T.; Froese Fischer, C.

    1987-04-01

    An experimental and theoretical study has been made of the 1s2s2p2 5P-1s2p3 5S transition in B ii. The experimental wavelength and lifetime (1323.92+/-0.07 Å and 0.65+/-0.01 ns), determined by beam-foil spectroscopy, are more than five times more accurate than previous experimental results. Our theoretical data, from multiconfiguration Hartree-Fock calculations, 1311.6 Å and 0.601 ns, are in excellent agreement with previous theoretical predictions of Beck and Nicolaides [Phys. Lett. 61A, 227 (1977)]. We have also observed the 1s2p3 5S-1s2p23s 5P transition, at 857.7+/-0.2 Å, in accord with the theoretical value 859.1 Å.

  17. Optical characterization of CuIn5S8 crystals by ellipsometry measurements

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2016-04-01

    Optical properties of CuIn5S8 crystals grown by Bridgman method were investigated by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficients were obtained from the analysis of ellipsometry experiments performed in the 1.2-6.2 eV spectral region. Analysis of spectral dependence of the absorption coefficient revealed the existence of direct band gap transitions with energy 1.53 eV. Wemple-DiDomenico and Spitzer-Fan models were used to find the oscillator energy, dispersion energy, zero-frequency refractive index and high-frequency dielectric constant values. Structural properties of the CuIn5S8 crystals were investigated using X-ray diffraction and energy dispersive spectroscopy analysis.

  18. Ellipsometry study of optical parameters of AgIn5S8 crystals

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2015-12-01

    AgIn5S8 crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2-6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn5S8 crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  19. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium

    NASA Astrophysics Data System (ADS)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.

    2014-07-01

    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  20. Interplay of RNA Pol IV and ROS1 during post-embryonic 5S rDNA chromatin remodeling.

    PubMed

    Douet, Julien; Blanchard, Bertrand; Cuvillier, Claudine; Tourmente, Sylvette

    2008-12-01

    We have investigated the chromatin structure of 5S rDNA, a heterochromatic pericentromeric tandemly repeated family, at 2, 3, 4 and 5 days post-germination. Our results revealed a large-scale reorganization of 5S rDNA chromatin that occurs during the first days of development. Unexpectedly, there is a decondensation followed by a 're'condensation of 5S rDNA chromatin, to obtain almost mature nuclei 5 d post-germination. The reorganization of 5S rDNA chromatin is accompanied by a rapid and active demethylation of 5S rDNA mediated by the ROS1 (repressor of silencing 1) demethylase, whereas the plant-specific RNA polymerase IV (Pol IV) is essential to the 5S chromatin 're'condensation. In conclusion, Pol IV and ROS1 collaborate to unlock the 5S rDNA chromatin inherited from the seed, and establish adult features. PMID:18845569

  1. Accurate taxonomy assignments from 16S rRNA sequences produced by highly parallel pyrosequencers

    PubMed Central

    Liu, Zongzhi; DeSantis, Todd Z.; Andersen, Gary L.; Knight, Rob

    2008-01-01

    The recent introduction of massively parallel pyrosequencers allows rapid, inexpensive analysis of microbial community composition using 16S ribosomal RNA (rRNA) sequences. However, a major challenge is to design a workflow so that taxonomic information can be accurately and rapidly assigned to each read, so that the composition of each community can be linked back to likely ecological roles played by members of each species, genus, family or phylum. Here, we use three large 16S rRNA datasets to test whether taxonomic information based on the full-length sequences can be recaptured by short reads that simulate the pyrosequencer outputs. We find that different taxonomic assignment methods vary radically in their ability to recapture the taxonomic information in full-length 16S rRNA sequences: most methods are sensitive to the region of the 16S rRNA gene that is targeted for sequencing, but many combinations of methods and rRNA regions produce consistent and accurate results. To process large datasets of partial 16S rRNA sequences obtained from surveys of various microbial communities, including those from human body habitats, we recommend the use of Greengenes or RDP classifier with fragments of at least 250 bases, starting from one of the primers R357, R534, R798, F343 or F517. PMID:18723574

  2. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  3. Global determinants of mortality in under 5s: 10 year worldwide longitudinal study

    PubMed Central

    Nacher, Mathieu; Guihenneuc, Chantal; Tubert-Bitter, Pascale; Chavance, Michel

    2013-01-01

    Objective To assess at country level the association of mortality in under 5s with a large set of determinants. Design Longitudinal study. Setting 193 United Nations member countries, 2000-09. Methods Yearly data between 2000 and 2009 based on 12 world development indicators were used in a multivariable general additive mixed model allowing for non-linear relations and lag effects. Main outcome measure National rate of deaths in under 5s per 1000 live births Results The model retained the variables: gross domestic product per capita; percentage of the population having access to improved water sources, having access to improved sanitation facilities, and living in urban areas; adolescent fertility rate; public health expenditure per capita; prevalence of HIV; perceived level of corruption and of violence; and mean number of years in school for women of reproductive age. Most of these variables exhibited non-linear behaviours and lag effects. Conclusions By providing a unified framework for mortality in under 5s, encompassing both high and low income countries this study showed non-linear behaviours and lag effects of known or suspected determinants of mortality in this age group. Although some of the determinants presented a linear action on log mortality indicating that whatever the context, acting on them would be a pertinent strategy to effectively reduce mortality, others had a threshold based relation potentially mediated by lag effects. These findings could help designing efficient strategies to achieve maximum progress towards millennium development goal 4, which aims to reduce mortality in under 5s by two thirds between 1990 and 2015. PMID:24212105

  4. BEND3 represses rDNA transcription by stabilizing a NoRC component via USP21 deubiquitinase

    PubMed Central

    Khan, Abid; Giri, Sumanprava; Wang, Yating; Chakraborty, Arindam; Ghosh, Archit K.; Anantharaman, Aparna; Aggarwal, Vasudha; Sathyan, Kizhakke M.; Ha, Taekjip; Prasanth, Kannanganattu V.; Prasanth, Supriya G.

    2015-01-01

    Ribosome biogenesis dictates the translational capacity of cells. Several mechanisms establish and maintain transcriptional output from eukaryotic ribosomal DNA (rDNA) loci. rDNA silencing is one such mechanism that ensures the inactivity and hence the maintenance of a silenced state of a subset of rRNA gene copies. Whereas oncogenic agents stimulate rRNA gene transcription, tumor suppressors decrease rRNA gene transcription. We demonstrate in mammalian cells that BANP, E5R, and Nac1 (BEN) domain 3 (BEND3), a quadruple BEN domain-containing protein, localizes in nucleoli and binds to ribosomal RNA gene promoters to help repress rRNA genes. Loss of BEND3 increases histone H3K4 trimethylation and, correspondingly, decreases rDNA promoter DNA methylation, consistent with a role for BEND3 in rDNA silencing. BEND3 associates with the nucleolar-remodeling complex (NoRC), and SUMOylated BEND3 stabilizes NoRC component TTF-1–interacting protein 5 via association with ubiquitin specific protease 21 (USP21) debiquitinase. Our results provide mechanistic insights into how the novel rDNA transcription repressor BEND3 acts together with NoRC to actively coordinate the establishment of rDNA silencing. PMID:26100909

  5. BEND3 represses rDNA transcription by stabilizing a NoRC component via USP21 deubiquitinase.

    PubMed

    Khan, Abid; Giri, Sumanprava; Wang, Yating; Chakraborty, Arindam; Ghosh, Archit K; Anantharaman, Aparna; Aggarwal, Vasudha; Sathyan, Kizhakke M; Ha, Taekjip; Prasanth, Kannanganattu V; Prasanth, Supriya G

    2015-07-01

    Ribosome biogenesis dictates the translational capacity of cells. Several mechanisms establish and maintain transcriptional output from eukaryotic ribosomal DNA (rDNA) loci. rDNA silencing is one such mechanism that ensures the inactivity and hence the maintenance of a silenced state of a subset of rRNA gene copies. Whereas oncogenic agents stimulate rRNA gene transcription, tumor suppressors decrease rRNA gene transcription. We demonstrate in mammalian cells that BANP, E5R, and Nac1 (BEN) domain 3 (BEND3), a quadruple BEN domain-containing protein, localizes in nucleoli and binds to ribosomal RNA gene promoters to help repress rRNA genes. Loss of BEND3 increases histone H3K4 trimethylation and, correspondingly, decreases rDNA promoter DNA methylation, consistent with a role for BEND3 in rDNA silencing. BEND3 associates with the nucleolar-remodeling complex (NoRC), and SUMOylated BEND3 stabilizes NoRC component TTF-1-interacting protein 5 via association with ubiquitin specific protease 21 (USP21) debiquitinase. Our results provide mechanistic insights into how the novel rDNA transcription repressor BEND3 acts together with NoRC to actively coordinate the establishment of rDNA silencing. PMID:26100909

  6. mRNA transcription in nuclei isolated from Saccharomyces cerevisiae.

    PubMed Central

    Jerome, J F; Jaehning, J A

    1986-01-01

    We developed an improved method for the isolation of transcriptionally active nuclei from Saccharomyces cerevisiae, which allows analysis of specific transcripts. When incubated with alpha-32P-labeled ribonucleoside triphosphates in vitro, nuclei isolated from haploid or diploid cells transcribed rRNA, tRNA, and mRNAs in a strand-specific manner, as shown by slot blot hybridization of the in vitro synthesized RNA to cloned genes encoding 5.8S, 18S and 28S rRNAs, tRNATyr, and GAL7, URA3, TY1 and HIS3 mRNAs. A yeast strain containing a high-copy-number plasmid which overproduced GAL7 mRNA was initially used to facilitate detection of a discrete message. We optimized conditions for the transcription of genes expressed by each of the three yeast nuclear RNA polymerases. Under optimal conditions, labeled transcripts could be detected from single-copy genes normally expressed at low levels in the cells (HIS3 and URA3). We determined that the alpha-amanitin sensitivity of transcript synthesis in the isolated nuclei paralleled the sensitivity of the corresponding purified RNA polymerases; in particular, mRNA synthesis was 50% sensitive to 1 microgram of alpha-amanitin per ml, establishing transcription of mRNA by RNA polymerase II. Images PMID:3537708

  7. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  8. Novel Approach to Quantitative Detection of Specific rRNA in a Microbial Community, Using Catalytic DNA

    PubMed Central

    Suenaga, Hikaru; Liu, Rui; Shiramasa, Yuko; Kanagawa, Takahiro

    2005-01-01

    We developed a novel method for the quantitative detection of the 16S rRNA of a specific bacterial species in the microbial community by using deoxyribozyme (DNAzyme), which possesses the catalytic function to cleave RNA in a sequence-specific manner. A mixture of heterogeneous 16S rRNA containing the target 16S rRNA was incubated with a species-specific DNAzyme. The cleaved target 16S rRNA was separated from the intact 16S rRNA by electrophoresis, and then their amounts were compared for the quantitative detection of target 16S rRNA. This method was used to determine the abundance of the 16S rRNA of a filamentous bacterium, Sphaerotilus natans, in activated sludge, which is a microbial mixture used in wastewater treatment systems. The result indicated that this DNAzyme-based approach would be applicable to actual microbial communities. PMID:16085888

  9. Transcription Regulation in Archaea.

    PubMed

    Gehring, Alexandra M; Walker, Julie E; Santangelo, Thomas J

    2016-07-15

    The known diversity of metabolic strategies and physiological adaptations of archaeal species to extreme environments is extraordinary. Accurate and responsive mechanisms to ensure that gene expression patterns match the needs of the cell necessitate regulatory strategies that control the activities and output of the archaeal transcription apparatus. Archaea are reliant on a single RNA polymerase for all transcription, and many of the known regulatory mechanisms employed for archaeal transcription mimic strategies also employed for eukaryotic and bacterial species. Novel mechanisms of transcription regulation have become apparent by increasingly sophisticated in vivo and in vitro investigations of archaeal species. This review emphasizes recent progress in understanding archaeal transcription regulatory mechanisms and highlights insights gained from studies of the influence of archaeal chromatin on transcription. PMID:27137495

  10. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    PubMed

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  11. Mutations of mitochondrial 12S rRNA in gastric carcinoma and their significance

    PubMed Central

    Han, Cheng-Bo; Ma, Jia-Ming; Xin, Yan; Mao, Xiao-Yun; Zhao, Yu-Jie; Wu, Dong-Ying; Zhang, Su-Min; Zhang, Yu-Kui

    2005-01-01

    AIM: To detect the variations of mitochondrial 12S rRNA in patients with gastric carcinoma, and to study their significance and the relationship between these variations and the genesis of gastric carcinoma. METHODS: PCR amplified mitochondrial 12S rRNA of 44 samples including 22 from gastric carcinoma tissues and 22 from adjacent normal tissues, was detected by direct DNA sequencing. Then laser capture microdissection technique (LCM) was used to separate the cancerous cells and dysplasia cells with specific mutations. Denaturing high performance liquid chromatography (DHPLC) plus allele-specific PCR (AS-PCR), nest-PCR and polyacrylamide gel electrophoresis (PAGE) were used to further evaluate this mutant property and quantitative difference of mutant type between cancerous and dysplasia cells. Finally, RNAdraw biosoft was used to analyze the RNA secondary structure of mutant-type 12S rRNA. RESULTS: Compared with Mitomap database, some new variations were found, among which np652 G insertion and np716 T-G transversion were found only in cancerous tissues. There was a statistic difference in the frequency of 12S rRNA variation between intestinal type (12/17, 70.59%) and diffusive type (5/17, 29.41%) of gastric carcinoma (P<0.05). DHPLC analysis showed that 12S rRNA np652 G insertion and np716 T-G transversion were heteroplasmic mutations. The frequency of 12S rRNA variation in cancerous cells was higher than that in dysplasia cells (P<0.01). 12S rRNA np652 G insertion showed obviously negative effects on the stability of 12S rRNA secondary structure, while others such as T-G transversion did not. CONCLUSION: The mutations of mitochondrial 12S rRNA may be associated with the occurrence of intestinal-type gastric carcinoma. Most variations exist both in gastric carcinomas and in normal tissues, and they might not be the characteristics of tumors. However, np652 G insertion and np716 T-G transversion may possess some molecular significance in gastric carcinogenesis

  12. WRKY transcription factors

    PubMed Central

    Bakshi, Madhunita; Oelmüller, Ralf

    2014-01-01

    WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469

  13. Plant transcription factors.

    PubMed

    Meshi, T; Iwabuchi, M

    1995-12-01

    Transcriptional regulation of gene expression relies on the recognition of promoter elements by transcription factors. In the past several years, a considerable number of (putative) transcription factors have been identified in plants. Some genes coding for these factors were isolated by south-western screening with oligonucleotides as a probe or by homology-based screening, and others were initially isolated by genetic means and subsequently identified as the genes for transcription factors. These transcription factors often form families of structurally related proteins with similar DNA-binding specificities and in addition, they are sometimes involved in related phenomena. Some groups of factors homo- and/or heterodimerize to increase the length and variability of the target sequences. Transcriptional activators, in general, comprise a modular activation domain. The activities of the transcription factors are controlled by post-translational modification, like phosphorylation and glycosylation, as well as at the levels of nuclear transport, oligomerization, etc. In this review, we will summarize the current knowledge of plant transcription factors to help understand the mechanistic aspects of the transcriptional regulation of genes. PMID:8589926

  14. Transcriptional activators in yeast

    PubMed Central

    2006-01-01

    Eukaryotic transcription activation domains (ADs) are not well defined on the proteome scale. We systematicallly tested ∼6000 yeast proteins for transcriptional activity using a yeast one-hybrid system and identified 451 transcriptional activators. We then determined their transcription activation strength using fusions to the Gal4 DNA-binding domain and a His3 reporter gene which contained a promoter with a Gal4-binding site. Among the 132 strongest activators 32 are known transcription factors while another 35 have no known function. Although zinc fingers, helix–loop–helix domains and several other domains are highly overrepresented among the activators, only few contain characterized ADs. We also found some striking correlations: the stronger the activation activity, the more acidic, glutamine-rich, proline-rich or asparagine-rich the activators were. About 29% of the activators have been found previously to specifically interact with the transcription machinery, while 10% are known to be components of transcription regulatory complexes. Based on their transcriptional activity, localization and interaction patterns, at least six previously uncharacterized proteins are suggested to be bona fide transcriptional regulators (namely YFL049W, YJR070C, YDR520C, YGL066W/Sgf73, YKR064W and YCR082W/Ahc2). PMID:16464826

  15. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  16. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  17. In β-actin knockouts, epigenetic reprogramming and rDNA transcription inactivation lead to growth and proliferation defects.

    PubMed

    Almuzzaini, Bader; Sarshad, Aishe A; Rahmanto, Aldwin S; Hansson, Magnus L; Von Euler, Anne; Sangfelt, Olle; Visa, Neus; Farrants, Ann-Kristin Östlund; Percipalle, Piergiorgio

    2016-08-01

    Actin and nuclear myosin 1 (NM1) are regulators of transcription and chromatin organization. Using a genome-wide approach, we report here that β-actin binds intergenic and genic regions across the mammalian genome, associated with both protein-coding and rRNA genes. Within the rDNA, the distribution of β-actin correlated with NM1 and the other subunits of the B-WICH complex, WSTF and SNF2h. In β-actin(-/-) mouse embryonic fibroblasts (MEFs), we found that rRNA synthesis levels decreased concomitantly with drops in RNA polymerase I (Pol I) and NM1 occupancies across the rRNA gene. Reintroduction of wild-type β-actin, in contrast to mutated forms with polymerization defects, efficiently rescued rRNA synthesis underscoring the direct role for a polymerization-competent form of β-actin in Pol I transcription. The rRNA synthesis defects in the β-actin(-/-) MEFs are a consequence of epigenetic reprogramming with up-regulation of the repressive mark H3K4me1 (monomethylation of lys4 on histone H3) and enhanced chromatin compaction at promoter-proximal enhancer (T0 sequence), which disturb binding of the transcription factor TTF1. We propose a novel genome-wide mechanism where the polymerase-associated β-actin synergizes with NM1 to coordinate permissive chromatin with Pol I transcription, cell growth, and proliferation.-Almuzzaini, B., Sarshad, A. A. , Rahmanto, A. S., Hansson, M. L., Von Euler, A., Sangfelt, O., Visa, N., Farrants, A.-K. Ö., Percipalle, P. In β-actin knockouts, epigenetic reprogramming and rDNA transcription inactivation lead to growth and proliferation defects. PMID:27127100

  18. Two spatially separated phases in semiconducting Rb0.8Fe1.5S2

    DOE PAGESBeta

    Wang, Meng; Tian, Wei; Valdivia, P.; Chi, Songxue; Bourret-Courchesne, E.; Dai, Pengcheng; Birgeneau, R. J.

    2014-09-26

    We report neutron scattering and transport measurements on semiconducting Rb0.8Fe1.5S2, a compound isostructural and isoelectronic to the well-studied A0.8FeySe2(A = K, Rb, Cs, Tl/K) superconducting systems. Both resistivity and DC susceptibility measurements reveal a magnetic phase transition at T = 275 K. Neutron diffraction studies show that the 275 K transition originates from a phase with rhombic iron vacancy order which exhibits an in-plane stripe antiferromagnetic ordering below 275 K. In addition, the stripe antiferromagnetic phase interdigitates mesoscopically with an ubiquitous phase with √5 x√5 iron vacancy order. This phase has a magnetic transition at TN = 425 K andmore » an iron vacancy order-disorder transition at TS = 600 K. These two different structural phases are closely similar to those observed in the isomorphous Se materials. Based on the close similarities of the in-plane antiferromagnetic structures, moments sizes, and ordering temperatures in semiconducting Rb0.8Fe1.5S2 and K0.81Fe1.58Se2, we argue that the in-plane antiferromagnetic order arises from strong coupling between local moments. Superconductivity, previously observed in the A0.8FeySe2₋ zSz system, is absent in A0.8Fe1.5S2, which has a semiconducting ground state. We discuss the implied relationship between stripe and block antiferromagnetism and superconductivity in these materials as well as a strategy for further investigation.« less

  19. SAXS investigation on the temperature dependence of the conformation of Carcinus aestuarii 5S hemocyanin subunit

    NASA Astrophysics Data System (ADS)

    Beltramini, M.; Di Muro, P.; Favilla, R.; La Monaca, A.; Mariani, P.; Sabatucci, A. L.; Salvato, B.; Solari, P. L.

    1999-01-01

    The small-angle X-ray scattering technique has been used to study the spatial distribution of a subunit isolated from Carcinus hemocyanin, in solution at pH 7.5 in the 20°C-40°C temperature range. From the obtained scattering profiles, two species with different gyration radius have been detected by Guinier approximation: one species with Rg1≈25 Å is assigned to the 75 kDa 5S subunit whereas a second species with Rg2≈48 Å, and accounting for ≈3% of the total protein, is attributed to the 450 kDa 16S hexamer. Whereas Rg2 decreases slightly (≈10%) and reversibly on increasing the temperature, Rg2 decreases more markedly (≈30%), but irreversibly. The scattering data have been analysed also on the basis of the impenetrable spheres model and by means of the distance distribution function: the temperature dependence of the geometrical dimensions of the particles is confirmed. In addition, for the 5S subunit also the cross-section gyration radius decreases appreciably (15%) and reversibly with temperature. These results are interpreted on the basis of temperature induced structural rearrangements among the three domains of 5S subunit leading to an increased compactness of the molecule and a more elongated form. In contrast, the effect on the hexamer is assigned to its irreversible dissociation to monomers. This interpretation agrees with the analysis of the distance distribution functions, calculated from the Fourier's transforms of the scattering curves at the different temperatures.

  20. Magic wavelengths for the 5 s -18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, E. A.; Norris, D. G.; Koller, S. B.; Wyllie, R.; Brown, R. C.; Porto, J. V.; Safronova, U. I.; Safronova, M. S.

    2015-03-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s -18 s transition of rubidium, and compare the calculation to experiment by measuring the light shift for atoms held in an optical dipole trap at a range of wavelengths near a calculated magic value.

  1. Nucleotide sequences of 5S ribosomal RNA from four oomycete and chytrid water molds.

    PubMed

    Walker, W F; Doolittle, W F

    1982-09-25

    The nucleotide sequences of the 5S rRNAs of the oomycete water molds Saprolegnia ferax and Pythium hydnosporum and of the chytrid water molds Blastocladiella simplex and Phlyctochytrium irregulare were determined by chemical and enzymatic partial degradation of 3' and 5' end-labelled molecules, followed by gel sequence analysis. The two oomycete sequences differed in 24 positions and the two chytrid sequences differed in 27 positions. These pairs differed in a mean of 44 positions. The chytrid sequences clearly most resemble the sequence from the zygomycete Phycomyces, while the oomycete sequences appear to be allied with those from protozoa and slime molds. PMID:6890670

  2. Minimally invasive L5-S1 oblique lumbar interbody fusion with anterior plate.

    PubMed

    Pham, Martin H; Jakoi, Andre M; Hsieh, Patrick C

    2016-07-01

    Lumbar interbody fusion is an important technique for the treatment of degenerative disc disease and degenerative scoliosis. The oblique lumbar interbody fusion (OLIF) establishes a minimally invasive retroperitoneal exposure anterior to the psoas and lumbar plexus. In this video case presentation, the authors demonstrate the techniques of the OLIF at L5-S1 performed on a 69-year-old female with degenerative scoliosis as one component of an overall strategy for her deformity correction. The video can be found here: https://youtu.be/VMUYWKLAl0g . PMID:27364428

  3. Conserved rates and patterns of transcription errors across bacterial growth states and lifestyles.

    PubMed

    Traverse, Charles C; Ochman, Howard

    2016-03-22

    Errors that occur during transcription have received much less attention than the mutations that occur in DNA because transcription errors are not heritable and usually result in a very limited number of altered proteins. However, transcription error rates are typically several orders of magnitude higher than the mutation rate. Also, individual transcripts can be translated multiple times, so a single error can have substantial effects on the pool of proteins. Transcription errors can also contribute to cellular noise, thereby influencing cell survival under stressful conditions, such as starvation or antibiotic stress. Implementing a method that captures transcription errors genome-wide, we measured the rates and spectra of transcription errors in Escherichia coli and in endosymbionts for which mutation and/or substitution rates are greatly elevated over those of E. coli Under all tested conditions, across all species, and even for different categories of RNA sequences (mRNA and rRNAs), there were no significant differences in rates of transcription errors, which ranged from 2.3 × 10(-5) per nucleotide in mRNA of the endosymbiont Buchnera aphidicola to 5.2 × 10(-5) per nucleotide in rRNA of the endosymbiont Carsonella ruddii The similarity of transcription error rates in these bacterial endosymbionts to that in E. coli (4.63 × 10(-5) per nucleotide) is all the more surprising given that genomic erosion has resulted in the loss of transcription fidelity factors in both Buchnera and Carsonella. PMID:26884158

  4. Divergent RNA transcription

    PubMed Central

    Naughton, Catherine; Corless, Samuel; Gilbert, Nick

    2013-01-01

    New approaches using biotinylated-psoralen as a probe for investigating DNA structure have revealed new insights into the relationship between DNA supercoiling, transcription and chromatin compaction. We explore a hypothesis that divergent RNA transcription generates negative supercoiling at promoters facilitating initiation complex formation and subsequent promoter clearance. PMID:23863199

  5. Refinement of the spinal muscular atrophy locus to the interval between D5S435 and MAP1B

    SciTech Connect

    Soares, V.M.; Brzustowicz, L.M.; Kleyn, P.W.; Knowles, J.A.; Palmer, D.A.; Asokan, S.; Penchaszadeh, G.K.; Gilliam, T.C. ); Munsat, T.L. )

    1993-02-01

    The childhood-onset SMA locus has been mapped to chromosome 5q13, in a region bounded by the proximal locus, D5S6, and the closely linked distal loci, D5S112 and MAP1B. We now describe a highly polymorphic, tightly linked microsatellite marker (D5S435) that is very likely the closet proximal marker to the SMA locus. Multipoint linkage analysis firmly establishes the following order of markers at 5q13; centromere-D5S76-D5S6-D5S435-MAP1B/D5S112-D5S39-telomere. The data indicate that SMA resides in an approximately 0.7-cM (range 01.-2.1) region between D5S435 and MAP1B. This finding reduces by approximately fourfold the genetic region that most likely harbors the SMA locus and will facilitate the physical mapping and cloning of the disease gene region. 24 refs., 3 figs., 1 tab.

  6. Decreases in average bacterial community rRNA operon copy number during succession.

    PubMed

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  7. Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

    PubMed Central

    Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

    1996-01-01

    Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

  8. Tax4Fun: predicting functional profiles from metagenomic 16S rRNA data

    PubMed Central

    Aßhauer, Kathrin P.; Wemheuer, Bernd; Daniel, Rolf; Meinicke, Peter

    2015-01-01

    Motivation: The characterization of phylogenetic and functional diversity is a key element in the analysis of microbial communities. Amplicon-based sequencing of marker genes, such as 16S rRNA, is a powerful tool for assessing and comparing the structure of microbial communities at a high phylogenetic resolution. Because 16S rRNA sequencing is more cost-effective than whole metagenome shotgun sequencing, marker gene analysis is frequently used for broad studies that involve a large number of different samples. However, in comparison to shotgun sequencing approaches, insights into the functional capabilities of the community get lost when restricting the analysis to taxonomic assignment of 16S rRNA data. Results: Tax4Fun is a software package that predicts the functional capabilities of microbial communities based on 16S rRNA datasets. We evaluated Tax4Fun on a range of paired metagenome/16S rRNA datasets to assess its performance. Our results indicate that Tax4Fun provides a good approximation to functional profiles obtained from metagenomic shotgun sequencing approaches. Availability and implementation: Tax4Fun is an open-source R package and applicable to output as obtained from the SILVAngs web server or the application of QIIME with a SILVA database extension. Tax4Fun is freely available for download at http://tax4fun.gobics.de/. Contact: kasshau@gwdg.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25957349

  9. Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces

    PubMed Central

    Orsi, William; Biddle, Jennifer F.; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface. PMID:23418556

  10. Interactions between 23S rRNA and tRNA in the ribosomal E site.

    PubMed Central

    Bocchetta, M; Xiong, L; Shah, S; Mankin, A S

    2001-01-01

    Interactions between tRNA or its analogs and 23S rRNA in the large ribosomal subunit were analyzed by RNA footprinting and by modification-interference selection. In the E site, tRNA protected bases G2112, A2392, and C2394 of 23S rRNA. Truncated tRNA, lacking the anticodon stem-loop, protected A2392 and C2394, but not G2112, and tRNA derivatives with a shortened 3' end protected only G2112, but not A2392 or C2394. Modification interference revealed C2394 as the only accessible nucleotide in 23S rRNA whose modification interferes with binding of tRNA in the large ribosomal subunit E site. The results suggest a direct contact between A76 of tRNA A76 and C2394 of 23S rRNA. Protections at G2112 may reflect interaction of this 23S rRNA region with the tRNA central fold. PMID:11214181

  11. Sequence and phylogenetic analysis of SSU rRNA gene of five microsporidia.

    PubMed

    Dong, ShiNan; Shen, ZhongYuan; Xu, Li; Zhu, Feng

    2010-01-01

    The complete small subunit rRNA (SSU rRNA) gene sequences of five microsporidia including Nosema heliothidis, and four novel microsporidia isolated from Pieris rapae, Phyllobrotica armta, Hemerophila atrilineata, and Bombyx mori, respectively, were obtained by PCR amplification, cloning, and sequencing. Two phylogenetic trees based on SSU rRNA sequences had been constructed by using Neighbor-Joining of Phylip software and UPGMA of MEGA4.0 software. The taxonomic status of four novel microsporidia was determined by analysis of phylogenetic relationship, length, G+C content, identity, and divergence of the SSU rRNA sequences. The results showed that the microsporidia isolated from Pieris rapae, Phyllobrotica armta, and Hemerophila atrilineata have close phylogenetic relationship with the Nosema, while another microsporidium isolated from Bombyx mori is closely related to the Endoreticulatus. So, we temporarily classify three novel species of microsporidia to genus Nosema, as Nosema sp. PR, Nosema sp. PA, Nosema sp. HA. Another is temporarily classified into genus Endoreticulatus, as Endoreticulatus sp. Zhenjiang. The result indicated as well that it is feasible and valuable to elucidate phylogenetic relationships and taxonomic status of microsporidian species by analyzing information from SSU rRNA sequences of microsporidia. PMID:19768503

  12. Transcriptional and phylogenetic analysis of five complete ambystomatid salamander mitochondrial genomes.

    PubMed

    Samuels, Amy K; Weisrock, David W; Smith, Jeramiah J; France, Katherine J; Walker, John A; Putta, Srikrishna; Voss, S Randal

    2005-04-11

    We report on a study that extended mitochondrial transcript information from a recent EST project to obtain complete mitochondrial genome sequence for 5 tiger salamander complex species (Ambystoma mexicanum, A. t. tigrinum, A. andersoni, A. californiense, and A. dumerilii). We describe, for the first time, aspects of mitochondrial transcription in a representative amphibian, and then use complete mitochondrial sequence data to examine salamander phylogeny at both deep and shallow levels of evolutionary divergence. The available mitochondrial ESTs for A. mexicanum (N=2481) and A. t. tigrinum (N=1205) provided 92% and 87% coverage of the mitochondrial genome, respectively. Complete mitochondrial sequences for all species were rapidly obtained by using long distance PCR and DNA sequencing. A number of genome structural characteristics (base pair length, base composition, gene number, gene boundaries, codon usage) were highly similar among all species and to other distantly related salamanders. Overall, mitochondrial transcription in Ambystoma approximated the pattern observed in other vertebrates. We inferred from the mapping of ESTs onto mtDNA that transcription occurs from both heavy and light strand promoters and continues around the entire length of the mtDNA, followed by post-transcriptional processing. However, the observation of many short transcripts corresponding to rRNA genes indicates that transcription may often terminate prematurely to bias transcription of rRNA genes; indeed an rRNA transcription termination signal sequence was observed immediately following the 16S rRNA gene. Phylogenetic analyses of salamander family relationships consistently grouped Ambystomatidae in a clade containing Cryptobranchidae and Hynobiidae, to the exclusion of Salamandridae. This robust result suggests a novel alternative hypothesis because previous studies have consistently identified Ambystomatidae and Salamandridae as closely related taxa. Phylogenetic analyses of tiger

  13. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    NASA Astrophysics Data System (ADS)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-03-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

  14. Intraspecific and Interspecific Variation in 5s RNA Genes Are Decoupled in Diploid Wheat Relatives

    PubMed Central

    Kellogg, E. A.; Appels, R.

    1995-01-01

    5S RNAs form part of the ribosome in most organisms. In some, e.g., prokaryotes and some fungi, the genes are part of the ribosomal operon, but in most eukaryotes they are in tandem arrays of hundreds to thousands of copies separate from the main ribosomal array. 5S RNA genes can be aligned across kingdoms. We were therefore surprised to find that, for 28 diploid species of the wheat tribe (Triticeae), nucleotide diversity within an array is up to 6.2% in the genes, not significantly different from that of the nontranscribed spacers. Rates of concerted evolution must therefore be insufficient to homogenize the entire array. Between species, there are significantly fewer fixed differences in the gene than would be expected, given the high within-species variation. In contrast, the amount of variation between species in the spacer is the same as or greater than that within individuals. This leads to a paradox. High variation within an individual suggests that there is little selection on any particular gene within an array. But conservation of the gene across species implies that polymorphisms are periodically eliminated at a rate approximately equal to or greater than that of speciation. Levels of intraspecific polymorphism and interspecific divergence are thus decoupled. This implies that selective mechanisms exist to eliminate mutations in the gene without also affecting the spacer. PMID:7635297

  15. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure.

    PubMed

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30-70 K in pressure range of 100-170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50-70 K in pressure range of 100-150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  16. Magnetization reversal phenomena in (Cr0.70Ti0.30)5S6

    NASA Astrophysics Data System (ADS)

    Hashimoto, Satoshi; Matsuda, Yuji; Sato, Tetsuya; Anzai, Shuichiro

    2005-12-01

    Magnetization reversal phenomena (MRP) along magnetic order-order transitions have recently been reported on impurity-doped magnetic systems. Because imperfect long-range magnetic order exists in these systems, it is expected that a systematic investigation of MRP will give physical information on thermomagnetic processes of magnetic systems in the range from the micro- to nanoscales. As a typical order-order transition (a state doubly modulated by helical and canting orders to a collinear ferrimagnetic state) has been known to occur on Cr5S6 at a transition temperature Tt, we investigate the magnetizations of (Cr0.70Ti0.30)5S6 on heating and cooling runs in various magnetic fields. At 20Oe, the field-cooled magnetization just below the Curie temperature has a positive sign; the sign turns negative below the compensation temperature TCM (first step) and finally returns to positive below Tt (second step). The first-step MRP observed in this system is explained by the potential barriers resulting from anisotropy energy when the preferred direction of collinear ferrimagnetic moment reverses. The proposed mechanism for second-step MRP is the pinning effect caused by the impurity atoms (Ti) in the helical long-range-order chains. Comparing other examples of MRPs, we discuss the roles of local impurity centers in the thermomagnetic process in magnetic order-order transitions.

  17. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    PubMed Central

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  18. Molecular phylogeny of pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences.

    PubMed

    Li, ZiHui; Feng, XianMin; Lu, SiQi; Zhang, Fan; Wang, FengYun; Huang, Song

    2008-05-01

    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis. PMID:18785590

  19. Homology of the 3' terminal sequences of the 18S rRNA of Bombyx mori and the 16S rRNA of Escherchia coli.

    PubMed Central

    Samols, D R; Hagenbuchle, O; Gage, L P

    1979-01-01

    The terminal 220 base pairs (bp) of the gene for 18S rRNA and 18 bp of the adjoining spacer rDNA of the silkworm Bombyx mori have been sequenced. Comparison with the sequence of the 16S rRNA gene of Escherichia coli has shown that a region including 45 bp of the B. mori sequence at the 3' end is remarkably homologous with the 3' terminal E. coli sequence. Other homologies occur in the terminal regions of the 18S and 16S rRNAs, including a perfectly conserved stretch of 13 bp within a longer homology located 150--200 bp from the 3' termini. These homologies are the most extensive so far reported between prokaryotic and eukaryotic genomic DNA. Images PMID:390496

  20. Chromosome mapping of 18S rDNA and 5S rDNA by dual-color fluorescence in situ hybridization in the half-smooth tongue sole (Cynoglossus semilaevis).

    PubMed

    Jiang, L; Jiang, J; Liu, J; Yuan, J; Chen, Y; Zhang, Q; Wang, X

    2014-01-01

    Half-smooth tongue sole (Cynoglossus semilaevis) is an important aquaculture flatfish in China. Cytogenetic analysis has revealed that its sex determination system is female heterogametic (ZZ/ZW). The W chromosome is morphologically larger and has been considered evolutionarily younger than any other chromosome in the set. However, the genetic origin and evolution process of this neo-chromosome remains unclear. In this study, 2 tandem arrays of rRNA genes were chosen to address this question. Both the major rDNA (18S rDNA) and the minor rDNA (5S rDNA) were located on the C. semilaevis chromosomes by fluorescence in situ hybridization (FISH). Six 18S rDNA signals were observed on the centromeric regions of 3 pairs of autosomes in both males and females. In females, there was an additional 18S rDNA signal mapping to the telomeric region of the W chromosome long arm. With respect to the 5S rDNA, 12 signals were mapped to the centromeric regions of six pairs of autosomes. Two-color FISH further confirmed that the two pairs of the 5S rDNA signals were correspondingly located at the same positions of the same autosomes as those of the 18S rDNA signals. These results allowed us to speculate about the evolution process of the W chromosome. Chromosome fusions and repetitive sequence accumulations might have occurred in C. semilaevis. The synteny and non-synteny of C. semilaevis 18S rDNA and 5S rDNA might imply the original and evolutionary characteristics of this species. These findings will facilitate studies on karyotype evolution of the order Pleuronectiformes. PMID:25526196

  1. Direct relationship between the level of p53 stabilization induced by rRNA synthesis-inhibiting drugs and the cell ribosome biogenesis rate.

    PubMed

    Scala, F; Brighenti, E; Govoni, M; Imbrogno, E; Fornari, F; Treré, D; Montanaro, L; Derenzini, M

    2016-02-25

    Many drugs currently used in chemotherapy work by hindering the process of ribosome biogenesis. In tumors with functional p53, the inhibition of ribosome biogenesis may contribute to the efficacy of this treatment by inducing p53 stabilization. As the level of stabilized p53 is critical for the induction of cytotoxic effects, it seems useful to highlight those cancer cell characteristics that can predict the degree of p53 stabilization following the treatment with inhibitors of ribosome biogenesis. In the present study we exposed a series of p53 wild-type human cancer cell lines to drugs such as actinomycin D (ActD), doxorubicin, 5-fluorouracil and CX-5461, which hinder ribosomal RNA (rRNA) synthesis. We found that the amount of stabilized p53 was directly related to the level of ribosome biogenesis in cells before the drug treatment. This was due to different levels of inactivation of the ribosomal proteins-MDM2 pathway of p53 digestion. Inhibition of rRNA synthesis always caused cell cycle arrest, independent of the ribosome biogenesis rate of the cells, whereas apoptosis occurred only in cells with a high rDNA transcription rate. The level of p53 stabilization induced by drugs acting in different ways from the inhibition of ribosome biogenesis, such as hydroxyurea (HU) and nutlin-3, was independent of the level of ribosome biogenesis in cells and always lower than that occurring after the inhibition of rRNA synthesis. Interestingly, in cells with a low ribosome biogenesis rate, the combined treatment with ActD and HU exerted an additive effect on p53 stabilization. These results indicated that (i) drugs inhibiting ribosome biogenesis may be highly effective in p53 wild-type cancers with a high ribosome biogenesis rate, as they induce apoptotic cell death, and (ii) the combination of drugs capable of stabilizing p53 through different mechanisms may be useful for treating cancers with a low ribosome biogenesis rate. PMID:25961931

  2. The human 18S rRNA base methyltransferases DIMT1L and WBSCR22-TRMT112 but not rRNA modification are required for ribosome biogenesis

    PubMed Central

    Zorbas, Christiane; Nicolas, Emilien; Wacheul, Ludivine; Huvelle, Emmeline; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2015-01-01

    At the heart of the ribosome lie rRNAs, whose catalytic function in translation is subtly modulated by posttranscriptional modifications. In the small ribosomal subunit of budding yeast, on the 18S rRNA, two adjacent adenosines (A1781/A1782) are N6-dimethylated by Dim1 near the decoding site, and one guanosine (G1575) is N7-methylated by Bud23-Trm112 at a ridge between the P- and E-site tRNAs. Here we establish human DIMT1L and WBSCR22-TRMT112 as the functional homologues of yeast Dim1 and Bud23-Trm112. We report that these enzymes are required for distinct pre-rRNA processing reactions leading to synthesis of 18S rRNA, and we demonstrate that in human cells, as in budding yeast, ribosome biogenesis requires the presence of the modification enzyme rather than its RNA-modifying catalytic activity. We conclude that a quality control mechanism has been conserved from yeast to human by which binding of a methyltransferase to nascent pre-rRNAs is a prerequisite to processing, so that all cleaved RNAs are committed to faithful modification. We further report that 18S rRNA dimethylation is nuclear in human cells, in contrast to yeast, where it is cytoplasmic. Yeast and human ribosome biogenesis thus have both conserved and distinctive features. PMID:25851604

  3. Pol I Transcription and Pre-rRNA Processing Are Coordinated in a Transcription-dependent Manner in Mammalian Cells

    PubMed Central

    Kopp, K.; Gasiorowski, J. Z.; Chen, D.; Gilmore, R.; Norton, J. T.; Wang, C.; Leary, D. J.; Chan, E.K.L.; Dean, D. A.

    2007-01-01

    Pre-rRNA synthesis and processing are key steps in ribosome biogenesis. Although recent evidence in yeast suggests that these two processes are coupled, the nature of their association is unclear. In this report, we analyze the coordination between rDNA transcription and pre-rRNA processing in mammalian cells. We found that pol I transcription factor UBF interacts with pre-rRNA processing factors as analyzed by immunoprecipitations, and the association depends on active rRNA synthesis. In addition, injections of plasmids containing the human rDNA promoter and varying lengths of 18S rDNA into HeLa nuclei show that pol I transcription machinery can be recruited to rDNA promoters regardless of the product that is transcribed, whereas subgroups of pre-rRNA processing factors are recruited to plasmids only when specific pre-rRNA fragments are produced. Our observations suggest a model for sequential recruitment of pol I transcription factors and pre-rRNA processing factors to elongating pre-rRNA on an as-needed basis rather than corecruitment to sites of active transcription. PMID:17108330

  4. Diversity of host species and strains of Pneumocystis carinii is based on rRNA sequences.

    PubMed Central

    Shah, J S; Pieciak, W; Liu, J; Buharin, A; Lane, D J

    1996-01-01

    We have amplified by PCR Pneumocystis carinii cytoplasmic small-subunit rRNA (variously referred to as 16S-like or 18S-like rRNA) genes from DNA extracted from bronchoalveolar lavage and induced sputum specimens from patients positive for P. carinii and from infected ferret lung tissue. The amplification products were cloned into pUC18, and individual clones were sequenced. Comparison of the determined sequences with each other and with published rat and partial human P.carinii small-subunit rRNA gene sequences reveals that, although all P. carinii small-subunit rRNAs are closely related (approximately 96% identity), small-subunit rRNA genes isolated from different host species (human, rat, and ferret) exhibit distinctive patterns of sequence variation. Two types of sequences were isolated from the infected ferret lung tissue, one as a predominant species and the other as a minor species. There was 96% identity between the two types. In situ hybridization of the infected ferret lung tissue with oligonucleotide probes specific for each type revealed that there were two distinct strains of P. carinii present in the ferret lung tissue. Unlike the ferret P. carinii isolates, the small-subunit rRNA gene sequences from different human P. carinii isolates have greater than 99% identity and are distinct from all rat and ferret sequences so far inspected or reported in the literature. Southern blot hybridization analysis of PCR amplification products from several additional bronchoalveolar lavage or induced sputum specimens from P. carinii-infected patients, using a 32P-labeled oligonucleotide probe specific for human P. carinii, also suggests that all of the human P. carinii isolates are identical. These findings indicate that human P. carinii isolates may represent a distinct species of P. carinii distinguishable from rat and ferret P. carinii on the basis of characterization of small-subunit rRNA gene sequences. PMID:8770515

  5. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  6. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy.

    PubMed

    Wang, Qiong; Garrity, George M; Tiedje, James M; Cole, James R

    2007-08-01

    The Ribosomal Database Project (RDP) Classifier, a naïve Bayesian classifier, can rapidly and accurately classify bacterial 16S rRNA sequences into the new higher-order taxonomy proposed in Bergey's Taxonomic Outline of the Prokaryotes (2nd ed., release 5.0, Springer-Verlag, New York, NY, 2004). It provides taxonomic assignments from domain to genus, with confidence estimates for each assignment. The majority of classifications (98%) were of high estimated confidence (> or = 95%) and high accuracy (98%). In addition to being tested with the corpus of 5,014 type strain sequences from Bergey's outline, the RDP Classifier was tested with a corpus of 23,095 rRNA sequences as assigned by the NCBI into their alternative higher-order taxonomy. The results from leave-one-out testing on both corpora show that the overall accuracies at all levels of confidence for near-full-length and 400-base segments were 89% or above down to the genus level, and the majority of the classification errors appear to be due to anomalies in the current taxonomies. For shorter rRNA segments, such as those that might be generated by pyrosequencing, the error rate varied greatly over the length of the 16S rRNA gene, with segments around the V2 and V4 variable regions giving the lowest error rates. The RDP Classifier is suitable both for the analysis of single rRNA sequences and for the analysis of libraries of thousands of sequences. Another related tool, RDP Library Compare, was developed to facilitate microbial-community comparison based on 16S rRNA gene sequence libraries. It combines the RDP Classifier with a statistical test to flag taxa differentially represented between samples. The RDP Classifier and RDP Library Compare are available online at http://rdp.cme.msu.edu/. PMID:17586664

  7. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae

    PubMed Central

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-01-01

    Methylation of ribose sugars at the 2′-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2′-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5′ central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D′ box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  8. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae.

    PubMed

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-02-27

    Methylation of ribose sugars at the 2'-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2'-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5' central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D' box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  9. Genome-wide analysis of small nucleolar RNAs of Leishmania major reveals a rich repertoire of RNAs involved in modification and processing of rRNA.

    PubMed

    Eliaz, Dror; Doniger, Tirza; Tkacz, Itai Dov; Biswas, Viplov Kumar; Gupta, Sachin Kumar; Kolev, Nikolay G; Unger, Ron; Ullu, Elisabetta; Tschudi, Christian; Michaeli, Shulamit

    2015-01-01

    Trypanosomatids are protozoan parasites and the causative agent of infamous infectious diseases. These organisms regulate their gene expression mainly at the post-transcriptional level and possess characteristic RNA processing mechanisms. In this study, we analyzed the complete repertoire of Leishmania major small nucleolar (snoRNA) RNAs by performing RNA-seq analysis on RNAs that were affinity-purified using the C/D snoRNA core protein, SNU13, and the H/ACA core protein, NHP2. This study revealed a large collection of C/D and H/ACA snoRNAs, organized in gene clusters generally containing both snoRNA types. Abundant snoRNAs were identified and predicted to guide trypanosome-specific rRNA cleavages. The repertoire of snoRNAs was compared to that of the closely related Trypanosoma brucei, and 80% of both C/D and H/ACA molecules were found to have functional homologues. The comparative analyses elucidated how snoRNAs evolved to generate molecules with analogous functions in both species. Interestingly, H/ACA RNAs have great flexibility in their ability to guide modifications, and several of the RNA species can guide more than one modification, compensating for the presence of single hairpin H/ACA snoRNA in these organisms. Placing the predicted modifications on the rRNA secondary structure revealed hypermodification regions mostly in domains which are modified in other eukaryotes, in addition to trypanosome-specific modifications. PMID:25970223

  10. NML-mediated rRNA base methylation links ribosomal subunit formation to cell proliferation in a p53-dependent manner.

    PubMed

    Waku, Tsuyoshi; Nakajima, Yuka; Yokoyama, Wataru; Nomura, Naoto; Kako, Koichiro; Kobayashi, Akira; Shimizu, Toshiyuki; Fukamizu, Akiyoshi

    2016-06-15

    Ribosomal RNAs (rRNAs) act as scaffolds and ribozymes in ribosomes, and these functions are modulated by post-transcriptional modifications. However, the biological role of base methylation, a well-conserved modification of rRNA, is poorly understood. Here, we demonstrate that a nucleolar factor, nucleomethylin (NML; also known as RRP8), is required for the N(1)-methyladenosine (m(1)A) modification in 28S rRNAs of human and mouse cells. NML also contributes to 60S ribosomal subunit formation. Intriguingly, NML depletion increases 60S ribosomal protein L11 (RPL11) levels in the ribosome-free fraction and protein levels of p53 through an RPL11-MDM2 complex, which activates the p53 pathway. Consequently, the growth of NML-depleted cells is suppressed in a p53-dependent manner. These observations reveal a new biological function of rRNA base methylation, which links ribosomal subunit formation to p53-dependent inhibition of cell proliferation in mammalian cells. PMID:27149924

  11. Modified nucleotides m(2)G966/m(5)C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon.

    PubMed

    Prokhorova, Irina V; Osterman, Ilya A; Burakovsky, Dmitry E; Serebryakova, Marina V; Galyamina, Maria A; Pobeguts, Olga V; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G; Govorun, Vadim M; Bogdanov, Alexey A; Sergiev, Petr V; Dontsova, Olga A

    2013-01-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show--using proteomic analysis and dual fluorescence reporter in vivo assays--that m(2)G966 and m(5)C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m(2)G966 and m(5)C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon. PMID:24241179

  12. Mechanistic Study on the Nuclear Modifier Gene MSS1 Mutation Suppressing Neomycin Sensitivity of the Mitochondrial 15S rRNA C1477G Mutation in Saccharomyces cerevisiae

    PubMed Central

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations. PMID:24595024

  13. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    NASA Astrophysics Data System (ADS)

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

    2013-11-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  14. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    PubMed Central

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1–RpL5-N–RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1–RpL5–RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  15. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  16. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    PubMed Central

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  17. 16S rRNA Phylogenetic Investigation of the Candidate Division “Korarchaeota”

    PubMed Central

    Auchtung, Thomas A.; Takacs-Vesbach, Cristina D.; Cavanaugh, Colleen M.

    2006-01-01

    The environmental distribution and phylogeny of “Korarchaeota,” a proposed ancient archaeal division, was investigated by using the 16S rRNA gene framework. Korarchaeota-specific primers were designed based on previously published sequences and used to screen a variety of environments. Korarchaeota 16S rRNA genes were amplified exclusively from high temperature Yellowstone National Park hot springs and a 9°N East Pacific Rise deep-sea hydrothermal vent. Phylogenetic analyses of these and all available sequences suggest that Korarchaeota exhibit a high level of endemicity. PMID:16820509

  18. Phylogeny of protostome worms derived from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade. PMID:7659019

  19. ASTP Onboard Voice Transcription

    NASA Technical Reports Server (NTRS)

    1975-01-01

    The transcription is presented of the Apollo-Soyuz Test Project voice communications as recorded on the command module data storage equipment. Data from this recorder are telemetered (dumped) to Space Tracking and Data Network sites for retransmission to the Johnson Space Center. The transcript is divided into three columns -- time, speaker, and text. The Greenwich mean time column consists of three two-digit numbers representing hours, minutes, and seconds (e.g., 22 34 14) for the Julian dates shown at the top of the page on which a new day begins. The speaker column indicates the source of a transmission; the text column contains the verbatim transcript of the communications.

  20. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    SciTech Connect

    Vilkas, M J; Ishikawa, Y; Trabert, E

    2008-02-29

    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  1. Solution-Based Processing of the Phase-Change Material KSb5S8

    SciTech Connect

    Mitzi,D.; Raoux, S.; Schrott, A.; Copel, M.; Kellock, A.; Jordan-Sweet, J.

    2006-01-01

    A hydrazine-based process for solution-depositing phase-change materials (PCMs) is demonstrated, using KSb{sub 5}S{sub 8} (KSS) as an example. The process involves dissolving the elemental metals and chalcogen in hydrazine at room temperature and spin-coating the solution onto a substrate, followed by a short low-temperature (T {<=} 250 C) anneal. The spin-coated KSS films, which range in thickness from 10 to 90 nm, are examined using variable temperature X-ray diffraction, medium energy ion scattering (MEIS), Rutherford backscattering spectroscopy (RBS), and scanning electron microscopy (SEM). The spin-coated KSS films exhibit a reversible amorphous-crystalline transition with a relatively high crystallization temperature ({approx}280 C). Selected other chalcogenide-based PCMs are also expected to be suitable for thin-film deposition using this approach.

  2. Minimally Invasive Approach For Extraforaminal Synovial Cyst L5-S1

    PubMed Central

    Torres Campa-Santamarina, Jose; Towne, Sara; Alimi, Marjan; Härtl, Roger

    2015-01-01

    Symptoms from synovial cysts are produced by neural compression in the spinal canal or the foramen. Few cases of extraforaminal synovial cyst have been published in the literature. This is a case report of a 65-year-old female who presented with a three-month history of sciatic pain and no relief with conservative treatment. MRI showed a left-sided extraforaminal synovial cyst at L5-S1 with compression of the L5 nerve root at the lateral portion of the foramen. Minimally invasive surgery for resection was performed using an extraforaminal tubular microscopic endoscopy-assisted approach. The patient improved clinically and remained symptom-free for the entire follow-up of 30 months. PMID:26623217

  3. Magic wavelengths for the 5 s - 18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, Elizabeth; Norris, David; Koller, Silvio; Wyllie, Robert; Brown, Roger; Porto, Trey; Safronova, Ulyana; Safronova, Marianna

    2015-05-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s - 18 s transition of rubidium near the 18 s - 6 p resonances. We compare the calculation to experiment by measuring the light shift for atoms held in a crossed optical dipole trap with wavelength tuned around the 18 s - 6p3 / 2 resonance at the experimentally convenient wavelength of 1064 nm.

  4. A conserved heptamer motif for ribosomal RNA transcription termination in animal mitochondria.

    PubMed Central

    Valverde, J R; Marco, R; Garesse, R

    1994-01-01

    A search of sequence data bases for a tridecamer transcription termination signal, previously described in human mtDNA as being responsible for the accumulation of mitochondrial ribosomal RNAs (rRNAs) in excess over the rest of mitochondrial genes, has revealed that this termination signal occurs in equivalent positions in a wide variety of organisms from protozoa to mammals. Due to the compact organization of the mtDNA, the tridecamer motif usually appears as part of the 3' adjacent gene sequence. Because in phylogenetically widely separated organisms the mitochondrial genome has experienced many rearrangements, it is interesting that its occurrence near the 3' end of the large rRNA is independent of the adjacent gene. The tridecamer sequence has diverged in phylogenetically widely separated organisms. Nevertheless, a well-conserved heptamer--TGGCAGA, the mitochondrial rRNA termination box--can be defined. Although extending the experimental evidence of its role as a transcription termination signal in humans will be of great interest, its evolutionary conservation strongly suggests that mitochondrial rRNA transcription termination could be a widely conserved mechanism in animals. Furthermore, the conservation of a homologous tridecamer motif in one of the last 3' secondary loops of nonmitochondrial 23S-like rRNAs suggests that the role of the sequence has changed during mitochondrial evolution. PMID:7515499

  5. Nucleolin: dual roles in rDNA chromatin transcription.

    PubMed

    Durut, Nathalie; Sáez-Vásquez, Julio

    2015-02-01

    Nucleolin is a major nucleolar protein conserved in all eukaryotic organisms. It is a multifunctional protein involved in different cellular aspects like chromatin organization and stability, DNA and RNA metabolism, assembly of ribonucleoprotein complexes, cytokinesis, cell proliferation and stress response. The multifunctionality of nucleolin is linked to its tripartite structure, post-translational modifications and its ability of shuttling from and to the nucleolus/nucleoplasm and cytoplasm. Nucleolin has been now studied for many years and its activities and properties have been described in a number of excellent reviews. Here, we overview the role of nucleolin in RNA polymerase I (RNAPI) transcription and describe recent results concerning its functional interaction with rDNA chromatin organization. For a long time, nucleolin has been associated with rRNA gene expression and pre-rRNA processing. However, the functional connection between nucleolin and active versus inactive rRNA genes is still not fully understood. Novel evidence indicates that the nucleolin protein might be required for controlling the transcriptional ON/OFF states of rDNA chromatin in both mammals and plants. PMID:25225127

  6. Octamer displacement and redistribution in transcription of single nucleosomes.

    PubMed Central

    O'Donohue, M F; Duband-Goulet, I; Hamiche, A; Prunell, A

    1994-01-01

    Single nucleosomes were assembled on a 357bp DNA fragment containing a 5S RNA gene from sea urchin and a promoter for SP6 RNA polymerase, and were fractionated as a function of their positions by gel electrophoresis. Transcribed nucleosome positions were detected by observing band disappearance in gels, which in turn provided evidence for the displacement of the histone octamer upon transcription. Differential band disappearance showed that nucleosomes closer to the promoter were harder to transcribe, and transcription was blocked when the nucleosome proximal boundary was at the start site. Nucleosomes located at discrete positions were also eluted from the gel bands and transcribed. In this case, new bands appeared as a consequence of octamer redistribution. Such redistribution occurred over all untranscribed positions, as well as over transcribed positions close enough to the promoter. Similar conclusions were derived from another previously investigated fragment containing a Xenopus 5S RNA gene. Images PMID:8152924

  7. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    PubMed Central

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  8. Chromosome-specific NOR inactivation explains selective rRNA gene silencing and dosage control in Arabidopsis

    PubMed Central

    Chandrasekhara, Chinmayi; Mohannath, Gireesha; Blevins, Todd; Pontvianne, Frederic; Pikaard, Craig S.

    2016-01-01

    In eukaryotes, scores of excess ribosomal RNA (rRNA) genes are silenced by repressive chromatin modifications. Given the near sequence identity of rRNA genes within a species, it is unclear how specific rRNA genes are reproducibly chosen for silencing. Using Arabidopsis thaliana ecotype (strain) Col-0, a systematic search identified sequence polymorphisms that differ between active and developmentally silenced rRNA gene subtypes. Recombinant inbred mapping populations derived from three different ecotype crosses were then used to map the chromosomal locations of silenced and active RNA gene subtypes. Importantly, silenced and active rRNA gene subtypes are not intermingled. All silenced rRNA gene subtypes mapped to the nucleolus organizer region (NOR) on chromosome 2 (NOR2). All active rRNA gene subtypes mapped to NOR4. Using an engineered A. thaliana line in which a portion of Col-0 chromosome 4 was replaced by sequences of another ecotype, we show that a major rRNA gene subtype silenced at NOR2 is active when introgressed into the genome at NOR4. Collectively, these results reveal that selective rRNA gene silencing is not regulated gene by gene based on mechanisms dependent on subtle gene sequence variation. Instead, we propose that a subchromosomal silencing mechanism operates on a multimegabase scale to inactivate NOR2. PMID:26744421

  9. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells

    PubMed Central

    Cao, Weibiao

    2016-01-01

    Mechanisms of the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA. PMID:26901778

  10. Expression of expanded CAG transcripts triggers nucleolar stress in Huntington's disease.

    PubMed

    Tsoi, Ho; Chan, Ho Yin Edwin

    2013-06-01

    Polyglutamine (polyQ) diseases, including several types of spinocerebellar ataxias and Huntington's disease (HD), are dominantly inherited neurodegenerative disorders caused by the expansion of the glutamine-coding CAG repeat in the open reading frame of the disease gene. Apart from being translated to produce toxic elongated polyQ domain-containing disease proteins, transcribed expanded CAG RNAs per se also exert toxicity in polyQ degeneration. In the R6/2 HD transgenic mouse model, expanded mutant Huntingtin (Htt) transcripts were found to physically interact with nucleolin (NCL), a nucleolar protein that plays a crucial role in ribosome biogenesis. We further demonstrated that mutant Htt transcripts deprived NCL from binding onto the Upstream Control Element (UCE) of the ribosomal RNA (rRNA) promoter. This resulted in UCE hypermethylation which abolished the binding of the transcription factor Upstream Binding Factor to UCE and subsequently led to down-regulation of pre-45s rRNA transcription. We also found that the p53/mitochondria-dependent nucleolar stress cell death pathway was activated in polyQ diseases. Ribosomal RNA transcription dysfunction has been reported in other types of neurodegenerative disorders including Alzheimer's disease; it is anticipated that nucleolar stress is one common pathogenic signaling mechanism shared by different forms of neurodegeneration. PMID:23315009

  11. Wnt5a Signals through DVL1 to Repress Ribosomal DNA Transcription by RNA Polymerase I.

    PubMed

    Dass, Randall A; Sarshad, Aishe A; Carson, Brittany B; Feenstra, Jennifer M; Kaur, Amanpreet; Obrdlik, Ales; Parks, Matthew M; Prakash, Varsha; Love, Damon K; Pietras, Kristian; Serra, Rosa; Blanchard, Scott C; Percipalle, Piergiorgio; Brown, Anthony M C; Vincent, C Theresa

    2016-08-01

    Ribosome biogenesis is essential for cell growth and proliferation and is commonly elevated in cancer. Accordingly, numerous oncogene and tumor suppressor signaling pathways target rRNA synthesis. In breast cancer, non-canonical Wnt signaling by Wnt5a has been reported to antagonize tumor growth. Here, we show that Wnt5a rapidly represses rDNA gene transcription in breast cancer cells and generates a chromatin state with reduced transcription of rDNA by RNA polymerase I (Pol I). These effects were specifically dependent on Dishevelled1 (DVL1), which accumulates in nucleolar organizer regions (NORs) and binds to rDNA regions of the chromosome. Upon DVL1 binding, the Pol I transcription activator and deacetylase Sirtuin 7 (SIRT7) releases from rDNA loci, concomitant with disassembly of Pol I transcription machinery at the rDNA promoter. These findings reveal that Wnt5a signals through DVL1 to suppress rRNA transcription. This provides a novel mechanism for how Wnt5a exerts tumor suppressive effects and why disruption of Wnt5a signaling enhances mammary tumor growth in vivo. PMID:27500936

  12. Wnt5a Signals through DVL1 to Repress Ribosomal DNA Transcription by RNA Polymerase I

    PubMed Central

    Dass, Randall A.; Sarshad, Aishe A.; Feenstra, Jennifer M.; Kaur, Amanpreet; Pietras, Kristian; Serra, Rosa; Blanchard, Scott C.; Percipalle, Piergiorgio; Brown, Anthony M. C.; Vincent, C. Theresa

    2016-01-01

    Ribosome biogenesis is essential for cell growth and proliferation and is commonly elevated in cancer. Accordingly, numerous oncogene and tumor suppressor signaling pathways target rRNA synthesis. In breast cancer, non-canonical Wnt signaling by Wnt5a has been reported to antagonize tumor growth. Here, we show that Wnt5a rapidly represses rDNA gene transcription in breast cancer cells and generates a chromatin state with reduced transcription of rDNA by RNA polymerase I (Pol I). These effects were specifically dependent on Dishevelled1 (DVL1), which accumulates in nucleolar organizer regions (NORs) and binds to rDNA regions of the chromosome. Upon DVL1 binding, the Pol I transcription activator and deacetylase Sirtuin 7 (SIRT7) releases from rDNA loci, concomitant with disassembly of Pol I transcription machinery at the rDNA promoter. These findings reveal that Wnt5a signals through DVL1 to suppress rRNA transcription. This provides a novel mechanism for how Wnt5a exerts tumor suppressive effects and why disruption of Wnt5a signaling enhances mammary tumor growth in vivo. PMID:27500936

  13. Molecular Diagnosis of Actinomadura madurae Infection by 16S rRNA Deep Sequencing

    PubMed Central

    SenGupta, Dhruba J.; Hoogestraat, Daniel R.; Cummings, Lisa A.; Bryant, Bronwyn H.; Natividad, Catherine; Thielges, Stephanie; Monsaas, Peter W.; Chau, Mimosa; Barbee, Lindley A.; Rosenthal, Christopher; Cookson, Brad T.; Hoffman, Noah G.

    2013-01-01

    Next-generation DNA sequencing can be used to catalog individual organisms within complex, polymicrobial specimens. Here, we utilized deep sequencing of 16S rRNA to implicate Actinomadura madurae as the cause of mycetoma in a diabetic patient when culture and conventional molecular methods were overwhelmed by overgrowth of other organisms. PMID:24108607

  14. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples. PMID:25343859

  15. Ribosome origins: The relative age of 23S rRNA Domains

    NASA Astrophysics Data System (ADS)

    Hury, James; Nagaswamy, Uma; Larios-Sanz, Maia; Fox, George E.

    2006-08-01

    The modern ribosome and its component RNAs are quite large and it is likely that at an earlier time they were much smaller. Hence, not all regions of the modern ribosomal RNAs (rRNA) are likely to be equally old. In the work described here, it is hypothesized that the oldest regions of the RNAs will usually be highly integrated into the machinery. When this is the case, an examination of the interconnectivity between local RNA regions can provide insight to the relative age of the various regions. Herein, we describe an analysis of all known long-range RNA/RNA interactions within the 23S rRNA and between the 23S rRNA and the 16S rRNA in order to assess the interconnectivity between the usual Domains as defined by secondary structure. Domain V, which contains the peptidyl transferase center is centrally located, extensively connected, and therefore likely to be the oldest region. Domain IV and Domain II are extensively interconnected with both themselves and Domain V. A portion of Domain IV is also extensively connected with the 30S subunit and hence Domain IV may be older than Domain II. These results are consistent with other evidence relating to the relative age of RNA regions. Although the relative time of addition of the GTPase center can not be reliably deduced it is pointed out that the development of this may have dramatically affected the progenotes that preceded the last common ancestor.

  16. Ribosomal Database Project: data and tools for high throughput rRNA analysis

    PubMed Central

    Cole, James R.; Wang, Qiong; Fish, Jordan A.; Chai, Benli; McGarrell, Donna M.; Sun, Yanni; Brown, C. Titus; Porras-Alfaro, Andrea; Kuske, Cheryl R.; Tiedje, James M.

    2014-01-01

    Ribosomal Database Project (RDP; http://rdp.cme.msu.edu/) provides the research community with aligned and annotated rRNA gene sequence data, along with tools to allow researchers to analyze their own rRNA gene sequences in the RDP framework. RDP data and tools are utilized in fields as diverse as human health, microbial ecology, environmental microbiology, nucleic acid chemistry, taxonomy and phylogenetics. In addition to aligned and annotated collections of bacterial and archaeal small subunit rRNA genes, RDP now includes a collection of fungal large subunit rRNA genes. RDP tools, including Classifier and Aligner, have been updated to work with this new fungal collection. The use of high-throughput sequencing to characterize environmental microbial populations has exploded in the past several years, and as sequence technologies have improved, the sizes of environmental datasets have increased. With release 11, RDP is providing an expanded set of tools to facilitate analysis of high-throughput data, including both single-stranded and paired-end reads. In addition, most tools are now available as open source packages for download and local use by researchers with high-volume needs or who would like to develop custom analysis pipelines. PMID:24288368

  17. Unequal Crossing over at the Rrna Tandon as a Source of Quantitative Genetic Variation in Drosophila

    PubMed Central

    Frankham, R.; Briscoe, D. A.; Nurthen, R. K.

    1980-01-01

    Abdominal bristle selection lines (three high and three low) and controls were founded from a marked homozygous line to measure the contribution of sex-linked "mutations" to selection response. Two of the low lines exhibited a period of rapid response to selection in females, but not in males. There were corresponding changes in female variance, in heritabilities in females, in the sex ratio (a deficiency of females) and in fitness, as well as the appearance of a mutant phenotype in females of one line. All of these changes were due to bb alleles (partial deficiencies for the rRNA tandon) in the X chromosomes of these lines, while the Y chromosomes remained wild-type bb+. We argue that the bb alleles arose by unequal crossing over in the rRNA tandon.—A prediction of this hypothesis is that further changes can occur in the rRNA tandon as selection is continued. This has now been shown to occur.—Our minimum estimate of the rate of occurrence of changes at the rRNA tandon is 3 x 10-4. As this is substantially higher than conventional mutation rates, the questions of the mechanisms and rates of origin of new quantitative genetic variation require careful re-examination. PMID:7439683

  18. 16S rRNA region based PCR protocol for identification and subtyping of Parvimonas micra

    PubMed Central

    Ota-Tsuzuki, C.; Brunheira, A.T.P.; Mayer, M.P.A.

    2008-01-01

    The present study established a PCR protocol in order to identify Parvimonas micra and to evaluate the intra-species diversity by PCR-RFLP of 16S rRNA partial sequence. The data indicated that the protocol was able to identify this species which could be clustered in five genotypes. PMID:24031274

  19. Analysis of 5S rDNA arrays in Arabidopsis thaliana: physical mapping and chromosome-specific polymorphisms.

    PubMed

    Cloix, C; Tutois, S; Mathieu, O; Cuvillier, C; Espagnol, M C; Picard, G; Tourmente, S

    2000-05-01

    A physical map of a pericentromeric region of chromosome 5 containing a 5S rDNA locus and spanning approximately 1000 kb was established using the CIC YAC clones. Three 5S rDNA arrays were resolved in this YAC contig by PFGE analysis and we have mapped different types of sequences between these three blocks. 5S rDNA units from each of these three arrays of chromosome 5, and from chromosomes 3 and 4, were isolated by PCR. A total of 38 new DNA sequences were obtained. Two types of 5S rDNA repeated units exist: the major variant with 0.5-kb repeats and one with short repeats (251 bp) only detected on YAC 11A3 from chromosome 3. Although the 38 sequences displayed noticeable heterogeneity, we were able to group them according to their 5S array origin. The presence of 5S array-specific variants was confirmed with the restriction polymorphism study of all the YACs carrying 5S units. PMID:10810091

  20. The nature of Z_b states from a combined analysis of Upsilon (5S)rightarrow h_b(mP) π ^+ π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π

    NASA Astrophysics Data System (ADS)

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-03-01

    With a combined analysis of data on Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π in an effective field theory approach, we determine resonance parameters of Z_b states in two scenarios. In one scenario we assume that Z_b states are pure molecular states, while in the other one we assume that Z_b states contain compact components. We find that the present data favor that there should be some compact components inside Z_b^{(' )} associated with the molecular components. By fitting the invariant mass spectra of Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{*}π , we determine that the probability of finding the compact components in Z_b states may be as large as about 40 %.

  1. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing.

    PubMed Central

    Schmidt, T M; DeLong, E F; Pace, N R

    1991-01-01

    The phylogenetic diversity of an oligotrophic marine picoplankton community was examined by analyzing the sequences of cloned ribosomal genes. This strategy does not rely on cultivation of the resident microorganisms. Bulk genomic DNA was isolated from picoplankton collected in the north central Pacific Ocean by tangential flow filtration. The mixed-population DNA was fragmented, size fractionated, and cloned into bacteriophage lambda. Thirty-eight clones containing 16S rRNA genes were identified in a screen of 3.2 x 10(4) recombinant phage, and portions of the rRNA gene were amplified by polymerase chain reaction and sequenced. The resulting sequences were used to establish the identities of the picoplankton by comparison with an established data base of rRNA sequences. Fifteen unique eubacterial sequences were obtained, including four from cyanobacteria and eleven from proteobacteria. A single eucaryote related to dinoflagellates was identified; no archaebacterial sequences were detected. The cyanobacterial sequences are all closely related to sequences from cultivated marine Synechococcus strains and with cyanobacterial sequences obtained from the Atlantic Ocean (Sargasso Sea). Several sequences were related to common marine isolates of the gamma subdivision of proteobacteria. In addition to sequences closely related to those of described bacteria, sequences were obtained from two phylogenetic groups of organisms that are not closely related to any known rRNA sequences from cultivated organisms. Both of these novel phylogenetic clusters are proteobacteria, one group within the alpha subdivision and the other distinct from known proteobacterial subdivisions. The rRNA sequences of the alpha-related group are nearly identical to those of some Sargasso Sea picoplankton, suggesting a global distribution of these organisms. Images PMID:2066334

  2. Origin and evolution of organisms as deduced from 5S ribosomal RNA sequences.

    PubMed

    Hori, H; Osawa, S

    1987-09-01

    A phylogenetic tree of most of the major groups of organisms has been constructed from the 352 5S ribosomal RNA sequences now available. The tree suggests that there are several major groups of eubacteria that diverged during the early stages of their evolution. Metabacteria (= archaebacteria) and eukaryotes separated after the emergence of eubacteria. Among eukaryotes, red algae emerged first; and, later, thraustochytrids (a Proctista group), ascomycetes (yeast), green plants (green algae and land plants), "yellow algae" (brown algae, diatoms, and chrysophyte algae), basidiomycetes (mushrooms and rusts), slime- and water molds, various protozoans, and animals emerged, approximately in that order. Three major types of photosynthetic eukaryotes--i.e., red algae (= Chlorophyll a group), green plants (Chl. a + b group) and yellow algae (Chl. a + c)--are remotely related to one another. Other photosynthetic unicellular protozoans--such as Cyanophora (Chl. a), Euglenophyta (Chl. a + b), Cryptophyta (Chl. a + c), and Dinophyta (Chl. a + c)--seem to have separated shortly after the emergence of the yellow algae. PMID:2452957

  3. Hard X-ray XAFS beamline, BL5S1, at AichiSR

    NASA Astrophysics Data System (ADS)

    Tabuchi, M.; Asakura, H.; Morimoto, H.; Watanabe, N.; Takeda, Y.

    2016-05-01

    A XAFS beamline, BL5S1, had been operated at Aichi Synchrotron Radiation Center, Japan since March 2013. The beamline was designed for the measurements in the energy range from 5 to 20 keV. The photon flux of 6 x 1010 at around 9 keV and beam spot size of 0.5 x 0.3 mm at sample position are as good as designed. For the standard transmission XAFS measurement, both of the step- and quick- scan modes are available. Energy resolution at around 9keV is good enough to discuss the energy shift of the order of 0.1 eV or higher even when the measurements are conducted in the quick-scan mode. With several kinds of detectors for fluorescence and/or CEY detection mode measurements, and various kinds of sample holders which are supported by the XAFS measurement software, users easily obtain spectra for their samples. Such a standard, well operated and easy to access XAFS beamline must be very important to broaden the base of the XAFS society further.

  4. Design and performance of a 1 MW-5 s high temperature superconductor magnetic energy storage system

    NASA Astrophysics Data System (ADS)

    Morandi, Antonio; Gholizad, Babak; Fabbri, Massimo

    2016-01-01

    The feasibility of a 1 MW-5 s superconducting magnetic energy storage (SMES) system based on state-of-the-art high-temperature superconductor (HTS) materials is investigated in detail. Both YBCO coated conductors and MgB2 are considered. A procedure for the electromagnetic design of the coil is introduced and the final layout is arrived at and compared for the two materials. The choice of the inductance of the coil is carried out as part of the design procedure. Both low-field (3 T) and high-field (8 T) designs are considered for the YBCO. AC losses during a complete charge/discharge cycle at full power are estimated and the cooling power needed for continuous operation is derived. The power conditioning system and control algorithms needed to carry out various operations are discussed in detail. Performances of the SMES system during voltage sag compensation, load leveling and power factor correction are investigated by means of numerical simulation.

  5. Rhizobium sp. strain BN4 (a selenium oxyanion-reducing bacterium) 16S rRNA gene complete sequence

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1482 base pair 16S rRNA gene sequence methods in conjunction with other biochemical and morphological studies to confirm the identification of a bacterium (refer to as the BN4 strain) as a Rhizobium sp. The 16S rRNA gene sequence places it with the Rhizobium clade that includes R. d...

  6. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus. PMID:26959315

  7. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus.

    PubMed

    Caradonna, Fabio; Bellavia, Daniele; Clemente, Ann Maria; Sisino, Giorgia; Barbieri, Rainer

    2007-09-01

    In this paper the chromosomal localization and molecular cloning and characterization of three 5S rDNA clusters of 700 bp (base pairs), 900 bp, and 950 bp in the sea urchin Paracentrotus lividus are reported. Southern blot hybridization demonstrated the existence of three 5S rDNA repeats of differing length in the P. lividus genome. Fluorescence in situ hybridization analysis, performed in parallel on both haploid and diploid metaphases and interphase nuclei using different 5S rDNA units as probes, localized these 5S rDNA clusters in 3 different pairs of P. lividus chromosomes. This is the first complete gene mapping not only in a sea urchin but also in the phylum of echinoderms as a whole. PMID:17893727

  8. Guanine nucleotide metabolism in a mutant strain of Escherichia coli with a temperature sensitive lesion in rRNA synthesis.

    PubMed

    Harris, J S; Chaney, S G

    1978-12-21

    We have described a mutant of Escherichia coli (designated 2S142) which shows specific inhibition of rRNA synthesis at 42 degrees C. ppGpp levels increase at the restrictive temperature, as expected. However, when the cells are returned to 30 degrees C, rRNA synthesis resumes before ppGpp levels have returned to normal. Furthermore, when ppGpp levels are decreased by the addition of tetracycline or choramphenicol, rRNA synthesis does not resume at 42 degrees C. Also, a derivative of 2S142 with a temperature-sensitive G factor (which cannot synthesize either protein or ppGpp at 42 degrees C) shows identical kinetics of rRNA shut-off at 42 degrees C as 2S142. Thus, the elevated ppGpp levels in this mutant do not appear to be directly responsible for the cessation of rRNA synthesis at 42 degrees C. PMID:367439

  9. Conformation of 4.5S RNA in the signal recognition particle and on the 30S ribosomal subunit

    PubMed Central

    GU, SHAN-QING; JÖCKEL, JOHANNES; BEINKER, PHILIPP; WARNECKE, JENS; SEMENKOV, YURI P.; RODNINA, MARINA V.; WINTERMEYER, WOLFGANG

    2005-01-01

    The signal recognition particle (SRP) from Escherichia coli consists of 4.5S RNA and protein Ffh. It is essential for targeting ribosomes that are translating integral membrane proteins to the translocation pore in the plasma membrane. Independently of Ffh, 4.5S RNA also interacts with elongation factor G (EF-G) and the 30S ribosomal subunit. Here we use a cross-linking approach to probe the conformation of 4.5S RNA in SRP and in the complex with the 30S ribosomal subunit and to map the binding site. The UV-activatable cross-linker p-azidophenacyl bromide (AzP) was attached to positions 1, 21, and 54 of wild-type or modified 4.5S RNA. In SRP, cross-links to Ffh were formed from AzP in all three positions in 4.5S RNA, indicating a strongly bent conformation in which the 5′ end (position 1) and the tetraloop region (including position 54) of the molecule are close to one another and to Ffh. In ribosomal complexes of 4.5S RNA, AzP in both positions 1 and 54 formed cross-links to the 30S ribosomal subunit, independently of the presence of Ffh. The major cross-linking target on the ribosome was protein S7; minor cross-links were formed to S2, S18, and S21. There were no cross-links from 4.5S RNA to the 50S subunit, where the primary binding site of SRP is located close to the peptide exit. The functional role of 4.5S RNA binding to the 30S subunit is unclear, as the RNA had no effect on translation or tRNA translocation on the ribosome. PMID:16043501

  10. Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

    NASA Technical Reports Server (NTRS)

    Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

    1985-01-01

    The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

  11. Photoaffinity labelling of the pea chloroplast transcriptional complex by nascent RNA in vitro.

    PubMed Central

    Khanna, N C; Lakhani, S; Tewari, K K

    1991-01-01

    We have used photoaffinity labelling to examine the chloroplast RNA polymerase components which come into contact with nascent transcripts during the in vitro transcription of plastid DNA. The transcripts were synthesized in the presence of a photoactive analogue (4-thio UTP) and alpha-32P-ATP, using enriched pea chloroplast RNA polymerase preparation and a recombinant plasmid containing the plastid 16S rRNA promoter. Brief irradiation of the transcriptional complex crosslinked the photoactive nascent RNA to proximal proteins. Labelling of the transcriptional complex was dependent on 4-thio UTP and template DNA. Two polypeptides of 51 and 54 kDa were consistently crosslinked to the nascent transcripts; about 60% of the total radioactivity of the crosslinked RNA was associated with these polypeptides. In some experiments, two additional polypeptides of 38 and 75 kDa were also found to be associated with about 13% and 17% of the total crosslinked RNA radioactivity, respectively. The UV-crosslinked transcriptional complexes were stable to either DNase or S1 nuclease hydrolysis but partially sensitive to RNase T1. Insensitivity of the complex to hydrolysis with RNase H suggested that the nascent transcripts were not crosslinked to the template. The complexes could also be hydrolysed by proteinase K and thermolysin. No crosslinkage was observed when labelled RNA molecules containing 4-thio UMP residues were added after synthesis to the polymerase preparation. This suggested that the method identified only those polypeptides which came into close contact with the transcript during its synthesis. Antibodies raised against the RNA-protein complex confirmed the presence of the polypeptides in the chloroplast RNA polymerase preparation on Western blots. Preincubation of these antibodies with the chloroplast RNA polymerase inhibited plastid DNA transcription. These data showed that the transcript-binding polypeptides were functional components of the chloroplast

  12. The Transcription Factor Encyclopedia

    PubMed Central

    2012-01-01

    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at http://www.cisreg.ca/tfe. PMID:22458515

  13. The transcription factor encyclopedia.

    PubMed

    Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I; Bolotin, Eugene; Ticoll, Amy; Cheung, Warren A; Zhang, Xiao Yu Cindy; Dickman, Christopher T D; Fulton, Debra L; Lim, Jonathan S; Schnabl, Jake M; Ramos, Oscar H P; Vasseur-Cognet, Mireille; de Leeuw, Charles N; Simpson, Elizabeth M; Ryffel, Gerhart U; Lam, Eric W-F; Kist, Ralf; Wilson, Miranda S C; Marco-Ferreres, Raquel; Brosens, Jan J; Beccari, Leonardo L; Bovolenta, Paola; Benayoun, Bérénice A; Monteiro, Lara J; Schwenen, Helma D C; Grontved, Lars; Wederell, Elizabeth; Mandrup, Susanne; Veitia, Reiner A; Chakravarthy, Harini; Hoodless, Pamela A; Mancarelli, M Michela; Torbett, Bruce E; Banham, Alison H; Reddy, Sekhar P; Cullum, Rebecca L; Liedtke, Michaela; Tschan, Mario P; Vaz, Michelle; Rizzino, Angie; Zannini, Mariastella; Frietze, Seth; Farnham, Peggy J; Eijkelenboom, Astrid; Brown, Philip J; Laperrière, David; Leprince, Dominique; de Cristofaro, Tiziana; Prince, Kelly L; Putker, Marrit; del Peso, Luis; Camenisch, Gieri; Wenger, Roland H; Mikula, Michal; Rozendaal, Marieke; Mader, Sylvie; Ostrowski, Jerzy; Rhodes, Simon J; Van Rechem, Capucine; Boulay, Gaylor; Olechnowicz, Sam W Z; Breslin, Mary B; Lan, Michael S; Nanan, Kyster K; Wegner, Michael; Hou, Juan; Mullen, Rachel D; Colvin, Stephanie C; Noy, Peter John; Webb, Carol F; Witek, Matthew E; Ferrell, Scott; Daniel, Juliet M; Park, Jason; Waldman, Scott A; Peet, Daniel J; Taggart, Michael; Jayaraman, Padma-Sheela; Karrich, Julien J; Blom, Bianca; Vesuna, Farhad; O'Geen, Henriette; Sun, Yunfu; Gronostajski, Richard M; Woodcroft, Mark W; Hough, Margaret R; Chen, Edwin; Europe-Finner, G Nicholas; Karolczak-Bayatti, Magdalena; Bailey, Jarrod; Hankinson, Oliver; Raman, Venu; LeBrun, David P; Biswal, Shyam; Harvey, Christopher J; DeBruyne, Jason P; Hogenesch, John B; Hevner, Robert F; Héligon, Christophe; Luo, Xin M; Blank, Marissa Cathleen; Millen, Kathleen Joyce; Sharlin, David S; Forrest, Douglas; Dahlman-Wright, Karin; Zhao, Chunyan; Mishima, Yuriko; Sinha, Satrajit; Chakrabarti, Rumela; Portales-Casamar, Elodie; Sladek, Frances M; Bradley, Philip H; Wasserman, Wyeth W

    2012-01-01

    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at http://www.cisreg.ca/tfe. PMID:22458515

  14. The ribosomal RNA transcription unit of Entamoeba invadens: accumulation of unprocessed pre-rRNA and a long non coding RNA during encystation.

    PubMed

    Ojha, Sandeep; Singh, Nishant; Bhattacharya, Alok; Bhattacharya, Sudha

    2013-01-01

    The ribosomal RNA genes in Entamoeba spp. are located on extrachromosomal circular molecules. Unlike model organisms where rRNA transcription stops during growth stress, Entamoeba histolytica continues transcription; but unprocessed pre-rRNA accumulates during stress, along with a novel class of circular transcripts from the 5'-external transcribed spacer (ETS). To determine the fate of rRNA transcription during stage conversion between trophozoite to cyst we analyzed Entamoeba invadens, a model system for differentiation studies in Entamoeba. We characterized the complete rDNA transcription unit by mapping the ends of pre-rRNA and mature rRNAs. The 3' end of mature 28S rRNA was located 321 nt downstream of the end predicted by sequence homology with E. histolytica. The major processing sites were mapped in external and internal transcribed spacers. The promoter located within 146 nt upstream of 5' ETS was used to transcribe the pre-rRNA. On the other hand, a second promoter located at the 3' end of 28S rDNA was used to transcribe almost the entire intergenic spacer into a long non coding (nc) RNA (>10 kb). Interestingly we found that the levels of pre-rRNA and long ncRNA, measured by northern hybridization, decreased initially in cells shifted to encystation medium, after which they began to increase and reached high levels by 72 h when mature cysts were formed. Unlike E. histolytica, no circular transcripts were found in E. invadens. E. histolytica and E. invadens express fundamentally different ncRNAs from the rDNA locus, which may reflect their adaptation to different hosts (human and reptiles, respectively). This is the first description of rDNA organization and transcription in E. invadens, and provides the framework for further studies on regulation of rRNA synthesis during cyst formation. PMID:24200639

  15. Mapping Yeast Transcriptional Networks

    PubMed Central

    Hughes, Timothy R.; de Boer, Carl G.

    2013-01-01

    The term “transcriptional network” refers to the mechanism(s) that underlies coordinated expression of genes, typically involving transcription factors (TFs) binding to the promoters of multiple genes, and individual genes controlled by multiple TFs. A multitude of studies in the last two decades have aimed to map and characterize transcriptional networks in the yeast Saccharomyces cerevisiae. We review the methodologies and accomplishments of these studies, as well as challenges we now face. For most yeast TFs, data have been collected on their sequence preferences, in vivo promoter occupancy, and gene expression profiles in deletion mutants. These systematic studies have led to the identification of new regulators of numerous cellular functions and shed light on the overall organization of yeast gene regulation. However, many yeast TFs appear to be inactive under standard laboratory growth conditions, and many of the available data were collected using techniques that have since been improved. Perhaps as a consequence, comprehensive and accurate mapping among TF sequence preferences, promoter binding, and gene expression remains an open challenge. We propose that the time is ripe for renewed systematic efforts toward a complete mapping of yeast transcriptional regulatory mechanisms. PMID:24018767

  16. Automatic Music Transcription

    NASA Astrophysics Data System (ADS)

    Klapuri, Anssi; Virtanen, Tuomas

    Written musical notation describes music in a symbolic form that is suitable for performing a piece using the available musical instruments. Traditionally, musical notation indicates the pitch, target instrument, timing, and duration of each sound to be played. The aim of music transcription either by humans or by a machine is to infer these musical parameters, given only the acoustic recording of a performance.

  17. A renaissance for the pioneering 16S rRNA gene

    SciTech Connect

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  18. Rapid identification of Renibacterium salmoninarum using an oligonucleotide probe complementary to 16S rRNA.

    PubMed

    Mattsson, J G; Gersdorf, H; Jansson, E; Hongslo, T; Göbel, U B; Johansson, K E

    1993-02-01

    Bacterial kidney disease in salmonid fish is caused by the slow-growing Gram-positive rod, Renibacterium salmoninarum. The partial sequence of 16S rRNA from R. salmoninarum was determined and compared with published bacterial 16S rRNA sequences. From this sequence information, a 30-bases-long oligonucleotide was designed and used as a specific probe for identification of R. salmoninarum in filter hybridization experiments. Strong specific hybridization signals were observed for all strains of R. salmoninarum tested. Furthermore, no cross-hybridization could be seen against 22 other bacterial species, among them other salmonid fish pathogens. The detection limit for the probe in direct filter hybridization by the dot-blot technique was 2.5 x 10(4) bacteria. It was also possible to detect R. salmoninarum in clinical samples by direct filter hybridization. PMID:8455640

  19. Structural Analysis of Base Substitutions in Thermus thermophilus 16S rRNA Conferring Streptomycin Resistance

    PubMed Central

    Demirci, Hasan; Murphy, Frank V.; Murphy, Eileen L.; Connetti, Jacqueline L.; Dahlberg, Albert E.; Jogl, Gerwald

    2014-01-01

    Streptomycin is a bactericidal antibiotic that induces translational errors. It binds to the 30S ribosomal subunit, interacting with ribosomal protein S12 and with 16S rRNA through contacts with the phosphodiester backbone. To explore the structural basis for streptomycin resistance, we determined the X-ray crystal structures of 30S ribosomal subunits from six streptomycin-resistant mutants of Thermus thermophilus both in the apo form and in complex with streptomycin. Base substitutions at highly conserved residues in the central pseudoknot of 16S rRNA produce novel hydrogen-bonding and base-stacking interactions. These rearrangements in secondary structure produce only minor adjustments in the three-dimensional fold of the pseudoknot. These results illustrate how antibiotic resistance can occur as a result of small changes in binding site conformation. PMID:24820088

  20. Expansion of the aminoglycoside-resistance 16S rRNA (m1A1408) methyltransferase family: expression and functional characterization of four hypothetical enzymes of diverse bacterial origin

    PubMed Central

    Witek, Marta A.; Conn, Graeme L.

    2014-01-01

    The global dissemination, potential activity in diverse species and broad resistance spectrum conferred by the aminoglycoside-resistance ribosomal RNA methyltransferases make them a significant potential new threat to the efficacy of aminoglycoside antibiotics in the treatment of serious bacterial infections. The N1 methylation of adenosine 1408 (m1A1408) confers resistance to structurally diverse aminoglycosides, including kanamycin, neomycin and apramycin. The limited analyses to date of the enzymes responsible have identified common features but also potential differences in their molecular details of action. Therefore, with the goal of expanding the known 16S rRNA (m1A1408) methyltransferase family as a platform for developing a more complete mechanistic understanding, we report here the cloning, expression and functional analyses of four hypothetical aminoglycoside-resistance rRNA methyltransferases from recent genome sequences of diverse bacterial species. Each of the genes produced a soluble, folded protein with a secondary structure, as determined from circular dichroism (CD) spectra, consistent with enzymes for which high-resolution structures are available. For each enzyme, antibiotic minimum inhibitory concentration (MIC) assays revealed a resistance spectrum characteristic of the known 16S rRNA (m1A1408) methyltransferases and the modified nucleotide was confirmed by reverse transcription as A1408. In common with other family members, higher binding affinity for the methylation reaction by-product S-adenosylhomocysteine (SAH) than the cosubstrate S-adenosyl-L-methionine (SAM) was observed for three methyltransferases, while one unexpectedly showed no measurable affinity for SAH. Collectively, these results confirm each hypothetical enzyme is a functional 16S rRNA (m1A1408) methyltransferase but also point to further potential mechanistic variation within this enzyme family. PMID:24963996

  1. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    PubMed

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. PMID:26226217

  2. Molecular systematics of hystricognath rodents: evidence from the mitochondrial 12S rRNA gene.

    PubMed

    Nedbal, M A; Allard, M W; Honeycutt, R L

    1994-09-01

    Nucleotide sequence variation among 22 representatives of 14 families of hystricognathid rodents was examined using an 814-bp region of the mitochondrial 12S ribosomal RNA (rRNA) gene composing domains I-III. The purpose of this study was twofold. First, the phylogenetic relationships among Old World phiomorph (primarily African) and New World caviomorph (primarily South American) families were investigated, with a special emphasis on testing hypotheses pertaining to the origin of New World families and the identification of major monophyletic groups. Second, divergence times derived from molecular data were compared to those suggested by the fossil record. The resultant 12S rRNA gene phylogeny, analyzed separately and in combination with other morphological and molecular data, supported a monophyletic Caviomorpha. This finding is counter to the idea of a multiple origin for the South American families. The most strongly supported relationships within the Caviomorpha were a monophyletic Octodontoidea (containing five families) and the placement of New World porcupines (family Erethizontidae) as the most divergent family. Although comparisons to other data were more equivocal, the most parsimonious 12S rRNA trees also supported a monophyletic Phiomorpha that could be subdivided into two major groups, a clade containing the Thryonomyoidea (Thryonomyidae and Petromuridae) plus Bathyergidae and the more divergent Hystricidae (Old World porcupines). No significant differences in rates of 12S rRNA gene divergence were observed for hystricognathids in comparison to other rodent groups. Although time since divergence estimates were influenced by the fossil dates chosen to calibrate absolute rates, the overall divergence times derived from both transversions only and Kimura corrected distances and calibrations using two independent dates revealed a divergence time between Old and New World groups dating in the Eocene. PMID:7820285

  3. Application of 12S rRNA gene for the identification of animal-derived drugs.

    PubMed

    Luo, Jiaoyang; Yan, Dan; Zhang, Da; Han, Yumei; Dong, Xiaoping; Yang, Yong; Deng, Kejun; Xiao, Xiaohe

    2011-01-01

    PURPOSE. Animal-derived drugs are the major source of biological products and traditional medicine, but they are often difficult to identify, causing confusion in the clinical application. Among these medicinal animals, a number of animal species are endangered, leading to the destruction of biodiversity. The identification of animal-derived drugs and their alternatives would be a first step toward biodiversity conservation and safe medication. Until now, no effective method for identifying animal-derived drugs has been demonstrated; DNA-based species identification presents a brand-new technique. METHODS. We designed primers to amplify a 523-bp fragment of 12S rRNA and generated sequences for 13 individuals within six medicinal animal species. We examined the efficiency of species recognition based on this sequence, and we also tested the taxonomic affiliations against the GenBank database. RESULTS. All the tested drugs were identified successfully, and a visible gap was found between the inter-specific and intra-specific variation. We further demonstrated the importance of data exploration in DNA-based species identification practice by examining the sequence characteristics of relative genera in GenBank. This region of the 12S rRNA gene had a 100% success rate of species recognition within the six medicinal animal species. CONCLUSIONS. We propose that the 12S rRNA locus might be universal for identifying animal-derived drugs and their adulterants. The development of 12S rRNA for indentifying animal-derived drugs that share a common gene target would contribute significantly to the clinical application of animal-derived drugs and the conservation of medicinal animal species. This article is open to POST-PUBLICATION REVIEW. Registered readers (see "For Readers") may comment by clicking on ABSTRACT on the issue's contents page. PMID:21906480

  4. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    SciTech Connect

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  5. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    PubMed

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general. PMID:26119842

  6. Characterization of the genus Bifidobacterium by automated ribotyping and 16S rRNA gene sequences.

    PubMed

    Sakata, Shinji; Ryu, Chun Sun; Kitahara, Maki; Sakamoto, Mitsuo; Hayashi, Hidenori; Fukuyama, Masafumi; Benno, Yoshimi

    2006-01-01

    In order to characterize the genus Bifidobacterium, ribopatterns and approximately 500 bp (Escherichia coli positions 27 to 520) of 16S rRNA gene sequences of 28 type strains and 64 reference strains of the genus Bifidobacterium were determined. Ribopatterns obtained from Bifidobacterium strains were divided into nine clusters (clusters I-IX) with a similarity of 60%. Cluster V, containing 17 species, was further subdivided into 22 subclusters with a similarity of 90%. In the genus Bifidobacterium, four groups were shown according to Miyake et al.: (i) the Bifidobacterium longum infantis-longum-suis type group, (ii) the B. catenulatum-pseudocatenulatum group, (iii) the B. gallinarum-saeculare-pullorum group, and (iv) the B. coryneforme-indicum group, which showed higher than 97% similarity of the 16S rRNA gene sequences in each group. Using ribotyping analysis, unique ribopatterns were obtained from these species, and they could be separated by cluster analysis. Ribopatterns of six B. adolescentis strains were separated into different clusters, and also showed diversity in 16S rRNA gene sequences. B. adolescentis consisted of heterogeneous strains. The nine strains of B. pseudolongum subsp. pseudolongum were divided into five subclusters. Each type strain of B. pseudolongum subsp. pseudolongum and B. pseudolongum subsp. globosum and two intermediate groups, which were suggested by Yaeshima et al., consisted of individual clusters. B. animalis subsp. animalis and B. animalis subsp. lactis could not be separated by ribotyping using Eco RI. We conclude that ribotyping is able to provide another characteristic of Bifidobacterium strains in addition to 16S rRNA gene sequence phylogenetic analysis, and this information suggests that ribotyping analysis is a useful tool for the characterization of Bifidobacterium species in combination with other techniques for taxonomic characterization. PMID:16428867

  7. Structure of the initiation-competent RNA polymerase I and its implication for transcription

    NASA Astrophysics Data System (ADS)

    Pilsl, Michael; Crucifix, Corinne; Papai, Gabor; Krupp, Ferdinand; Steinbauer, Robert; Griesenbeck, Joachim; Milkereit, Philipp; Tschochner, Herbert; Schultz, Patrick

    2016-07-01

    Eukaryotic RNA polymerase I (Pol I) is specialized in rRNA gene transcription synthesizing up to 60% of cellular RNA. High level rRNA production relies on efficient binding of initiation factors to the rRNA gene promoter and recruitment of Pol I complexes containing initiation factor Rrn3. Here, we determine the cryo-EM structure of the Pol I-Rrn3 complex at 7.5 Å resolution, and compare it with Rrn3-free monomeric and dimeric Pol I. We observe that Rrn3 contacts the Pol I A43/A14 stalk and subunits A190 and AC40, that association re-organizes the Rrn3 interaction interface, thereby preventing Pol I dimerization; and Rrn3-bound and monomeric Pol I differ from the dimeric enzyme in cleft opening, and localization of the A12.2 C-terminus in the active centre. Our findings thus support a dual role for Rrn3 in transcription initiation to stabilize a monomeric initiation competent Pol I and to drive pre-initiation complex formation.

  8. Structure of the initiation-competent RNA polymerase I and its implication for transcription

    PubMed Central

    Pilsl, Michael; Crucifix, Corinne; Papai, Gabor; Krupp, Ferdinand; Steinbauer, Robert; Griesenbeck, Joachim; Milkereit, Philipp; Tschochner, Herbert; Schultz, Patrick

    2016-01-01

    Eukaryotic RNA polymerase I (Pol I) is specialized in rRNA gene transcription synthesizing up to 60% of cellular RNA. High level rRNA production relies on efficient binding of initiation factors to the rRNA gene promoter and recruitment of Pol I complexes containing initiation factor Rrn3. Here, we determine the cryo-EM structure of the Pol I-Rrn3 complex at 7.5 Å resolution, and compare it with Rrn3-free monomeric and dimeric Pol I. We observe that Rrn3 contacts the Pol I A43/A14 stalk and subunits A190 and AC40, that association re-organizes the Rrn3 interaction interface, thereby preventing Pol I dimerization; and Rrn3-bound and monomeric Pol I differ from the dimeric enzyme in cleft opening, and localization of the A12.2 C-terminus in the active centre. Our findings thus support a dual role for Rrn3 in transcription initiation to stabilize a monomeric initiation competent Pol I and to drive pre-initiation complex formation. PMID:27418187

  9. Structure of the initiation-competent RNA polymerase I and its implication for transcription.

    PubMed

    Pilsl, Michael; Crucifix, Corinne; Papai, Gabor; Krupp, Ferdinand; Steinbauer, Robert; Griesenbeck, Joachim; Milkereit, Philipp; Tschochner, Herbert; Schultz, Patrick

    2016-01-01

    Eukaryotic RNA polymerase I (Pol I) is specialized in rRNA gene transcription synthesizing up to 60% of cellular RNA. High level rRNA production relies on efficient binding of initiation factors to the rRNA gene promoter and recruitment of Pol I complexes containing initiation factor Rrn3. Here, we determine the cryo-EM structure of the Pol I-Rrn3 complex at 7.5 Å resolution, and compare it with Rrn3-free monomeric and dimeric Pol I. We observe that Rrn3 contacts the Pol I A43/A14 stalk and subunits A190 and AC40, that association re-organizes the Rrn3 interaction interface, thereby preventing Pol I dimerization; and Rrn3-bound and monomeric Pol I differ from the dimeric enzyme in cleft opening, and localization of the A12.2 C-terminus in the active centre. Our findings thus support a dual role for Rrn3 in transcription initiation to stabilize a monomeric initiation competent Pol I and to drive pre-initiation complex formation. PMID:27418187

  10. Elucidating the role of C/D snoRNA in rRNA processing and modification in Trypanosoma brucei.

    PubMed

    Barth, Sarit; Shalem, Boaz; Hury, Avraham; Tkacz, Itai Dov; Liang, Xue-Hai; Uliel, Shai; Myslyuk, Inna; Doniger, Tirza; Salmon-Divon, Mali; Unger, Ron; Michaeli, Shulamit

    2008-01-01

    Most eukaryotic C/D small nucleolar RNAs (snoRNAs) guide 2'-O methylation (Nm) on rRNA and are also involved in rRNA processing. The four core proteins that bind C/D snoRNA in Trypanosoma brucei are fibrillarin (NOP1), NOP56, NOP58, and SNU13. Silencing of NOP1 by RNA interference identified rRNA-processing and modification defects that caused lethality. Systematic mapping of 2'-O-methyls on rRNA revealed the existence of hypermethylation at certain positions of the rRNA in the bloodstream form of the parasites, suggesting that this modification may assist the parasites in coping with the major temperature changes during cycling between their insect and mammalian hosts. The rRNA-processing defects of NOP1-depleted cells suggest the involvement of C/D snoRNA in trypanosome-specific rRNA-processing events to generate the small rRNA fragments. MRP RNA, which is involved in rRNA processing, was identified in this study in one of the snoRNA gene clusters, suggesting that trypanosomes utilize a combination of unique C/D snoRNAs and conserved snoRNAs for rRNA processing. PMID:17981991

  11. A Mutation in the 16S rRNA Decoding Region Attenuates the Virulence of Mycobacterium tuberculosis.

    PubMed

    Watanabe, Shinya; Matsumura, Kazunori; Iwai, Hiroki; Funatogawa, Keiji; Haishima, Yuji; Fukui, Chie; Okumura, Kayo; Kato-Miyazawa, Masako; Hashimoto, Masahito; Teramoto, Kanae; Kirikae, Fumiko; Miyoshi-Akiyama, Tohru; Kirikae, Teruo

    2016-08-01

    Mycobacterium tuberculosis contains a single rRNA operon that encodes targets for antituberculosis agents, including kanamycin. To date, only four mutations in the kanamycin binding sites of 16S rRNA have been reported in kanamycin-resistant clinical isolates. We hypothesized that another mutation(s) in the region may dramatically decrease M. tuberculosis viability and virulence. Here, we describe an rRNA mutation, U1406A, which was generated in vitro and confers resistance to kanamycin while highly attenuating M. tuberculosis virulence. The mutant showed decreased expression of 20% (n = 361) of mycobacterial proteins, including central metabolic enzymes, mycolic acid biosynthesis enzymes, and virulence factors such as antigen 85 complexes and ESAT-6. The mutation also induced three proteins, including KsgA (Rv1010; 16S rRNA adenine dimethyltransferase), which closely bind to the U1406A mutation site on the ribosome; these proteins were associated with ribosome maturation and translation initiation processes. The mutant showed an increase in 17S rRNA (precursor 16S rRNA) and a decrease in the ratio of 30S subunits to the 70S ribosomes, suggesting that the U1406A mutation in 16S rRNA attenuated M. tuberculosis virulence by affecting these processes. PMID:27245411

  12. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    PubMed Central

    Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  13. Details of gastropod phylogeny inferred from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Steiner, G; Backeljau, T; De Wachter, R

    1998-02-01

    Some generally accepted viewpoints on the phylogenetic relationships within the molluscan class Gastropoda are reassessed by comparing complete 18S rRNA sequences. Phylogenetic analyses were performed using the neighbor-joining and maximum parsimony methods. The previously suggested basal position of Archaeogastropoda, including Neritimorpha and Vetigastropoda, in the gastropod clade is confirmed. The present study also provides new molecular evidence for the monophyly of both Caenogastropoda and Euthyneura (Pulmonata and Opisthobranchia), making Prosobranchia paraphyletic. The relationships within Caenogastropoda and Euthyneura data turn out to be very unstable on the basis of the present 18S rRNA sequences. The present 18S rRNA data question, but are insufficient to decide on, muricacean (Neogastropoda), neotaenioglossan, pulmonate, or stylommatophoran monophyly. The analyses also focus on two systellommatophoran families, namely, Veronicellidae and Onchidiidae. It is suggested that Systellommatophora are not a monophyletic unit but, due to the lack of stability in the euthyneuran clade, their affinity to either Opisthobranchia or Pulmonata could not be determined. PMID:9479694

  14. Oligodeoxynucleotide probes for Campylobacter fetus and Campylobacter hyointestinalis based on 16S rRNA sequences.

    PubMed Central

    Wesley, I V; Wesley, R D; Cardella, M; Dewhirst, F E; Paster, B J

    1991-01-01

    Deoxyoligonucleotide probes were constructed for the identification of Campylobacter fetus and Campylobacter hyointestinalis based on 16S rRNA sequence data. Probes were targeted to hypervariable regions of 16S rRNA. Specificity of oligonucleotide probes was tested in a colony blot assay with type strains of 15 Campylobacter and Arcobacter species as well as in a slot blot format using genomic DNA extracted from field strains of C. fetus and C. hyointestinalis. Two oligonucleotides were constructed for C. fetus that hybridized with equal specificity with each of 57 biochemically confirmed isolates of C. fetus but not with any other Campylobacter species. The C. hyointestinalis probe reacted with 47 of 48 biochemically confirmed field isolates of C. hyointestinalis. In Southern blot hybridization of BglII digests of genomic DNA, the respective probes reacted within three restriction fragments of either C. hyointestinalis (7.2, 8.2, and 10.1 kb) or C. fetus (7.0, 7.7, and 9.0 kb). This suggests multiple copies of genes encoding 16S rRNA. Images PMID:1723076

  15. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    PubMed

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  16. Characterization of Xanthomonas campestris Pathovars by rRNA Gene Restriction Patterns

    PubMed Central

    Berthier, Yvette; Verdier, Valérie; Guesdon, Jean-Luc; Chevrier, Danièle; Denis, Jean-Baptiste; Decoux, Guy; Lemattre, Monique

    1993-01-01

    Genomic DNA of 191 strains of the family Pseudomonadaceae, including 187 strains of the genus Xanthomonas, was cleaved by EcoRI endonuclease. After hybridization of Southern transfer blots with 2-acetylamino-fluorene-labelled Escherichia coli 16+23S rRNA probe, 27 different patterns were obtained. The strains are clearly distinguishable at the genus, species, and pathovar levels. The variability of the rRNA gene restriction patterns was determined for four pathovars of Xanthomonas campestris species. The 16 strains of X. campestris pv. begoniae analyzed gave only one pattern. The variability of rRNA gene restriction patterns of X. campestris pv. manihotis strains could be related to ecotypes. In contrast, the variability of patterns observed for X. campestris pv. malvacearum was not correlated with pathogenicity or with the geographical origins of the strains. The highest degree of variability of DNA fingerprints was observed within X. campestris pv. dieffenbachiae, which is pathogenic to several hosts of the Araceae family. In this case, variability was related to both host plant and pathogenicity. Images PMID:16348894

  17. Molecular systematics of Volvocales (Chlorophyceae, Chlorophyta) based on exhaustive 18S rRNA phylogenetic analyses.

    PubMed

    Nakada, Takashi; Misawa, Kazuharu; Nozaki, Hisayoshi

    2008-07-01

    The taxonomy of Volvocales (Chlorophyceae, Chlorophyta) was traditionally based solely on morphological characteristics. However, because recent molecular phylogeny largely contradicts the traditional subordinal and familial classifications, no classification system has yet been established that describes the subdivision of Volvocales in a manner consistent with the phylogenetic relationships. Towards development of a natural classification system at and above the generic level, identification and sorting of hundreds of sequences based on subjective phylogenetic definitions is a significant step. We constructed an 18S rRNA gene phylogeny based on 449 volvocalean sequences collected using exhaustive BLAST searches of the GenBank database. Many chimeric sequences, which can cause fallacious phylogenetic trees, were detected and excluded during data collection. The results revealed 21 strongly supported primary clades within phylogenetically redefined Volvocales. Phylogenetic classification following PhyloCode was proposed based on the presented 18S rRNA gene phylogeny along with the results of previous combined 18S and 26S rRNA and chloroplast multigene analyses. PMID:18430591

  18. rRNA Binding Sites and the Molecular Mechanism of Action of the Tetracyclines.

    PubMed

    Chukwudi, Chinwe U

    2016-08-01

    The tetracycline antibiotics are known to be effective in the treatment of both infectious and noninfectious disease conditions. The 16S rRNA binding mechanism currently held for the antibacterial action of the tetracyclines does not explain their activity against viruses, protozoa that lack mitochondria, and noninfectious conditions. Also, the mechanism by which the tetracyclines selectively inhibit microbial protein synthesis against host eukaryotic protein synthesis despite conservation of ribosome structure and functions is still questionable. Many studies have investigated the binding of the tetracyclines to the 16S rRNA using the small ribosomal subunit of different bacterial species, but there seems to be no agreement between various reports on the exact binding site on the 16S rRNA. The wide range of activity of the tetracyclines against a broad spectrum of bacterial pathogens, viruses, protozoa, and helminths, as well as noninfectious conditions, indicates a more generalized effect on RNA. In the light of recent evidence that the tetracyclines bind to various synthetic double-stranded RNAs (dsRNAs) of random base sequences, suggesting that the double-stranded structures may play a more important role in the binding of the tetracyclines to RNA than the specific base pairs, as earlier speculated, it is imperative to consider possible alternative binding modes or sites that could help explain the mechanisms of action of the tetracyclines against various pathogens and disease conditions. PMID:27246781

  19. Phylogenetic analysis of complete rRNA gene sequence of Nosema philosamiae isolated from the lepidopteran Philosamia cynthia ricini.

    PubMed

    Zhu, Feng; Shen, Zhongyuan; Xu, Xiaofang; Tao, Hengping; Dong, Shinan; Tang, Xudong; Xu, Li

    2010-01-01

    ABSTRACT. The microsporidian Nosema philosamiae is a pathogen that infects the eri-silkworm Philosamia cynthia ricini. The complete sequence of rRNA gene (4,314 bp) was obtained by polymerase chain reaction amplification with specific primers and sequencing. The sequence analysis showed that the organization of the rRNA of N. philosamiae was similar to the pattern of Nosema bombycis. Phylogenetic analysis of rRNA gene sequences revealed that N. philosamiae had a close relationship with other Nosema species, confirming that N. philosamiae is correctly assigned to the genus Nosema. PMID:20384905

  20. rRNA gene restriction patterns of Haemophilus influenzae biogroup aegyptius strains associated with Brazilian purpuric fever.

    PubMed Central

    Irino, K; Grimont, F; Casin, I; Grimont, P A

    1988-01-01

    The rRNA gene restriction patterns of 92 isolates of Haemophilus influenzae biogroup aegyptius, associated with conjunctivitis or Brazilian purpuric fever in the State of São Paulo, Brazil, were studied with 16 + 23S rRNA from Escherichia coli as a probe. All strains were classified into 15 patterns. Isolates from Brazilian purpuric fever cases were seen only in patterns 3 (most frequently) and 4 (rarely), whereas isolates from conjunctivitis were found in all 15 patterns. The study demonstrated that rRNA from E. coli can serve as a probe for molecular epidemiology. Images PMID:2459153

  1. Effects of induction of rRNA overproduction on ribosomal protein synthesis and ribosome subunit assembly in Escherichia coli.

    PubMed Central

    Yamagishi, M; Nomura, M

    1988-01-01

    Overproduction of rRNA was artificially induced in Escherichia coli cells to test whether the synthesis of ribosomal protein (r-protein) is normally repressed by feedback regulation. When rRNA was overproduced more than twofold from a hybrid plasmid carrying the rrnB operon fused to the lambda pL promoter (pL-rrnB), synthesis of individual r-proteins increased by an average of about 60%. This demonstrates that the synthesis of r-proteins is repressed under normal conditions. The increase of r-protein production, however, for unknown reasons, was not as great as the increase in rRNA synthesis and resulted in an imbalance between the amounts of rRNA and r-protein synthesis. Therefore, only a small (less than 20%) increase in the synthesis of complete 30S and 50S ribosome subunits was detected, and a considerable fraction of the excess rRNA was degraded. Lack of complete cooperativity in the assembly of ribosome subunits in vivo is discussed as a possible explanation for the absence of a large stimulation of ribosome synthesis observed under these conditions. In addition to the induction of intact rRNA overproduction from the pL-rrnB operon, the effects of unbalanced overproduction of each of the two large rRNAs, 16S rRNA and 23S rRNA, on r-protein synthesis were examined using pL-rrnB derivatives carrying a large deletion in either the 23S rRNA gene or the 16S rRNA gene. Operon-specific derepression after 23S or 16S rRNA overproduction correlated with the overproduction of rRNA containing the target site for the operon-specific repressor r-protein. These results are discussed to explain the apparent coupling of the assembly of one ribosomal subunit with that of the other which was observed in earlier studies on conditionally lethal mutants with defects in ribosome assembly. PMID:3053641

  2. Application of PRECEDE-PROCEED model to tackle problems identified with diarrhoea burden among under-5s in Botswana.

    PubMed

    Popoola, Tosin; Mchunu, Gugu

    2015-05-01

    Diarrhoea has been identified as the second leading cause of mortality among under-5s and also claims more life than HIV, measles and malaria combined together in the same category of population. This article is a combination of literature review and personal experience of lessons learnt from past diarrhoea outbreaks in Botswana that caused significant rate of mortality among under-5s. The paper used literature review to identify contributory factors to diarrhoea burden among under-5s in Botswana and applied a community health nursing framework (PRECEDE-PROCEED) to tackle the problems identified. The study revealed that Botswana mothers are lacking in knowledge related to exclusive breastfeeding, prevention and treatment of diarrhoea disease. The paper recommends that health-care workers in Botswana be sensitized on current diarrhoea management to tailor their health education methods appropriately. PMID:26125574

  3. Transsacral transdiscal L5-S1 screws for the management of high-grade spondylolisthesis in an adolescent.

    PubMed

    Palejwala, Ali; Fridley, Jared; Jea, Andrew

    2016-06-01

    The surgical management of high-grade spondylolisthesis in adolescents remains a controversial issue. Because the basic procedure, posterolateral fusion, is associated with a significant rate of pseudarthrosis and listhesis progression, there is a pressing need for alternative surgical techniques. In the present report, the authors describe the case of an adolescent patient with significant low-back pain who was found to have Grade IV spondylolisthesis at L5-S1 that was treated with transsacral transdiscal screw fixation. Bilateral pedicle screws were placed starting from the top of the S-1 pedicle, across the L5-S1 intervertebral disc space, and into the L-5 body. At 14 months after surgery, the patient had considerable improvement in his pain and radiographic fusion across L5-S1. The authors conclude that transsacral transdiscal pedicle screws may serve as an efficacious and safe option for the correction of high-grade spondylolisthesis in adolescent patients. PMID:26894520

  4. Dissociative excitation of the N(+)(5S) state by electron impact on N2 - Excitation function and quenching

    NASA Technical Reports Server (NTRS)

    Erdman, P. W.; Zipf, E. C.

    1986-01-01

    Metastable N(+)(5S) ions were produced in the laboratory by dissociative excitation of N2 with energetic electrons. The resulting radiative decay of the N(+)(5S) state was observed with sufficient resolution to completely resolve the doublet from the nearby N2 molecular radiation. The excitation function was measured from threshold to 500 eV. The cross section peaks at a high electron energy and also exhibits a high threshold energy both of which are typical of dissociative excitation-ionization processes. This finding complicates the explanation of electron impact on N2 as the mechanism for the source of the 2145 A 'auroral mystery feature' by further increasing the required peak cross section. It is suggested that the apparent N(+)(5S) quenching in auroras may be an artifact due to the softening of the electron energy spectrum in the auroral E region.

  5. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.

    PubMed

    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B

    2016-07-01

    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex. PMID:26974236

  6. Domain rearrangement of SRP protein Ffh upon binding 4.5S RNA and the SRP receptor FtsY

    PubMed Central

    BUSKIEWICZ, IWONA; KUBARENKO, ANDRIY; PESKE, FRANK; RODNINA, MARINA V.; WINTERMEYER, WOLFGANG

    2005-01-01

    The signal recognition particle (SRP) mediates membrane targeting of translating ribosomes displaying a signal-anchor sequence. In Escherichia coli, SRP consists of 4.5S RNA and a protein, Ffh, that recognizes the signal peptide emerging from the ribosome and the SRP receptor at the membrane, FtsY. In the present work, we studied the interactions between the NG and M domains in Ffh and their rearrangements upon complex formation with 4.5S RNA and/or FtsY. In free Ffh, the NG and M domains are facing one another in an orientation that allows cross-linking between positions 231 in the G domain and 377 in the M domain. There are binding interactions between the two domains, as the isolated domains form a strong complex. The interdomain contacts are disrupted upon binding of Ffh to 4.5S RNA, consuming a part of the total binding energy of 4.5S RNA-Ffh association that is roughly equivalent to the free energy of domain binding to each other. In the SRP particle, the NG domain binds to 4.5S RNA in a region adjacent to the binding site of the M domain. Ffh binding to FtsY also requires a reorientation of NG and M domains. These results suggest that in free Ffh, the binding sites for 4.5S RNA and FtsY are occluded by strong domain–domain interactions which must be disrupted for the formation of SRP or the Ffh-FtsY complex. PMID:15923378

  7. Domain rearrangement of SRP protein Ffh upon binding 4.5S RNA and the SRP receptor FtsY.

    PubMed

    Buskiewicz, Iwona; Kubarenko, Andriy; Peske, Frank; Rodnina, Marina V; Wintermeyer, Wolfgang

    2005-06-01

    The signal recognition particle (SRP) mediates membrane targeting of translating ribosomes displaying a signal-anchor sequence. In Escherichia coli, SRP consists of 4.5S RNA and a protein, Ffh, that recognizes the signal peptide emerging from the ribosome and the SRP receptor at the membrane, FtsY. In the present work, we studied the interactions between the NG and M domains in Ffh and their rearrangements upon complex formation with 4.5S RNA and/or FtsY. In free Ffh, the NG and M domains are facing one another in an orientation that allows cross-linking between positions 231 in the G domain and 377 in the M domain. There are binding interactions between the two domains, as the isolated domains form a strong complex. The interdomain contacts are disrupted upon binding of Ffh to 4.5S RNA, consuming a part of the total binding energy of 4.5S RNA-Ffh association that is roughly equivalent to the free energy of domain binding to each other. In the SRP particle, the NG domain binds to 4.5S RNA in a region adjacent to the binding site of the M domain. Ffh binding to FtsY also requires a reorientation of NG and M domains. These results suggest that in free Ffh, the binding sites for 4.5S RNA and FtsY are occluded by strong domain-domain interactions which must be disrupted for the formation of SRP or the Ffh-FtsY complex. PMID:15923378

  8. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location. PMID:27334092

  9. Vaccinia virus transcription.

    PubMed

    Broyles, Steven S

    2003-09-01

    Vaccinia virus replication takes place in the cytoplasm of the host cell. The nearly 200 kbp genome owes part of its complexity to encoding most of the proteins involved in genome and mRNA synthesis. The multisubunit vaccinia virus RNA polymerase requires a separate set of virus-encoded proteins for the transcription of the early, intermediate and late classes of genes. Cell fractionation studies have provided evidence for a role for host cell proteins in the initiation and termination of vaccinia virus intermediate and late gene transcription. Vaccinia virus resembles nuclear DNA viruses in the integration of viral and host proteins for viral mRNA synthesis, yet is markedly less reliant on host proteins than its nuclear counterparts. PMID:12917449

  10. Xenopus transcription factor IIIA-dependent DNA renaturation.

    PubMed

    Fiser-Littell, R M; Hanas, J S

    1988-11-15

    Kinetic and titration analyses are used to elucidate the mechanism by which Xenopus transcription factor IIIA (TFIIIA), a protein required for 5 S RNA synthesis by RNA polymerase III, promotes DNA renaturation. TFIIIA promotes 50% renaturation of complementary strands (303 bases) in 45 s. Analyses of the renaturation kinetics indicate the rate-limiting step in this TFIIIA-dependent reaction is first order. TFIIIA-dependent DNA renaturation is a stoichiometric rather than a catalytic process. The renaturation rates for specific and nonspecific DNA are very similar, indicating lack of sequence specificity in this TFIIIA-dependent process. In the nanomolar concentration range of protein and DNA, renaturation occurs at a ratio of about one TFIIIA molecule/single strand (303 bases). Elevated reaction temperatures strongly stimulate TFIIIA-dependent DNA renaturation; at 45 degrees C, renaturation of the 303-base pair fragment nears completion in about 5 s. The ability of TFIIIA to rapidly promote DNA renaturation is unique when compared with Escherichia coli recA protein, single-stranded DNA binding protein, or bacteriophage T4 gene 32 protein. This mechanism by which TFIIIA promotes DNA renaturation is compatible with features of 5 S RNA gene transcription. PMID:2460459

  11. Crystal Structure of the Thermus thermophilus 16 S rRNA Methyltransferase RsmC in Complex with Cofactor and Substrate Guanosine*S⃞

    PubMed Central

    Demirci, Hasan; Gregory, Steven T.; Dahlberg, Albert E.; Jogl, Gerwald

    2008-01-01

    Post-transcriptional modification is a ubiquitous feature of ribosomal RNA in all kingdoms of life. Modified nucleotides are generally clustered in functionally important regions of the ribosome, but the functional contribution to protein synthesis is not well understood. Here we describe high resolution crystal structures for the N2-guanine methyltransferase RsmC that modifies residue G1207 in 16 S rRNA near the decoding site of the 30 S ribosomal subunit. RsmC is a class I S-adenosyl-l-methionine-dependent methyltransferase composed of two methyltransferase domains. However, only one S-adenosyl-l-methionine molecule and one substrate molecule, guanosine, bind in the ternary complex. The N-terminal domain does not bind any cofactor. Two structures with bound S-adenosyl-l-methionine and S-adenosyl-l-homocysteine confirm that the cofactor binding mode is highly similar to other class I methyltransferases. Secondary structure elements of the N-terminal domain contribute to cofactor-binding interactions and restrict access to the cofactor-binding site. The orientation of guanosine in the active site reveals that G1207 has to disengage from its Watson-Crick base pairing interaction with C1051 in the 16 S rRNA and flip out into the active site prior to its modification. Inspection of the 30 S crystal structure indicates that access to G1207 by RsmC is incompatible with the native subunit structure, consistent with previous suggestions that this enzyme recognizes a subunit assembly intermediate. PMID:18667428

  12. Intrinsic disorder in transcription factors†

    PubMed Central

    Liu, Jiangang; Perumal, Narayanan B.; Oldfield, Christopher J.; Su, Eric W.; Uversky, Vladimir N.; Dunker, A. Keith

    2008-01-01

    Intrinsic disorder (ID) is highly abundant in eukaryotes, which reflect the greater need for disorder-associated signaling and transcriptional regulation in nucleated cells. Although several well-characterized examples of intrinsically disordered proteins in transcriptional regulation have been reported, no systematic analysis has been reported so far. To test for a general prevalence of intrinsic disorder in transcriptional regulation, we used the Predictor Of Natural Disorder Regions (PONDR) to analyze the abundance of intrinsic disorder in three transcription factor datasets and two control sets. This analysis revealed that from 94.13% to 82.63% of transcription factors posses extended regions of intrinsic disorder, relative to 54.51% and 18.64% of the proteins in two control datasets, which indicates the significant prevalence of intrinsic disorder in transcription factors. This propensity of transcription factors for intrinsic disorder was confirmed by cumulative distribution function analysis and charge-hydropathy plots. The amino acid composition analysis showed that all three transcription factor datasets were substantially depleted in order-promoting residues, and significantly enriched in disorder-promoting residues. Our analysis of the distribution of disorder within the transcription factor datasets revealed that: (a) The AT-hooks and basic regions of transcription factor DNA-binding domains are highly disordered; (b) The degree of disorder in transcription factor activation regions is much higher than that in DNA-binding domains; (c) The degree of disorder is significantly higher in eukaryotic transcription factors than in prokaryotic transcription factors; (d) The level of α-MoRFs (molecular recognition feature) prediction is much higher in transcription factors. Overall, our data reflected the fact that the eukaryotes with well-developed gene transcription machinery require transcription factor flexibility to be more efficient. PMID:16734424

  13. Identification of a 5S rDNA spacer type specific Triticum urartu and wheats containing the T. urartu genome.

    PubMed

    Allaby, R G; Brown, T A

    2000-04-01

    A PCR system was designed to amplify 5S spacer rDNA specifically from homeologous chromosome 1 in a variety of species representative of the Aegilops and Triticum genera. Two polymerase chain reaction (PCR) primer combinations were used, one of which appears to be apomorphic in nature and specific to chromosome 1A in Triticum urartu and tetraploid and hexaploid wheats containing the AA genome donated by T. urartu. The value of studying single repeat types to investigate the molecular evolution of 5S-rDNA arrays is considered. PMID:10791812

  14. RNA transcription modulates phase transition-driven nuclear body assembly

    PubMed Central

    Berry, Joel; Weber, Stephanie C.; Vaidya, Nilesh; Haataja, Mikko; Brangwynne, Clifford P.

    2015-01-01

    Nuclear bodies are RNA and protein-rich, membraneless organelles that play important roles in gene regulation. The largest and most well-known nuclear body is the nucleolus, an organelle whose primary function in ribosome biogenesis makes it key for cell growth and size homeostasis. The nucleolus and other nuclear bodies behave like liquid-phase droplets and appear to condense from the nucleoplasm by concentration-dependent phase separation. However, nucleoli actively consume chemical energy, and it is unclear how such nonequilibrium activity might impact classical liquid–liquid phase separation. Here, we combine in vivo and in vitro experiments with theory and simulation to characterize the assembly and disassembly dynamics of nucleoli in early Caenorhabditis elegans embryos. In addition to classical nucleoli that assemble at the transcriptionally active nucleolar organizing regions, we observe dozens of “extranucleolar droplets” (ENDs) that condense in the nucleoplasm in a transcription-independent manner. We show that growth of nucleoli and ENDs is consistent with a first-order phase transition in which late-stage coarsening dynamics are mediated by Brownian coalescence and, to a lesser degree, Ostwald ripening. By manipulating C. elegans cell size, we change nucleolar component concentration and confirm several key model predictions. Our results show that rRNA transcription and other nonequilibrium biological activity can modulate the effective thermodynamic parameters governing nucleolar and END assembly, but do not appear to fundamentally alter the passive phase separation mechanism. PMID:26351690

  15. RNA transcription modulates phase transition-driven nuclear body assembly.

    PubMed

    Berry, Joel; Weber, Stephanie C; Vaidya, Nilesh; Haataja, Mikko; Brangwynne, Clifford P

    2015-09-22

    Nuclear bodies are RNA and protein-rich, membraneless organelles that play important roles in gene regulation. The largest and most well-known nuclear body is the nucleolus, an organelle whose primary function in ribosome biogenesis makes it key for cell growth and size homeostasis. The nucleolus and other nuclear bodies behave like liquid-phase droplets and appear to condense from the nucleoplasm by concentration-dependent phase separation. However, nucleoli actively consume chemical energy, and it is unclear how such nonequilibrium activity might impact classical liquid-liquid phase separation. Here, we combine in vivo and in vitro experiments with theory and simulation to characterize the assembly and disassembly dynamics of nucleoli in early Caenorhabditis elegans embryos. In addition to classical nucleoli that assemble at the transcriptionally active nucleolar organizing regions, we observe dozens of "extranucleolar droplets" (ENDs) that condense in the nucleoplasm in a transcription-independent manner. We show that growth of nucleoli and ENDs is consistent with a first-order phase transition in which late-stage coarsening dynamics are mediated by Brownian coalescence and, to a lesser degree, Ostwald ripening. By manipulating C. elegans cell size, we change nucleolar component concentration and confirm several key model predictions. Our results show that rRNA transcription and other nonequilibrium biological activity can modulate the effective thermodynamic parameters governing nucleolar and END assembly, but do not appear to fundamentally alter the passive phase separation mechanism. PMID:26351690

  16. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    PubMed Central

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A; Gwerder, Myriam; Gutsche, Katrin; Altmeyer, Matthias; Jungmichel, Stephanie; Toledo, Luis I; Fink, Daniel; Rask, Maj-Britt; Grøfte, Merete; Lukas, Claudia; Nielsen, Michael L; Smerdon, Stephen J; Lukas, Jiri; Stucki, Manuel

    2016-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in-trans signaling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identified TCOF1-Treacle, a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1, and demonstrate that NBS1 translocation and accumulation in the nucleoli is Treacle-dependent. Finally, we provide evidence that Treacle-mediated NBS1 recruitment into the nucleoli regulates rRNA silencing in-trans in the presence of distant chromosome breaks. PMID:25064736

  17. Measurement of (5'R)- and (5'S)-8,5'-cyclo-2'-deoxyadenosines in DNA in vivo by liquid chromatography/isotope-dilution tandem mass spectrometry

    SciTech Connect

    Jaruga, Pawel; Xiao, Yan; Nelson, Bryant C.; Dizdaroglu, Miral

    2009-09-04

    Oxidatively induced DNA lesions (5'R)- and (5'S)-8,5'-cyclo-2'-deoxyadenosines (R-cdA and S-cdA) are detectable and accumulate in vivo due to disease states and defects in DNA repair. They block transcription and inhibit gene expression, and may play a role in disease processes. Accurate measurement of these lesions in DNA in vivo is necessary to understand their biological effects. We report on a methodology using liquid chromatography/isotope-dilution tandem mass spectrometry to measure R-cdA and S-cdA in DNA. This methodology permitted the detection of these compounds at a level of 0.1 fmol on-column. Levels of R-cdA and S-cdA in mouse liver DNA amounted to 0.133 {+-} 0.024 and 0.498 {+-} 0.065 molecules/10{sup 7} DNA 2'-deoxynucleosides, respectively. The successful measurement of R-cdA and S-cdA in DNA in vivo suggests that this methodology will be used for understanding of their repair and biological consequences, and that these compounds may be used as putative biomarkers for disease states.

  18. The Zinc Finger Protein ZNF658 Regulates the Transcription of Genes Involved in Zinc Homeostasis and Affects Ribosome Biogenesis through the Zinc Transcriptional Regulatory Element

    PubMed Central

    Ogo, Ogo A.; Tyson, John; Cockell, Simon J.; Howard, Alison; Valentine, Ruth A.

    2015-01-01

    We previously identified the ZTRE (zinc transcriptional regulatory element) in genes involved in zinc homeostasis and showed that it mediates transcriptional repression in response to zinc. We now report that ZNF658 acts at the ZTRE. ZNF658 was identified by matrix-assisted laser desorption ionization–time of flight mass spectrometry of a band excised after electrophoretic mobility shift assay using a ZTRE probe. The protein contains a KRAB domain and 21 zinc fingers. It has similarity with ZAP1 from Saccharomyces cerevisiae, which regulates the response to zinc restriction, including a conserved DNA binding region we show to be functional also in ZNF658. Small interfering RNA (siRNA) targeted to ZNF658 abrogated the zinc-induced, ZTRE-dependent reduction in SLC30A5 (ZnT5 gene), SLC30A10 (ZnT10 gene), and CBWD transcripts in human Caco-2 cells and the ability of zinc to repress reporter gene expression from corresponding promoter-reporter constructs. Microarray analysis of the effect of reducing ZNF658 expression by siRNA uncovered a large decrease in rRNA. We find that ZTREs are clustered within the 45S rRNA precursor. We also saw effects on expression of multiple ribosomal proteins. ZNF658 thus links zinc homeostasis with ribosome biogenesis, the most active transcriptional, and hence zinc-demanding, process in the cell. ZNF658 is thus a novel transcriptional regulator that plays a fundamental role in the orchestrated cellular response to zinc availability. PMID:25582195

  19. Simultaneous alignment and folding of 28S rRNA sequences uncovers phylogenetic signal in structure variation.

    PubMed

    Letsch, Harald O; Greve, Carola; Kück, Patrick; Fleck, Günther; Stocsits, Roman R; Misof, Bernhard

    2009-12-01

    Secondary structure models of mitochondrial and nuclear (r)RNA sequences are frequently applied to aid the alignment of these molecules in phylogenetic analyses. Additionally, it is often speculated that structure variation of (r)RNA sequences might profitably be used as phylogenetic markers. The benefit of these approaches depends on the reliability of structure models. We used a recently developed approach to show that reliable inference of large (r)RNA secondary structures as a prerequisite of simultaneous sequence and structure alignment is feasible. The approach iteratively establishes local structure constraints of each sequence and infers fully folded individual structures by constrained MFE optimization. A comparison of structure edit distances of individual constraints and fully folded structures showed pronounced phylogenetic signal in fully folded structures. As model sequences we characterized secondary structures of 28S rRNA sequences of selected insects and examined their phylogenetic signal according to established phylogenetic hypotheses. PMID:19654047

  20. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

    1992-01-01

    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  1. Primary and secondary structure of 5.8S rRNA from the silkgland of Bombyx mori.

    PubMed Central

    Fujiwara, H; Kawata, Y; Ishikawa, H

    1982-01-01

    Nucleotide sequence of 5.8S rRNA of the silkworm, Bombyx mori has been determined by gel sequencing methods. The 5.8S rRNA was the longest so far reported, with the 5'-terminal sequence several nucleotides longer than those of the other organisms. Upon constructing the secondary structure in accordance with the "burp gun" model (12), the Bombyx 5.8S rRNA formed a wide-open "muzzle" due to several unpaired bases at the ends. The overall structure also appeared less stable with less G . C pairs and more unpaired bases than that of the HeLa 5.8S rRNA. These structural features may be essential for those 5.8S rRNAs which interact with 28S rRNAs containing the hidden break to form a stable complex. PMID:7088713

  2. Molecular Evolution of Mycoplasma capricolum subsp. capripneumoniae Strains, Based on Polymorphisms in the 16S rRNA Genes

    PubMed Central

    Pettersson, Bertil; Bölske, Göran; Thiaucourt, François; Uhlén, Mathias; Johansson, Karl-Erik

    1998-01-01

    Mycoplasma capricolum subsp. capripneumoniae belongs to the so-called Mycoplasma mycoides cluster and is the causal agent of contagious caprine pleuropneumonia (CCPP). All members of the M. mycoides cluster have two rRNA operons. The sequences of the 16S rRNA genes of both rRNA operons from 20 strains of M. capricolum subsp. capripneumoniae of different geographical origins in Africa and Asia were determined. Nucleotide differences which were present in only one of the two operons (polymorphisms) were detected in 24 positions. The polymorphisms were not randomly distributed in the 16S rRNA genes, and some of them were found in regions of low evolutionary variability. Interestingly, 11 polymorphisms were found in all the M. capricolum subsp. capripneumoniae strains, thus defining a putative ancestor. A sequence length difference between the 16S rRNA genes in a poly(A) region and 12 additional polymorphisms were found in only one or some of the strains. A phylogenetic tree was constructed by comparative analysis of the polymorphisms, and this tree revealed two distinct lines of descent. The nucleotide substitution rate of strains within line II was up to 50% higher than within line I. A tree was also constructed from individual operonal 16S rRNA sequences, and the sequences of the two operons were found to form two distinct clades. The topologies of both clades were strikingly similar, which supports the use of 16S rRNA sequence data from homologous operons for phylogenetic studies. The strain-specific polymorphism patterns of the 16S rRNA genes of M. capricolum subsp. capripneumoniae may be used as epidemiological markers for CCPP. PMID:9573185

  3. Modifications of both selectivity factor and upstream binding factor contribute to poliovirus-mediated inhibition of RNA polymerase I transcription.

    PubMed

    Banerjee, Rajeev; Weidman, Mary K; Navarro, Sonia; Comai, Lucio; Dasgupta, Asim

    2005-08-01

    Soon after infection, poliovirus (PV) shuts off host-cell transcription, which is catalysed by all three cellular RNA polymerases. rRNA constitutes more than 50 % of all cellular RNA and is transcribed from rDNA by RNA polymerase I (pol I). Here, evidence has been provided suggesting that both pol I transcription factors, SL-1 (selectivity factor) and UBF (upstream binding factor), are modified and inactivated in PV-infected cells. The viral protease 3C(pro) appeared to cleave the TATA-binding protein-associated factor 110 (TAF(110)), a subunit of the SL-1 complex, into four fragments in vitro. In vitro protease-cleavage assays using various mutants of TAF(110) and purified 3C(pro) indicated that the Q(265)G(266) and Q(805)G(806) sites were cleaved by 3C(pro). Both SL-1 and UBF were depleted in PV-infected cells and their disappearance correlated with pol I transcription inhibition. rRNA synthesis from a template containing a human pol I promoter demonstrated that both SL-1 and UBF were necessary to restore pol I transcription fully in PV-infected cell extracts. These results suggested that both SL-1 and UBF are transcriptionally inactivated in PV-infected HeLa cells. PMID:16033979

  4. rRNA Gene Expression of Abundant and Rare Activated-Sludge Microorganisms and Growth Rate Induced Micropollutant Removal.

    PubMed

    Vuono, David C; Regnery, Julia; Li, Dong; Jones, Zackary L; Holloway, Ryan W; Drewes, Jörg E

    2016-06-21

    The role of abundant and rare taxa in modulating the performance of wastewater-treatment systems is a critical component of making better predictions for enhanced functions such as micropollutant biotransformation. In this study, we compared 16S rRNA genes (rDNA) and rRNA gene expression of taxa in an activated-sludge-treatment plant (sequencing batch membrane bioreactor) at two solids retention times (SRTs): 20 and 5 days. These two SRTs were used to influence the rates of micropollutant biotransformation and nutrient removal. Our results show that rare taxa (<1%) have disproportionally high ratios of rRNA to rDNA, an indication of higher protein synthesis, compared to abundant taxa (≥1%) and suggests that rare taxa likely play an unrecognized role in bioreactor performance. There were also significant differences in community-wide rRNA expression signatures at 20-day SRT: anaerobic-oxic-anoxic periods were the primary driver of rRNA similarity. These results indicate differential expression of rRNA at high SRTs, which may further explain why high SRTs promote higher rates of micropollutant biotransformation. An analysis of micropollutant-associated degradation genes via metagenomics and direct measurements of a suite of micropollutants and nutrients further corroborates the loss of enhanced functions at 5-day SRT operation. This work advances our knowledge of the underlying ecosystem properties and dynamics of abundant and rare organisms associated with enhanced functions in engineered systems. PMID:27196630

  5. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes.

    PubMed

    Soni, Dharmendra Kumar; Dubey, Suresh Kumar

    2014-12-01

    The discrimination between Listeria monocytogenes and Listeria species has been detected. The 16S rRNA and hlyA were PCR amplified with set of oligonucleotide primers with flank 1,500 and 456 bp fragments, respectively. Based on the differences in 16S rRNA and hlyA genes, a total 80 isolates from different environmental, food and clinical samples confirmed it to be L. monocytogenes. The 16S rRNA sequence similarity suggested that the isolates were similar to the previously reported ones from different habitats by others. The phylogenetic interrelationships of the genus Listeria were investigated by sequencing of 16S rRNA and hlyA gene. The 16S rRNA sequence indicated that genus Listeria is comprised of following closely related but distinct lines of descent, one is the L. monocytogenes species group (including L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) and other, the species L. grayi, L. rocourtiae and L. fleischmannii. The phylogenetic tree based on hlyA gene sequence clearly differentiates between the L. monocytogenes, L. ivanovii and L. seeligeri. In the present study, we identified 80 isolates of L. monocytogenes originating from different clinical, food and environmental samples based on 16S rRNA and hlyA gene sequence similarity. PMID:25205124

  6. Dictyostelium ribosomal protein genes and the elongation factor 1B gene show coordinate developmental regulation which is under post-transcriptional control.

    PubMed

    Agarwal, A K; Blumberg, D D

    1999-06-01

    Starvation for amino acids initiates the developmental program in the cellular slime mold, Dictyostelium discoideum [19, 20]. One of the earliest developmental events is the decline in ribosomal protein synthesis [2, 17, 29, 30]. The ribosomal protein mRNAs are excluded from polysomes with 20 min to 1 h following the removal of nutrients, and their mRNA levels decline sharply at about 9 h into the 24-h developmental cycle [28, 31, 35, 36]. It has been generally assumed that the decline in r-protein mRNA levels during late development reflected a decline in the transcription rate [12, 32, 43]. Here we demonstrate that this is not the case. The transcription rates of three ribosomal protein genes, rpL11, rpL23 and rpS9 as well as an elongation factor 1B gene have been determined during growth and development in Dictyostelium. Throughout growth and development the transcription rate of the ribosomal protein genes remains relatively constant at 0.2%-0.5% of the rate of rRNA transcription while the elongation factor 1B gene is transcribed at 0.4%-0.6% of the rRNA rate. This low but constant transcription rate is in contrast to a spore coat protein gene Psp D, which is transcribed at 6% of the rRNA rate in late developing cells. The elongation factor 1B gene appears to be co-regulated with the ribosomal protein genes both in terms of its transcription rate and mRNA accumulation. Dictyostelium has been a popular model for understanding signal transduction and the growth to differentiation transition, thus it is of significance that the regulation of ribosome biosynthesis in Dictyostelium resembles that of higher eukaryotes in being regulated largely at the post-transcriptional level in response to starvation as opposed to yeasts where the regulation is largely transcriptional [27]. PMID:10374261

  7. Multi-site-specific 16S rRNA Methyltransferase RsmF from Thermus thermophilus

    SciTech Connect

    Demirci, H.; Larsen, L; Hansen, T; Rasmussen, A; Cadambi, A; Gregory, S; Kirpekar, F; Jogl, G

    2010-01-01

    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m{sup 5}C) modifications in 16S rRNA of Thermus thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m{sup 5}C967. In contrast to E. coli RsmF, which introduces a single m{sup 5}C1407 modification, T. thermophilus RsmF modifies three positions, generating m{sup 5}C1400 and m{sup 5}C1404 in addition to m{sup 5}C1407. These three residues are clustered near the decoding site of the ribosome, but are situated in distinct structural contexts, suggesting a requirement for flexibility in the RsmF active site that is absent from the E. coli enzyme. Two of these residues, C1400 and C1404, are sufficiently buried in the mature ribosome structure so as to require extensive unfolding of the rRNA to be accessible to RsmF. In vitro, T. thermophilus RsmF methylates C1400, C1404, and C1407 in a 30S subunit substrate, but only C1400 and C1404 when naked 16S rRNA is the substrate. The multispecificity of T. thermophilus RsmF is potentially explained by three crystal structures of the enzyme in a complex with cofactor S-adenosyl-methionine at up to 1.3 {angstrom} resolution. In addition to confirming the overall structural similarity to E. coli RsmF, these structures also reveal that key segments in the active site are likely to be dynamic in solution, thereby expanding substrate recognition by T. thermophilus RsmF.

  8. Analysis, Optimization and Verification of Illumina-Generated 16S rRNA Gene Amplicon Surveys

    PubMed Central

    Nelson, Michael C.; Morrison, Hilary G.; Benjamino, Jacquelynn; Grim, Sharon L.; Graf, Joerg

    2014-01-01

    The exploration of microbial communities by sequencing 16S rRNA genes has expanded with low-cost, high-throughput sequencing instruments. Illumina-based 16S rRNA gene sequencing has recently gained popularity over 454 pyrosequencing due to its lower costs, higher accuracy and greater throughput. Although recent reports suggest that Illumina and 454 pyrosequencing provide similar beta diversity measures, it remains to be demonstrated that pre-existing 454 pyrosequencing workflows can transfer directly from 454 to Illumina MiSeq sequencing by simply changing the sequencing adapters of the primers. In this study, we modified 454 pyrosequencing primers targeting the V4-V5 hyper-variable regions of the 16S rRNA gene to be compatible with Illumina sequencers. Microbial communities from cows, humans, leeches, mice, sewage, and termites and a mock community were analyzed by 454 and MiSeq sequencing of the V4-V5 region and MiSeq sequencing of the V4 region. Our analysis revealed that reference-based OTU clustering alone introduced biases compared to de novo clustering, preventing certain taxa from being observed in some samples. Based on this we devised and recommend an analysis pipeline that includes read merging, contaminant filtering, and reference-based clustering followed by de novo OTU clustering, which produces diversity measures consistent with de novo OTU clustering analysis. Low levels of dataset contamination with Illumina sequencing were discovered that could affect analyses that require highly sensitive approaches. While moving to Illumina-based sequencing platforms promises to provide deeper insights into the breadth and function of microbial diversity, our results show that care must be taken to ensure that sequencing and processing artifacts do not obscure true microbial diversity. PMID:24722003

  9. Greengenes, a Chimera-checked 16S rRNA gene database and workbenchcompatible with ARB

    SciTech Connect

    DeSantis, Todd Z.; Hugenholtz, Philip; Larsen, Neils; Rojas,Mark; Brodie, Eoin L.; Keller, Keith; Huber, Thomas; Dalevi, Daniel; Hu,Ping; Andersen, Gary L.

    2006-04-10

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that in congruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3 percent of environmental sequences and 0.2 percent of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  10. Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

    NASA Technical Reports Server (NTRS)

    Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1991-01-01

    Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

  11. Single Molecule Transcription Elongation

    PubMed Central

    Galburt, Eric A.; Grill, Stephan W.; Bustamante, Carlos

    2009-01-01

    Single molecule optical trapping assays have now been applied to a great number of macromolecular systems including DNA, RNA, cargo motors, restriction enzymes, DNA helicases, chromosome remodelers, DNA polymerases and both viral and bacterial RNA polymerases. The advantages of the technique are the ability to observe dynamic, unsynchronized molecular processes, to determine the distributions of experimental quantities and to apply force to the system while monitoring the response over time. Here, we describe the application of these powerful techniques to study the dynamics of transcription elongation by RNA polymerase II from Saccharomyces cerevisiae. PMID:19426807

  12. Mutation analysis of 16S rRNA in patients with Rett syndrome.

    PubMed

    Armstrong, J; Pineda, M; Monrós, E

    2000-07-01

    Rett syndrome (RTT) is a progressive neurodevelopmental disorder that affects one in 10,000-15,000 females. RTT is mainly sporadic; familial cases have an estimated frequency of less than 1%. Before the recent identification of de novo dominant mutations in the X-linked MECP2 gene, many other hypotheses had been proposed to explain the particular pattern of inheritance and the phenotypic expression of the disease. The involvement of mitochondrial DNA had been investigated because of the structural and functional mitochondrial abnormalities evident in the patients. In 1997 the finding of mutations at 16S rRNA in several affected RTT females and their mothers was reported, suggesting that mitochondrial DNA might play a key role in the pathogenesis of RTT. To investigate the relevance of such mutations, we used the same methodologic approach to analyze RTT mitochondrial DNA in our series. No 16S rRNA alterations were evident in 27 Spanish patients with classic RTT. PMID:10963979

  13. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation

    PubMed Central

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G.; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S. Kundhavai; Klaholz, Bruno P.; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  14. Greengenes: 16S rRNA Database and Workbench Compatible with ARB

    DOE Data Explorer

    DeSantis, T. Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie, E. L.; Keller, K.; Huber, T.; Dalevi, D. Hu, P. Andersen, G. L.

    Greengenes was developed, as the abstract of an AEM reprint states, to "addresse limitations of public repositories by providing chimera screening, standard alignment, and taxonomic classification using multiple published taxonomies. It was found that there is incongruent taxonomic nomenclature among curators even at the phylum level. Putative chimeras were identified in 3% of environmental sequences and in 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages in the Archaea and Bacteria....Greengenes is also a functional workbench to assist in analysis of user-generated 16S rRNA gene sequences. Batches of sequencing reads can be uploaded for quality-based trimming and creation of multiple-sequence alignments (9). Three types of non-MSA similarity searches are also available, seed extension by BLAST (1), similarity based on shared 7-mers by a tool called Simrank, and a direct degenerative pattern match for probe/primer evaluation. Results are displayed using user-preferred taxonomic nomenclature and can be saved between sessions. [Taken from DeSantis, T. Z., P. Hugenholtz, N. Larsen, M. Rojas, E. L. Brodie, K. Keller, T. Huber, D. Dalevi, P. Hu, and G. L. Andersen. 2006. Greengenes, a Chimera-Checked 16S rRNA Gene Database and Workbench Compatible with ARB. Appl Environ Microbiol 72:5069-72, pages 1 and 3] (Specialized Interface)

  15. The Unique 16S rRNA Genes of Piezophiles Reflect both Phylogeny and Adaptation▿ †

    PubMed Central

    Lauro, Federico M.; Chastain, Roger A.; Blankenship, Lesley E.; Yayanos, A. Aristides; Bartlett, Douglas H.

    2007-01-01

    In the ocean's most extreme depths, pressures of 70 to 110 megapascals prevent the growth of all but the most hyperpiezophilic (pressure-loving) organisms. The physiological adaptations required for growth under these conditions are considered to be substantial. Efforts to determine specific adaptations permitting growth at extreme pressures have thus far focused on relatively few γ-proteobacteria, in part due to the technical difficulties of obtaining piezophilic bacteria in pure culture. Here, we present the molecular phylogenies of several new piezophiles of widely differing geographic origins. Included are results from an analysis of the first deep-trench bacterial isolates recovered from the southern hemisphere (9.9-km depth) and of the first gram-positive piezophilic strains. These new data allowed both phylogenetic and structural 16S rRNA comparisons among deep-ocean trench piezophiles and closely related strains not adapted to high pressure. Our results suggest that (i) the Circumpolar Deep Water acts as repository for hyperpiezophiles and drives their dissemination to deep trenches in the Pacific Ocean and (ii) the occurrence of elongated helices in the 16S rRNA genes increases with the extent of adaptation to growth at elevated pressure. These helix changes are believed to improve ribosome function under deep-sea conditions. PMID:17158629

  16. PhylOPDb: a 16S rRNA oligonucleotide probe database for prokaryotic identification

    PubMed Central

    Jaziri, Faouzi; Parisot, Nicolas; Abid, Anis; Denonfoux, Jérémie; Ribière, Céline; Gasc, Cyrielle; Boucher, Delphine; Brugère, Jean-François; Mahul, Antoine; Hill, David R.C.; Peyretaillade, Eric; Peyret, Pierre

    2014-01-01

    In recent years, high-throughput molecular tools have led to an exponential growth of available 16S rRNA gene sequences. Incorporating such data, molecular tools based on target-probe hybridization were developed to monitor microbial communities within complex environments. Unfortunately, only a few 16S rRNA gene-targeted probe collections were described. Here, we present PhylOPDb, an online resource for a comprehensive phylogenetic oligonucleotide probe database. PhylOPDb provides a convivial and easy-to-use web interface to browse both regular and explorative 16S rRNA-targeted probes. Such probes set or subset could be used to globally monitor known and unknown prokaryotic communities through various techniques including DNA microarrays, polymerase chain reaction (PCR), fluorescent in situ hybridization (FISH), targeted gene capture or in silico rapid sequence identification. PhylOPDb contains 74 003 25-mer probes targeting 2178 genera including Bacteria and Archaea. Database URL: http://g2im.u-clermont1.fr/phylopdb/ PMID:24771669

  17. Functional Specialization of Domains Tandemly Duplicated Witin 16S rRNA Methyltransferase RsmC

    SciTech Connect

    Sunita,S.; Purta, E.; Durawa, M.; Tkaczuk, K.; Swaathi, J.; Bujnicki, J.; Sivaraman, J.

    2007-01-01

    RNA methyltransferases (MTases) are important players in the biogenesis and regulation of the ribosome, the cellular machine for protein synthesis. RsmC is a MTase that catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (SAM) to G1207 of 16S rRNA. Mutations of G1207 have dominant lethal phenotypes in Escherichia coli, underscoring the significance of this modified nucleotide for ribosome function. Here we report the crystal structure of E. coli RsmC refined to 2.1 Angstroms resolution, which reveals two homologous domains tandemly duplicated within a single polypeptide. We characterized the function of the individual domains and identified key residues involved in binding of rRNA and SAM, and in catalysis. We also discovered that one of the domains is important for the folding of the other. Domain duplication and subfunctionalization by complementary degeneration of redundant functions (in particular substrate binding versus catalysis) has been reported for many enzymes, including those involved in RNA metabolism. Thus, RsmC can be regarded as a model system for functional streamlining of domains accompanied by the development of dependencies concerning folding and stability.

  18. rRNA genes from the lower chordate Herdmania momus: structural similarity with higher eukaryotes.

    PubMed Central

    Degnan, B M; Yan, J; Hawkins, C J; Lavin, M F

    1990-01-01

    Ascidians, primitive chordates that have retained features of the likely progenitors to all vertebrates, are a useful model to study the evolutionary relationship of chordates to other animals. We have selected the well characterized ribosomal RNA (rRNA) genes to investigate this relationship, and we describe here the cloning and characterization of an entire ribosomal DNA (rDNA) tandem repeat unit from a lower chordate, the ascidian Herdmania momus. rDNA copy number and considerable sequence differences were observed between two H. momus populations. Comparison of rDNA primary sequence and rRNA secondary structures from H. momus with those from other well characterized organisms, demonstrated that the ascidians are more closely related to other chordates than invertebrates. The rDNA tandem repeat makes up a larger percentage (7%) of the genome of this animal than in other higher eukaryotes. The total length of the spacer and transcribed region in H. momus rDNA is small compared to most higher eukaryotes, being less than 8 kb, and the intergenic spacer region consists of smaller internal repeats. Comparative analysis of rDNA sequences has allowed the construction of secondary structures for the 18S, 5.8S and 26S rRNAs. Images PMID:2263465

  19. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  20. Case of localized recombination in 23S rRNA genes from divergent bradyrhizobium lineages associated with neotropical legumes.

    PubMed

    Parker, M A

    2001-05-01

    Enzyme electrophoresis and rRNA sequencing were used to analyze relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legumes (Clitoria javitensis, Erythrina costaricensis, Rhynchosia pyramidalis, and Desmodium axillare) growing on Barro Colorado Island (BCI), Panama. Bacteria with identical multilocus allele profiles were commonly found in association with two or more legume genera. Among the 16 multilocus genotypes (electrophoretic types [ETs]) detected, six ETs formed a closely related cluster that included isolates from all four legume taxa. Bacteria from two other BCI legumes (Platypodium and Machaerium) sampled in a previous study were also identical to certain ETs in this group. Isolates from different legume genera that had the same ET had identical nucleotide sequences for both a 5' portion of the 23S rRNA and the nearly full-length 16S rRNA genes. These results suggest that Bradyrhizobium genotypes with low host specificity may be prevalent in this tropical forest. Parsimony analysis of 16S rRNA sequence variation indicated that most isolates were related to Bradyrhizobium japonicum USDA 110, although one ET sampled from C. javitensis had a 16S rRNA gene highly similar to that of Bradyrhizobium elkanii USDA 76. However, this isolate displayed a mosaic structure within the 5' 23S rRNA region: one 84-bp segment was identical to that of BCI isolate Pe1-3 (a close relative of B. japonicum USDA 110, based on 16S rRNA data), while an adjacent 288-bp segment matched that of B. elkanii USDA 76. This mosaic structure is one of the first observations suggesting recombination in nature between Bradyrhizobium isolates related to B. japonicum versus B. elkanii. PMID:11319084

  1. The phylogeny of intestinal porcine spirochetes (Serpulina species) based on sequence analysis of the 16S rRNA gene.

    PubMed Central

    Pettersson, B; Fellström, C; Andersson, A; Uhlén, M; Gunnarsson, A; Johansson, K E

    1996-01-01

    Four type or reference strains and twenty-two field strains of intestinal spirochetes isolated from Swedish pig herds were subjected to phylogenetic analysis based on 16S rRNA sequences. Almost complete (>95%) 16S rRNA sequences were obtained by solid-phase DNA sequencing of in vitro-amplified rRNA genes. The genotypic patterns were compared with a previously proposed biochemical classification scheme, comprising beta-hemolysis, indole production, hippurate hydrolysis, and alpha-galactosidase, alpha-glucosidase, and beta-glucosidase activities. Comparison of the small-subunit rRNA sequences showed that the strains of the genus Serpulina were closely related. Phylogenetic trees were constructed, and three clusters were observed. This was also confirmed by signature nucleotide analysis of the serpulinas. The indole-producing strains, including the strains of S. hyodysenteriae and some weakly beta-hemolytic Serpulina strains, formed one cluster. A second cluster comprised weakly beta-hemolytic strains that showed beta-galactosidase activity but lacked indole production and hippurate-hydrolyzing capacity. The second cluster contained two subclusters with similar phenotypic profiles. A third cluster involved strains that possessed a hippurate-hydrolyzing capacity which was distinct from that of the former two clusters, because of 17 unique nucleotide positions of the 16S rRNA gene. Interestingly, the strains of this third cluster were found likely to have a 16S rRNA structure in the V2 region of the molecule different from that of the serpulinas belonging to the other clusters. As a consequence of these findings, we propose that the intestinal spirochetes of this phenotype (i.e., P43/6/78-like strains) should be regarded as a separate Serpulina species. Furthermore, this cluster was found to be by far the most homogeneous one. In conclusion, the biochemical classification of porcine intestinal spirochetes was comparable to that by phylogenetic analysis based on 16S rRNA

  2. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  3. Photocarrier dynamics in transition metal dichalcogenide alloy Mo0.5W0.5S2.

    PubMed

    He, Jiaqi; He, Dawei; Wang, Yongsheng; Zhao, Hui

    2015-12-28

    We report a transient absorption study of photocarrier dynamics in transition metal dichalcogenide alloy, Mo0.5W0.5S2. Photocarriers were injected by a 400-nm pump pulse and detected by a 660-nm probe pulse. We observed a fast energy relaxation process of about 0.7 ps. The photocarrier lifetime is in the range of 50 - 100 ps, which weakly depends on the injected photocarrier density and is a few times shorter than MoS2 and WS2, reflecting the relatively lower crystalline quality of the alloy. Saturable absorption was also observed in Mo0.5W0.5S2, with a saturation energy fluence of 32 μJ cm(-2). These results provide important parameters on photocarrier properties of transition metal dichalcogenide alloys. PMID:26832001

  4. Theoretical study on the adsorption of carbon dioxide on individual and alkali-metal doped MOF-5s

    NASA Astrophysics Data System (ADS)

    Ha, Nguyen Thi Thu; Lefedova, O. V.; Ha, Nguyen Ngoc

    2016-01-01

    Density functional theory (DFT) calculations were performed to investigate the adsorption of carbon dioxide (CO2) on metal-organic framework (MOF-5) and alkali-metal (Li, K, Na) doped MOF-5s. The adsorption energy calculation showed that metal atom adsorption is exothermic in MOF-5 system. Moreover, alkali-metal doping can significantly improve the adsorption ability of carbon dioxide on MOF-5. The best influence is observed for Li-doping.

  5. Foraminoplastic transfacet epidural endoscopic approach for removal of intraforaminal disc herniation at the L5-S1 level

    PubMed Central

    Kaczmarczyk, Jacek; Nowakowski, Andrzej; Sulewski, Adam

    2014-01-01

    Transforaminal endoscopic disc removal in the L5-S1 motion segment of the lumbar spine creates a technical challenge due to anatomical reasons and individual variability. The majority of surgeons prefer a posterior classical or minimally invasive approach. There is only one foraminoplastic modification of the technique in the literature so far. In this paper we present a new technique with a foraminoplastic transfacet approach that may be suitable in older patients with advanced degenerative disease of the spine. PMID:24729817

  6. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  7. A Tale of Two Lines: Searching for the 5s - 5p Resonance Lines in Pm-like Ion Spectra

    SciTech Connect

    Trabert, E; Vilkas, M J; Ishikawa, Y

    2008-10-24

    Highly charged ions in the promethium sequence have been suggested to show spectral features resembling the alkali sequence ions. Guided by calculations, the 5s-5p resonance lines have been sought in a variety of experiments. In the light of the most extensive calculations of Pm-like ions yet, applying relativistic multi-reference Moeller-Plesset second-order perturbation theory, the experimental evidence is reviewed and the line identification problem assessed.

  8. Describing a new syndrome in L5-S1 disc herniation: Sexual and sphincter dysfunction without pain and muscle weakness

    PubMed Central

    Akca, Nezih; Ozdemir, Bulent; Kanat, Ayhan; Batcik, Osman Ersagun; Yazar, Ugur; Zorba, Orhan Unal

    2014-01-01

    Context: Little seems to be known about the sexual dysfunction (SD) in lumbar intervertebral disc herniation. Aims: Investigation of sexual and sphincter dysfunction in patient with lumbar disc hernitions. Settings and Design: A retrospective analysis. Materials and Methods: Sexual and sphincter dysfunction in patients admitted with lumbar disc herniations between September 2012-March 2014. Statistical Analysis Used: Statistical analysis was performed using the Predictive Analytics SoftWare (PASW) Statistics 18.0 for Windows (Statistical Package for the Social Sciences, SPSS Inc., Chicago, Illinois). The statistical significance was set at P < 0.05. The Wilcoxon signed ranks test was used to evaluate the difference between patients. Results: Four patients with sexual and sphincter dysfunction were found, including two women and two men, aged between 20 and 52 years. All of them admitted without low back pain. In addition, on neurological examination, reflex and motor deficit were not found. However, almost all patients had perianal sensory deficit and sexual and sphincter dysfunction. Magnetic resonance imaging (MRI) of three patients displayed a large extruded disc fragment at L5-S1 level on the left side. In fourth patient, there were not prominent disc herniations. There was not statistically significant difference between pre-operative and post-operative sexual function, anal-urethral sphincter function, and perianal sensation score. A syndrome in L5-S1 disc herniation with sexual and sphincter dysfunction without pain and muscle weakness was noted. We think that it is crucial for neurosurgeons to early realise that paralysis of the sphincter and sexual dysfunction are possible in patients with lumbar L5-S1 disc disease. Conclusion: A syndrome with perianal sensory deficit, paralysis of the sphincter, and sexual dysfunction may occur in patients with lumbar L5-S1 disc disease. The improvement of perianal sensory deficit after surgery was counteracted by a trend

  9. Imaging Transcription in Living Cells

    PubMed Central

    Darzacq, Xavier; Yao, Jie; Larson, Daniel R.; Causse, Sebastien Z.; Bosanac, Lana; de Turris, Valeria; Ruda, Vera M.; Lionnet, Timothee; Zenklusen, Daniel; Guglielmi, Benjamin; Tjian, Robert; Singer, Robert H.

    2011-01-01

    The advent of new technologies for the imaging of living cells has made it possible to determine the properties of transcription, the kinetics of polymerase movement, the association of transcription factors, and the progression of the polymerase on the gene. We report here the current state of the field and the progress necessary to achieve a more complete understanding of the various steps in transcription. Our Consortium is dedicated to developing and implementing the technology to further this understanding. PMID:19416065

  10. Minimally Invasive Transforaminal Lumbar Interbody Fusion at L5-S1 through a Unilateral Approach: Technical Feasibility and Outcomes

    PubMed Central

    Choi, Won-Suh; Kim, Jin-Sung; Ryu, Kyeong-Sik; Hur, Jung-Woo; Seong, Ji-Hoon

    2016-01-01

    Background. Minimally invasive spinal transforaminal lumbar interbody fusion (MIS-TLIF) at L5-S1 is technically more demanding than it is at other levels because of the anatomical and biomechanical traits. Objective. To determine the clinical and radiological outcomes of MIS-TLIF for treatment of single-level spinal stenosis low-grade isthmic or degenerative spondylolisthesis at L5-S1. Methods. Radiological data and electronic medical records of patients who underwent MIS-TLIF between May 2012 and December 2014 were reviewed. Fusion rate, cage position, disc height (DH), disc angle (DA), disc slope angle, segmental lordotic angle (SLA), lumbar lordotic angle (LLA), and pelvic parameters were assessed. For functional assessment, the visual analogue scale (VAS), Oswestry disability index (ODI), and patient satisfaction rate (PSR) were utilized. Results. A total of 21 levels in 21 patients were studied. DH, DA, SLA, and LLA had increased from their preoperative measures at the final follow-up. Fusion rate was 86.7% (18/21) at 12 months' follow-up. The most common cage position was anteromedial (15/21). The mean VAS scores for back and leg pain mean ODI scores improved significantly at the final follow-up. PSR was 88%. Cage subsidence was observed in 33.3% (7/21). Conclusions. The clinical and radiologic outcomes after MIS-TLIF at L5-S1 in patients with spinal stenosis or spondylolisthesis are generally favorable. PMID:27433472

  11. Temporal and tissue specific gene expression patterns of the zebrafish kinesin-1 heavy chain family, kif5s, during development

    PubMed Central

    Campbell, Philip D.; Marlow, Florence L.

    2013-01-01

    Homo- and heterodimers of Kif5 proteins form the motor domain of Kinesin-1, a major plus-end directed microtubule motor. Kif5s have been implicated in the intracellular transport of organelles, vesicles, proteins, and RNAs in many cell types. There are three mammalian KIF5s. KIF5A and KIF5C proteins are strictly neural in mouse whereas, KIF5B is ubiquitously expressed. Mouse knockouts indicate crucial roles for KIF5 in development and human mutations in KIF5A lead to the neurodegenerative disease Hereditary Spastic Paraplegia. However, the developmental functions and the extent to which individual kif5 functions overlap have not been elucidated. Zebrafish possess five kif5 genes: kif5Aa, kif5Ab, kif5Ba, kif5Bb, and kif5C. Here we report their tissue specific expression patterns in embryonic and larval stages. Specifically, we find that kif5As are strictly zygotic and exhibit neural-specific expression. In contrast, kif5Bs exhibit strong maternal contribution and are ubiquitously expressed. Lastly, kif5C exhibits weak maternal expression followed by enrichment in neural populations. In addition, kif5s show distinct expression domains in the larval retina. PMID:23684767

  12. Transcriptional Regulation: a Genomic Overview

    PubMed Central

    Riechmann, José Luis

    2002-01-01

    The availability of the Arabidopsis thaliana genome sequence allows a comprehensive analysis of transcriptional regulation in plants using novel genomic approaches and methodologies. Such a genomic view of transcription first necessitates the compilation of lists of elements. Transcription factors are the most numerous of the different types of proteins involved in transcription in eukaryotes, and the Arabidopsis genome codes for more than 1,500 of them, or approximately 6% of its total number of genes. A genome-wide comparison of transcription factors across the three eukaryotic kingdoms reveals the evolutionary generation of diversity in the components of the regulatory machinery of transcription. However, as illustrated by Arabidopsis, transcription in plants follows similar basic principles and logic to those in animals and fungi. A global view and understanding of transcription at a cellular and organismal level requires the characterization of the Arabidopsis transcriptome and promoterome, as well as of the interactome, the localizome, and the phenome of the proteins involved in transcription. PMID:22303220

  13. Deregulated transcription factors in leukemia.

    PubMed

    Shima, Yutaka; Kitabayashi, Issay

    2011-08-01

    Specific chromosomal translocations and other mutations associated with acute myeloblastic leukemia (AML) often involve transcription factors and transcriptional coactivators. Such target genes include AML1, C/EBPα, RARα, MOZ, p300/CBP, and MLL, all of which are important in the regulation of hematopoiesis. The resultant fusion or mutant proteins deregulate the transcription of the affected genes and disrupt their essential role in hematopoiesis, causing differentiation block and abnormal proliferation and/or survival. This review focuses on such transcription factors and coactivators, and describes their roles in leukemogenesis and hematopoiesis. PMID:21823042

  14. Experimental characterization of Cis-acting elements important for translation and transcription in halophilic archaea.

    PubMed

    Brenneis, Mariam; Hering, Oliver; Lange, Christian; Soppa, Jörg

    2007-12-01

    these leadered transcripts with the 16S rRNA could be excluded. Taken together, either a scanning mechanism similar to the mechanism of translation initiation operating in eukaryotes or a novel mechanism must operate on most leadered haloarchaeal transcripts. PMID:18159946

  15. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.

    PubMed

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G

    2005-09-01

    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  16. [Strategy of selecting 16S rRNA hypervariable regions for metagenome-phylogenetic marker genes based analysis].

    PubMed

    Zhang, Jun-yi; Zhu, Bing-chuan; Xu, Chao; Ding, Xiao; Li, Jun-feng; Zhang, Xue-gong; Lu, Zu-hong

    2015-11-01

    The advent of next generation sequencing technology enables parallel analysis of the whole microbial community from multiple samples. Particularly, sequencing 16S rRNA hypervariable tags has become the most efficient and cost-effective method for assessing microbial diversity. Due to its short read length of the 2nd-generation sequencing methods that cannot cover the full 16S rRNA genomic region, specific hypervariable regions or V-regions must be selected to act as the proxy. Over the past decade, selection of V-regions has not been consistent in assessing microbial diversity. Here we evaluated the current strategies of selecting 16S rRNA hypervariable regions for surveying microbial diversity. The environmental condition was considered as one of the important factors for selection of 16S rRNA hypervariable regions. We suggested that a pilot study to test different V-regions is required in bacterial diversity studies based on 16S rRNA genes. PMID:26915214

  17. RRNA and dnaK relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legume trees in Costa Rica.

    PubMed

    Parker, Matthew A

    2004-05-01

    Enzyme electrophoresis and sequencing of rRNA and dnaK genes revealed high genetic diversity among root nodule bacteria from the Costa Rican trees Andira inermis, Dalbergia retusa, Platymiscium pinnatum (Papilionoideae tribe Dalbergieae) and Lonchocarpus atropurpureus (Papilionoideae tribe Millettieae). A total of 21 distinct multilocus genotypes [ETs (electrophoretic types)] was found among the 36 isolates analyzed, and no ETs were shared in common by isolates from different legume hosts. However, three of the ETs from D. retusa were identical to Bradyrhizobium sp. isolates detected in prior studies of several other legume genera in both Costa Rica and Panama. Nearly full-length 16S rRNA sequences and partial 23S rRNA sequences confirmed that two isolates from D. retusa were highly similar or identical to Bradyrhizobium strains isolated from the legumes Erythrina and Clitoria (Papilionoideae tribe Phaseoleae) in Panama. rRNA sequences for five isolates from L. atropurpureus, P. pinnatum and A. inermis were not closely related to any currently known strains from Central America or elsewhere, but had affinities to the reference strains Bradyrhizobium japonicum USDA 110 (three isolates) or to B. elkanii USDA 76 (two isolates). A phylogenetic tree for 21 Bradyrhizobium strains based on 603 bp of the dnaK gene showed several significant conflicts with the rRNA tree, suggesting that genealogical relationships may have been altered by lateral gene transfer events. PMID:15214639

  18. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes.

    PubMed

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-06-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  19. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes

    PubMed Central

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-01-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  20. Strengths and Limitations of 16S rRNA Gene Amplicon Sequencing in Revealing Temporal Microbial Community Dynamics

    PubMed Central

    Poretsky, Rachel; Rodriguez-R, Luis M.; Luo, Chengwei; Tsementzi, Despina; Konstantinidis, Konstantinos T.

    2014-01-01

    This study explored the short-term planktonic microbial community structure and resilience in Lake Lanier (GA, USA) while simultaneously evaluating the technical aspects of identifying taxa via 16S rRNA gene amplicon and metagenomic sequence data. 16S rRNA gene amplicons generated from four temporally discrete samples were sequenced with 454 GS-FLX-Ti yielding ∼40,000 rRNA gene sequences from each sample and representing ∼300 observed OTUs. Replicates obtained from the same biological sample clustered together but several biases were observed, linked to either the PCR or sequencing-preparation steps. In comparisons with companion whole-community shotgun metagenome datasets, the estimated number of OTUs at each timepoint was concordant, but 1.5 times and ∼10 times as many phyla and genera, respectively, were identified in the metagenomes. Our analyses showed that the 16S rRNA gene captures broad shifts in community diversity over time, but with limited resolution and lower sensitivity compared to metagenomic data. We also identified OTUs that showed marked shifts in abundance over four close timepoints separated by perturbations and tracked these taxa in the metagenome vs. 16S rRNA amplicon data. A strong summer storm had less of an effect on community composition than did seasonal mixing, which revealed a distinct succession of organisms. This study provides insights into freshwater microbial communities and advances the approaches for assessing community diversity and dynamics in situ. PMID:24714158

  1. Group I introns are inherited through common ancestry in the nuclear-encoded rRNA of Zygnematales (Charophyceae).

    PubMed Central

    Bhattacharya, D; Surek, B; Rüsing, M; Damberger, S; Melkonian, M

    1994-01-01

    Group I introns are found in organellar genomes, in the genomes of eubacteria and phages, and in nuclear-encoded rRNAs. The origin and distribution of nuclear-encoded rRNA group I introns are not understood. To elucidate their evolutionary relationships, we analyzed diverse nuclear-encoded small-subunit rRNA group I introns including nine sequences from the green-algal order Zygnematales (Charophyceae). Phylogenetic analyses of group I introns and rRNA coding regions suggest that lateral transfers have occurred in the evolutionary history of group I introns and that, after transfer, some of these elements may form stable components of the host-cell nuclear genomes. The Zygnematales introns, which share a common insertion site (position 1506 relative to the Escherichia coli small-subunit rRNA), form one subfamily of group I introns that has, after its origin, been inherited through common ancestry. Since the first Zygnematales appear in the middle Devonian within the fossil record, the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding region for 350-400 million years. PMID:7937917

  2. Mutational analysis of the L1 binding site of 23S rRNA in Escherichia coli.

    PubMed Central

    Said, B; Cole, J R; Nomura, M

    1988-01-01

    The L11 ribosomal protein operon of Escherichia coli contains the genes for L11 and L1 and is feedback regulated by the translational repressor L1. Both the L1 binding site on 23S rRNA and the L1 repressor target site on L11 operon mRNA share similar proposed secondary structures and contain some primary sequence identity. Several site-directed mutations in the binding region of 23S rRNA were constructed and their effects on binding were examined. For in vitro analysis, a filter binding method was used. For in vivo analysis, a conditional expression system was used to overproduce a 23S rRNA fragment containing the L1 binding region, which leads to specific derepression of the synthesis of L11 and L1. Changes in the shared region of the 23S rRNA L1 binding site produced effects on L1 binding similar to those found previously in analysis of corresponding changes in the L11 operon mRNA target site. The results support the hypothesis that r-protein L1 interacts with both 23S rRNA and L11 operon mRNA by recognizing similar features on both RNAs. Images PMID:3060846

  3. METAXA2: improved identification and taxonomic classification of small and large subunit rRNA in metagenomic data.

    PubMed

    Bengtsson-Palme, Johan; Hartmann, Martin; Eriksson, Karl Martin; Pal, Chandan; Thorell, Kaisa; Larsson, Dan Göran Joakim; Nilsson, Rolf Henrik

    2015-11-01

    The ribosomal rRNA genes are widely used as genetic markers for taxonomic identification of microbes. Particularly the small subunit (SSU; 16S/18S) rRNA gene is frequently used for species- or genus-level identification, but also the large subunit (LSU; 23S/28S) rRNA gene is employed in taxonomic assignment. The METAXA software tool is a popular utility for extracting partial rRNA sequences from large sequencing data sets and assigning them to an archaeal, bacterial, nuclear eukaryote, mitochondrial or chloroplast origin. This study describes a comprehensive update to METAXA - METAXA2 - that extends the capabilities of the tool, introducing support for the LSU rRNA gene, a greatly improved classifier allowing classification down to genus or species level, as well as enhanced support for short-read (100 bp) and paired-end sequences, among other changes. The performance of METAXA2 was compared to other commonly used taxonomic classifiers, showing that METAXA2 often outperforms previous methods in terms of making correct predictions while maintaining a low misclassification rate. METAXA2 is freely available from http://microbiology.se/software/metaxa2/. PMID:25732605

  4. Archaeal DnaG contains a conserved N-terminal RNA-binding domain and enables tailing of rRNA by the exosome

    PubMed Central

    Hou, Linlin; Klug, Gabriele; Evguenieva-Hackenberg, Elena

    2014-01-01

    The archaeal exosome is a phosphorolytic 3′–5′ exoribonuclease complex. In a reverse reaction it synthesizes A-rich RNA tails. Its RNA-binding cap comprises the eukaryotic orthologs Rrp4 and Csl4, and an archaea-specific subunit annotated as DnaG. In Sulfolobus solfataricus DnaG and Rrp4 but not Csl4 show preference for poly(rA). Archaeal DnaG contains N- and C-terminal domains (NTD and CTD) of unknown function flanking a TOPRIM domain. We found that the NT and TOPRIM domains have comparable, high conservation in all archaea, while the CTD conservation correlates with the presence of exosome. We show that the NTD is a novel RNA-binding domain with poly(rA)-preference cooperating with the TOPRIM domain in binding of RNA. Consistently, a fusion protein containing full-length Csl4 and NTD of DnaG led to enhanced degradation of A-rich RNA by the exosome. We also found that DnaG strongly binds native and in vitro transcribed rRNA and enables its polynucleotidylation by the exosome. Furthermore, rRNA-derived transcripts with heteropolymeric tails were degraded faster by the exosome than their non-tailed variants. Based on our data, we propose that archaeal DnaG is an RNA-binding protein, which, in the context of the exosome, is involved in targeting of stable RNA for degradation. PMID:25326320

  5. Development of three specific PCR-based tools to determine quantity, cellulolytic transcriptional activity and phylogeny of anaerobic fungi.

    PubMed

    Dollhofer, Veronika; Callaghan, Tony Martin; Dorn-In, Samart; Bauer, Johann; Lebuhn, Michael

    2016-08-01

    Anaerobic fungi (AF) decompose plant material with their rhizoid and multiple cellulolytic enzymes. They disintegrate the complex structure of lignocellulosic substrates, making them more accessible and suitable for further microbial degradation. There is also much interest in their use as biocatalysts for biotechnological applications. Here, three novel polymerase chain reaction (PCR)-based methods for detecting AF and their transcriptional activity in in vitro cultures and environmental samples were developed. Two real-time quantitative PCR (qPCR)-based methods targeting AF were developed: AF-SSU, was designed to quantify the 18S rRNA genes of AF. AF-Endo, measuring transcripts of an endoglucanase gene from the glycoside hydrolase family 5 (GH5), was developed to quantify their transcriptional cellulolytic activity. The third PCR based approach was designed for phylogenetical analysis. It targets the 28S rRNA gene (LSU) of AF revealing their phylogenetic affiliation. The in silico-designed primer/probe combinations were successfully tested for the specific amplification of AF from animal and biogas plant derived samples. In combination, these three methods represent useful tools for the analysis of AF transcriptional cellulolytic activity, their abundance and their phylogenetic placement. PMID:27220661

  6. Evaluation of suitable reference genes for normalization of microRNA expression by real-time reverse transcription PCR analysis during longan somatic embryogenesis.

    PubMed

    Lin, Yu Ling; Lai, Zhong Xiong

    2013-05-01

    Accurate profiling of microRNAs (miRNAs) is an essential step for understanding both developmental and physiological functions of miRNAs. Real-time quantitative PCR (qPCR) is being widely used in miRNA expression studies, but choosing a suitable reference gene is a crucial factor for correct analysis of results. To date, there has been no systematic evaluation of qPCR reference genes for the study of miRNAs during somatic embryogenesis (SE) in the longan tree (Dimocarpus longan). Here, the most stably expressed miRNAs in synchronized longan tree embryogenic cultures at different developmental stages were determined using the geNorm and NormFinder algorithms. Validation qPCR experiments were performed for 24 miRNAs together with a snRNA (U6 snRNA), a rRNA (5S rRNA), and three housekeeping genes. It was found that small RNAs had better expression stability than protein-coding genes, and dlo-miR24 was identified as the most reliable reference gene, followed by dlo-miR168a*, dlo-miR2089*-1 and 5S rRNA. dlo-miR24 was recommended as a normalizer if only a single reference gene was to be used, while the combination of dlo-miR156c, dlo-2089*-1 and 5S rRNA was preferred to normalize miRNA expression data during longan SE. PMID:23454294

  7. Mechanosensitive mechanisms in transcriptional regulation

    PubMed Central

    Mammoto, Akiko; Mammoto, Tadanori; Ingber, Donald E.

    2012-01-01

    Summary Transcriptional regulation contributes to the maintenance of pluripotency, self-renewal and differentiation in embryonic cells and in stem cells. Therefore, control of gene expression at the level of transcription is crucial for embryonic development, as well as for organogenesis, functional adaptation, and regeneration in adult tissues and organs. In the past, most work has focused on how transcriptional regulation results from the complex interplay between chemical cues, adhesion signals, transcription factors and their co-regulators during development. However, chemical signaling alone is not sufficient to explain how three-dimensional (3D) tissues and organs are constructed and maintained through the spatiotemporal control of transcriptional activities. Accumulated evidence indicates that mechanical cues, which include physical forces (e.g. tension, compression or shear stress), alterations in extracellular matrix (ECM) mechanics and changes in cell shape, are transmitted to the nucleus directly or indirectly to orchestrate transcriptional activities that are crucial for embryogenesis and organogenesis. In this Commentary, we review how the mechanical control of gene transcription contributes to the maintenance of pluripotency, determination of cell fate, pattern formation and organogenesis, as well as how it is involved in the control of cell and tissue function throughout embryogenesis and adult life. A deeper understanding of these mechanosensitive transcriptional control mechanisms should lead to new approaches to tissue engineering and regenerative medicine. PMID:22797927

  8. Spatial distribution of Escherichia coli in the mouse large intestine inferred from rRNA in situ hybridization.

    PubMed Central

    Poulsen, L K; Lan, F; Kristensen, C S; Hobolth, P; Molin, S; Krogfelt, K A

    1994-01-01

    Fluorescent oligonucleotide probes targeting rRNA were used to develop an in situ hybridization technique by which the spatial distribution of Escherichia coli in the large intestines of streptomycin-treated mice was determined. Single E. coli cells were identified in thin frozen sections from the large intestines by the use of a probe specific for E. coli 23S rRNA. Furthermore, the total bacterial population was visualized with an rRNA probe targeting the domain Bacteria. By this technique, all E. coli cells were seen embedded in the mucosal material overlying the epithelial cells of the large intestine, and no direct attachment to the epithelium was observed. Images PMID:7927805

  9. PCR primers to amplify 16S rRNA genes from cyanobacteria.

    PubMed Central

    Nübel, U; Garcia-Pichel, F; Muyzer, G

    1997-01-01

    We developed and tested a set of oligonucleotide primers for the specific amplification of 16S rRNA gene segments from cyanobacteria and plastids by PCR. PCR products were recovered from all cultures of cyanobacteria and diatoms that were checked but not from other bacteria and archaea. Gene segments selectively retrieved from cyanobacteria and diatoms in unialgal but nonaxenic cultures and from cyanobionts in lichens could be directly sequenced. In the context of growing sequence databases, this procedure allows rapid and phylogenetically meaningful identification without pure cultures or molecular cloning. We demonstrate the use of this specific PCR in combination with denaturing gradient gel electrophoresis to probe the diversity of oxygenic phototrophic microorganisms in cultures, lichens, and complex microbial communities. PMID:9251225

  10. Identification of Scopulariopsis species by partial 28S rRNA gene sequence analysis.

    PubMed

    Jagielski, Tomasz; Kosim, Kinga; Skóra, Magdalena; Macura, Anna Barbara; Bielecki, Jacek

    2013-01-01

    The genus Scopulariopsis contains over 30 species of mitosporic moulds, which although usually saprophytic may also act as opportunistic pathogens in humans. They have mainly been associated with onychomycosis, and only sporadically reported as a cause of deep tissue infections or systemic disease. Identification of Scopulariopsis species still largely relies on phenotype-based methods. There is a need for a molecular diagnostic approach, that would allow to reliably discriminate between different Scopulariopsis species. The aim of this study was to apply sequence analysis of partial 28S rRNA gene for species identification of Scopulariopsis clinical isolates. Although the method employed did reveal some genetic polymorphism among Scopulariopsis isolates tested, it was not enough for species delineation. For this to be achieved, other genetic loci, within and beyond the rDNA operon, need to be investigated. PMID:24459837

  11. Novelty in phylogeny of gastrotricha: evidence from 18S rRNA gene.

    PubMed

    Wirz, A; Pucciarelli, S; Miceli, C; Tongiorgi, P; Balsamo, M

    1999-11-01

    Gastrotricha form a phylum which is crucial for defining the origin of pseudocoelomates, in that they share a number of characters with Rotifera and Nematoda but also with acoelomates, and even the evolutionary relationships within the phylum are anything but defined. For this reason the first extensive molecular data on Gastrotricha from the 18S rRNA sequences of both orders have been obtained and analyzed. Sequence analyses show that the phylum Gastrotricha is strictly monophyletic along an evolutionary line quite distinct from that of both Rotifera and Nematoda. A new view of the evolutionary history of the phylum Gastrotricha is put forward, in which Chaetonotida, and not Macrodasyida, are the most primitive forms of the group, contrary to the commonly held view. A polyphyletic origin of aschelminthes is supported, and the misleading term pseudocoelomates should be discarded. PMID:10603259

  12. Preliminary study on mitochondrial 16S rRNA gene sequences and phylogeny of flatfishes (Pleuronectiformes)

    NASA Astrophysics Data System (ADS)

    You, Feng; Liu, Jing; Zhang, Peijun; Xiang, Jianhai

    2005-09-01

    A 605 bp section of mitochondrial 16S rRNA gene from Paralichthys olivaceus, Pseudorhombus cinnamomeus, Psetta maxima and Kareius bicoloratus, which represent 3 families of Order Pleuronectiformes was amplified by PCR and sequenced to show the molecular systematics of Pleuronectiformes for comparison with related gene sequences of other 6 flatfish downloaded from GenBank. Phylogenetic analysis based on genetic distance from related gene sequences of 10 flatfish showed that this method was ideal to explore the relationship between species, genera and families. Phylogenetic trees set-up is based on neighbor-joining, maximum parsimony and maximum likelihood methods that accords to the general rule of Pleuronectiformes evolution. But they also resulted in some confusion. Unlike data from morphological characters, P. olivaceus clustered with K. bicoloratus, but P. cinnamomeus did not cluster with P. olivaceus, which is worth further studying.

  13. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae.

    PubMed

    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C

    2016-09-01

    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  14. Processing of a composite large subunit rRNA. Studies with chlamydomonas mutants deficient in maturation of the 23s-like rrna.

    PubMed Central

    Holloway, S P; Herrin, D L

    1998-01-01

    (Cr.LSU). Little is known of the cis and trans requirements or of the processing pathway for this essential RNA. Previous work showed that the ribosome-deficient ac20 mutant overaccumulates an unspliced large subunit (LSU) RNA, suggesting that it might be a splicing mutant. To elucidate the molecular basis of the ac20 phenotype, a detailed analysis of the rrn transcripts in ac20 and wild-type cells was performed. The results indicate that processing of the ITSs, particularly ITS-1, is inefficient in ac20 and that ITS processing occurs after splicing. Deletion of the Cr.LSU intron from ac20 also did not alleviate the mutant phenotype. Thus, the primary defect in ac20 is not splicing but most likely is associated with ITS processing. A splicing deficiency was studied by transforming wild-type cells with rrnL genes containing point mutations in the intron core. Heteroplasmic transformants were obtained in most cases, except for P4 helix mutants; these strains grew slowly, were light sensitive, and had an RNA profile indicative of inefficient splicing. Transcript analysis in the P4 mutants also indicated that ITS processing can occur on an unspliced precursor, although with reduced efficiency. These latter results indicate that although there is not an absolutely required order for LSU processing, there does seem to be a preferred order that results in efficient processing in vivo. PMID:9668137

  15. Structural basis of transcription activation.

    PubMed

    Feng, Yu; Zhang, Yu; Ebright, Richard H

    2016-06-10

    Class II transcription activators function by binding to a DNA site overlapping a core promoter and stimulating isomerization of an initial RNA polymerase (RNAP)-promoter closed complex into a catalytically competent RNAP-promoter open complex. Here, we report a 4.4 angstrom crystal structure of an intact bacterial class II transcription activation complex. The structure comprises Thermus thermophilus transcription activator protein TTHB099 (TAP) [homolog of Escherichia coli catabolite activator protein (CAP)], T. thermophilus RNAP σ(A) holoenzyme, a class II TAP-dependent promoter, and a ribotetranucleotide primer. The structure reveals the interactions between RNAP holoenzyme and DNA responsible for transcription initiation and reveals the interactions between TAP and RNAP holoenzyme responsible for transcription activation. The structure indicates that TAP stimulates isomerization through simple, adhesive, stabilizing protein-protein interactions with RNAP holoenzyme. PMID:27284196

  16. Mitotic bookmarking by transcription factors

    PubMed Central

    2013-01-01

    Mitosis is accompanied by dramatic changes in chromatin organization and nuclear architecture. Transcription halts globally and most sequence-specific transcription factors and co-factors are ejected from mitotic chromatin. How then does the cell maintain its transcriptional identity throughout the cell division cycle? It has become clear that not all traces of active transcription and gene repression are erased within mitotic chromatin. Many histone modifications are stable or only partially diminished throughout mitosis. In addition, some sequence-specific DNA binding factors have emerged that remain bound to select sites within mitotic chromatin, raising the possibility that they function to transmit regulatory information through the transcriptionally silent mitotic phase, a concept that has been termed “mitotic bookmarking.” Here we review recent approaches to studying potential bookmarking factors with regards to their mitotic partitioning, and summarize emerging ideas concerning the in vivo functions of mitotically bound nuclear factors. PMID:23547918

  17. Identification of the Microbiota in Carious Dentin Lesions Using 16S rRNA Gene Sequencing

    PubMed Central

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4–76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  18. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    PubMed Central

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  19. Improved PCR primers to amplify 16S rRNA genes from NC10 bacteria.

    PubMed

    He, Zhanfei; Wang, Jiaqi; Hu, Jiajie; Zhang, Hao; Cai, Chaoyang; Shen, Jiaxian; Xu, Xinhua; Zheng, Ping; Hu, Baolan

    2016-06-01

    Anaerobic oxidation of methane (AOM) coupled to nitrite reduction (AOM-NIR) is ecologically significant for mitigating the methane-induced greenhouse effect. The microbes responsible for this reaction, NC10 bacteria, have been widely detected in diverse ecosystems. However, some defects were discovered in the commonly used NC10-specific primers, 202F and qP1F. In the present work, the primers were redesigned and improved to overcome the defects found in the previous primers. A new nested PCR method was developed using the improved primers to amplify 16S ribosomal RNA (rRNA) genes from NC10 bacteria. In the new nested PCR method, the qP1mF/1492R and 1051F/qP2R primer sets were used in the first and second rounds, respectively. The PCR products were sequenced, and more operational taxonomic units (OTUs) of the NC10 phylum were obtained using the new primers compared to the previous primers. The sensitivity of the new nested PCR was tested by the serial dilution method, and the limit of detection was approximately 10(3) copies g(-1) dry sed. for the environmental samples compared to approximately 10(5) copies g(-1) dry sed. by the previous method. Finally, the improved primer, qP1mF, was used in quantitative PCR (qPCR) to determine the abundance of NC10 bacteria, and the results agreed well with the activity of AOM-NIR measured by isotope tracer experiments. The improved primers are able to amplify NC10 16S rRNA genes more efficiently than the previous primers and useful to explore the microbial community of the NC10 phylum in different systems. PMID:27020287

  20. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    PubMed

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  1. Measurement of rRNA Variations in Natural Communities of Microorganisms on the Southeastern U.S. Continental Shelf †

    PubMed Central

    Kramer, Jonathan G.; Singleton, Fred L.

    1993-01-01

    The development of a clear understanding of the physiology of marine prokaryotes is complicated by the difficulties inherent in resolving the activity of various components of natural microbial communities. Application of appropriate molecular biological techniques offers a means of overcoming some of these problems. In this regard, we have used direct probing of bulk RNA purified from selective size fractions to examine variations in the rRNA content of heterotrophic communities and Synechococcus populations on the southeastern U.S. continental shelf. Heterotrophic communities in natural seawater cultures amended with selected substrates were examined. Synechococcus populations were isolated from the water column by differential filtration. The total cellular rRNA content of the target populations was assayed by probing RNA purified from these samples with an oligonucleotide complementing a universally conserved region in the eubacterial 16S rRNA (heterotrophs) or with a 1.5-kbp fragment encoding the Synechococcus sp. strain WH 7803 16S rRNA (cyanobacteria). The analyses revealed that heterotrophic bacteria responded to the addition of glucose and trace nutrients after a 6-h lag period. However, no response was detected after amino acids were added. The cellular rRNA content increased 48-fold before dropping to a value 20 times that detected before nutrients were added. Variations in the rRNA content from Synechococcus spp. followed a distinct diel pattern imposed by the phasing of cell division within the irradiance cycle. The results indicate that careful application of these appropriate molecular biological techniques can be of great use in discerning basic physiological characteristics of selected natural populations and the mechanisms which regulate growth at the subcellular level. Images PMID:16349009

  2. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  3. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.

    PubMed

    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V

    2015-02-25

    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences. PMID:25523504

  4. Composition and Metabolic Activities of the Bacterial Community in Shrimp Sauce at the Flavor-Forming Stage of Fermentation As Revealed by Metatranscriptome and 16S rRNA Gene Sequencings.

    PubMed

    Duan, Shan; Hu, Xiaoxi; Li, Mengru; Miao, Jianyin; Du, Jinghe; Wu, Rongli

    2016-03-30

    The bacterial community and the metabolic activities involved at the flavor-forming stage during the fermentation of shrimp sauce were investigated using metatranscriptome and 16S rRNA gene sequencings. Results showed that the abundance of Tetragenococcus was 95.1%. Tetragenococcus halophilus was identified in 520 of 588 transcripts annotated in the Nr database. Activation of the citrate cycle and oxidative phosphorylation, along with the absence of lactate dehydrogenase gene expression, in T. halophilus suggests that T. halophilus probably underwent aerobic metabolism during shrimp sauce fermentation. The metabolism of amino acids, production of peptidase, and degradation of limonene and pinene were very active in T. halophilus. Carnobacterium, Pseudomonas, Escherichia, Staphylococcus, Bacillus, and Clostridium were also metabolically active, although present in very small populations. Enterococcus, Abiotrophia, Streptococcus, and Lactobacillus were detected in metatranscriptome sequencing, but not in 16S rRNA gene sequencing. Many minor taxa showed no gene expression, suggesting that they were in dormant status. PMID:26978261

  5. Endoscopic Trans-iliac Approach to L5-S1 Disc and Foramen – A Report on Clinical Experience

    PubMed Central

    Osman, Said G; Sherlekar, Sandeep; Malik, Atif; Winters, Charles; Grewal, PK; Narayanan, Malini; Gemechu, Nigussie

    2014-01-01

    Background The lumbosacral junction is a difficult area for spine surgery because of the complex anatomy. In the era of minimally invasive spine surgery, the presence of the iliac wing has, at the level of lumbosacral junction, created a major obstacle in the paths of two of the major approaches, namely, the direct lateral and percutaneous posterolateral endoscopic approaches. A trans-iliac cadaver study published by the senior author and co-workers in 1997, suggested the possibility of an alternative approach to the lumbosacral junction. Purpose To determine the feasibility of percutaneous, endoscopic trans-iliac approach to the L5-S1 disc and foramen Study Design Prospective case series study. Materials and Methods 15 consecutive patients undergoing the transiliac approach to L5-S1 disc and foramen were included in the study. Pre- and postoperative visual analogue scale (VAS); Oswestry Disability Index (ODI); and intra-operative blood loss and operative time, were obtained for the study. Preoperative MRI or CT scan was used to determine the need for trans-iliac access. The procedure was performed with the patient in prone position and under monitored sedation for decompression. Endotracheal anesthesia was used for fusion cases. The transiliac access was established with a cannulated drill or core drill through the iliac wing. Once the trans-iliac window had been created, the rest of the procedure proceeded as for percutaneous endoscopic transforaminal decompression and fusion. Results 15 patients (9 male and 6 female) participated in the study. The VAS for back and leg pain significantly improved in all patients. The ODI dropped by more than 50%. There was minimal blood loss, and transient post-operative dysesthesia in 2 cases which resolved after 3 weeks. Conclusion Endoscopic trans-iliac approach to the L5-S1 disc and foramen is feasible and safe. Decompression can be performed safely via trans-iliac access with minimal blood loss, and in a short operative time

  6. Hadron physics potential of future high-luminosity B-factories at the ϒ(5S) and above

    NASA Astrophysics Data System (ADS)

    Drutskoy, A. G.; Guo, F.-K.; Llanes-Estrada, F. J.; Nefediev, A. V.; Torres-Rincon, J. M.

    2013-01-01

    We point out the physics opportunities of future high-luminosity B-factories at the ϒ(5 S) resonance and above. Currently the two B-factories, the SuperB factory in Tor Vergata, Italy and the Belle II factory in KEK, Japan, are under development and are expected to start operation in 2017 and 2016, respectively. In this paper we discuss numerous interesting investigations, which can be performed in the e + e - center-of-mass energy region from the ϒ(5 S) and up to 11.5GeV, where an efficient data taking operation should be possible with the planned B-factories. These studies include abundant Bs production and decay properties; independent confirmation and, if found, exhaustive exploration of Belle's claimed charged bottomonia; clarification of puzzles of interquarkonium dipion transitions; extraction of the light-quark mass ratio from hadronic ϒ(5 S) decays; analysis of quarkonium and exotic internal structure from open flavour decays, leading to severe SU(3) symmetry violations; clarification of whether a hybrid state has similar mass to the ϒ(5 S) bottomonium, making it a double state; searches for molecular/tetraquark states that should be more stable with heavy quarks; completion of the table of positive-parity BJ mesons and study of their basic properties; production of Λ _b bar Λ _b heavy baryon pairs, that, following weak decay, open vistas on the charmed baryon spectrum and new channels to study CP violation; confirmation or refutation of the deviation from pQCD of the pion transition form factor, by extending the Q2 reach of current analysis; and possibly reaching the threshold for the production of triply charmed baryons. If, in addition, the future colliders can be later upgraded to 12.5GeV, then the possibility of copious production of B_c bar B_c pairs opens, entailing new studies of CP violation and improved, independent tests of the CKM picture (through determination of V bc , and of effective theories for heavy quarks.

  7. Emergence of 16S rRNA methylase-producing Acinetobacter baumannii and Pseudomonas aeruginosa isolates in hospitals in Vietnam

    PubMed Central

    2013-01-01

    Background 16S rRNA methylase-producing Gram-negative bacteria are highly resistant to all clinically important aminoglycosides. We analyzed clinical strains of 16S rRNA methylase-producing Acinetobactor baumannii and Pseudomonas aeruginosa obtained from clinical isolates in medical settings in Vietnam. Methods From 2008 to 2011, 101 clinical strains of A. baumannii and 15 of P. aeruginosa were isolated from patients in intensive care units (ICUs) in two medical settings in Vietnam. Antimicrobial susceptibilities were determined using the microdilution method and epidemiological analysis was performed by pulsed-field gel electrophoresis and MLST. Genes encoding the 16S rRNA methylases, OXAs and CTX-Ms were analyzed by PCR and sequence analysis. Results 16S rRNA methylase-producing Gram-negative pathogens were detected in two hospitals in Vietnam. Of the 101 clinical isolates of A. baumannii and the 15 of P. aeruginosa isolated from two ICUs in these hospitals, 72 (71.3%) were highly resistant to amikacin, arbekacin and gentamicin, with MICs greater than 1,024 mg/L. The 16S rRNA methylases ArmA and RmtB were produced by 61 and 9 isolates of A. baumannii, respectively, and RmtB was produced by 2 isolates of P. aeruginosa. Moreover, 52 of the A. baumannii isolates producing 16S rRNA methylases harbored both blaOXA-23-like and blaOXA-51-like genes. Most A. baumannii isolates producing 16S rRNA methylase obtained in hospital A in Hanoi were ST91 and ST231, whereas most from hospital B in Ho Chi Minh City were ST136, ST195, and ST254. The two P. aeruginosa isolates harboring rmtB showed different patterns on PFGE, one each corresponding to ST217 and ST313. Conclusions Gram-negative bacteria producing the 16S rRNA methylases ArmA and RmtB are emerging in medical settings in Vietnam. A. baumannii isolates in northern and southern regions of Vietnam may be of different lineages. PMID:23721359

  8. Assessing the Fecal Microbiota: An Optimized Ion Torrent 16S rRNA Gene-Based Analysis Protocol

    PubMed Central

    Foroni, Elena; Duranti, Sabrina; Turroni, Francesca; Lugli, Gabriele Andrea; Sanchez, Borja; Martín, Rebeca; Gueimonde, Miguel; van Sinderen, Douwe; Margolles, Abelardo; Ventura, Marco

    2013-01-01

    Assessing the distribution of 16S rRNA gene sequences within a biological sample represents the current state-of-the-art for determination of human gut microbiota composition. Advances in dissecting the microbial biodiversity of this ecosystem have very much been dependent on the development of novel high-throughput DNA sequencing technologies, like the Ion Torrent. However, the precise representation of this bacterial community may be affected by the protocols used for DNA extraction as well as by the PCR primers employed in the amplification reaction. Here, we describe an optimized protocol for 16S rRNA gene-based profiling of the fecal microbiota. PMID:23869230

  9. Cloning, in vitro transcription, and biological activity of Escherichia coli 23S ribosomal RNA.

    PubMed

    Weitzmann, C J; Cunningham, P R; Ofengand, J

    1990-06-25

    The 23S rRNA gene was excised from the rrnB operon of pKK3535 and ligated into pUC19 behind the strong class III T7 promoter so that the correct 5' end of mature 23S RNA was produced upon transcription by T7 RNA polymerase. At the 3' end, generation of a restriction site for linearization required the addition of 2 adenosine residues to the mature 23S sequence. In vitro runoff transcripts were indistinguishable from natural 23S RNA in size on denaturing gels and in 5'-terminal sequence. The length and sequence of the 3' terminal T1 fragment was also as expected from the DNA sequence, except that an additional C, A, or U residue was added to 21%, 18%, or 5% of the molecules, respectively. Typical transcription reactions yielded 500-700 moles RNA per mole template. This transcript was used as a substrate for methyl transfer from S-adenosyl methionine catalyzed by Escherichia coli cell extracts. The majority (50-65%) of activity observed in a crude (S30) extract appeared in the post-ribosomal supernatant (S100). Activities catalyzing formation of m5C, m5U, m2G, and m6A residues in the synthetic transcript were observed. PMID:2194163

  10. Leucine-rich pentatricopeptide-repeat containing protein regulates mitochondrial transcription.

    PubMed

    Sondheimer, Neal; Fang, Ji-Kang; Polyak, Erzsebet; Falk, Marni J; Avadhani, Narayan G

    2010-09-01

    Mitochondrial function depends upon the coordinated expression of the mitochondrial and nuclear genomes. Although the basal factors that carry out the process of mitochondrial transcription are known, the regulation of this process is incompletely understood. To further our understanding of mitochondrial gene regulation, we identified proteins that bound to the previously described point of termination for the major mRNA-coding transcript H2. One was the leucine-rich pentatricopeptide-repeat containing protein (LRPPRC), which has been linked to the French-Canadian variant of Leigh syndrome. Cells with reduced expression of LRPPRC had a reduction in oxygen consumption. The expression of mitochondrial mRNA and tRNA was dependent upon LRPPRC levels, but reductions in LRPPRC did not affect the expression of mitochondrial rRNA. Reduction of LRPPRC levels interfered with mitochondrial transcription in vitro but did not affect the stability of mitochondrial mRNAs or alter the expression of nuclear genes responsible for mitochondrial transcription in vivo. These findings demonstrate the control of mitochondrial mRNA synthesis by a protein that has an established role in regulating nuclear transcription and a link to mitochondrial disease. PMID:20677761

  11. Intragenomic heterogeneity of the 16S rRNA gene in strain UFO1 caused by a 100-bp insertion in helix 6

    SciTech Connect

    Allison E. Ray; Stephanie A. Connon; Peter P. Sheridan; Jeremy Gilbreath; Malcolm S. Shields; Deborah T. Newby; Yoshiko Fujita; Timothy S. Magnuson

    2010-06-01

    The determination of variation in 16S rRNA gene sequences is perhaps the most common method for assessing microbial community diversity. However, the occurrence of multiple copies of 16S rRNA genes within some organisms can bias estimates of microbial diversity. During phylogenetic characterization of a metal-transforming, fermentative bacterium (strain UFO1) isolated from the Field Research Center (FRC) in Oak Ridge, TN, we detected an apparent 16S rRNA pseudogene. The putative 16S rRNA pseudogene was first detected in clone libraries constructed with 16S rRNA genes amplified from UFO1 genomic DNA. Sequencing revealed two distinct 16S rRNA genes, with one differing from the other by a 100 bp insert near the 5’ end. Ribosomal RNA was extracted from strain UFO1 and analyzed by RT-qPCR with insert and non-insert specific primers; however, only the non-insert 16S rRNA sequence was expressed. Reverse-transcribed rRNA from strain UFO1 was also used to construct a cDNA library. Of 190 clones screened by PCR, none contained the 16S rRNA gene with the 100 bp insert. Examination of GenBank 16S rRNA gene sequences revealed that the same insert sequence was present in other clones, including those from an environmental library constructed from FRC enrichments. These findings demonstrate the existence of widely disparate copies of the 16S rRNA gene in the same species and a putative 16S rRNA pseudogene, which may confound 16S rRNA-based methods for assessments of microbial diversity in environmental samples.

  12. RNA polymerase and the regulation of transcription

    SciTech Connect

    Reznikoff, W.S.; Gross, C.A.; Burgess, R.R.; Record, M.T.; Dahlberg, J.E.; Wickens, M.P.

    1987-01-01

    This book consists of eight sections, each containing several papers. The section titles are: RNA Polymerases; Transcription Initiation - Bacterial; Regulation of Bacterial Transcription Initiation; Stable RNA Synthesis in Eukaryotes: Chromatin Structure; Promoters; Enhancers; and the Global Control of Eukaryotic Transcription; Specific Eukaryotic Transcription Factors; Termination of Transcription; and Short Communications.

  13. The influence of soil pH on the diversity, abundance and transcriptional activity of ammonia oxidizing archaea and bacteria.

    PubMed

    Nicol, Graeme W; Leininger, Sven; Schleper, Christa; Prosser, James I

    2008-11-01

    Autotrophic ammonia oxidation occurs in acid soils, even though laboratory cultures of isolated ammonia oxidizing bacteria fail to grow below neutral pH. To investigate whether archaea possessing ammonia monooxygenase genes were responsible for autotrophic nitrification in acid soils, the community structure and phylogeny of ammonia oxidizing bacteria and archaea were determined across a soil pH gradient (4.9-7.5) by amplifying 16S rRNA and amoA genes followed by denaturing gradient gel electrophoresis (DGGE) and sequence analysis. The structure of both communities changed with soil pH, with distinct populations in acid and neutral soils. Phylogenetic reconstructions of crenarchaeal 16S rRNA and amoA genes confirmed selection of distinct lineages within the pH gradient and high similarity in phylogenies indicated a high level of congruence between 16S rRNA and amoA genes. The abundance of archaeal and bacterial amoA gene copies and mRNA transcripts contrasted across the pH gradient. Archaeal amoA gene and transcript abundance decreased with increasing soil pH, while bacterial amoA gene abundance was generally lower and transcripts increased with increasing pH. Short-term activity was investigated by DGGE analysis of gene transcripts in microcosms containing acidic or neutral soil or mixed soil with pH readjusted to that of native soils. Although mixed soil microcosms contained identical archaeal ammonia oxidizer communities, those adapted to acidic or neutral pH ranges showed greater relative activity at their native soil pH. Findings indicate that different bacterial and archaeal ammonia oxidizer phylotypes are selected in soils of different pH and that these differences in community structure and abundances are reflected in different contributions to ammonia oxidizer activity. They also suggest that both groups of ammonia oxidizers have distinct physiological characteristics and ecological niches, with consequences for nitrification in acid soils. PMID:18707610

  14. Dynein Light Chain LC8 Is Required for RNA Polymerase I-Mediated Transcription in Trypanosoma brucei, Facilitating Assembly and Promoter Binding of Class I Transcription Factor A

    PubMed Central

    Kirkham, Justin K.; Park, Sung Hee; Nguyen, Tu N.; Lee, Ju Huck

    2015-01-01

    Dynein light chain LC8 is highly conserved among eukaryotes and has both dynein-dependent and dynein-independent functions. Interestingly, LC8 was identified as a subunit of the class I transcription factor A (CITFA), which is essential for transcription by RNA polymerase I (Pol I) in the parasite Trypanosoma brucei. Given that LC8 has never been identified with a basal transcription factor and that T. brucei relies on RNA Pol I for expressing the variant surface glycoprotein (VSG), the key protein in antigenic variation, we investigated the CITFA-specific role of LC8. Depletion of LC8 from mammalian-infective bloodstream trypanosomes affected cell cycle progression, reduced the abundances of rRNA and VSG mRNA, and resulted in rapid cell death. Sedimentation analysis, coimmunoprecipitation of recombinant proteins, and bioinformatic analysis revealed an LC8 binding site near the N terminus of the subunit CITFA2. Mutation of this site prevented the formation of a CITFA2-LC8 heterotetramer and, in vivo, was lethal, affecting assembly of a functional CITFA complex. Gel shift assays and UV cross-linking experiments identified CITFA2 as a promoter-binding CITFA subunit. Accordingly, silencing of LC8 or CITFA2 resulted in a loss of CITFA from RNA Pol I promoters. Hence, we discovered an LC8 interaction that, unprecedentedly, has a basal function in transcription. PMID:26459761

  15. Structural and functional exchangeability of 5 S RNA species from the eubacterium E.coli and the thermoacidophilic archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Teixidò, J; Altamura, S; Londei, P; Amils, R

    1989-01-01

    The role of 5 S RNA within the large ribosomal subunit of the extremely thermophilic archaebacterium Sulfolobus solfataricus has been analysed by means of in vitro reconstitution procedures. It is shown that Sulfolobus 50 S subunits reconstituted in the absence of 5 S RNA are inactive in protein synthesis and lack 2-3 ribosomal proteins. Furthermore, it has been determined that in the course of the in vitro assembly process Sulfolobus 5 S RNA can be replaced by the correspondent RNA species of E.coli; Sulfolobus reconstituted particles containing the eubacterial 5 S molecule are stable and active in polypeptide synthesis at high temperatures. Images PMID:2493632

  16. Transcript-based Cloning of RRP46, a Regulator of rRNA Processing and R-Gene-Independent Cell Death in Barley–Powdery Mildew Interactions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Programmed cell death (PCD) plays a pivotal role in plant development and defense. To investigate the degree of interaction between PCD and R-gene mediated defense, we used the 22K Barley1 GeneChip to compare and contrast time-course expression profiles of Blumeria graminis f. sp. hordei (Bgh) chal...

  17. RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility

    PubMed Central

    Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

    2015-01-01

    Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmAII enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmAII, rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmAII in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmAII activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmAII, thereby facilitating TEL binding to the ribosome. PMID:26365244

  18. Comparative Studies of 5S rDNA Profiles and Cyt b Sequences in two Onychostoma Species (Cyprinidae)

    PubMed Central

    Han, Chiao-Chuan; Yen, Tsair-Bor; Chen, Nian-Cih; Tseng, Mei-Chen

    2015-01-01

    Onychostoma barbatulum and O. alticorpus, two primarily freshwater cyprinid fish, have similar morphological characters and partially overlapping ecological habitats. In order to explore the genetic differences between these two species, chromosomal characteristics and genetic variations were examined by fluorescence in situ hybridization (FISH) of 5S rDNA and cytochrome (Cyt) b gene analysis. Ten specimens of O. barbatulum and O. alticorpus were collected from the Nanzihsian Stream in southern Taiwan. FISH revealed that the 5S rDNA loci of O. barbatulum and O. alticorpus were found at a pericentromeric and subtelomeric position, respectively, in a pair of submetacentric chromosomes. Cyt b genes were amplified and sequenced from five individuals of each species. Intraspecific genetic distances ranged from 0.001–0.004 in O. barbatulum and from 0.001–0.006 in O. alticorpus. Genetic distances between these two species ranged from 0.132–0.142. The phylogenetic tree showed these two species are not sister species. In conclusion, FISH cytogenetic information and Cyt b gene analyses indicated that these two species have significantly different genetic characteristics; nevertheless, their morphological similarities may be due to environmental adaptation. PMID:26690426

  19. Li(V0.5Ti0.5)S2 as a 1 V lithium intercalation electrode

    NASA Astrophysics Data System (ADS)

    Clark, Steve J.; Wang, Da; Armstrong, A. Robert; Bruce, Peter G.

    2016-03-01

    Graphite, the dominant anode in rechargeable lithium batteries, operates at ~0.1 V versus Li+/Li and can result in lithium plating on the graphite surface, raising safety concerns. Titanates, for example, Li4Ti5O12, intercalate lithium at~1.6 V versus Li+/Li, avoiding problematic lithium plating at the expense of reduced cell voltage. There is interest in 1 V anodes, as this voltage is sufficiently high to avoid lithium plating while not significantly reducing cell potential. The sulfides, LiVS2 and LiTiS2, have been investigated as possible 1 V intercalation electrodes but suffer from capacity fading, large 1st cycle irreversible capacity or polarization. Here we report that the 50/50 solid solution, Li1+x(V0.5Ti0.5)S2, delivers a reversible capacity to store charge of 220 mAhg-1 (at 0.9 V), 99% of theoretical, at a rate of C/2, retaining 205 mAhg-1 at C-rate (92% of theoretical). Rate capability is excellent with 200 mAhg-1 at 3C. C-rate is discharge in 1 h. Polarization is low, 100 mV at C/2. To the best of our knowledge, the properties/performances of Li(V0.5Ti0.5)S2 exceed all previous 1 V electrodes.

  20. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).

    PubMed

    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F

    2014-01-01

    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera. PMID:25501173

  1. Thickness-Dependent and Magnetic-Field-Driven Suppression of Antiferromagnetic Order in Thin V5S8 Single Crystals.

    PubMed

    Hardy, Will J; Yuan, Jiangtan; Guo, Hua; Zhou, Panpan; Lou, Jun; Natelson, Douglas

    2016-06-28

    With materials approaching the 2D limit yielding many exciting systems with intriguing physical properties and promising technological functionalities, understanding and engineering magnetic order in nanoscale, layered materials is generating keen interest. One such material is V5S8, a metal with an antiferromagnetic ground state below the Néel temperature TN ∼ 32 K and a prominent spin-flop signature in the magnetoresistance (MR) when H∥c ∼ 4.2 T. Here we study nanoscale-thickness single crystals of V5S8, focusing on temperatures close to TN and the evolution of material properties in response to systematic reduction in crystal thickness. Transport measurements just below TN reveal magnetic hysteresis that we ascribe to a metamagnetic transition, the first-order magnetic-field-driven breakdown of the ordered state. The reduction of crystal thickness to ∼10 nm coincides with systematic changes in the magnetic response: TN falls, implying that antiferromagnetism is suppressed; and while the spin-flop signature remains, the hysteresis disappears, implying that the metamagnetic transition becomes second order as the thickness approaches the 2D limit. This work demonstrates that single crystals of magnetic materials with nanometer thicknesses are promising systems for future studies of magnetism in reduced dimensionality and quantum phase transitions. PMID:27163511

  2. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    PubMed Central

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  3. 5S program to reduce change-over time on forming department (case study on CV Piranti Works temanggung)

    NASA Astrophysics Data System (ADS)

    Rosiana Dewi, Septika; Setiawan, Budi; P, Susatyo Nugroho W.

    2013-06-01

    Productivity is one aspect that determines the success of a company in the competitive world of business. There are seven main types of activities that do not have value-added in manufacturing processes such as overproduction, waiting time, transportation, excess inventory, unnecessary motion and defects. The whole activity is a waste (waste) that can cause harm to the Company. Therefore, in production activities is important to pay attention so that the objectives of production productivity can be achieved. Problems experienced by CV Piranti Works is a production target is not achieved resulting in a lost sale raises the cost of which can cause harm to the Company. From the analysis conducted major known cause of the problem is the length of time required for changeover. This is supported by the high non-value added activity in the changeover activities. Lean Manufacturing is an approach to make system more efficient by reducing waste. This study refers to the book compiled by Takashi Osada (2004) and several other references. In this research used method 5S (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) for the of forming departement. The purpose of this research is to design a work environment using the 5S method (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) and make arrangement of equipment and working tool cabinet design with TRIZ methods. From these results, is expected to eliminate or reduce of non-value added activity and improved the changeover time so as to meet production targets completion of the company.

  4. AthaMap, integrating transcriptional and post-transcriptional data

    PubMed Central

    Bülow, Lorenz; Engelmann, Stefan; Schindler, Martin; Hehl, Reinhard

    2009-01-01

    The AthaMap database generates a map of predicted transcription factor binding sites (TFBS) for the whole Arabidopsis thaliana genome. AthaMap has now been extended to include data on post-transcriptional regulation. A total of 403 173 genomic positions of small RNAs have been mapped in the A. thaliana genome. These identify 5772 putative post-transcriptionally regulated target genes. AthaMap tools have been modified to improve the identification of common TFBS in co-regulated genes by subtracting post-transcriptionally regulated genes from such analyses. Furthermore, AthaMap was updated to the TAIR7 genome annotation, a graphic display of gene analysis results was implemented, and the TFBS data content was increased. AthaMap is freely available at http://www.athamap.de/. PMID:18842622

  5. AthaMap, integrating transcriptional and post-transcriptional data.

    PubMed

    Bülow, Lorenz; Engelmann, Stefan; Schindler, Martin; Hehl, Reinhard

    2009-01-01

    The AthaMap database generates a map of predicted transcription factor binding sites (TFBS) for the whole Arabidopsis thaliana genome. AthaMap has now been extended to include data on post-transcriptional regulation. A total of 403,173 genomic positions of small RNAs have been mapped in the A. thaliana genome. These identify 5772 putative post-transcriptionally regulated target genes. AthaMap tools have been modified to improve the identification of common TFBS in co-regulated genes by subtracting post-transcriptionally regulated genes from such analyses. Furthermore, AthaMap was updated to the TAIR7 genome annotation, a graphic display of gene analysis results was implemented, and the TFBS data content was increased. AthaMap is freely available at http://www.athamap.de/. PMID:18842622

  6. Effects of Cr(III) and Cr(VI) on nitrification inhibition as determined by SOUR, function-specific gene expression and 16S rRNA sequence analysis of wastewater nitrifying enrichments.

    PubMed

    Kapoor, Vikram; Elk, Michael; Li, Xuan; Impellitteri, Christopher A; Santo Domingo, Jorge W

    2016-03-01

    The effect of Cr(III) and Cr(VI) on nitrification was examined with samples from nitrifying enrichment cultures using three different approaches: by measuring substrate (ammonia) specific oxygen uptake rates (SOUR), by using RT-qPCR to quantify the transcripts of functional genes involved in nitrification, and by analysis of 16S rRNA sequences to determine changes in structure and activity of the microbial communities. The nitrifying bioreactor was operated as a continuous reactor with a 24 h hydraulic retention time. The samples were exposed in batch vessels to Cr(III) (10-300 mg/L) and Cr(VI) (1-30 mg/L) for a period of 12 h. There was considerable decrease in SOUR with increasing dosages for both Cr(III) and Cr(VI), however Cr(VI) was more inhibitory than Cr(III). Based on the RT-qPCR data, there was reduction in the transcript levels of amoA and hao for increasing Cr(III) dosage, which corresponded well with the ammonia oxidation activity measured via SOUR. For Cr(VI) exposure, there was comparatively little reduction in amoA expression while hao expression decreased for 1-3 mg/L Cr(VI) and increased at 30 mg/L Cr(VI). While Nitrosomonas spp. were the dominant bacteria in the bioreactor, based on 16S rRNA sequencing, there was a considerable reduction in Nitrosomonas activity upon exposure to 300 mg/L Cr(III). In contrast, a relatively small reduction in activity was observed at 30 mg/L Cr(VI) loading. Our data that suggest that both Cr(III) and Cr(VI) were inhibitory to nitrification at concentrations near the high end of industrial effluent concentrations. PMID:26774300

  7. Cockayne syndrome protein A is a transcription factor of RNA polymerase I and stimulates ribosomal biogenesis and growth

    PubMed Central

    Koch, Sylvia; Garcia Gonzalez, Omar; Assfalg, Robin; Schelling, Adrian; Schäfer, Patrick; Scharffetter-Kochanek, Karin; Iben, Sebastian

    2014-01-01

    Mutations in the Cockayne syndrome A (CSA) protein account for 20% of Cockayne syndrome (CS) cases, a childhood disorder of premature aging and early death. Hitherto, CSA has exclusively been described as DNA repair factor of the transcription-coupled branch of nucleotide excision repair. Here we show a novel function of CSA as transcription factor of RNA polymerase I in the nucleolus. Knockdown of CSA reduces pre-rRNA synthesis by RNA polymerase I. CSA associates with RNA polymerase I and the active fraction of the rDNA and stimulates re-initiation of rDNA transcription by recruiting the Cockayne syndrome proteins TFIIH and CSB. Moreover, compared with CSA deficient parental CS cells, CSA transfected CS cells reveal significantly more rRNA with induced growth and enhanced global translation. A previously unknown global dysregulation of ribosomal biogenesis most likely contributes to the reduced growth and premature aging of CS patients. PMID:24781187

  8. Technical considerations in the use of 18s rRNA in gene expression studies

    EPA Science Inventory

    Gene expression analysis is now commonly used in ecotoxicological studies to indicate exposure of an organism to xenobiotics. For example, the vitellogenin gene is used to diagnose exposure of fish to environmental estrogens. Reverse transcription polymerase chain reaction (RT-PC...

  9. Defining the RNA polymerase III transcriptome: Genome-wide localization of the RNA polymerase III transcription machinery in human cells

    PubMed Central

    Canella, Donatella; Praz, Viviane; Reina, Jaime H.; Cousin, Pascal; Hernandez, Nouria

    2010-01-01

    Our view of the RNA polymerase III (Pol III) transcription machinery in mammalian cells arises mostly from studies of the RN5S (5S) gene, the Ad2 VAI gene, and the RNU6 (U6) gene, as paradigms for genes with type 1, 2, and 3 promoters. Recruitment of Pol III onto these genes requires prior binding of well-characterized transcription factors. Technical limitations in dealing with repeated genomic units, typically found at mammalian Pol III genes, have so far hampered genome-wide studies of the Pol III transcription machinery and transcriptome. We have localized, genome-wide, Pol III and some of its transcription factors. Our results reveal broad usage of the known Pol III transcription machinery and define a minimal Pol III transcriptome in dividing IMR90hTert fibroblasts. This transcriptome consists of some 500 actively transcribed genes including a few dozen candidate novel genes, of which we confirmed nine as Pol III transcription units by additional methods. It does not contain any of the microRNA genes previously described as transcribed by Pol III, but reveals two other microRNA genes, MIR886 (hsa-mir-886) and MIR1975 (RNY5, hY5, hsa-mir-1975), which are genuine Pol III transcription units. PMID:20413673

  10. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and relevance to genomovar assignment

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic variability in 16S rRNA gene sequences has been demonstrated among isolates of Flavobacterium columnare and a restriction fragment length polymorphism (RFLP) assay is available for genetic typing this important fish pathogen. Interpretation of restriction patterns can be difficult due to th...

  11. Functional importance of individual rRNA 2′-O-ribose methylations revealed by high-resolution phenotyping

    PubMed Central

    Esguerra, Jonathan; Warringer, Jonas; Blomberg, Anders

    2008-01-01

    Ribosomal RNAs contain numerous modifications at specific nucleotides. Despite their evolutionary conservation, the functional role of individual 2′-O-ribose methylations in rRNA is not known. A distinct family of small nucleolar RNAs, box C/D snoRNAs, guides the methylating complex to specific rRNA sites. Using a high-resolution phenotyping approach, we characterized 20 box C/D snoRNA gene deletions for altered growth dynamics under a wide array of environmental perturbations, encompassing intraribosomal antibiotics, inhibitors of specific cellular features, as well as general stressors. Ribosome-specific antibiotics generated phenotypes indicating different and long-ranging structural effects of rRNA methylations on the ribosome. For all studied box C/D snoRNA mutants we uncovered phenotypes to extraribosomal growth inhibitors, most frequently reflected in alteration in growth lag (adaptation time). A number of strains were highly pleiotropic and displayed a great number of sensitive phenotypes, e.g., deletion mutants of snR70 and snR71, which both have clear human homologues, and deletion mutants of snR65 and snR68. Our data indicate that individual rRNA ribose methylations can play either distinct or general roles in the workings of the ribosome. PMID:18256246

  12. Distinct Ectomycorrhizospheres Share Similar Bacterial Communities as Revealed by Pyrosequencing-Based Analysis of 16S rRNA Genes

    PubMed Central

    Oger, P.; Morin, E.; Frey-Klett, P.

    2012-01-01

    Analysis of the 16S rRNA gene sequences generated from Xerocomus pruinatus and Scleroderma citrinum ectomycorrhizospheres revealed that similar bacterial communities inhabited the two ectomycorrhizospheres in terms of phyla and genera, with an enrichment of the Burkholderia genus. Compared to the bulk soil habitat, ectomycorrhizospheres hosted significantly more Alpha-, Beta-, and Gammaproteobacteria. PMID:22307291

  13. Microbial rRNA: rDNA gene ratios may be unexpectedly low due to extracellular DNA preservation in soils

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We tested a method of estimating the activity of detectable individual bacterial and archaeal OTUs within a community by calculating ratios of absolute 16S rRNA to rDNA copy numbers. We investigated phylogenetically coherent patterns of activity among soil prokaryotes in non-growing soil communitie...

  14. Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

    NASA Technical Reports Server (NTRS)

    Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.

    1995-01-01

    Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

  15. 23S rRNA gene mutations contributing to macrolide resistance in Campylobacter jejuni and Campylobacter coli

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Operon specific 23S rRNA mutations affecting minimum inhibitory concentrations (MICs) of macrolides (erythromycin [ERY], azithromycin [AZM], tylosin [TYL]) and a lincosamide (clindamycin [CLI]) were examined in a collection of Campylobacter jejuni and C. coli isolates. The three copies of the Campy...

  16. Sequencing and characterization of full-length sequence of 18S rRNA gene from the reniform nematode

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Variation within this gene is rare but it has been observed in few metazoan species. For the first time, we h...

  17. Species Identification and Profiling of Complex Microbial Communities Using Shotgun Illumina Sequencing of 16S rRNA Amplicon Sequences

    PubMed Central

    Lay, Christophe; Ho, Eliza Xin Pei; Low, Louie; Hibberd, Martin Lloyd; Nagarajan, Niranjan

    2013-01-01

    The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequencing of the bacterial 16S rRNA gene, optimized to amplify more than 90% of sequences in the Greengenes database and with the ability to distinguish nearly twice as many species-level OTUs compared to existing protocols. Using several in silico and experimental datasets, we demonstrate that despite the presence of multiple variable and conserved regions, the resulting shotgun sequences can be used to accurately quantify the constituents of complex microbial communities. The reconstruction of a significant fraction of the 16S rRNA gene also enabled high precision (>90%) in species-level identification thereby opening up potential application of this approach for clinical microbial characterization. PMID:23579286

  18. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei

    PubMed Central

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K. Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit

    2016-01-01

    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts. PMID:27142987