Science.gov

Sample records for 6-keto pgf1 alpha

  1. Development and validation of a LC/MS/MS method for 6-keto PGF1α, a metabolite of prostacyclin (PGI₂).

    PubMed

    Chappell, Derek L; Xiao, Xiaoyao; Radziszewski, Waldemar; Laterza, Omar F

    2011-11-01

    A sensitive liquid chromatography/tandem mass spectrometry (LC/MS/MS) method was developed for the quantitation of 6-keto PGF(1α) in human urine and plasma. Prostacyclin (PGI(2)) is a locally acting prostanoid, which mediates vasorelaxation and inhibition of platelet aggregation. 6-Keto PGF(1α) is the most-immediate metabolite of PGI(2). Samples were spiked with an internal standard (6-keto PGF(1α)-d(4)), purified by immuno-affinity chromatography and selected reaction monitoring (SRM) was performed. Analytical validation of the 6-keto PGF(1α) assay was performed in urine. This included an assessment of assay precision, recovery, stability, sensitivity and linearity. Urinary 6-keto PGF(1α) concentrations were also correlated to urinary 2,3-dinor-6-keto PGF(1α) (PGIM) concentrations using urine samples collected from 16 healthy volunteers. The mean concentration of 6-keto PGF(1α) in urine (mean ± SD) was 92 ± 51 pg/ml or 168 ± 91 pg/mg creatinine. Overall, there was a statistically significant correlation between urinary 6-keto PGF(1α) and PGIM (r(2)=0.55, p ≤ 0.001; slope=2.7; y-intercept=130). However, PGIM was approximately 3-fold more abundant than 6-keto PGF(1α) in urine. In addition, 6-keto PGF(1α) concentrations were measured in EDTA plasma samples obtained from 7 healthy donors. The mean concentration of 6-keto PGF(1α) in plasma was 1.9 ± 0.8 pg/ml (± SD).

  2. Evaluation of plasma and urinary levels of 6-keto-prostaglandin F1alpha as a marker for asymptomatic myxomatous mitral valve disease in dogs.

    PubMed

    Rasmussen, Caroline E; Sundqvist, Anna V; Kjempff, Christina T; Tarnow, Inge; Kjelgaard-Hansen, Mads; Kamstrup, Thea S; Sterup, Anne-Lise; Soerensen, Tina M; Olsen, Lisbeth H

    2010-05-01

    Endothelial dysfunction might be involved in the pathogenesis of myxomatous mitral valve disease (MMVD). The aims of this study were (1) to validate an enzyme immunoassay (EIA) for canine 6-keto-prostaglandin (PG)F(1alpha) (prostacyclin metabolite and marker for endothelial function) and (2) to compare plasma and urinary 6-keto-PGF(1alpha) in dogs with asymptomatic MMVD. The study included two breeds predisposed to MMVD and two control groups (Cairn terriers and dogs of different breeds). Echocardiography was used to estimate the severity of MMVD. The intra- and inter-assay coefficients of variation were between 3.1% and 24.5% in the assay range. No echocardiographic parameter was correlated with plasma or urinary 6-keto-PGF(1alpha) (P>0.05), but all control dogs had lower urinary 6-keto-PGF(1alpha) (P<0.02) and the Cairn terriers had higher plasma 6-keto-PGF(1alpha) (P<0.02). The EIA appeared valid for measuring canine 6-keto-PGF(1alpha) in plasma and urine. It is suggested that 6-keto-PGF(1alpha) levels are related to breed and not MMVD in asymptomatic stages.

  3. Stimulation of the synthesis of 15-hydroxyeicosatetraenoic acid (15-HETE) and 6-keto-prostaglandin F/sub 1. cap alpha. / (6-keto-PGF/sub 1. cap alpha. /) by cultured human umbilical veins

    SciTech Connect

    Ibe, B.O.; Johnson, A.R.; Falck, J.R.; Campbell, W.B.

    1986-03-05

    These studies were designed to investigate the synthesis of 6-keto-PGF/sub 1..cap alpha../ and 15-HETE in cultured human endothelial cells. The identification of the 15-HETE in these cells was made by UV absorption and gas chromatography/mass spectrometry. Specific radioimmunoassays were developed to quantify the synthesized 6-keto-PGF/sub 1..cap alpha../ and 15-HETE. The release of 15-HETE and 6-keto-PGF/sub 1..cap alpha../ was stimulated by arachidonic acid, histamine or the calcium ionophore A23187. The release of 15-HETE paralleled the release of 6-keto-PGF/sub 1..cap alpha../ and was both concentration-related and time-dependent. Aspirin, ibuprofen and indomethacin inhibited both the formation of 6-keto-PGF/sub 1..cap alpha../ and 15-HETE in similar concentrations. These data indicate that agents which stimulate PGI/sub 2/ synthesis also stimulate the synthesis of 15-HETE. Also, they implicate the cyclooxygenase pathway in the synthesis of 6-keto PGF/sub 1..cap alpha../ and 15-HETE in human endothelial cells.

  4. Effect of phorbol ester on 6-keto PGF sup 1. alpha. production in aorta from control-salt and aldosterone-salt hypertensive rats

    SciTech Connect

    Jones, S.B.; Jones, A.W. )

    1991-03-11

    The authors have previously shown that norepinephrine (NE) stimulated 6-keto-PGF{sub 1{alpha}} and thromboxane B{sub 2}(TXB{sub 2}) production in aorta from control-salt (CSR) and aldosterone-salt hypertensive rats (AHR) through the alpha-1 adrenoceptor (A1AR). While there was no difference in NE-stimulated TXB{sub 2} production between CSR and AHR, 6-keto-PGF{sub 1{alpha}} production was attenuated in aorta from AHR compared tissues. The authors were interested in whether the source of the arachidonic acid (AA) metabolites was through direct coupling of the A1AR and PLA{sub 2} or secondary to activation of PLC. One approach to answering this question was to bypass the receptor and activate protein kinase-C (PKC) directly. PMA caused a time-dependent increase in both 6-keto-PGF{sub 1{alpha}} and TXB{sub 2}. The time course was much slower than NE-stimulated production of these metabolites, but the pattern was similar with TXB{sub 2} appearing before 6-keto-PGF{sub 1{alpha}}. The PMA concentration-response curves for 6-keto-PGF{sub 1{alpha}} production for CSR and AHR were nearly superimposable. Staurosporine inhibited PMA stimulated 6-keto-PGF{sub 1{alpha}} production in CSR and AHR with nearly equal potency. Thus, while activation of PKC results in increases in AA metabolites, alterations in this pathway do not appear to be responsible for the differences observed with NE-stimulated 6-keto-PGF{sub 1{alpha}} production. These data support the concept of direct coupling between the A1AR and PLA{sub 2} in vascular smooth muscle.

  5. Major urinary metabolites of 6-keto-prostaglandin F2α in mice.

    PubMed

    Kuklev, Dmitry V; Hankin, Joseph A; Uhlson, Charis L; Hong, Yu H; Murphy, Robert C; Smith, William L

    2013-07-01

    Western diets are enriched in omega-6 vs. omega-3 fatty acids, and a shift in this balance toward omega-3 fatty acids may have health benefits. There is limited information about the catabolism of 3-series prostaglandins (PG) formed from eicosapentaenoic acid (EPA), a fish oil omega-3 fatty acid that becomes elevated in tissues following fish oil consumption. Quantification of appropriate urinary 3-series PG metabolites could be used for noninvasive measurement of omega-3 fatty acid tone. Here we describe the preparation of tritium- and deuterium-labeled 6-keto-PGF2α and their use in identifying urinary metabolites in mice using LC-MS/MS. The major 6-keto-PGF2α urinary metabolites included dinor-6-keto-PGF2α (~10%) and dinor-13,14-dihydro-6,15-diketo-PGF1α (~10%). These metabolites can arise only from the enzymatic conversion of EPA to the 3-series PGH endoperoxide by cyclooxygenases, then PGI3 by prostacyclin synthase and, finally, nonenzymatic hydrolysis to 6-keto-PGF2α. The 6-keto-PGF derivatives are not formed by free radical mechanisms that generate isoprostanes, and thus, these metabolites provide an unbiased marker for utilization of EPA by cyclooxygenases.

  6. Urinary 11-dehydro-thromboxane B₂ and 2,3-dinor-6-keto-prostaglandin-F₁α in healthy post-menopausal and pre-menopausal women receiving aspirin 100 mg.

    PubMed

    Hartanto, Marcia Dewi; Arieselia, Zita; Setiabudy, Rianto; Setiawati, Arini; Baziad, Ali

    2012-07-01

    The prevalence of cardiovascular diseases in women increases sharply after menopause. In postmenopausal women, thromboxane production increases while prostacyclin decreases. Low dose aspirin reduces the production of both thromboxane and prostacyclin. The present study was an open-label clinical trial with two parallel groups of 15 premenopausal women and 15 postmenopausal women. Twenty-four hours urine was collected from each subject before and after aspirin 100 mg daily for 7 days. The concentration of thromboxane and prostacyclin was measured as their metabolites (11-dehydro-thromboxane B(2) and 2,3-dinor-6-keto-prostaglandin-F(1α)) in urine using enzyme immunoassay methods. This study showed that aspirin significantly reduced thromboxane in both groups with significantly larger percentage reduction in postmenopausal women compared to premenopausal women (73.32 vs. 61.13%, p = 0.021). This study also showed that aspirin reduced prostacyclin significantly in both groups, but the percentage reduction between the groups was not significantly different. The decrease in the ratio of 11-dTXB(2)/2,3-dinor-6-keto-PGF(1α) should be compared to assess aspirin efficacy as an antithrombotic. Calculation of the ratio of 11-dTXB(2)/2,3-dinor-6-keto-PGF(1α) before aspirin consumption was higher in postmenopausal women than in premenopausal women. The decrease in 11-dTXB(2)/2,3-dinor-6-keto-PGF(1α) ratio by aspirin was greater in postmenopausal women than in premenopausal women (1.91 vs. 0.17; p = 0.022). It was concluded that aspirin reduced thromboxane and prostacyclin significantly in each group with significant 11-dTXB(2) percentage reduction between groups and non-significant 2,3-dinor-6-keto-PGF(1α) percentage reduction between groups, but reduced the 11-dTXB(2)/2,3-dinor-6-keto-PGF(1α) ratio much larger in postmenopausal women compared to that in premenopausal women.

  7. Urinary 11-dehydro-thromboxane B₂ and 2,3-dinor-6-keto-prostaglandin-F₁α in healthy post-menopausal and pre-menopausal women receiving aspirin 100 mg.

    PubMed

    Hartanto, Marcia Dewi; Arieselia, Zita; Setiabudy, Rianto; Setiawati, Arini; Baziad, Ali

    2012-07-01

    The prevalence of cardiovascular diseases in women increases sharply after menopause. In postmenopausal women, thromboxane production increases while prostacyclin decreases. Low dose aspirin reduces the production of both thromboxane and prostacyclin. The present study was an open-label clinical trial with two parallel groups of 15 premenopausal women and 15 postmenopausal women. Twenty-four hours urine was collected from each subject before and after aspirin 100 mg daily for 7 days. The concentration of thromboxane and prostacyclin was measured as their metabolites (11-dehydro-thromboxane B(2) and 2,3-dinor-6-keto-prostaglandin-F(1α)) in urine using enzyme immunoassay methods. This study showed that aspirin significantly reduced thromboxane in both groups with significantly larger percentage reduction in postmenopausal women compared to premenopausal women (73.32 vs. 61.13%, p = 0.021). This study also showed that aspirin reduced prostacyclin significantly in both groups, but the percentage reduction between the groups was not significantly different. The decrease in the ratio of 11-dTXB(2)/2,3-dinor-6-keto-PGF(1α) should be compared to assess aspirin efficacy as an antithrombotic. Calculation of the ratio of 11-dTXB(2)/2,3-dinor-6-keto-PGF(1α) before aspirin consumption was higher in postmenopausal women than in premenopausal women. The decrease in 11-dTXB(2)/2,3-dinor-6-keto-PGF(1α) ratio by aspirin was greater in postmenopausal women than in premenopausal women (1.91 vs. 0.17; p = 0.022). It was concluded that aspirin reduced thromboxane and prostacyclin significantly in each group with significant 11-dTXB(2) percentage reduction between groups and non-significant 2,3-dinor-6-keto-PGF(1α) percentage reduction between groups, but reduced the 11-dTXB(2)/2,3-dinor-6-keto-PGF(1α) ratio much larger in postmenopausal women compared to that in premenopausal women. PMID:22311294

  8. Pro Atrial Natriuretic Peptide (1-30) and 6-keto PGF1α Activity Affects Na(+) Homeostasis in Non-modulating Hypertension.

    PubMed

    Sanchez, Ramiro A; Gilbert, Bernardo H; Masnatta, Lucas; Giannone, Carlos; Pesiney, Carlina; Ramirez, Agustin J

    2015-01-01

    Non-modulating hypertension (NMHT) is a high renin subtype of salt sensitive hypertension, which fails to achieve renal vasodilatation and a correct Na(+) handling during sodium load. We investigate, in MHT and NMHT, the role of ANP, the renin-angiotensin system and PgI2, in the renal sodium handling mechanisms. After 10 days of low (20mmol.L) or after 72hs of high (250mmol.L) sodium intake, 13 NMHT (34±5y; 9 male) and 13 MHT (32±4y; 10male) were studied. Pro-ANP (1-30) PgI2, PRA and total exchangeable Na(+)24 (ENa(+)) were measured. Under low sodium intake, PRA (4.2±0.5ng.ml.h; p<0.05) and Pro-ANP (78.6±2pg/ml, p<0.05) were higher than in NMHT under (3.1±0.4ng.ml.h and 69.8±3 pg/ml). After 72h of high Na(+) intake, Pro-ANP (1-30) increased significantly only in MHT (82.1±3pg/ml, p<0.05). PgI2, under low sodium intake (1.83±0.2pg/24h), increased in MHT after 72h under high sodium (2.58±0.5pg/ 24h, p<0.02). Under low sodium diet, PgI2 (2.16±0.11pg/24h) was as higher in NMHT, as in MHT. After 72h under high Na+ intake, it failed to show any change (2.61±0.36 pg/24h; p=ns). A significant correlation between variations in ENa(+) and mean blood pressure (r=0.50, p<0.01), variations in Pro-ANP (1-30) values and ENa(+) in MHT (r=0.95; p<0.001) while a negative correlation between ENa(+) variations and ENa(+) (r=0.81, p<0.05) was observed in NMHT. ENa(+) variations were only significantly related to variations in FF in MHT. Thus, in NMHT, there is an unbalanced relationship between vasonstrictor and vasodilator mediators. From these, as an extrarenal homeostatic mediator, ANP seems to play an important role to compensate the altered renal sodium handling.

  9. PGI2 synthesis and excretion in dog kidney: evidence for renal PG compartmentalization

    SciTech Connect

    Boyd, R.M.; Nasjletti, A.; Heerdt, P.M.; Baer, P.G.

    1986-01-01

    To assess the concept of compartmentalization of renal prostaglandins (PG), we compared entry of PGE2 and the PGI2 metabolite 6-keto-PGF1 alpha into the renal vascular and tubular compartments, in sodium pentobarbital-anesthetized dogs. Renal arterial 6-keto-PGF1 alpha infusion increased both renal venous and urinary 6-keto-PGF1 alpha outflow. In contrast, renal arterial infusion of arachidonic acid (AA) or bradykinin (BK) increased renal venous 6-keto-PGF1 alpha outflow but had no effect on its urinary outflow. Both urinary and renal venous PGE2 outflows increased during AA or BK infusion. Ureteral stopped-flow studies revealed no postglomerular 6-keto-PGF1 alpha entry into tubular fluid. During renal arterial infusion of (3H)PGI2 and inulin, first-pass 3H clearance was 40% of inulin clearance; 35% of urinary 3H was 6-keto-PGF1 alpha, and two other urinary metabolites were found. During renal arterial infusion of (3H)6-keto-PGF1 alpha and inulin, first-pass 3H clearance was 150% of inulin clearance; 75% of urinary 3H was 6-keto-PGF1 alpha, and only one other metabolite was found. We conclude that in the dog PGE2 synthesized in the kidney enters directly into both the renal vascular and tubular compartments, but 6-keto-PGF1 alpha of renal origin enters directly into only the renal vascular compartment.

  10. Varying levels of 6-keto-prostaglandin F1α and thromboxane B2 in serum and endothelialization and hyperplasia in small-diameter grafts seeded with CD34+ bone marrow cells in canines.

    PubMed

    Lian, Weishuai; Zhang, Huayi; Wang, Kun; Jiang, Junhao; Su, Zijie; Yu, Zhenhai

    2014-05-01

    The aim of the present study was to investigate the serum levels of 6-keto-prostaglandin (PG)F1α and thromboxane (TX)B2, as well as the endothelialization and hyperplasia of polytetrafluoroethylene (PTFE) and Dacron prostheses seeded with CD34+ cells in medium-term observation. A total of 24 crossbred dogs were randomly distributed into PTFE or Dacron groups. CD34+ cells were isolated from bone marrow aspirate and collected using an immunomagnetic bead-based system. The PTFE or Dacron prostheses were implanted into the abdominal aortic artery and inferior vena cava of the dogs. In each group, 8 dogs were implanted with prostheses that had been seeded with CD34+ cells, while 4 dogs were implanted with prostheses that had been seeded with autogenous blood as a control. Serum concentrations of 6-keto-PGF1α and TXB2 were determined at days 0, 10, 30 and 60 following surgery. The grafts were removed and examined at days 10, 30, 60 and 100 following surgery. Finally, CD34 factor staining was used to identify endothelial cells, while light and electron microscopy were applied to examine endothelialization and patency. The results revealed that confluent endothelial cells appeared on the neointima of prostheses seeded with CD34+ cells at day 30 following surgery. In the control groups compared with the experimental groups, there were fewer endothelial cells and the neointima was significantly thicker in the arterial (PTFE, 174±1.41 vs. 117±2.83 μm, respectively; P=0.001; Dacron, 187.5±3.5 vs. 100±1.41 μm, respectively; P<0.001) and venous (PTFE, 230.5±6.36 vs. 135±5.66 μm, respectively; P=0.001; Dacron, 249±2.83 vs. 121.5±3.54 μm, respectively; P<0.001) prostheses. In the experimental groups, intimal hyperplasia in the venous prostheses (PTFE, 135±5.66 μm; Dacron, 121.5±3.54 μm) was more severe compared with that in the arterial prostheses (PTFE, 117±2.83 μm; Dacron, 100±1.41 μm) at day 60. Compared with the 6-keto-PGF1α concentrations in the

  11. Determination of 6-keto prostaglandin F1α and its metabolites in human plasma by LC-MS/MS.

    PubMed

    Enzler, Mark; Schipp, Stefan; Nicolas, Laurent B; Dingemanse, Jasper; Siethoff, Christoph

    2012-07-15

    An HPLC-MS/MS method was developed and validated for the quantification of 6-keto prostaglandin F1α, the stable hydrolysis product of prostacyclin, and its metabolites 2,3-dinor-6-keto prostaglandin F1α and 6,15-diketo-13,14-dihydro prostaglandin F1α in human plasma. For sample preparation, a solid phase extraction step was combined with a column switching approach for analytes enrichment and further sample clean-up of the processed sample. The assay was validated in the concentration range 50.0-5000 pg/mL for 6-keto prostaglandin F1α and 6,15-diketo-13,14-dihydro prostaglandin F1α, and 100-10,000 pg/mL for 2,3-dinor-6-keto prostaglandin F1α. The inter-batch precision was better than 12.7%, 9.2%, and 9.4% for 6-keto prostaglandin F1α, 2,3-dinor-6-keto prostaglandin F1α, and 6,15-diketo-13,14-dihydro prostaglandin F1α, respectively. The inter-batch accuracy was between 97.3% and 100.8% for 6-keto prostaglandin F1α, between 97.5% and 103.0% for 2,3-dinor-6-keto prostaglandin F1α, and between 92.0% and 100.0% for 6,15-diketo-13,14-dihydro prostaglandin F1α. Further it has been demonstrated that the analytes were stable in plasma for 20 h at room temperature, during three freeze-and-thaw cycles, for 96 days at -25 °C storage temperature, and 50h in the autosampler tray at room temperature.

  12. Angiotensin II-induced hypertension in the rat. Effects on the plasma concentration, renal excretion, and tissue release of prostaglandins.

    PubMed Central

    Diz, D I; Baer, P G; Nasjletti, A

    1983-01-01

    We examined in rats the effects of intraperitoneal angiotensin II (AII) infusion for 12 d on urinary excretion, plasma concentration, and in vitro release of prostaglandin (PG) E2 and 6-keto-PGF1 alpha, a PGI2 metabolite. AII at 200 ng/min increased systolic blood pressure (SBP) progressively from 125 +/- 3 to 170 +/- 9 mmHg (P less than 0.01) and elevated fluid intake and urine volume. Urinary 6-keto-PGF1 alpha excretion increased from 38 +/- 6 to 55 +/- 5 and 51 +/- 7 ng/d (P less than 0.05) on days 8 and 11, respectively, of AII infusion, but urinary PGE2 excretion did not change. Relative to a control value of 129 +/- 12 pg/ml in vehicle-infused (V) rats, arterial plasma 6-keto-PGF1 alpha concentration increased by 133% (P less than 0.01) with AII infusion. Aortic rings from AII-infused rats released more 6-keto-PGF1 alpha (68 +/- 7 ng/mg) during 15-min incubation in Krebs solution than did rings from V rats (40 +/- 3 ng/mg); release of PGE2, which was less than 1% of that of 6-keto-PGF1 alpha, was also increased. Slices of inner renal medulla from AII-infused rats released more 6-keto-PGF1 alpha (14 +/- 1 ng/mg) during incubation than did slices from V rats (8 +/- 1 ng/mg, P less than 0.05), but PGE2 release was not altered. In contrast, AII infusion did not alter release of 6-keto-PGF1 alpha or PGE2 from inferior vena cava segments or from renal cortex slices. Infusion of AII at 125 ng/min also increased SBP, plasma 6-keto-PGF1 alpha concentration, and in vitro release of 6-keto-PGF1 alpha from rings of aorta and renal inner medulla slices; at 75 ng/min AII had no effect. SBP on AII infusion day 11 correlated positively with both 6-keto-PGF1 alpha plasma concentration (r = 0.54) and net aortic ring release (r = 0.70) when data from all rats were combined. We conclude that augmentation of PGI2 production is a feature of AII-induced hypertension. The enhancement of PGI2 production may be an expression of nonspecific alteration in vascular structure and

  13. Functional significance of renal prostacyclin and thromboxane A2 production in patients with systemic lupus erythematosus.

    PubMed Central

    Patrono, C; Ciabattoni, G; Remuzzi, G; Gotti, E; Bombardieri, S; Di Munno, O; Tartarelli, G; Cinotti, G A; Simonetti, B M; Pierucci, A

    1985-01-01

    We have examined the urinary excretion of stable immunoreactive eicosanoids in 23 female patients with systemic lupus erythematosus (SLE), 16 patients with chronic glomerular disease (CGD), and 20 healthy women. SLE patients had significantly higher urinary thromboxane B2 (TXB2) and prostaglandin (PG) E2 excretion and significantly lower 6-keto-PGF1 alpha than did healthy women. In contrast, CGD patients only differed from controls for having reduced 6-keto-PGF1 alpha excretion. The group of SLE patients with active renal lesions differed significantly from the group with inactive lesions for having a lower creatinine clearance and urinary 6-keto-PGF1 alpha and higher urinary TXB2. Higher urinary TXB2 excretion was associated with comparable platelet TXB2 production in whole blood, undetectable TXB2 in peripheral venous blood, and unchanged urinary excretion of 2,3-dinor-TXB2. A significant inverse correlation was found between urinary TXB2 and creatinine clearance rate (CCr). In contrast, the urinary excretion of 6-keto-PGF1 alpha showed a significant linear correlation with both CCr and para-aminohippurate clearance rate (CPAH). In four SLE and seven CGD patients, inhibition of renal cyclooxygenase activity by ibuprofen was associated with a significant reduction in urinary 6-keto-PGF1 alpha and TXB2 and in both CCr and CPAH. However, the average decrease in both clearances was 50% lower in SLE patients than in CGD patients, when fractionated by the reduction in urinary 6-keto-PGF1 alpha or PGE2 excretion. We conclude that the intrarenal synthesis of PGI2 and TXA2 is specifically altered in SLE. Such biochemical alterations are associated with changes in glomerular hemodynamics and may play a role in the progression of SLE nephropathy. PMID:3900132

  14. Decreased prostacyclin production in the infant of the diabetic mother

    SciTech Connect

    Stuart, M.J.; Sunderji, S.G.; Allen, J.B.

    1981-09-01

    Maternal diabetes mellitus is recognized to be a predisposing factor to thrombosis in the neonate. In the adult with diabetes, abnormalities in the metabolism of AA by the platelet and vessel wall occur, which result in an increase in proaggregatory platelet thromboxane A2. A decrease in antiaggregatory vascular PGI2 has been demonstrated in the diabetic rat, although conclusive proof of a similar abnormality is lacking in humans. We evaluated vascular AA metabolism in 10 IDM (groups II and III comparison to 20 control neonates of gestational ages 32 to 40 weeks (group I). Mean uptakes of labeled AA into vascular tissue of both controls and IDM were similar. The conversion of (14C) AA to 6-keto-PGF1 alpha was not dependent on gestational age (r . 0.223) in the control neonates, with a mean value of 5.2% +- 1.3 (1 S.D.). A marked decrease (p less than 0.001) in 6-keto-PGF1 alpha formation to 1.7% +- 0.3 was found in the group II IDM of mothers with poor diabetic control (HbA1c . 9.3% +- 0.5). In the group III neonates whose mothers had normal HBA1c levels (6.1% +- 0.9), 6-keto-PGF1 alpha production was normal at 4.9% +- 0.8. Although no correlation between maternal fasting blood glucose and neonatal 6-keto-PGF1 alpha was demonstrable, a significant inverse correlation (r . 0.872; p less than 0.02) was observed between maternal HbA1c levels and the conversion of AA to 6-keto-PGF1 alpha in the vascular tissues of the IDM. It appear possible that abnormalities in platelet-vascular AA metabolism may play an etiologic role in the vascular complications present in some IDM.

  15. Effect of tienoxolol, a new diuretic beta-blocking agent, on urinary prostaglandin excretion in the rat.

    PubMed Central

    Caussade, F.; Cloarec, A.

    1993-01-01

    1. The effects of tienoxolol, (ethyl 2-[3-[(1,1-dimethylethyl)amino]-2-hydroxypropoxy]-5- [(2-thienylcarbonyl) amino] benzoate, hydrochloride), a novel drug exhibiting both diuretic and beta-adrenoceptor blocking properties, were investigated on urinary 6-keto-prostaglandin F1 alpha (6-keto-PGF1 alpha) and PGE2 excretion in the rat and compared to those of reference diuretic (furosemide) and beta-adrenoceptor antagonists (acebutolol, propranolol). Since tienoxolol was shown to bind to A1 and A2 adenosine receptors, the action of theophylline was also evaluated. 2. Tienoxolol (8-128 mg kg-1, p.o.) induced a dose-related increase of 6-keto-PGF1 alpha excretion from 32 mg kg-1 but a significant elevation of urinary PGE2 levels was only reached after administration of 128 mg kg-1. However, renal prostaglandin concentrations were not modified by tienoxolol. 3. Furosemide (32 mg kg-1) displayed a strong diuretic activity but did not enhance 6-keto-PGF1 alpha excretion. Likewise, the latter was unaffected by acebutolol and propranolol (128 mg kg-1) and no significant diuresis was observed following administration of these two beta-blocking agents. Theophylline (64 mg kg-1), like tienoxolol, was able to induce both diuresis and urinary prostaglandin excretion. Furthermore, they bound with similar affinities to A1 and A2 adenosine receptors. This led to the suggestion that a relationship between P1-purinoceptors, prostaglandin release, diuresis and natriuresis could exist. 4. Oral co-administration of NECA (0.2 mg kg-1) with tienoxolol markedly reduced the urinary 6-keto-PGF1 alpha excretion observed when tienoxolol was administered alone. However, neither diuresis nor natriuresis were modified, demonstrating that the proposed relationship was untenable.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8098641

  16. Arachidonate metabolism in bovine gallbladder muscle

    SciTech Connect

    Nakano, M.; Hidaka, T.; Ueta, T.; Ogura, R.

    1983-04-01

    Incubation of (1-/sup 14/C)arachidonic acid (AA) with homogenates of bovine gallbladder muscle generated a large amount of radioactive material having the chromatographic mobility of 6-keto-PGF1 alpha (stable product of PGI2) and smaller amounts of products that comigrated with PGF2 alpha PGE2. Formation of these products was inhibited by the cyclooxygenase inhibitor indomethacin. The major radioactive product identified by thin-layer chromatographic mobility and by gas chromatography - mass spectrometric analysis was found to be 6-keto-PGF1 alpha. The quantitative metabolic pattern of (1-/sup 14/C)PGH2 was virtually identical to that of (1-/sup 14/C)AA. Incubation of arachidonic acid with slices of bovine gallbladder muscle released labile anti-aggregatory material in the medium, which was inhibited by aspirin or 15-hydroperoxy-AA. These results indicate that bovine gallbladder muscle has a considerable enzymatic capacity to produce PGI2 from arachidonic acid.

  17. Easy method for preparing radioactive methyl esters of eicosanoids suitable as ligands in radioimmunoassays

    SciTech Connect

    Moonen, P.; Klok, G.; Keirse, M.J.

    1985-03-01

    A rapid and convenient method is described for methylating prostanoids and other arachidonic acid metabolites. With /sup 3/H-methyl iodide of high specific activity, tracers for radioimmunoassay can be produced at a cost which is only a fraction of that of labeled compounds currently available. In radioimmunoassays for PGE2, TXB2 and 6-keto-PGF1 alpha, labeled methyl esters gave results which were comparable to those obtained with the use of tritiated free acids as radioligands.

  18. [Image and quantity analysis of prostaglandin in rats' blood plasma and Na(+)-K(+)-ATPase in their cerebellum during the prevention of motion sickness by cinnarizine].

    PubMed

    Dong, W; Tian, D; Zhang, M

    1998-06-01

    To study the mechanism of cinnarizine in preventing motion sickness, TXB2, 6-Keto-PGF1 alpha in rats' blood plasma and Na(+)-K(+)-ATPase activity in the endothelial cells of their cerebellar capillary were measured and analysed by a radioactive immunity analyser and a computer image system. The results showed that TXB2 and 6-Keto-PGF1 alpha in rats' blood plasma in the cinnarizine preventing group (CPG) decreased remarkably, compared with those in the motion sickness group(MSG) (p < 0.05). The activity of Na(+)-K(+)-ATPase in the endothelial cells of rats' cerebellar capillary in CPG was higher than that in MSG (p < 0.01). The authors suggest that the lower concentration of TXB2 and 6-Keto-PGF1 alpha in rats' blood plasma in CPG is closely related to cinnarizine which prevents Ca2+ from entering into the platelets and into the endothelial cells of blood vessels. The higher activity of Na(+)-K(+)-ATPase in the cerebellum may be caused by cinnarizene which dilates the blood vessels in the brain, increases the blood flow therein, and hinders Ca2+ from getting into the cerebellum cells. These change are believed to be the important mechanism of how cinnarizine prevents motion sickness. PMID:12548903

  19. Arachidonic acid metabolism in fibroblasts derived from canine myocardium

    SciTech Connect

    Weber, D.R.; Prescott, S.M.

    1986-03-05

    Canine fibroblasts from normal or healing infarcted myocardium were grown in culture. The cells were morphologically indistinguishable, but the doubling time of cells from healing myocardium was 39.6 +/- 3.5 hr whereas that of normals was 24 +/- 3.7 (n=5, p < .025). Fibroblasts incorporated (/sup 3/H)arachidonate (AA) into phospholipids. Calcium ionophore A23187 (10 ..mu..M) caused release and metabolism of (/sup 3/H) AA. A23187 or AA (10..mu..M) induced production of 6-keto PGF1..cap alpha.., PGE2, and a hydroxy metabolite of AA. RIA of 6-keto PGF1..cap alpha.. showed that subconfluent cells from healing myocardium produced 1202 +/- 354 pg/mg protein whereas that of normals was 551 +/- 222 (n=7, p < .025). Histamine and bradykinin also induced AA metabolism but were less potent. They examined the effect of AA released from deteriorating myocytes on AA metabolism by cultured fibroblasts. They confirmed that isolated myocytes labelled with (/sup 3/H)AA released but did not metabolize (/sup 3/H)AA. In coincubations, fibroblasts incorporated myocyte-derived AA. Subsequent stimulation of the fibroblasts with A23187 induced the synthesis of 6-keto PGF1..cap alpha.., PGE2 and a hydroxy metabolite. The fibroblast content of healing myocardium was 35-1000 times that of normal tissue (n=7). Thus even a moderate change in AA metabolism, amplified by the AA released from deteriorating myocytes, may be a significant physiologic or pathologic event.

  20. Eicosanoid synthesis by warm- and cold-acclimated American bullfrog (Rana catesbeiana) brain.

    PubMed

    Martinez, J M; Chapunoff, D; Romero, M A; Herman, C A

    1994-07-15

    Previous studies in bullfrogs have demonstrated the presence of leukotriene (LT)C4 binding sites in the brain. However, synthesis of eicosanoids by brain tissue has not been examined. Because prostaglandin (PG) synthesis differs in warm- and cold-acclimated bullfrog lung tissue, this study compared the synthesis of prostaglandins and leukotrienes in brains from warm-(22 degrees C) and cold-acclimated (5 degrees C) animals. Initial experiments determined that leukotriene and prostaglandin production rates were greatest during the initial 30 min time period. Therefore, tissues were incubated in Munsick's solution and gassed with 95% O2, 5% CO2 for 30 min. Media were analyzed by radioimmunoassay for LTC4, LTB4, PGE2, PGF2 alpha, TXB2, and 6-keto PGF1 alpha. In warm-acclimated bullfrog brains, production was as follows: LTC4 > PGE2 > 6-keto PGF1 alpha, thromboxane (TX)B2, LTB4, and PGF2 alpha. Brain tissues from cold-acclimated animals incubated at 22 degrees C produced significantly greater quantities of PGE2 and 6-keto PGF1 alpha than did brains from warm-acclimated animals. Stimulation of TXB2 levels was observed when the animal was stunned with a blow to the head prior to decapitation. Indomethacin, a cyclooxygenase inhibitor, decreased prostaglandin but not leukotriene synthesis. Epinephrine (4 x 10(-8) M), the amphibian sympathetic postganglionic neurotransmitter, stimulated leukotriene synthesis by brains from warm-acclimated bullfrogs, and the effect was blocked with the 5-lipoxygenase inhibitor MK-886 (5 x 10(-5) M). These results clearly indicate that the bullfrog brain synthesized both leukotrienes and prostaglandins. Further studies are necessary to determine their function in the amphibian central nervous system.

  1. Hypotensive and Angiotensin-Converting Enzyme Inhibitory Activities of Eisenia fetida Extract in Spontaneously Hypertensive Rats

    PubMed Central

    Mao, Shumei; Li, Chengde

    2015-01-01

    Objectives. This study aimed to investigate the antihypertensive effects of an Eisenia fetida extract (EFE) and its possible mechanisms in spontaneously hypertensive rats (SHR rats). Methods. Sixteen-week-old SHR rats and Wistar-Kyoto rats (WKY rats) were used in this study. Rats were, respectively, given EFE (EFE group), captopril (captopril group), or phosphate-buffered saline (PBS) (normal control group and SHR group) for 4 weeks. ACE inhibitory activity of EFE in vitro was determined. The systolic blood pressure (SBP) and diastolic blood pressure (DBP) were measured using a Rat Tail-Cuff Blood Pressure System. Levels of angiotensin II (Ang II), aldosterone (Ald), and 6-keto-prostaglandin F1 alpha (6-keto-PGF1α) in plasma were determined by radioimmunoassay, and serum nitric oxide (NO) concentration was measured by Griess reagent systems. Results. EFE had marked ACE inhibitory activity in vitro (IC50 = 2.5 mg/mL). After the 4-week drug management, SHR rats in EFE group and in captopril group had lower SBP and DBP, lower levels of Ang II and Ald, and higher levels of 6-keto-PGF1α and NO than the SHR rats in SHR group. Conclusion. These results indicate that EFE has hypotensive effects in SHR rats and its effects might be associated with its ACE inhibitory activity. PMID:26798397

  2. Stimulation of gastric and colonic mucosal eicosanoid synthesis by plantain banana.

    PubMed

    Goel, R K; Tavares, I A; Bennett, A

    1989-11-01

    Extracts of plantain banana (Musa sapientum Linn var. paradisiaca) were studied on the accumulation of eicosanoids in incubates of human gastric and colonic mucosa. The ethanolic extract caused a concentration-dependent increase in the eicosanoid accumulation but the water extract was ineffective. Since all the eicosanoids studied tended to increase, banana may act by increasing the availability of arachidonate. In control tissues the accumulation of PGE and TXB2 in the incubates decreased with time while that of 6-keto-PGF1 alpha increased (colon only, studied).

  3. The effect of ageing on human platelet sensitivity to serotonin.

    PubMed

    Gleerup, G; Winther, K

    1988-10-01

    Twelve healthy young volunteers (mean age 21, range 18-27 years) and 12 elderly people (mean age 77, range 72-86 years) were tested regarding platelet aggregation induced by adrenaline, ADP and serotonin. The serum levels of thromboxane B2 (TXB2) and serum 6-keto-PGF1 alpha and the plasma level of adrenaline and cyclic AMP (cAMP) were also measured. Platelet aggregation induced by adrenaline and ADP increased significantly in the elderly compared with the young group (P less than 0.05 and P less than 0.02, respectively). There was a substantial and highly significant increase in the response of platelets from elderly people to serotonin (P less than 0.01). No alteration was observed in the serum level of TXB2 or 6-keto-PGF1 alpha. Plasma adrenaline increased in the old group, but plasma cAMP was unaffected. As serotonin is known to amplify adrenaline- and ADR-induced platelet aggregation, the considerable increase in platelet sensitivity to serotonin could be an important factor in the increased adrenaline and ADP-induced platelet aggregability of elderly people.

  4. Prostaglandin F{sub 2{alpha}} regulates cytokine responses of mast cells through the receptors for prostaglandin E

    SciTech Connect

    Kaneko, Izumi; Hishinuma, Takanori; Suzuki, Kaori; Owada, Yuji; Kitanaka, Noriko; Kondo, Hisatake; Goto, Junichi; Furukawa, Hiroshi; Ono, Masao

    2008-03-14

    There is an increasing body of evidence that prostanoids modulate mast cell functions and contribute to the development of allergic inflammation. The present study aimed to identify an undetermined function of prostaglandin (PG) F{sub 2{alpha}} in mast cell activation and the signaling mechanism involved in it. Simultaneous quantification of prostanoids by liquid chromatography/tandem mass spectrometry revealed the constitutive release of PGF{sub 2{alpha}}, thromboxane B{sub 2}, and 6-keto-PGF{sub 1{alpha}} from bone marrow-derived mast cells (BMMCs). Upon activation of BMMCs by lipopolysaccharide, the cytokine production in BMMCs was enhanced when the culture was supplemented with PGF{sub 2{alpha}}. However, F prostanoid receptor-a selective receptor for PGF{sub 2{alpha}}-was not detected in BMMCs. Further investigations performed using prostanoid receptor antagonists revealed an alternative mechanism wherein the receptors for PGE species-E prostanoid receptors-mediated the PGF{sub 2{alpha}} signal in BMMCs. The present study provides an insight into a novel function of PGF{sub 2{alpha}}, i.e., an autocrine accelerator for mast cell activation.

  5. Stretch-induced prostaglandins and protein turnover in cultured skeletal muscle

    NASA Technical Reports Server (NTRS)

    Vandenburgh, Herman H.; Hatfaludy, Sophia; Sohar, Istvan; Shansky, Janet

    1990-01-01

    The purpose of the study is to determine whether mechanical stimulation of cultured muscle cells influences prostaglandin efflux rates and whether they are related to stretch-induced alterations in protein turnover rates. The materials and methods of the experiment, including cell cultures, mechanical stimulation, protein synthesis, and degradation assays are outlined, and emphasis is placed on the effect of short-term mechanical stimulation in basal medium prostaglandin efflux from cultured skeletal muscle and stretch-induced alterations in prostaglandins efflux in complete medium. The major finding of the study is that mechanical stimulation of tissue-cultured skeletal-muscle cells under conditions inducing skeletal-muscle hypertropy increases the efflux of PGE(2) and PGE(2-alpha) but not 6-keto-PGF(1-alpha), the prostacyclin product.

  6. Reduced progesterone and altered cotyledonary prostaglandin values induced by locoweed (Astragalus lentiginosus) in sheep

    SciTech Connect

    Ellis, L.C.; James, L.F.; McMullen, R.W.; Panter, K.E.

    1985-09-01

    Feeding 300 or 400 g of dried spotted locoweed, Astragalus lentiginosus per day to 11 pregnant Columbia ewes from the 20th to the 50th days of their gestations resulted in dead and edematous fetuses. Aspartate aminotransferase values were increased, whereas serum progesterone values were significantly diminished in a dose-dependent manner by locoweed ingestion. Cotyledonary 6-keto-prostaglandin (PG)F1 alpha (400 g/day only) and PGF2 alpha (300 and 400 g/day) values were significantly increased, whereas PGE values were not affected by the treatment. Alterations in PG values in these sheep may be a mechanism for altering corpus luteum function and inducing fetal death, which would ultimately result in abortion.

  7. He-Ne laser treatment on menorrhagia

    NASA Astrophysics Data System (ADS)

    Ding, Ai-Hua

    1993-03-01

    By using He-Ne laser treatment, 84.7 - 91.1% of patients with menorrhagia, a common symptom of multiple gynecological diseases, are treated effectively. After laser irradiation, the amount of vaginal bleeding was reduced 47.1% on average. It has been proven that low-energy laser is an effective non-traumatic, painless, and easily acceptable new physical method in patients with menorrhagia. To study the mechanisms of efficiency, the quantitative determination of PGE2, PGF2(alpha ), 6-Keto-PGF1(alpha ), TXB2 in endometrium and blood flow before and after treatment were carried out. The results suggest that the effectiveness may be due to the recovery regulation of local uterine PGS level.

  8. Naproxen sodium in short-term prophylaxis of pure menstrual migraine: pathophysiological and clinical considerations.

    PubMed

    Allais, G; Bussone, G; De Lorenzo, C; Castagnoli Gabellari, I; Zonca, M; Mana, O; Borgogno, P; Acuto, G; Benedetto, C

    2007-05-01

    We investigated the biological and clinical effects of naproxen sodium (NxS) in the short-term prophylaxis of pure menstrual migraine (PMM) in 25 women suffering from migraine without aura, occurring exclusively from 2 days before to 5 days after menstruation onset. Daily oral NxS (550 mg) from 7 days before menstruation to 7 days after menstruation onset was given for 3 menstrual cycles, and 5 days before menstruation to 5 days after menstruation onset over the next 3 menstrual cycles. In the month before initiation of treatment and in the third month of treatment, 6-keto-PGF1(alpha), TXB(2) and PGE(2) were measured in plasma before menstruation (day -2) and on the second day (day +2) after bleeding onset. In the 20 women analysed, 6-keto-PGF1(alpha) was 17% lower (p<0.0001) and TXB(2) was 30% lower (p<0.0001) on day -2 during treatment than the same day pretreatment; TXB(2) was also lower (p<0.02) on day +2 during treatment than day +2 pretreatment. The 6-keto-PGF1(alpha)/TXB(2) ratio was higher (p<0.01) on day -2 treatment than day -2 pretreatment. PGE(2) levels were significantly lower (p<0.002) on day +2 than pre-treatment values on the same day. The number of attacks reduced from 1.7+/-0.11 pretreatment to 1.2+/-0.10 at the 3rd month (p<0.001), to 1.1+/-0.06 at the 6th month (p<0.0001). The duration reduced from 25.6+/-4.42 h pretreatment to 15.5+/-4.43 h in the 3rd month (p<0.02), to 13.35+/-4.26 h in the 6th month (p<0.001). The intensity reduced from 2.4+/-0.11 pretreatment, to 1.2+/-0.10 in the 3rd month of treatment (p<0.0001), and 1.1+/-0.07 in the 6th month (p<0.0001).

  9. Tilmicosin and tylosin have anti-inflammatory properties via modulation of COX-2 and iNOS gene expression and production of cytokines in LPS-induced macrophages and monocytes.

    PubMed

    Cao, Xing-Yuan; Dong, Mei; Shen, Jian-Zhong; Wu, Bei-Bei; Wu, Cong-Ming; Du, Xiang-Dang; Wang, Zhuo; Qi, Yi-Tao; Li, Bing-Yu

    2006-05-01

    Macrolides have been reported to modify the host immune and inflammatory responses both in vivo and in vitro. We examined the in vitro effect of the macrolides tilmicosin and tylosin, which are only used in the veterinary clinic, on the production of nitric oxide (NO), prostaglandin E(2) (PGE(2)) and cytokines by lipopolysaccharide (LPS)-stimulated RAW264.7 macrophages and mouse peripheral blood mononuclear cells (PBMCs). Compared with 5 microg/mL, tilmicosin and tylosin concentrations of 10 microg/mL and 20 microg/mL significantly decreased the production of 6-keto-prostaglandin F(1alpha) (6-keto-PGF(1alpha)), PGE(2), NO, tumour necrosis factor-alpha (TNF-alpha), interleukin (IL)-1beta and IL-6, and increased IL-10 production. Cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS) gene expression were also significantly reduced. These results support the opinion that macrolides may exert an anti-inflammatory effect through modulating the synthesis of several mediators and cytokines involved in the inflammatory process.

  10. Ibuprofen improves survival from endotoxic shock in the rat.

    PubMed

    Wise, W C; Cook, J A; Eller, T; Halushka, P V

    1980-10-01

    During endotoxemia, there is a significant increase in arachidonic acid-derived metabolites. To test the hypothesis that one or more of these metabolites play a significant role in the pathogenesis of endotoxic shock we investigated the therapeutic efficacy of varying doses of ibuprofen, a cyclooxygenase inhibitor, on the pathophysiologic sequelae of endotoxic shock in the Long-Evans rat, induced by S. enteritidis endotoxin (20 mg/kg). Pretreatment with ibuprofen (1-3.75 mg/kg) produced an optimal survival rate of 80% compared to only 11% in the vehicle-treated group. Doses of 0.1, 0.5 and 30 mg/kg of ibuprofen also significantly (P < .05) improved survival over nontreated shocked controls. Plasma thromboxane B2 and 6-keto-prostaglandin F1 alpha(PGF1 alpha) levels rose from < 200 pg/ml to 2207 +/- 282 (N = 16) and 840 +/- 59 (N = 8), respectively, within 30 min after injection. The rise in plasma thromboxane B2 and 6-keto-PGF1 alpha levels was reduced with ibuprofen (3.75 and 30 mg/kg) to < 200 pg/ml. Ibuprofen (3.75 and 30 mg/kg) reduced thrombin-induced in vitro platelet thromboxane B2 synthesis by 95 and 99%, respectively. The severity of coagulopathies as reflected by elevations in serum fibrogen/fibrin degradation products and lysosomal integrity were likewise significantly reduced (40%) with ibuprofen (3.75 mg/kg) pretreatment. These results are consistent with the hypothesis that arachidonic acid metabolites play a significant early role in the pathogenesis of endotoxic shock. Our observations suggest potential benefits from agents which inhibit fatty acid cyclooxygenase.

  11. Aldosterone alters the participation of endothelial factors in noradrenaline vasoconstriction differently in resistance arteries from normotensive and hypertensive rats.

    PubMed

    Xavier, Fabiano E; Blanco-Rivero, Javier; Avendaño, María Soledad; Sastre, Esther; Yela, Rubén; Velázquez, Kyra; Salaíces, Mercedes; Balfagón, Gloria

    2011-03-11

    This study analyzed the effect of aldosterone (0.05mg/kg per day, 3 weeks) on vasoconstriction induced by noradrenaline in mesenteric resistance arteries from WKY rats and SHR. Contraction to noradrenaline was measured in mesenteric resistance arteries from untreated and aldosterone-treatedrats from both strains. Participation of nitric oxide (NO), superoxide anions, thromboxane A(2) (TxA(2)) and prostacyclin in this response was determined. 6-keto-prostaglandin (PG)F1alpha and thromboxane B(2) (TxB(2)) releases were determined by enzyme immunoassay. NO and superoxide anion release were also determined by fluorescence and chemiluminiscence, respectively. Aldosterone did not modify noradrenaline-induced contraction in either strain. In mesenteric resistance arteries from both aldosterone-treated groups, endothelium removal or preincubation with NO synthesis inhibitor L-NAME increased the noradrenaline-induced contraction, while incubation with the superoxide anion scavenger tempol decreased it. Preincubation with either the COX-1/2 or COX-2 inhibitor (indomethacin and NS-398, respectively) decreased the noradrenaline contraction in aldosterone-treated animals, while this response was not modified by COX-1 inhibitor SC-560. TxA(2) synthesis inhibitor (furegrelate), or TxA2 receptor antagonist (SQ 29 548) also decreased the noradrenaline contraction in aldosterone-treated animals. In untreated SHR, but not WKY rats, this response was increased by L-NAME, and reduced by tempol, indomethacin, NS-398 or SQ 29 548. Aldosterone treatment did not modify NO or TxB(2) release, but it did increase superoxide anion and 6-keto-PGF(1alpha) release in mesenteric resistance arteries from both strains. In conclusion, chronic aldosterone treatment reduces smooth muscle contraction to alpha-adrenergic stimuli, producing a new balance in the release of endothelium-derived prostanoids and NO.

  12. Metabolism of central neurotransmitters during development of tolerance to the anticonvulsant effect of clonazepam and of physical dependence on the drug in dogs.

    PubMed

    Scherkl, R; Hashem, A; Dreimann, E; Neumayer, H H; Frey, H H

    1990-01-01

    In previous studies, development of functional tolerance to the anticonvulsant effect of clonazepam and physical dependence on the drug have been demonstrated. In the present study, dogs were treated for 6 weeks with clonazepam 0.5 mg/kg b.i.d. Under methohexital anesthesia, cerebrospinal fluid samples were taken before treatment, at 3 days (acute effect), 4 and 5 weeks (tolerance) after the start of treatment, 2 and 8 days after withdrawal and 5 weeks after the end of treatment as another control. The following transmitters or metabolites were determined: HVA, VMA, 5-HIAA, GABA, PGE2, TXB2 and 6-keto PGF1 alpha. 5-HIAA levels showed a significant rise, indicating an increased activity of the serotonergic system in the brain during development both of tolerance and withdrawal. Dopaminergic activity was not altered during treatment, but was increased after cessation of treatment, as indicated by a significant increase in HVA concentrations. PMID:1700684

  13. Regulation of prostaglandin production by nitric oxide; an in vivo analysis.

    PubMed Central

    Salvemini, D; Settle, S L; Masferrer, J L; Seibert, K; Currie, M G; Needleman, P

    1995-01-01

    1. Endotoxin E. Coli lipopolysaccharide (LPS)-treatment in conscious, restrained rats increased plasma and urinary prostaglandin (PG) and nitric oxide (NO) production. Inducible cyclo-oxygenase (COX-2) and nitric oxide synthase (iNOS) expression accounted for the LPS-induced PG and NO release since the glucocorticoid, dexamethasone inhibited both effects. Thus, LPS (4 mg kg-1) increased the plasma levels of nitrite/nitrate from 14 +/- 1 to 84 +/- 7 microM within 3 h and this rise was inhibited to 35 +/- 1 microM by dexamethasone. Levels of 6-keto PGF1 alpha in the plasma were below the detection limit of the assay (< 0.2 ng ml-1). However, 3 h after the injection of LPS these levels rose to 2.6 +/- 0.2 ng ml-1 and to 0.7 +/- 0.01 ng ml-1 after LPS in rats that received dexamethasone. 2. The induced enzymes were inhibited in vivo with selective COX and NOS inhibitors. Furthermore, NOS inhibitors, that did not affect COX activity in vitro markedly suppressed PG production in the LPS-treated animals. For instance, the LPS-induced increased in plasma nitrite/nitrate and 6-keto PGF1 alpha at 3 h was decreased to 18 +/- 2 microM and 0.5 +/- 0.02 ng ml-1, 23 +/- 1 microM and 0.7 +/- 0.01 ng ml-1, 29 +/- 2 microM and 1 +/- 0.01 ng ml-1 in rats treated with LPS in the presence of the NOS inhibitors NG-monomethyl-L-arginine, NG-nitro arginine methyl ester and aminoguanidine, respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7542531

  14. Biochemical and pharmacological effects of dipyrone and its metabolites in model systems related to arachidonic acid cascade.

    PubMed

    Weithmann, K U; Alpermann, H G

    1985-01-01

    The metabolites of dipyrone (metamizol, Novalgin) were compared with appropriate standard drugs for their influences on the pathways of the arachidonic acid metabolism. The drugs in this study had no significant effects on the lipoxygenase pathway in human neutrophils in vitro. The dipyrone metabolites 4-methylaminoantipyrine (MAAP) and 4-aminoantipyrine (AAP) inhibited prostaglandin synthesis in the 10(-3) to 10(-4) mol/l range thus being comparable to acetylsalicylic acid (ASA), whereas the two additional metabolites 4-acetylaminoantipyrine (AAAP) and 4-formylaminoantipyrine (FAAP) were practically inactive. This result is in accordance with the effects of the metabolites on the formation of oedema in the arthritis rat model, and supports published data showing that MAAP and AAP are the metabolites responsible for the clinical effects of dipyrone. Further systems in our study depending at least partially on the prostaglandin pathway were the release of antiaggregatory activity from rat aortae in vitro and the aggregation of human platelets induced by arachidonic acid in vitro. MAAP exhibits antiaggregatory activity (IC50 5 x 10(-6) mol/l), whereas the inhibitory effect on the vascular antiaggregatory release is much weaker. Compared to normals platelet aggregability ex vivo is enhanced in arthritic rats, but could significantly be lowered again by treatment of the rats with MAAP. A further system studied was the release of 6-keto-PGF1 alpha from rat mucosa in vitro and ex vivo. In vitro there is inhibition to be found with MAAP as well as with ASA. Ex vivo, however, dipyrone or MAAP slightly stimulates mucosal 6-keto-PGF1 alpha rather than inhibiting it, whereas ASA exerts inhibition, as expected.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. Amlodipine and haemodynamic effects of cyclo-oxygenase inhibition.

    PubMed

    Minuz, P; Pancera, P; Ribul, M; Priante, F; Degan, M; Campedelli, A; Arosio, E; Lechi, A

    1995-01-01

    1. The haemodynamic effects of calcium antagonists could depend at least in part on the activity of vasoactive prostanoids. 2. We set out to study the effect of the cyclo-oxygenase inhibitor ibuprofen, 400 mg three times daily for 3 days, by a randomised cross-over study vs placebo in 12 mild to moderate essential hypertensive patients who had been treated for 1 month with amlodipine. 3. Blood pressure, heart rate and vascular resistances in the upper limb (Doppler ultrasound) were measured. Plasma renin activity and urinary aldosterone, as well as indices of renal function, were evaluated. Urinary 2,3-dinor-6-keto-PGF1 alpha and 2,3-dinor-TXB2, as well as 6-keto-PGF1 alpha and TXB2, were measured as indices of systemic and renal PGI2 and TXA2 synthesis. 4. Amlodipine normalised blood pressure and reduced upper limb vascular resistances; it did not affect urinary prostanoid excretion. Short-term combined administration of ibuprofen resulted in, by comparison with placebo, inhibition of systemic PGI2 (-80.5 ng 24 h-1, 95% CI -99.2, -61.4; P < 0.001) and TXA2 (-216.1 ng 24 h-1, 95% CI -276.5, -155.8; P < 0.001), together with an increase in systolic (+7.8 mm Hg, 95% CI +3.1, +12.3; P < 0.01) and diastolic (+3.9 mm Hg, 95% CI +1.2, +6.6; P < 0.01) blood pressure; it had no significant effect on regional vascular resistances (+4.7 mm Hg ml-1 s, 95% CI -5.6, +15.0). Effects of ibuprofen on renal prostanoid synthesis were less marked, and there was no change in indices of renal function or hydro-electrolytic balance.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. Blood eicosanoids and immune indices during fasciolosis in water buffaloes.

    PubMed

    Chen, L; Daugschies, A; Wang, B; Mao, X

    2000-12-01

    The effects of trickle infections of water buffaloes with Fasciola hepatica (60 metacercariae daily during a period of 20 days) on the blood plasma levels of prostaglandin E(2) (PGE2), 6-keto-prostaglandin F(1alpha) (6-keto-PG F(1alpha)) and thromboxane B(2) (TXB2) were assessed. F. hepatica specific IgG and T- and B-lymphocyte ratios were evaluated as indicators of the immune response. Although the applied mode of infection did not result in clinical disease, changes in the plasma eicosanoid pattern were observed. Plasma PGE2 values were significantly elevated in the infected water buffaloes 11 weeks post-infection (w.p.i.). In contrast, transiently but significantly lower TXB2 values than in the uninfected controls were recorded in the phase of chronic fasciolosis. Plasma 6-keto-PGF(1alpha) values were not considerably altered by the infection throughout the study period. F. hepatica-specific IgG were detected from 4 to 21 w.p.i. The proportion of peripheral T- and B-lymphocytes shifted towards B-cells from 2 to 12 w.p.i., gradually returning to control values afterwards. Although the water buffaloes appeared to be rather resistant to trickle infection with F. hepatica, moderate changes in plasma eicosanoid patterns were observed, indicating tissue damage and/or inflammation. Induction of the immune response could be monitored by an increase of F. hepatica-specific IgG, which was paralleled by a relative increase of the B-lymphocyte population.

  17. Alpha Thalassemia

    MedlinePlus

    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  18. Evidence for a Direct Stimulatory Effect of Prostacyclin on Renin Release in Man

    PubMed Central

    Patrono, Carlo; Pugliese, Francesco; Ciabattoni, Giovanni; Patrignani, Paola; Maseri, Attilio; Chierchia, Sergio; Peskar, Bernhard A.; Cinotti, Giulio A.; Simonetti, Bianca M.; Pierucci, Alessandro

    1982-01-01

    The objectives of this investigation were: (a) to characterize the time and dose dependence of the effects of prostacyclin (PGI2) on renin release in healthy men; (b) to define whether PGI2-induced renin release is secondary to hemodynamic changes; (c) to determine the plasma and urine concentrations of 6-keto-PGF1α (the stable breakdown product of PGI2) associated with renin release induced by exogenous or pharmacologically enhanced endogenous PGI2. Intravenous PGI2 or 6-keto-PGF1α infusions at nominal rates of 2.5, 5.0, 10.0, and 20.0 ng/kg per min were performed in each of six normal human subjects; in three of them, PGI2 infusion was repeated after β-adrenergic blockade and cyclooxygenase inhibition. PGI2, but not 6-keto-PGF1α, caused a time- and dose-dependent increase of plasma renin activity, which reached statistical significance at 5.0 ng/kg per min and was still significantly elevated 30 min after discontinuing the infusion. Although combined propranolol and indomethacin treatment significantly enhanced the hypotensive effects of infused PGI2, it did not modify the dose-related pattern of PGI2-induced renin release. Plasma 6-keto-PGF1α levels rose from undetectable levels (<7.5 pg/ml) in a stepwise fashion during increasingly higher infusion rates of PGI2 or 6-keto-PGF1α. The threshold concentration of plasma 6-keto-PGF1α associated with a statistically significant stimulation of renin release was ∼200 pg/ml. Upon discontinuing PGI2 or 6-keto-PGF1α infusion, the disappearance of 6-keto-PGF1α from blood showed an identical biphasic behavior, the initial phase having an apparent t½ of 3.2 min. The intravenous infusion of furosemide, which is known to stimulate renin release via a cyclooxygenase-dependent mechanism, caused a three-to fourfold increase of urinary 6-keto-PGF1α excretion rate, concomitant with the elevation of plasma renin activity levels, in six healthy women. 6-Keto-PGF1α remained undetectable in peripheral venous plasma

  19. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  20. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  1. Inhibitory effects and mechanisms of high molecular-weight phlorotannins from Sargassum thunbergii on ADP-induced platelet aggregation

    NASA Astrophysics Data System (ADS)

    Wei, Yuxi; Wang, Changyun; Li, Jing; Guo, Qi; Qi, Hongtao

    2009-09-01

    We evaluated the effects of high molecular-weight phlorotannins from Sargassum thunbergii (STP) on ADP-induced platelet aggregation and arachidonic acid (AA) metabolism in New Zealand white rabbits and Wistar rats. The inhibition of STP on platelet aggregation was investigated using a turbidimetric method, and the levels of the terminal products of AA metabolism were measured using the corresponding kits for maleic dialdehyde (MDA), thromboxane B2 (TXB2) and 6-keto-prostaglandin F1α (6-keto-PGF1α) by colorimetry and radioimmunoassay, as appropriate. We found that STP could inhibit ADP-induced platelet aggregation, and the inhibitory ratio was 91.50% at the STP concentration of 4.0 mg/mL. Furthermore, STP markedly affected AA metabolism by decreasing the synthesis of MDA ( P<0.01) and increasing the synthesis of 6-keto-PGF1α, thus changing the plasma TXB2/6-keto-PGF1α balance when the platelets were activated ( P<0.01). Therefore, STP altered AA metabolism and these findings partly revealed the molecular mechanism by which STP inhibits ADP-induced platelet aggregation.

  2. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  3. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  4. alpha-Hexachlorocyclohexane (alpha-HCH)

    Integrated Risk Information System (IRIS)

    alpha - Hexachlorocyclohexane ( alpha - HCH ) ; CASRN 319 - 84 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Ass

  5. Alpha-1 Antitrypsin Test

    MedlinePlus

    ... measures the level of the protein AAT in blood. Alpha-1 antitrypsin phenotype testing evaluates the amount and type of AAT being produced and compares it to normal patterns. Alpha-1 antitrypsin genotype testing ( DNA testing) can ...

  6. Alpha-1 antitrypsin test

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003715.htm Alpha-1 antitrypsin test To use the sharing features on this page, please enable JavaScript. Alpha-1 antitrypsin is a laboratory test to measure the ...

  7. The Alpha Centauri System.

    ERIC Educational Resources Information Center

    Soderblom, David R.

    1987-01-01

    Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

  8. Lung, aorta, and platelet metabolism of /sup 14/C-arachidonic acid in vitamin E deficient rats

    SciTech Connect

    Valentovic, M.A.; Gairola, C.; Lubawy, W.C.

    1982-08-01

    /sup 14/C-arachidonic acid metabolism was determined in aortas, platelets, and perfused lungs from rats pair fed a basal diet supplemented with 0 or 100 ppm vitamin E for 11 weeks. Spontaneous erythrocyte hemolysis tests showed 92% and 8% hemolysis for the 0 and 100 ppm vitamin E groups, respectively. Elevated lung homogenate levels of malonaldehyde in the 0 ppm group confirmed its deficient vitamin E status. Aortas from the vitamin E deficient group synthesized 54% less prostacyclin than aortas from the supplemented group (p less than 0.05). Although thromboxane generation by platelets from the vitamin E deficient group exhibited a 37% increase, this difference was not statistically significant compared to the supplemented animals. Greater amounts of PGE2, PGF2 alpha, TXB2, and 6-keto-PGF1 alpha were obtained in albumin buffer perfusates from lungs of vitamin E deficient rats than in those from supplemented rats. Significant differences (p less than 0.05) were noticed, however, only for PGE2 and PGF2 alpha. These studies indicate that vitamin E quantitatively alters arachidonic acid metabolism in aortic and lung tissue but its effect on thromboxane synthesis by platelets is less marked.

  9. Differences in responsiveness of intrapulmonary artery and vein to arachidonic acid: mechanism of arterial relaxation involves cyclic guanosine 3':5'-monophosphate and cyclic adenosine 3':5'-monophosphate

    SciTech Connect

    Ignarro, L.J.; Harbison, R.G.; Wood, K.S.; Wolin, M.S.; McNamara, D.B.; Hyman, A.L.; Kadowitz, P.J.

    1985-06-01

    The objective of this study was to examine the relationship between responses of bovine intrapulmonary artery and vein to arachidonic acid and cyclic nucleotide levels in order to better understand the mechanism of relaxation elicited by arachidonic acid and acetylcholine. Arachidonic acid relaxed phenylephrine-precontracted arterial rings and elevated both cyclic GMP and cyclic AMP levels in arteries with intact endothelium. In contrast, endothelium-damaged arterial rings contracted to arachidonic acid without demonstrating significant changes in cyclic nucleotide levels. Indomethacin partially inhibited endothelium-dependent relaxation and abolished cyclic AMP accumulation whereas methylene blue, a guanylate cyclase inhibitor, partially inhibited relaxation and abolished cyclic GMP accumulation in response to arachidonic acid. All vessel responses were blocked by a combination of the two inhibitors. Prostaglandin (PG) I2 relaxed arterial rings and elevated cyclic AMP levels whereas PGE2 and PGF2 alpha caused contraction, suggesting that the indomethacin-sensitive component of arachidonic acid-elicited relaxation is due to PGI2 formation and cyclic AMP accumulation. The methylene blue-sensitive component is attributed to an endothelium-dependent but cyclooxygenase-independent generation of a substance causing cyclic GMP accumulation. Intrapulmonary veins contracted to arachidonic acid with no changes in cyclic nucleotide levels and PGI2 was without effect. Homogenates of intrapulmonary artery and vein formed 6-keto-PGF1 alpha, PGF2 alpha and PGE2 from (/sup 14/C)arachidonic acid, which was inhibited by indomethacin. Thus, bovine intrapulmonary vein may not possess receptors for PGI2.

  10. [Xinfeng capsule improves hypercoagulative state by inhibiting miR-155/NF-κB signaling pathway in patients with active ankylosing spondylitis].

    PubMed

    Fang, Li; Liu, Jian; Wan, Lei; Zhu, Fubing; Tan, Bing; Zhang, Pingheng

    2016-08-01

    Objective To observe the effect of Xinfeng capsule (XFC) on miR-155, nuclear factor kappa B (NF-κB) signal pathway, and indexes related to hypercoagulative state in patients with active ankylosing spondylitis (AS), and investigate the possible mechanism. Methods Fifty-six cases in active AS were randomly divided into XFC group and sulfasalazine (SASP) group. All cases in the XFC group took three capsules three times daily for twelve consecutive weeks. The ones in the SASP group took four tablets two times daily for twelve consecutive weeks. The expression of miR-155 was detected by real-time PCR. The mRNA expressions of nuclear factor κB activator 1(Act1), NF-κB inhibitor-alpha (IκBα), inhibitor of kappa-B kinase beta (IKKβ), NF-κB p65, and NF-κB p50 were tested by reverse transcription PCR (RT-PCR). Meanwhile, the protein expressions of NF-κB P65 and NF-κB P50 were determined by Western blotting. Tumor necrosis factor-alpha (TNF-α), interleukin (IL)-4, IL-10, IL-17, thromboxane B2 (TXB2), 6-ketone-prostaglandin F1 (6-keto-PGF1), platelet granular membrane protein 140 (GMP140), platelet activation factor (PAF), and plasminogen activator inhibitor-2 (PAI-2) were determined by ELISA. Clinical efficacy was evaluated in the two groups. Results Compared with the SASP group, 50% Bath ankylosing spondylitis disease activity index (BASDAI50) was significantly higher in the XFC group. Compared with the SASP group after treatment, platelet (PLT), fibrinogen (FBG) and D-D dimer (D-D), TXB2, GMP140, PAF, PAI-2, IL-17, erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), visual analog scale (VAS), BASDAI, BASFI, and BAS-G were reduced more obviously in the XFC group after treatment; meanwhile, 6-keto-PGF1, IL-4, and IL-10 significantly increased. Compared with the SASP group after treatment, the expressions of IKKβ mRNA, IκBα mRNA, NF-κB p65 mRNA, NF-κB p50 mRNA, NF-κB P65 protein, NF-κB P50 protein, and miR-155 were lower in the XFC group after

  11. Aspirin sensitivity of platelet aggregation in diabetes mellitus.

    PubMed

    Albert, Stewart G; Hasnain, Bibi I; Ritter, Detlef G; Joist, J Heinrich; Mooradian, Arshag D

    2005-11-01

    Although aspirin is cardioprotective in high-risk populations, many with diabetes mellitus (DM) are unresponsive to these benefits. We questioned whether cardiovascular unresponsiveness might be demonstrated by lack of aspirin sensitivity to in vitro platelet functions especially in subjects with poorly controlled diabetes. Six women and 4 men (48+/-8 years [mean+/-S.D.]), selected for poor control (glycohemoglobin 11.9+/-2.2%) and 10 sex-age (+/-5 years) matched controls received 81 mg aspirin daily. There was a 2-week washout from aspirin and related drugs. After the aspirin dose on day-7, blood for platelet aggregation assays, and 24-h urine for 2,3 dinor thromboxane B2 (TxB2) and 2,3 dinor 6-keto (PGF1alpha) were obtained. Aspirin sensitivity was defined as inhibition (i.e., lower than expected) platelet aggregation after exposure to an agonist. Those with diabetes and controls were sensitive to aspirin inhibition of platelet aggregation induced by 1.6 mM arachidonic acid (9.5+/-3.9% versus 9.1+/-3.1%, normal range 40-100%) and by 0.83 microg/mL collagen (17.4+/-13.9% versus 13.2+/-9.3%, normal range 60-93%), respectively. Aspirin sensitivity to 2 microM ADP was present in five with diabetes and five controls. Urinary prostaglandin metabolites were suppressed below reference ranges, without differences between those with DM or controls for TxB2 (350+/-149 pg/mg versus 348+/-93 pg/mg creatinine) and PGF1alpha (255+/-104 pg/mg versus 222+/-88 pg/mg creatinine). In conclusion, in poorly controlled diabetes, there was no differential lack of aspirin sensitivity to platelet aggregation, or lack of aspirin suppression of urinary TxB2 or PGF1alpha, compared with controls on aspirin. Despite suppression of urinary prostaglandin metabolites, aspirin resistance was most apparent to ADP-mediated platelet aggregation. It is not known what level of inhibition of in vitro tests is necessary for the cardioprotective benefits of aspirin in diabetes mellitus. Thus, the lack of

  12. [Isolated human venous segments as a model for the study of problems of nitrate tolerance].

    PubMed

    Schneider, W; Hawlicek, J; Kirsten, N; Kober, G; Krause, A; Weyenmeyer, T; Satter, P; von Loh, D; Kalenbach, M

    1989-01-01

    Concentration-dependent relaxation (6-70%) of segments of human saphenous veins under isometric conditions could be demonstrated with cumulative concentrations of isosorbide dinitrate (ISDN) and Glycerol trinitrate GTN (10(-9)-10(-5) M). Vein segments were obtained during coronary by-pass surgery. Nitrate (GTN)-induced relaxation was accompanied by a 2- to 3-fold increase of cyclic GMP content in the vessel walls. However, no change of concentrations in the vessel walls could be determined for the metabolites of prostaglandines: (PG E2, PG F2 alpha, TX B2, 6-keto-PGF1 alpha). Pretreatment of patients with 40 mg ISDN (standard release formulation) 4 times daily for 1 week prior to surgery with the last dose 1 hour before harvesting the vein segments did not influence relaxation. by ISDN. Immersion of vein segments for 1 hour in buffer solution containing 10(-6) M ISDN (= therapeutic concentration) prior to relaxation with cumulative concentrations of ISDN did not influence relaxation either. Induction of in vitro tolerance required ISDN concentrations which exceeded the range achieved under therapeutic conditions: 4.4 x 10(-4) M. This in vitro tolerance could be widely reversed by 10 mM N-Acetylcysteine (NAC) suggesting involvement of sulfhydril (SH) groups. Since tolerance in this experimental model was not seen under concentrations achieved in patients it seems likely that clinical tolerance is caused by activation of counterregulatory forces.

  13. Neonatal dietary supplementation of arachidonic acid increases prostaglandin levels in adipose tissue but does not promote fat mass development in guinea pigs.

    PubMed

    Aprikian, Olivier; Reynaud, Denis; Pace-Asciak, Cecil; Leone, Patricia; Blancher, Florence; Monnard, Irina; Darimont, Christian; Macé, Katherine

    2007-11-01

    The role of arachidonic acid (AA) on the development of adipose tissue is still controversial since its metabolites, i.e., prostaglandins, can either stimulate or inhibit preadipocyte differentiation in vitro. In the present study, we evaluated the effects of early postnatal supplementation of AA on body weight and adipose tissue development in guinea pigs. Male newborn guinea pigs were fed for 21 days (day 21) with diets (milk and pellet) supplemented (+AA) or not (-AA) with 1.2% (total fatty acids) AA. From day 21 to day 105 both groups were fed a chow diet. The 21-days-old +AA pups showed a twofold higher AA accretion in phospholipids associated with a two- to sixfold increase in several prostaglandins, such as 6-keto PGF(1alpha) (the stable hydrolysis product of PGI(2)), PGF(2alpha), PGE(2), and PGD(2) in adipose tissue, compared with the -AA group. No difference in fat pad and body weight, aP2, and leptin gene expression in adipose tissue, fasting plasma glucose, free-fatty acids, and triglyceride concentration was observed between groups at day 21 or day 105. These results show that dietary supplementation of AA during the suckling/weaning period increases prostaglandin levels in adipose tissue but does not influence early fat mass development in the guinea pig.

  14. Aspirin therapy and thromboxane biosynthesis in systemic lupus erythematosus.

    PubMed

    Avalos, Ingrid; Chung, Cecilia P; Oeser, Annette; Milne, Ginger L; Borntrager, Holly; Morrow, Jason D; Raggi, Paolo; Solus, Joseph; Stein, C Michael

    2007-01-01

    Incomplete suppression of thromboxane biosynthesis during aspirin therapy is associated with increased cardiovascular risk. Since systemic lupus erythematosus (SLE) is associated with platelet activation and increased cardiovascular mortality, we compared thromboxane and prostacyclin biosynthesis in patients with SLE and control subjects, and measured inhibition of thromboxane excretion in aspirin-treated subjects. We measured the urinary excretion of 11-dehydro thromboxane B( 2) (TXB(2)) and 2,3-dinor 6-ketoPGF(1alpha) (PGI-M), the stable metabolites of thromboxane A(2) and prostacyclin, respectively, in 74 patients with SLE and 70 controls. In subjects who were not receiving aspirin, TXB(2) excretion was higher in patients with SLE [0.40 ng/mg creatinine (0.26-0.64), median (interquartile range)] than controls [0.31 ng/mg creatinine (0.23-0.44)] (P = 0.04), and in these patients, TXB(2) excretion correlated with disease activity (rho = 0.28, P = 0.03) and tumor necrosis factor alpha (rho = 0.48, P < 0.001). Aspirin therapy resulted in significantly lower TXB(2) excretion in controls (P = 0.01), but not in patients with SLE (P = 0.10), compared with subjects not receiving aspirin. Prostacyclin biosynthesis did not differ among patients and controls, and was not affected by aspirin (P all >0.35). Thromboxane biosynthesis is increased in SLE and is associated with disease activity. Additionally, response to aspirin may be attenuated in some patients with SLE. PMID:18042592

  15. Histamine stimulation of prostaglandin and HETE synthesis in human endothelial cells

    SciTech Connect

    Revtyak, G.E.; Hughes, M.J.; Johnson, A.R.; Campbell, W.B.

    1988-08-01

    Endothelial cells (EC) cultured from human umbilical artery (UA) and vein (UV) metabolized (/sup 14/C)arachidonic acid to prostaglandins (PGs), monohydroxyeicosatetraenoic acids (HETEs), and epoxyeicosatrienoic acids (EETs). Major radioactive products were identified as 6-keto-PGF1 alpha, PGE2, PGF2 alpha, 12-hydroxy heptadecatrienoic acid, 15-HETE, and 11-HETE. In addition, extracts from UV ECs contained 12-HETE, 5-HETE, 14,15-EET, and 5,6-EET as minor products, whereas extracts from UA ECs contained only 12-HETE as a minor product. UA ECs also produced metabolites comigrating with 14,15-EET, 11,12-EET, 8,9-EET, and 5,6-EET. Histamine increased the release of (/sup 14/C)PGs and (/sup 14/C)HETEs from (/sup 14/C)arachidonic acid-labeled ECs. Indomethacin, aspirin, and nordihydroguauretic acid completely inhibited synthesis of both (/sup 14/C)PGs and (/sup 14/C)HETEs from exogenous (/sup 14/C)arachidonic acid in these cells. Microsomes metabolized (/sup 14/C)arachidonic acid to the same (/sup 14/C)PGs and (/sup 14/C)HETEs as intact cells. Pretreatment of microsomes with indomethacin completely inhibited formation of these products. These data indicate that UA ECs and UV ECs metabolize endogenous and exogenous arachidonic acid to both PGs and HETEs. Also 15-HETE and 11-HETE appear to be synthesized by a microsomal enzyme with the properties of cyclooxygenase.

  16. Lipoxygenase- and cyclooxygenase-reaction products and incorporation into glycerolipids or radiolabeled arachidonic acid in the bovine retina

    SciTech Connect

    Birkle, D.L.; Bazan, N.G.

    1984-02-01

    The metabolism of radiolabeled arachidonic acid (AA) by the intact bovine retina in vitro has been studied. Synthesis of prostaglandins (PGs) and hydroxyeicosatetraenoic acids (HETEs), and incorporation of AA into glycerolipids has been measured by reverse-phase and straight-phase high performance liquid chromatography with flow scintillation detection, and by thin-layer chromatography. AA was actively acylated into glycerolipids, particularly triglycerides, phosphatidylcholine and phosphatidylinositol. AA was also converted to the major PGs, PGF2 alpha, PGE2, PGD2, 6-keto-PGF1 alpha and TXB2, and to the lipoxygenase reaction products, 12-HETE, 5-HETE, and other monohydroxy isomers. Approximately 6% of the radiolabeled AA was converted to eicosanoids. The synthesis of HETEs was inhibited in a concentration-dependent manner (IC50 . 8.3 nM) by nordihydroguaiaretic acid (NDGA). PG synthesis was inhibited by aspirin (10 microM), indomethacin (1 microM) and NDGA (IC50 . 380 nM). Metabolism of AA via lipoxygenase, cyclooxygenase and activation-acylation was inhibited by boiling retinal tissue prior to incubation. These studies demonstrate an active system for the uptake and utilization of AA in the bovine retina, and provide the first evidence of lipoxygenase-mediated metabolism of AA, resulting in the synthesis of mono-hydroxyeicosatetraenoic acids, in the retina.

  17. Hangover headache and prostaglandins: prophylactic treatment with tolfenamic acid.

    PubMed

    Kaivola, S; Parantainen, J; Osterman, T; Timonen, H

    1983-03-01

    Tolfenamic acid (TA), a potent inhibitor of prostaglandin (PG) biosynthesis and action, was tested prophylactically against hangover symptoms in 30 healthy volunteers in a double-blind cross-over study. One capsule of TA (200 mg) or placebo was taken before starting to drink alcohol and another before going to bed. The hangover symptoms were evaluated in the morning. TA was found significantly better than placebo in the subjective evaluation of drug efficacy (p less than 0.001) and in reducing the reported hangover symptoms in general (p less than 0.01). In the TA group, significantly lower symptom scores were obtained for headache (p less than 0.01), and for nausea, vomiting, irritation, tremor, thirst and dryness of mouth (all p less than 0.05). In a separate study with eight participants, plasma levels of PGs were followed during ingestion of alcohol with or without TA. The plasma concentrations of PGE2 and TXB2 (a metabolite of thromboxane A2) were lower in the TA group during alcohol ingestion, while PGF2 alpha and 6-keto-PGF1 alpha (a metabolite of prostacyclin) were unaffected. TXB2 correlated with blood alcohol levels in a U-shaped manner.

  18. Determination of Alpha

    NASA Astrophysics Data System (ADS)

    Chmeissani, Mokhtar Abdallah

    The determination of the strong coupling constant alpha_ s, using Energy-Energy Correlation Asymmetry and jet mass difference with Mark II data at SLC (91 GeV) is presented. In Energy-Energy Correlation Asymmetry (EECA), we used the same systematic procedure used to determine alpha_ s with MARK II data at PEP (29 GeV). The chi^2 fit suggests that alpha_ s = 0.119 +/- 0.007(stat.) +/- 0.007(syst.). In addition, we used the EECA method to determine the QCD scale parameter Lambda_{LLA}. The chi^2 fit suggests that Lambda _{LLA} = 420 +/- 90(stat.) MeV. In the jet mass difference method, the determination of alpha_ s is based on QCD calculations up to 2nd order. We showed that in this method we are able to reproduce the value of alpha _ s from a Monte Carlo sample to a very high accuracy. The result with this method is alpha _ s = 0.134 +/- 0.085(stat.) +/- 0.004(syst.). The two values of alpha_ s presented in this work are in agreement within the error bars and in a good agreement with recent results of alpha_ s published from other e^+e^- experiments.

  19. Event counting alpha detector

    DOEpatents

    Bolton, R.D.; MacArthur, D.W.

    1996-08-27

    An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

  20. Event counting alpha detector

    DOEpatents

    Bolton, Richard D.; MacArthur, Duncan W.

    1996-01-01

    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  1. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  2. Imaging alpha particle detector

    DOEpatents

    Anderson, David F.

    1985-01-01

    A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  3. The alpha channeling effect

    SciTech Connect

    Fisch, N. J.

    2015-12-10

    Alpha particles born through fusion reactions in a tokamak reactor tend to slow down on electrons, but that could take up to hundreds of milliseconds. Before that happens, the energy in these alpha particles can destabilize on collisionless timescales toroidal Alfven modes and other waves, in a way deleterious to energy confinement. However, it has been speculated that this energy might be instead be channeled into useful energy, so as to heat fuel ions or to drive current. Such a channeling needs to be catalyzed by waves Waves can produce diffusion in energy of the alpha particles in a way that is strictly coupled to diffusion in space. If these diffusion paths in energy-position space point from high energy in the center to low energy on the periphery, then alpha particles will be cooled while forced to the periphery. The energy from the alpha particles is absorbed by the wave. The amplified wave can then heat ions or drive current. This process or paradigm for extracting alpha particle energy collisionlessly has been called alpha channeling. While the effect is speculative, the upside potential for economical fusion is immense. The paradigm also operates more generally in other contexts of magnetically confined plasma.

  4. Alpha One Foundation

    MedlinePlus

    ... related programs More News Our Number One Goal: Find a cure for Alpha-1. Website Sponsors Helpful Links 3300 Ponce de Leon Blvd. Coral Gables, FL 33134 Phone: (877) 228-7321 Email: info@alphaone.org Copyright ...

  5. Altered secretion of selected arachidonic acid metabolites during subclinical endometritis relative to estrous cycle stage and grade of fibrosis in mares.

    PubMed

    Gajos, Katarzyna; Kozdrowski, Roland; Nowak, Marcin; Siemieniuch, Marta J

    2015-08-01

    Mares that fail to become pregnant after repeated breeding, without showing typical signs of clinical endometritis, should be suspected of subclinical endometritis (SE). Contact with infectious agents results in altered synthesis and secretion of inflammatory mediators, including cytokines and arachidonic acid metabolites, and disturbs endometrial functional balance. To address the hypothesis that SE affects the immune endocrine status of the equine endometrium, spontaneous secretion of prostaglandin E(2) (PGE(2)), prostaglandin F(2α) (PGF(2α)), 6-keto-PGF(1α )(a metabolite of prostacyclin I(2)), leukotriene B(4) (LTB(4)), and leukotriene C(4) (LTC(4)) was examined. In addition, secretion of these factors was examined relative to the grade of inflammation, fibrosis, and estrous cycle stage. Eighty-two warmblood mares, of known breeding history, were enrolled in this study. On the basis of histopathologic assessment, mares were classified as suffering from first-grade SE, second-grade SE, or being healthy. The grade of fibrosis and the infiltration of endometrial tissue with polymorphonuclear leukocytes were examined by routine hematoxylin-eosin staining. In mares suffering from SE, the secretion profiles of PGE(2), 6-keto-PGF(1α), LTB(4), and LTC(4) were changed compared to mares that did not suffer from endometritis. The secretion of PGE(2) and 6-keto-PGF1α was increased, whereas that of LTB(4) and LTC(4) was decreased. Secretion of 6-keto-PGF(1α) was increased in first- and second-grade SE (P < 0.01). The concentration of PGI(2) metabolite was increased only in inflamed endometrium, independently of the inflammation grade, but was not affected by fibrosis. Prostaglandin E(2) secretion was increased in second-grade SE (P < 0.05). The secretion of LTB(4) decreased in both first- and second-grade SE (P < 0.05), whereas secretion of LTC(4) was decreased only in second-grade SE (P < 0.05). Fibrosis did not change the secretion profile of PGE(2), PGF(2α), and 6

  6. Alpha Particle Diagnostic

    SciTech Connect

    Fisher, Ray, K.

    2009-05-13

    The study of burning plasmas is the next frontier in fusion energy research, and will be a major objective of the U.S. fusion program through U.S. collaboration with our international partners on the ITER Project. For DT magnetic fusion to be useful for energy production, it is essential that the energetic alpha particles produced by the fusion reactions be confined long enough to deposit a significant fraction of their initial ~3.5 MeV energy in the plasma before they are lost. Development of diagnostics to study the behavior of energetic confined alpha particles is a very important if not essential part of burning plasma research. Despite the clear need for these measurements, development of diagnostics to study confined the fast confined alphas to date has proven extremely difficult, and the available techniques remain for the most part unproven and with significant uncertainties. Research under this grant had the goal of developing diagnostics of fast confined alphas, primarily based on measurements of the neutron and ion tails resulting from alpha particle knock-on collisions with the plasma deuterium and tritium fuel ions. One of the strengths of this approach is the ability to measure the alphas in the hot plasma core where the interesting ignition physics will occur.

  7. Stimulated arachidonate metabolism during foam cell transformation of mouse peritoneal macrophages with oxidized low density lipoprotein.

    PubMed Central

    Yokode, M; Kita, T; Kikawa, Y; Ogorochi, T; Narumiya, S; Kawai, C

    1988-01-01

    Changes in arachidonate metabolism were examined in mouse peritoneal macrophages incubated with various types of lipoproteins. Oxidized low density lipoprotein (LDL) was incorporated by macrophages and stimulated macrophage prostaglandin E2 (PGE2) and leukotriene C4 syntheses, respectively, 10.8- and 10.7-fold higher than by the control. Production of 6-keto-PGF1 alpha, a stable metabolite of prostacyclin, was also stimulated. No stimulation was found with native LDL, which was minimally incorporated by the cells. Acetylated LDL and beta-migrating very low density lipoprotein (beta-VLDL), though incorporated more efficiently than oxidized LDL, also had no stimulatory effect. When oxidized LDL was separated into the lipoprotein-lipid peroxide complex and free lipid peroxides, most of the stimulatory activity was found in the former fraction, indicating that stimulation of arachidonate metabolism in the cell is associated with uptake of the lipoprotein-lipid peroxide complex. These results suggest that peroxidative modification of LDL could contribute to the progression of atheroma by stimulating arachidonate metabolism during incorporation into macrophages. Images PMID:3125226

  8. The use of carprofen, a non-steroidal antiinflammatory agent, in peptic ulcer diseases.

    PubMed

    Konturek, S J; Kwiecień, N; Obtulowicz, W; Zmuda, A; Polański, M; Kopp, B; Sito, E; Oleksy, J

    1983-12-01

    The effects of carprofen (Roche), a nonsteroid antiinflammatory agent, on gastric secretion, serum gastrin level, electropotential difference (PD), gastric microbleeding, DNA loss, and the generation of mucosal prostaglandins (PGs) were examined in 20 duodenal ulcer patients with active ulcer (15 patients) or in remission (5 patients). Carprofen administered for one-week period at a therapeutic dose (300 mg/day) was well tolerated by all ulcer patients and no adverse effects were observed during or after treatment. Endoscopy performed after carprofen treatment showed complete ulcer healing in 9 out of 15 patients and no exacerbations were observed in the rest of patients. No significant changes were observed in basal or pentagastrin-induced secretion, PD, gastric microbleeding and DNA loss. The generation of PGE2, 6-keto-PGF1 alpha and thromboxane B2 was not affected by the treatment with carprofen. This study indicates that carprofen shows excellent gastrointestinal tolerance in ulcer patients, and it might be useful in the treatment of arthritic patients with peptic ulcer disease.

  9. Acceleration of atherogenesis by COX-1-dependent prostanoid formation in low density lipoprotein receptor knockout mice.

    PubMed

    Praticò, D; Tillmann, C; Zhang, Z B; Li, H; FitzGerald, G A

    2001-03-13

    The cyclooxygenase (COX) product, prostacyclin (PGI(2)), inhibits platelet activation and vascular smooth-muscle cell migration and proliferation. Biochemically selective inhibition of COX-2 reduces PGI(2) biosynthesis substantially in humans. Because deletion of the PGI(2) receptor accelerates atherogenesis in the fat-fed low density lipoprotein receptor knockout mouse, we wished to determine whether selective inhibition of COX-2 would accelerate atherogenesis in this model. To address this hypothesis, we used dosing with nimesulide, which inhibited COX-2 ex vivo, depressed urinary 2,3 dinor 6-keto PGF(1alpha) by approximately 60% but had no effect on thromboxane formation by platelets, which only express COX-1. By contrast, the isoform nonspecific inhibitor, indomethacin, suppressed platelet function and thromboxane formation ex vivo and in vivo, coincident with effects on PGI(2) biosynthesis indistinguishable from nimesulide. Indomethacin reduced the extent of atherosclerosis by 55 +/- 4%, whereas nimesulide failed to increase the rate of atherogenesis. Despite their divergent effects on atherogenesis, both drugs depressed two indices of systemic inflammation, soluble intracellular adhesion molecule-1, and monocyte chemoattractant protein-1 to a similar but incomplete degree. Neither drug altered serum lipids and the marked increase in vascular expression of COX-2 during atherogenesis. Accelerated progression of atherosclerosis is unlikely during chronic intake of specific COX-2 inhibitors. Furthermore, evidence that COX-1-derived prostanoids contribute to atherogenesis suggests that controlled evaluation of the effects of nonsteroidal anti-inflammatory drugs and/or aspirin on plaque progression in humans is timely.

  10. The interaction of sodium nitroprusside with human endothelial cells and platelets: nitroprusside and prostacyclin synergistically inhibit platelet function

    SciTech Connect

    Levin, R.I.; Weksler, B.B.; Jaffe, E.A.

    1982-12-01

    Sodium nitroprusside (NP) is a potent vasodilator that also inhibits platelet aggregation. To test the hypothesis that NP causes both of these effects by altering the balance between prostacyclin (PGI2) produced by endothelial cells and thromboxane A2 (TXA2) produced by platelets, we incubated each of these cell types with NP for 5 minutes and assayed the PGI2 and TXA2 produced. NP at pharmacologically achieved doses (0.01--30 micrograms/ml) inhibited platelet aggregation and resultant TXA2 synthesis in a dose- and time-dependent manner (p less than 0.001). The inhibition was not dependent on cAMP production, external calcium concentration, or suppression of TXA2 synthesis. NP did not alter the production of PGI2 by cultured human endothelial cells as measured by radioimmunoassay for 6-Keto-PGF1 alpha, the stable hydrolysis product of PGI2. However, supernates of NP-treated endothelial cells containing low, noninhibitory concentrations of NP unexpectedly inhibited platelet aggregation. This inhibition of platelet aggregation was due to synergy between PGI2 (0.1--3 nM) and NP (p interaction less than 0.03). The synergistic inhibition by NP and PGI2 of platelet aggregation and TXA2 synthesis in vivo may explain some of the beneficial actions of NP in the treatment of hypertension and congestive heart failure.

  11. Influence of endogenous prostaglandins on mTAL injury.

    PubMed

    Silva, P; Rosen, S; Spokes, K; Taylor, M; Epstein, F H

    1990-11-01

    We altered renal prostaglandin production by isolated rat kidneys in several ways to see if this would influence the susceptibility of cells lining the medullary thick ascending limb to injury. Rats were fed a diet containing either safflower oil (high in linoleic acid) or fish oil (low in arachidonate precursors) as a source of fat. After 90 min of perfusion, the kidneys of rats fed safflower oil showed only 32.7 +/- 6.7% of medullary thick ascending limb cells near the inner medulla with severe damage, whereas the same zone in perfused kidneys of rats fed fish oil showed 96.6 +/- 1.3% severely damaged cells (P less than 0.01). The protection afforded by safflower oil was accompanied by a doubling of urinary excretion of PGE2 and 6-keto-PGF1 alpha, and was eliminated by indomethacin, which suppressed prostaglandin synthesis. Perfusion with bradykinin also greatly increased prostaglandin excretion and reduced severe medullary thick ascending limb damage in the deepest zone of the outer medulla from 51.3 +/- 6.6% in controls to 28.5 +/- 5.9% (P less than 0.02). The protection provided by bradykinin was also completely reversed by indomethacin. The results suggest that endogenous prostaglandins serve a protective function against hypoxic injury for cells of the medullary thick ascending limb.

  12. Effect of dietary palm oil and its fractions on rat plasma and high density lipoprotein lipids.

    PubMed

    Sundram, K; Khor, H T; Ong, A S

    1990-04-01

    Male Sprague Dawley rats were fed semipurified diets containing 20% fat for 15 weeks. The dietary fats were corn oil, soybean oil, palm oil, palm olein and palm stearin. No differences in the body and organ weights of rats fed the various diets were evident. Plasma cholesterol levels of rats fed soybean oil were significantly lower than those of rats fed corn oil, palm oil, palm olein or palm stearin. Significant differences between the plasma cholesterol content of rats fed corn oil and rats fed the three palm oils were not evident. HDL cholesterol was raised in rats fed the three palm oil diets compared to the rats fed either corn oil or soybean oil. The cholesterol-phospholipid molar ratio of rat platelets was not influenced by the dietary fat type. The formation of 6-keto-PGF1 alpha was significantly enhanced in palm oil-fed rats compared to all other dietary treatments. Fatty acid compositional changes in the plasma cholesterol esters and plasma triglycerides were diet regulated with significant differences between rats fed the polyunsaturated corn and soybean oil compared to the three palm oils.

  13. The effect of ozone exposure on rat alveolar macrophage arachidonic acid metabolism

    SciTech Connect

    Madden, M.C.; Eling, T.E.; Dailey, L.A.; Friedman, M. )

    1991-01-01

    Rat alveolar macrophages were prelabeled with {sup 3}H-arachidonic acid ({sup 3}H-AA) and exposed to air or O3 (0.1-1.0 ppm) in vitro for 2 h. Alveolar macrophages released 3.6-fold more tritium at the 1.0 ppm exposure concentration compared with air-exposed macrophages. A significantly increased production of several {sup 3}H-AA metabolites, including 6-keto-PGF1 alpha, thromboxane B2, 12-hydroxy-5,8,10-heptadecatrienoic acid, prostaglandins E2 and D2, leukotrienes B4 and D4, and 15-hydroxyeicosatetraenoic acid was formed by macrophages exposed to 1.0 ppm O3 compared with air-exposed macrophages as determined by high performance liquid chromatography (HPLC) analysis. O3 exposure did not alter macrophage {sup 3}H-AA metabolism in response to calcium ionophore A23187. The largest tritiated peak observed in the HPLC chromatograms of O{sub 3}-exposed cells was a polar complex of products that contained various phospholipids and neutral lipids (including diacylglycerol) and possibly degradation products of {sup 3}H-AA and some of its metabolites. These changes in macrophage arachidonic acid metabolism may play an important role in the lung response to O{sub 3} exposure in vivo.

  14. Decreased arachidonic acid content and metabolism in tissues of NZB/W F1 females fed a diet containing 0. 45% dehydroisoandrosterone (DHA)

    SciTech Connect

    Matsunaga, A.; Cottam, G.L.

    1987-05-01

    A diet containing 0.45% DHA fed to NZB/W mice, a model of systemic lupus erythematosus, delays the time of onset, improves survival and decreases the formation of antibodies to ds-DNA. Essential fatty acid-deficient diets or inclusion of eicosapentaenoic acid have similar beneficial effects and led them to investigate arachidonic acid metabolism in response to feeding DHA. The arachidonic acid content of plasma cholesteryl ester decreased from 37.4 +/- 2.2 to 28.2 +/- 1.3 mg%. In total liver phospholipid the value decreased from 18.1 +/- 0.52 to 13.7 +/- 1.3 mg%, in total kidney phospholipid the value decreased from 24.10 +/- 0.87 to 20.7 +/- 0.32 mg% and in resident peritoneal macrophages the value decreased from 15.4 +/- 4.6 to 3.6 +/- 1.4 mg%. The metabolism of exogenous (1-/sup 14/C)arachidonic acid by resident peritoneal macrophages in response to Zymosan stimulation for 2 hr was examined by extraction of metabolites and separation by HPLC. Cells isolated from DHA-fed animals produced less PGE2 than controls, yet similar amounts of 6-keto PGF1..cap alpha.. were produced. Arachidonic acid metabolites have significant effects on the immune system and may be a mechanism involved in the benefits obtained by inclusion of DHA in the diet.

  15. Increased thromboxane production in women with a history of venous thromboembolic event: effect of heparins.

    PubMed

    Kaaja, R; Pettilä, V; Leinonen, P; Ylikorkala, O

    2001-09-01

    We investigated the production of prostacyclin and thromboxane in pregnant women with a previous venous thromboembolic event before, during and after the use of unfractionated heparin and low molecular weight heparin (dalteparin). Twenty women were studied before starting heparin prophylaxis (before 20 weeks of gestation), during heparin prophylaxis (at 30 weeks of gestation) and after heparin prophylaxis (16 weeks after delivery). Ten pregnant women with no history of thromboembolism were studied as the control group. Urinary output of the stable metabolite of prostacyclin (2,3-dinor-6-keto-PGF1alpha) and that of thromboxane A2 (2,3-dinor-TxB2), as well as a number of markers of thrombophilia were measured and expressed as mean (+/-SEM). Women with a history of thromboembolism were characterized by normal prostacyclin production but elevated thromboxane production (44.0 +/- 4.1 versus 19.0 +/- 3.6 ng/mmol creatinine, P < 0.001) at 12 weeks of pregnancy. Heparin prophylaxis (regardless of the type) had abolished elevated thromboxane concentrations at 30 weeks of gestation. Four months after delivery, thromboxane dominance had returned (25.2 +/- 3.5 versus 13.6 +/- 2.1 ng/mmol creatinine, P < 0.01). The presence of hereditary thrombophilia (9/20) was not associated with any changes in prostanoid concentrations. Thus, women with a history of venous thromboembolic events have thromboxane dominance during and after pregnancy, but this dominance can be eliminated through the use of heparins. PMID:11552994

  16. Lipoxygenase products mediate the attachment of rat macrophages to glomeruli in vitro

    SciTech Connect

    Baud, L.; Sraer, J.; Delarue, F.; Bens, M.; Balavoine, F.; Schlondorff, D.; Ardaillou, R.; Sraer, J.D.

    1985-06-01

    Because there is an accumulation of macrophages in the Bowman's space during human and experimental glomerulonephritis, the authors have studied the binding of (/sup 3/H)-uridine labeled macrophages to isolated glomeruli. Binding was related to the glomerular protein and macrophage concentrations, temperature, time of incubation, and was a saturable process. Macrophage adherence depended on glomerular lipoxygenase activity but not on glomerular cyclooxygenase activity since preincubation of glomeruli with nordihydroguaiaretic acid (NDGA) inhibited this phenomenon whereas preincubation with indomethacin was ineffective. Glomeruli interacted with macrophages in converting arachidonic acid (C20:4) to prostaglandins (PG) since productions of 6 keto-PGF1 alpha, TXB2, and PGD2 by glomeruli and macrophages incubated in combination were much greater than the sums of their respective productions by glomeruli and macrophages incubated separately. Macrophages were the source of the supplementary synthesis of PG which was abolished when these cells were pretreated with aspirin. Stimulation of macrophages by glomeruli was blunted by pretreatment of glomeruli with NDGA. Production of PG and of 12-HETE by macrophages was stimulated by a lipid extract of glomeruli containing the oxygenated metabolites of C20:4. Direct addition of 12-HPETE also stimulated macrophage functions. These data suggest that macrophage attachment to glomeruli and macrophage stimulation in the presence of glomeruli depend on glomerular lipoxygenase activity.

  17. Effect of radiation on prostacyclin (PGI2) production by cultured endothelial cells

    SciTech Connect

    Eldor, A.; Vlodavsky, I.; Hyam, E.; Atzmon, R.; Fuks, Z.

    1983-02-01

    The effect of ionizing irradiation on the synthesis of prostacyclin (PGI2) by cultured bovine aortic endothelial cells was determined. PGI2 was measured in the culture medium by a radioimmunoassay for 6-Keto PGF1 alpha. Two phenomena were observed following irradiation: a) Cells which suffered an immediate radiation damage (1000-5000 rads) released high quantities of PGI2 to the culture medium. This was due to a de novo synthesis of PGI2 stimulated by radiation induced cellular damage, since pretreatment with aspirin of the endothelial cell monolayers resulted in a marked inhibition of PGI2 release following irradiation. b) Metabolically active cells which remained confluent and firmly attached to the culture dish following single, low and intermediate doses (200-1200 rads) radiation, exhibited a marked decrease in their capacity to synthesize PGI2 upon exposure to various stimuli of the arachidonic acid cascade. Similar results were observed with cells treated with fractionated radiation. The quantities of PGI2 produced by the endothelial cells decreased as a function of the dose of radiation and time interval between irradiation and subsequent stimulation. The effect of radiation on PGI2 production by the vascular endothelium may be relevant to the development of radiation induced capillary occlusions, and the enhancement of atherosclerotic lesions in large vessels.

  18. Glomerular and tubular adaptive responses to acute nephron loss in the rat. Effect of prostaglandin synthesis inhibition.

    PubMed Central

    Pelayo, J C; Shanley, P F

    1990-01-01

    These studies, using in vivo micropuncture techniques in the Munich-Wistar rat, document the magnitude of changes in glomerular and tubular function and structure 24 h after approximately 75% nephron loss (Nx) and compared these results with those obtained in sham-operated rats. The contribution of either nephron hypertrophy or renal prostaglandin to these adjustments in nephron function was also explored. After acute Nx, single nephron GFR (SNGFR) was increased, on average by approximately 30%, due primarily to glomerular hyperperfusion and hypertension. The approximately 45% reduction in preglomerular and the constancy in postglomerular vascular resistances was entirely responsible for these adaptations. Although increases in fluid reabsorption in proximal convoluted tubules correlated closely with increase in SNGFR, the fractional fluid reabsorption between late proximal and early distal tubular segments was depressed. Nephron hypertrophy could not be substantiated based on either measurements of protein content in renal tissue homogenates or morphometric analysis of proximal convoluted tubules. However, acute Nx was associated with increased urinary excretory rates per functional nephron for 6-keto-PGF1 alpha and TXB2. Prostaglandin synthesis inhibition did not affect function in control nephrons, but this maneuver was associated with normalization of glomerular and tubular function in remnant nephrons. The results suggest that enhanced synthesis of cyclooxygenase-dependent products is one of the earliest responses to Nx, and even before hypertrophy the pathophysiologic effects of prostaglandin may be important contributors to the adaptations in remnant nephron function. PMID:1693376

  19. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  20. Portable alpha spectrometer.

    PubMed

    Martín Sánchez, A; de la Torre Pérez, J

    2012-09-01

    Many portable devices have been designed to detect γ-rays or alpha and beta particles. Most of the α-particle detectors give the total count as a result, without identifying the radionuclides existing in the sample. The development of a device allowing rapid and straightforward α-particle spectrometry would be very useful for detecting the radioactive contents of unknown samples. This work describes the construction of a portable device using silicon semiconductor detectors designed to rapidly detect and possibly identify alpha-emitting radionuclides.

  1. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  2. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  3. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  4. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.

    1998-08-19

    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  5. {alpha}-Decay half-lives, {alpha}-capture, and {alpha}-nucleus potential

    SciTech Connect

    Denisov, V. Yu. Khudenko, A.A.

    2009-11-15

    {alpha}-Decay half-lives and {alpha}-capture cross sections are evaluated in the framework of a unified model for {alpha}-decay and {alpha}-capture. In this model {alpha}-decay and {alpha}-capture are considered as penetration of the {alpha}-particle through the potential barrier formed by the nuclear, Coulomb, and centrifugal interactions between the {alpha}-particle and nucleus. The spins and parities of the parent and daughter nuclei as well as the quadrupole and hexadecapole deformations of the daughter nuclei are taken into account for evaluation of the {alpha}-decay half-lives. The {alpha}-decay half-lives for 344 nuclei and the {alpha}-capture cross sections of {sup 40}Ca, {sup 44}Ca, {sup 59}Co, {sup 208}Pb, and {sup 209}Bi agree well with the experimental data. The evaluated {alpha}-decay half-lives within the range of 10{sup -9}{<=}T{sub 1/2}{<=}10{sup 38} s for 1246 {alpha}-emitters are tabulated.

  6. Effects of ozone on cyclooxygenase metabolites in the baboon tracheobronchial tree

    SciTech Connect

    Fouke, J.M.; DeLemos, R.A.; Dunn, M.J.; McFadden, E.R. Jr. )

    1990-07-01

    Short-term exposure to 0.5 parts per million (ppm) ozone has been shown to cause an increase in respiratory resistance in primates that can be diminished by 50% with pretreatment with cromolyn sodium. Because of the known membrane-stabilizing effects of cromolyn and the resultant inhibition of mediator production, we hypothesized a role for the products of arachidonic acid (AA) metabolism in these events. We exposed five adult male baboons to 0.5 ppm ozone on two occasions, once with cromolyn pretreatment and once without. Pulmonary resistance (RL) was monitored and bronchoalveolar lavage (BAL) was performed before and after each exposure. The BAL was analyzed for a stable hydrolysis product of prostacyclin, 6-keto-prostaglandin (PG) F1 alpha, PGE2, a stable hydrolysis product of thromboxane (Tx) A2, TxB2, and PGF2 alpha. RL increased after ozone exposure (1.62 +/- 0.23 to 3.77 +/- 0.51 cmH2O.l-1.s, difference 2.15; P less than 0.02), and this effect was partially blocked by cromolyn (1.93 +/- 0.09 to 3.18 +/- 0.40 cmH2O.l-1.s, difference 1.25; P less than 0.02). The base-line levels of the metabolites of AA in the BAL were as follows (in pg/ml): 6-keto-PGF1 alpha 72.78 +/- 12.6, PGE2 145.92 +/- 30.52, TxB2 52.52 +/- 9.56, and PGF2 alpha 22.28 +/- 5.42. Ozone exposure had no effect on the level of any of these prostanoids (P = NS). These studies quantify the magnitude of cyclooxygenase products of AA metabolism in BAL from baboon lungs and demonstrate that changes in the levels of these mediators in BAL are not prerequisites for ozone-induced increases in respiratory resistance.

  7. Simultaneous quantification of GABAergic 3alpha,5alpha/3alpha,5beta neuroactive steroids in human and rat serum.

    PubMed

    Porcu, Patrizia; O'Buckley, Todd K; Alward, Sarah E; Marx, Christine E; Shampine, Lawrence J; Girdler, Susan S; Morrow, A Leslie

    2009-01-01

    The 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone enhance GABAergic neurotransmission and produce inhibitory neurobehavioral and anti-inflammatory effects. Despite substantial information on the progesterone derivative (3alpha,5alpha)-3-hydroxypregnan-20-one (3alpha,5alpha-THP, allopregnanolone), the physiological significance of the other endogenous GABAergic neuroactive steroids has remained elusive. Here, we describe the validation of a method using gas chromatography-mass spectrometry to simultaneously identify serum levels of the eight 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone. The method shows specificity, sensitivity and enhanced throughput compared to other methods already available for neuroactive steroid quantification. Administration of pregnenolone to rats and progesterone to women produced selective effects on the 3alpha,5alpha- and 3alpha,5beta-reduced neuroactive steroids, indicating differential regulation of their biosynthetic pathways. Pregnenolone administration increased serum levels of 3alpha,5alpha-THP (+1488%, p<0.001), (3alpha,5alpha)-3,21-dihydroxypregnan-20-one (3alpha,5alpha-THDOC, +205%, p<0.01), (3alpha,5alpha)-3-hydroxyandrostan-17-one (3alpha,5alpha-A, +216%, p<0.001), (3alpha,5alpha,17beta)-androstane-3,17-diol (3alpha,5alpha-A-diol, +190%, p<0.01). (3alpha,5beta)-3-hydroxypregnan-20-one (3alpha,5beta-THP) and (3alpha,5beta)-3-hydroxyandrostan-17-one (3alpha,5beta-A) were not altered, while (3alpha,5beta)-3,21-dihydroxypregnan-20-one (3alpha,5beta-THDOC) and (3alpha,5beta,17beta)-androstane-3,17-diol (3alpha,5beta-A-diol) were increased from undetectable levels to 271+/-100 and 2.4+/-0.9 pg+/-SEM, respectively (5/8 rats). Progesterone administration increased serum levels of 3alpha,5alpha-THP (+1806%, p<0.0001), 3alpha,5beta-THP (+575%, p<0.001), 3alpha,5alpha

  8. Acrolein stimulates eicosanoid release from bovine airway epithelial cells

    SciTech Connect

    Doupnik, C.A.; Leikauf, G.D. )

    1990-10-01

    Injury to the airway mucosa after exposure to environmental irritants is associated with pulmonary inflammation and bronchial hyperresponsiveness. To better understand the relationships between mediator release and airway epithelial cell injury during irritant exposures, we studied the effects of acrolein, a low-molecular-weight aldehyde found in cigarette smoke, on arachidonic acid metabolism in cultured bovine tracheal epithelial cells. Confluent airway epithelial cell monolayers, prelabeled with (3H)arachidonic acid, released significant levels of 3H activity when exposed (20 min) to 100 microM acrolein. (3H)arachidonic acid products were resolved using reverse-phase high-performance liquid chromatography. Under control conditions the released 3H activity coeluted predominantly with the cyclooxygenase product, prostaglandin (PG) E2. After exposure to acrolein, significant peaks in 3H activity coeluted with the lipoxygenase products 12-hydroxyeicosatetraenoic acid (HETE) and 15-HETE, as well as with PGE2, PGF2 alpha, and 6-keto-PGF1 alpha. Dose-response relationships for acrolein-induced release of immunoreactive PGF2 alpha and PGE2 from unlabeled epithelial monolayers demonstrated 30 microM acrolein as the threshold dose, with 100 microM acrolein inducing nearly a fivefold increase in both PGF2 alpha and PGE2. Cellular viability after exposure to 100 microM acrolein, determined by released lactate dehydrogenase activity, was not affected until exposure periods were greater than or equal to 2 h. These results implicate the airway epithelial cell as a possible source of eicosanoids after exposure to acrolein.

  9. Proteinaceous alpha-amylase inhibitors.

    PubMed

    Svensson, Birte; Fukuda, Kenji; Nielsen, Peter K; Bønsager, Birgit C

    2004-02-12

    Proteins that inhibit alpha-amylases have been isolated from plants and microorganisms. These inhibitors can have natural roles in the control of endogenous alpha-amylase activity or in defence against pathogens and pests; certain inhibitors are reported to be antinutritional factors. The alpha-amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha-amylases in complex with inhibitors from five families. These structures indicate major diversity but also some similarity in the structural basis of alpha-amylase inhibition. Mutational analysis of the mechanism of inhibition was performed in a few cases and various protein engineering and biotechnological approaches have been outlined for exploitation of the inhibitory function. PMID:14871655

  10. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W.; Allander, Krag S.; Bounds, John A.

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  11. Background canceling surface alpha detector

    DOEpatents

    MacArthur, D.W.; Allander, K.S.; Bounds, J.A.

    1996-06-11

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

  12. Long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.

    1993-02-02

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  13. Lorentz violation and {alpha} decay

    SciTech Connect

    Altschul, Brett

    2009-01-01

    Relating the effective Lorentz violation coefficients for composite particles to the coefficients for their constituent fields is a challenging problem. We calculate the Lorentz violation coefficients relevant to the dynamics of an {alpha} particle in terms of proton and neutron coefficients. The {alpha}-particle coefficients would lead to anisotropies in the {alpha} decays of nuclei, and because the decay process involves quantum tunneling, the effects of any Lorentz violations could be exponentially enhanced.

  14. Long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; Wolf, Michael A.; McAtee, James L.; Unruh, Wesley P.; Cucchiara, Alfred L.; Huchton, Roger L.

    1993-01-01

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  15. Modeling Solar Lyman Alpha Irradiance

    NASA Technical Reports Server (NTRS)

    Pap, J.; Hudson, H. S.; Rottman, G. J.; Willson, R. C.; Donnelly, R. F.; London, J.

    1990-01-01

    Solar Lyman alpha irradiance is estimated from various solar indices using linear regression analyses. Models developed with multiple linear regression analysis, including daily values and 81-day running means of solar indices, predict reasonably well both the short- and long-term variations observed in Lyman alpha. It is shown that the full disk equivalent width of the He line at 1083 nm offers the best proxy for Lyman alpha, and that the total irradiance corrected for sunspot effect also has a high correlation with Lyman alpha.

  16. ISS Update: Alpha Magnetic Spectrometer

    NASA Video Gallery

    NASA Public Affairs Officer Kelly Humphries interviews Trent Martin, Johnson Space Center project manager for the Alpha Magnetic Spectrometer (AMS) aboard the International Space Station. Questions...

  17. Resting alpha activity predicts learning ability in alpha neurofeedback

    PubMed Central

    Wan, Feng; Nan, Wenya; Vai, Mang I.; Rosa, Agostinho

    2014-01-01

    Individuals differ in their ability to learn how to regulate the brain activity by neurofeedback. This study aimed to investigate whether the resting alpha activity can predict the learning ability in alpha neurofeedback. A total of 25 subjects performed 20 sessions of individualized alpha neurofeedback and the learning ability was assessed by three indices respectively: the training parameter changes between two periods, within a short period and across the whole training time. It was found that the resting alpha amplitude measured before training had significant positive correlations with all learning indices and could be used as a predictor for the learning ability prediction. This finding would help the researchers in not only predicting the training efficacy in individuals but also gaining further insight into the mechanisms of alpha neurofeedback. PMID:25071528

  18. Alpha Magnetic Spectrometer

    NASA Astrophysics Data System (ADS)

    Ting, Samuel

    2012-07-01

    The Alpha Magnetic Spectrometer (AMS) is a precision particle physics magnetic spectrometer designed to measure electrons, positrons, gamma rays and various nuclei and anti-nuclei from the cosmos up to TeV energy ranges. AMS weighs 7.5 tons and measures 5 meters by 4 meters by 3 meters. It contains 300,000 channels of electronics and 650 onboard microprocessors. It was delivered to the International Space Station onboard space shuttle Endeavour and installed on May 19, 2011. Since that time, more than 14 billion cosmic ray events have been collected. All the detectors function properly. At this moment, we are actively engaged in data analysis. AMS is an international collaboration involving 16 countries and 60 institutes. It took 16 years to construct and test. AMS is the only major physical science experiment on the International Space Station and will continue to collect data over the entire lifetime of the Space Station (10-20 years).

  19. Microscopic cluster model of {alpha}+n, {alpha}+p, {alpha}+ {sup 3}He, and {alpha}+{alpha} elastic scattering from a realistic effective nuclear interaction

    SciTech Connect

    Dohet-Eraly, J.; Baye, D.

    2011-07-15

    An effective nucleon-nucleon interaction adapted to cluster-model calculations of collisions is derived from the realistic Argonne potential AV18 with the unitary correlation operator method. The unitary correlation is determined from the {alpha}+{alpha} elastic phase shifts calculated in a cluster approach by the generator coordinate method coupled with the microscopic R-matrix method. With this interaction, the elastic phase shifts for the {alpha}+n, {alpha}+p, and {alpha}+{sup 3}He collisions are calculated within the same model. Without further adjustment, a good agreement with experimental data is obtained with a small model space.

  20. Alpha particle emitters in medicine

    SciTech Connect

    Fisher, D.R.

    1989-09-01

    Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ({sup 211}At) and natural bismuth-212 ({sup 212}Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ({sup 223}Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs.

  1. Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

    PubMed

    Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

    2006-01-01

    The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

  2. Genetics Home Reference: alpha-mannosidosis

    MedlinePlus

    ... Me Understand Genetics Home Health Conditions alpha-mannosidosis alpha-mannosidosis Enable Javascript to view the expand/collapse boxes. Download PDF Open All Close All Description Alpha-mannosidosis is a rare inherited disorder that causes ...

  3. Effect of vasoactive peptides on prostacyclin synthesis in man.

    PubMed Central

    Barrow, S. E.; Dollery, C. T.; Heavey, D. J.; Hickling, N. E.; Ritter, J. M.; Vial, J.

    1986-01-01

    Bradykinin, angiotensin II, arginine vasopressin (AVP) or des-amino-D-arginine vasopressin (DDAVP) were administered by intravenous infusion to 10 healthy men. The concentration of 6-oxo-prostaglandin F1 alpha (6-oxo-PGF1 alpha), the stable hydrolysis product of prostacyclin (PGI2), was measured in plasma using gas chromatography/negative ion chemical ionisation mass spectrometry. Dose-related increases in plasma concentrations of 6-oxo-PGF1 alpha occurred during administration of bradykinin (100-3200 ng kg-1 min-1). The concentrations of 6-oxo-PGF1 alpha rose from baseline values in the range less than 1.0-4.9 pg ml-1 to 24.9-47.6 pg ml-1 at maximum tolerated infusion rates. There were no changes in the concentrations of 6-oxo-PGF1 alpha during administration of angiotensin II, AVP or DDAVP at infusion rates which caused haemodynamic changes. PMID:3513880

  4. The synovial prostaglandin system in chronic inflammatory arthritis: differential effects of steroidal and nonsteroidal anti-inflammatory drugs

    PubMed Central

    Bombardieri, S.; Cattani, P.; Ciabattoni, G.; Di Munno, O.; Pasero, G.; Patrono, C.; Pinca, E.; Pugliese, F.

    1981-01-01

    1 The present study was undertaken to characterize the spectrum of arachidonic acid metabolites present in synovial effusions of patients with rheumatoid or psoriatic arthritis, and to compare changes in their concentration following a short-term treatment with 6α-methyl-prednisolone (6-MeP: 4-8 mg/day) or indoprofen (1.2 g/day), a nonsteroidal anti-inflammatory agent with proven synovial prostaglandin inhibitory effect. 2 Measurements of prostaglandin E2 (PGE2), thromboxane (TX) B2, 6-keto-PGF1α and PGF2α were performed by radioimmunoassay techniques in synovial effusions obtained from 23 patients, and validated by thin-layer chromatographic analysis of the extracted immunoreactivity. 3 PGE2 and TXB2 accounted for more than 60% of the total immunoreactivity in untreated patients. The absence of any constant ratio between the different arachidonic acid metabolites detected in synovial fluid is consistent with a heterogeneous cellular origin of these compounds. 4 Indoprofen treatment was associated with a consistent reduction of synovial prostaglandin and thromboxane concentrations, ranging from 36% in the case of 6-keto-PGF1α to 90% in the case of PGE2. 5 In contrast, 6-MeP caused opposite changes on different metabolites originating via the cyclo-oxygenase pathway. Thus, 6-keto-PGF1α concentrations were reduced by 35%, PGF2α concentrations were increased by 30%, while PGE2 and TXB2 were unchanged following 6-MeP. 6 Although the mechanism(s) underlying the failure of 6-MeP to reduce synovial PGE2 and TXB2 levels are uncertain, the results of the present study clearly indicate that therapeutic doses of steroidal and nonsteroidal anti-inflammatory drugs cause quite distinct changes in arachidonic acid metabolism, which might be relevant to their specific therapeutic actions and side-effects. PMID:6895043

  5. Magnesium is a cerebrovasodilator in newborn piglets.

    PubMed

    Kim, C R; Oh, W; Stonestreet, B S

    1997-01-01

    We tested the hypothesis that, in newborn piglets, magnesium results in a dose-dependent prostanoid-mediated cerebrovasodilation. Pial arterioles (50-200 microns in diameter) were serially measured, and cortical subarachnoid cerebrospinal fluid (CSF) was collected for radioimmunoassay of 6-ketoprostaglandin F1 alpha (6-keto-PGF1 alpha, hydrolysis product of prostacyclin) and thromboxane B2 (TxB2, metabolite of thromboxane A2) before and after CSF containing 1.2, 2.4, 4.8, and 9.6 mM MgCl2 was suffused over the parietal cortex under a closed cranial window in twelve 2- to 4-day-old piglets. Magnesium suffusion resulted (P < 0.05) in a dose-dependent pial arteriolar vasodilation. The increase in vessel diameter was greater (P < 0.001) with 2.4, 4.8, and 9.6 mM than with 1.2 mM concentration of magnesium. The increase in vessel diameter with 9.6 mM was also greater (P < 0.001) than with the 2.4 mM concentration of magnesium. Magnesium suffusion did not result in changes in cortical CSF prostanoid concentrations. The effect of intravenous indomethacin (5 mg/kg) on cyclooxygenase inhibition in the pial arterioles was confirmed by a 24 +/- 3% decrease in vessel diameter at the baseline (1.2 mM) magnesium concentration. In contrast, cyclooxygenase inhibition with intravenous indomethacin did not attenuate the magnesium-induced cerebrovasodilation. We conclude that in new born piglets magnesium suffusion over the parietal cortex results in a dose-dependent cerebrovasodilation that is most likely not mediated by prostanoids.

  6. Evaluation of prostaglandin biosynthetic activity in canine basilar artery following subarachnoid injection of blood.

    PubMed

    Sasaki, T; Murota, S I; Wakai, S; Asano, T; Sano, K

    1981-11-01

    Transformation of arachidonic acid into prostaglandins was investigated in the basilar artery by incubating sections of artery with carbon-14-labeled arachidonic acid. Thin-layer radiochromatography revealed that, in normal canine basilar arteries, 14C-arachidonic acid was transformed mainly to 6-keto-prostaglandin (PG)F1 alpha, a spontaneous metabolite of prostacyclin (PGI2). Among other prostaglandins, only a small amount of PGF2 alpha was detected, whereas PGD2, PGE2, and thromboxane B2 were not. Arteries removed on Days 3 and 8 after subarachnoid blood injection showed a prostaglandin synthesis profile similar to that in the normal cerebral artery. In borate-buffered saline (0.1M borate buffer, pH 9.0/0.15M NaCl = 1:9, vol/vol), canine basilar artery produced a PGI2-like substance that inhibited adenosine diphosphate (ADP)-induced platelet aggregation. Its anti-aggregatory activity was completely abolished by acidification. Aspirin likewise inhibited production of the anti-aggregatory substance. From these results, it was concluded that the anti-aggregatory activity was due solely to the production of PGI2 by the arterial specimen. Based on the above results, PGI2 biosynthetic activity in the cerebral artery exposed to subarachnoid blood injection was bioassayed by measuring the inhibitory activity of the incubation product upon ADP-induced platelet aggregation following incubation of the arteries in borate-buffered saline for 5 to 30 minutes at 20 degrees C, using synthetic PGI2-Na as a standard. The synthetic activity of PGI2 in the artery exposed to subarachnoid blood injection had diminished remarkably by Days 3 and 8. This diminution of PGI2 synthesis in the cerebral artery may be involved in the pathogenesis of cerebral vasospasm.

  7. Stimulation of arachidonic acid metabolism in primary cultures of osteoblast-like cells by hormones and drugs

    SciTech Connect

    Feyen, J.H.; van der Wilt, G.; Moonen, P.; Di Bon, A.; Nijweide, P.J.

    1984-12-01

    The effects of parathyroid hormone (PTH), dihydroxycholecalciferol (1,25-(OH)2 D3), thrombin, epidermal growth factor (EGF) and 12-o-tetradecanoylphorbol-13-acetate (PMA) on the biosynthesis and release of arachidonic acid metabolites were studied in primary cultures of osteoblast-like cells isolated from 18-day-old chick embryo calvaria. Cells were labelled with (/sup 14/C)-arachidonic acid for 30 h. The radioactive eicosanoids were extracted from the cell culture media after a further 30 h stimulation period and analysed on a PRP-1 column by HPLC. The radioactive products were characterized by co-elution of (/sup 3/H) standard prostanoids. Osteoblasts showed a basal release of the prostanoids 6-keto-PGF1 alpha, TXB2, PGF2 alpha, PGE2, PGD2 and PGB2, the latter being the most abundant one. Indomethacin (10(-5) M) effectively inhibited the basal release, but not that of an as yet unidentified compound. The release of prostanoids was stimulated by PTH (2 U/ml), thrombin (0.4 NIH/ml), EGF (50 ng/ml) and PMA (25 ng/ml), the latter being by far the most potent one. 1,25-(OH)2D3 was found to slightly inhibit the prostanoid release. These results indicate: (1) primary cultures of osteoblasts synthesize several prostaglandins, thromboxane B2 and one unidentified product. (2) the action on bone of PTH and the various drugs tested may be, at least partly, mediated by an increased prostaglandin production by osteoblasts. Clearly this does not apply to 1,25-(OH)2D3.

  8. Alpha-particle spectrometer experiment

    NASA Technical Reports Server (NTRS)

    Gorenstein, P.; Bjorkholm, P.

    1972-01-01

    Mapping the radon emanation of the moon was studied to find potential areas of high activity by detection of radon isotopes and their daughter products. It was felt that based on observation of regions overflown by Apollo spacecraft and within the field of view of the alpha-particle spectrometer, a radon map could be constructed, identifying and locating lunar areas of outgassing. The basic theory of radon migration from natural concentrations of uranium and thorium is discussed in terms of radon decay and the production of alpha particles. The preliminary analysis of the results indicates no significant alpha emission.

  9. Alpha--College for Exploring

    ERIC Educational Resources Information Center

    Leppert, William; Koenig, Joan

    1976-01-01

    Describes Alpha, the experimental college of individualized instruction at the College of DuPage (Illinois). At this college, students design their own curricula and work in an open classroom situation, and teachers start with students instead of subjects. (DC)

  10. Genetics Home Reference: alpha thalassemia

    MedlinePlus

    ... in each cell. Each copy is called an allele. For each gene, one allele is inherited from a person's father, and the ... person's mother. As a result, there are four alleles that produce alpha-globin. The different types of ...

  11. Detecting Alpha-1 Antitrypsin Deficiency.

    PubMed

    Stoller, James K

    2016-08-01

    Alpha-1 antitrypsin deficiency is a widely underrecognized condition, with evidence of persisting long diagnostic delays and patients' frequent need to see multiple physicians before initial diagnosis. Reasons for underrecognition include inadequate understanding of alpha-1 antitrypsin deficiency by physicians and allied health care providers; failure to implement available, guideline-based practice recommendations; and the belief that effective therapy is unavailable. Multiple studies have described both the results of screening and targeted detection of individuals with alpha-1 antitrypsin deficiency, with both varying strategies employed to identify at-risk individuals and varying results of testing. Also, various strategies to enhance detection of affected individuals have been examined, including use of the electronic medical record to prompt testing and empowerment of allied health providers, especially respiratory therapists, to promote testing for alpha-1 antitrypsin deficiency. Such efforts are likely to enhance detection with the expected result that the harmful effects of delayed diagnosis can be mitigated. PMID:27564667

  12. Alpha Magnetic Spectrometer (AMS) Overview

    NASA Video Gallery

    The Alpha Magnetic Spectrometer (AMS) is flying to the station on STS-134. The AMS experiment is a state-of-the-art particle physics detector being operated by an international team composed of 60 ...

  13. Comparative effects of immediate-release and extended-release aspirin on basal and bradykinin-stimulated excretion of thromboxane and prostacyclin metabolites.

    PubMed

    Gamboa, Jorge L; Devin, Jessica K; Ramirez, Claudia E; Yu, Chang; Nian, Hui; Lee, Rhonda H; Brown, Nancy J

    2016-04-01

    A goal of aspirin therapy is to inhibit thromboxane production and platelet aggregation without inhibiting endothelial production of the vasodilator and anti-thrombotic prostacyclin. This study tested the hypothesis that extended-release aspirin (NHP-554C) would have increased selectivity for inhibition of basal and simulated thromboxane formation compared to immediate-release aspirin (ASA). Thirty-six healthy subjects were randomized to NHP-554C or ASA groups. Within each group, subjects were randomized to 5-day treatment with 81 mg/d, 162.5 mg/d and placebo in a crossover design in which treatment periods were separated by 2-week washout. On the fifth day of treatment, 81 mg/d and 162.5 mg/d ASA reduced basal urinary excretion of the stable thromboxane metabolite 11-dehydro-thromboxane B2 62.3% and 66.2% and basal excretion of the stable prostacyclin metabolite 2,3-dinor-6-keto-PGF1α 22.8% and 26.5%, respectively, compared to placebo. NHP-554C 81 mg/d and 162.5 mg/d reduced 11-dehydro-thromboxane B2 53% (P = 0.03 vs. ASA 81 mg/d) and 67.9% and 2,3-dinor-6-keto-PGF1α 13.4% and 18.5%, respectively. NHP-554C 81 mg/d did not significantly reduce basal excretion of the prostacyclin metabolite. Both doses of ASA and NHP significantly reduced excretion of both thromboxane and prostacyclin metabolites following intravenous bradykinin. During NHP-554C 162.5 mg/d, but not during ASA, bradykinin significantly increased urinary 2,3-dinor-6-keto-PGF1α. Nevertheless, 11-dehydro-thromboxane B2 and 2,3-dinor-6-keto-PGF1α responses to bradykinin were statistically similar during ASA and NHP-554C. In conclusion, at doses of 81 and 162.5 mg/d immediate- and extended-release aspirin selectively decrease basal thromboxane production. Both forms of aspirin decrease bradykinin-stimulated thromboxane and prostacyclin production, but some stimulated prostacyclin production remains during treatment with NHP-554C. PMID:27069632

  14. Novel benzoxazole inhibitors of mPGES-1.

    PubMed

    Kablaoui, Natasha; Patel, Snahel; Shao, Jay; Demian, Douglas; Hoffmaster, Keith; Berlioz, Francioise; Vazquez, Michael L; Moore, William M; Nugent, Richard A

    2013-02-01

    A novel series of potent benzoxazole mPGES-1 inhibitors has been derived from a hit from a high throughput screen. Compound 37 displays mPGES-1 inhibition in an enzyme assay (0.018 μM) and PGE-2 inhibition in a cell-based assay (0.034 μM). It demonstrates 500- and 2500-fold selectivity for mPGES-1 over COX-2 and 6-keto PGF-1α, respectively. In vivo PK studies in dogs demonstrate 55% oral bioavailability and an 7 h half-life. PMID:23266122

  15. Novel benzoxazole inhibitors of mPGES-1.

    PubMed

    Kablaoui, Natasha; Patel, Snahel; Shao, Jay; Demian, Douglas; Hoffmaster, Keith; Berlioz, Francioise; Vazquez, Michael L; Moore, William M; Nugent, Richard A

    2013-02-01

    A novel series of potent benzoxazole mPGES-1 inhibitors has been derived from a hit from a high throughput screen. Compound 37 displays mPGES-1 inhibition in an enzyme assay (0.018 μM) and PGE-2 inhibition in a cell-based assay (0.034 μM). It demonstrates 500- and 2500-fold selectivity for mPGES-1 over COX-2 and 6-keto PGF-1α, respectively. In vivo PK studies in dogs demonstrate 55% oral bioavailability and an 7 h half-life.

  16. Synthesis and herbicidal activity of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives.

    PubMed

    Xu, Han; Zou, Xiao-Mao; Zhu, You-Quan; Liu, Bin; Tao, Han-Lin; Hu, Xu-Hong; Song, Hai-Bin; Hu, Fang-Zhong; Wang, Yong; Yang, Hua-Zheng

    2006-06-01

    A series of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives was synthesised. Herbicidal activities of the two intermediate compounds and 15 pyridazinone derivatives were evaluated through barnyardgrass and rape cup tests and Spirodela polyrrhiza (L.) Schleiden tests. Selected compounds were also evaluated under greenhouse conditions. Bleaching activities were observed at 10 microg ml(-1) and some compounds exhibited herbicidal activities at a rate of 300 g ha(-1). The relationship between crystal structures and herbicidal activities is discussed through a comparison of two compounds (5a and 5f). PMID:16602079

  17. Alpha decay in electron surrounding

    SciTech Connect

    Igashov, S. Yu.; Tchuvil’sky, Yu. M.

    2013-12-15

    The influence of atomic electron shells on the constant of alpha decay of heavy and mediummass nuclei was considered in detail. A method for simultaneously taking into account the change in the potential-barrier shape and the effect of reflection of a diverging Coulomb wave in the classically allowed region was developed. The ratios of decay probabilities per unit time for a bare nucleus and the respective neutral atom were found for some alpha-decaying isotopes.

  18. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  19. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  20. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  1. Binding of actin to lens alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    Actin has been coupled to a cyanogen bromide-activated Sepharose 4B column, then tested for binding to alpha, beta, and gamma crystallin preparations from the bovine lens. Alpha, but not beta or gamma, crystallins bound to the actin affinity column in a time dependent and saturable manner. Subfractionation of the alpha crystallin preparation into the alpha-A and alpha-B species, followed by incubation with the affinity column, demonstrated that both species bound approximately the same. Together, these studies demonstrate a specific and saturable binding of lens alpha-A and alpha-B with actin.

  2. [Alpha-Synuclein in blood and cerebrospinal fluid of patients with alpha-synucleinopathy].

    PubMed

    Ono, Kenjiro; Yamada, Masahito

    2014-03-01

    Alpha-Synuclein protein(alphaS) aggregates from a monomer to assemblies such as oligomers, protofibrils, and mature fibrils. The early intermediate aggregate, that is, the oligomer, has been reported to be the most toxic species. We recently reported that melatonin inhibits alphaS aggregation, including protofibril and oligomer formations. While the alphaS concentration in cerebrospinal fluid was reported to significantly decrease in patients with Parkinson's disease (PD) and dementia with Lewy bodies, there have been reports that the alphaS oligomer concentration was elevated in the cerebrospinal fluid of PD patients. Moreover, it was reported that the alphaS oligomer concentration was also elevated in the blood of PD patients. Further studies may establish alphaS in cerebrospinal fluid and blood as a biomarker of alpha-synucleinopathies, including PD.

  3. Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...

  4. Workshop on Precision Measurements of $\\alpha_s$

    SciTech Connect

    Bethke, Siegfried; Hoang, Andre H.; Kluth, Stefan; Schieck, Jochen; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS

    2011-10-01

    These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

  5. alpha-Thalassemia caused by an unstable alpha-globin mutant.

    PubMed Central

    Liebhaber, S A; Kan, Y W

    1983-01-01

    In a previous study, molecular cloning of the alpha-globin genes from a patient with nondeletion Hb-H disease (genotype--/alpha alpha) showed that a single nucleotide mutation (CTG to CCG) in one of the genes resulted in a leucine to proline substitution. This paper describes the approach we used to detect the abnormal alpha-globin chain. The chain was identified using a cell-free translation system. It turned over rapidly both in vitro and in vivo in the patient's reticulocytes. The unusual feature of this unstable alpha-globin is that the alpha-globin deficiency causes alpha-thalassemia. Simple heterozygotes for this lesion (alpha Pro alpha/alpha alpha) resemble alpha-thalassemia carriers and do not exhibit the hemolytic anemia usually associated with unstable hemoglobins. Images PMID:6826718

  6. Bremsstrahlung in {alpha} Decay Reexamined

    SciTech Connect

    Boie, H.; Scheit, H.; Jentschura, U. D.; Koeck, F.; Lauer, M.; Schwalm, D.; Milstein, A. I.; Terekhov, I. S.

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the {alpha} decay of {sup 210}Po has been performed, which allows us to follow the photon spectra up to energies of {approx}500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the {alpha} particle and the emitted photon.

  7. NACA Physicist Studying Alpha Rays

    NASA Technical Reports Server (NTRS)

    1957-01-01

    NACA Physicits studying Alpha Rays in a continuous cloud chamber. A cloud chamber is used by Lewis scientists to obtain information aimed at minimizing undesirable effects of radiation on nuclear-powered aircraft components. Here, alpha particles from a polonium source emit in a flower-like pattern at the cloud chamber's center. The particles are made visible by means of alcohol vapor diffusing from an area at room temperature to an area at minus -78 deg. Centigrade. Nuclear-powered aircraft were never developed and aircraft nuclear propulsion systems were canceled in the early 1960s.

  8. Bremsstrahlung in alpha decay reexamined.

    PubMed

    Boie, H; Scheit, H; Jentschura, U D; Köck, F; Lauer, M; Milstein, A I; Terekhov, I S; Schwalm, D

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the alpha decay of (210)Po has been performed, which allows us to follow the photon spectra up to energies of approximately 500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the alpha particle and the emitted photon.

  9. Test chamber for alpha spectrometry

    DOEpatents

    Larsen, Robert P.

    1977-01-01

    Alpha emitters for low-level radiochemical analysis by measurement of alpha spectra are positioned precisely with respect to the location of a surface-barrier detector by means of a chamber having a removable threaded planchet holder. A pedestal on the planchet holder holds a specimen in fixed engagement close to the detector. Insertion of the planchet holder establishes an O-ring seal that permits the chamber to be pumped to a desired vacuum. The detector is protected against accidental contact and resulting damage.

  10. MK-886, an inhibitor of the 5-lipoxygenase-activating protein, inhibits cyclooxygenase-1 activity and suppresses platelet aggregation.

    PubMed

    Koeberle, Andreas; Siemoneit, Ulf; Northoff, Hinnak; Hofmann, Bettina; Schneider, Gisbert; Werz, Oliver

    2009-04-17

    MK-886, an inhibitor of the 5-lipoxygenase-activating protein (FLAP), potently suppresses leukotriene biosynthesis in intact cells and is frequently used to define a role of the 5-lipoxygenase (EC 1.13.11.34) pathway in cellular or animal models of inflammation, allergy, cancer, and cardiovascular disease. Here we show that MK-886 also interferes with the activities of cyclooxygenases (COX, EC 1.14.99.1). MK-886 inhibited isolated COX-1 (IC(50)=8 microM) and blocked the formation of the COX-1-derived products 12(S)-hydroxy-5-cis-8,10-trans-heptadecatrienoic acid (12-HHT) and thromboxane B(2) in washed human platelets in response to collagen as well as from exogenous arachidonic acid (IC(50)=13-15 microM). Isolated COX-2 was less affected (IC(50)=58 microM), and in A549 cells, MK-886 (33 microM) failed to suppress COX-2-dependent 6-keto-prostaglandin (PG)F(1alpha) formation. The distinct susceptibility of MK-886 towards COX-1 and -2 is apparent in automated molecular docking studies that indicate a preferred binding of MK-886 to COX-1 into the active site. MK-886 (10 microM) inhibited COX-1-mediated platelet aggregation induced by collagen or arachidonic acid whereas thrombin- or U-46619-induced (COX-independent) aggregation was not affected. Since leukotrienes and prostaglandins share (patho)physiological properties in the development and regulation of carcinogenesis, inflammation, and vascular functions, caution should be used when interpreting data where MK-886 is used as tool to determine the involvement of FLAP and/or the 5-lipoxygenase pathway in respective experimental models.

  11. Receptors for bradykinin in intact cultured human fibroblasts. Identification and characterization by direct binding study.

    PubMed Central

    Roscher, A A; Manganiello, V C; Jelsema, C L; Moss, J

    1983-01-01

    Bradykinin receptors on cultured human fibroblasts were characterized using [2,3-prolyl-3,4-3H(N)]bradykinin as radioligand. During incubation with intact fibroblasts, intact [3H]bradykinin was lost much more rapidly at 37 degrees than at 4 degrees C as determined by bioassay, high-performance liquid chromatography, and ion-exchange chromatography, and is likely to be degraded. At 4 degrees, but not at 37 degrees C, bradykinin remained intact in the presence of 2 mM bacitracin, but not in the presence of soybean trypsin inhibitor or SQ-20881, an inhibitor of kininase II. Specific binding at 4 degrees C was saturable with a maximum number of binding sites of 230 +/- 18 fmol/mg protein (mean +/- SE, n = 4) and a dissociation constant of 4.6 +/- 0.5 nM (mean +/- SE, n = 4). Linear Scatchard plots, Hill coefficients close to unity (0.95-1.06), and the failure of excess bradykinin to influence dissociation kinetics are consistent with a single component binding system with no significant cooperativity. Na+ at physiological concentrations and Ca++ or Mg++ at 3-10 mM reduced binding by 25%. The relative potencies of bradykinin analogues and unrelated peptides in competing for [3H]bradykinin binding indicated a specificity of the binding sites consistent with that of a B2 type receptor. Potencies of the peptides in displacing [3H]bradykinin correlated with their abilities to release prostacyclin, determined as its metabolite 6-keto-PGF1 alpha. This system, the first in which bradykinin receptors on human cells have been characterized, should prove useful for investigation of the regulation of bradykinin-influenced biological processes. PMID:6135711

  12. Curcumin blocks prostaglandin E2 biosynthesis through direct inhibition of the microsomal prostaglandin E2 synthase-1.

    PubMed

    Koeberle, Andreas; Northoff, Hinnak; Werz, Oliver

    2009-08-01

    Prostaglandin E(2) (PGE(2)) plays a crucial role in the apparent link between tumor growth and chronic inflammation. Cyclooxygenase (COX)-2 and microsomal PGE(2) synthase-1, which are overexpressed in many cancers, are functionally coupled and thus produce massive PGE(2) in various tumors. Curcumin, a polyphenolic beta-diketone from tumeric with anti-carcinogenic and anti-inflammatory activities, was shown to suppress PGE(2) formation and to block the expression of COX-2 and of microsomal PGE(2) synthase-1. Here, we identified microsomal PGE(2) synthase-1 as a molecular target of curcumin and we show that inhibition of microsomal PGE(2) synthase-1 activity is the predominant mechanism of curcumin to suppress PGE(2) biosynthesis. Curcumin reversibly inhibited the conversion of PGH(2) to PGE(2) by microsomal PGE(2) synthase-1 in microsomes of interleukin-1beta-stimulated A549 lung carcinoma cells with an IC(50) of 0.2 to 0.3 micromol/L. Closely related polyphenols (e.g., resveratrol, coniferyl alcohol, eugenol, rosmarinic acid) failed in this respect, and isolated ovine COX-1 and human recombinant COX-2 were not inhibited by curcumin up to 30 micromol/L. In lipopolysaccharide-stimulated human whole blood, curcumin inhibited COX-2-derived PGE(2) formation from endogenous or from exogenous arachidonic acid, whereas the concomitant formation of COX-2-mediated 6-keto PGF(1)alpha and COX-1-derived 12(S)-hydroxy-5-cis-8,10-trans-heptadecatrienoic acid was suppressed only at significant higher concentrations. Based on the key function of PGE(2) in inflammation and carcinogenesis, inhibition of microsomal PGE(2) synthase-1 by curcumin provides a molecular basis for its anticarcinogenic and anti-inflammatory activities.

  13. Alcoholism, Alpha Production, and Biofeedback

    ERIC Educational Resources Information Center

    Jones, Frances W.; Holmes, David S.

    1976-01-01

    Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater…

  14. Targeted therapy using alpha emitters.

    PubMed

    Vaidyanathan, G; Zalutsky, M R

    1996-10-01

    Radionuclides such as 211At and 212Bi which decay by the emission of alpha-particles are attractive for certain applications of targeted radiotherapy. The tissue penetration of 212Bi and 211At alpha-particles is equivalent to only a few cell diameters, offering the possibility of combining cell-specific targeting with radiation of similar range. Unlike the beta-particles emitted by radionuclides such as 131I and 90Y, alpha-particles are radiation of high linear energy transfer and thus greater biological effectiveness. Several approaches have been explored for targeted radiotherapy with 212Bi- and 211At-labelled substances including colloids, monoclonal antibodies, metabolic precursors, receptor-avid ligands and other lower molecular weight molecules. An additional agent which exemplifies the promise of alpha-emitting radiopharmaceuticals is meta-[211At]astatobenzylguanidine. The toxicity of this compound under single-cell conditions, determined both by [3H]thymidine incorporation and by limiting dilution clonogenic assays, for human neuroblastoma cells is of the order of 1000 times higher than that of meta-[131I] iodobenzylguanidine. For meta-[211At] astatobenzylguanidine, the Do value was equivalent to only 6-7 211At atoms bound per cell. These results suggest that meta-[211At] astatobenzylguanidine might be valuable for the targeted radiotherapy of micrometastatic neuroblastomas.

  15. Meet the Alpha-Pets.

    ERIC Educational Resources Information Center

    Zitlaw, Jo Ann Bruce; Frank, Cheryl Standish

    1985-01-01

    "Alpha-Pets" are the focal point of an integrated, multidisciplinary curriculum. Each pet is featured for a week in a vocabulary-rich story and introduces related activities beginning with the featured letter, such as the four food groups during Freddie Fish's week or universe during Ulysses Unicorn's week. (MT)

  16. Alpha proton x ray spectrometer

    NASA Technical Reports Server (NTRS)

    Rieder, Rudi; Waeke, H.; Economou, T.

    1994-01-01

    Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

  17. Postnatal changes of nicotinic acetylcholine receptor alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits genes expression in rat brain.

    PubMed

    Zhang, X; Liu, C; Miao, H; Gong, Z H; Nordberg, A

    1998-10-01

    Postnatal changes of nicotinic acetylcholine receptor (nAChR) alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits mRNAs were investigated in rat brain using ribonuclease protection assay. Multiple developmental patterns were observed: (1) transient expression during the first few postnatal weeks; alpha 2 in the hippocampus and brain stem, alpha 3 in the striatum, cerebellum and cortex, alpha 4 in the hippocampus, striatum and cerebellum, alpha 7 in the cerebellum and beta 2 in the striatum. (2) Constant expression across development; alpha 2 and alpha 3 in the thalamus, alpha 4 in the cortex, thalamus and brain stem, alpha 7 in the thalamus and brain stem and beta 2 in all brain regions except striatum. (3) Non-detection across development; alpha 2 in the cortex, striatum and cerebellum. (4) Increase with age; alpha 7 in the cortex and hippocampus. (5) Bell-shaped development; alpha 7 in the striatum. Postnatal changes of nAChR isoforms in different brain regions of rat were investigated by receptor binding assays. The developmental patterns of [3H]epibatidine and (-)-[3H]nicotine binding sites were similar to each other in each brain region, but different from that of [3H] alpha-bungarotoxin binding sites. No obvious correlation was observed between the developmental patterns of [3H] alpha-bungarotoxin, [3H]epibatidine and (-)-[3H]nicotine binding sites and corresponding subunits mRNAs. These results indicate that multiple mechanisms are involved in changes of gene expression of nAChRs subunits in the brain of developing rats.

  18. Coexistence of {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in {sup 10}Be

    SciTech Connect

    Itagaki, N.; Ito, M.; Milin, M.; Hashimoto, T.; Ishiyama, H.; Miyatake, H.

    2008-06-15

    The coexistence of the {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in the excited states of {sup 10}Be has been discussed. In the previous analysis, all the low-lying states of {sup 10}Be were found to be well described by the motion of the two valence neutrons around two {alpha} clusters. However, the {alpha}+t+t cluster structure was found to coexist with the {alpha}+{alpha}+n+n structure around E{sub x}=15 MeV, close to the corresponding threshold. We have introduced a microscopic model to solve the coupling effect between these two configurations. The K=0 and K=1 states are generated from the {alpha}+t+t configurations due to the spin coupling of two triton clusters. The present case of {sup 10}Be is one of the few examples in which completely different configurations of triton-type ({alpha}+t+t three-center) and {alpha}-type ({alpha}+{alpha}+n+n two-center) clusters coexist in a single nucleus in the same energy region.

  19. A synopsis of collective alpha effects and implications for ITER

    SciTech Connect

    Sigmar, D.J.

    1990-10-01

    This paper discusses the following: Alpha Interaction with Toroidal Alfven Eigenmodes; Alpha Interaction with Ballooning Modes; Alpha Interaction with Fishbone Oscillations; and Implications for ITER.

  20. Genetics Home Reference: 5-alpha reductase deficiency

    MedlinePlus

    ... gene provides instructions for making an enzyme called steroid 5-alpha reductase 2. This enzyme is involved ... external genitalia. Mutations in the SRD5A2 gene prevent steroid 5-alpha reductase 2 from effectively converting testosterone ...

  1. What Causes Alpha-1 Antitrypsin Deficiency?

    MedlinePlus

    ... from the NHLBI on Twitter. What Causes Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency is an inherited disease. "Inherited" ... have AAT deficiency inherit two faulty AAT genes, one from each parent. These genes tell cells in ...

  2. How Is Alpha-1 Antitrypsin Deficiency Treated?

    MedlinePlus

    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Treated? Alpha-1 antitrypsin (AAT) deficiency has no cure, but its ... of these treatments are the same as the ones used for a lung disease called COPD (chronic ...

  3. Q (Alpha) Function and Squeezing Effect

    NASA Technical Reports Server (NTRS)

    Yunjie, Xia; Xianghe, Kong; Kezhu, Yan; Wanping, Chen

    1996-01-01

    The relation of squeezing and Q(alpha) function is discussed in this paper. By means of Q function, the squeezing of field with gaussian Q(alpha) function or negative P(a)function is also discussed in detail.

  4. Association of actin with alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Boyle, D.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The alpha crystallins are cytosolic proteins that co-localize and co-purify with actin-containing microfilaments. Affinity column chromatography employing both covalently-coupled actin or alpha crystallin was used to demonstrate specific and saturable binding of actin with alpha crystallin. This conclusion was confirmed by direct visualization of alpha aggregates bound to actin polymerized in vitro. The significance of this interaction in relation to the functional properties of these two polypeptides will be discussed.

  5. The ultraviolet spectra of Alpha Aquilae and Alpha Canis Minoris

    NASA Technical Reports Server (NTRS)

    Morton, D. C.; Bruzual A., G.; Kurucz, R. L.; Spinrad, H.

    1977-01-01

    Scans of Alpha Aql (A7 IV, V) and Alpha CMi (F5 IV-V) obtained with the Copernicus satellite spectrometer over the wavelength range from 2100 to 3200 A are presented along with a spectrum of the integrated solar disk over the same range procured during a calibrated rocket flight. About 1500 fairly strong absorption lines in the Alpha CMi spectrum between 2400 and 2961 A are identified by comparison with a solar atlas and by using a theoretical spectrum synthesized from a blanketed LTE model with an effective temperature of 6500 K and a surface gravity of 10,000 cm/sec per sec. The Mg II resonance doublet at 2795.528 and 2802.704 A is found to be present in all three stars together with a discontinuity at 2635 A due to Fe II, Fe I, Cr I, and Mn II. It is concluded that the Mg II resonance lines and the 2635-A continuum break would be the best spectral features for estimating the redshift of a galaxy observed at low resolution provided the redshift is not less than about 0.75.

  6. Effectiveness of Alpha Biofeedback Therapy: Negative Results.

    ERIC Educational Resources Information Center

    Watson, Charles G.; Herder, Joseph

    1980-01-01

    Assessed the utility of alpha biofeedback training in the treatment of patients (N=66). Biofeedback and placebo biofeedback groups were given alpha or mock-alpha training sessions. Improvement on 54 variables was compared to that of no-treatment controls. Only a chance number of significant changes appeared among the groups. (Author)

  7. Recent Results on the CKM Angle Alpha

    SciTech Connect

    Mihalyi, A.; /Wisconsin U., Madison

    2005-10-18

    The method to measure the CKM angle {alpha} and the modes sensitive to it are discussed. It is shown that the B {yields} {rho}{rho} decays provide the most stringent constraint on {alpha}, which is found to be {alpha} = 96{sup o} {+-} 10{sup o}(stat) {+-} 4{sup o}(syst){+-} 13{sup o}(penguin).

  8. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  9. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  10. 6 alpha-Fluoro- and 6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione: synthesis and evaluation of activity and kinetics of their C-22 epimers.

    PubMed

    Thalén, B A; Axelsson, B I; Andersson, P H; Brattsand, R L; Nylander, B; Wickström, L I

    1998-01-01

    It is generally accepted that the anti-inflammatory effect of glucocorticosteroids cannot be separated from their adverse effects at the receptor level. However, modification of the pharmacokinetics through structural alterations could provide steroids with a better therapeutic index than those currently used. Thus, new 16 alpha,17 alpha-acetals between butyraldehyde and 6 alpha-fluoro- or 6 alpha,9 alpha-difluoro-16 alpha-hydroxycortisol were synthesized and studied. Acetalization of the corresponding 16 alpha,17 alpha-diols or transacetalization of their 16 alpha,17 alpha-acetonides in dioxane produced mixtures of C-22 epimers, which were resolved by preparative chromatography. Alternatively, an efficient method was used to produce the 22R-epimer stereoselectively through performing the acetalization and transacetalization in a hydrocarbon with an inert material present. The C-22 configuration of (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione was unambiguously established by single crystal X-ray diffraction. The present compounds, especially the 22R-epimer just mentioned, bind to the rat thymus glucocorticoid receptor with high potency. The C-22 epimers of the 6 alpha,9 alpha-difluoro derivatives showed a 10-fold higher biotransformation rate than the budesonide 22R-epimer when incubated with human liver S9 subcellular fraction. The high receptor affinity in combination with the high biotransformation rate indicates that (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione may be an improved 16 alpha,17 alpha-acetal glucocorticosteroid for therapy of inflammatory diseases, in which the mucous membranes are involved, such as those in the intestinal tract as well in the respiratory tract. PMID:9437793

  11. Effect of Decreasing Intraluteal Progesterone on Sensitivity of the Early Porcine Corpus Luteum to the Luteolytic Actions of Prostaglandin F2alpha1

    PubMed Central

    Diaz, Francisco J.; Luo, Wenxiang; Wiltbank, Milo C.

    2010-01-01

    increased by PGF (1.5-fold) or PGF+EPO (2.2-fold). Thus, these data support the hypothesis that elimination of the protective effect of intraluteal P4 does not directly cause luteolysis of the early CL but allows PGF to induce luteolytic responses in CL lacking luteolytic capacity. PMID:20739670

  12. Alpha voltaic batteries and methods thereof

    NASA Technical Reports Server (NTRS)

    Raffaelle, Ryne P. (Inventor); Jenkins, Phillip (Inventor); Wilt, David (Inventor); Scheiman, David (Inventor); Chubb, Donald (Inventor); Castro, Stephanie (Inventor)

    2011-01-01

    An alpha voltaic battery includes at least one layer of a semiconductor material comprising at least one p/n junction, at least one absorption and conversion layer on the at least one layer of semiconductor layer, and at least one alpha particle emitter. The absorption and conversion layer prevents at least a portion of alpha particles from the alpha particle emitter from damaging the p/n junction in the layer of semiconductor material. The absorption and conversion layer also converts at least a portion of energy from the alpha particles into electron-hole pairs for collection by the one p/n junction in the layer of semiconductor material.

  13. THE LYMAN ALPHA REFERENCE SAMPLE: EXTENDED LYMAN ALPHA HALOS PRODUCED AT LOW DUST CONTENT

    SciTech Connect

    Hayes, Matthew; Oestlin, Goeran; Duval, Florent; Guaita, Lucia; Melinder, Jens; Sandberg, Andreas; Schaerer, Daniel; Verhamme, Anne; Orlitova, Ivana; Mas-Hesse, J. Miguel; Oti-Floranes, Hector; Adamo, Angela; Atek, Hakim; Cannon, John M.; Herenz, E. Christian; Kunth, Daniel; Laursen, Peter

    2013-03-10

    We report on new imaging observations of the Lyman alpha emission line (Ly{alpha}), performed with the Hubble Space Telescope, that comprise the backbone of the Lyman alpha Reference Sample. We present images of 14 starburst galaxies at redshifts 0.028 < z < 0.18 in continuum-subtracted Ly{alpha}, H{alpha}, and the far ultraviolet continuum. We show that Ly{alpha} is emitted on scales that systematically exceed those of the massive stellar population and recombination nebulae: as measured by the Petrosian 20% radius, R{sub P20}, Ly{alpha} radii are larger than those of H{alpha} by factors ranging from 1 to 3.6, with an average of 2.4. The average ratio of Ly{alpha}-to-FUV radii is 2.9. This suggests that much of the Ly{alpha} light is pushed to large radii by resonance scattering. Defining the Relative Petrosian Extension of Ly{alpha} compared to H{alpha}, {xi}{sub Ly{alpha}} = R {sup Ly{alpha}}{sub P20}/R {sup H{alpha}}{sub P20}, we find {xi}{sub Ly{alpha}} to be uncorrelated with total Ly{alpha} luminosity. However, {xi}{sub Ly{alpha}} is strongly correlated with quantities that scale with dust content, in the sense that a low dust abundance is a necessary requirement (although not the only one) in order to spread Ly{alpha} photons throughout the interstellar medium and drive a large extended Ly{alpha} halo.

  14. Subjective pain perception mediated by alpha rhythms.

    PubMed

    Peng, Weiwei; Babiloni, Claudio; Mao, Yanhui; Hu, Yong

    2015-07-01

    Suppression of spontaneous alpha oscillatory activities, interpreted as cortical excitability, was observed in response to both transient and tonic painful stimuli. The changes of alpha rhythms induced by pain could be modulated by painful sensory inputs, experimental tasks, and top-down cognitive regulations such as attention. The temporal and spatial characteristics, as well as neural functions of pain induced alpha responses, depend much on how these factors contribute to the observed alpha event-related desynchronization/synchronization (ERD/ERS). How sensory-, task-, and cognitive-related changes of alpha oscillatory activities interact in pain perception process is reviewed in the current study, and the following conclusions are made: (1) the functional inhibition hypothesis that has been proposed in auditory and visual modalities could be applied also in pain modality; (2) the neural functions of pain induced alpha ERD/ERS were highly dependent on the cortical regions where it is observed, e.g., somatosensory cortex alpha ERD/ERS in pain perception for painful stimulus processing; (3) the attention modulation of pain perception, i.e., influences on the sensory and affective dimensions of pain experience, could be mediated by changes of alpha rhythms. Finally, we propose a model regarding the determinants of pain related alpha oscillatory activity, i.e., sensory-discriminative, affective-motivational, and cognitive-modulative aspects of pain experience, would affect and determine pain related alpha oscillatory activities in an integrated way within the distributed alpha system. PMID:26026894

  15. Synthesis of 16 alpha-3H androgen and estrogen substrates for 16 alpha-hydroxylase.

    PubMed

    Cantineau, R; Kremers, P; De Graeve, J; Cornelis, A; Laszlo, P; Gielen, J E; Lambotte, R

    1981-02-01

    The synthesis of 16 alpha-3H androgens and estrogens is described. 1-(3H)-Acetic acid in the presence of zinc dust reacts with 16 alpha-bromo-17-ketosteroids to produce 16 alpha-3H-17-ketosteroids. This chemical reaction was used to prepare 16 alpha-3H-dehydroepiandrosterone (I) and 16 alpha-3H-estrone acetate (XI) from 16 alpha-bromo-dehydroepiandrosterone (X) and from 16 alpha-bromo-estrone acetate (XII), respectively. Using appropriate microbiological techniques, it was possible to convert these radiolabelled substrates into 16 alpha-3H-androstenedione (II) and 16 alpha-3H-estradiol-17 beta (VII). 16 alpha-3H-Estrone (VI) was obtained by the chemical hydrolysis of 16 alpha-3H-estrone acetate. The label distribution as determined by microbiological 16 alpha-hydroxylations indicated a specific labelling of 77% for androgens and 65% for estrogens in the 16 alpha position. These substrates can be used for measuring the 16 alpha hydroxylase activity, an important step in the biosynthesis of estriol (VIII) and estetrol (IX). PMID:7013160

  16. A study of presynaptic alpha2-autoreceptors in alpha2A/D-, alpha2B- and alpha2C-adrenoceptor-deficient mice.

    PubMed

    Trendelenburg, A U; Klebroff, W; Hein, L; Starke, K

    2001-08-01

    The function of presynaptic alpha2-autoreceptors was studied in the hippocampus, occipito-parietal cortex, atria and vas deferens of NMRI mice, mice in which the alpha2A/D-, the alpha2B- or alpha2c-adrenoceptor gene had been disrupted (alpha2A/DKO, alpha2BKO and alpha2CKO, respectively), and the wildtype mice from which the knockout animals had been generated. Tissue pieces were preincubated with 3H-noradrenaline and then superfused and stimulated electrically. The alpha2-adrenoceptor agonist medetomidine reduced the electrically evoked overflow of tritium in all tissues from all mouse strains (stimulation with single pulses or single high-frequency pulse trains, called POPs, i.e. pulse patterns leading to minimal autoinhibition). The effects of medetomidine did not differ in NMRI, wildtype, alpha2BKO and alpha2CKO mice but were greatly reduced in alpha2A/DKO brain preparations and to a lesser extent in alpha2A/DKO atria and vasa deferentia. Six drugs were tested as antagonists against medetomidine. Their pKd values indicated that the hippocampal and occipito-parietal alpha2-autoreceptors in NMRI and wildtype mice were alpha2D (the rodent variant of the alpha2A/D-adrenoceptor) whereas the atrial and vas deferens alpha2-autoreceptors in NMRI and wildtype mice could not be identified with a single alpha2 subtype. Deletion of the alpha2A/D gene changed the pKd values in all tissues so that they now reflected alpha2C properties, whereas deletion of the alpha2C gene changed the pKd values in atria and vasa deferentia so that they now had alpha2D properties (as they had in NMRI and wildtype brain preparations). Autoinhibition by released noradrenaline was created using trains of up to 64 pulses or up to 4 POPs, and the overflow-enhancing effect of the alpha2 antagonist rauwolscine was determined. Results did not differ, irrespective of whether preparations were obtained from NMRI, wildtype, alpha2BKO or alpha2CKO mice: the overflow of tritium elicited by p pulses or POPs

  17. High gas flow alpha detector

    DOEpatents

    Bolton, Richard D.; Bounds, John A.; Rawool-Sullivan, Mohini W.

    1996-01-01

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors.

  18. High gas flow alpha detector

    DOEpatents

    Bolton, R.D.; Bounds, J.A.; Rawool-Sullivan, M.W.

    1996-05-07

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors. 4 figs.

  19. Reliability of {alpha}{sub 1} and {alpha}{sub 2} from lattice codes

    SciTech Connect

    Ng, K.Y.

    1996-10-01

    Whether the higher-order terms in the momentum-compaction factor, {alpha}{sub 1} and {alpha}{sub 2}, can be obtained reliably from lattice codes is an important issue for some quasi-isochronous rings. A FODO lattice consisting of thin quadrupoles, dipoles filling all spaces, and two families of thin sextupoles is solved and {alpha}{sub 1} and {alpha}{sub 2} are derived analytically. We find accurate agreement with SYNCH is examined. Some methods of measurement of {alpha}{sub 1} and {alpha}{sub 2} are discussed.

  20. alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

    PubMed Central

    Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L

    1988-01-01

    An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

  1. Effects of interferon-alpha (IFN-alpha) administration on leucocytes in healthy humans.

    PubMed

    Corssmit, E P; Heijligenberg, R; Hack, C E; Endert, E; Sauerwein, H P; Romijn, J A

    1997-02-01

    Plasma concentrations of IFN-alpha are increased in several inflammatory conditions. Several lines of evidence indicate that IFN-alpha has anti-inflammatory properties. To study the effects of IFN-alpha on leucocyte subsets and activation and on cytokines, we administered IFN-alpha (rhIFN-alpha2b; 5 x 10(6) U/m2) to eight healthy human subjects in a randomized controlled cross-over study and analysed changes in circulating leucocytes and parameters for neutrophil and monocyte activation. After administration of IFN-alpha, neutrophil counts increased, monocyte counts decreased transiently, whereas the number of lymphocytes, basophils and eosinophils showed a sustained decrease. IFN-alpha administration was also associated with neutrophil activation, reflected in an increase in the plasma concentrations of elastase-alpha1-antitrypsin complexes and lactoferrin. Serum neopterin, a marker for monocyte activation, was significantly increased 10 h after administration of IFN-alpha. IFN-alpha significantly increased plasma concentrations of IL-6, IL-8 and IL-10. Although IL-1 and tumour necrosis factor (TNF) remained undetectable, plasma concentrations of soluble TNF receptors p55 and p75 increased after IFN-alpha administration. We conclude that IFN-alpha induces multiple alterations in the distribution and functional properties of leucocytes. IFN-alpha exerts pro- as well as anti-inflammatory effects within the cytokine network.

  2. Beta/alpha continuous air monitor

    DOEpatents

    Becker, G.K.; Martz, D.E.

    1988-06-27

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

  3. Beta/alpha continuous air monitor

    DOEpatents

    Becker, Gregory K.; Martz, Dowell E.

    1989-01-01

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinguishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts.

  4. Effect of platelet-activating factor on porcine pulmonary blood vessels in vitro.

    PubMed

    Pritze, S; Simmet, T; Peskar, B A

    1991-10-01

    Platelet-activating factor (PAF) induced contractions of porcine pulmonary vein strips in a concentration-dependent manner, while porcine pulmonary artery strips were unresponsive. Exposure to the specific PAF-antagonists WEB 2086 or BN 52021 antagonized the contractile responses of pulmonary vein strips. Cysteinyl-leukotrienes (LT) and thromboxane (TX) B2 were not detected in the bath fluid after stimulation with PAF suggesting that these eicosanoids as well as their precursors are not mediators of PAF-induced contractions of porcine pulmonary vein strips. Furthermore, PAF had no significant effect on 6-keto-prostaglandin (PG) F1a release and flurbiprofen did not affect the PAF response, while it inhibited the release of 6-keto-PGF1a. This indicates that PGI2 or any other cyclooxygenase product is unlikely to modulate or mediate the PAF response. Incubation experiments with fragments of pulmonary vascular tissues demonstrated spontaneous release of small amounts of cysteinyl-LT, TXB2 and 6-keto-PGF1a, which was significantly increased during incubation in the presence of ionophore A23187. While these results demonstrate the synthesizing capacity of the porcine pulmonary vascular tissues for various eicosanoids, PAF failed to stimulate eicosanoid release under these experimental conditions. We conclude that PAF causes contractions of porcine pulmonary vein strips, which are not mediated by cysteinyl-LT or cyclooxygenase products of arachidonate metabolism. The specific contractile effect of PAF on pulmonary veins, but not arteries, could contribute to the disturbances of the pulmonary circulation observed after injection of PAF or release of endogenous PAF, e.g. after administration of endotoxin.

  5. Hemoglobin Evanston (alpha 14 Trp----Arg). An unstable alpha-chain variant expressed as alpha-thalassemia.

    PubMed Central

    Honig, G R; Shamsuddin, M; Vida, L N; Mompoint, M; Valcourt, E; Bowie, L J; Jones, E C; Powers, P A; Spritz, R A; Guis, M

    1984-01-01

    A new hematologic syndrome with phenotypic features of mild Hb H disease was identified in three children from two unrelated black American families. Erythrocytes from each of these children contained Hb H (beta 4) and Hb Barts (gamma 4), as well as a slowly migrating hemoglobin fraction that made up 7-10% of the total hemoglobin. The parents of the affected children all showed mild thalassemia-like changes, with one of the parents in each family also expressing the variant hemoglobin; in the latter individuals the mutant alpha-chains made up less than 2% of the total, and were present mainly or exclusively in combination with delta-chains in the form of a slowly migrating Hb A2. Purified Hb Evanston showed an increased oxygen affinity, but its Bohr effect, cooperativity, and 2,3-diphosphoglycerate effect were normal. The mutant hemoglobin appeared to have normal stability to heat and to isopropanol, and the stability of its alpha-chain in an extended time course synthesis study also appeared to be similar to that of alpha A. However, the results from short-term globin synthesis studies, and from mRNA translation in vitro, suggest that the two types of alpha-chains were synthesized at relatively equal rates, with a major fraction of the newly synthesized variant alpha-chains undergoing rapid catabolism. The hematologic data taken in combination with DNA hybridization and globin synthesis findings indicate that the proposita in each of these families has the genotype--, alpha A/--, alpha Ev. These observations suggest that two separate mechanisms are contributing to the alpha-thalassemia-like expression of Hb Evanston : the newly synthesized alpha EV-chains are unstable and are subject to early proteolytic destruction; and the mutant alpha-allele is linked to an alpha-globin gene deletion. Images PMID:6725558

  6. Teaching calculus with Wolfram|Alpha

    NASA Astrophysics Data System (ADS)

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-12-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to Wolfram|Alpha in our differential and integral calculus labs, together with the positive results from our experience. We also discuss the current limitations of Wolfram|Alpha, including a discussion on why we still use a CAS for our multivariate calculus labs.

  7. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H

    1996-01-01

    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  8. Prospects for alpha particle studies on TFTR

    SciTech Connect

    Zweben, S.J.

    1987-05-01

    TFTR is expected to produce approximately 5 MW of alpha heating during the D/T Q approx. = 1 phase of operation in 1990. At that point the collective confinement properties and the heating effects of alpha particles become accessible for study for the first time. This paper outlines the potential performance of TFTR with respect to alpha particle production, the diagnostics which will be available for alpha particle measurements, and the physics issues which can be studied both before and during D/T operation.

  9. 5 alpha-reductase deficiency without hypospadias.

    PubMed Central

    Ng, W K; Taylor, N F; Hughes, I A; Taylor, J; Ransley, P G; Grant, D B

    1990-01-01

    A boy aged 4 with penoscrotal hypospadias and his brother aged 12 with micropenis had typical changes of homozygous 5 alpha-reductase deficiency. After three injections of chorionic gonadotrophin there was a trivial rise in plasma dihydrotestosterone with a normal increase in plasma testosterone. Urine steroid chromatography showed abnormally high 5 beta: 5 alpha ratios and 5 alpha-reductase activity was appreciably reduced in genital skin fibroblasts. The results indicate that 5 alpha-reductase deficiency is not invariably associated with genital ambiguity. PMID:2248513

  10. Synthesis of anticholinergic agents: N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate salts.

    PubMed

    Oroshnik, W; Soldati, G

    1978-05-01

    The synthesis of a new anticholinergic agent, N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate, obtained by reacting N-methyl-4-piperidinyl alpha-cyclopentylmandelate with benzoyl chloride in the presence of methyllithium, is reported. This material may be useful as an antiperspirant.

  11. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  12. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  13. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  14. Resting-State Alpha in Autism Spectrum Disorder and Alpha Associations with Thalamic Volume

    ERIC Educational Resources Information Center

    Edgar, J. Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D.; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M.; Qasmieh, Saba; Levy, Susan E.; Schultz, Robert T.; Roberts, Timothy P. L.

    2015-01-01

    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha…

  15. High-alpha space trucks

    SciTech Connect

    Cook, L.M.; Ball, J.

    1997-01-01

    Vertically-landing Reusable Launch Vehicles (RLVs) are the best hope of building a true {open_quotes}Space Truck{close_quotes} with current technology. Because they do not require a low angle-of-attack (AOA, or alpha) horizontal landing, they can be designed to operate exclusively at very high angles-of-attack. This offers savings in vehicle dry weight and complexity, which can be traded for significantly heavier payload, more ascent velocity, or extra design margin. The price for abandoning low angle-of-attack flight is reduced crossrange. To quantify the potential weight reduction, a trade study was performed to determine the relationship between a vehicle{close_quote}s maximum crossrange (angle-of-attack) and it{close_quote}s dry weight (payload margin). At the study conclusion, three vertically-landing (VL) vehicles provided multiple points on a payload weight vs. maximum crossrange curve, showing significant payload increases as crossrange is sacrificed. This is primarily the result of being able to simplify the structure, fly a cooler entry trajectory, and be aerodynamically stable through the entire flight. This reduces subsystem requirements and complexity, enhancing reliability. Further benefits are realized in reduced landing propellant requirements and simplifying or eliminating the {open_quotes}rotation{close_quotes} maneuver. This paper also suggests unique operability solutions that adapt high-alpha vehicles to traditional high-crossrange missions such as the polar {open_quotes}once-around{close_quotes} flight, and proposes a small scale drop-test program to prove the subsonic and landing portion of the flight envelope. {copyright} {ital 1997 American Institute of Physics.}

  16. Arrangements of alpha-globin gene cluster in Taiwan.

    PubMed

    Peng, H W; Choo, K B; Ho, C H; Yen, M S; Liung, W Y; Lin, C K; Yang, Z L; Ng, H T; Ching, K N; Han, S H

    1989-01-01

    In a gene mapping study on 217 newborn babies in Taiwan with alpha- and zeta-globin probes, we have observed 4 cases (1.84%) of alpha-thalassemia-2 heterozygotes (zeta zeta-alpha/zeta zeta alpha alpha) without increased levels of hemoglobin (Hb) Bart's in the cord blood. Eleven subjects (5.07%) were found to have the South East Asian alpha-thalassemia-1 haplotype (zeta zeta--SEA/zeta zeta alpha alpha) with increased Hb Bart's levels ranging from 2.2 to 9%. One case, with Hb Bart's level of 14% in the cord blood, was found to have the genotype of zeta zeta--SEA/zeta zeta alpha alpha T (0.46%). Four heterozygotes (1.84%) were found with the triple alpha gene anti-rightward arrangement (zeta zeta alpha alpha alpha 3.7/zeta zeta alpha alpha). Twenty-one heterozygotes (9.68%) were found to have the triple zeta-globin gene arrangement (zeta zeta zeta alpha alpha/zeta zeta alpha alpha). A new triple zeta-globin gene variant with a BamHI polymorphism was also observed in this study.

  17. Alpha Biofeedback Conditioning and Retarded Subjects.

    ERIC Educational Resources Information Center

    Martin, Walter; And Others

    1981-01-01

    An experimental group of three institutionalized severely retarded adult males received binary tone feedback for alpha production while a control group (3) followed identical procedures without feedback. Analysis revealed significant difference between groups in alpha percentage increase over baseline, encouraging research on applications for…

  18. Elementary Processes Underlying Alpha Channeling in Tokamaks

    SciTech Connect

    NM.J. Fisch

    2012-06-15

    Alpha channeling in tokamaks is speculative, but also extraordinarily attractive. Waves that can accomplish this effect have been identified. Key aspects of the theory now enjoy experimental confirmation. This paper will review the elementary processes of wave-particle interactions in plasma that underlie the alpha channeling effect

  19. Alpha-1 Antitrypsin Deficiency (Inherited Emphysema)

    MedlinePlus

    ... 1 protein in the blood with normal alpha-1 antitrypsin from healthy plasma donors. It is given in a vein (IV). The dose is adjusted based on body weight. This treatment is often given once a week. There are three ... the management of Alpha-1 related emphysema includes: • Exercise and a healthy lifestyle ...

  20. Psychiatric Symptoms in Alpha-Mannosidosis

    ERIC Educational Resources Information Center

    Malm, D.; Pantel, J.; Linaker, O. M.

    2005-01-01

    Alpha-mannosidosis is characterized by mild to moderate intellectual disability (ID), moderate to severe neurosensory hearing loss, frequent infections, psychomotor disturbances and skeletal dysmorphism. For the first time, a panel of nine alpha-mannosidosis patients with psychiatric symptoms is presented. The clinical picture has several…

  1. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  2. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  3. Remote Associates Test and Alpha Brain Waves

    ERIC Educational Resources Information Center

    Haarmann, Henk J.; George, Timothy; Smaliy, Alexei; Dien, Joseph

    2012-01-01

    Previous studies found that performance on the remote associates test (RAT) improves after a period of incubation and that increased alpha brain waves over the right posterior brain predict the emergence of RAT insight solutions. We report an experiment that tested whether increased alpha brain waves during incubation improve RAT performance.…

  4. Atypical Alpha Asymmetry in Adults with ADHD

    ERIC Educational Resources Information Center

    Hale, T. Sigi; Smalley, Susan L.; Hanada, Grant; Macion, James; McCracken, James T.; McGough, James J.; Loo, Sandra K.

    2009-01-01

    Introduction: A growing body of literature suggests atypical cerebral asymmetry and interhemispheric interaction in ADHD. A common means of assessing lateralized brain function in clinical populations has been to examine the relative proportion of EEG alpha activity (8-12 Hz) in each hemisphere (i.e., alpha asymmetry). Increased rightward alpha…

  5. Commentary on Coefficient Alpha: A Cautionary Tale

    ERIC Educational Resources Information Center

    Green, Samuel B.; Yang, Yanyun

    2009-01-01

    The general use of coefficient alpha to assess reliability should be discouraged on a number of grounds. The assumptions underlying coefficient alpha are unlikely to hold in practice, and violation of these assumptions can result in nontrivial negative or positive bias. Structural equation modeling was discussed as an informative process both to…

  6. Teaching Calculus with Wolfram|Alpha

    ERIC Educational Resources Information Center

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-01-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to…

  7. Coefficient Alpha Bootstrap Confidence Interval under Nonnormality

    ERIC Educational Resources Information Center

    Padilla, Miguel A.; Divers, Jasmin; Newton, Matthew

    2012-01-01

    Three different bootstrap methods for estimating confidence intervals (CIs) for coefficient alpha were investigated. In addition, the bootstrap methods were compared with the most promising coefficient alpha CI estimation methods reported in the literature. The CI methods were assessed through a Monte Carlo simulation utilizing conditions…

  8. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  9. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  10. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  11. Inhibitory spectrum of alpha 2-plasmin inhibitor.

    PubMed

    Saito, H; Goldsmith, G H; Moroi, M; Aoki, N

    1979-04-01

    alpha 2-Plasmin inhibitor (alpha 2PI) has been recently characterized as a fast-reacting inhibitor of plasmin in human plasma and appears to play an important role in the regulation of fibrinolysis in vivo. We have studied the effect of purified alpha 2PI upon various proteases participating in human blood coagulation and kinin generation. At physiological concentration (50 microgram/ml), alpha 2PI inhibited the clot-promoting and prekallikrein-activating activity of Hageman factor fragments, the amidolytic, kininogenase, and clot-promoting activities of plasma kallikrein, and the clot-promoting properties of activated plasma thromboplastin antecedent (PTA, Factor XIa) and thrombin. alpha 2PI had minimal inhibitory effect on surface-bound activated PTA and activated Stuart factor (Factor Xa). alpha 2PI did not inhibit the activity of activated Christmas factor (Factor IXa) or urinary kallikrein. Heparin (1.5-2.0 units/ml) did not enhance the inhibitory function of alpha 2PI. These results suggest that, like other plasma protease inhibitors, alpha 2PI possesses a broad in vitro spectrum of inhibitory properties.

  12. Suppression of hepatic prostaglandin F2 alpha in rats by dietary alpha-tocopherol acetate is independent of total hepatic alpha-tocopherol.

    PubMed

    Duitsman, P K; Chen, H W; Cook, L R; Hendrich, S

    1992-09-01

    Groups of eight weanling female F344/N rats were fed semipurified diets that supplied 0, 50, 500, 5000, or 15,000 mg alpha-tocopherol acetate/kg diet, with and without 0.05% phenobarbital (PB) for 9 weeks. Both plasma and hepatic alpha-tocopherol levels, measured by HPLC, strongly correlated with alpha-tocopherol intake (r greater than 0.73, p less than 0.0001). Phenobarbital both depleted hepatic alpha-tocopherol and increased plasma alpha-tocopherol significantly. Although treatment with PB for 9 weeks significantly increased GST activity, PB did not affect hepatic prostaglandin (PG)F2 alpha status, as determined by radioimmunoassay. PGF2 alpha was significantly greater (by 52%) in rats fed no alpha-tocopherol than in rats fed 15,000 mg alpha-tocopherol acetate/kg diet. Hepatic PGF2 alpha status was correlated inversely but weakly with dietary alpha-tocopherol (r = -0.24, p less than 0.05). Hepatic PGF2 alpha status was not correlated with hepatic or plasma alpha-tocopherol status. This finding suggests either that there is a small depletion-resistant subcellular alpha-tocopherol pool which regulates PGF2 alpha production or that alpha-tocopherol alters PGF2 alpha production in vivo by an indirect mechanism.

  13. Local Structure and Vibrational Properties of alpha-Pu, alpha-U, and the alpha-U Charge Density Wave

    SciTech Connect

    Nelson, E J; Allen, P G; Blobaum, K M; Wall, M A; Booth, C H

    2004-08-10

    The local atomic environment and vibrational properties of atoms in monoclinic pure {alpha}-plutonium as well as orthorhombic pure {alpha}-uranium and its low-temperature charge-density-wave (CDW) modulation are examined by extended x-ray absorption fine structure spectroscopy (EXAFS). Pu L{sub III}-edge and U L{sub III}-edge EXAFS data measured at low temperatures verify the crystal structures of {alpha}-U and {alpha}-Pu samples previously determined by x-ray diffraction and neutron scattering. Debye-Waller factors from temperature-dependent EXAFS measurements are fit with a correlated Debye model. The observed Pu-Pu bond correlated Debye temperature of {theta}{sub cD}({alpha}-Pu) = 162 {+-} 5 K for the pure {alpha}-Pu phase agrees with our previous measurement of the correlated Debye temperature of the gallium-containing {alpha}'-Pu phase in a mixed phase 1.9 at% Ga-doped {alpha}'-Pu/{delta}-Pu alloy. The temperature dependence of the U-U nearest neighbor Debye-Waller factor exhibits a sharp discontinuity in slope near T{sub CDW} = 43 K, the transition temperature at which the charge-density wave (CDW) in {alpha}-U condenses from a soft phonon mode along the (100) direction. Our measurement of the CDW using EXAFS is the first observation of the structure of the CDW in polycrystalline {alpha}-U. The different temperature dependence of the Debye-Waller factor for T < T{sub CDW} can be modeled by the change in bond length distributions resulting from condensation of the charge density wave. For T > T{sub CDW}, the observed correlated Debye temperature of {theta}{sub cD}({alpha}-U) = 199 {+-} 3 K is in good agreement with other measurements of the Debye temperature for polycrystalline {alpha}-U. CDW structural models fit to the {alpha}-U EXAFS data support a squared CDW at the lowest temperatures, with a displacement amplitude of {var_epsilon} = 0.05 {+-} 0.02 {angstrom}.

  14. Improved peak shape fitting in alpha spectra.

    PubMed

    Pommé, S; Caro Marroyo, B

    2015-02-01

    Peak overlap is a recurrent issue in alpha-particle spectrometry, not only in routine analyses but also in the high-resolution spectra from which reference values for alpha emission probabilities are derived. In this work, improved peak shape formulae are presented for the deconvolution of alpha-particle spectra. They have been implemented as fit functions in a spreadsheet application and optimum fit parameters were searched with built-in optimisation routines. Deconvolution results are shown for a few challenging spectra with high statistical precision. The algorithm outperforms the best available routines for high-resolution spectrometry, which may facilitate a more reliable determination of alpha emission probabilities in the future. It is also applicable to alpha spectra with inferior energy resolution. PMID:25497323

  15. Homomers of alpha 8 and alpha 7 subunits of nicotinic receptors exhibit similar channel but contrasting binding site properties.

    PubMed

    Gerzanich, V; Anand, R; Lindstrom, J

    1994-02-01

    alpha 8 subunits of alpha-bungarotoxin-sensitive chick neuronal nicotinic acetylcholine receptors expressed in Xenopus oocytes from cRNA are shown to form homomeric, acetylcholine-gated, rapidly desensitizing, inwardly rectifying, Ca(2+)-permeable cation channels similar to those of alpha 7 homomers. alpha 8 forms oligomers of several sizes, of which < 14% are expressed on the oocyte surface, which is less efficient than for alpha 7 homomers. alpha 8 homomers are more sensitive to agonists but less sensitive to antagonists than are alpha 7 homomers, and some agonists for alpha 8 homomers are partial agonists or antagonists for alpha 7 homomers. The pharmacological properties of homomers of alpha 8 and alpha 7 subunits generally reflect those of native alpha 8 and alpha 7 receptors.

  16. Catalytic Mechanism of Human Alpha-galactosidase

    SciTech Connect

    Guce, A.; Clark, N; Salgado, E; Ivanen, D; Kulinskaya, A; Brumer, H; Garman, S

    2010-01-01

    The enzyme {alpha}-galactosidase ({alpha}-GAL, also known as {alpha}-GAL A; E.C. 3.2.1.22) is responsible for the breakdown of {alpha}-galactosides in the lysosome. Defects in human {alpha}-GAL lead to the development of Fabry disease, a lysosomal storage disorder characterized by the buildup of {alpha}-galactosylated substrates in the tissues. {alpha}-GAL is an active target of clinical research: there are currently two treatment options for Fabry disease, recombinant enzyme replacement therapy (approved in the United States in 2003) and pharmacological chaperone therapy (currently in clinical trials). Previously, we have reported the structure of human {alpha}-GAL, which revealed the overall structure of the enzyme and established the locations of hundreds of mutations that lead to the development of Fabry disease. Here, we describe the catalytic mechanism of the enzyme derived from x-ray crystal structures of each of the four stages of the double displacement reaction mechanism. Use of a difluoro-{alpha}-galactopyranoside allowed trapping of a covalent intermediate. The ensemble of structures reveals distortion of the ligand into a {sup 1}S{sub 3} skew (or twist) boat conformation in the middle of the reaction cycle. The high resolution structures of each step in the catalytic cycle will allow for improved drug design efforts on {alpha}-GAL and other glycoside hydrolase family 27 enzymes by developing ligands that specifically target different states of the catalytic cycle. Additionally, the structures revealed a second ligand-binding site suitable for targeting by novel pharmacological chaperones.

  17. Sumoylation and the function of CCAAT enhancer binding protein alpha (C/EBP alpha).

    PubMed

    Khanna-Gupta, Arati

    2008-01-01

    CCAAT enhancer binding protein alpha (C/EBP alpha) is the founding member of a family of basic region/leucine zipper (bZIP) transcription factors and is a master regulator of granulopoiesis. It is expressed at high levels throughout myeloid differentiation and binds to the promoters of multiple myeloid-specific genes at different stages of myeloid maturation. Profound hematopoietic abnormalities occur in mice nullizygous for C/EBP alpha including a selective early block in the differentiation of granulocytes. Mutations in C/EBP alpha are present in a subset of patients with AML presenting with a normal karyotype. These mutations can result in the expression of a 30 kDa dominant negative C/EBP alpha isoform, which contributes to loss of C/EBP alpha function. The molecular basis for this observation remains unknown. In addition to phosphorylation, C/EBP alpha is modified, post-translationally by a small ubiquitin-related modifier (SUMO) at a lysine residue (K159), which lies within the growth inhibitory region of the C/EBP alpha protein. Sumoylation at K159 in the C/EBP alpha protein prevents association of the SWI/SNF chromatin remodeling complex with C/EBP alpha, thereby hampering transactivation. In this review, the functional implications of post-translational modification, particularly sumoylation, of C/EBP alpha in normal granulopoiesis and leukemia are considered. PMID:18406180

  18. Folate receptor {alpha} regulates cell proliferation in mouse gonadotroph {alpha}T3-1 cells

    SciTech Connect

    Yao, Congjun; Evans, Chheng-Orn; Stevens, Victoria L.; Owens, Timothy R.; Oyesiku, Nelson M.

    2009-11-01

    We have previously found that the mRNA and protein levels of the folate receptor alpha (FR{alpha}) are uniquely over-expressed in clinically human nonfunctional (NF) pituitary adenomas, but the mechanistic role of FR{alpha} has not fully been determined. We investigated the effect of FR{alpha} over-expression in the mouse gonadotroph {alpha}T3-1 cell line as a model for NF pituitary adenomas. We found that the expression and function of FR{alpha} were strongly up-regulated, by Western blotting and folic acid binding assay. Furthermore, we found a higher cell growth rate, an enhanced percentage of cells in S-phase by BrdU assay, and a higher PCNA staining. These observations indicate that over-expression of FR{alpha} promotes cell proliferation. These effects were abrogated in the same {alpha}T3-1 cells when transfected with a mutant FR{alpha} cDNA that confers a dominant-negative phenotype by inhibiting folic acid binding. Finally, by real-time quantitative PCR, we found that mRNA expression of NOTCH3 was up-regulated in FR{alpha} over-expressing cells. In summary, our data suggests that FR{alpha} regulates pituitary tumor cell proliferation and mechanistically may involve the NOTCH pathway. Potentially, this finding could be exploited to develop new, innovative molecular targeted treatment for human NF pituitary adenomas.

  19. Alpha1 and Alpha2 Integrins Mediate Invasive Activity of Mouse Mammary Carcinoma Cells through Regulation of Stromelysin-1 Expression

    SciTech Connect

    Lochter, Andre; Navre, Marc; Werb, Zena; Bissell, Mina J

    1998-06-29

    Tumor cell invasion relies on cell migration and extracellular matrix proteolysis. We investigated the contribution of different integrins to the invasive activity of mouse mammary carcinoma cells. Antibodies against integrin subunits {alpha}6 and {beta}1, but not against {alpha}1 and {alpha}2, inhibited cell locomotion on a reconstituted basement membrane in two-dimensional cell migration assays, whereas antibodies against {beta}1, but not against a6 or {alpha}2, interfered with cell adhesion to basement membrane constituents. Blocking antibodies against {alpha}1 integrins impaired only cell adhesion to type IV collagen. Antibodies against {alpha}1, {alpha}2, {alpha}6, and {beta}1, but not {alpha}5, integrin subunits reduced invasion of a reconstituted basement membrane. Integrins {alpha}1 and {alpha}2, which contributed only marginally to motility and adhesion, regulated proteinase production. Antibodies against {alpha}1 and {alpha}2, but not {alpha}6 and {beta}1, integrin subunits inhibited both transcription and protein expression of the matrix metalloproteinase stromelysin-1. Inhibition of tumor cell invasion by antibodies against {alpha}1 and {alpha}2 was reversed by addition of recombinant stromelysin-1. In contrast, stromelysin-1 could not rescue invasion inhibited by anti-{alpha}6 antibodies. Our data indicate that {alpha}1 and {alpha}2 integrins confer invasive behavior by regulating stromelysin-1 expression, whereas {alpha}6 integrins regulate cell motility. These results provide new insights into the specific functions of integrins during tumor cell invasion.

  20. G alpha 12 and G alpha 13 subunits define a fourth class of G protein alpha subunits.

    PubMed Central

    Strathmann, M P; Simon, M I

    1991-01-01

    Heterotrimeric guanine nucleotide-binding regulatory proteins (G proteins) are central to the signaling processes of multicellular organisms. We have explored the diversity of the G protein subunits in mammals and found evidence for a large family of genes that encode the alpha subunits. Amino acid sequence comparisons show that the different alpha subunits fall into at least three classes. These classes have been conserved in animals separated by considerable evolutionary distances; they are present in mammals, Drosophila, and nematodes. We have now obtained cDNA clones encoding two murine alpha subunits, G alpha 12 and G alpha 13, that define a fourth class. The translation products are predicted to have molecular masses of 44 kDa and to be insensitive to ADP-ribosylation by pertussis toxin. They share 67% amino acid sequence identity with each other and less than 45% identity with other alpha subunits. Their transcripts can be detected in every tissue examined, although the relative levels of the G alpha 13 message appear somewhat variable. Images PMID:1905812

  1. Sensitivity to alpha-amylcinnamic aldehyde and alpha-amylcinnamic alcohol.

    PubMed

    Guin, J D; Haffley, P

    1983-01-01

    Sensitivity to alpha-amylcinnamic aldehyde (alpha-AcAld) is apparently uncommon, but, like allergy to alpha-amylcinnamic alcohol (alpha-AcAlc), it often accompanies allergy to the perfume in Mycolog cream. Although alpha-AcAlc is a known ingredient, alpha-AcAld is not. However, gas-liquid chromatographic analysis shows alpha-AcAld to be present. Of fourteen persons sensitive to either chemical, ten reacted to both. Of these, one man and three women were markedly sensitive, and all three women had chronic recalcitrant vulvar eczema. That condition might have been the cause as well as the result of sensitization, but reexposure to a suspected product reproduced the eruption in both persons tested. Its use with other potent sensitizers, e.g., ethylenediamine, to treat irritations and chronic eczemas in an area of high absorption may partly explain development of allergy to a relatively weak sensitizer.

  2. Effect of UVB on hydrolysis of alpha-tocopherol acetate to alpha-tocopherol in mouse skin.

    PubMed

    Kramer-Stickland, K; Liebler, D C

    1998-08-01

    We have assessed the hydrolysis of alpha-tocopherol acetate (alpha-TAc) to the active antioxidant alpha-tocopherol (alpha-TH) in mouse epidermis and in supernatant from epidermal homogenates. Topically administered alpha-TH prevents UVB photocarcinogenesis in C3H mice, whereas alpha-TAc does not. Hydrolysis in skin was monitored in mice treated topically with deuterium labeled alpha-TAc (d3-alpha-TAc). Epidermal samples were isolated from mice and analyzed for endogenous (d0-alpha-TAc) and d3-alpha-TH by gas chromatography-mass spectrometry. Within 24 h, the levels of d3-alpha-TH increased up to 10-fold over endogenous d0-alpha-TH levels; however, in mice irradiated with UVB prior to the application of d3-alpha-TAc, levels of d3-alpha-TH increased up to 30-40-fold over endogenous d0-alpha-TH. This enhancement of alpha-TAc hydrolysis increased with increasing UVB dose. Prior UVB exposure may increase hydrolysis of alpha-TAc by increasing epidermal esterase activity. Nonspecific esterase activity was measured in the 2000 x g supernatant from epidermis of unirradiated and irradiated mice. Alpha-napthyl acetate, a nonspecific esterase substrate, was converted to alpha-napthol in supernatants from unirradiated mice. Hydrolysis to alpha-napthol increased approximately 3-fold in supernatants from irradiated mice. Hydrolysis of alpha-TAc to alpha-TH also occurred in supernatant from unirradiated mice, and this hydrolysis increased approximately 3-fold in supernatant from irradiated animals. These data indicate that nonspecific esterase activity was increased by UVB in the skin, that alpha-TAc is converted to alpha-TH in the homogenate fraction containing nonspecific esterase, and that UVB exposure modulates the metabolism of alpha-TAc to alpha-TH in vivo.

  3. Mapping High-Velocity H-alpha and Lyman-alpha Emission from Supernova 1987A

    NASA Technical Reports Server (NTRS)

    France, Kevin; McCray, Richard; Fransson, Claes; Larsson, Josefin; Frank, Kari A.; Burrows, David N.; Challis, Peter; Kirshner, Robert P.; Chevalier, Roger A.; Garnavich, Peter; Heng, Kevin; Lawrence, Stephen S.; Lundqvist, Peter; Smith, Nathan; Sonneborn, George

    2015-01-01

    We present new Hubble Space Telescope images of high-velocity H-alpha and Lyman-alpha emission in the outer debris of SN 1987A. The H-alpha images are dominated by emission from hydrogen atoms crossing the reverse shock. For the first time we observe emission from the reverse shock surface well above and below the equatorial ring, suggesting a bipolar or conical structure perpendicular to the ring plane. Using the H-alpha imaging, we measure the mass flux of hydrogen atoms crossing the reverse shock front, in the velocity intervals (-7,500 < V(sub obs) < -2,800 km/s) and (1,000 < V(sub obs) < 7,500 km/s), ?M(sub H) = 1.2 × 10(exp -3) M/ y. We also present the first Lyman-alpha imaging of the whole remnant and new Chandra X-ray observations. Comparing the spatial distribution of the Lyman-alpha and X-ray emission, we observe that the majority of the high-velocity Lyman-alpha emission originates interior to the equatorial ring. The observed Lyman-alpha/H-alpha photon ratio, R(L-alpha/H-alpha) approx. = 17, is significantly higher than the theoretically predicted ratio of approx. = 5 for neutral atoms crossing the reverse shock front. We attribute this excess to Lyman-alpha emission produced by X-ray heating of the outer debris. The spatial orientation of the Lyman-alpha and X-ray emission suggests that X-ray heating of the outer debris is the dominant Lyman-alpha production mechanism in SN 1987A at this phase in its evolution.

  4. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].

    PubMed

    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo

    2004-10-01

    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples.

  5. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].

    PubMed

    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo

    2004-10-01

    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples. PMID:15678944

  6. A new alpha chain hemoglobin variant: Hb Al-Hammadi Riyadh [alpha75(EF4)Asp-->Val (alpha2)].

    PubMed

    Burnichon, Nelly; Lacan, Philippe; Becchi, Michel; Zanella-Cleon, Isabelle; Aubry, Martine; Mowafy, Mohammed; Couprie, Nicole; Francina, Alain

    2006-01-01

    A new hemoglobin (Hb) variant in the heterozygous state, Hb Al-Hammadi Riyadh [codon 75 (GAC-->GTC); alpha75(EF4)Asp-->Val (alpha2)] corresponding to an A-->T transversion on the second exon of the alpha2-globin gene, is described. The variant was characterized by DNA sequencing and mass spectrometry (MS). The variant was found during a routine Hb analysis for anemia in a 16-month-old boy who lived in Riyadh, Kingdom of Saudi Arabia.

  7. Genetics Home Reference: mucolipidosis III alpha/beta

    MedlinePlus

    ... Health Conditions mucolipidosis III alpha/beta mucolipidosis III alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis III alpha/beta is a slowly progressive disorder that affects ...

  8. Genetics Home Reference: mucolipidosis II alpha/beta

    MedlinePlus

    ... Health Conditions mucolipidosis II alpha/beta mucolipidosis II alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis II alpha/beta (also known as I-cell disease) is ...

  9. 24xi-Methyl 5 alpha-cholestane-3 alpha,6 beta,9 alpha,25-tetrol 24-monoacetate, a novel polyhydroxylated steroid from the soft coral Sarcophyton tortuosum.

    PubMed

    Su, J Y; Peng, T S; Long, K H; Zeng, L M

    1986-01-01

    A novel polyhydroxylated steroid, named sartortuosterol A, with rare 3 alpha- and 6-hydroxyl groups, was isolated from the South China Sea soft coral Sarcophyton tortuosum Tixier-Durivault, and its structure was established as 24xi-methyl 5 alpha-cholestane-3 alpha, 6 beta, 9 alpha,25-tetrol 25-monoacetate from spectroscopic data and chemical conversions.

  10. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed. PMID:7162915

  11. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed.

  12. Applying alpha-channeling to mirror machines

    SciTech Connect

    Zhmoginov, A. I.; Fisch, N. J.

    2012-05-15

    The {alpha}-channeling effect entails the use of radio-frequency waves to expel and cool high-energetic {alpha} particles born in a fusion reactor; the device reactivity can then be increased even further by redirecting the extracted energy to fuel ions. Originally proposed for tokamaks, this technique has also been shown to benefit open-ended fusion devices. Here, the fundamental theory and practical aspects of {alpha} channeling in mirror machines are reviewed, including the influence of magnetic field inhomogeneity and the effect of a finite wave region on the {alpha}-channeling mechanism. For practical implementation of the {alpha}-channeling effect in mirror geometry, suitable contained weakly damped modes are identified. In addition, the parameter space of candidate waves for implementing the {alpha}-channeling effect can be significantly extended through the introduction of a suitable minority ion species that has the catalytic effect of moderating the transfer of power from the {alpha}-channeling wave to the fuel ions.

  13. Lyman alpha radiation in external galaxies

    NASA Technical Reports Server (NTRS)

    Neufeld, David A.; Mckee, Christopher F.

    1990-01-01

    The Ly alpha line of atomic hydrogen is often a luminous component of the radiation emitted by distant galaxies. Except for those galaxies which have a substantial central source of non-stellar ionizing radiation, most of the Ly alpha radiation emitted by galaxies is generated within regions of the interstellar medium which are photoionized by starlight. Conversely, much of the energy radiated by photoionized regions is carried by the Ly alpha line. Only hot, massive stars are capable of ionizing hydrogen in the interstellar medium which surrounds them, and because such stars are necessarily short-lived, Ly alpha emission traces regions of active star formation. Researchers argue that the strength of the Ly alpha emission observed from external galaxies may be used to estimate quantitatively the dust content of the emitting region, while the Ly alpha line profile is sensitive to the presence of shock waves. Interstellar dust particles and shock waves are intimately associated with the process of star formation in two senses. First, both dust particles and shock waves owe their existence to stellar activity; second, they may both serve as agents which facilitate the formation of stars, shocks by triggering gravitational instabilities in the interstellar gas that they compress, and dust by shielding star-forming molecular clouds from the ionizing and dissociative effects of external UV radiation. By using Ly alpha observations as a probe of the dust content in diffuse gas at high redshift, we might hope to learn about the earliest epochs of star formation.

  14. Diagnostics for PLX-alpha

    NASA Astrophysics Data System (ADS)

    Gilmore, Mark; Hsu, Scott

    2015-11-01

    The goal of the Plasma Liner eXperiment PLX-alpha at Los Alamos National Laboratory is to establish the viability of creating a spherically imploding plasma liner for MIF and HED applications, using a spherical array of supersonic plasma jets launched by innovative contoured-gap coaxial plasma guns. PLX- α experiments will focus in particular on establishing the ram pressure and uniformity scalings of partial and fully spherical plasma liners. In order to characterize these parameters experimentally, a suite of diagnostics is planned, including multi-camera fast imaging, a 16-channel visible interferometer (upgraded from 8 channels) with reconfigurable, fiber-coupled front end, and visible and VUV high-resolution and survey spectroscopy. Tomographic reconstruction and data fusion techniques will be used in conjunction with interferometry, imaging, and synthetic diagnostics from modeling to characterize liner uniformity in 3D. Diagnostic and data analysis design, implementation, and status will be presented. Supported by the Advanced Research Projects Agency - Energy - U.S. Department of Energy.

  15. Lyman Alpha Spicule Observatory (LASO)

    NASA Technical Reports Server (NTRS)

    Chamberlin, Phillip C.

    2011-01-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe smallscale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mAngstroms (33mAngstroms pixels) across a broad 20Angstrom spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-a emission at 1216Angstroms. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  16. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail

    2011-01-01

    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  17. Lyman Alpha Spicule Observatory (LASO)

    NASA Astrophysics Data System (ADS)

    Chamberlin, Phillip C.; Allred, J.; Airapetian, V.; Gong, Q.; Fontenla, J.; McIntosh, S.; de Pontieu, B.

    2011-05-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe small-scale eruptive events called "Rapid Blue-shifted Events” (RBEs), the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1” pixels) over a 2'x2' field of view with high spectral resolution of 66mÅ (33mÅ pixels) across a broad 20Å spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-α emission at 1216Å. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  18. Lyman Alpha Spicule Observatory (LASO)

    NASA Astrophysics Data System (ADS)

    Chamberlin, P. C.; Allred, J. C.; Airapetian, V.; Gong, Q.; Mcintosh, S. W.; De Pontieu, B.; Fontenla, J. M.

    2011-12-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe small-scale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mÅ (33mÅ pixels) across a broad 20Å spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-α emission at 1216Å. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  19. Divergence of human [alpha]-chain constant region gene sequences: A novel recombinant [alpha]2 gene

    SciTech Connect

    Chintalacharuvu, K. R.; Morrison, S.L. ); Raines, M. )

    1994-06-01

    IgA is the major Ig synthesized in humans and provides the first line of defense at the mucosal surfaces. The constant region of IgA heavy chain is encoded by the [alpha] gene on chromosome 14. Previous studies have indicated the presence of two [alpha] genes, [alpha]1 and [alpha]2 existing in two allotypic forms, [alpha]2 m(1) and [alpha]2 m(2). Here the authors report the cloning and complete nucleotide sequence determination of a novel human [alpha] gene. Nucleotide sequence comparison with the published [alpha] sequences suggests that the gene arose as a consequence of recombination or gene conversion between the two [alpha]2 alleles. The authors have expressed the gene as a chimeric protein in myeloma cells indicating that it encodes a functional protein. The novel IgA resembles IgA2 m(2) in that disulfide bonds link H and L chains. This novel recombinant gene provides insights into the mechanisms of generation of different constant regions and suggests that within human populations, multiple alleles of [alpha] may be present providing IgAs of different structures.

  20. Fibrinogen {alpha} genes: Conservation of bipartite transcripts and carboxy-terminal-extended {alpha} subunits in vertebrates

    SciTech Connect

    Fu, Y.; Cao, Y.; Hertzberg, K.M.; Grieninger, G.

    1995-11-01

    All three well-studied subunits of the clotting protein fibrinogen ({alpha}, {beta}, {gamma}) share N-terminal structural homologies, but until recently only the {beta} and {gamma} chains were recognized as having similar globular C-termini. With the discovery of an extra exon in the human fibrinogen {alpha} gene (exon VI), a minor form of the {alpha} subunit ({alpha}{sub E}) with an extended {beta}- and {gamma}-like C-terminus has been identified. In the present study, the polymerase chain reaction has been used to identify sequences that encode counterparts to {alpha}{sub E} in chicken, rabbit, rat, and baboon. The basic six-exon structure of the fibrinogen {alpha} genes is shown to be conserved among mammals and birds, as are the intron positions. Bipartite transcripts - still bearing an intron prior to the last exon - are found among the products of the various vertebrate fibrinogen {alpha} genes. The last exon represents the largest conserved segment of the gene and, in each species examined, encodes exactly 236 amino acids. The C-termini of these {alpha}{sub E} chains align without a single gap and are between 76 and 99% identical. Since the exon VI-encoded domain of {alpha}{sub E} is as well conserved as the corresponding regions of the {beta} and {gamma} chains, it follows that it is equally important and that {alpha}{sub E}-fibrinogen plays a vital, if as-yet unrecognized physiological role. 21 refs., 7 figs., 1 tab.

  1. Variable displacement alpha-type Stirling engine

    NASA Astrophysics Data System (ADS)

    Homutescu, V. M.; Bălănescu, D. T.; Panaite, C. E.; Atanasiu, M. V.

    2016-08-01

    The basic design and construction of an alpha-type Stirling engine with on load variable displacement is presented. The variable displacement is obtained through a planar quadrilateral linkage with one on load movable ground link. The physico-mathematical model used for analyzing the variable displacement alpha-type Stirling engine behavior is an isothermal model that takes into account the real movement of the pistons. Performances and power adjustment capabilities of such alpha-type Stirling engine are calculated and analyzed. An exemplification through the use of the numerical simulation was performed in this regard.

  2. Alpha spectral analysis via artificial neural networks

    SciTech Connect

    Kangas, L.J.; Hashem, S.; Keller, P.E.; Kouzes, R.T.; Troyer, G.L.

    1994-10-01

    An artificial neural network system that assigns quality factors to alpha particle energy spectra is discussed. The alpha energy spectra are used to detect plutonium contamination in the work environment. The quality factors represent the levels of spectral degradation caused by miscalibration and foreign matter affecting the instruments. A set of spectra was labeled with a quality factor by an expert and used in training the artificial neural network expert system. The investigation shows that the expert knowledge of alpha spectra quality factors can be transferred to an ANN system.

  3. Determining cellular role of G alpha 12.

    PubMed

    Dermott, Jonathan M; Dhanasekaran, N

    2002-01-01

    Using the expression strategies described here, we have demonstrated a model system whereby the sequential signaling events involved in cell proliferation and subsequent transformation regulated by G alpha 12 can be investigated. The model system presented here can also be used to study the temporal interrelationships between small GTPases, kinases, and other signaling proteins involved in G alpha 12-signaling pathways. Further analyses using this model system and the strategies presented here should provide valuable clues in defining the signaling network regulated by G alpha 12 in stimulating cell proliferation and oncogenic transformation. PMID:11771390

  4. Crystallization of hepatocyte nuclear factor 4 alpha (HNF4 alpha) in complex with the HNF1 alpha promoter element.

    PubMed

    Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G; Chi, Young-In

    2008-04-01

    Hepatocyte nuclear factor 4alpha (HNF4alpha) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4alpha cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4alpha DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1alpha. The HNF4alpha protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 A using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 A, beta = 119.36 degrees . A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants. PMID:18391435

  5. Production of tumor necrosis factor alpha, interleukin-1 alpha, and interleukin-6 during murine coccidioidomycosis.

    PubMed Central

    Cox, R A; Magee, D M

    1995-01-01

    The proinflammatory cytokines tumor necrosis factor alpha (TNF-alpha), interleukin-1 alpha (IL-1 alpha), and interleukin-6 (IL-6) were induced in mice infected with Coccidioides immitis. Analyses of the cytokine profiles of two inbred mouse strains which differ in their susceptibility to pulmonary challenge with C. immitis revealed higher levels of IL-6 in lungs from DBA/2 mice (resistant strain) than in those from BALB/c mice (susceptible strain) beginning at day 6 and continuing through day 15 postinfection. Spleen cells from both mouse strains secreted TNF-alpha, IL-1 alpha, and IL-6 in vitro in response to stimulation with killed spherules but differed in that spleen cells from the resistant strain produced increased levels of these cytokines earlier after pulmonary challenge and at increased levels throughout the course of the disease. PMID:7558338

  6. Influence of fast alpha diffusion and thermal alpha buildup on tokamak reactor performance

    SciTech Connect

    Uckan, N.A.; Tolliver, J.S.; Houlberg, W.A.; Attenberger, S.E.

    1987-11-01

    The effect of fast alpha diffusion and thermal alpha accumulation on the confinement capability of a candidate Engineering Test Reactor (ETR) plasma (Tokamak Ignition/Burn Experimental Reactor (TIBER-II)) in achieving ignition and steady-state driven operation has been assessed using both global and 1-1/2-D transport models. Estimates are made of the threshold for radial diffusion of fast alphas and thermal alpha buildup. It is shown that a relatively low level of radial transport, when combined with large gradients in the fast alpha density, leads to a significant radial flow with a deleterious effect on plasma performance. Similarly, modest levels of thermal alpha concentration significantly influence the ignition and steady-state burn capability. 23 refs., 9 figs., 4 tabs.

  7. Radioimmunotherapy with alpha-particle emitting radionuclides.

    PubMed

    Zalutsky, M R; Pozzi, O R

    2004-12-01

    An important consideration in the development of effective strategies for radioimmunotherapy is the nature of the radiation emitted by the radionuclide. Radionuclides decaying by the emission of alpha-particles offer the possibility of matching the cell specific reactivity of monoclonal antibodies with radiation with a range of only a few cell diameters. Furthermore, alpha-particles have important biological advantages compared with external beam radiation and beta-particles including a higher biological effectiveness, which is nearly independent of oxygen concentration, dose rate and cell cycle position. In this review, the clinical settings most likely to benefit from alpha-particle radioimmunotherapy will be discussed. The current status of preclinical and clinical research with antibodies labeled with 3 promising alpha-particle emitting radionuclides - (213)Bi, (225)Ac, and (211)At - also will be summarized.

  8. Radioimmunotherapy with alpha-particle emitting radionuclides.

    PubMed

    Zalutsky, M R; Pozzi, O R

    2004-12-01

    An important consideration in the development of effective strategies for radioimmunotherapy is the nature of the radiation emitted by the radionuclide. Radionuclides decaying by the emission of alpha-particles offer the possibility of matching the cell specific reactivity of monoclonal antibodies with radiation with a range of only a few cell diameters. Furthermore, alpha-particles have important biological advantages compared with external beam radiation and beta-particles including a higher biological effectiveness, which is nearly independent of oxygen concentration, dose rate and cell cycle position. In this review, the clinical settings most likely to benefit from alpha-particle radioimmunotherapy will be discussed. The current status of preclinical and clinical research with antibodies labeled with 3 promising alpha-particle emitting radionuclides - (213)Bi, (225)Ac, and (211)At - also will be summarized. PMID:15640792

  9. Alpha Coincidence Spectroscopy studied with GEANT4

    SciTech Connect

    Dion, Michael P.; Miller, Brian W.; Tatishvili, Gocha; Warren, Glen A.

    2013-11-02

    Abstract The high-energy side of peaks in alpha spectra, e.g. 241Am, as measured with a silicon detector has structure caused mainly by alpha-conversion electron and to some extent alphagamma coincidences. We compare GEANT4 simulation results to 241Am alpha spectroscopy measurements with a passivated implanted planar silicon detector. A large discrepancy between the measurements and simulations suggest that the GEANT4 photon evaporation database for 237Np (daughter of 241Am decay) does not accurately describe the conversion electron spectrum and therefore was found to have large discrepancies with experimental measurements. We describe how to improve the agreement between GEANT4 and alpha spectroscopy for actinides of interest by including experimental measurements of conversion electron spectroscopy into the photon evaporation database.

  10. Radioimmunotherapy with alpha-emitting nuclides.

    PubMed

    McDevitt, M R; Sgouros, G; Finn, R D; Humm, J L; Jurcic, J G; Larson, S M; Scheinberg, D A

    1998-09-01

    This review discusses the application of alpha particle-emitting radionuclides in targeted radioimmunotherapy. It will outline the production and chemistry of astatine-211, bismuth-212, lead-212, actinium-225, bismuth-213, fermium-255, radium-223 and terbium-149, which at present are the most promising alpha-emitting isotopes available for human clinical use. The selective cytotoxicity offered by alpha particle-emitting radioimmunoconstructs is due to the high linear energy transfer and short particle path length of these radionuclides. Based upon the pharmacokinetics of alpha particle-emitting radioimmunoconstructs, both stochastic and conventional dosimetric methodology is discussed, as is the preclinical and initial clinical use of these radionuclides conjugated to monoclonal antibodies for the treatment of human neoplasia. PMID:9724387

  11. Genetics Home Reference: alpha-1 antitrypsin deficiency

    MedlinePlus

    ... and genetic modifiers of emphysema risk. Thorax. 2004 Mar;59(3):259-64. Review. Citation on PubMed ... alpha}1-antitrypsin deficiency. Arch Intern Med. 2009 Mar 23;169(6):546-50. doi: 10.1001/ ...

  12. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, L.R.; Post, D.E. Jr.; Dawson, J.M.

    1983-11-23

    This invention relates generally to high energy confined plasmas and more particularly is directed to measuring the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a confined energetic plasma.

  13. Note on Two Generalizations of Coefficient Alpha.

    ERIC Educational Resources Information Center

    Raju, Nambury S.

    1979-01-01

    An important relationship is given for two generalizations of coefficient alpha: (1) Rajaratnam, Cronbach, and Gleser's generalizability formula for stratified-parallel tests, and (2) Raju's coefficient beta. (Author/CTM)

  14. [Multiplex PCR for detecting genotypes of deletional alpha-thalassemia].

    PubMed

    Wu, Jie-Ying; Liao, Can; Li, Jian; Huang, Yi-Ning

    2004-08-01

    To investigate the clinical application of multiplex PCR in detecting genotypes of deletional alpha-thalassemia in South China and observe the distribution frequency of alpha-globin gene deletion, 145 patients with silent carrier, alpha thalassemia trait or HbH were identified by M-PCR and 1.2% agarose gel electrophoresis. There are 1.3, 1.6, 1.8 and 2.0 kb bands which indicate --(SEA), -alpha(4.2), alphaalpha and -alpha(3.7), respectively. The results showed that among 145 patients, 100 patients with --(SEA)/alphaalpha (68.9%), 15 with -alpha(3.7)/alphaalpha (10.3%), 8 with -alpha(4.2)/alphaalpha (5.52%), 2 with -alpha(3.7)/-alpha(4.2) (1.38%), 1 with -alpha(3.7)/-alpha(3.7) (0.69%), 1 with -alpha(4.2)/-alpha(4.2) (0.69%), 14 with --(SEA)/-alpha(3.7) (9.65%), 2 with --(SEA)/-alpha(4.2) (1.38%) were found. Two patients prenatal diagnosed were confirmed with Bart's hydrops fetuses. In conclusion, M-PCR analysis is a simple, rapid and accurate method for detection of alpha-thalassemia gene deletion. This technique is helpful in screening, carrier identification and prenatal diagnosis of deletional alpha-thalassemia.

  15. The ALPHA Experiment: A Cold Antihydrogen Trap

    SciTech Connect

    Bertsche, W.; Chapman, S.; Deutsch, A.; Fajans, J.; Gomberoff, K.; Wurtele, J.; Boston, A.; Chartier, M.; Nolan, P.; Page, R.D.; Bowe, P.D.; Hangst, J.S.; Madsen, N.; Cesar, C.L.; Miranda, D.; Charlton, M.; Jenkins, M.; Joergensen, L.V.; Telle, H.H.; Werf, D.P. van der

    2005-10-26

    The ALPHA experiment aims to trap antihydrogen as the next crucial step towards a precise CPT test, by a spectroscopic comparison of antihydrogen with hydrogen. The experiment will retain the salient techniques developed by the ATHENA collaboration during the previous phase of antihydrogen experiments at the antiproton decelerator (AD) at CERN. The collaboration has identified the key problems in adding a neutral antiatom trap to the previously developed experimental configuration. The solutions identified by ALPHA are described in this paper.

  16. Transport of Radioactive Material by Alpha Recoil

    SciTech Connect

    Icenhour, A.S.

    2005-05-19

    The movement of high-specific-activity radioactive particles (i.e., alpha recoil) has been observed and studied since the early 1900s. These studies have been motivated by concerns about containment of radioactivity and the protection of human health. Additionally, studies have investigated the potential advantage of alpha recoil to effect separations of various isotopes. This report provides a review of the observations and results of a number of the studies.

  17. Measurement of the angle alpha at BABAR

    SciTech Connect

    Perez, A.; /Orsay, LAL

    2009-06-25

    The authors present recent measurements of the CKM angle {alpha} using data collected by the BABAR detector at the PEP-II asymmetric-energy e{sup +}e{sup -} collider at the SLAC National Accelerator Laboratory, operating at the {Upsilon}(4S) resonance. They present constraints on {alpha} from B {yields} {pi}{pi}, B {yields} {rho}{rho} and B {yields} {rho}{pi} decays.

  18. Alpha-emitters for medical therapy workshop

    SciTech Connect

    Feinendegen, L.E.; McClure, J.J.

    1996-12-31

    A workshop on ``Alpha-Emitters for Medical Therapy`` was held May 30-31, 1996 in Denver Colorado to identify research goals and potential clinical needs for applying alpha-particle emitters and to provide DOE with sufficient information for future planning. The workshop was attended by 36 participants representing radiooncology, nuclear medicine, immunotherapy, radiobiology, molecular biology, biochemistry, radiopharmaceutical chemistry, dosimetry, and physics. This report provides a summary of the key points and recommendations arrived at during the conference.

  19. Different polyphenolic components of soft fruits inhibit alpha-amylase and alpha-glucosidase.

    PubMed

    McDougall, Gordon J; Shpiro, Faina; Dobson, Patricia; Smith, Pauline; Blake, Alison; Stewart, Derek

    2005-04-01

    Polyphenol-rich extracts from soft fruits were tested for their ability to inhibit alpha-amylase and alpha-glucosidase. All extracts tested caused some inhibition of alpha-amylase, but there was a 10-fold difference between the least and most effective extracts. Strawberry and raspberry extracts were more effective alpha-amylase inhibitors than blueberry, blackcurrant, or red cabbage. Conversely, alpha-glucosidase was more readily inhibited by blueberry and blackcurrant extracts. The extent of inhibition of alpha-glucosidase was related to their anthocyanin content. For example, blueberry and blackcurrant extracts, which have the highest anthocyanin content, were the most effective inhibitors of alpha-glucosidase. The extracts most effective in inhibiting alpha-amylase (strawberry and raspberry) contain appreciable amounts of soluble tannins. Other tannin-rich extracts (red grape, red wine, and green tea) were also effective inhibitors of alpha-amylase. Indeed, removing tannins from strawberry extracts with gelatin also removed inhibition. Fractionation of raspberry extracts on Sephadex LH-20 produced an unbound fraction enriched in anthocyanins and a bound fraction enriched in tannin-like polyphenols. The unbound anthocyanin-enriched fraction was more effective against alpha-glucosidase than the original extract, whereas the alpha-amylase inhibitors were concentrated in the bound fraction. The LH-20 bound sample was separated by preparative HPLC, and fractions were assayed for inhibition of alpha-amylase. The inhibitory components were identified as ellagitannins using LC-MS-MS. This study suggests that different polyphenolic components of fruits may influence different steps in starch digestion in a synergistic manner. PMID:15796622

  20. HETDEX: Evolution of Lyman Alpha Emitters

    NASA Astrophysics Data System (ADS)

    Blanc, Guillermo A.; Gebhardt, K.; Hill, G. J.; Gronwall, C.; Ciardullo, R.; Finkelstein, S.; Gawiser, E.; HETDEX Collaboration

    2012-01-01

    The Hobby Eberly Telescope Dark Energy Experiment (HETDEX) will produce a sample of 800,000 Lyman Alpha Emitters (LAEs) over the 1.9Alpha photon escape fraction. Our results show a strong evolution in the Lyman Alpha escape fraction with redshift, most likely associated with the buildup of dust in the ISM. Dust is shown to be the main parameter setting the escape of Lyman Alpha photons. The observed relation between E(B-V) and the escape fraction indicates that radiative transfer effects in LAEs promote the escape of Lyman Alpha photons, but only up to the point of them suffering similar amounts of extinction as continuum photons. Enhancement of the Lyman Alpha EW (e.g. due to the presence of a clumpy medium) seems not to be a common process in these objects. We also discuss the potential of the full HETDEX sample to study the evolution of LAE properties.

  1. Alpha-dispersion in human tissue

    NASA Astrophysics Data System (ADS)

    Grimnes, Sverre; Martinsen, Ørjan G.

    2010-04-01

    Beta dispersion is found in living tissue in the kilohertz - megahertz range and is caused by the cellular structure of biological materials with low frequency properties caused by cell membranes. Alpha dispersion is found in the hertz range and the causes are not so well known. Alpha dispersions are the first to disappear when tissue dies. Tissue data have often been based upon excised specimen from animals and are therefore not necessarily representative for human tissue alpha dispersions. Here we present data obtained with non-invasive skin surface electrodes for different segments of the living human body. We found alpha dispersions in all cases; the ankle-wrist results had the smallest. Large alpha dispersions were found where the distance between the electrodes and muscle masses was small, e.g. on the calf. Further studies on electrode technique and reciprocity, electrode positioning, statistical variations, gender, age and bodily constitutions are necessary in order to reveal more about the alpha dispersion, its appearance and disappearance.

  2. [Alpha-1 antitrypsin deficiency: diagnosis and treatment].

    PubMed

    Camelier, Aquiles A; Winter, Daniel Hugo; Jardim, José Roberto; Barboza, Carlos Eduardo Galvão; Cukier, Alberto; Miravitlles, Marc

    2008-07-01

    Alpha-1 antitrypsin deficiency is a recently identified genetic disease that occurs almost as frequently as cystic fibrosis. It is caused by various mutations in the SERPINA1 gene, and has numerous clinical implications. Alpha-1 antitrypsin is mainly produced in the liver and acts as an antiprotease. Its principal function is to inactivate neutrophil elastase, preventing tissue damage. The mutation most commonly associated with the clinical disease is the Z allele, which causes polymerization and accumulation within hepatocytes. The accumulation of and the consequent reduction in the serum levels of alpha-1 antitrypsin cause, respectively, liver and lung disease, the latter occurring mainly as early emphysema, predominantly in the lung bases. Diagnosis involves detection of low serum levels of alpha-1 antitrypsin as well as phenotypic confirmation. In addition to the standard treatment of chronic obstructive pulmonary disease, specific therapy consisting of infusion of purified alpha-1 antitrypsin is currently available. The clinical efficacy of this therapy, which appears to be safe, has yet to be definitively established, and its cost-effectiveness is also a controversial issue that is rarely addressed. Despite its importance, in Brazil, there are no epidemiological data on the prevalence of the disease or the frequency of occurrence of deficiency alleles. Underdiagnosis has also been a significant limitation to the study of the disease as well as to appropriate treatment of patients. It is hoped that the creation of the Alpha One International Registry will resolve these and other important issues. PMID:18695797

  3. Alpha particle analysis using PEARLS spectrometry

    SciTech Connect

    McKlveen, J.W.; Klingler, G.W.; McDowell, W.J.; Case, G.N.

    1984-01-01

    Alpha particle assay by conventional plate-counting methods is difficult because chemical separation, tracer techniques, and/or self-absorption losses in the final sample may cause either non-reproducible results or create unacceptable errors. PEARLS (Photon-Electron Rejecting Alpha Liquid Scintillation) Spectrometry is an attractive alternative since radionuclides may be extracted into a scintillator in which there would be no self-absorption or geometry problems and in which up to 100% chemical recovery and counting efficiency is possible. Sample preparation may include extraction of the alpha emitter of interest by a specific organic-phase-soluble compound directly into the liquid scintillator. Detection electronics use energy and pulse-shape discrimination to provide discrete alpha spectra and virtual absence of beta and gamma backgrounds. Backgrounds on the order of 0.01 cpm are readily achievable. Accuracy and reproducibility are typically in the 100 +-1% range. Specific procedures have been developed for gross alpha, uranium, plutonium, thorium, and polonium assay. This paper will review liquid scintillation alpha counting methods and reference some of the specific applications. 8 refs., 1 fig.

  4. Enzymic conversion of alpha-oxyprotohaem IX into biliverdin IX alpha by haem oxygenase.

    PubMed Central

    Yoshinaga, T; Sudo, Y; Sano, S

    1990-01-01

    Conversion of four isomers of meso-oxyprotohaem IX into the corresponding biliverdin IX was attempted with a reconstituted haem oxygenase system in the presence of NADPH-cytochrome c reductase and NADPH. Only the alpha-isomer of meso-oxyprotohaem IX was converted effectively into biliverdin IX alpha, which was further reduced to bilirubin IX alpha by biliverdin reductase. Only trace amounts of biliverdins IX beta, IX gamma and IX delta were respectively formed from the incubation mixture of the corresponding oxyprotohaemin IX isomers with the complete haem oxygenase system under the same conditions. In a kinetic study, the Km for alpha-meso-oxyprotohaem IX was 3.6 microM, which was 2-fold higher than that for protohaem IX. The maximum velocity (Vmax.) of the conversion of alpha-meso-oxyprotohaem IX into biliverdin IX alpha was twice as fast as that of protohaem IX. These results demonstrate that alpha-meso-oxyprotohaem IX is an intermediate of haem degradation and it was converted stereospecifically into biliverdin IX alpha via verdohaem IX alpha. PMID:2122884

  5. Assembly of an alpha-gamma coincidence measuring device for checking alpha decay schemes.

    PubMed

    Martín Sánchez, A; Caro Marroyo, B

    2012-09-01

    Two new chambers for measuring alpha-particle emissions have been made: a low-geometry chamber with a powerful magnet to eliminate conversion electrons, and an alpha-gamma coincidence chamber. Both devices incorporate a high-resolution Si detector, and the second chamber, a low-energy Ge detector as well. A dual parameter multichannel analyzer was used to register coincidences in the second device. Alpha-particle and gamma-ray detectors work simultaneously in both individual and dual modes, providing single and coincidence spectra. Some preliminary alpha-gamma coincidence spectra have been obtained.

  6. Methods for the synthesis and polymerization of .alpha.,.alpha.'-dihalo-p-xylenes

    DOEpatents

    Ferraris, John P.; Neef, Charles J.

    2002-07-30

    The present invention describes an improved method for the polymerization of .alpha.,.alpha.-dihalo-p-xylene's such as the .alpha.,.alpha.'-dihalo-2-methoxy-5-(2-ethylhexyloxy)-xylene's. The procedure for synthesis is based on the specific order of addition of reagents and the use of an anionic initiator that allows control of the molecular weight of the polymer. The molecular weight control allows processability of the polymer which is important for its utility in applications including in light-emitting-diodes, field effect transistors and photovoltaic devices.

  7. Overview Of Suborbital Human Transportation Concept Alpha

    NASA Astrophysics Data System (ADS)

    Adirim, H.; Pilz, N.; Marini, M.; Hendrick, P.; Schmid, M.; Behr, R.; Barth, T.; Tarfeld, F.; Wiegand, A.; Charbonnier, D.; Haya Ramos, R.; Steeland, J.; Mack, A.

    2011-05-01

    Within the EC co-funded project FAST20XX (Future high-Altitude high-Speed Transport 20XX), the European suborbital passenger transportation system concept ALPHA (Airplane Launched PHoenix Aircraft), which shall be based to a maximum extent on existing technologies and capabilities, is currently being investigated as collaborative project by a European consortium under coordination of ESA. The ALPHA concept incorporates an air-launch from a carrier aircraft, which shall be used as first stage. The ALPHA vehicle shall be capable of transporting up to four passengers plus one pilot to an altitude of at least 100 km. The ALPHA vehicle is a down-scaled version of the suborbital space transportation concept Hopper, which was already deeply investigated within the European FESTIP System Study and the German ASTRA program including the successfully flown experimental landing demonstrator Phoenix. This approach has allowed the use of existing aerodynamic vehicle data and has led to the adaptation of the external Hopper/Phoenix configuration for ALPHA. In FESTIP and ASTRA, the Hopper configuration showed sufficient stability margins. Due to the geometric similarity of the ALPHA and Hopper vehicles, a trimable and flyable configuration could be derived by means of ALPHA flight trajectory calculations. In its current configuration, the ALPHA vehicle has a length of ca. 9 m and a gross take-off mass of ca. 3.5 Mg. The launch, staging and separation of ALPHA shall be performed either as internal air-launch from the cargo bay of the carrier aircraft, as under-wing air-launch or as towed air-launch. After separation from the carrier aircraft, the ALPHA vehicle ignites its onboard rocket propulsion system. Since conventional liquid and solid propulsion did not seem suitable for ALPHA due to Their high cost, limited safety and toxicity, a low-cost, “green” and non-hazardous hybrid propulsion system based on liquid nitrous oxide in combination with a solid polymer fuel was

  8. Recent advances in the discovery of alpha1-adrenoceptor agonists.

    PubMed

    Bishop, Michael J

    2007-01-01

    The alpha(1) adrenoceptors are three of nine well-characterized receptors that are activated by epinephrine and norepinephrine. Agonists acting at the alpha(1) adrenoceptors produce numerous physiological effects, and are used therapeutically for several indications. Many known alpha(1) adrenoceptor agonists are alpha(1A) selective, but the discovery of highly selective alpha(1B) and alpha(1D) adrenoceptor agonists has proven to be an extremely difficult goal to achieve. This review will focus on recent advances in the discovery, development and clinical utility of subtype-specific alpha(1) agonists as well as contributions to our understanding of agonist-receptor interactions.

  9. Pharmacologic specificity of alpha-2 adrenergic receptor subtypes

    SciTech Connect

    Petrash, A.; Bylund, D.

    1986-03-01

    The authors have defined alpha-2 adrenergic receptor subtypes in human and rat tissues using prazosin as a subtype selective drug. Prazosin has a lower affinity (250 nM) at alpha-2A receptor and a higher affinity (5 nM) at alpha-2B receptors. In order to determine if other adrenergic drugs are selective for one or the other subtypes, the authors performed (/sup 3/H)yohimbine inhibition experiments with various adrenergic drugs in tissues containing alpha-2A, alpha-2B or both subtypes. Oxymetazoline, WB4101 and yohimbine were found to be 80-, 20- and 10-fold more potent at alpha-2A receptors than at alpha-2B receptors. Phentolamine, adazoxan, (+)- and (-)-mianserin, clonidine, (+)-butaclamol, (-)- and (+)-norepinephrine, epinephrine, dopamine and thioridazine were found to have equal affinities for the two subtypes. These results further validate the subdivision of alpha-2 adrenergic receptors into alpha-2A and alpha-2B subtypes.

  10. Cancer radioimmunotherapy with alpha-emitting nuclides.

    PubMed

    Couturier, Olivier; Supiot, Stéphane; Degraef-Mougin, Marie; Faivre-Chauvet, Alain; Carlier, Thomas; Chatal, Jean-François; Davodeau, François; Cherel, Michel

    2005-05-01

    In lymphoid malignancies and in certain solid cancers such as medullary thyroid carcinoma, somewhat mixed success has been achieved when applying radioimmunotherapy (RIT) with beta-emitters for the treatment of refractory cases. The development of novel RIT with alpha-emitters has created new opportunities and theoretical advantages due to the high linear energy transfer (LET) and the short path length in biological tissue of alpha-particles. These physical properties offer the prospect of achieving selective tumoural cell killing. Thus, RIT with alpha-emitters appears particularly suited for the elimination of circulating single cells or cell clusters or for the treatment of micrometastases at an early stage. However, to avoid non-specific irradiation of healthy tissues, it is necessary to identify accessible tumoural targets easily and rapidly. For this purpose, a small number of alpha-emitters have been investigated, among which only a few have been used for in vivo preclinical studies. Another problem is the availability and cost of these radionuclides; for instance, the low cost and the development of a reliable actinium-225/bismuth-213 generator were probably determining elements in the choice of bismuth-213 in the only human trial of RIT with an alpha-emitter. This article reviews the literature concerning monoclonal antibodies radiolabelled with alpha-emitters that have been developed for possible RIT in cancer patients. The principal radio-immunoconjugates are considered, starting with physical and chemical properties of alpha-emitters, their mode of production, the possibilities and difficulties of labelling, in vitro studies and finally, when available, in vivo preclinical and clinical studies. PMID:15841373

  11. Alpha Channeling in Rotating Plasma with Stationary Waves

    SciTech Connect

    A. Fetterman and N.J. Fisch

    2010-02-15

    An extension of the alpha channeling effect to supersonically rotating mirrors shows that the rotation itself can be driven using alpha particle energy. Alpha channeling uses radiofrequency waves to remove alpha particles collisionlessly at low energy. We show that stationary magnetic fields with high nθ can be used for this purpose, and simulations show that a large fraction of the alpha energy can be converted to rotation energy.

  12. Experimental and Theoretical Electron Density Distribution of Alpha,Alpha-Trehalose Dihydrate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alpha,alpha-rehalose is of interest because of its cryoprotective and antidessicant properties, and because it possesses various technical anomalies such as 13C NMR spectra that give misleading indications of intramolecular structural symmetry. It is a non-reducing disaccharide, with the glycosidic...

  13. Correcting Coefficient Alpha for Correlated Errors: Is [alpha][K]a Lower Bound to Reliability?

    ERIC Educational Resources Information Center

    Rae, Gordon

    2006-01-01

    When errors of measurement are positively correlated, coefficient alpha may overestimate the "true" reliability of a composite. To reduce this inflation bias, Komaroff (1997) has proposed an adjusted alpha coefficient, ak. This article shows that ak is only guaranteed to be a lower bound to reliability if the latter does not include correlated…

  14. Amyloid formation and disaggregation of {alpha}-synuclein and its tandem repeat ({alpha}-TR)

    SciTech Connect

    Bae, Song Yi; Kim, Seulgi; Hwang, Heejin; Kim, Hyun-Kyung; Yoon, Hyun C.; Kim, Jae Ho; Lee, SangYoon; Kim, T. Doohun

    2010-10-01

    Research highlights: {yields} Formation of the {alpha}-synuclein amyloid fibrils by [BIMbF{sub 3}Im]. {yields} Disaggregation of amyloid fibrils by epigallocatechin gallate (EGCG) and baicalein. {yields} Amyloid formation of {alpha}-synuclein tandem repeat ({alpha}-TR). -- Abstract: The aggregation of {alpha}-synuclein is clearly related to the pathogenesis of Parkinson's disease. Therefore, detailed understanding of the mechanism of fibril formation is highly valuable for the development of clinical treatment and also of the diagnostic tools. Here, we have investigated the interaction of {alpha}-synuclein with ionic liquids by using several biochemical techniques including Thioflavin T assays and transmission electron microscopy (TEM). Our data shows a rapid formation of {alpha}-synuclein amyloid fibrils was stimulated by 1-butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide [BIMbF{sub 3}Im], and these fibrils could be disaggregated by polyphenols such as epigallocatechin gallate (EGCG) and baicalein. Furthermore, the effect of [BIMbF{sub 3}Im] on the {alpha}-synuclein tandem repeat ({alpha}-TR) in the aggregation process was studied.

  15. Contrasting effects of peroxisome-proliferator-activated receptor (PPAR)γ agonists on membrane-associated prostaglandin E2 synthase-1 in IL-1β-stimulated rat chondrocytes: evidence for PPARγ-independent inhibition by 15-deoxy-Δ12,14prostaglandin J2

    PubMed Central

    Bianchi, Arnaud; Moulin, David; Sebillaud, Sylvie; Koufany, Meriem; Galteau, Marie-Madeleine; Netter, Patrick; Terlain, Bernard; Jouzeau, Jean-Yves

    2005-01-01

    Microsomal prostaglandin E synthase (mPGES)-1 is a newly identified inducible enzyme of the arachidonic acid cascade with a key function in prostaglandin (PG)E2 synthesis. We investigated the kinetics of inducible cyclo-oxygenase (COX)-2 and mPGES-1 expression with respect to the production of 6-keto-PGF1α and PGE2 in rat chondrocytes stimulated with 10 ng/ml IL-1β, and compared their modulation by peroxisome-proliferator-activated receptor (PPAR)γ agonists. Real-time PCR analysis showed that IL-1β induced COX-2 expression maximally (37-fold) at 12 hours and mPGES-1 expression maximally (68-fold) at 24 hours. Levels of 6-keto-PGF1α and PGE2 peaked 24 hours after stimulation with IL-1β; the induction of PGE2 was greater (11-fold versus 70-fold, respectively). The cyclopentenone 15-deoxy-Δ12,14prostaglandin J2 (15d-PGJ2) decreased prostaglandin synthesis in a dose-dependent manner (0.1 to 10 μM), with more potency on PGE2 level than on 6-keto-PGF1α level (-90% versus -66% at 10 μM). A high dose of 15d-PGJ2 partly decreased COX-2 expression but decreased mPGES-1 expression almost completely at both the mRNA and protein levels. Rosiglitazone was poorly effective on these parameters even at 10 μM. Inhibitory effects of 10 μM 15d-PGJ2 were neither reduced by PPARγ blockade with GW-9662 nor enhanced by PPARγ overexpression, supporting a PPARγ-independent mechanism. EMSA and TransAM® analyses demonstrated that mutated IκBα almost completely suppressed the stimulating effect of IL-1β on mPGES-1 expression and PGE2 production, whereas 15d-PGJ2 inhibited NF-κB transactivation. These data demonstrate the following in IL-1-stimulated rat chondrocytes: first, mPGES-1 is rate limiting for PGE2 synthesis; second, activation of the prostaglandin cascade requires NF-κB activation; third, 15d-PGJ2 strongly inhibits the synthesis of prostaglandins, in contrast with rosiglitazone; fourth, inhibition by 15d-PGJ2 occurs independently of PPARγ through inhibition of

  16. Prestimulus EEG alpha activity reflects temporal expectancy.

    PubMed

    Min, Byoung-Kyong; Park, Jin Young; Kim, Eun Joo; Kim, Joong Il; Kim, Jae-Jin; Park, Hae-Jeong

    2008-06-27

    Since prestimulus EEG alpha activity has recently been considered to convey prestimulus top-down processing, we investigated whether prestimulus alpha activity reflects temporal expectancy of upcoming stimulation even under the non-classical contingent negative variation (CNV) paradigm. EEG was recorded from 16 subjects performing a color and a shape discrimination task manipulated with constant and variable inter-stimulus interval (ISI) conditions. The power of oscillatory activity was investigated by convolving the EEG signals with Morlet wavelets. The constant ISI condition yielded significantly shorter reaction times than the variable ISI condition, indicating more efficient preparation for upcoming stimuli during the constant ISI. We found significantly higher prestimulus alpha activity in the constant ISI condition than in the variable ISI condition, but no significant CNV even in the constant ISI condition. Such a reflection of temporal expectancy in the prestimulus alpha activity corroborates that the prestimulus top-down mental state for preparing upcoming task-performance is considerably reflected in the prestimulus ongoing alpha activity. PMID:18486342

  17. Role of Frontal Alpha Oscillations in Creativity

    PubMed Central

    Lustenberger, Caroline; Boyle, Michael R.; Foulser, A. Alban; Mellin, Juliann M.; Fröhlich, Flavio

    2015-01-01

    Creativity, the ability to produce innovative ideas, is a key higher-order cognitive function that is poorly understood. At the level of macroscopic cortical network dynamics, recent EEG data suggests that cortical oscillations in the alpha frequency band (8 – 12 Hz) are correlated with creative thinking. However, whether alpha oscillations play a fundamental role in creativity has remained unknown. Here we show that creativity is increased by enhancing alpha power using 10 Hz transcranial alternating current stimulation (10Hz-tACS) of the frontal cortex. In a study of 20 healthy participants with a randomized, balanced cross-over design, we found a significant improvement of 7.4% in the Creativity Index measured by the Torrance Test of Creative Thinking, a comprehensive and most frequently used assay of creative potential and strengths. In a second similar study with 20 subjects, 40Hz-tACS was used in instead of 10Hz-tACS to rule out a general “electrical stimulation” effect. No significant change in the Creativity Index was found for such frontal gamma stimulation. Our results suggest that alpha activity in frontal brain areas is selectively involved in creativity; this enhancement represents the first demonstration of specific neuronal dynamics that drive creativity and can be modulated by non-invasive brain stimulation. Our findings agree with the model that alpha recruitment increases with internal processing demands and is involved in inhibitory top-down control, which is an important requirement for creative ideation. PMID:25913062

  18. Alpha-particle sensitive test SRAMs

    NASA Technical Reports Server (NTRS)

    Buehler, M. G.; Blaes, B. R.

    1990-01-01

    A bench-level test is being developed to evaluate memory-cell upsets in a test SRAM designed with a cell offset voltage. This offset voltage controls the critical charge needed to upset the cell. The effect is demonstrated using a specially designed 2-micron n-well CMOS 4-kb test SRAM and a Po-208 5.1-MeV 0.61-LET alpha-particle source. This test SRAM has been made sensitive to alpha particles through the use of a cell offset voltage, and this has allowed a bench-level characterization in a laboratory setting. The experimental data are linked to a alpha-particle interaction physics and to SPICE circuit simulations through the alpha-particle collection depth. The collection depth is determined by two methods and found to be about 7 micron. In addition, alpha particles that struck outside the bloated drain were able to flip the SRAM cells. This lateral charge collection was observed to be more than 6 micron.

  19. H-alpha Observations of MKW10

    NASA Astrophysics Data System (ADS)

    Johnson, Harold; Coble, Kimberly A.; Koopmann, Rebecca A.; Durbala, Adriana; Undergraduate ALFALFA Team

    2016-01-01

    As part of the Undergraduate ALFALFA Team project looking at clusters and groups of galaxies to investigate the effects of environment on star formation, we analyzed H-alpha and R-band observations of the group MKW10 from the WIYN 0.9-m telescope with MOSAIC camera at Kitt Peak. We continuum-subtract the H-alpha images by scaling and subtracting the broadband R images. This process includes: determining the seeing of each image by calculating the FWHM values of several stars in the image; convolving all images to the worst seeing; stacking images for each filter; subtracting sky background; scaling the R image to H-alpha; and subtracting the scaled R from H-alpha. We then use the H-alpha-continuum-subtracted image to perform surface photometry of individual galaxies in MKW10. The data will be used to determine star formation rates and distributions of galaxies in this group environment and will be compared to results for galaxies in other UAT group and cluster environments. Analysis is ongoing.This work has been supported by NSF grant AST-1211005 and the Illinois Space Grant Consortium.

  20. Venus - False Color Image of Alpha Regio

    NASA Technical Reports Server (NTRS)

    1991-01-01

    This Magellan radar image shows Alpha Regio, a topographic upland approximately 1,300 kilometers (806 miles) across which is centered on 25 degrees south latitude, 4 degrees east longitude. In 1963 Alpha Regio was the first feature on Venus to be identified from Earth based radar. The radar bright area of Alpha Regio is characterized by multiple sets of intersecting trends of structural features such as ridges, troughs and flat floored fault valleys that together form a polygonal outline. Circular to oblong dark patches within the complex terrain are local topographic lows that are filled with smooth volcanic lava. Complex ridged terrains such as Alpha, formerly called 'tessera' in the Soviet Venera 15 and 16 radar missions and the Arecibo radar data, appear to be widespread and common surface expressions of Venusian tectonic processes. Directly south of the complex ridged terrain is a large ovoid shaped feature named Eve. The radar bright spot located centrally within Eve marks the location of the prime meridian of Venus. Magellan radar data reveals that relatively young lava flows emanate from Eve and extends into the southern margin of the ridged terrain at Alpha. The mosaic was produced by Eric de Jong and Myche McAuley in the JPL Multimission Image Processing Laboratory.

  1. ALPHA ATTENUATION DUE TO DUST LOADING

    SciTech Connect

    Dailey, A; Dennis Hadlock, D

    2007-08-09

    Previous studies had been done in order to show the attenuation of alpha particles in filter media. These studies provided an accurate correction for this attenuation, but there had not yet been a study with sufficient results to properly correct for attenuation due to dust loading on the filters. At the Savannah River Site, filter samples are corrected for attenuation due to dust loading at 20%. Depending on the facility the filter comes from and the duration of the sampling period, the proper correction factor may vary. The objective of this study was to determine self-absorption curves for each of three counting instruments. Prior work indicated significant decreases in alpha count rate (as much as 38%) due to dust loading, especially on filters from facilities where sampling takes place over long intervals. The alpha count rate decreased because of a decrease in the energy of the alpha. The study performed resulted in a set of alpha absorption curves for each of three detectors. This study also took into account the affects of the geometry differences in the different counting equipment used.

  2. Benchmarking the External Surrogate Ratio Method using the (alpha,alpha' f) reaction at STARS

    SciTech Connect

    Lesher, S R; Bernstein, L A; Ai, H; Beausang, C W; Bleuel, D; Burke, J T; Clark, R M; Fallon, P; Gibelin, J; Lee, I Y; Lyles, B F; Macchiavelli, A O; McMahan, M A; Moody, K J; Norman, E B; Phair, L; Rodriguez-Vieitez, E; Wiedeking, M

    2008-01-09

    We measured the ratio of the fission probabilities of {sup 234}U* relative to {sup 236}U* formed via an ({alpha},{alpha}{prime}) direct reactions using the STARS array at the 88-inch cyclotron at the Lawrence Berkeley National Laboratory. This ratio has a shape similar to the ratio of neutron capture probabilities from {sup 233}U(n; f) and {sup 235}U(n; f), indicating the alpha reactions likely formed a compound nucleus. This result indicates that the ratios of fission exit channel probabilities for two actinide nuclei populated via ({alpha}, {alpha}{prime}) can be used to determine an unknown fission cross section relative to a known one. The validity of the External Surrogate Ratio Method (ESRM) is tested and the results support the conclusions of Burke et al. [1].

  3. Alpha-decay of light protactinium isotopes

    SciTech Connect

    Faestermann, T.; Gillitzer, A.; Hartel, K.; Henning, W.; Kienle, P.

    1987-12-10

    Light protactinium isotopes have been produced with /sup 204/Pb (/sup 19/F,xn) reactions. ..cap alpha..-activities with E/sub ..cap alpha../ = 9.90(5) MeV, T/sub 1/2/ = 53(10) ns and E/sub ..cap alpha../ = 9.65(5) MeV, T/sub 1/2/ = 0.78(16) ..mu..s could be attributed to the previously unobserved nuclei /sup 219/Pa and /sup 220/Pa with the help of excitation functions. The peak cross sections for the 4n and 3n evaporation channels are on the order of 10 ..mu..b. The decay energies as well as the halflives fit well into the systematics of these nuclei close to the magic neutron number N = 126. /sup 219/Pa is the shortest lived nuclide known with directly measured halflife.

  4. Coefficient alpha and interculture test selection.

    PubMed

    Thurber, Steven; Kishi, Yasuhiro

    2014-04-01

    The internal consistency reliability of a measure can be a focal point in an evaluation of the potential adequacy of an instrument for adaptation to another cultural setting. Cronbach's alpha (α) coefficient is often used as the statistical index for such a determination. However, alpha presumes a tau-equivalent test and may constitute an inaccurate population estimate for multidimensional tests. These notions are expanded and examined with a Japanese version of a questionnaire on nursing attitudes toward suicidal patients, originally constructed in Sweden using the English language. The English measure was reported to have acceptable internal consistency (α) albeit the dimensionality of the questionnaire was not addressed. The Japanese scale was found to lack tau-equivalence. An alternative to alpha, "composite reliability," was computed and found to be below acceptable standards in magnitude and precision. Implications for research application of the Japanese instrument are discussed. PMID:22523134

  5. Radiation risks from inhaled alpha emitters

    NASA Astrophysics Data System (ADS)

    Simmons, Jack A.

    2001-06-01

    The alpha emitter that gives rise to the greatest concern over its link to the induction of lung cancer is radon. As noted by the ICRP, attempts to relate the risk of cancer induction to the dose delivered by the alpha particles result in a value for this risk which is unrealistically high. Instead, an estimate based on the epidemiology of radon in mines is preferred. The logical result, that the weighting factor for these alpha particles should be very much lesser than the recommended value of 20, appears to have been ignored. It will be shown that there are two fundamental reasons for this large discrepancy. The first is that the implied "linear non-threshold" hypothesis is not supported by recent investigations. The second is that the concept of "dose" is meaningless at the levels of exposure considered in this context. Alternative proposals in terms of fluence and the effect cross-section will be presented.

  6. Synthesis of peptide .alpha.-thioesters

    DOEpatents

    Camarero, Julio A.; Mitchell, Alexander R.; De Yoreo, James J.

    2008-08-19

    Disclosed herein is a new method for the solid phase peptide synthesis (SPPS) of C-terminal peptide .alpha. thioesters using Fmoc/t-Bu chemistry. This method is based on the use of an aryl hydrazine linker, which is totally stable to conditions required for Fmoc-SPPS. When the peptide synthesis has been completed, activation of the linker is achieved by mild oxidation. The oxidation step converts the acyl-hydrazine group into a highly reactive acyl-diazene intermediate which reacts with an .alpha.-amino acid alkylthioester (H-AA-SR) to yield the corresponding peptide .alpha.-thioester in good yield. A variety of peptide thioesters, cyclic peptides and a fully functional Src homology 3 (SH3) protein domain have been successfully prepared.

  7. ALPHA MIS: Reference manual. Revision 2

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  8. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, Larry R.; Post Jr., Douglass E.; Dawson, John M.

    1986-06-03

    Measurement of the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a magnetically contained plasma is provided. The fusion plasma is seeded with energetic boron neutrals for producing, by means of the reaction .sup.10 B (.alpha.,n) .sup.13 N reaction, radioactive nitrogen nuclei which are then collected by a probe. The radioactivity of the probe is then measured by conventional techniques in determining the energy distribution of the alpha particles in the plasma. In a preferred embodiment, diborane gas (B.sub.2 H.sub.6) is the source of the boron neutrals to produce .sup.13 N which decays almost exclusively by positron emission with a convenient half-life of 10 minutes.

  9. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, Larry R.; Post, Jr., Douglass E.; Dawson, John M.

    1986-01-01

    Measurement of the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a magnetically contained plasma is provided. The fusion plasma is seeded with energetic boron neutrals for producing, by means of the reaction .sup.10 B (.alpha.,n) .sup.13 N reaction, radioactive nitrogen nuclei which are then collected by a probe. The radioactivity of the probe is then measured by conventional techniques in determining the energy distribution of the alpha particles in the plasma. In a preferred embodiment, diborane gas (B.sub.2 H.sub.6) is the source of the boron neutrals to produce .sup.13 N which decays almost exclusively by positron emission with a convenient half-life of 10 minutes.

  10. Microdosimetry for Targeted Alpha Therapy of Cancer

    PubMed Central

    Huang, Chen-Yu; Guatelli, Susanna; Oborn, Bradley M.; Allen, Barry J.

    2012-01-01

    Targeted alpha therapy (TAT) has the advantage of delivering therapeutic doses to individual cancer cells while reducing the dose to normal tissues. TAT applications relate to hematologic malignancies and now extend to solid tumors. Results from several clinical trials have shown efficacy with limited toxicity. However, the dosimetry for the labeled alpha particle is challenging because of the heterogeneous antigen expression among cancer cells and the nature of short-range, high-LET alpha radiation. This paper demonstrates that it is inappropriate to investigate the therapeutic efficacy of TAT by macrodosimetry. The objective of this work is to review the microdosimetry of TAT as a function of the cell geometry, source-target configuration, cell sensitivity, and biological factors. A detailed knowledge of each of these parameters is required for accurate microdosimetric calculations. PMID:22988479

  11. Ultraviolet observations of alpha Aurigae from Copernicus

    NASA Technical Reports Server (NTRS)

    Dupree, A. K.

    1975-01-01

    Emission lines of L-alpha (1215.67 A) and O VI (1031.94 A) were detected in the spectroscopic binary alpha Aur (Capella) with the Princeton experiment on Copernicus. Temperatures of the emitting regions are inferred to be in excess of 300,000 K. The temperature and emission measure are consistent with a variable source of soft X-rays. If the emission is attributed to the primary star (G5 III), the atmosphere is expanding with velocities of about 20-100 km/s. Such expansion can lead to material within the binary system. The density of interstellar hydrogen inferred from absorption of stellar L-alpha appears to be approximately 0.01 hydrogen atoms per cu cm.

  12. The evolutionary conservation of DNA polymerase. alpha

    SciTech Connect

    Miller, M.A.; Korn, D.; Wang, T.S.F. )

    1988-08-25

    The evolutionary conservation of DNA polymerase {alpha} was assessed by immunological and molecular genetic approaches. Four anti-human KB cell DNA polymerase {alpha} monoclonal antibodies were tested for their ability to recognize a phylogenetically broad array of eukaryotic DNA polymerases. While the single non-neutralizing antibody used in this study recognizes higher mammalian (human, simian, canine, and bovine) polymerases only, three neutralizing antibodies exhibit greater, but variable, extents of cross-reactivity among vertebrate species. Genomic Southern hybridization studies with the cDNA of the human DNA polymerase {alpha} catalytic polypeptide identify the existence of many consensus DNA sequences within the DNA polymerase genes of vertebrate, invertebrate, plant and unicellular organisms. These findings illustrate the differential evolutionary conservation of four unique epitopes on DNA sequences, presumably reflective of critical functional domains, in the DNA polymerase genes from a broad diversity of living forms.

  13. Alternating current long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; McAtee, J.L.

    1993-02-16

    An alpha particle detector, utilizing alternating currents, which is capable of detecting alpha particles from distinct sources. The use of alternating currents allows use of simpler ac circuits which, in turn, are not susceptible to dc error components. It also allows the benefit of gas gain, if desired. In the invention, a voltage source creates an electric field between two conductive grids, and between the grids and a conductive enclosure. Air containing air ions created by collision with alpha particles is drawn into the enclosure and detected. In some embodiments, the air flow into the enclosure is interrupted, creating an alternating flow of ions. In another embodiment, a modulated voltage is applied to the grid, also modulating the detection of ions.

  14. Alternating current long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; McAtee, James L.

    1993-01-01

    An alpha particle detector, utilizing alternating currents, whcih is capable of detecting alpha particles from distinct sources. The use of alternating currents allows use of simpler ac circuits which, in turn, are not susceptible to dc error components. It also allows the benefit of gas gain, if desired. In the invention, a voltage source creates an electric field between two conductive grids, and between the grids and a conductive enclosure. Air containing air ions created by collision with alpha particles is drawn into the enclosure and detected. In some embodiments, the air flow into the enclosure is interrupted, creating an alternating flow of ions. In another embodiment, a modulated voltage is applied to the grid, also modulating the detection of ions.

  15. Lyman-alpha imagery of Comet Kohoutek

    NASA Technical Reports Server (NTRS)

    Carruthers, G. R.; Opal, C. B.; Page, T. L.; Meier, R. R.; Prinz, D. K.

    1974-01-01

    Electrographic imagery of Comet Kohoutek in the 1100-1500 A wavelength range was obtained from a sounding rocket on Jan. 8, 1974, and from the Skylab space station on 13 occasions between Nov. 26, 1973 and Feb. 2, 1974. These images are predominantly due to Lyman-alpha (1216 A) emission from the hydrogen coma of the comet. The rocket pictures have been calibrated for absolute sensitivity and a hydrogen production rate has been determined. However, the Skylab camera suffered degradation of its sensitivity during the mission, and its absolute sensitivity for each observation can only be estimated by comparison of the comet images with those taken by the rocket camera, with imagery of the geocoronal Lyman-alpha glow, of the moon in reflected Lyman-alpha, and of ultraviolet-bright stars. The rocket and geocoronal comparisons are used to derive a preliminary, qualitative history of the development of the cometary hydrogen coma and the associated hydrogen production rate.

  16. Solution structure of {alpha}-conotoxin PIA, a novel antagonist of {alpha}6 subunit containing nicotinic acetylcholine receptors

    SciTech Connect

    Chi, Seung-Wook; Lee, Si-Hyung; Kim, Do-Hyoung; Kim, Jae-Sung; Olivera, Baldomero M.; McIntosh, J. Michael; Han, Kyou-Hoon . E-mail: khhan600@kribb.re.kr

    2005-12-30

    {alpha}-Conotoxin PIA is a novel nicotinic acetylcholine receptor (nAChR) antagonist isolated from Conus purpurascens that targets nAChR subtypes containing {alpha}6 and {alpha}3 subunits. {alpha}-conotoxin PIA displays 75-fold higher affinity for rat {alpha}6/{alpha}3{beta}2{beta}3 nAChRs than for rat {alpha}3{beta}2 nAChRs. We have determined the three-dimensional structure of {alpha}-conotoxin PIA by nuclear magnetic resonance spectroscopy. The {alpha}-conotoxin PIA has an '{omega}-shaped' overall topology as other {alpha}4/7 subfamily conotoxins. Yet, unlike other neuronally targeted {alpha}4/7-conotoxins, its N-terminal tail Arg{sup 1}-Asp{sup 2}-Pro{sup 3} protrudes out of its main molecular body because Asp{sup 2}-Pro{sup 3}-Cys{sup 4}-Cys{sup 5} forms a stable type I {beta}-turn. In addition, a kink introduced by Pro{sup 15} in the second loop of this toxin provides a distinct steric and electrostatic environment from those in {alpha}-conotoxins MII and GIC. By comparing the structure of {alpha}-conotoxin PIA with other functionally related {alpha}-conotoxins we suggest structural features in {alpha}-conotoxin PIA that may be associated with its unique receptor recognition profile.

  17. Low-valent niobium-mediated double activation of C-F/C-H bonds: fluorene synthesis from o-arylated alpha,alpha,alpha-trifluorotoluene derivatives.

    PubMed

    Fuchibe, Kohei; Akiyama, Takahiko

    2006-02-01

    By the treatment of 0.3 molar amount of NbCl5 and LiAlH4, o-arylated alpha,alpha,alpha-trifluorotoluenes afforded fluorene derivatives in good yields. C-F bonds of the CF3 group and the neighboring ortho C-H bond were doubly activated to give the coupling products. PMID:16448098

  18. Opposite effects of the acute promyelocytic leukemia PML-retinoic acid receptor alpha (RAR alpha) and PLZF-RAR alpha fusion proteins on retinoic acid signalling.

    PubMed Central

    Ruthardt, M; Testa, U; Nervi, C; Ferrucci, P F; Grignani, F; Puccetti, E; Grignani, F; Peschle, C; Pelicci, P G

    1997-01-01

    Fusion proteins involving the retinoic acid receptor alpha (RAR alpha) and the PML or PLZF nuclear protein are the genetic markers of acute promyelocytic leukemias (APLs). APLs with the PML-RAR alpha or the PLZF-RAR alpha fusion protein are phenotypically indistinguishable except that they differ in their sensitivity to retinoic acid (RA)-induced differentiation: PML-RAR alpha blasts are sensitive to RA and patients enter disease remission after RA treatment, while patients with PLZF-RAR alpha do not. We here report that (i) like PML-RAR alpha expression, PLZF-RAR alpha expression blocks terminal differentiation of hematopoietic precursor cell lines (U937 and HL-60) in response to different stimuli (vitamin D3, transforming growth factor beta1, and dimethyl sulfoxide); (ii) PML-RAR alpha, but not PLZF-RAR alpha, increases RA sensitivity of hematopoietic precursor cells and restores RA sensitivity of RA-resistant hematopoietic cells; (iii) PML-RAR alpha and PLZF-RAR alpha have similar RA binding affinities; and (iv) PML-RAR alpha enhances the RA response of RA target genes (those for RAR beta, RAR gamma, and transglutaminase type II [TGase]) in vivo, while PLZF-RAR alpha expression has either no effect (RAR beta) or an inhibitory activity (RAR gamma and type II TGase). These data demonstrate that PML-RAR alpha and PLZF-RAR alpha have similar (inhibitory) effects on RA-independent differentiation and opposite (stimulatory or inhibitory) effects on RA-dependent differentiation and that they behave in vivo as RA-dependent enhancers or inhibitors of RA-responsive genes, respectively. Their different activities on the RA signalling pathway might underlie the different responses of PML-RAR alpha and PLZF-RAR alpha APLs to RA treatment. The PLZF-RAR alpha fusion protein contains an approximately 120-amino-acid N-terminal motif (called the POZ domain), which is also found in a variety of zinc finger proteins and a group of poxvirus proteins and which mediates protein

  19. Lunar surface outgassing and alpha particle measurements

    SciTech Connect

    Lawson, S. L.; Feldman, W. C.; Lawrence, David J. ,; Moore, K. R.; Elphic, R. C.; Maurice, S.; Belian, Richard D.; Binder, Alan B.

    2002-01-01

    The Lunar Prospector Alpha Particle Spectrometer (LP APS) searched for lunar surface gas release events and mapped their distribution by detecting alpha particle?; produced by the decay of gaseous radon-222 (5.5 MeV, 3.8 day half-life), solid polonium-2 18 (6.0 MeV, 3 minute half-life), and solid polonium-210 (5.3 MeV, 138 day half-life, but held up in production by the 21 year half-life of lead-210). These three nuclides are radioactive daughters from the decay of uranium-238.

  20. HETDEX: Diffuse Lyman-Alpha Emission

    NASA Astrophysics Data System (ADS)

    Tuttle, Sarah E.; Finkelstein, S.; Gebhardt, K.; HETDEX Collaboration

    2012-01-01

    The intermediate redshift universe probed by HETDEX, 1.8 < z < 3.0, holds a great deal of information about star formation and the evolution of galaxies. Although simulations reveal a regime active with gas accretion and feeding of galaxies via filaments, observational evidence for this accretion from the Intergalactic Medium (IGM) at any redshift has been very limited. Here we use data from VIRUS-P across several well-characterized fields to put limits on diffuse emission of Lyman-Alpha at the outskirts of galaxies. This work is done in preparation for a similar program with the full HETDEX sample of Lyman-Alpha Emitters (LAEs).

  1. Hydrogen Lyman-alpha coronagraph/polarimeter

    NASA Technical Reports Server (NTRS)

    Fineschi, Silvano; Hoover, Richard B.; Walker, Arthur B. C., Jr.

    1992-01-01

    The present treatment of vector magnetic field measurement in coronas by means of the Hanle effect of the Lyman-alpha line uses data from all-reflecting imaging coronagraph/polarimeters. The polarization sensitivity, bandpass, and spatial resolution of these instruments are defined through a modeling of the Hanle-effect signature in Lyman-alpha emission from coronal magnetic loops; the line-of-sight integration through an inhomogeneous coronal medium is taken into account. The use of the Hanle effect to measure solar corona vector magnetic fields is verified.

  2. Alpha particles in effective field theory

    SciTech Connect

    Caniu, C.

    2014-11-11

    Using an effective field theory for alpha (α) particles at non-relativistic energies, we calculate the strong scattering amplitude modified by Coulomb corrections for a system of two αs. For the strong interaction, we consider a momentum-dependent interaction which, in contrast to an energy dependent interaction alone [1], could be more useful in extending the theory to systems with more than two α particles. We will present preliminary results of our EFT calculations for systems with two alpha particles.

  3. Parallel Genetic Algorithm for Alpha Spectra Fitting

    NASA Astrophysics Data System (ADS)

    García-Orellana, Carlos J.; Rubio-Montero, Pilar; González-Velasco, Horacio

    2005-01-01

    We present a performance study of alpha-particle spectra fitting using parallel Genetic Algorithm (GA). The method uses a two-step approach. In the first step we run parallel GA to find an initial solution for the second step, in which we use Levenberg-Marquardt (LM) method for a precise final fit. GA is a high resources-demanding method, so we use a Beowulf cluster for parallel simulation. The relationship between simulation time (and parallel efficiency) and processors number is studied using several alpha spectra, with the aim of obtaining a method to estimate the optimal processors number that must be used in a simulation.

  4. Has iprindole an alpha adrenergic activity?

    PubMed

    Ganry, H; Bourin, M

    1993-05-01

    1. Acute administration of iprindole potentiated the toxicity of 1-norepinephrine and increased the intensity of oxotremorine-induced tremors. 2. On the forced swimming test combination iprindole with imipramine reduced the duration of immobility. 3. The action of yohimbine on the locomotor activity was antagonized by a pre-injection of iprindole. 4. Iprindole increased and prolonged exophthalmia and loss of righting reflex induced by xylazine. 5 All these results seems indicate that iprindole has an indirect alpha 1 and alpha 2 adrenergic activity.

  5. Fan-less long range alpha detector

    DOEpatents

    MacArthur, Duncan W.; Bounds, John A.

    1994-01-01

    A fan-less long range alpha detector which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces.

  6. Fan-less long range alpha detector

    DOEpatents

    MacArthur, D.W.; Bounds, J.A.

    1994-05-10

    A fan-less long range alpha detector is disclosed which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces. 2 figures.

  7. Identification and quantification of alphaS1, alphaS2, beta, and kappa-caseins in water buffalo milk by reverse phase-high performance liquid chromatography and mass spectrometry.

    PubMed

    Feligini, Maria; Bonizzi, Ivan; Buffoni, Joanna Natalia; Cosenza, Gianfranco; Ramunno, Luigi

    2009-04-01

    A method for the simultaneous quantitation of alpha(S1), alpha(S2), beta, and kappa-caseins in water buffalo (Bubalus bubalis) milk using reverse phase high-performance liquid chromatography was developed. The molecular masses of the peaks separated by the described chromatographic protocol were determined by ESI-MS. alpha(S1)- and kappa-caseins were found to be heteromorphic in several individual milk samples. In particular, alpha(S1)-casein showed two peaks with a molecular mass of 23,490 Da and 23,516 Da, and kappa-casein showed three peaks with molecular masses of 19,165 Da, 19,177 Da, and 19,247 Da. Only one form for beta-casein (24,033 Da) and alpha(S2)-casein (22,741 Da) were detected. The mean values of casein fraction concentration observed throughout the individual samples were 8.89 gL(-1) with a relative standard deviation (RSD) of 20% for alpha(S1)-casein, 5.08 gL(-1) with a RSD of 25% for alpha(S2)-casein, 20.91 gL(-1) with a RSD of 16% for beta-casein, and 4.13 gL(-1) with a RSD of 24% for kappa-casein. Linear and second-order polynomial correlations with total nitrogen were calculated for all casein fractions.

  8. alpha(1A)- and alpha(1B)-adrenergic receptors differentially modulate antidepressant-like behavior in the mouse.

    PubMed

    Doze, Van A; Handel, Evelyn M; Jensen, Kelly A; Darsie, Belle; Luger, Elizabeth J; Haselton, James R; Talbot, Jeffery N; Rorabaugh, Boyd R

    2009-08-18

    Tricyclic antidepressant (TCA) drugs are used for the treatment of chronic depression, obsessive-compulsive disorder (OCD), and anxiety-related disorders. Chronic use of TCA drugs increases the expression of alpha(1)-adrenergic receptors (alpha(1)-ARs). Yet, it is unclear whether increased alpha(1)-AR expression contributes to the antidepressant effects of these drugs or if this effect is unrelated to their therapeutic benefit. In this study, mice expressing constitutively active mutant alpha(1A)-ARs (CAM alpha(1A)-AR) or CAM alpha(1B)-ARs were used to examine the effects of alpha(1A)- and alpha(1B)-AR signaling on rodent behavioral models of depression, OCD, and anxiety. CAM alpha(1A)-AR mice, but not CAM alpha(1B)-AR mice, exhibited antidepressant-like behavior in the tail suspension test and forced swim test. This behavior was reversed by prazosin, a selective alpha(1)-AR inverse agonist, and mimicked by chronically treating wild type mice with cirazoline, an alpha(1A)-AR agonist. Marble burying behavior, commonly used to model OCD in rodents, was significantly decreased in CAM alpha(1A)-AR mice but not in CAM alpha(1B)-AR mice. In contrast, no significant differences in anxiety-related behavior were observed between wild type, CAM alpha(1A)-AR, and CAM alpha(1B)-AR animals in the elevated plus maze and light/dark box. This is the first study to demonstrate that alpha(1A)- and alpha(1B)-ARs differentially modulate antidepressant-like behavior in the mouse. These data suggest that alpha(1A)-ARs may be a useful therapeutic target for the treatment of depression.

  9. A practical alpha particle irradiator for studying internal alpha particle exposure.

    PubMed

    Lee, Ki-Man; Lee, Ui-Seob; Kim, Eun-Hee

    2016-09-01

    An alpha particle irradiator has been built in the Radiation Bioengineering Laboratory at Seoul National University (SNU) to investigate the cellular responses to alpha emissions from radon and the progeny. This irradiator is designed to have the energy of alpha particles entering target cells similar to that of alpha emissions from the radon progeny Po-218 and Po-214 residing in the human respiratory tract. For the SNU alpha particle irradiator, an irradiation system is equipped with cell dishes of 4µm thick Mylar bottom and a special setup of cells on slide for gamma-H2AX assay. Dose calibration for the alpha particle irradiator was performed by dual approaches, detection and computer simulation, in consideration of the source-to-target distance (STD) and the size of a cell dish. The uniformity of dose among cells in a dish is achieved by keeping the STD and the size of cell dish in certain ranges. The performance of the SNU alpha particle irradiator has been proven to be reliable through the gamma-H2AX assay with the human lung epithelial cells irradiated. PMID:27475622

  10. Quantification of functional and inactivated alpha 2-macroglobulin in sepsis.

    PubMed

    Abbink, J J; Nuijens, J H; Eerenberg, A J; Huijbregts, C C; Strack van Schijndel, R J; Thijs, L G; Hack, C E

    1991-01-23

    Alpha 2-macroglobulin (alpha 2 M) in vitro inhibits numerous proteinases that are generated during inflammatory reactions and therefore, probably plays an important role in diseases such as sepsis. To monitor the state of alpha 2 M in sepsis, we developed novel assays for functional and inactive alpha 2M. Functional alpha 2M in plasma was measured by quantitating the binding of alpha 2M to solid-phase trypsin. Inactive alpha 2M (i alpha 2M) was assessed with a monoclonal antibody, mcAb M1, that specifically reacts with a neodeterminant exposed on i alpha 2M. This mcAb in combination with chromogenic substrates was used to detect alpha 2M-proteinase complexes. Functional alpha 2M was reduced in plasma from 48 patients with clinical sepsis compared to healthy controls (p less than 0.0001). Levels of functional alpha 2M on admission and the lowest levels encountered in 23 patients with shock were lower than in 25 normotensive patients (p = 0.023 and p = 0.009, respectively). Increased levels of i alpha 2M (greater than 30 nM) at least on one occasion were found in only 4 of the 48 patients, being not different in hypotensive compared with normotensive patients, and not in patients who died compared with those who survived. Levels of functional alpha 2M correlated significantly with levels of factor XII and prekallikrein suggesting that decreases in alpha 2M at least in part were due to contact activation. Indeed, in two patients with increased i alpha 2M, complexes between alpha 2M and kallikrein were demonstrated in addition to plasmin- and thrombin-alpha 2M complexes.

  11. Substrate specificity of human liver neutral alpha-mannosidase.

    PubMed Central

    al Daher, S; De Gasperi, R; Daniel, P; Hirani, S; Warren, C; Winchester, B

    1992-01-01

    The digestion of radiolabelled natural oligosaccharide substrates by human liver neutral alpha-mannosidase has been studied by h.p.l.c. and h.p.t.l.c. The high-mannose oligosaccharides Man9GlcNAc and Man8GlcNAc are hydrolysed by the enzyme by two distinct non-random routes to a common product of composition Man6GlcNAc, which is then slowly converted into a unique Man5GlcNAc oligosaccharide, Man alpha(1----2)Man alpha(1----2)Man alpha(1----3)[Man alpha (1----6)] Man beta(1----4)GlcNAc. These pathways are different from the processing and lysosomal catabolic pathways for these structures. In particular, the alpha(1----2)-linked mannose residues attached to the core alpha(1----3)-linked mannose residue are resistant to hydrolysis. The key processing intermediate, Man alpha(1----3)[Man alpha(1----6)]Man alpha(1----6)[Man alpha(1----3)] Man beta(1----4)GlcNAc, is not produced in the digestion of high-mannose glycans by the neutral alpha-mannosidase, but it is hydrolysed by the enzyme by a non-random route to Man beta(1----4)GlcNAc via the core structure Man alpha(1----3)[Man alpha(1----6)]Man beta(1----4)GlcNAc. In contrast with its ready hydrolysis by lysosomal alpha-mannosidase, the core alpha(1----3)-mannosidic linkage is quite resistant to hydrolysis by neutral alpha-mannosidase. The precise specificity of neutral alpha-mannosidase towards high-mannose oligosaccharides suggests that it has a role in the modification of such structures in the cytosol. Images Fig. 4. PMID:1520283

  12. Sequence analysis of frog alpha B-crystallin cDNA: sequence homology and evolutionary comparison of alpha A, alpha B and heat shock proteins.

    PubMed

    Lu, S F; Pan, F M; Chiou, S H

    1995-11-22

    alpha-Crystallin is a major lens protein present in the lenses of all vertebrate species. Recent studies have revealed that bovine alpha-crystallins possess genuine chaperone activity similar to small heat-shock proteins. In order to facilitate the determination of the primary sequence of amphibian alpha B-crystallin, cDNA encoding alpha B subunit chain was amplified using a new "Rapid Amplification of cDNA Ends" (RACE) protocol of Polymerase Chain Reaction (PCR). PCR-amplified product corresponding to alpha B subunit was then subcloned into pUC18 vector and transformed into E. coli strain JM109. Plasmids purified from the positive clones were prepared for nucleotide sequencing by the automatic fluorescence-based dideoxynucleotide chain-termination method. Sequencing more than five clones containing DNA inserts coding for alpha B-crystallin subunit constructed only one complete full-length reading frame of 522 base pairs similar to that of alpha A subunit, covering a deduced protein sequence of 173 amino acids including the universal translation-initiating methionine. The frog alpha B crystallin shows 69, 66 and 56% whereas alpha A crystallin shows 83, 81 and 69% sequence similarity to the homologous chains of bovine, chicken and dogfish, respectively, revealing a more divergent structural relationship among these alpha B subunits as compared to alpha A subunits. Structural analysis and comparison of alpha A- and alpha B-crystallin subunits from eye lenses of different classes of vertebrates also shed some light on the evolutionary relatedness between alpha B/alpha A crystallins and the small heat-shock proteins.

  13. Synergistic alpha-1 and alpha-2 adrenergic stimulation of rat proximal nephron Na+/H+ exchange

    SciTech Connect

    Gesek, F.A.; Cragoe, E.J. Jr.; Strandhoy, J.W.

    1989-06-01

    Both alpha-1 and alpha-2 adrenoceptors have been localized to the renal cortex, with the majority of binding sites on the proximal tubule. Because the major regulator of Na+ uptake into the proximal tubule is the Na+/H+ exchanger, and because alpha-1 and alpha-2 adrenoceptors stimulate it in other tissues, we tested the hypothesis that both alpha adrenoceptor subtypes can increase Na+ uptake into the proximal nephron by stimulating the Na+/H+ antiporter. Enhancement of Na+ transport by agonists was studied in isolated rat proximal tubules by determining the uptake of 22Na that was suppressible by the Na+/H+ inhibitor, 5-(N-ethyl-N-isopropyl)amiloride (EIPA). The phorbol ester, phorbol-12-myristate-13-acetate, (0.1 microM), directly stimulated the antiporter through protein kinase C and increased EIPA-suppressible 22Na uptake 250% above control. The alpha-1 adrenoceptor agonists, cirazoline and phenylephrine, in addition to the mixed agonist, norepinephrine, maximally stimulated uptake by 226 to 232% at 1 microM concentrations. alpha-2 agonists produced a range of maximal stimulations at 1 microM from 65% with guanabenz to 251% with B-HT 933. Increases in 22Na uptake by agonists were inhibited by selective adrenergic antagonists and by EIPA. The drugs did not change the EIPA-resistant component of 22Na uptake. Inasmuch as the adrenoceptor subtypes likely stimulated Na+/H+ exchange by differing intracellular pathways impinging upon common transport steps, we examined whether simultaneous stimulation of both pathways was additive. Submaximal concentrations (5 nM each) of alpha-1 and alpha-2 adrenoceptor agonists in combination synergistically enhanced 22Na uptake to a level similar to 1 microM concentrations of adrenoceptor agonists alone or in combination.

  14. Plant alpha-amylase inhibitors and their interaction with insect alpha-amylases.

    PubMed

    Franco, Octávio L; Rigden, Daniel J; Melo, Francislete R; Grossi-De-Sá, Maria F

    2002-01-01

    Insect pests and pathogens (fungi, bacteria and viruses) are responsible for severe crop losses. Insects feed directly on the plant tissues, while the pathogens lead to damage or death of the plant. Plants have evolved a certain degree of resistance through the production of defence compounds, which may be aproteic, e.g. antibiotics, alkaloids, terpenes, cyanogenic glucosides or proteic, e.g. chitinases, beta-1,3-glucanases, lectins, arcelins, vicilins, systemins and enzyme inhibitors. The enzyme inhibitors impede digestion through their action on insect gut digestive alpha-amylases and proteinases, which play a key role in the digestion of plant starch and proteins. The natural defences of crop plants may be improved through the use of transgenic technology. Current research in the area focuses particularly on weevils as these are highly dependent on starch for their energy supply. Six different alpha-amylase inhibitor classes, lectin-like, knottin-like, cereal-type, Kunitz-like, gamma-purothionin-like and thaumatin-like could be used in pest control. These classes of inhibitors show remarkable structural variety leading to different modes of inhibition and different specificity profiles against diverse alpha-amylases. Specificity of inhibition is an important issue as the introduced inhibitor must not adversely affect the plant's own alpha-amylases, nor the nutritional value of the crop. Of particular interest are some bifunctional inhibitors with additional favourable properties, such as proteinase inhibitory activity or chitinase activity. The area has benefited from the recent determination of many structures of alpha-amylases, inhibitors and complexes. These structures highlight the remarkable variety in structural modes of alpha-amylase inhibition. The continuing discovery of new classes of alpha-amylase inhibitor ensures that exciting discoveries remain to be made. In this review, we summarize existing knowledge of insect alpha-amylases, plant alpha

  15. Interaction of per 3,6-anhydro-alpha cyclodextrins (alpha 36CD) and lead-alpha 36CD complex with biological systems.

    PubMed

    Debouzy, J C; Fauvelle, F; Gadelle, A; Baudin, C; Richard, M; Perly, B; Chouteau, F; Joets, J; Tazz, J J; Daveloose, D

    1998-05-01

    The interactions of per (3,6 anhydro) alpha cyclodextrin (alpha 36CD) and of lead-alpha 36CD complex with biological systems were tested by NMR, ESR and electronic microscopy using erythrocytes and model membranes. It was found that the haemolytic activity of alpha 36CD alone was seven fold lower than that of natural alpha cyclodextrin (evaluated by the concentration inducing 50% haemolysis, DH50 = 35 mM). Conversely, the formation of the complex resulted in an increase of haemolytic properties, with DH50 of 1 mM. The mechanism proposed was an increased membrane diffusion by endocytosis of the complex, leading to higher amounts of intracellular lead.

  16. Determining the alpha dynamo parameter in incompressible homogeneous magnetohydrodynamic turbulence

    NASA Technical Reports Server (NTRS)

    Matthaeus, W. H.; Goldstein, M. L.; Lantz, S. R.

    1983-01-01

    Alpha, an important parameter in dynamo theory, is proportional to either the kinetic, current, magnetic, or velocity helicity of the fluctuating magnetic field and fluctuating velocity field. The particular helicity to which alpha is proportional depends on the assumptions used in deriving the first order smoothed equations that describe the alpha effect. In two cases, when alpha is proportional to either the magnetic helicity or velocity helicity, alpha is determined experimentally from two point measurements of the fluctuating fields in incompressible, homogeneous turbulence having arbitrary symmetry. For the other two possibilities, alpha is determined if the turbulence is isotropic.

  17. The alpha-form of the hydroxides of bivalent metals

    NASA Technical Reports Server (NTRS)

    Feitknecht, W.

    1984-01-01

    X-ray analyses were made of the hydroxides of the bivalent metals. The freshly pptd. hydroxide is usually in the alpha-form, which on standing is converted to another form or other forms. The alpha and c grating dimensions of the alpha-form and the C6-type of Co, Zn, C, Co-Zn and Ni-Zn hydroxides are tabulated. Ni hydroxide does not exhibit an alpha-form. The alpha-Co(OH)2, the blue form, is stabilized by sugar or by the higher alcohols: these compounds do not stabilize alpha-Zn(OH)2.

  18. Aspergillus nidulans alpha-galactosidase of glycoside hydrolase family 36 catalyses the formation of alpha-galacto-oligosaccharides by transglycosylation.

    PubMed

    Nakai, Hiroyuki; Baumann, Martin J; Petersen, Bent O; Westphal, Yvonne; Hachem, Maher Abou; Dilokpimol, Adiphol; Duus, Jens Ø; Schols, Henk A; Svensson, Birte

    2010-09-01

    The alpha-galactosidase from Aspergillus nidulans (AglC) belongs to a phylogenetic cluster containing eukaryotic alpha-galactosidases and alpha-galacto-oligosaccharide synthases of glycoside hydrolase family 36 (GH36). The recombinant AglC, produced in high yield (0.65 g.L(-1) culture) as His-tag fusion in Escherichia coli, catalysed efficient transglycosylation with alpha-(1-->6) regioselectivity from 40 mm 4-nitrophenol alpha-d-galactopyranoside, melibiose or raffinose, resulting in a 37-74% yield of 4-nitrophenol alpha-D-Galp-(1-->6)-D-Galp, alpha-D-Galp-(1-->6)-alpha-D-Galp-(1-->6)-D-Glcp and alpha-D-Galp-(1-->6)-alpha-D-Galp-(1-->6)-D-Glcp-(alpha1-->beta2)-d-Fruf (stachyose), respectively. Furthermore, among 10 monosaccharide acceptor candidates (400 mm) and the donor 4-nitrophenol alpha-D-galactopyranoside (40 mm), alpha-(1-->6) linked galactodisaccharides were also obtained with galactose, glucose and mannose in high yields of 39-58%. AglC did not transglycosylate monosaccharides without the 6-hydroxymethyl group, i.e. xylose, L-arabinose, L-fucose and L-rhamnose, or with axial 3-OH, i.e. gulose, allose, altrose and L-rhamnose. Structural modelling using Thermotoga maritima GH36 alpha-galactosidase as the template and superimposition of melibiose from the complex with human GH27 alpha-galactosidase supported that recognition at subsite +1 in AglC presumably requires a hydrogen bond between 3-OH and Trp358 and a hydrophobic environment around the C-6 hydroxymethyl group. In addition, successful transglycosylation of eight of 10 disaccharides (400 mm), except xylobiose and arabinobiose, indicated broad specificity for interaction with the +2 subsite. AglC thus transferred alpha-galactosyl to 6-OH of the terminal residue in the alpha-linked melibiose, maltose, trehalose, sucrose and turanose in 6-46% yield and the beta-linked lactose, lactulose and cellobiose in 28-38% yield. The product structures were identified using NMR and ESI-MS and five of the 13

  19. Synthesis of 16 alpha-/sub 3/H androgen and estrogen substrates for 16 alpha-hydroxylase

    SciTech Connect

    Cantineau, R.; Kremers, P.; De Graeve, J.; Cornelis, A.; Laszlo, P.; Gielen, J.E.; Lambotte, R.

    1981-02-01

    The synthesis of 16 alpha-/sup 3/H androgens and estrogens is described. 1-(/sup 3/H)-Acetic acid in the presence of zinc dust reacts with 16 alpha-bromo-17-ketosteroids to produce 16 alpha-/sup 3/H-17-ketosteroids. This chemical reaction was used to prepare 16 alpha-/sup 3/H-dehydroepiandrosterone (I) and 16 alpha-/sub 4/H-estrone acetate (XI) from 16 alpha-bromo-dehydroepiandrosterone (X) and from 16 alpha-bromo-estrone acetate (XII), respectively. Using appropriate microbiological techniques, it was possible to convert these radiolabelled substrates into 16 alpha-/sup 3/H-androstenedione (II) and 16 alpha-/sup 3/H-estradiol-17 beta (VII). 16 alpha-/sup 3/H-Estrone (VI) was obtained by the chemical hydrolysis of 16 alpha-/sup 3/H-estrone acetate. The label distribution as determined by microbiological 16 alpha-hydroxylations indicated a specific labelling of 77% for androgens and 65% for estrogens in the 16 alpha position. These substrates can be used for measuring the 16 alpha hydroxylase activity, an important step in the biosynthesis of estriol (VIII) and estetrol (IX).

  20. Prediction of {alpha}-decay half-lives and Q{sub {alpha}} values of superheavy nuclei by a global potential for {alpha} + nucleus systems

    SciTech Connect

    Sahu, Basudeb

    2011-09-15

    An approach we have proposed recently for calculation of Q{sub {alpha}} energy and decay half-life T{sub 1/2}{sup {alpha}} on the {alpha} decay of radioactive heavy ions is applied to the evaluation of these two important parameters for the nuclei in the superheavy region Z = 112-118 for which experimental data are not available. It is shown that the {alpha} + nucleus potential represented by an exactly solvable potential used in the calculation could be expressed in terms of proton (Z) and neutron (N) numbers of the {alpha} emitter so that varieties of {alpha}-emitting nuclei differing in their Z and N values could be addressed for their decay properties without the help of any adjustable parameter and the results of Q{sub {alpha}} and T{sub 1/2}{sup {alpha}} for a nucleus are estimated without any prior knowledge of any one of these quantities. This procedure to obtain the values of Q{sub {alpha}} and T{sub 1/2}{sup {alpha}} works well to reproduce the known experimental results for superheavy nuclei and hence, the procedure is expected to provide proper information about these parameters in experiments on {alpha} decay of new nuclei in the superheavy region.

  1. Understanding a Widely Misunderstood Statistic: Cronbach's "Alpha"

    ERIC Educational Resources Information Center

    Ritter, Nicola L.

    2010-01-01

    It is important to explore score reliability in virtually all studies, because tests are not reliable. The present paper explains the most frequently used reliability estimate, coefficient alpha, so that the coefficient's conceptual underpinnings will be understood. Researchers need to understand score reliability because of the possible impact…

  2. Systemic Targeted Alpha Radiotherapy for Cancer

    PubMed Central

    Allen, BJ

    2013-01-01

    Background: The fundamental principles of internal targeted alpha therapy forcancer were established many decades ago.The high linear energy transfer (LET) ofalpha radiation to the targeted cancer cellscauses double strand breaks in DNA. Atthe same time, the short range radiation spares adjacent normal tissues. This targeted approach complements conventional external beam radiotherapy and chemotherapy. Such therapies fail on several fronts, such as lack of control of some primary cancers (e.g. glioblastoma multiforme) and to inhibit the development of lethal metastaticcancer after successful treatment of the primary cancer. Objective: This review charts the developing role of systemic high LET, internalradiation therapy. Method: Targeted alpha therapy is a rapidly advancing experimental therapy thatholds promise to deliver high cytotoxicity to targeted cancer cells. Initially thoughtto be indicated for leukemia and micrometastases, there is now evidence that solidtumors can also be regressed. Results: Alpha therapy may be molecular or physiological in its targeting. Alphaemitting radioisotopes such as Bi-212, Bi-213, At-211 and Ac-225 are used to labelmonoclonal antibodies or proteins that target specific cancer cells. Alternatively, Radium-233 is used for palliative therapy of breast and prostate cancers because of its bone seeking properties. Conclusion: Preclinical studies and clinical trials of alpha therapy are discussedfor leukemia, lymphoma, melanoma, glioblastoma multiforme, bone metastases, ovarian cancer, pancreatic cancer and other cancers. PMID:25505750

  3. Cosmetic use of alpha-hydroxy acids.

    PubMed

    Vidt, D G; Bergfeld, W F

    1997-06-01

    Frequent and daily use of cosmetic and skin-care products that contain alpha-hydroxy acids (AHAs) moisturizes the skin and produces smoother, less-wrinkled skin surfaces. The cosmetic products developed as astringents and exfoliants diminish skin scales and remove excess skin oil. New studies suggest that photodamaged skin improves with AHA treatment. PMID:9188214

  4. Production of alpha-amylase by yeast

    SciTech Connect

    Thomse, K.K.

    1987-01-01

    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  5. Electron Screening Effects on {alpha}-decay

    SciTech Connect

    Musumarra, A.; Bonasera, A.; Del Zoppo, A.; Di Pietro, A.; Figuera, P.; Kimura, S.; Lattuada, M.; Pellegriti, M. G.; Scuderi, V.; Torresi, D.; Farinon, F.; Geissel, H.; Knoebel, R.; Prochazka, A.; Scheidenberger, C.; Nociforo, C.; Behr, K.-H.; Bosch, F.; Boutin, D.; Bruenle, A.

    2009-08-26

    An open problem in Nuclear Astrophysics concerns the understanding of electron-screening effects on nuclear reaction rates at stellar energies. In this framework, we have proposed to investigate the influence of the electron cloud on {alpha}-decay by measuring Q-values and {alpha}-decay half-lives of fully stripped, H-like and He-like ions. These kinds of measurements have been feasible just recently for highly-charged radioactive nuclides by fragmentation of {sup 238}U at relativistic energies at the FRS-ESR facility at GSI. In this way it is possible to produce, efficiently separate and store highly-charged {alpha}-emitters. Candidates for the proposed investigation were carefully selected and will be studied by using the Schottky Mass Spectroscopy technique. In order to establish a solid reference data set, lifetimes and Q{sub {alpha}}-value measurements of the corresponding neutrals have been performed directly at the FRS, by implanting the separated ions into an active Silicon stopper.

  6. E-PERM alpha surface monitor

    SciTech Connect

    Fricke, V.

    1999-12-16

    Innovative Technology Summary Reports are designed to provide potential users with the information they need to quickly determine if a technology would apply to a particular environmental management problem. They are also designed for readers who may recommend that a technology be considered by prospective users. Each report describes a technology, system, or process that has been developed and tested with funding from DOE's Office of Science and Technology (OST). The E-PERM{reg{underscore}sign} Alpha Surface Monitor is an integrating electret ion chamber innovative technology used to measure alpha radiation on surfaces of materials. The technology is best used on surfaces with low contamination levels such as areas with potential for free release, but can also be used in areas with higher levels of contamination. Measurement accuracy and production of the E-PERM {reg{underscore}sign} Alpha Surface Monitor compared favorably with the baseline technology. The innovative technology cost is approximately 28% higher than the baseline with an average unit cost per reading costing %6.04 vs. $4.36; however, the flexibility of the E-PERM{reg{underscore}sign} Alpha Surface Monitor may offer advantages in ALARA, reduction of operator error, waste minimization, and measurement accuracy.

  7. Alpha particles diffusion due to charge changes

    SciTech Connect

    Clauser, C. F. Farengo, R.

    2015-12-15

    Alpha particles diffusion due to charge changes in a magnetized plasma is studied. Analytical calculations and numerical simulations are employed to show that this process can be very important in the pedestal-edge-SOL regions. This is the first study that presents clear evidence of the importance of atomic processes on the diffusion of alpha particles. A simple 1D model that includes inelastic collisions with plasma species, “cold” neutrals, and partially ionized species was employed. The code, which follows the exact particle orbits and includes the effect of inelastic collisions via a Monte Carlo type random process, runs on a graphic processor unit (GPU). The analytical and numerical results show excellent agreement when a uniform background (plasma and cold species) is assumed. The simulations also show that the gradients in the density of the plasma and cold species, which are large and opposite in the edge region, produce an inward flux of alpha particles. Calculations of the alpha particles flux reaching the walls or divertor plates should include these processes.

  8. Cytokine therapeutics: lessons from interferon alpha.

    PubMed Central

    Gutterman, J U

    1994-01-01

    Cytokines are soluble proteins that allow for communication between cells and the external environment. Interferon (IFN) alpha, the first cytokine to be produced by recombinant DNA technology, has emerged as an important regulator of growth and differentiation, affecting cellular communication and signal transduction pathways as well as immunological control. This review focuses on the biological and clinical activities of the cytokine. Originally discovered as an antiviral substance, the efficacy of IFN-alpha in malignant, viral, immunological, angiogenic, inflammatory, and fibrotic diseases suggests a spectrum of interrelated pathophysiologies. The principles learned from in vivo studies will be discussed, particularly hairy cell leukemia, chronic myelogenous leukemia, certain angiogenic diseases, and hepatitis. After the surprising discovery of activity in a rare B-cell neoplasm, IFN-alpha emerged as a prototypic tumor suppressor protein that represses the clinical tumorigenic phenotype in some malignancies capable of differentiation. Regulatory agencies throughout the world have approved IFN-alpha for treatment of 13 malignant and viral disorders. The principles established with this cytokine serve as a paradigm for future development of natural proteins for human disease. PMID:8108387

  9. Alpha 97: Basic Education and Institutional Environments.

    ERIC Educational Resources Information Center

    Hautecoeur, Jean-Paul, Ed.

    This document was published by Alpha, a research program specializing in alternative, experimental approaches to adult basic education. It is an attempt to widen the field and examine the relationship between the micro and macro levels, between the diversity of different practices and the major policy orientations that foster or limit this…

  10. H. cap alpha. in RS CVn binaries

    SciTech Connect

    Bopp, B.W.; Talcott, J.C.

    1980-01-01

    The 1976--78 results of a spectroscopic program to monitor H..cap alpha.. in several RS CVn-type binaries are reported. For six objects well observed over orbital phase, four (HR 4665, HR 5110, sigma Gem, Z Her) show H..cap alpha.. as an absorption feature having a constant ( +- 15%) equivalent width (EW). AR Lac exhibits an absorption profile also, but the EW varies by a factor of three due to partial filling by emission. This variation is sporadic and not phase dependent. The H..cap alpha.. feature in HK Lac shows the most extreme variation: normally seen as an absorption feature with variable EW, it has been observed as a pure emission feature on three spectrograms, showing a blueshift with respect to the photosphere of approx.50--100 km sec/sup -1/. On a single occasion HK Lac showed double H..cap alpha.. emission with a separation of the peaks of approx.300 km sec/sup -1/. These high velocity features are interpreted in terms of prominence-like structure in the atmosphere of the active star.

  11. Method of making nanocrystalline alpha alumina

    DOEpatents

    Siegel, Richard W.; Hahn, Horst; Eastman, Jeffrey A.

    1992-01-01

    Method of making selected phases of nanocrystalline ceramic materials. Various methods of controlling the production of nanocrystalline alpha alumina and titanium oxygen phases are described. Control of the gas atmosphere and use of particular oxidation treatments give rise to the ability to control the particular phases provided in the aluminum/oxygen and titanium/oxygen system.

  12. Alpha and Beta at the B Factories

    SciTech Connect

    Finocchiaro, Giuseppe; /Frascati

    2007-10-15

    We review recent experimental results on time-dependent CP asymmetries in the B system from the BABAR and Belle experiments. Measurements of the {alpha} and {beta} angles of the Unitarity Triangle of the CKM matrix are discussed. These measurements constitute stringent tests of the Standard Model, and are also used to search for new physics.

  13. Coefficient Alpha and Reliability of Scale Scores

    ERIC Educational Resources Information Center

    Almehrizi, Rashid S.

    2013-01-01

    The majority of large-scale assessments develop various score scales that are either linear or nonlinear transformations of raw scores for better interpretations and uses of assessment results. The current formula for coefficient alpha (a; the commonly used reliability coefficient) only provides internal consistency reliability estimates of raw…

  14. MCNP S(. alpha. beta. ) detector scheme

    SciTech Connect

    Hendricks, J.S.; Prael, R.E.

    1990-10-01

    An approximate method to allow S({alpha},{Beta}) thermal collision contributions to point detectors and DXTRAN by Prael has been implemented in MCNP4. The method is described and test results are presented, including some results that indicate inadequacies in the NJOY processing of the nuclear data. 9 refs., 53 figs., 6 tabs.

  15. The Ups and Downs of Alpha Centauri

    NASA Astrophysics Data System (ADS)

    Ayres, Thomas R.

    2013-07-01

    The nearby Alpha Centauri triple system has two solar-type stars in a relatively close orbit (20 au separation), and a dim red dwarf companion -- Proxima -- about 10,000 au away, on the Sun-ward side of the group. The heaviest star -- Alpha Cen A -- is a close twin of the Sun. Its slightly less massive companion -- Alpha Cen B -- is a K-type dwarf, and is the closest star thought to host an exoplanet (Earth-sized, but in a much tighter orbit). The close pair has been scrutinized for more than a decade in X-rays by XMM and Chandra, on a semiannual basis since 2003 and 2005, respectively. However, in recent years only Chandra has been able to cleanly separate the pair, which are approaching closest separation on the sky (only a few arcseconds) in their 80-year orbit. For the past 3 years, the HST STIS spectrograph has joined the crowd, also capturing FUV snapshots of the pair every six months. The Alpha Cen stars provide an important complement to long-term studies of the Sun at high energies. The K-star has displayed a clear 8-year cycle in recent years, while the G-star remains mired in a Maunder-like minimum.

  16. Alpha particles diffusion due to charge changes

    NASA Astrophysics Data System (ADS)

    Clauser, C. F.; Farengo, R.

    2015-12-01

    Alpha particles diffusion due to charge changes in a magnetized plasma is studied. Analytical calculations and numerical simulations are employed to show that this process can be very important in the pedestal-edge-SOL regions. This is the first study that presents clear evidence of the importance of atomic processes on the diffusion of alpha particles. A simple 1D model that includes inelastic collisions with plasma species, "cold" neutrals, and partially ionized species was employed. The code, which follows the exact particle orbits and includes the effect of inelastic collisions via a Monte Carlo type random process, runs on a graphic processor unit (GPU). The analytical and numerical results show excellent agreement when a uniform background (plasma and cold species) is assumed. The simulations also show that the gradients in the density of the plasma and cold species, which are large and opposite in the edge region, produce an inward flux of alpha particles. Calculations of the alpha particles flux reaching the walls or divertor plates should include these processes.

  17. Human alpha 2-adrenergic receptor subtype distribution: widespread and subtype-selective expression of alpha 2C10, alpha 2C4, and alpha 2C2 mRNA in multiple tissues.

    PubMed

    Eason, M G; Liggett, S B

    1993-07-01

    At present, molecular cloning and pharmacological studies have delineated three human alpha 2-adrenergic receptor (alpha 2AR) subtypes, alpha 2C10, alpha 2C4, and alpha 2C2. Assignment of the alpha 2AR subtypes to specific functions has been limited by an unclear definition of tissue alpha 2AR expression outside of the central nervous system. It has been suggested that alpha 2C4 expression is confined to the brain, that alpha 2C2 expression is only in the liver and kidney, and that there is nearly ubiquitous expression of alpha 2C10. However, this is based on studies of a limited number of rat tissues or on studies using non-species-specific approaches. Therefore, to define alpha 2C10, alpha 2C4, and alpha 2C2 tissue expression, we used reverse transcription of total RNA isolated from 20 human tissues, followed by amplification of alpha 2AR cDNA using the polymerase chain reaction. This technique provided two advantages: high sensitivity and, with the use of subtype-specific oligonucleotide primers and probes, differentiation between the alpha 2AR subtypes. The tissues studied were aorta, vena cava, heart (epicardium and endocardium), lung, skeletal muscle, liver, pancreas (head and tail), fat (perinephric and subcutaneous), kidney (cortex and medulla), prostate, stomach, ileum, jejunum, colon, adrenal gland, and spleen. We found that the majority of these tissues expressed alpha 2C10, with the exceptions being the head of the pancreas, subcutaneous fat, colon, and spleen. In marked distinction to other studies, however, we found a prolific expression of the alpha 2C4 and alpha 2C2 subtypes. Expression of alpha 2C4 was found in all tissues with the exception of liver, fat, stomach, and colon, and a virtually ubiquitous expression of alpha 2C2 was found, with the exception of epicardium. Of all tissues studied, only colon and subcutaneous fat expressed a single alpha 2AR subtype, which was alpha 2C2. Thus, the alpha 2AR subtypes do not have a confined expression but

  18. Human alpha 2-adrenergic receptor subtype distribution: widespread and subtype-selective expression of alpha 2C10, alpha 2C4, and alpha 2C2 mRNA in multiple tissues.

    PubMed

    Eason, M G; Liggett, S B

    1993-07-01

    At present, molecular cloning and pharmacological studies have delineated three human alpha 2-adrenergic receptor (alpha 2AR) subtypes, alpha 2C10, alpha 2C4, and alpha 2C2. Assignment of the alpha 2AR subtypes to specific functions has been limited by an unclear definition of tissue alpha 2AR expression outside of the central nervous system. It has been suggested that alpha 2C4 expression is confined to the brain, that alpha 2C2 expression is only in the liver and kidney, and that there is nearly ubiquitous expression of alpha 2C10. However, this is based on studies of a limited number of rat tissues or on studies using non-species-specific approaches. Therefore, to define alpha 2C10, alpha 2C4, and alpha 2C2 tissue expression, we used reverse transcription of total RNA isolated from 20 human tissues, followed by amplification of alpha 2AR cDNA using the polymerase chain reaction. This technique provided two advantages: high sensitivity and, with the use of subtype-specific oligonucleotide primers and probes, differentiation between the alpha 2AR subtypes. The tissues studied were aorta, vena cava, heart (epicardium and endocardium), lung, skeletal muscle, liver, pancreas (head and tail), fat (perinephric and subcutaneous), kidney (cortex and medulla), prostate, stomach, ileum, jejunum, colon, adrenal gland, and spleen. We found that the majority of these tissues expressed alpha 2C10, with the exceptions being the head of the pancreas, subcutaneous fat, colon, and spleen. In marked distinction to other studies, however, we found a prolific expression of the alpha 2C4 and alpha 2C2 subtypes. Expression of alpha 2C4 was found in all tissues with the exception of liver, fat, stomach, and colon, and a virtually ubiquitous expression of alpha 2C2 was found, with the exception of epicardium. Of all tissues studied, only colon and subcutaneous fat expressed a single alpha 2AR subtype, which was alpha 2C2. Thus, the alpha 2AR subtypes do not have a confined expression but

  19. Alpha decay of {sup 181}Pb

    SciTech Connect

    Davids, C.N.; Henderson, D.J.; Hermann, R.

    1995-08-01

    The {alpha}-decay energy of {sup 181}Pb was measured as 7211(10) keV and 7044(15). In the first study the isotope was produced in {sup 90}Zr bombardments of {sup 94}Mo and, after traversing a velocity filter, implanted in a position-sensitive Si detector; no half life for {sup 181}Pb was reported. In the second study the isotope was produced in {sup 40}Ca bombardments of {sup 144}Sm and transported to a position in front of a Si(Au) surface barrier detector with a fast He-gas-jet capillary system; an estimate of 50 ms was determined for the {sup 181}Pb half life. Recently we investigated {sup 181}Pb {alpha} decay at ATLAS as part of a survey experiment in which a l-pnA beam of 400-MeV {sup 92}Mo was used to irradiate targets of {sup 89}Y, {sup 90,92,94}Zr, and {sup 92}Mo to examine yields for one- and two-nucleon evaporation products from symmetric cold-fusion reactions. Recoiling nuclei of interest were passed through the Fragment Mass Analyzer and implanted in a double-sided silicon strip detector for {alpha}-particle assay. With the {sup 90}Zr target we observed a group at 7065(20) keV which was correlated with A = 181 recoils and had a half life of 45(20) ms. Our new results for {sup 181}Pb therefore agreed with those of the second study. There was no indication in the {sup 90}Zr + {sup 92}Mo data of the 7211(10)-keV {alpha} particles seen by Keller et al. The interested reader is referred to the 1993 atomic mass evaluation wherein the input {alpha}-decay energies and resultant masses of the light Pb isotopes (including {sup 181}Pb) are discussed.

  20. Alpha-particle emission probabilities of ²³⁶U obtained by alpha spectrometry.

    PubMed

    Marouli, M; Pommé, S; Jobbágy, V; Van Ammel, R; Paepen, J; Stroh, H; Benedik, L

    2014-05-01

    High-resolution alpha-particle spectrometry was performed with an ion-implanted silicon detector in vacuum on a homogeneously electrodeposited (236)U source. The source was measured at different solid angles subtended by the detector, varying between 0.8% and 2.4% of 4π sr, to assess the influence of coincidental detection of alpha-particles and conversion electrons on the measured alpha-particle emission probabilities. Additional measurements were performed using a bending magnet to eliminate conversion electrons, the results of which coincide with normal measurements extrapolated to an infinitely small solid angle. The measured alpha emission probabilities for the three main peaks - 74.20 (5)%, 25.68 (5)% and 0.123 (5)%, respectively - are consistent with literature data, but their precision has been improved by at least one order of magnitude in this work.

  1. Mechanism of release of active alpha subunit from dimeric alpha beta avian myeloblastosis virus DNA polymerase.

    PubMed Central

    Papas, T S; Marciani, D J; Samuel, K; Chirikjian, J G

    1976-01-01

    Storage of the dimeric (alphabeta) form of avian myeloblastosis virus (AMV) DNA polymerase in glycerol resulted in the release of the smaller alpha subunit, as detected by glycerol gradient sedimentation. Analysis by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of enzyme stored in glycerol showed the concomitant appearance of several polypeptides and a lowering in the level of both beta and alpha components. This reduction appears to be the result of cleavages introduced by traces of hydrolytic activity present in glycerol samples. An enhancement of alpha subunit released, as detected by activity profile, was also achieved upon direct but limited exposure of purified avian myeloblastosis virus DNA polymerase to carboxymethyl-cellulose-bound trypsin matrix. Electrophoretic analysis of digested enzyme revealed a progressive fragmentation, with simultaneous increase in the alpha subunit and decrease in the beta subunit. PMID:58080

  2. Alpha 1D- and alpha 1A-adrenoceptors mediate contraction in rat renal artery.

    PubMed

    Villalobos-Molina, R; López-Guerrero, J J; Ibarra, M

    1997-03-19

    To investigate the alpha 1-adrenoceptor subtype(s) mediating contraction in rat renal artery, we have compared the effect of the alpha 1-adrenoceptor antagonists, 5-methylurapidil, BMY 7378 (8-(2-(4-(2-methoxyphenyl)-1-piperazinyl) ethyl) 8-azaspiro (4.5) decane-7,9-dione 2HCl) and chloroethylclonidine on functional responses to noradrenaline. A clear blockade by chloroethylclonidine (10(-4) M) of noradrenaline-induced contraction was observed and, along with this effect. pKB values of 9.12 and 8.40 for BMY 7378 and 9.75 and 10.06 for 5-methylurapidil were obtained, indicating that the renal artery expresses the alpha 1D-adrenoceptor subtype as the one involved in contraction and not only the alpha 1A subtype as has been reported. PMID:9098691

  3. Degradation of the potato glycoalkaloids--alpha-solanine and alpha-chaconine in groundwater.

    PubMed

    Jensen, Pia H; Jacobsen, Ole S; Henriksen, Trine; Strobel, Bjarne W; Hansen, Hans Christian B

    2009-06-01

    The potato glycoalkaloids alpha-chaconine and alpha-solanine are produced in high amounts in potato plants from where release to soil takes place. Degradation of the compounds in groundwater was investigated, as their fate in the terrestrial environment is unknown. Abiotic and microbial degradation were followed in groundwater sampled from below a potato field and spiked with the glycoalkaloids (115 nmol/l). Degradation was primarily microbial and the glycoalkaloids were degraded within 21-42 days. The metabolites beta(1)-solanine, gamma-solanine, and solanidine were formed from alpha-solanine, while beta-chaconine, gamma-chaconine and solanidine were detected from alpha-chaconine. Thus, indigenous groundwater microorganisms are capable of degrading the glycoalkaloids.

  4. Interaction of alphaVbeta3 and alphaVbeta6 integrins with human parechovirus 1.

    PubMed

    Seitsonen, Jani; Susi, Petri; Heikkilä, Outi; Sinkovits, Robert S; Laurinmäki, Pasi; Hyypiä, Timo; Butcher, Sarah J

    2010-09-01

    Human parechovirus (HPEV) infections are very common in early childhood and can be severe in neonates. It has been shown that integrins are important for cellular infectivity of HPEV1 through experiments using peptide blocking assays and function-blocking antibodies to alpha(V) integrins. The interaction of HPEV1 with alpha(V) integrins is presumably mediated by a C-terminal RGD motif in the capsid protein VP1. We characterized the binding of integrins alpha(V)beta(3) and alpha(V)beta(6) to HPEV1 by biochemical and structural studies. We showed that although HPEV1 bound efficiently to immobilized integrins, alpha(V)beta(6) bound more efficiently than alpha(V)beta(3) to immobilized HPEV1. Moreover, soluble alpha(V)beta(6), but not alpha(V)beta(3), blocked HPEV1 cellular infectivity, indicating that it is a high-affinity receptor for HPEV1. We also showed that HPEV1 binding to integrins in vitro could be partially blocked by RGD peptides. Using electron cryo-microscopy and image reconstruction, we showed that HPEV1 has the typical T=1 (pseudo T=3) organization of a picornavirus. Complexes of HPEV1 and integrins indicated that both integrin footprints reside between the 5-fold and 3-fold symmetry axes. This result does not match the RGD position predicted from the coxsackievirus A9 X-ray structure but is consistent with the predicted location of this motif in the shorter C terminus found in HPEV1. This first structural characterization of a parechovirus indicates that the differences in receptor binding are due to the amino acid differences in the integrins rather than to significantly different viral footprints.

  5. Kinetics of chaperoning of dithiothreitol-denatured alpha-lactalbumin by alpha-crystallin.

    PubMed

    Bettelheim, Frederick A

    2002-06-18

    Molecular chaperones prevent the aggregation of partially folded or misfolded forms of protein. alpha-Crystallin performs such a function in the ocular lens. Dynamic light scattering (DLS) measurements were performed to gain insight into the kinetics and mechanism of alpha-crystallin chaperoning. Experiments were conducted as a function of alpha-lactalbumin concentration as well as the alpha-crystallin/alpha-lactalbumin ratio over a 24 h period. In the particle distribution patterns the lactalbumin concentration was partitioned into three compartments: (a) monomeric free lactalbumin; (b) lactalbumin in the chaperoning complex; and (c) lactalbumin aggregates. DLS intensities were converted to molar concentrations by assuming a model of a spherical chaperoning complex. In the model, alpha-crystallin is the central core and alpha-lactalbumin molecules occupy a ring surrounding the core. The kinetics of chaperoning was studied by proposing a simple scheme with four rate constants. The reversible reaction of the formation of the chaperoning complex is characterized by rate constants k(1) and k(2). The rate constants k(3) and k(4) govern the irreversible aggregation of lactalbumin: the former from the free monomeric lactalbumin pool and the latter describing the aggregation of the denatured lactalbumin released from the chaperoning complex. The rate constants, k(3) and k(4) are four magnitudes larger than k(1) and k(2). The equilibrium constant of chaperoning complex formation lies in favor of the reactants. k(4) is somewhat faster than k(3) and it is three times faster than k(s) governing the self-aggregation of lactalbumin in the absence of alpha-crystallin.

  6. Peroxisome proliferator-activated receptor {alpha}-independent peroxisome proliferation

    SciTech Connect

    Zhang Xiuguo; Tanaka, Naoki . E-mail: naopi@hsp.md.shinshu-u.ac.jp; Nakajima, Takero; Kamijo, Yuji; Gonzalez, Frank J.; Aoyama, Toshifumi

    2006-08-11

    Hepatic peroxisome proliferation, increases in the numerical and volume density of peroxisomes, is believed to be closely related to peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) activation; however, it remains unknown whether peroxisome proliferation depends absolutely on this activation. To verify occurrence of PPAR{alpha}-independent peroxisome proliferation, fenofibrate treatment was used, which was expected to significantly enhance PPAR{alpha} dependence in the assay system. Surprisingly, a novel type of PPAR{alpha}-independent peroxisome proliferation and enlargement was uncovered in PPAR{alpha}-null mice. The increased expression of dynamin-like protein 1, but not peroxisome biogenesis factor 11{alpha}, might be associated with the PPAR{alpha}-independent peroxisome proliferation at least in part.

  7. Genetics Home Reference: alpha-methylacyl-CoA racemase deficiency

    MedlinePlus

    ... Me Understand Genetics Home Health Conditions AMACR deficiency alpha-methylacyl-CoA racemase deficiency Enable Javascript to view ... boxes. Download PDF Open All Close All Description Alpha-methylacyl-CoA racemase (AMACR) deficiency is a disorder ...

  8. Antibody-mediated reduction of {alpha}-ketoamides

    DOEpatents

    Schultz, P.G.; Gallop, M.A.

    1998-06-09

    Monoclonal antibodies raised against a 4-nitrophenyl phosphonate hapten catalyze the stereospecific reduction of an {alpha}-ketoamide to the corresponding {alpha}-hydroxyamide in the presence of an appropriate reducing agent.

  9. Who Is at Risk for Alpha-1 Antitrypsin Deficiency?

    MedlinePlus

    ... on Twitter. Who Is at Risk for Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency occurs in all ethnic groups. ... it doesn't mean that you'll develop one of the diseases related to the condition. Some ...

  10. Antibody-mediated reduction of .alpha.-ketoamides

    DOEpatents

    Schultz, Peter G.; Gallop, Mark A.

    1998-01-01

    Monoclonal antibodies raised against a 4-nitrophenyl phosphonate hapten catalyze the stereospecific reduction of an .alpha.-ketoamide to the corresponding .alpha.-hydroxyamide in the presence of an appropriate reducing agent.

  11. An assay for intermolecular exchange of alpha crystallin

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    An affinity column of alpha crystallin linked to cyanogen bromide-activated Sepharose was developed to study the exchange of alpha subunits. Alpha crystallin bound to the Sepharose-alpha complex was dissociated with 8 mol/l urea, followed by quantitation using high-performance reverse-phase liquid chromatography. The time course of binding at 37 degrees C showed a hyperbolic binding pattern reaching equilibrium between 6-18 hr. Under these conditions, binding of beta and gamma crystallins to the same matrix was less than 10% of the alpha values, as was binding of alpha to glycine-coupled Sepharose. This assay was used to demonstrate changes in the subunit exchange of alpha crystallins present in high molecular weight versus lower molecular weight aggregates of the human lens. These results show that this binding procedure was a specific reproducible assay that might be used to study intermolecular interactions of the alpha crystallins.

  12. Synthesis of 15 alpha-hydroxyestrogen 15-N-acetylglucosaminides.

    PubMed

    Suzuki, E; Namba, S; Kurihara, H; Goto, J; Matsuki, Y; Nambara, T

    1995-03-01

    The synthesis of 15-N-acetylglucosaminides of 15 alpha-hydroxyesterone, 15 alpha-hydroxyestradiol, and 15 alpha-hydroxyestriol (estetrol) is described. The latter two were prepared by condensation of 2-acetamido-1 alpha-chloro-1,2-dideoxy-3,4,6-trio-O-acetyl-D-glucopyranose with appropriately protected 15 alpha-hydroxyestrogens by the Koenigs-Knorr reaction employing cadmium carbonate as a catalyst. Subsequent removal of protecting groups with methanolic potassium hydroxide provided the desired conjugates. 15 alpha-Hydroxyestrone 15-N-acetylglucosaminide was synthesized from the corresponding 15 alpha-hydroxyestradiol derivative by Jones oxidation followed by brief alkaline hydrolysis. These conjugates underwent enzymatic hydrolysis with beta-N-acetylglucosaminidase from Jack beans to produce 15 alpha-hydroxyestrogens. PMID:7792832

  13. Uptake and bioconversion of alpha-tocopheryl acetate to alpha-tocopherol in skin of hairless mice.

    PubMed

    Norkus, E P; Bryce, G F; Bhagavan, H N

    1993-04-01

    The photoprotective effect of topically applied alpha-tocopheryl acetate (vitamin E acetate), a stable derivative of alpha-tocopherol (vitamin E), and its possible bioconversion to the active antioxidant species (alpha-tocopherol) was examined in skin tissue of female hairless mice (HRS/J) exposed to UV-B irradiation. Our results indicate that topically applied alpha-tocopheryl acetate is absorbed into and retained by skin tissue. Furthermore, skin tissue from UV-B-irradiated animals that received daily topical alpha-tocopheryl acetate treatments contained significantly higher levels (P < 0.001) of alpha-tocopheryl acetate than non-UV-B-irradiated mice that received identical daily topical alpha-tocopheryl acetate treatments. Finally, free alpha-tocopherol levels in skin also were significantly increased (P < 0.001) by topical applications of alpha-tocopheryl acetate and skin levels of free alpha-tocopherol were significantly greater (P < 0.001) in UV-B-irradiated animals that received daily topical alpha-tocopheryl acetate treatments than in non-UV-B-irradiated animals. These results suggest that UV-B irradiation enhances both the absorption of alpha-tocopheryl acetate and its bioconversion to free alpha-tocopherol.

  14. Removal of alpha-Gal epitopes from porcine aortic valve and pericardium using recombinant human alpha galactosidase A.

    PubMed

    Park, Seongsik; Kim, Woong-Han; Choi, Sun-Young; Kim, Yong-Jin

    2009-12-01

    It has been reported that the immune response due to alpha-Gal epitopes is an important factor in tissue valve failure. The elimination of the interaction between the natural anti-Gal antibodies and alpha-gal epitopes on the xenografts is a prerequisite to the success of xenografts in humans. Previously, we reported that the green coffee bean alpha-galactosidase could remove all alpha-Gal epitopes from cell surface of porcine aortic valve and pericardial tissue, but it has limitations on cost effectiveness. In this study we wanted to know whether the recently produced recombinant human alpha-galactosidase A has the same effective enzymatic activity as green coffee bean alpha-galactosidase in removing alpha-Gal epitopes from the same tissues. After treating fresh porcine aortic valve and pericardial tissue with recombinant alpha-galactosidase A, each sample was stained with Griffonia simplicifolia type I isolectin B4 indirect immunoperoxidase avidin-biotin technique. We then examined whether the alpha-Gal epitopes were reduced or abolished in each consecutive concentration of recombinant alpha-galactosidase A by comparing the degree of the Griffonia simplicifolia isolectin B4 staining. As a result, the recombinant alpha-galactosidase A could remove cell surface alpha-Gals on porcine aortic valve and pericardial tissue as effectively as green coffee bean alpha-galactosidase.

  15. Structural and electrochemical studies of alpha manganese dioxide ({alpha}-MnO{sub 2})

    SciTech Connect

    Johnson, C.S.; Dees, D.W.; Mansuetto, M.F.; Thackeray, M.M.; Vissers, D.R.; Argyriou, D.; Loong, C.-K.; Christensen, L.

    1996-08-01

    The structural and electrochemical properties of alpha-MnO[sub 2], prepared by acid digestion of Mn[sub 2]O[sub 3], and its lithiated derivatives xLi[sub 2] O . MnO[sub 2] (where x is greater than or equal to zero and less than or equal to 0.25) have been investigated as insertion compounds in the search for new and viable cathode materials for rechargeable 3-V batteries. The alpha-MnO[sub 2] product fabricated by this technique contains water within the large (2x2) channels of the structure; the water can be removed from the alpha-MnO[sub 2] framework without degradation of the structure, and then at least partially replaced by Li[sub 2]O. The lithia-doped alpha-MnO[sub 2] electrodes, described generically as xLi[sub 2]O . Mno[sub 2], stabilize the structure and provide higher capacities on cycling than the parent material. The structures of these alpha- MnO[sub 2]-type electrode materials are described. and electrochemical data are presented for both liquid electrolyte and polymer electrolyte Li/alpha-MnO[sub 2] and Li/xLi[sub 2]O . MnO[sub 2] cells.

  16. Inhibition of microsomal lipid peroxidation by alpha-tocopherol and alpha-tocopherol acetate.

    PubMed

    Gonzalez Flecha, B S; Repetto, M; Evelson, P; Boveris, A

    1991-08-01

    1. The antioxidant effects of alpha-tocopherol and alpha-tocopherol acetate were assayed for the (a) oxygen uptake, (b) chemiluminescence and (c) malondialdehyde formation, of tert-butyl hydroperoxide-supplemented rat liver microsomes. 2. Oxygen uptake was inhibited 60% by both alpha-tocopherol and alpha-tocopherol acetate with the half-maximal effect at 5 nmol tocopherol/mg protein. Chemiluminescence and malondialdehyde formation were equally inhibited 35% by both tocopherols with half-maximal effects at 2 nmol tocopherol/mg protein. 3. The rate of O2 uptake by tocopherol-supplemented microsomes was dependent on O2 concentration. A 60% inhibition by 5 nmol tocopherol/mg protein at 0.2 mM O2 is decreased to 5% inhibition at 0.6 mM O2. 4. The inhibition of O2 uptake, chemiluminescence and malondialdehyde formation indicate that both alpha-tocopherol and alpha-tocopherol acetate have similar effects as free radical traps in the hydrophobic domain of biomembranes. The different inhibition observed at different O2 concentrations indicate competition between vitamin E and O2 by unoxygenated lipid radicals.

  17. Nucleotide dependent differences between the {alpha}-skeletal and {alpha}-cardiac actin isoforms

    SciTech Connect

    Orban, Jozsef; Lorinczy, Denes; Nyitrai, Miklos; Hild, Gabor

    2008-04-11

    The thermodynamic properties of the actin filaments prepared from cardiomyocytes were investigated with differential scanning calorimetry. This method could distinguish between the {alpha}-cardiac and {alpha}-skeletal components of the actin filaments polymerised from ADP-actin monomers by their different melting temperatures (T{sub m}). Similar separation was not possible with filaments polymerised from ATP-actin monomers. Further analyses revealed that the activation energy (E{sub act}) was greater for filaments of {alpha}-skeletal actin than for {alpha}-cardiac actin monomers when the filaments were polymerised from ADP-actin monomers. These results showed that the {alpha}-cardiac actin filaments were thermodynamically less stable than the filaments of {alpha}-skeletal actin and their difference was nucleotide dependent. Based on these results and considering previous observations it was concluded that the existence of two actin isoforms and their nucleotide dependent conformational differences are part of the tuning regulatory mechanism by which the cardiac muscle cells can maintain their biological function under pathological conditions.

  18. Effects of alpha-proton drift velocity on alpha particle firehose instability

    NASA Astrophysics Data System (ADS)

    Seough, Jungjoon; Nariyuki, Yasuhiro

    2016-08-01

    In situ measurements have shown that the less-abundant alpha particles are characterized by temperature anisotropy which could drive the anisotropy-driven kinetic instabilities in the solar wind. In the collisionless plasma, the differential alpha-proton flow velocity V d = V α - V p usually has a non-zero value of the order of the local Alfvén velocity. The presence of such differential flow may affect the properties of dispersion relations for anisotropy-driven instabilities. Based upon linear Vlasov dispersion theory in a homogeneous plasma, the present study investigates the effects of the alpha-proton drift velocity on the parallel and oblique firehose instabilities driven by an excessive parallel temperature anisotropy of alpha particles, where the parallel and oblique represent directions of fluctuation propagation relative to the background magnetic field. It is found that for oblique firehose mode as well as parallel mode, the dispersion properties are affected by the presence of the alpha-proton drift velocity, which in turn results in the increase of the maximum growth rates as Vd increases and consequently leads to the modification of the marginal stability conditions in the parameter space ( β ∥ α , T ⊥ α / T ∥ α ) . We discuss the relevance of our results to the measured temperature anisotropy of alpha particles in the solar wind context.

  19. Chaperone-like activities of {alpha}-synuclein: {alpha}-Synuclein assists enzyme activities of esterases

    SciTech Connect

    Ahn, Misun; Kim, SeungBum; Kang, Mira; Ryu, Yeonwoo . E-mail: ywryu@ajou.ac.kr; Doohun Kim, T. . E-mail: doohunkim@ajou.ac.kr

    2006-08-11

    {alpha}-Synuclein, a major constituent of Lewy bodies (LBs), has been implicated to play a critical role in the pathogenesis of Parkinson's disease (PD), although the physiological function of {alpha}-synuclein has not yet been known. Here we have shown that {alpha}-synuclein, which has no well-defined secondary or tertiary structure, can protect the enzyme activity of microbial esterases against stress conditions such as heat, pH, and organic solvents. In particular, the flexibility of {alpha}-synuclein and its C-terminal region seems to be important for complex formation, but the structural integrity of the C-terminal region may not be required for stabilization of enzyme activity. In addition, atomic force microscopy (AFM) and in vivo enzyme assays showed highly specific interactions of esterases with {alpha}-synuclein. Our results indicate that {alpha}-synuclein not only protects the enzyme activity of microbial esterases in vitro, but also can stabilize the active conformation of microbial esterases in vivo.

  20. Alternative nonallelic deletion is constitutive of ruminant alpha(s1)-casein.

    PubMed

    Ferranti, P; Lilla, S; Chianese, L; Addeo, F

    1999-07-01

    Multiple forms of alpha(s1)-casein were identified in the four major ruminant species by structural characterization of the protein fraction. While alpha(s1)-casein phenotypes were constituted by a mixture of at least seven molecular forms in ovine and caprine species, there were only two forms in bovine and water buffalo species. In ovine and caprine forms the main component corresponded to the 199-residue-long form, and the deleted proteins differed from the complete one by the absence of peptides 141-148, 110-117, or Gln78, or a combination of such deletions. The deleted segments corresponded to the sequence regions encoded by exons 13 and 16, and by the first triplet of exon 11 (CAG), suggesting that the occurrence of the short protein forms is due to alternative skipping, as previously demonstrated for some caprine and ovine phenotypes. The alternative deletion of Gln78 in alpha(s1)-casein, the only form common to the milk of all the species examined and located in a sequence region joining the polar phosphorylation cluster and the hydrophobic C-terminal domain of the protein, may play a functional role in the stabilization of the milk micelle structure.

  1. Possible Stimulation of Nuclear alpha Decay by Superfluid Helium

    SciTech Connect

    Barabanov, A. L.

    2009-08-28

    It is suggested that superfluid helium (condensate of {sup 4}He atoms) may stimulate nuclear alpha decay in a situation when an alpha emitter moves through superfluid helium with fine-tuned velocity, so that the backward-emitted alpha particle is at rest in the laboratory frame. It is shown that the probability of stimulated alpha decay in this case may be sizable enough to be detected.

  2. Possible stimulation of nuclear alpha decay by superfluid helium.

    PubMed

    Barabanov, A L

    2009-08-28

    It is suggested that superfluid helium (condensate of (4)He atoms) may stimulate nuclear alpha decay in a situation when an alpha emitter moves through superfluid helium with fine-tuned velocity, so that the backward-emitted alpha particle is at rest in the laboratory frame. It is shown that the probability of stimulated alpha decay in this case may be sizable enough to be detected.

  3. Complex effects of IL1A polymorphism and calpain inhibitors on interleukin 1 alpha (IL-1 alpha) mRNA levels and secretion of IL-1 alpha protein.

    PubMed

    Lee, S; Temple, S; Roberts, S; Price, P

    2008-07-01

    Alleles of IL1A-889(C>T) and IL1A+4845(G>T) are in linkage disequilibrium. Interleukin 1alpha (IL-1alpha) is produced as a precursor protein and cleaved at positions 117-118 by calpain, generating a mature protein for export. IL1A+4845 affects amino acids expressed at position 114 and hence may modulate calpain-mediated cleavage. We sought evidence for this mechanism in intact cells. Blood leukocytes from heterozygous donors released more IL-1alpha protein than cells from IL1A(1,1) donors, while release from IL1A(2,2) cells was variable. Genotype did not affect levels of IL-1alpha mRNA, so differential cleavage of the precursor is a feasible mechanism. However, genotype also had no effect on inhibition of IL-1alpha release by pretreatment with calpain inhibitors, and calpain inhibitors reduced IL-1alpha and tumor necrosis factor alpha mRNA levels. Hence, calpain inhibitors probably affect inhibition of signal transduction pathway rather than cleavage of IL-1alpha protein. As ratios of mu-calpain/calpastatin were lowest in heterozygous donors, genetically determined IL-1alpha levels may modulate transcription of calpain and calpastatin. This could reduce the impact of IL1A genotype on IL-1alpha secretion and amplify individual variation in levels generated in culture.

  4. Nicotine inhibits Fc epsilon RI-induced cysteinyl leukotrienes and cytokine production without affecting mast cell degranulation through alpha 7/alpha 9/alpha 10-nicotinic receptors.

    PubMed

    Mishra, Neerad C; Rir-sima-ah, Jules; Boyd, R Thomas; Singh, Shashi P; Gundavarapu, Sravanthi; Langley, Raymond J; Razani-Boroujerdi, Seddigheh; Sopori, Mohan L

    2010-07-01

    Smokers are less likely to develop some inflammatory and allergic diseases. In Brown-Norway rats, nicotine inhibits several parameters of allergic asthma, including the production of Th2 cytokines and the cysteinyl leukotriene LTC(4). Cysteinyl leukotrienes are primarily produced by mast cells, and these cells play a central role in allergic asthma. Mast cells express a high-affinity receptor for IgE (FcepsilonRI). Following its cross-linking, cells degranulate and release preformed inflammatory mediators (early phase) and synthesize and secrete cytokines/chemokines and leukotrienes (late phase). The mechanism by which nicotine modulates mast cell activation is unclear. Using alpha-bungarotoxin binding and quantitative PCR and PCR product sequencing, we showed that the rat mast/basophil cell line RBL-2H3 expresses nicotinic acetylcholine receptors (nAChRs) alpha7, alpha9, and alpha10; exposure to exceedingly low concentrations of nicotine (nanomolar), but not the biologically inactive metabolite cotinine, for > or = 8 h suppressed the late phase (leukotriene/cytokine production) but not degranulation (histamine and hexosaminidase release). These effects were unrelated to those of nicotine on intracellular free calcium concentration but were causally associated with the inhibition of cytosolic phospholipase A(2) activity and the PI3K/ERK/NF-kappaB pathway, including phosphorylation of Akt and ERK and nuclear translocation of NF-kappaB. The suppressive effect of nicotine on the late-phase response was blocked by the alpha7/alpha9-nAChR antagonists methyllycaconitine and alpha-bungarotoxin, as well as by small interfering RNA knockdown of alpha7-, alpha9-, or alpha10-nAChRs, suggesting a functional interaction between alpha7-, alpha9-, and alpha10-nAChRs that might explain the response of RBL cells to nanomolar concentrations of nicotine. This "hybrid" receptor might serve as a target for novel antiallergic/antiasthmatic therapies.

  5. Bioavailability of alpha-tocopherol fed with retinol and relative bioavailability of D-alpha-tocopherol or DL-alpha-tocopherol acetate.

    PubMed

    Eicher, S D; Morrill, J L; Velazco, J

    1997-02-01

    Two experiments were conducted to examine the effects of the form of alpha-tocopherol or interactions of alpha-tocopherol with vitamin A on its bioavailability. In Experiment 1, Holstein steers were fed a diet that was low in vitamins A and E for 1 mo; then, steers were blocked by body weight (X = 97.5 kg) and assigned randomly to one of four oral treatments: 1) no added vitamins, 2) 442 mg of retinyl acetate, 3) 1342 mg of D-alpha-tocopherol, or 4) 442 mg of retinyl acetate and 1342 mg of D-alpha-tocopherol. Each treatment was given as a pulse dose. Blood was sampled over a 36-h period. Concentrations of plasma retinyl palmitate peaked at 2 to 6 h postsupplementation for all calves and then peaked again at 22 to 28 h for calves receiving vitamin supplements. Concentrations of plasma alpha-tocopherol peaked earliest with D-alpha-tocopherol supplementation alone at 12 to 20 h after supplementation, but simultaneous supplementation with retinyl acetate resulted in lower plasma alpha-tocopherol concentrations. Plasma retinyl palmitate decreased during peak alpha-tocopherol concentrations. In Experiment 2, blood and tissue were analyzed after a single gastric tube administration of a powder (DL-alpha-tocopheryl acetate) or a liquid (D-alpha-tocopherol) form of vitamin E to Holstein calves. Plasma and kidney concentrations of alpha-tocopherol were higher when calves were fed D-alpha-tocopherol than when calves were fed the DL-alpha-tocopherol acetate form. Concentrations in the liver, spleen, adipose tissue, heart, muscle, cellular blood fraction, and gut did not differ between the two forms.

  6. Nicotine enhances expression of the alpha 3, alpha 4, alpha 5, and alpha 7 nicotinic receptors modulating calcium metabolism and regulating adhesion and motility of respiratory epithelial cells.

    PubMed

    Zia, S; Ndoye, A; Nguyen, V T; Grando, S A

    1997-09-01

    The purpose of this study was to investigate the possibility of direct toxic effects of nicotine (Nic) on human bronchial epithelial cells (BEC) suggested by our previous findings of functional nicotinic acetylcholine receptors (nAChRs) in the epithelial cells lining mucocutaneous membranes. We now demonstrate for the first time that human and murine BEC both in vivo and in vitro express functional nAChRs, and that classic alpha 3, alpha 4, alpha 5 and alpha 7 subunits can contribute to formation of these acetylcholine-gated ion channels. In human bronchial and mouse lung tissues, and in cultures of human BEC, the nAChRs were visualized by subunit-specific antibodies on the cell membranes, particularly at the sites of cell-to-cell contacts. The epithelial cells of submucosal glands abundantly expressed alpha 7 nAChRs. Smoking significantly (p < 0.05) increased the relative numbers of nAChRs, and this effects could be reproduced in cultures of BEC exposed to 10 microM Nic. At a higher dose, Nic decreased the relative numbers of alpha 5-containing nAChRs, suggesting a role for receptor desensitization. The function of the nAChR channels expressed by BEC was demonstrated by biphasic increase in the concentrations of intracellular calcium ([Ca++]i) in response to activation of the channel by Nic and fluctuations of [Ca++]i due to channel blockade by mecamylamine (Mec). Long-term exposure to milimolar concentrations of Nic resulted in a steady increase of [Ca++]i, which may lead to cell damage. The biological roles of epithelial nAChRs apparently involve regulation of cell-to-cell communications, adhesion and motility, because Mec caused rapid and profound changes in these cell functions which were reversible by Nic. An over exposure of BEC to Nic, however, produced an antagonist-like effect, suggesting that the pathobiological effects of Nic toxicity might result from both activation of nAChR channels and nAChR desensitization. We conclude that medical consequences of

  7. Hematotoxic effects of 3,5-dinitro-4-chloro-alpha,alpha,alpha-trifluorotoluene, a water contaminant

    SciTech Connect

    Guastadisegni, C.; Hall, D.; Macri, A.

    1986-10-01

    Three short-term studies of 7, 14, and 21 days, respectively, were made to investigate the nature of the anemia induced in rats by 3,5-dinitro-4-chloro-alpha,alpha,alpha-trifluorotoluene (DNCTT). This compound is an intermediate in the synthesis of dinitroaniline herbicides and was detected as a contaminant of a water-bearing stratum in northern Italy. DNCTT was mixed in a powdered rodent diet at a level of 2000 ppm and administered to Wistar-derived rats. DNCTT was shown to produce a hemolytic anemia of rapid onset; packed cell volume and hemoglobin concentration were decreased at all three treatment periods. Methemoglobin and reticulocyte count were increased in all the treated groups. The relative organ weights of the spleen and the liver were increased compared to those of the control groups. Spleen enlargement was also evident at the macroscopic examination, whereas the liver appearance was normal. Pearl's Prussian blue staining performed on the spleen and liver was highly positive in the spleen of treated rats, but no iron deposition was detected in the liver of treated rats.

  8. Some numerical reslts on best uniform polynomial approximation of. chi. sup. alpha. on (0,1)

    SciTech Connect

    Carpenter, A.J.; Varga, R.S.

    1992-01-01

    Let {alpha} be a positive number, and let E{sub n}(chi{sup {alpha}}; (0,1)) denote the error of best uniform approximation to {chi}{sup {alpha}}, by polynomials of degree at most n, on the interval (0,1). The Russian mathematician S.N. Bernstein established the existence of a nonnegative constant {Beta}({alpha}) such that {Beta}({alpha}):= {sub n{yields}{infinity}lim(2n){sup 2{alpha}}E{sub n}({chi}{sup {alpha}};(0.1)). In addition, Bernstein showed that {Beta}{alpha} < {Gamma}(2{alpha}){vert bar}sin(pi}{alpha}){vert bar}/{pi} ({alpha} > 0) and that {Gamma}(2{alpha}){vert bar}sin({pi}{alpha}){vert bar}/{pi} (1{minus}1/2{alpha}{minus}1) < {Beta}({alpha}) ({alpha} > {1/2}), so that the asymptotic behavior of {Beta}({alpha}) is known when {alpha}{yields}{infinity}. Still, the problem of trying to determine {Beta}({alpha}) more precisely, for all {alpha} > 0, is intriguing. To this end, we have rigorously determined the numbers for thirteen values of {alpha}, where these numbers were calculated with a precision of at least 200 significant digits. For each of these thirteen values of {alpha}, Richardson's extrapolation was applied to the products to obtain estimates of {Beta}({alpha}) to approximately 40 decimal places. Included are graphs of the points ({alpha},{Beta}({alpha})) for the thirteen values of {alpha} that we considered.

  9. 40 CFR 721.10491 - Benzenepropanal,.alpha.-methyl-.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Benzenepropanal,.alpha.-methyl-. 721... Substances § 721.10491 Benzenepropanal,.alpha.-methyl-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzenepropanal,.alpha.-methyl- (PMN...

  10. 40 CFR 721.10491 - Benzenepropanal,.alpha.-methyl-.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Benzenepropanal,.alpha.-methyl-. 721... Substances § 721.10491 Benzenepropanal,.alpha.-methyl-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzenepropanal,.alpha.-methyl- (PMN...

  11. Purplebook Alpha: For Pre-Professional Trainees in Higher Education.

    ERIC Educational Resources Information Center

    Reitan, Henry M.; Coole, Walter A.

    The "Purplebook" is an essential part of the "Greenbook System"--an integrated sequence of five programs (Alpha, Beta, Gamma, Delta, and Epsilon) for professional development of college educators. The Alpha program is designed for college seniors or graduate students preparing for careers in higher education. Purplebook Alpha provides guidelines…

  12. Direct Measurement of {sup 21}Na+{alpha} Stellar Reaction

    SciTech Connect

    Binh, D. N.; Kubono, S.; Yamaguchi, H.; Hayakawa, S.; Hashimoto, T.; Kahl, D.; Teranishi, T.; Iwasa, N.; Kume, N.; Kato, S.; Khiem, L. H.; Tho, N. T.; Wakabayashi, Y.

    2010-08-12

    The measurement of the resonant alpha scattering and the {sup 21}Na({alpha}, p) reaction were performed for the first time in inverse kinematics with the thick target method using a {sup 21}Na radioisotope (RI) beam. This paper reports the current result of alpha scattering measurement and its astrophysics implication.

  13. Alpha and the Gay Issue: A Lesson in Homophobia?

    ERIC Educational Resources Information Center

    Hunt, Stephen John

    2005-01-01

    The Alpha course is possibly the most widespread and best-known evangelizing initiative of recent times. Billing itself as an introduction into "basic Christianity", Alpha is a programme that has been adopted worldwide by tens of thousands of churches. This paper overviews Alpha's attitude towards one of the most controversial debates in the…

  14. Factors Affecting Coefficient Alpha: A Mini Monte Carlo Study.

    ERIC Educational Resources Information Center

    Reinhardt, Brian M.

    Factors affecting a lower-bound estimate of internal consistency reliability, Cronbach's coefficient alpha, are explored. Theoretically, coefficient alpha is an estimate of the correlation between two tests drawn at random from a pool of items like the items in the test under consideration. As a practical matter, coefficient alpha can be an index…

  15. Protonation of acyllithium reagents by dichloromethane and dichloroarylmethane. A new method for the synthesis of {alpha},{alpha}-dichloro alcohols

    SciTech Connect

    Kabalka, G.W.; Li, N.S.; Yu, S.

    1995-04-01

    The first example of the protonation of acylithium reagents by dichloromethane and dichloroarylmethane is described. The reaction affords the corresponding {alpha},{alpha}-dichloro alcohols in excellent yields. 23 refs., 1 tab.

  16. Immunohistochemical demonstration of alpha 1-antichymotrypsin and alpha 1-antitrypsin in salivary gland pleomorphic adenomas of children.

    PubMed

    Takahashi, H; Fujita, S; Tsuda, N; Tezuka, F; Okabe, H

    1990-09-01

    Twenty-five benign pleomorphic adenomas of salivary glands in children were studied with immunohistochemical techniques in order to characterize the cell types comprising the epithelial and so-called "mesenchymal" regions of the tumors. The antisera against alpha 1-antichymotrypsin (alpha 1-ACT) and alpha 1-antitrypsin (alpha 1-AT) were used to stain in normal salivary gland tissue as well as in pleomorphic adenoma. In normal salivary glands, alpha 1-ACT was localized to the intercalated duct and serous acinar cells. On the other hand, there was positive staining for alpha 1-AT in the intercalated and striated duct cells. Twenty-five cases (100%) of pleomorphic adenomas in children displayed positivity to alpha 1-ACT staining and 22 cases (88%) showed a positive staining for alpha 1-AT. alpha 1-ACT staining was particularly intense in chondrocyte-like cells of 20 cases (80%), in inner tubular cells of 16 (64%) and cyst-lining cells of 12 (52%). The limited number of tumor cells which were called plasmatoid or hyaline cells and squamous epithelial cells, were positive for alpha 1-ACT. None of the outer tubular cells and hyalinous material was positively stained for alpha 1-ACT. A strong positive reaction for alpha 1-AT was observed in chondrocyte-like cells of 15 cases (60%). Inner tubular cells were positive for alpha 1-AT in 12 cases (48%), plasmatoid or hyaline cells in 10 (40%) and cyst-lining cells in 8 (35%). Squamous epithelial cells, clear cells, secretory product and hyalinous material were positive for alpha 1-AT in some cases. Chondroid matrix and myxoid stroma had no reaction with both antibodies. The biological role of alpha 1-ACT and alpha 1-AT with a wide immunohistochemical distribution in pleomorphic adenomas of children may be associated with a self regulating mechanism which inhibits degradation by tissue proteinases.

  17. The Ups and Downs of Alpha Centauri

    NASA Astrophysics Data System (ADS)

    Ayres, Thomas

    2014-11-01

    Nearby Alpha Centauri is destined for a pivotal chapter in human history, as first stop of future starfarers from Earth: 3x closer than the next nearest star; three very different objects to visit -- Alpha Cen A (G2V), B (K1V), and C (M6V); and B hosts an Earth-mass companion, albeit in a hot, lifeless orbit. For its part, Chandra has been keeping intent watch on the high-energy starspot cycles of AB, with semi-annual pointings over the past decade. Only HRC-I can separate AB as they plunge toward a close approach of 4" in 2016; and LETGS has countered that an abrupt 50x drop in XMM count rate of sun-like A in early 2005, ominously reported as the "darkening of the solar twin," simply is a soft sensitivity issue, not an unprecedented, inexplicable case of corona interrupta.

  18. Low Alpha Experiments at the ALS

    SciTech Connect

    Robin, D.; Alvis, R.; Jackson, A.; Holtzapple, R.; Podobedov, B.

    1996-04-01

    We present a modified, low alpha lattice for the Advanced Light Source where the quadrupole field strengths have been detuned to allow the momentum compaction factor to be varied smoothly from positive to negative values. With this low alpha lattice we decrease the momentum compaction factor by a factor of 5, to 0.0003 over normal operation, resulting in a measured bunch length reduction by a factor of 2. We also measure the size of the second-order momentum compaction factor as well as store beam in a negative momentum compaction lattice. Streak camera measurements at positive and negative momentum compaction operation show longitudinal beam profile distributions that are in agreement with simulations by Fang {ital et} {ital al}. (8). {copyright} {ital 1996 American Institute of Physics.}

  19. Low alpha experiments at the ALS

    SciTech Connect

    Robin, D.; Alvis, R.; Jackson, A.; Holtzapple, R.; Podobedov, B.

    1995-08-01

    The authors present a modified, low alpha lattice for the Advanced Light Source where the quadrupole field strengths have been detuned to allow the momentum compaction factor to be varied smoothly from positive to negative values. With this low alpha lattice the authors decrease the momentum compaction factor by a factor of 5 to 0.0003 over normal operation resulting in a measured bunch length reduction of 2. They also measure the size the second order momentum compaction factor as well as store beam in a negative momentum compaction lattice. Streak camera measurements at positive and negative momentum compaction operation show longitudinal beam profile distributions that are in agreement with simulations by Fang et al.

  20. Project Longshot: A mission to Alpha Centauri

    NASA Technical Reports Server (NTRS)

    West, Curtis; Chamberlain, Sally; Pagan, Neftali; Stevens, Robert

    1989-01-01

    Project Longshot, an exercise in the Advanced Design Program for Space, had as its destination Alpha Centauri, the closest star system to our own solar system. Alpha Centauri, a trinary star system, is 4.34 light years from earth. Although Project Longshot is impossible based on existing technologies, areas that require further investigation in order to make this feat possible are identified. Three areas where advances in technology are needed are propulsion, data processing for autonomous command and control functions, and reliability. Propulsion, possibly by antimatter annihilation; navigation and navigation aids; reliable hardware and instruments; artificial intelligence to eliminate the need for command telemetry; laser communication; and a reliable, compact, and lightweight power system that converts energy efficiently and reliably present major challenges. Project Longshot promises exciting advances in science and technology and new information concerning the universe.

  1. Alpha-induced reactions in iridium

    SciTech Connect

    Bhardwaj, M.K.; Rizvi, I.A.; Chaubey, A.K. )

    1992-05-01

    The excitation function of ({alpha},{ital xn}) reactions on {sup 191}Ir (abundance 37.3%) and on {sup 193}Ir (abundance 62.7%) has been measured for the 17--55 MeV alpha-particle bombarding energy range. The stacked foil activation technique and {gamma}-ray spectroscopy were used to determine the cross sections. The experimental data were compared with calculated values obtained by means of a geometry-dependent hybrid model. The initial exciton number {ital n}{sub 0}=4 with {ital n}=2, {ital p}=2, and {ital h}=0 gives the best agreements with the presently measured results. To calculate the excitation function theoretically a computer code was used. This set of excitation functions provides a data basis for probing the validity of combined equilibrium and preequilibrium reaction models in a considerable energy range.

  2. Automatically processed alpha-track radon monitor

    DOEpatents

    Langner, Jr., G. Harold

    1993-01-01

    An automatically processed alpha-track radon monitor is provided which includes a housing having an aperture allowing radon entry, and a filter that excludes the entry of radon daughters into the housing. A flexible track registration material is located within the housing that records alpha-particle emissions from the decay of radon and radon daughters inside the housing. The flexible track registration material is capable of being spliced such that the registration material from a plurality of monitors can be spliced into a single strip to facilitate automatic processing of the registration material from the plurality of monitors. A process for the automatic counting of radon registered by a radon monitor is also provided.

  3. Automatically processed alpha-track radon monitor

    DOEpatents

    Langner, G.H. Jr.

    1993-01-12

    An automatically processed alpha-track radon monitor is provided which includes a housing having an aperture allowing radon entry, and a filter that excludes the entry of radon daughters into the housing. A flexible track registration material is located within the housing that records alpha-particle emissions from the decay of radon and radon daughters inside the housing. The flexible track registration material is capable of being spliced such that the registration material from a plurality of monitors can be spliced into a single strip to facilitate automatic processing of the registration material from the plurality of monitors. A process for the automatic counting of radon registered by a radon monitor is also provided.

  4. Alternate Alpha Induced Reactions for NIF Radiochemistry

    SciTech Connect

    Shaughnessy, D A; Moody, K J; Bernstein, L A

    2010-02-26

    Radiochemical analysis of NIF capsule residues has been identified as a potential diagnostic of NIF capsule performance. In particular, alpha-induced nuclear reactions that occur on tracer elements added to the NIF capsule have been shown through simulation to be a very sensitive diagnostic for mix. The short range of the alpha particles makes them representative of the hot spot where they are created through the fusion of deuterium and tritium. Reactions on elements doped into the innermost part of the capsule ablator would therefore be sensitive to material that had mixed into the hot spot. Radiochemical determinations of activated detector elements may perhaps be the only true measure of mix that occurs in a NIF capsule, particularly in cases when the capsule fails.

  5. Optical conductivity of alpha-Mn

    NASA Technical Reports Server (NTRS)

    Scoles, K. J.; Christy, R. W.

    1982-01-01

    The optical constants were measured at room temperature in the photon-energy range 0.6-6.5 eV on evaporated thin films. Evaporation conditions were chosen that gave the alpha-Mn crystal structure with relatively large grains. The optical conductivity was separated into intraband and interband contributions by fitting to the Drude formula at low energies. The results are anomalous in comparison to other 3d transition metals: the free-electron lifetime is exceptionally short (in agreement with the large dc resistivity of Mn), and the interband transitions seem unusually weak at the lower energies. Possible explanations related to the complicated crystal structure of alpha-Mn with its loss of point symmetry at the atom sites are discussed.

  6. Optical conductivity of alpha-Mn

    NASA Technical Reports Server (NTRS)

    Scoles, K. J.; Christy, R. W.

    1982-01-01

    The optical constants were measured at room temperature in the photon-energy range 0.6 to 6.5 eV on evaporated thin films. Evaporation conditions were chosen that gave the alpha-Mn crystal structure with reasonably large grains. The optical conductivity was separated into intraband and interband contributions by fitting to the Drude formula at low energies. The results are anomalous in comparison to other 3d transition metals. The free-electron lifetime is exceptionally sort (in agreement with the large dc resistivity of Mn), and the interband transitions seem unusually weak at the lower energies. Possible explanations related to the complicated crystal structure of alpha-Mn are discussed.

  7. Thrombolysis by thienopyridines and their congeners.

    PubMed

    Gryglewski, R J; Dupin, J P; Uracz, W; Swiês, J; Madej, J; Hou, G; Gravier, D; Casadebaig, F

    2000-12-01

    We propose that anti-platelet thienopyridines, such as ticlopidine or clopidogrel, are thrombolytic owing to endothelial release of prostacyclin (PGI2) and tissue plasminogen activator (t-PA). In this study we used anaesthetised Wistar rats with extracorporal circulation in which arterial blood superfused thrombi which adhered to a strip of collagen. Weight of thrombi was continuously monitored. When administered intravenously, clopidogrel or its R enantiomer deprived of anti-platelet action, both at doses of 3 mg x kg(-1), produced lost in weight of thrombi by 14.1 +/- 1.3% or 16.0 +/- 1.4% (n = 9), and at doses 10 mg x kg(-1) by 28.3 +/- 2.3% or 30.4 +/- 1.9% (n = 8), respectively. Maximum of thrombolysis occurred 30-45 min following the drug administration. Ticlopidine at a dose of 30 mg x kg(-1) reduced weight of thrombi by 33.7 +/- 1.7% (n = 32). Thrombolytic action of ticlopidine was accompanied by a rise in 6!keto-PGF1alpha blood levels from 0.42 +/- 0.10 to 1.58 +/- 0.29 ng x ml(-1) and t-PA antigen plasma levels from 4.70 +/- 1.00 to 12.90 +/- 1.15 ng x ml(-1) (n = 7). Five out of eleven tested thienopyridine congeners with pyrimidine or pyrimidinone instead of pyridine rings had thrombolytic potencies similar to that of clopidogrel (ED30s at a range of 6.2-11.4 mg x kg(-1)). A substantial increase in thrombolytic potency (ED30s at a range of 0.3-2.1 mg x kg(-1)) was observed for congeners in which thienyl ring was condensed with an additional cyclopentyl, cyclohexyl or cycloheptyl structures or in which thienopyridine complex was replaced for a pyridopyrimidine one. We claim that thienopyridines, independently of their delayed anti-platelet action, do produce immediate thrombolysis in vivo. This new activity emulates capacity of their native, non-metabolised molecules to release prostacyclin and tissue plasminogen activator. We have also shown that structural changes in molecules of thienopyridines may intensify their thrombolytic potency.

  8. Radiation-induced changes in the profile of spinal cord serotonin, prostaglandin synthesis, and vascular permeability

    SciTech Connect

    Siegal, T.; Pfeffer, M.R.

    1995-01-01

    To investigate the profile of biochemical and physiological changes induced in the rat spinal cord by radiation, over a period of 8 months. The thoraco-lumbar spinal cords of Fisher rats were irradiated to a dose of 15 Gy. The rats were then followed and killed at various times afterward. Serotonin (5-HT) and its major metabolite 5-hydroxyindole-3-acetic acid (5-HIAA) were assayed as well as prostaglandin synthesis. Microvessel permeability was assessed by quantitative evaluation of Evans blue dye extravasation. None of the rats developed neurologic dysfunction, and histologic examination revealed only occasional gliosis in the ventral white matter at 240 days after irradiation. Serotonin levels were unchanged at 2, 14, and 56 days after radiation but increased at 120 and 240 days in the irradiated cord segments when compared to both the nonirradiated thoracic and cervical segments (p < 0.01) and age-matched controls (p < 0.03). The calculated utilization ratio of serotonin (5-HIAA/5-HT) remained unchanged. Immediately after radiation (at 3 and 24 h) an abrupt but brief increase in the synthesis of prostaglandin-E{sub 2} (PGE{sub 2}), thromboxane (TXB{sub 2}), and prostacyclin [6 keto-PGF1{alpha} (6KPGF)] was noted, which returned to normal at 3 days. This was followed after 7 and 14 days by a significant fall off in synthesis of all three prostaglandins. Thereafter, at 28, 56, 120, and 240 days, escalated production of thromboxane followed, white prostacyclin synthesis remained markedly reduced (-88% of control level at 240 days). Up to 7 days after radiation the calculated TXB{sub 2}/6KPGF ratio remained balanced, regardless of the observed abrupt early fluctuations in their rate of synthesis. Later, between 7 and 240 days after radiation, a significant imbalance was present which became more pronounced over time. In the first 24 h after radiation, a 104% increase in microvessel permeability was observed which returned to normal by 3 days. 57 refs., 3 figs.

  9. Preclinical pharmacology of robenacoxib: a novel selective inhibitor of cyclooxygenase-2.

    PubMed

    King, J N; Dawson, J; Esser, R E; Fujimoto, R; Kimble, E F; Maniara, W; Marshall, P J; O'Byrne, L; Quadros, E; Toutain, P L; Lees, P

    2009-02-01

    This manuscript reports the results of preclinical studies in the rat with robenacoxib, a novel selective cyclooxygenase (COX)-2 inhibitor. Robenacoxib selectively inhibited COX-2 in vitro as evidenced from COX-1:COX-2 IC50 ratios of 27:1 in purified enzyme preparations and >967:1 in isolated cell assays. Binding to COX-1 was rapid and readily reversible (dissociation t(1/2) < 1 min), whilst COX-2 binding was slowly reversible (t(1/2) = 25 min). In vivo, robenacoxib inhibited PGE2 production (an index of COX-2 inhibition) in lipopolysaccharide (LPS)-stimulated air pouches (ID50 0.3 mg/kg) and for at least 24 h in zymosan-induced inflammatory exudate (at 2 mg/kg). Robenacoxib was COX-1 sparing, as it inhibited serum TxB2 synthesis ex vivo (an index of COX-1 inhibition) only at very high doses (100 mg/kg but not at 2-30 mg/kg). Robenacoxib inhibited carrageenan-induced paw oedema (ID50 0.40-0.48 mg/kg), LPS-induced fever (ID50 1.1 mg/kg) and Randall-Selitto pain (10 mg/kg). Robenacoxib was highly bound to plasma protein (99.9% at 50 ng/mL in vitro). After intravenous dosing, clearance was 2.4 mL/min/kg and volume of distribution at steady-state was 306 mL/kg. Robenacoxib was preferentially distributed into inflammatory exudate; the AUC for exudate was 2.9 times higher than for blood and the MRT in exudate (15.9 h) was three times longer than in blood (5.3 h). Robenacoxib produced significantly less gastric ulceration and intestinal permeability as compared with the reference nonsteroidal anti-inflammatory drug (NSAID), diclofenac, and did not inhibit PGE2 or 6-keto PGF(1alpha) concentrations in the stomach and ileum at 30 mg/kg. Robenacoxib also had no relevant effects on kidney function at 30 mg/kg. In summary, results of preclinical studies in rats studies suggest that robenacoxib has an attractive pharmacological profile for potential use in the intended target species, cats and dogs.

  10. 8-NH2-boldine, an antagonist of alpha1A and alpha1B adrenoceptors without affinity for the alpha1D subtype: structural requirements for aporphines at alpha1-adrenoceptor subtypes.

    PubMed

    Ivorra, M Dolores; Valiente, Miguel; Martínez, Sonia; Madrero, Yolanda; Noguera, M Antonia; Cassels, Bruce K; Sobarzo, Eduardo M; D'Ocon, Pilar

    2005-10-01

    Structure-activity analysis of 21 aporphine derivatives was performed by examining their affinities for cloned human alpha (1A), alpha (1B) and alpha (1D) adrenoceptors (AR) using membranes prepared from rat-1 fibroblasts stably expressing each alpha (1)-AR subtype. All the compounds tested competed for [ (125)I]-HEAT binding with steep and monophasic curves. The most interesting compound was 8-NH (2)-boldine, which retains the selective affinity for alpha(1A)-AR (pKi = 6.37 +/- 0.21) vs. alpha(1B)-AR (pKi = 5.53 +/- 0.11) exhibited by 1,2,9,10-tetraoxygenated aporphines, but shows low affinity for alpha(1D)-AR (pKi < 2.5). Binding studies on native adrenoceptors present in rat cerebral cortex confirms the results obtained for human cloned alpha (1)-AR subtypes. The compounds selective for the alpha (1A) subtype discriminate two binding sites in rat cerebral cortex confirming a mixed population of alpha (1A)- and alpha (1B)-AR in this tissue. All compounds are more selective as inhibitors of [ (3)H]-prazosin binding than of [ (3)H]-diltiazem binding to rat cerebral cortical membranes. A close relationship was found between affinities obtained for cloned alpha (1A)-AR and inhibitory potencies on noradrenaline-induced contraction or inositol phosphate accumulation in tail artery, confirming that there is a homogeneous functional population of alpha(1A)-AR in this vessel. On the contrary, a poor correlation seems to exist between the affinity of 8-NH (2)-boldine for cloned alpha (1D)-AR and its potency as an inhibitor of noradrenaline-induced contraction or inositol phosphate accumulation in rat aorta, which confirms that a heterogeneous population of alpha (1)-AR mediates the adrenergic response in this vessel.

  11. Tumour necrosis factor-alpha (TNF-alpha) in patients who have asbestosis and develop cancer.

    PubMed Central

    Partanen, R; Koskinen, H; Hemminki, K

    1995-01-01

    OBJECTIVES--Concentrations of tumour necrosis factor-alpha (TNF-alpha) were assayed by radioimmunoassay in serum samples collected between 1981 and 1987 from 111 patients with asbestosis who were at a high risk of cancer. Follow up of these patients until 1993 showed that 38 had developed cancer (27 lung, three mesotheliomas, and eight diverse malignancies). RESULTS--The mean serum concentrations of TNF-alpha given in fmol/100 microliters serum in all the cases with cancer (14.1) and the cases with lung cancer (13.6) were significantly higher (P < 0.05) than the mean concentrations in the exposed controls (10.5). A positive increase was considered to be any value that was > 2 SDs above the mean of the exposed controls. 22% (six of 27) of the cases with lung cancer were positive compared with 4% (three of 73) of the exposed controls, a significant difference (P < 0.001). The serum concentrations of TNF-alpha correlated moderately with cancer (r = 0.3), lung cancer (r = 0.3), and Neu oncoproteins and epidermal growth factor receptor (EGFR) (r = 0.3, 0.5 respectively). Also, there was a significant correlation between development of cancer and severity or progression of asbestosis. There was no correlation between the concentrations of TNF-alpha and severity or progression of asbestosis. CONCLUSIONS--These results showed high concentrations of TNF-alpha in the patients who had cancer. TNF-alpha may offer an auxiliary method in early diagnosis of cancers related to asbestosis. PMID:7795753

  12. Proceedings, High-Precision $\\alpha_s$ Measurements from LHC to FCC-ee

    SciTech Connect

    d'Enterria, David; Skands, Peter Z.

    2015-01-01

    This document provides a writeup of all contributions to the workshop on "High precision measurements of $\\alpha_s$: From LHC to FCC-ee" held at CERN, Oct. 12--13, 2015. The workshop explored in depth the latest developments on the determination of the QCD coupling $\\alpha_s$ from 15 methods where high precision measurements are (or will be) available. Those include low-energy observables: (i) lattice QCD, (ii) pion decay factor, (iii) quarkonia and (iv) $\\tau$ decays, (v) soft parton-to-hadron fragmentation functions, as well as high-energy observables: (vi) global fits of parton distribution functions, (vii) hard parton-to-hadron fragmentation functions, (viii) jets in $e^\\pm$p DIS and $\\gamma$-p photoproduction, (ix) photon structure function in $\\gamma$-$\\gamma$, (x) event shapes and (xi) jet cross sections in $e^+e^-$ collisions, (xii) W boson and (xiii) Z boson decays, and (xiv) jets and (xv) top-quark cross sections in proton-(anti)proton collisions. The current status of the theoretical and experimental uncertainties associated to each extraction method, the improvements expected from LHC data in the coming years, and future perspectives achievable in $e^+e^-$ collisions at the Future Circular Collider (FCC-ee) with $\\cal{O}$(1--100 ab$^{-1}$) integrated luminosities yielding 10$^{12}$ Z bosons and jets, and 10$^{8}$ W bosons and $\\tau$ leptons, are thoroughly reviewed. The current uncertainty of the (preliminary) 2015 strong coupling world-average value, $\\alpha_s(m_Z)$ = 0.1177 $\\pm$ 0.0013, is about 1\\%. Some participants believed this may be reduced by a factor of three in the near future by including novel high-precision observables, although this opinion was not universally shared. At the FCC-ee facility, a factor of ten reduction in the $\\alpha_s$ uncertainty should be possible, mostly thanks to the huge Z and W data samples available.

  13. Characterization of the bovine C alpha gene.

    PubMed Central

    Brown, W R; Rabbani, H; Butler, J E; Hammarström, L

    1997-01-01

    The complete genomic sequence of a bovine C alpha gene is reported here. The genomic sequence was obtained from a C alpha phage clone that had been cloned from a genomic EMBL4 phage vector library. The C alpha sequence had previously been expressed as a chimeric antibody and identified as IgA using IgA-specific antibodies. Intron/exon boundaries were determined by comparison of the genomic sequence with an expressed bovine C alpha sequence obtained from spleen by reverse transcription-polymerase chain reaction (RT-PCR). Analysis of 50 Swedish bovine genomic DNA samples using genomic blots and five different restriction enzymes failed to detect evidence of polymorphism. However, PstI digests of Brown Swiss DNA showed a restriction fragment length polymorphism (RFLP), suggesting that at least two allelic variants of bovine IgA exist. Comparison of the deduced amino acid sequence of bovine IgA with sequences available for other species indicated that the highest homology was with that of swine, another artiodactyl. This was the highest homology observed for all mammalian IgA compared except for that between IgA1 and IgA2 in humans. Bovine IgA shares with rabbit IgA3 and IgA4, an additional N-linked glycosylation site at position 282. However, the collective data indicate that cattle are like swine and rodents and unlike rabbits in having a single locus of the gene encoding IgA of this species. Images Figure 4 PMID:9203958

  14. First Attempts at Antihydrogen Trapping in ALPHA

    SciTech Connect

    Andresen, G. B.; Bowe, P. D.; Hangst, J. S.; Bertsche, W.; Butler, E.; Charlton, M.; Humphries, A. J.; Jenkins, M. J.; Joergensen, L. V.; Madsen, N.; Werf, D. P. van der; Bray, C. C.; Chapman, S.; Fajans, J.; Povilus, A.; Wurtele, J. S.; Cesar, C. L.; Lambo, R.; Silveira, D. M.; Fujiwara, M. C.

    2008-08-08

    The ALPHA apparatus is designed to produce and trap antihydrogen atoms. The device comprises a multifunction Penning trap and a superconducting, neutral atom trap having a minimum-B configuration. The atom trap features an octupole magnet for transverse confinement and solenoidal mirror coils for longitudinal confinement. The magnetic trap employs a fast shutdown system to maximize the probability of detecting the annihilation of released antihydrogen. In this article we describe the first attempts to observe antihydrogen trapping.

  15. First Attempts at Antihydrogen Trapping in ALPHA

    NASA Astrophysics Data System (ADS)

    Andresen, G. B.; Bertsche, W.; Bowe, P. D.; Bray, C. C.; Butler, E.; Cesar, C. L.; Chapman, S.; Charlton, M.; Fajans, J.; Fujiwara, M. C.; Funakoshi, R.; Gill, D. R.; Hangst, J. S.; Hardy, W. N.; Hayano, R. S.; Hayden, M. E.; Humphries, A. J.; Hydomako, R.; Jenkins, M. J.; Jørgensen, L. V.; Kurchaninov, L.; Lambo, R.; Madsen, N.; Nolan, P.; Olchanski, K.; Olin, A.; Page, R. D.; Povilus, A.; Pusa, P.; Robicheaux, F.; Sarid, E.; El Nasr, S. Seif; Silveira, D. M.; Storey, J. W.; Thompson, R. I.; van der Werf, D. P.; Wurtele, J. S.; Yamazaki, Y.

    2008-08-01

    The ALPHA apparatus is designed to produce and trap antihydrogen atoms. The device comprises a multifunction Penning trap and a superconducting, neutral atom trap having a minimum-B configuration. The atom trap features an octupole magnet for transverse confinement and solenoidal mirror coils for longitudinal confinement. The magnetic trap employs a fast shutdown system to maximize the probability of detecting the annihilation of released antihydrogen. In this article we describe the first attempts to observe antihydrogen trapping.

  16. Diamond detector for alpha-particle spectrometry.

    PubMed

    Dueñas, J A; de la Torre Pérez, J; Martín Sánchez, A; Martel, I

    2014-08-01

    An artificially grown high purity diamond was used as a detector for alpha-particle spectrometry. Diamond detectors can match the performance of silicon detectors employed in standard continuous air monitoring systems. Its radiation hardness and electronic properties make them ideal to work under extreme condition such as high temperature and ambient lights. A 50 μm thickness single-crystal diamond detector has been compared with a 300 μm passivated implanted planar silicon detector, under ambient conditions.

  17. Fourth High Alpha Conference, volume 2

    NASA Technical Reports Server (NTRS)

    1994-01-01

    The goal of the Fourth High Alpha Conference, held at the NASA Dryden Flight Research Center on July 12-14, 1994, was to focus on the flight validation of high angle of attack technologies and provide an in-depth review of the latest high angle of attack activities. Areas that were covered include high angle of attack aerodynamics, propulsion and inlet dynamics, thrust vectoring, control laws and handling qualities, and tactical utility.

  18. Fourth High Alpha Conference, volume 1

    NASA Technical Reports Server (NTRS)

    1994-01-01

    The goal of the Fourth High Alpha Conference was to focus on the flight validation of high angle-of-attack technologies and provide an in-depth review of the latest high angle-of-attack activities. Areas that were covered include: high angle-of-attack aerodynamics, propulsion and inlet dynamics, thrust vectoring, control laws and handling qualities, tactical utility, and forebody controls.

  19. [Alpha 2-antiplasmin in bovine plasma].

    PubMed

    Piliavskaia, A S; Panchenko, N E

    1985-01-01

    Bovine and human blood plasma contains alpha 2-antiplasmin which possesses affinity to lysin-binding sites in plasmin and inhibits the human plasmin. Its isolation was conducted for two stages: separation of plasminogen on lysin-cellulose, fractionation by ammonium sulphate, desalination on molselector G-25, chromatography on DEAE-Sephadex A-50 and affinity chromatography on plasmin-sepharose with the blocked active site.

  20. Lyman Alpha Photochemistry in the Solar Nebula

    NASA Technical Reports Server (NTRS)

    Fegley, Bruce, Jr.

    1997-01-01

    The purpose of the project "Lyman Alpha Photochemistry in the Solar Nebula" was to model photochemistry in the primitive solar nebula and the early solar systems. As part of the modeling, it was necessary to model the composition of the gas and dust accreted by the solar nebula. This final report contains a list of publications where the results of this project have been published.

  1. High resolution alpha particle spectrometry through collimation

    NASA Astrophysics Data System (ADS)

    Park, Seunghoon; Kwak, Sung-Woo; Kang, Han-Byeol

    2015-06-01

    Alpha particle spectrometry with collimation is a useful method for identifying nuclear materials among various nuclides. A mesh type collimator reduces the low energy tail and broadened energy distribution by cutting off particles with a low incidence angle. The relation between the resolution and the counting efficiency can be investigated by changing a ratio of the mesh hole diameter and the collimator thickness. Through collimation, a target particle can be distinguished by a PIPS® detector under a mixture of various nuclides.

  2. Screening alpha-glucosidase and alpha-amylase inhibitors from natural compounds by molecular docking in silico.

    PubMed

    Jhong, Chien-Hung; Riyaphan, Jirawat; Lin, Shih-Hung; Chia, Yi-Chen; Weng, Ching-Feng

    2015-01-01

    The alpha-glucosidase inhibitor is a common oral anti-diabetic drug used for controlling carbohydrates normally converted into simple sugars and absorbed by the intestines. However, some adverse clinical effects have been observed. The present study seeks an alternative drug that can regulate the hyperglycemia by down-regulating alpha-glucosidase and alpha-amylase activity by molecular docking approach to screen the hyperglycemia antagonist against alpha-glucosidase and alpha-amylase activities from the 47 natural compounds. The docking data showed that Curcumin, 16-hydroxy-cleroda-3,13-dine-16,15-olide (16-H), Docosanol, Tetracosanol, Antroquinonol, Berberine, Catechin, Quercetin, Actinodaphnine, and Rutin from 47 natural compounds had binding ability towards alpha-amylase and alpha-glucosidase as well. Curcumin had a better biding ability of alpha-amylase than the other natural compounds. Analyzed alpha-glucosidase activity reveals natural compound inhibitors (below 0.5 mM) are Curcumin, Actinodaphnine, 16-H, Quercetin, Berberine, and Catechin when compared to the commercial drug Acarbose (3 mM). A natural compound with alpha-amylase inhibitors (below 0.5 mM) includes Curcumin, Berberine, Docosanol, 16-H, Actinodaphnine/Tetracosanol, Catechin, and Quercetin when compared to Acarbose (1 mM). When taken together, the implication is that molecular docking is a fast and effective way to screen alpha-glucosidase and alpha-amylase inhibitors as lead compounds of natural sources isolated from medicinal plants.

  3. Fasting induces basolateral uptake transporters of the SLC family in the liver via HNF4alpha and PGC1alpha.

    PubMed

    Dietrich, Christoph G; Martin, Ina V; Porn, Anne C; Voigt, Sebastian; Gartung, Carsten; Trautwein, Christian; Geier, Andreas

    2007-09-01

    Fasting induces numerous adaptive changes in metabolism by several central signaling pathways, the most important represented by the HNF4alpha/PGC-1alpha-pathway. Because HNF4alpha has been identified as central regulator of basolateral bile acid transporters and a previous study reports increased basolateral bile acid uptake into the liver during fasting, we hypothesized that HNF4alpha is involved in fasting-induced bile acid uptake via upregulation of basolateral bile acid transporters. In rats, mRNA of Ntcp, Oatp1, and Oatp2 were significantly increased after 48 h of fasting. Protein expression as determined by Western blot showed significant increases for all three transporters 72 h after the onset of fasting. Whereas binding activity of HNF1alpha in electrophoretic mobility shift assays remained unchanged, HNF4alpha binding activity to the Ntcp promoter was increased significantly. In line with this result, we found significantly increased mRNA expression of HNF4alpha and PGC-1alpha. Functional studies in HepG2 cells revealed an increased endogenous NTCP mRNA expression upon cotransfection with either HNF4alpha, PGC-1alpha, or a combination of both. We conclude that upregulation of the basolateral bile acid transporters Ntcp, Oatp1, and Oatp2 in fasted rats is mediated via the HNF4alpha/PGC-1alpha pathway. PMID:17640976

  4. Fasting induces basolateral uptake transporters of the SLC family in the liver via HNF4alpha and PGC1alpha.

    PubMed

    Dietrich, Christoph G; Martin, Ina V; Porn, Anne C; Voigt, Sebastian; Gartung, Carsten; Trautwein, Christian; Geier, Andreas

    2007-09-01

    Fasting induces numerous adaptive changes in metabolism by several central signaling pathways, the most important represented by the HNF4alpha/PGC-1alpha-pathway. Because HNF4alpha has been identified as central regulator of basolateral bile acid transporters and a previous study reports increased basolateral bile acid uptake into the liver during fasting, we hypothesized that HNF4alpha is involved in fasting-induced bile acid uptake via upregulation of basolateral bile acid transporters. In rats, mRNA of Ntcp, Oatp1, and Oatp2 were significantly increased after 48 h of fasting. Protein expression as determined by Western blot showed significant increases for all three transporters 72 h after the onset of fasting. Whereas binding activity of HNF1alpha in electrophoretic mobility shift assays remained unchanged, HNF4alpha binding activity to the Ntcp promoter was increased significantly. In line with this result, we found significantly increased mRNA expression of HNF4alpha and PGC-1alpha. Functional studies in HepG2 cells revealed an increased endogenous NTCP mRNA expression upon cotransfection with either HNF4alpha, PGC-1alpha, or a combination of both. We conclude that upregulation of the basolateral bile acid transporters Ntcp, Oatp1, and Oatp2 in fasted rats is mediated via the HNF4alpha/PGC-1alpha pathway.

  5. Lyman Alpha Mapping Project (LAMP) Brightness Maps

    NASA Astrophysics Data System (ADS)

    Retherford, Kurt D.; Gladstone, G.; Stern, S.; Egan, A. F.; Miles, P. F.; Parker, J. W.; Greathouse, T. K.; Davis, M. W.; Slater, D. C.; Kaufmann, D. E.; Versteeg, M. H.; Feldman, P. D.; Hurley, D. M.; Pryor, W. R.; Hendrix, A. R.

    2010-10-01

    The Lyman Alpha Mapping Project (LAMP) is an ultraviolet (UV) spectrograph on the Lunar Reconnaissance Orbiter (LRO) that is designed to map the lunar albedo at far-UV wavelengths. LAMP primarily measures interplanetary Hydrogen Lyman-alpha sky-glow and far-UV starlight reflected from the night-side lunar surface, including permanently shadowed regions (PSRs) near the poles. Dayside observations are also obtained. Brightness maps sorted by wavelength (including the Lyman-alpha wavelength of 121.6 nm) are reported for the polar regions, with a few regions of interest reported in more detail. LAMP's spectral range of 58 nm to 196 nm includes a water ice spectral feature near 160 nm, which provides a diagnostic tool for detecting water on the lunar surface that is complementary to recent discoveries using infrared and radio frequency techniques. Progress towards producing far-UV albedo maps and searching for water ice signatures will be reported. We'll discuss how LAMP data may address questions regarding how water is formed on the moon, transported through the lunar atmosphere, and deposited in the PSRs.

  6. ALPHA, Mass Generation and Quantum Information

    NASA Astrophysics Data System (ADS)

    Goradia, Shantilal

    2008-05-01

    The generation of Planck energy 10E19 Gev/Planck time during the observable age of the universe (10E60 Planck times) would generate 10E79 Gev. 10E79 Gev approximates the energy of the baryon number, implying an increase of the baryon number by 10E19/Planck time. What is the source of energy for this mass generation? The ALPHA implicated as negative entropy in [1] must create vacuum energy. Vacuum energy is negative energy. Nature must balance negative energy by generating positive energy (mass), implying ALPHA balances the increasing entropy of the visible universe and generates baryonic mass. Additionally, the successful cloning of the sheep Dolly, and observed molecular blinking dots in biochemistry support the binary BITS of ON and OFF states in [1]. Vindicating Hermite's 1873 mathematical linkage of the base of natural logarithm to transcendentality will implicate natural log based ALPHA in [1] as connected to consciousness. [1] Goradia S: www.arXiv.org/pdf/physics/0210040v3.

  7. Lunar Surface Outgassing and Alpha Particle Measurements

    NASA Astrophysics Data System (ADS)

    Lawson, S. L.; Feldman, W. C.; Lawrence, D. J.; Moore, K. R.; Elphic, R. C.; Maurice, S.; Belian, R. D.; Binder, A. B.

    2002-01-01

    The Lunar Prospector Alpha Particle Spectrometer (LP APS) searched for lunar surface gas release events and mapped their distribution by detecting alpha particles produced by the decay of gaseous radon-222 (5.5 MeV, 3.8 day half-life), solid polonium-218 (6.0 MeV, 3 minute half-life), and solid polonium-210 (5.3 MeV, 138 day half-life, but held up in production by the 21 year half-life of lead-210). These three nuclides are radioactive daughters from the decay of uranium-238. Radon reaches the lunar surface either at areas of high soil porosity or where fissures release the trapped gases in which radon is entrained. Once released, the radon spreads out by "bouncing" across the surface on ballistic trajectories in a randomwalk process. The half-life of radon-222 allows the gas to spread out by several 100 km before it decays (depositing approximately half of the polonium-218 recoil nuclides on the lunar surface) and allows the APS to detect gas release events up to several days after they occur. The long residence time of the lead-210 precursor to polonium-210 allows the mapping of gas vents which have been active over the last approximately 60 years. Because radon and polonium are daughter products of the decay of uranium, the background level of alpha particle activity is a function of the lunar crustal uranium distribution.

  8. The Alpha Dynamo Effects in Laboratory Plasmas

    SciTech Connect

    Hantao Ji; Stewart C. Prager

    2001-10-16

    A concise review of observations of the alpha dynamo effect in laboratory plasmas is given. Unlike many astrophysical systems, the laboratory pinch plasmas are driven magnetically. When the system is overdriven, the resultant instabilities cause magnetic and flow fields to fluctuate, and their correlation induces electromotive forces along the mean magnetic field. This alpha-effect drives mean parallel electric current, which, in turn, modifies the initial background mean magnetic structure towards the stable regime. This drive-and-relax cycle, or the so-called self-organization process, happens in magnetized plasmas in a timescale much shorter than resistive diffusion time, thus it is a fast and unquenched dynamo process. The observed alpha-effect redistributes magnetic helicity (a measure of twistedness and knottedness of magnetic field lines) but conserves its total value. It can be shown that fast and unquenched dynamos are natural consequences of a driven system where fluctuations are statistically either not stationary in time or not homogeneous in space, or both. Implications to astrophysical phenomena will be discussed.

  9. Multimode fiber with z-dependent alpha-value.

    PubMed

    Marcuse, D

    1979-07-01

    The width of the impulse response of multimode fibers with power law index profiles depends on the alpha-value of the power law exponent. For constant alpha, optimum pulse width is achievable only in a very narrow range of values centered around alpha = 2 - (12/5)Delta. We show in this paper that the optimum width of the impulse response is achievable for fibers with nonoptimum alpha-values provided alpha varies slowly along the fiber and deviates on average by equal amounts to either side of its (constant) optimum value.

  10. Alpha Particle Physics Experiments in the Tokamak Fusion Test Reactor

    SciTech Connect

    Budny, R.V.; Darrow, D.S.; Medley, S.S.; Nazikian, R.; Zweben, S.J.; et al.

    1998-12-14

    Alpha particle physics experiments were done on the Tokamak Fusion Test Reactor (TFTR) during its deuterium-tritium (DT) run from 1993-1997. These experiments utilized several new alpha particle diagnostics and hundreds of DT discharges to characterize the alpha particle confinement and wave-particle interactions. In general, the results from the alpha particle diagnostics agreed with the classical single-particle confinement model in magnetohydrodynamic (MHD) quiescent discharges. Also, the observed alpha particle interactions with sawteeth, toroidal Alfvén eigenmodes (TAE), and ion cyclotron resonant frequency (ICRF) waves were roughly consistent with theoretical modeling. This paper reviews what was learned and identifies what remains to be understood.

  11. Giant Resonances in the Alpha-Nucleus Interaction

    SciTech Connect

    Karpeshin, F. F.

    2010-04-30

    Tunneling of alpha particles through the Coulomb barrier for the source {sup 135}Pr nucleus is consecutively considered. The effect of sharp peaks arising in the case of coincidence of the alpha energy with that of a quasistationary state within the barrier is elucidated. Peaks' energy depend on the alpha-nucleus potential. They can give rise to 'anomalous' properties of some neutron resonances. The peaks can also be observed in the incoming alpha-nucleus channel. The method can be applied for solution of the reverse problem of the alpha-nucleus scattering.

  12. Detection of alpha radiation in a beta radiation field

    DOEpatents

    Mohagheghi, Amir H.; Reese, Robert P.

    2001-01-01

    An apparatus and method for detecting alpha particles in the presence of high activities of beta particles utilizing an alpha spectrometer. The apparatus of the present invention utilizes a magnetic field applied around the sample in an alpha spectrometer to deflect the beta particles from the sample prior to reaching the detector, thus permitting detection of low concentrations of alpha particles. In the method of the invention, the strength of magnetic field required to adequately deflect the beta particles and permit alpha particle detection is given by an algorithm that controls the field strength as a function of sample beta energy and the distance of the sample to the detector.

  13. Antihypertensive effect of eicosapentaenoic acid (EPA) on spontaneously hypertensive rats (SHR)

    SciTech Connect

    Lam, B.K.; Quilley, J.; Hirai, A.; Yoshida, S.; Tamura, Y.; Wong, P.Y.K.

    1986-03-05

    EPA ethyl ester (99.8% pure) was administered orally (300 mg/kg/d) to adult (25-wk-old) and young (11 1/2-wk-old) SHR rats for 2 weeks at which time systolic blood pressure (BP), platelet aggregation, glomerular leukotriene (LT)A/sub 4/ hydrolase activity, plasma renin activity (PRA), urinary levels of TxB/sub 2/ and 6-keto-PGF/sub 1..cap alpha../ and aortic conversion of (/sup 14/C)-AA to (/sup 14/C)-6-keto-PGF/sub 1..cap alpha../ were measured. EPA treatment decreased BP of adult SHR with established hypertension from 238.7 +/- 2 to 217 +/- 4 mmHg (M +/- SD, P < 0.001) and retarded the development of hypertension in young SHR rats (178 +/- 6 vs. 218 +/- 4 mmHg in controls, p < 0.001). Platelets showed decreased responsiveness to ADP (3 ..mu..M) and glomerular LTA/sub 4/ hydrolase activity was inhibited. PRA and urinary levels of TxB/sub 2/ and 6-keto-PGF/sub 1..cap alpha../ were not changed. Similarly, there was no change in aortic conversion of (/sup 14/C)-AA to (/sup 14/C)-6-keto-PGF/sub 1..cap alpha../ indicating that EPA treatment does not alter vascular cyclo-oxygenase activity. These results indicate that EPA treatment affects eicosanoid metabolism and cardiovascular function.

  14. Exposure to diesel exhaust upregulates COX-2 expression in ApoE knockout mice

    PubMed Central

    Bai, Ni; Tranfield, Erin M.; Kavanagh, Terrance J.; Kaufman, Joel D.; Rosenfeld, Michael E.; van Eeden, Stephan F.

    2015-01-01

    Introduction We have shown that diesel exhaust (DE) inhalation caused progression of atherosclerosis; however, the mechanisms are not fully understood. We hypothesize that exposure to DE upregulates cyclooxygenase (COX) expression and activity, which could play a role in DE-induced atherosclerosis. Methods ApoE knockout mice (30-week old) fed with regular chow were exposed to DE (at 200 μg/m3 of particulate matter) or filtered air (control) for 7 weeks (6 h/day, 5 days/week). The protein and mRNA expression of COX-1 and COX-2 were evaluated by immunohistochemistry analysis and quantitative real-time PCR, respectively. To examine COX activity, thoracic aortae were mounted in a wire myograph, and phenylephrine (PE)-stimulated vasoconstriction was measured with and without the presence of COX antagonists (indomethacin). COX-2 activity was further assessed by urine 2,3-dinor-6-keto PGF1α level, a major metabolite of prostacyclin I2 (PGI2). Results Immunohistochemistry analysis demonstrates that DE exposure enhanced COX-2 expression in both thoracic aorta (p < 0.01) and aortic root (p < 0.03), with no modification of COX-1 expression. The increased COX-2 expression was positively correlated with smooth muscle cell content in aortic lesions (R2 = 0.4081, p < 0.008). The fractional changes of maximal vasoconstriction in the presence of indomethacin was attenuated by 3-fold after DE exposure (p < 0.02). Urine 2,3-dinor-6-keto PGF1α level was 15-fold higher in DE group than the control (p < 0.007). The mRNA expression of COX-2 (p < 0.006) and PGI synthase (p < 0.02), but not COX-1, was significantly augmented after DE exposure. Conclusion We show that DE inhalation enhanced COX-2 expression, which is also associated with phenotypic changes of aortic lesion. PMID:22746401

  15. Modulation of Inflammatory and Hemostatic Markers in Obstructive Sleep Apnea Patients Treated with Mandibular Advancement Splints: A Parallel, Controlled Trial

    PubMed Central

    Niżankowska-Jędrzejczyk, Agata; Almeida, Fernanda R.; Lowe, Alan A.; Kania, Aleksander; Nastałek, Paweł; Mejza, Filip; Foley, Jonathan H.; Niżankowska-Mogilnicka, Ewa; Undas, Anetta

    2014-01-01

    Study Objective: Obstructive sleep apnea (OSA) is associated with systemic inflammation and a hypercoagulable state. The current study aim was to investigate whether mandibular advancement splint (MAS) therapy affects inflammatory and hemostatic parameters in patients with mild-to-moderate OSA. Methods: Twenty-two patients with mild-to-moderate OSA and 16 control subjects were studied. OSA subjects were treated with a titratable MAS for 6 months. Baseline plasma C-reactive protein, interleukin-1β, interleukin-10, interleukin-6, P-selectin, fibrinogen, D-dimer, plasminogen activator inhibitor-1 (PAI-1), thrombin-antithrombin complex, activated thrombin-activatable fibrinolysis inhibitor (TAFIa), 6-keto-PGF1α, glucose, and fibrin clot lysis time (CLT) were measured in all subjects. After 3 months of MAS therapy, measurements were repeated for the 22 patients, and after 6 months all measurements were repeated for all study subjects. Results: MAS treatment reduced significantly AHI at 3 months (24 vs 13.1/h) and further improved it at 6 months (13.1 vs 7.05/h). Compared with controls, OSA subjects had a significant higher baseline mean levels of fibrinogen, TAFIa, 6-keto-PGF1α, and glucose. MAS treatment significantly improved levels of IL-1β, D-dimer, TAFIa, and CLT. Despite residual apneas, MAS treatment group presented similar measured homeostatic and inflammatory levels to controls except for glucose. Conclusion: Treatment with MAS in mild-to-moderate OSA subjects improves the inflammatory profile and homeostatic markers. Citation: Niżankowska-Jędrzejczyk A; Almeida FR; Lowe AA; Kania A; Nastałek P; Mejza F; Foley JH; Niżankowska-Mogilnicka E; Undas A. Modulation of inflammatory and hemostatic markers in obstructive sleep apnea patients treated with mandibular advancement splints: a parallel, controlled trial. J Clin Sleep Med 2014;10(3):255-262. PMID:24634622

  16. Potential protective effects of Clostridium butyricum on experimental gastric ulcers in mice

    PubMed Central

    Wang, Fang-Yan; Liu, Jia-Ming; Luo, Hai-Hua; Liu, Ai-Hua; Jiang, Yong

    2015-01-01

    AIM: To investigate the effects of Clostridium butyricum (C. butyricum) on experimental gastric ulcers (GUs) induced by alcohol, restraint cold stress, or pyloric ligation in mice, respectively. METHODS: One hundred and twenty mice were randomly allocated into three types of gastric ulcer models (n = 40 each), induced by alcohol, restraint cold stress, or pyloric ligation. In each GU model, 40 mice were allocated into four groups (n = 10 each): the sham control group; model group (GU induction without pretreatment); C. butyricum group (GU induction with C. butyricum pretreatment); and Omeprazole group (GU induction with Omeprazole pretreatment). The effects of C. butyricum were evaluated by examining the histological changes in the gastric mucosal erosion area, the activities of superoxide dismutase (SOD) and catalase (CAT), the level of malondialdehyde (MDA), and the contents of interleukin (IL)-1β, tumor necrosis factor (TNF)-α, leukotriene B4 (LTB4) and 6-keto-PGF-1α (degradation product of PGI2) in the gastric tissue. RESULTS: Our data showed that C. butyricum significantly reduced the gastric mucosal injury area and ameliorated the pathological conditions of the gastric mucosa. C. butyricum not only minimized the decreases in activity of SOD and CAT, but also reduced the level of MDA in all three GU models used in this study. The accumulation of IL1-β, TNF-α and LBT4 decreased, while 6-keto-PGF-1α increased with pretreatment by C. butyricum in all three GU models. CONCLUSION: Our data demonstrated the protective effects of pretreatment with C. butyricum on anti-oxidation and anti-inflammation in different types of GU models in mice. Further studies are needed to explore its potential clinical benefits. PMID:26217085

  17. Thyroxine therapy ameliorates serum levels of eicosanoids in Chinese subclinical hypothyroidism patients

    PubMed Central

    Zhang, Yan; Zhang, Bing-chang; Xu, Jin; Zhao, Meng; Wang, Zhe; Song, Yong-feng; Zhang, Hai-qing; Gao, Ling; Zhang, Qun-ye; Zhao, Jia-jun

    2016-01-01

    Aim: The eicosanoids derived from phospholipids play key roles in inflammation. However, the profiles of serum eicosanoids in subclinical hypothyroidism (SH) patients and the effects of thyroxine replacement therapy (TRT) on these eicosanoids remain unclear. Many studies show that TSH regulates lipid metabolism. As eicosanoids derived from phospholipids play key roles in oxidative stress and immune function and inflammatory process, it was necessary to explore the profiles of serum eicosanoids in SH patients and the effects of thyroxine replacement therapy (TRT) on the eicosanoids. Methods: A total of 50 Chinese SH patients and 22 healthy volunteers were recruited. SH patients received TRT (L-T4, 25 and 50 mcg/d for patients with TSH≤10.0 mIU/L and TSH>10.0 mIU/L, respectively) for 3 months. Serum levels of major eicosanoids and cPLA2 were analyzed using LC-MS and clinical biochemical assays. Results: The serum levels of cPLA2, eicosanoids (8-isoPGF2a, 11-dehydroTXB2 and 12-HETE) and 11-dehydroTXB2/6-Keto-PGF1a were significantly elevated in SH patients. The serum TSH levels were significantly correlated with the levels of cPLA2 (r=+0.65), 11-dehydroTXB2 (r=+0.32) and 11-dehydroTXB2/6-Keto-PGF1a (r=+0.37). After 3-month TRT, the serum levels of TSH, cPLA2 and the above-mentioned eicosanoids in SH patients were significantly decreased. Conclusion: The metabolism of eicosanoids is significantly altered in Chinese SH patients, and TRT can ameliorate the abnormalities of serum eicosanoid levels. PMID:26997566

  18. Acidic metabolites. VI. 20 alpha-isosteroids as intermediates in 20 alpha-dihydrosteroid formation

    SciTech Connect

    Monder, C.; Bradlow, H.L.; Han, C.A.; Zumoff, B.

    1985-03-01

    We have previously shown that human subjects metabolize the 20 beta-epimer of isocortisol (11 beta, 17,20 beta-trihydroxy-3-oxo-pregn-4-en-21-al) to both 20 alpha- and 20 beta-hydroxy steroid end products. In this paper we describe the synthesis of tritium labeled 20 alpha-epimers of isocortisol and isoTHF (3 alpha, 11 beta, 17,20 alpha-tetrahydroxy-5 beta-pregnan-21-al) and their metabolic fate in humans. Both steroids yielded 20 alpha-hydroxy urinary neutral end-products (cortols and cortolones) and no 20 beta-hydroxy epimers. Regeneration of 17-ketols from aldols occurred to a small extent with isoTHF, but not with isocortisol. Isocortisol and isoTHF yielded less cortoic acids than did the corresponding ketols. The results provide further evidence that in man the stereochemistry at C-20 of the end-products of corticosteroid metabolism is determined by the configuration of the aldol at C-20 prior to subsequent metabolic events.

  19. Alpha-1, alpha-2, and beta adrenergic signal transduction in cultured uterine myocytes.

    PubMed

    Phillippe, M; Saunders, T; Bangalore, S

    1990-04-01

    The following studies were undertaken to develop a cultured uterine myocyte model which would allow further clarification of the adrenergic signal transduction mechanisms utilized by these myocytes. After mechanical removal of the endometrium, rabbit uterine myocytes were isolated by an overnight enzymatic disaggregation using collagenase and DNase I. The isolated myocytes were maintained in culture in 75-cm2 flasks containing Waymouth's MB 751/1 medium-10% fetal bovine serum along with 10(-8) M estradiol, penicillin, streptomycin, and Fungizone. The phase contrast and electron micrographic appearance of these cells was consistent with that previously reported for smooth muscle myocytes in culture. Immunocytochemical studies utilizing monoclonal anti-alpha-smooth muscle actin antibodies confirmed the presence of smooth muscle actin in these cultured myocytes. Western blot studies similarly confirmed the presence of alpha-smooth muscle actin in rabbit myometrial tissue and the cultured myocytes, both the primary and F1 generation. After prelabeling the myocytes with [3H]inositol, adrenergic stimulation experiments demonstrated alpha-1 receptor mediated stimulation of inositol phosphates. Beta receptor stimulation experiments confirmed cAMP production in these cultured myocytes, and the ability of clonidine, an alpha-2 agonist, to inhibit forskolin stimulated cAMP production confirmed the presence of functional alpha-2 adrenergic receptors in these myocytes. In conclusion, these cultured rabbit uterine myocytes have provided an in vitro model which can be utilized to further clarify the adrenergic receptor signal transduction mechanisms in genital tract smooth muscle.

  20. Identification of hydrogen peroxide oxidation sites of alpha A- and alpha B-crystallins.

    PubMed

    Smith, J B; Jiang, X; Abraham, E C

    1997-02-01

    The alpha-crystallins are the most abundant structural proteins of the lens and, because of their chaperone activity, contribute to the solubility of the other crystallins. With aging, the lens crystallins undergo a variety of modifications which correlate with a loss of solubility and the development of cataract. A recent study demonstrating that alpha-crystallins exposed in vitro to FeCl3 and H2O2 exhibit decreased chaperone activity, implicates metal catalyzed oxidations of alpha-crystallins in this loss of solubility. The present study has determined that alpha-crystallins incubated with FeCl3 and H2O2 are modified by the nearly complete oxidation of all methionine residues to methionine sulfoxide, with no other detectable reaction products. The modifications were identified from the molecular weights of peptides formed by enzymatic digestion of the alpha-crystallins and located by tandem mass spectrometric analysis of the fragmentation pattern of the mass spectra of the fragments from peptides with oxidized methionine is loss of 64 Da, which corresponds to loss of CH3SOH from the methionine sulfoxide. These fragments are useful in identifying peptides that include oxidized methionine residues.

  1. Ozone inactivation of human alpha 1-proteinase inhibitor

    SciTech Connect

    Johnson, D.A.

    1980-06-01

    Ozone decreased the trypsin, chymotrypsin, and elastase inhibitory activities of human alpha 1-proteinase inhibitor both in plasma and in solutions of the pure inhibitor. The total loss of porcine elastase inhibitory activity required 18 mol of ozone/mol of pure alpha 1-PI and approximately 850 mol of ozone/mol of alpha 1-PI in plasma. A corresponding loss of the ability to inhibit human leukocyte elastase was observed. Inactivated alpha 1-PI contains four residues of methionine sulfoxide, in addition to oxidized tryosine and tryptophan. Electrophoretic analysis demonstrated that the ozone-inactivated alpha 1-PI did not form normal complexes with serine proteinases. These findings suggest that the inhalation of ozone could inactivate alpha 1-PI on the airspace side of the lung to create a localized alpha 1-PI deficiency, which might contribute to the development of emphysema.

  2. Complex-Energy Shell-Model Description of Alpha Decay

    SciTech Connect

    Id Betan, R.; Nazarewicz, Witold

    2011-01-01

    In his pioneering work of alpha decay, Gamow assumed that the alpha particle formed inside the nucleus tunnels through the barrier of the alpha-daughter potential. The corresponding metastable state can be viewed as a complex-energy solution of the time-independent Schroedinger equation with the outgoing boundary condition. The formation of the alpha cluster, missing in the original Gamow formulation, can be described within the R-matrix theory in terms of the formation amplitude. In this work, the alpha decay process is described by computing the formation amplitude and barrier penetrability in a large complex-energy configuration space spanned by the complex-energy eigenstates of the finite Woods-Saxon (WS) potential. The proper normalization of the decay channel is essential as it strongly modifies the alpha-decay spectroscopic factor. The test calculations are carried out for the ^{212}Po alpha decay.

  3. Alpha adrenoceptors in the rabbit ear thermoregulatory microcirculation.

    PubMed

    Li, Z; Koman, L A; Smith, B P; Gordon, E S; Smith, T L

    1998-03-01

    The rabbit ear microcirculation was analyzed in a chronic unanesthetized model to evaluate alpha adrenergic microvascular control in a thermoregulatory end organ. This model allowed direct measurement of microcirculatory responses without the effects of anesthetics or inflammatory responses induced by acute surgical intervention. The ipsilateral facial artery was catheterized for drug injections into the experimental ear. Microvascular diameter changes following stimulation or blockade of adrenoceptor (AR) subtypes were observed directly through a chronic microvascular chamber implanted in the rabbit ear. Vascular alpha1- and alpha2-ARs appear to be distributed differently across the arterioles and AVAs of the rabbit ear. Both alpha1- and alpha2-ARs appear to contribute to vasoconstriction of AVAs in the conscious rabbit ear. In contrast, alpha1-AR's (vs alpha2-ARs) appear to predominate in adrenergically mediated sympathetic vasoconstriction of arterioles. PMID:9521886

  4. On the mechanism of the chemical and enzymic oxygenations of alpha-oxyprotohemin IX to Fe.biliverdin IX alpha.

    PubMed Central

    Sano, S; Sano, T; Morishima, I; Shiro, Y; Maeda, Y

    1986-01-01

    alpha-Oxyprotohemin IX, an early intermediate in heme catabolism, was synthesized and its autoxidation to biliverdin IX alpha was studied. In anaerobic aqueous pyridine, alpha-oxyprotohemin (hexacoordinated) underwent autoreduction to yield an Fe(II) alpha-oxyprotoporphyrin pi-neutral radical bis(pyridine) complex, which reacted with an equimolar amount of dioxygen to give pyridine.verdohemochrome IX alpha and CO in 75-80% yield via an intermediate with an absorption maximum at 893 nm. Verdohemochrome IX alpha did not react with further dioxygen. Reconstituted apomyoglobin.alpha-oxyprotohemin IX complex (pentacoordinated) reacted with an equimolar amount of dioxygen to form an Fe(II) oxyporphyrin pi-neutral radical intermediate, which rearranged to a green compound (lambda max 660 and 704 nm) with elision of CO. The green product, which is probably an apomyoglobin.verdoheme pi-radical complex, reacted with another equimolar amount of dioxygen to give Fe(III).biliverdin IX alpha. Demetallation of this gave biliverdin IX alpha in overall yield of 70-75%. These results indicate that the sequence of oxyheme autoxidation in the presence of apomyoglobin is alpha-oxyprotoheme IX O2----CO----verdohemochrome IX alpha pi-radical O2----Fe(III).biliverdin IX alpha. A similar mechanism may prevail in vivo. The hexa- and pentacoordinated Fe(II) pi-radical form of the oxyporphyrin is crucial in triggering the autoxidation of the complex to verdohemochrome IX alpha. Further oxygenation of verdohemochrome IX alpha to Fe(III).biliverdin IX alpha occurred only in the pentacoordinated apomyoglobin.verdoheme Fe(II) complex. PMID:3456152

  5. Kinetics of permeation and metabolism of alpha-tocopherol and alpha-tocopheryl acetate in micro-Yucatan pig sin.

    PubMed

    Rangarajan, M; Zatz, J L

    2001-01-01

    The objective of this research was to investigate the permeation and metabolism of alpha-tocopheryl acetate (alpha-TAc) and alpha-tocopherol (alpha-T) from solution and emulsion formulations and to delineate the kinetics of such metabolism. Simple formulations containing alpha-TAc and alpha-T were applied to fresh, viable micro-Yucatan skin dermatomed to a thickness of 250-300 microns, as a finite dose in a flow-through diffusion system. The experiments were stopped at time intervals of 2, 6, 12, and 24 hours. At the end of each time interval, the amounts removed by washing, retained in the stratum corneum (SC), and penetrated into the viable skin and receptor were determined by a validated HPLC method. Receptor concentrations were below the limit of detection. alpha-TAc underwent metabolism in pig skin to the active antioxidant alpha-T. The metabolite appeared as early as two hours after application. The extent of metabolism was highest at 6-12 hours after application. No metabolism was detected in the stratum corneum. Delivery of alpha-T from isopropyl myristate (IPM) solution was more efficient than utilization of alpha-TAc from the same solution. Approximately 1.5% of alpha-T yielded the same viable skin concentration as 5% alpha-TAc. Topical application of alpha-tocopherol or its prodrug acetate was capable of enhancing the overall antioxidant capacity of pig skin. The hydrolytic pathway of alpha-TAc leading to the active antioxidant alpha-T could possibly be saturable.

  6. Ovarian cancer-induced immunosuppression: relationship to tumor necrosis factor-alpha (TNF-alpha) release from ovarian tissue.

    PubMed

    Hassan, M I; Kassim, S K; Saeda, L; Laban, M; Khalifa, A

    1999-01-01

    Cytokines have been reported to be potential biological markers of, disease status in cancer patients. Tumor necrosis factor-alpha (TNF-alpha) is a key cytokine released from monocytes and macrophages. TNF-alpha is involved in essential biological functions such as immunoregulation, modulation of cell growth and differentiation. In this work, the role of TNF-alpha release in ovarian cancer patients was investigated. Fifty-five patients with ovarian cancer and 20 controls of matched age and parity were included in this study. TNF-alpha concentrations were measured in sera and cytosolic fractions of both groups. The results demonstrated a significant increase in TNF-alpha concentrations among patients compared to the control subjects (P < 0.001). Furthermore, a non-significant increase (P = 0.05, was observed between the different types (serous, Mucinous, and endometrioid) of epithelial ovarian cancers. Also TNF-alpha concentrations did not correlate with the disease stage. Moreover, immunohistochemical analysis of tissue specimens stained for TNF-alpha was positive in malignant lesions and negative for the normal ovarian tissue. These findings confirmed the TNF-alpha kinetics obtained by ELISA assays. Interestingly, TNF-alpha levels were also elevated in culture supernatants of PBMC stimulated by cytosolic fractions from malignant ovarian tissues. Blastogenic assays using cytosolic fractions from malignant ovarian specimens to stimulate healthy donor peripheral blood mononuclear cells (PBMC) showed a marked decrease in 3H-thymidine uptake compared to the cells stimulated by normal cytosols. To establish a cause-effect relationship between TNF-alpha release and inhibition of cell proliferation, the experiments showed that 3H-thymidine uptake by PBMC was markedly inhibited by recombinant human TNF-alpha (rh TNF-alpha) and that inhibition was significantly reversed when TNF-alpha monoclonal antibody was added to the cells. The data presented in this work indicate that

  7. Three new alpha-globin variants: Hb Itapira [alpha30(B11)Glu-->Val (alpha1)], Hb Bom Jesus Da Lapa [alpha30(B11)Glu-->Ala (alpha1)] and Hb Boa Esperança [alpha16(A14)Lys-->Thr (alpha2)].

    PubMed

    Jorge, Susan E Costa; Kimura, Elza M; Oliveira, Denise M; Ogo, Satie; Albuquerque, Dulcinéia M; Costa, Fernando F; Sonati, Maria de Fátima

    2007-01-01

    Three novel alpha-globin variants were found during a screening program for hemoglobinopathies in blood donors at the UNICAMP Hematology and Hemotherapy Center, Campinas, State of São Paulo, Southeastern Brazil. They were named for the town of origin of the carrier as Hb Itapira [alpha30(B11)Glu-->Val], Hb Bom Jesus da Lapa [alpha30(B11)Glu-->Ala] and Hb Boa Esperança [alpha16(A14)Lys-->Thr]. Hb Itapira, like Hb Bom Jesus da Lapa, shows an electrophoretic mobility similar to that of Hb S [beta6(A3)GluVal, GAG-->GTG] at alkaline pH; it is associated with a triplicate alpha-globin allele (alphaalphaalpha(anti 3.7)) and corresponds to only 5.5% of the total hemoglobin (Hb). Hb Boa Esperança, found in two different individuals, moves faster than Hb A and exhibits an abnormal functional performance.

  8. Producing a compound Nucleus via Inelastic Scattering: The 90Zr(alpha,alpha')90Zr* Case

    SciTech Connect

    Escher, J E; Dietrich, F S

    2008-05-23

    In a Surrogate reaction a compound nucleus is produced via a direct reaction (pickup, stripping, or inelastic scattering). For a proper application of the Surrogate approach it is necessary to predict the resulting angular momentum and parity distribution in the compound nucleus. A model for determining these distributions is developed for the case of inelastic alpha scattering off a spherical nucleus. The focus is on obtaining a first, simple description of the direct-reaction process that produces the compound nucleus and on providing the basis for a more complete treatment of the problem. The approximations employed in the present description are discussed and the extensions required for a more rigorous treatment of the problem are outlined. To illustrate the formalism, an application to {sup 90}Zr({alpha},{alpha}{prime}){sup 90}Zr* is presented.

  9. Tetrahydro-iso-alpha Acids Antagonize Estrogen Receptor Alpha Activity in MCF-7 Breast Cancer Cells.

    PubMed

    Lempereur, Maëlle; Majewska, Claire; Brunquers, Amandine; Wongpramud, Sumalee; Valet, Bénédicte; Janssens, Philippe; Dillemans, Monique; Van Nedervelde, Laurence; Gallo, Dominique

    2016-01-01

    Tetrahydro-iso-alpha acids commonly called THIAA or Tetra are modified hop acids extracted from hop (Humulus lupulus L.) which are frequently used in brewing industry mainly in order to provide beer bitterness and foam stability. Interestingly, molecular structure of tetrahydro-iso-alpha acids is close to a new type of estrogen receptor alpha (ERα) antagonists aimed at disrupting the binding of coactivators containing an LxxLL motif (NR-box). In this work we show that THIAA decreases estradiol-stimulated proliferation of MCF-7 (ERα-positive breast cancer cells). Besides, we show that it inhibits ERα transcriptional activity. Interestingly, this extract fails to compete with estradiol for ERα binding and does not significantly impact the receptor turnover rate in MCF-7 cells, suggesting that it does not act like classical antiestrogens. Hence, we demonstrate that THIAA is able to antagonize ERα estradiol-induced recruitment of the LxxLL binding motif. PMID:27190515

  10. Tetrahydro-iso-alpha Acids Antagonize Estrogen Receptor Alpha Activity in MCF-7 Breast Cancer Cells

    PubMed Central

    Lempereur, Maëlle; Majewska, Claire; Brunquers, Amandine; Wongpramud, Sumalee; Valet, Bénédicte; Janssens, Philippe; Dillemans, Monique; Van Nedervelde, Laurence; Gallo, Dominique

    2016-01-01

    Tetrahydro-iso-alpha acids commonly called THIAA or Tetra are modified hop acids extracted from hop (Humulus lupulus L.) which are frequently used in brewing industry mainly in order to provide beer bitterness and foam stability. Interestingly, molecular structure of tetrahydro-iso-alpha acids is close to a new type of estrogen receptor alpha (ERα) antagonists aimed at disrupting the binding of coactivators containing an LxxLL motif (NR-box). In this work we show that THIAA decreases estradiol-stimulated proliferation of MCF-7 (ERα-positive breast cancer cells). Besides, we show that it inhibits ERα transcriptional activity. Interestingly, this extract fails to compete with estradiol for ERα binding and does not significantly impact the receptor turnover rate in MCF-7 cells, suggesting that it does not act like classical antiestrogens. Hence, we demonstrate that THIAA is able to antagonize ERα estradiol-induced recruitment of the LxxLL binding motif. PMID:27190515

  11. Degradation of the human proteinase inhibitors alpha-1-antitrypsin and alpha-2-macroglobulin by Bacteroides gingivalis.

    PubMed Central

    Carlsson, J; Herrmann, B F; Höfling, J F; Sundqvist, G K

    1984-01-01

    Various strains of black-pigmented Bacteroides species were grown on horse blood agar and suspended in human serum. After various times of incubation the effect of the bacteria on the serum was evaluated by polyacrylamide gel electrophoresis and "rocket" immunoelectrophoresis. The formation of trichloroacetic acid-soluble material in the suspensions and the capacity of the treated sera to inhibit the activity of trypsin were also determined. The two tested strains of Bacteroides gingivalis (W83, H185) degraded most serum proteins, including the plasma proteinase inhibitors alpha-1-antitrypsin and alpha-2-macroglobulin. They did not, however, degrade alpha-1-antichymotrypsin. Bacteroides intermedius NCTC 9336, Bacteroides asaccharolyticus NCTC 9337, and an asaccharolytic oral strain different from B. gingivalis (BN11a-f) did not degrade the plasma proteinase inhibitors. These strains were, however, able to inactivate the capacity of serum to inhibit the activity of trypsin. Images PMID:6198282

  12. Alpha6 beta4 and alpha6 beta1 integrins in astrocytomas and other CNS tumors.

    PubMed

    Previtali, S; Quattrini, A; Nemni, R; Truci, G; Ducati, A; Wrabetz, L; Canal, N

    1996-04-01

    Laminin may alter the biological behavior of gliomas. Therefore, we investigated the expression of two laminin receptors, alpha6 beta1 and alpha6 beta4 integrins in normal brain, astrogliotic brain, and astrocytomas as compared to other central nervous system (CNS) tumors. In most CNS tumors, the expression of these integrins was unchanged in neoplastic as compared to normal counterpart cells. In contrast, increased numbers of reactive and neoplastic astrocytes expressed beta4 integrin as compared to normal astrocytes, whereas alpha6 and beta1 integrin expression did not change. Conversely, lower numbers of astrocytoma blood vessels expressed beta4, whereas all blood vessels in normal brain expressed beta4. These data suggest that the profile of laminin receptors changes in neoplastic astrocytes and in astrocytoma blood vessels; this change may play an important role in astrocytoma pathogenesis.

  13. Biochemical characterization of CK2alpha and alpha' paralogues and their derived holoenzymes: evidence for the existence of a heterotrimeric CK2alpha'-holoenzyme forming trimeric complexes.

    PubMed

    Olsen, Birgitte B; Rasmussen, Tine; Niefind, Karsten; Issinger, Olaf-Georg

    2008-09-01

    Altogether 2 holoenzymes and 4 catalytic CK2 constructs were expressed and characterized i.e. CK2alpha(2)1-335 beta2; CK2alpha'-derived holoenzyme; CK2alpha1-335; MBP-CK2alpha'; His-tagged CK2alpha and His-tagged CK2alpha'. The two His-tagged catalytic subunits were expressed in insect cells, all others in Escherichia coli. IC50 studies involving the established CK2 inhibitors DMAT, TBBt, TBBz, apigenin and emodin were carried out and the Ki values calculated. Although the differences in the Ki values found were modest, there was a general tendency showing that the CK2 holoenzymes were more sensitive towards the inhibitors than the free catalytic subunits. Thermal inactivation experiments involving the individual catalytic subunits showed an almost complete loss of activity after only 2 min at 45 degrees C. In the case of the two holoenzymes, the CK2alpha'-derived holoenzyme lost ca. 90% of its activity after 14 min, whereas CK2alpha2(1-335) beta2 only showed a loss of ca. 40% by this time of incubation. Gel filtration analyses were performed at high (500 mM) and low (150 mM) monovalent salt concentrations in the absence or presence of ATP. At 500 mM NaCl the CK2alpha'-derived holoenzyme eluted at a position corresponding to a molecular mass of 105 kDa which is significantly below the elution of the CK2alpha(2)1-335 beta2 holoenzyme (145 kDa). Calmodulin was not phosphorylated by either CK2alpha2(1-335) beta2 or the CK2alpha'-derived holoenzyme. However, in the presence of polylysine only the CK2alpha(2)1-335 beta2 holoenzyme could use calmodulin as a substrate such as the catalytic subunits, in contrast to the CK2alpha'-derived holoenzyme which only phosphorylated calmodulin weakly. This attenuation may be owing to a different structural interaction between the catalytic CK2alpha' subunit and non-catalytic CK2beta subunit.

  14. Far-Infrared and Millimeter Continuum Studies of K-Giants: Alpha Boo and Alpha Tau

    NASA Technical Reports Server (NTRS)

    Cohen, Martin; Carbon, Duane F.; Welch, William J.; Lim, Tanya; Forster, James R.; Goorvitch, David; Thigpen, William (Technical Monitor)

    2002-01-01

    We have imaged two normal, non-coronal, infrared-bright K-giants, alpha Boo and alpha Tau, in the 1.4-millimeter and 2.8-millimeter continuum using BIMA. These stars have been used as important absolute calibrators for several infrared satellites. Our goals are: (1) to probe the structure of their upper photospheres; (2) to establish whether these stars radiate as simple photospheres or possess long-wavelength chromospheres; and (3) to make a connection between millimeter-wave and far-infrared absolute flux calibrations. To accomplish these goals we also present ISO Long Wavelength Spectrometer (LWS) measurements of both these K-giants. The far-infrared and millimeter continuum radiation is produced in the vicinity of the temperature minimum in a Boo and a Tau, offering a direct test of the model photospheres and chromospheres for these two cool giants. We find that current photospheric models predict fluxes in reasonable agreement with those observed for those wavelengths which sample the upper photosphere, namely less than or equal to 170 micrometers in alpha Tau and less than or equal to 125 micrometers in alpha Boo. It is possible that alpha Tau is still radiative as far as 0.9 - 1.4 millimeters. We detect chromospheric radiation from both stars by 2.8 millimeters (by 1.4 millimeters in alpha Boo), and are able to establish useful bounds on the location of the temperature minimum. An attempt to interpret the chromospheric fluxes using the two-component "bifurcation model" proposed by Wiedemann et al. (1994) appears to lead to a significant contradiction.

  15. Pre-clinical immunogenicity of human papillomavirus alpha-7 and alpha-9 major capsid proteins.

    PubMed

    Bissett, Sara L; Mattiuzzo, Giada; Draper, Eve; Godi, Anna; Wilkinson, Dianna E; Minor, Philip; Page, Mark; Beddows, Simon

    2014-11-12

    Human papillomavirus (HPV) vaccines confer protection against the oncogenic genotypes HPV16 and HPV18 through the generation of type-specific neutralizing antibodies raised against the constituent virus-like particles (VLP) based upon the major capsid proteins (L1) of these genotypes. The vaccines also confer a degree of cross-protection against some genetically related types from the Alpha-9 (HPV16-like: HPV31, HPV33, HPV35, HPV52, HPV58) and Alpha-7 (HPV18-like: HPV39, HPV45, HPV59, HPV68) species groups. The mechanism of cross-protection is unclear but may involve antibodies capable of recognizing shared inter-genotype epitopes. The relationship(s) between the genetic and antigenic diversity of the L1 protein, particularly for non-vaccine genotypes, is poorly understood. We carried out a comprehensive evaluation of the immunogenicity of L1 VLP derived from genotypes within the Alpha-7 and Alpha-9 species groups in New Zealand White rabbits and used L1L2 pseudoviruses as the target antigens in neutralization assays. The majority antibody response against L1 VLP was type-specific, as expected, but several instances of robust cross-neutralization were nevertheless observed including between HPV33 and HPV58 within the Alpha-9 species and between HPV39, HPV59 and HPV68 in the Alpha-7 species. Immunization with an experimental tetravalent preparation comprising VLP based upon HPV16, HPV18, HPV39 and HPV58 was capable of generating neutralizing antibodies against all the Alpha-7 and Alpha-9 genotypes. Competition of HPV31 and HPV33 cross-neutralizing antibodies in the tetravalent sera confirmed that these antibodies originated from HPV16 and HPV58 VLP, respectively, and suggested that they represent minority specificities within the antibody repertoire generated by the immunizing antigen. These data improve our understanding of the antigenic diversity of the L1 protein per se and may inform the rational design of a next generation vaccine formulation based upon

  16. Pre-clinical immunogenicity of human papillomavirus alpha-7 and alpha-9 major capsid proteins

    PubMed Central

    Bissett, Sara L.; Mattiuzzo, Giada; Draper, Eve; Godi, Anna; Wilkinson, Dianna E.; Minor, Philip; Page, Mark; Beddows, Simon

    2014-01-01

    Human papillomavirus (HPV) vaccines confer protection against the oncogenic genotypes HPV16 and HPV18 through the generation of type-specific neutralizing antibodies raised against the constituent virus-like particles (VLP) based upon the major capsid proteins (L1) of these genotypes. The vaccines also confer a degree of cross-protection against some genetically related types from the Alpha-9 (HPV16-like: HPV31, HPV33, HPV35, HPV52, HPV58) and Alpha-7 (HPV18-like: HPV39, HPV45, HPV59, HPV68) species groups. The mechanism of cross-protection is unclear but may involve antibodies capable of recognizing shared inter-genotype epitopes. The relationship(s) between the genetic and antigenic diversity of the L1 protein, particularly for non-vaccine genotypes, is poorly understood. We carried out a comprehensive evaluation of the immunogenicity of L1 VLP derived from genotypes within the Alpha-7 and Alpha-9 species groups in New Zealand White rabbits and used L1L2 pseudoviruses as the target antigens in neutralization assays. The majority antibody response against L1 VLP was type-specific, as expected, but several instances of robust cross-neutralization were nevertheless observed including between HPV33 and HPV58 within the Alpha-9 species and between HPV39, HPV59 and HPV68 in the Alpha-7 species. Immunization with an experimental tetravalent preparation comprising VLP based upon HPV16, HPV18, HPV39 and HPV58 was capable of generating neutralizing antibodies against all the Alpha-7 and Alpha-9 genotypes. Competition of HPV31 and HPV33 cross-neutralizing antibodies in the tetravalent sera confirmed that these antibodies originated from HPV16 and HPV58 VLP, respectively, and suggested that they represent minority specificities within the antibody repertoire generated by the immunizing antigen. These data improve our understanding of the antigenic diversity of the L1 protein per se and may inform the rational design of a next generation vaccine formulation based upon

  17. Approximate formulation of redistribution in the Ly-alpha, Ly-beta, H-alpha system

    NASA Technical Reports Server (NTRS)

    Cooper, J.; Ballagh, R. J.; Hubeny, I.

    1989-01-01

    Simple approximate formulas are given for the coupled redistribution of Ly-alpha, Ly-beta, and H-alpha, by using well-defined approximations to an essentially exact formulation. These formulas incorporate all the essential physics including Raman scattering, lower state radiative decay, and correlated terms representing emission during a collision which must be retained in order that the emission coefficients are properly behaved in the line wings. Approximate expressions for the appropriate line broadening parameters are collected. Finally, practical expressions for the source functions are given. These are formulated through newly introduced nonimpact redistribution functions, which are shown to be reasonably approximated by existing (ordinary and generalized) redistribution functions.

  18. Alpha3* and alpha 7 nAChR-mediated Ca2+ transient generation in IMR-32 neuroblastoma cells.

    PubMed

    Ween, Hilde; Thorin-Hagene, Kirsten; Andersen, Elisabeth; Grønlien, Jens Halvard; Lee, Chih-Hung; Gopalakrishnan, Murali; Malysz, John

    2010-10-01

    Alpha3-containing (alpha 3*) and alpha 7 nicotinic acetylcholine receptors (nAChRs) are expressed in human IMR-32 neuroblastoma cells and implicated in Ca(2+) signaling. In this study, we investigated the intracellular Ca(2+) transient generation evoked by selective activation of alpha 3* (agonist potency rank order: epibatidine>varenicline>nicotine approximately cytisine) and alpha 7 (rank order in the presence of alpha 7 positive allosteric modulator or PAM: A-795723>NS6784 approximately PNU-282987) using, respectively, varenicline and NS6784 (+alpha 7 PAM) by Ca(2+) imaging. Effects of inhibitors of nAChRs (MLA and mecamylamine), ER Ca(2+) ATPase pump (CPA and thapsigargin), Ca(2+)-induced Ca(2+) release (ryanodine and dantrolene), Ca(2+) channels (nitrendipine, diltiazem, and Cd(2+)), and removal of extracellular Ca(2+) were examined. alpha 7 PAMs, when tested in the presence of NS6784, were more active when added first, followed by the agonist, than in the reverse order. Removal of extracellular Ca(2+) - but not CPA, thapsigargin, ryanodine, dantrolene, nitrendipine, diltiazem, or Cd(2+) - diminished the alpha 7 agonist-evoked Ca(2+) transients. In contrast, only diltiazem and nitrendipine and removal of extracellular Ca(2+) inhibited the alpha 3*-mediated Ca(2+) transients. The differential effect of diltiazem and nitrendipine versus Cd(2+) was due to direct inhibition of alpha 3* nAChRs as revealed by Ca(2+) imaging in HEK-293 cells expressing human alpha 3 beta 4 nAChRs and patch clamp in IMR-32 cells. In summary, this study provides evidence that alpha 3* and alpha 7 nAChR agonist-evoked global Ca(2+) transient generation in IMR-32 cells does not primarily involve voltage-dependent Ca(2+) channels, intracellular Ca(2+) stores, or Ca(2+)-induced Ca(2+) release. These mechanisms may, however, be still involved in other forms of nAChR-mediated Ca(2+) signaling.

  19. ON THE ORIGINS OF THE DIFFUSE H{alpha} EMISSION: IONIZED GAS OR DUST-SCATTERED H{alpha} HALOS?

    SciTech Connect

    Seon, Kwang-Il; Witt, Adolf N.

    2012-10-20

    It is known that the diffuse H{alpha} emission outside of bright H II regions not only are very extended, but also can occur in distinct patches or filaments far from H II regions, and the line ratios of [S II] {lambda}6716/H{alpha} and [N II] {lambda}6583/H{alpha} observed far from bright H II regions are generally higher than those in the H II regions. These observations have been regarded as evidence against the dust-scattering origin of the diffuse H{alpha} emission (including other optical lines), and the effect of dust scattering has been neglected in studies on the diffuse H{alpha} emission. In this paper, we reexamine the arguments against dust scattering and find that the dust-scattering origin of the diffuse H{alpha} emission cannot be ruled out. As opposed to the previous contention, the expected dust-scattered H{alpha} halos surrounding H II regions are, in fact, in good agreement with the observed H{alpha} morphology. We calculate an extensive set of photoionization models by varying elemental abundances, ionizing stellar types, and clumpiness of the interstellar medium (ISM) and find that the observed line ratios of [S II]/H{alpha}, [N II]/H{alpha}, and He I {lambda}5876/H{alpha} in the diffuse ISM accord well with the dust-scattered halos around H II regions, which are photoionized by late O- and/or early B-type stars. We also demonstrate that the H{alpha} absorption feature in the underlying continuum from the dust-scattered starlight ({sup d}iffuse galactic light{sup )} and unresolved stars is able to substantially increase the [S II]/H{alpha} and [N II]/H{alpha} line ratios in the diffuse ISM.

  20. Biosynthesis of alpha2(IV) and alpha1(IV) chains of collagen IV and interactions with matrix metalloproteinase-9.

    PubMed

    Toth, M; Sado, Y; Ninomiya, Y; Fridman, R

    1999-07-01

    In vitro binding studies with latent matrix metalloproteinase-9 (pro-MMP-9) have revealed the existence of nondisulfide-bonded alpha2(IV) chains on the cell surface capable of forming a high-affinity complex with the enzyme. Here we investigated the biosynthesis and cellular distribution of alpha2(IV) and alpha1(IV) chains in breast epithelial (MCF10A and MDA-MB-231) and fibrosarcoma (HT1080) cells by pulse-chase analysis followed by immunoprecipitation with chain-specific monoclonal antibodies (mAb). These studies showed that whereas the alpha1(IV) chain remained in the intracellular compartment, nondisulfide-bonded alpha2(IV) chains were secreted into the media in a stable form. Consistently, only alpha2(IV) was detected on the cell surface by surface biotinylation or indirect immunofluorescence. In agreement with the pulse-chase analysis, media subjected to co-precipitation experiments with pro-MMP-9 or pro-MMP-9-affinity chromatography followed by immunoblotting with chain-specific mAbs resulted in the detection of alpha2(IV). A preferential secretion of nondisulfide-bonded alpha2(IV) chains was also observed in CHO-K1 cells transiently transfected with full-length mouse alpha2(IV) or alpha (IV) cDNAs. However, a complex of mouse alpha1(IV) with pro-MMP-9 was coprecipitated with exogenous enzyme from lysates of CHO-K1 cells transfected with mouse alpha1(IV), suggesting that under overexpression conditions the enzyme can also interact with the alpha1 (IV) chain. Collectively, these studies further demonstrate the interactions of pro-MMP-9 with collagen IV chains and a unique processing and targeting of nondisulfide-bonded alpha2(IV) chains that may play a role in the surface/matrix association of pro-MMP-9.

  1. cap alpha. -2 adrenergic receptor: a radiohistochemical study

    SciTech Connect

    Unnerstall, J.R.

    1984-01-01

    ..cap alpha..-2 adrenergic agents have been shown to influence blood pressure, heart rate and other physiological and behavioral functions through interactions with adrenergic pathways within the central nervous system. Pharmacologically relevant ..cap alpha..-1 adrenergic receptors were biochemically characterized and radiohistochemically analyzed in intact tissue sections of the rat and human central nervous system. The anatomical distribution of the ..cap alpha..-2 receptors, labeled with the agonist (/sup 3/H)para-aminoclonidine, verified the concept that ..cap alpha..-2 receptors are closely associated with adrenergic nerve terminals and that ..cap alpha..-2 agents can influence autonomic and endocrine function through an action in the central nervous system. Since ..cap alpha..-2 agonists can influence sympathetic outflow, ..cap alpha..-2 binding sites were closely analyzed in the intermediolateral cell column of the thoracic spinal cord. The transport of putative presynaptic ..cap alpha..-2 binding sites in the rat sciatic nerve was analyzed by light microscopic radiohistochemical techniques. Finally, in intact tissue section of the rat central nervous system, the biochemical characteristics of (/sup 3/H)rauwolscine binding were analyzed. Data were also shown which indicates that the synthetic ..cap alpha..-2 antagonist (/sup 3/H)RX781094 also binds to ..cap alpha..-2 receptors with high-affinity. Further, the distribution of (/sup 3/H)RX781094 binding sites in the rat central nervous system was identical to the distribution seen when using (/sup 3/H)para-aminoclonidine.

  2. Structural differences determine the relative selectivity of nicotinic compounds for native alpha 4 beta 2*-, alpha 6 beta 2*-, alpha 3 beta 4*- and alpha 7-nicotine acetylcholine receptors.

    PubMed

    Grady, Sharon R; Drenan, Ryan M; Breining, Scott R; Yohannes, Daniel; Wageman, Charles R; Fedorov, Nikolai B; McKinney, Sheri; Whiteaker, Paul; Bencherif, Merouane; Lester, Henry A; Marks, Michael J

    2010-06-01

    Mammalian brain expresses multiple nicotinic acetylcholine receptor (nAChR) subtypes that differ in subunit composition, sites of expression and pharmacological and functional properties. Among known subtypes of receptors, alpha 4 beta 2* and alpha 6 beta 2*-nAChR have the highest affinity for nicotine (where * indicates possibility of other subunits). The alpha 4 beta 2*-nAChRs are widely distributed, while alpha 6 beta 2*-nAChR are restricted to a few regions. Both subtypes modulate release of dopamine from the dopaminergic neurons of the mesoaccumbens pathway thought to be essential for reward and addiction. alpha 4 beta 2*-nAChR also modulate GABA release in these areas. Identification of selective compounds would facilitate study of nAChR subtypes. An improved understanding of the role of nAChR subtypes may help in developing more effective smoking cessation aids with fewer side effects than current therapeutics. We have screened a series of nicotinic compounds that vary in the distance between the pyridine and the cationic center, in steric bulk, and in flexibility of the molecule. These compounds were screened using membrane binding and synaptosomal function assays, or recordings from GH4C1 cells expressing h alpha 7, to determine affinity, potency and efficacy at four subtypes of nAChRs found in brain, alpha 4 beta 2*, alpha 6 beta 2*, alpha 7 and alpha 3 beta 4*. In addition, physiological assays in gain-of-function mutant mice were used to assess in vivo activity at alpha 4 beta 2* and alpha 6 beta 2*-nAChRs. This approach has identified several compounds with agonist or partial agonist activity that display improved selectivity for alpha 6 beta 2*-nAChR.

  3. Characterization, cloning, and expression of porcine alpha B crystallin.

    PubMed

    Liao, J H; Hung, C C; Lee, J S; Wu, S H; Chiou, S H

    1998-03-01

    alpha-Crystallin is a major lens protein present in the lenses of all vertebrate species. Recent studies have revealed that bovine alpha-crystallins possess genuine chaperone activity similar to small heat-shock proteins. In order to compare this chaperone-like structural protein from the eye lenses of different mammalian species, we have cloned and expressed one of the main alpha-crystallin subunits, i.e., alpha B crystallin, from the porcine lenses in order to facilitate the structure-function evaluation and comparison of this chaperonin protein. cDNA encoding alpha B subunit chain was obtained using a new "Marathon cDNA amplification" protocol of Polymerase Chain Reaction (PCR). PCR-amplified product corresponding to alpha B subunit was then ligated into pGEM-T plasmid and prepared for nucleotide sequencing by the dideoxy-nucleotide chain-termination method. Sequencing several positive clones containing DNA inserts coding for alpha B-crystallin subunit constructed only one complete full-length reading frame of 525 base pairs similar to human and bovine alpha B subunits, covering a deduced protein sequence of 175 amino acids including the universal translation-initiating methionine. The porcine alpha B crystallin shows only 3 and 7 residues difference to bovine and human alpha B crystallins respectively, revealing the close relatedness among mammalian eye lens proteins. The sequence differences between porcine and sub-mammalian species such as chicken and bullfrog are much greater, especially at the N- and C-terminal regions of these alpha B crystallins. Expression of alpha B subunit chain in E. coli vector generated a polypeptide which can cross-react with the antiserum against the native and purified alpha B subunit from the native porcine lenses albeit with a much lower activity.

  4. Sterol synthesis. A novel reductive rearrangement of an alpha,beta-unsaturated steroidal epoxide; a new chemical synthesis of 5alpha-cholest-8(14)-en-3beta, 15alpha-diol.

    PubMed

    Parish, E J; Schroepfer, G J

    1977-04-01

    Reduction of 3beta-benzoyloxy-14alpha,15alpha-epoxy-5alpha-cholest-7-ene with either lithium triethylboro-hydride or lithium aluminum hydride (4 molar excess) gave 5-alpha-cholest-8(14)-en-3beta,15alpha-diol in high yield. Reduction of the epoxy ester with lithium triethylborodeuteride or lithium aluminum deuteride (4 molar excess) gave [7alpha-2-H]-5alpha-cholest-8(14)-en-3beta,15alpha-diol. Reduction of 2beta-benzoyloxy-14alpha,15alpha-epoxy-5alpha-cholest-7-ene with a large excess (24 molar excess) of lithium aluminum hydride gave, in addition to the expected 5alpha-cholest-8(14)-en-3beta,15alpha-diol, a significant yield (33%) of 5alpha-cholest-8(14)-en-3beta-o1. Reduction of the epoxy ester with a large excess (24 molar excess) of lithium aluminum deuteride gave [7alpha-2H]-5alpha-cholest-8(14)-en-3beta,15alpha-diol and 5alpha-cholest-8(14)-en-3beta-o1 which contained two atoms of stably bound deuterium. PMID:858170

  5. Alpha resonant scattering for astrophysical reaction studies

    NASA Astrophysics Data System (ADS)

    Yamaguchi, H.; Kahl, D.; Nakao, T.; Wakabayashi, Y.; Kubano, S.; Hashimoto, T.; Hayakawa, S.; Kawabata, T.; Iwasa, N.; Teranishi, T.; Kwon, Y. K.; Binh, D. N.; Khiem, L. H.; Duy, N. G.

    2014-05-01

    Several alpha-induced astrophysical reactions have been studied at CRIB (CNS Radioactive Ion Beam separator), which is a low-energy RI beam separator at Center for Nuclear Study (CNS) of the University of Tokyo. One of the methods to study them is the α resonant scattering using the thick-target method in inverse kinematics. Among the recent studies at CRIB, the measurement of 7Be+α resonant scattering is discussed. Based on the result of the experiment, we evaluated the contributions of high-lying resonances for the 7Be(α,γ) reaction, and proposed a new cluster band in 11C.

  6. Towards antihydrogen trapping and spectroscopy at ALPHA

    NASA Astrophysics Data System (ADS)

    Butler, E.; Andresen, G. B.; Ashkezari, M. D.; Baquero-Ruiz, M.; Bertsche, W.; Bowe, P. D.; Bray, C. C.; Cesar, C. L.; Chapman, S.; Charlton, M.; Fajans, J.; Friesen, T.; Fujiwara, M. C.; Gill, D. R.; Hangst, J. S.; Hardy, W. N.; Hayano, R. S.; Hayden, M. E.; Humphries, A. J.; Hydomako, R.; Jonsell, S.; Kurchaninov, L.; Lambo, R.; Madsen, N.; Menary, S.; Nolan, P.; Olchanski, K.; Olin, A.; Povilus, A.; Pusa, P.; Robicheaux, F.; Sarid, E.; Silveira, D. M.; So, C.; Storey, J. W.; Thompson, R. I.; van der Werf, D. P.; Wilding, D.; Wurtele, J. S.; Yamazaki, Y.

    2011-07-01

    Spectroscopy of antihydrogen has the potential to yield high-precision tests of the CPT theorem and shed light on the matter-antimatter imbalance in the Universe. The ALPHA antihydrogen trap at CERN's Antiproton Decelerator aims to prepare a sample of antihydrogen atoms confined in an octupole-based Ioffe trap and to measure the frequency of several atomic transitions. We describe our techniques to directly measure the antiproton temperature and a new technique to cool them to below 10 K. We also show how our unique position-sensitive annihilation detector provides us with a highly sensitive method of identifying antiproton annihilations and effectively rejecting the cosmic-ray background.

  7. [DNA diagnosis of alpha-herpesvirinae infection].

    PubMed

    Hondo, R; Ito, S

    2000-04-01

    Herpesviruses have a characteristic of the latency after the primary infection. Advanced study on the causal relation between the reactivation of latent virus and the appearance of the symptoms would need both of the detection of viral genome by the DNA diagnosis method and the analysis of the kinetics of the virus. We developed a new quantitative method for the detection and the titration of copy number in the viral genome using the combination of polymerase chain reaction and microplate hybridization. The availability of the method was confirmed by the several cases of alpha-herpesvirinae infections.

  8. Expression of human. alpha. -fetoprotein in yeast

    SciTech Connect

    Yamamoto, Ritsu; Sakamoto, Takashi; Nishi, Shinzo; Sakai, Masaharu; Morinaga, Tomonori; Tamaoki, Taiki Univ. of Calgary, Alberta )

    1990-01-01

    Human {alpha}-fetoprotein (AFP) was expressed in Saccharomyces cerevisiae, with a plasmid containing the cDNA sequence for human AFP fused with the rat AFP signal peptide. The recombinant AFP was purified from the yeast lysate by DEAE-cellulose and immunoaffinity chromatography. The amino acid composition and the molecular weight of the recombinant AFP were similar to those of hepatoma AFP. N-terminal amino acids sequence analysis indicated that the signal peptide had been processed. The recombinant and hepatoma AFP reacted identically in Ouchterlony immunodiffusion and radioimmunoassay tests. These observations indicated that the yeast recombinant protein had the properties of native AFP.

  9. Robust Hypothesis Testing with alpha -Divergence

    NASA Astrophysics Data System (ADS)

    Gul, Gokhan; Zoubir, Abdelhak M.

    2016-09-01

    A robust minimax test for two composite hypotheses, which are determined by the neighborhoods of two nominal distributions with respect to a set of distances - called $\\alpha-$divergence distances, is proposed. Sion's minimax theorem is adopted to characterize the saddle value condition. Least favorable distributions, the robust decision rule and the robust likelihood ratio test are derived. If the nominal probability distributions satisfy a symmetry condition, the design procedure is shown to be simplified considerably. The parameters controlling the degree of robustness are bounded from above and the bounds are shown to be resulting from a solution of a set of equations. The simulations performed evaluate and exemplify the theoretical derivations.

  10. Expansion-cooled Lyman-alpha clouds

    NASA Astrophysics Data System (ADS)

    Duncan, Robert C.; Vishniac, Ethan T.; Ostriker, Jeremiah P.

    1991-02-01

    It is shown that recent observations by Pettini et al. (1990) which indicate that low-N H I Ly-alpha forest lines have small velocity widths and that the velocity widths are positively correlated with N (H I) can be understood as the result of adiabatic cooling of expanding clouds. It is argued that expansion cooling can efficiently lower temperatures and velocity widths of diffuse ionized clouds, and that this trend of diminishing temperature and velocity width in a wide range of plausible cloud models is consistent with double-quasar data. Expansion can provide a natural explanation for the steep z-evolution of the cloud numbers.

  11. Spectrometer for rare alpha-decay events

    SciTech Connect

    Kuznetsov, A.N.; Kushniruk, V.F.; Nefed'ev, O.K.; Rykhlyuk, A.V.; Subbotin, V.G.; Tomin, V.I.; Kharitonov, Yu.P.; Tsyganov, Yu.S.

    1987-07-01

    A low-background alpha spectrometer with 4..pi.. registration geometry is described. Use of time measurements reduces the background level in the region of 6-7 MeV to 0.02-0.03 counts/day. For two detectors 20 mm in diameter located at a distance of 1 mm from one another in registration of decay of /sup 223/Ra applied to the surface of one of the detectors, the decay efficiency is 0.82 +/- 0.04. The resolution for the 3.18-MeV line is 60 keV.

  12. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  13. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  14. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  15. Alpha particle collective Thomson scattering in TFTR

    SciTech Connect

    Machuzak, J.S.; Woskov, P.P.; Rhee, D.Y.; Gilmore, J.; Bretz, N.L.; Park, H.K.; Aamodt, R.E.; Cheung, P.Y.; Russell, D.A.; Bindslev, H.

    1993-11-01

    A collective Thomson scattering diagnostic is being implemented on TFTR to measure alpha particle, energetic and thermal ion densities and velocity distributions. A 60 GHz, 0.1-1 kW gyrotron will be used as the transmitter source, and the scattering geometry will be perpendicular to the magnetic field in the extraordinary mode polarization. An enhanced scattered signal is anticipated from fluctuations in the lower hybrid frequency range with this scattering geometry. Millimeter wave collective Thomson scattering diagnostics have the advantage of larger scattering angles to decrease the amount of stray light, and long, high power, modulated pulses to obtain improved signal to noise through synchronous detection techniques.

  16. Alpha resonant scattering for astrophysical reaction studies

    SciTech Connect

    Yamaguchi, H.; Kahl, D.; Nakao, T.; Wakabayashi, Y.; Kubano, S.; Hashimoto, T.; Hayakawa, S.; Kawabata, T.; Iwasa, N.; Teranishi, T.; Kwon, Y. K.; Binh, D. N.; Khiem, L. H.; Duy, N. G.

    2014-05-02

    Several alpha-induced astrophysical reactions have been studied at CRIB (CNS Radioactive Ion Beam separator), which is a low-energy RI beam separator at Center for Nuclear Study (CNS) of the University of Tokyo. One of the methods to study them is the α resonant scattering using the thick-target method in inverse kinematics. Among the recent studies at CRIB, the measurement of {sup 7}Be+α resonant scattering is discussed. Based on the result of the experiment, we evaluated the contributions of high-lying resonances for the {sup 7}Be(α,γ) reaction, and proposed a new cluster band in {sup 11}C.

  17. Molecular Dynamics Simulations of Alpha-synuclein

    NASA Astrophysics Data System (ADS)

    Sammalkorpi, Maria; Schreck, Carl; Nath, Abhinav; Dewitt, David; Rhoades, Elizabeth; O'Hern, Corey

    2011-03-01

    We investigate the conformational dynamics of single alpha-synuclein proteins, which have been implicated in amyloid diseases such as Parkinson's and Alzheimer's disease, in solution using unconstrained and constrained all-atom, explicit solvent molecular dynamics simulations. The constraints on inter-residue separations are obtained from our single-molecule FRET measurements of eleven FRET pairs that span the protein. By comparing the simulation data satisfying different combinations of FRET constraints, we are able to identify those constraints that are most important in determining the radius of gyration and key features of the contact map of the protein.

  18. Alpha Channeling in a Rotating Plasma

    SciTech Connect

    Abraham J. Fetterman and Nathaniel J. Fisch

    2008-09-23

    The wave-particle α-channeling effect is generalized to include rotating plasma. Specifically, radio frequency waves can resonate with α particles in a mirror machine with E × B rotation to diffuse the α particles along constrained paths in phase space. Of major interest is that the α-particle energy, in addition to amplifying the RF waves, can directly enhance the rotation energy which in turn provides additional plasma confinement in centrifugal fusion reactors. An ancillary benefit is the rapid removal of alpha particles, which increases the fusion reactivity.

  19. [Alpha Fetoprotein-producing Lung Adenocarcinoma].

    PubMed

    Komori, Kazuyuki; Tabata, Toshiharu; Sato, Kimiaki; Katsumata, Hiroshi; Minowa, Muneo; Kondo, Takashi

    2015-11-01

    We report a case of alpha fetoprotein (AFP) -producing lung adenocarcinoma. A 53-year-old man was referred to our hospital due to right pneumothorax. Computed tomography showed right moderate pneumothorax, a solid tumor in the upper lobe (S3) and mediastinal lymph node swelling. The serum AFP level was as high as 223.0 ng/ml. Frozen examination revealed a low-differentiated adenocarcinoma. Based on the pathological and immunohistochemical findings, the tumor was diagnosed as AFP-producing lung adenocarcinoma.

  20. Characterization of the alpha-gamma and alpha-beta complex: evidence for an in vivo functional role of alpha-crystallin as a molecular chaperone

    NASA Technical Reports Server (NTRS)

    Boyle, D.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1994-01-01

    Previous studies have demonstrated that in vitro, alpha-crystallin can protect other lens proteins against extensive denaturation and aggregation. The mechanism of this protection involves preferential binding of the partially denatured protein to a central region of the native alpha-crystallin complex. To test whether a similar phenomenon might occur in vivo, a high molecular weight aggregate (HMWA) fraction was isolated from the aged bovine lens. Negative staining of this preparation revealed the presence of particles of 13-14 nm diameter, characteristic of alpha-crystallin. Immunolocalization of the same particles using antiserum specific for gamma- and beta-crystallins demonstrated preferential binding of these crystallins to the central region of the alpha-crystallin complex. Together, these results provide evidence that in the intact lens, the alpha-crystallins are functionally important molecular chaperones.

  1. A neuronal nicotinic acetylcholine receptor subunit (alpha 7) is developmentally regulated and forms a homo-oligomeric channel blocked by alpha-BTX.

    PubMed

    Couturier, S; Bertrand, D; Matter, J M; Hernandez, M C; Bertrand, S; Millar, N; Valera, S; Barkas, T; Ballivet, M

    1990-12-01

    cDNA and genomic clones encoding alpha 7, a novel neuronal nicotinic acetylcholine receptor (nAChR) alpha subunit, were isolated and sequenced. The mature alpha 7 protein (479 residues) has moderate homology with all other alpha and non-alpha nAChR subunits and probably assumes the same transmembrane topology. alpha 7 transcripts transiently accumulate in the developing optic tectum between E5 and E16. They are present in both the deep and the superficial layers of E12 tectum. In Xenopus oocytes, the alpha 7 protein assembles into a homo-oligomeric channel responding to acetylcholine and nicotine. The alpha 7 channel desensitizes very rapidly, rectifies strongly above -20 mV, and is blocked by alpha-bungarotoxin. A bacterial fusion protein encompassing residues 124-239 of alpha 7 binds labeled alpha-bungarotoxin. We conclude that alpha-bungarotoxin binding proteins in the vertebrate nervous system can function as nAChRs.

  2. Development of CD8 alpha/beta + TCR alpha beta intestinal intraepithelial lymphocytes in athymic nu/nu mice and participation in regional immune responses.

    PubMed Central

    Emoto, M; Emoto, Y; Kaufmann, S H

    1996-01-01

    On the basis of the CD8 coreceptor expression, T-cell receptor (TCR)alpha beta-bearing intestinal intraepithelial lymphocytes (i-IEL) segregate into two populations. The CD8 alpha alpha + TCR alpha beta i-IEL develop thymus independently, whereas the CD8 alpha beta + TCR alpha beta i-IEL are generally considered to be thymus dependent. Flow cytometry analysis revealed a distinct population of CD8 alpha beta + TCR alpha beta i-IEL in individual athymic nu/nu mice. The i-IEL encompassing CD8 alpha beta + TCR alpha beta cells expressed potent cytolytic and interferon-gamma-producing activities. These findings demonstrate that CD8 alpha beta + TCR alpha beta i-IEL can develop in nu/nu mice independently from a functional thymus and suggest that these cells, directly or indirectly, perform biological functions in the gut. PMID:8881753

  3. The Alpha-1A Adrenergic Receptor in the Rabbit Heart.

    PubMed

    Thomas, R Croft; Cowley, Patrick M; Singh, Abhishek; Myagmar, Bat-Erdene; Swigart, Philip M; Baker, Anthony J; Simpson, Paul C

    2016-01-01

    The alpha-1A-adrenergic receptor (AR) subtype is associated with cardioprotective signaling in the mouse and human heart. The rabbit is useful for cardiac disease modeling, but data on the alpha-1A in the rabbit heart are limited. Our objective was to test for expression and function of the alpha-1A in rabbit heart. By quantitative real-time reverse transcription PCR (qPCR) on mRNA from ventricular myocardium of adult male New Zealand White rabbits, the alpha-1B was 99% of total alpha-1-AR mRNA, with <1% alpha-1A and alpha-1D, whereas alpha-1A mRNA was over 50% of total in brain and liver. Saturation radioligand binding identified ~4 fmol total alpha-1-ARs per mg myocardial protein, with 17% alpha-1A by competition with the selective antagonist 5-methylurapidil. The alpha-1D was not detected by competition with BMY-7378, indicating that 83% of alpha-1-ARs were alpha-1B. In isolated left ventricle and right ventricle, the selective alpha-1A agonist A61603 stimulated a negative inotropic effect, versus a positive inotropic effect with the nonselective alpha-1-agonist phenylephrine and the beta-agonist isoproterenol. Blood pressure assay in conscious rabbits using an indwelling aortic telemeter showed that A61603 by bolus intravenous dosing increased mean arterial pressure by 20 mm Hg at 0.14 μg/kg, 10-fold lower than norepinephrine, and chronic A61603 infusion by iPRECIO programmable micro Infusion pump did not increase BP at 22 μg/kg/d. A myocardial slice model useful in human myocardium and an anthracycline cardiotoxicity model useful in mouse were both problematic in rabbit. We conclude that alpha-1A mRNA is very low in rabbit heart, but the receptor is present by binding and mediates a negative inotropic response. Expression and function of the alpha-1A in rabbit heart differ from mouse and human, but the vasopressor response is similar to mouse. PMID:27258143

  4. The Alpha-1A Adrenergic Receptor in the Rabbit Heart

    PubMed Central

    Myagmar, Bat-Erdene; Swigart, Philip M.; Baker, Anthony J.; Simpson, Paul C.

    2016-01-01

    The alpha-1A-adrenergic receptor (AR) subtype is associated with cardioprotective signaling in the mouse and human heart. The rabbit is useful for cardiac disease modeling, but data on the alpha-1A in the rabbit heart are limited. Our objective was to test for expression and function of the alpha-1A in rabbit heart. By quantitative real-time reverse transcription PCR (qPCR) on mRNA from ventricular myocardium of adult male New Zealand White rabbits, the alpha-1B was 99% of total alpha-1-AR mRNA, with <1% alpha-1A and alpha-1D, whereas alpha-1A mRNA was over 50% of total in brain and liver. Saturation radioligand binding identified ~4 fmol total alpha-1-ARs per mg myocardial protein, with 17% alpha-1A by competition with the selective antagonist 5-methylurapidil. The alpha-1D was not detected by competition with BMY-7378, indicating that 83% of alpha-1-ARs were alpha-1B. In isolated left ventricle and right ventricle, the selective alpha-1A agonist A61603 stimulated a negative inotropic effect, versus a positive inotropic effect with the nonselective alpha-1-agonist phenylephrine and the beta-agonist isoproterenol. Blood pressure assay in conscious rabbits using an indwelling aortic telemeter showed that A61603 by bolus intravenous dosing increased mean arterial pressure by 20 mm Hg at 0.14 μg/kg, 10-fold lower than norepinephrine, and chronic A61603 infusion by iPRECIO programmable micro Infusion pump did not increase BP at 22 μg/kg/d. A myocardial slice model useful in human myocardium and an anthracycline cardiotoxicity model useful in mouse were both problematic in rabbit. We conclude that alpha-1A mRNA is very low in rabbit heart, but the receptor is present by binding and mediates a negative inotropic response. Expression and function of the alpha-1A in rabbit heart differ from mouse and human, but the vasopressor response is similar to mouse. PMID:27258143

  5. The complete cDNA sequence of laminin alpha 4 and its relationship to the other human laminin alpha chains.

    PubMed

    Richards, A; Al-Imara, L; Pope, F M

    1996-06-15

    We previously localised the gene (LAMA4) encoding a novel laminin alpha 4 chain to chromosome 6q21. In this study, we describe the complete coding sequence and compare the protein with the other three known human laminin alpha chains. Although closely linked to LAMA2, the LAMA4 product most closely resembles laminin alpha 3, a constituent of laminin 5. Like laminin alpha 3A, the alpha 4 chain is a truncated version of the alpha 1 and alpha 2 chains, with a much reduced short arm. While the alpha 4 molecule is most similar to alpha 3, it shares some features of the C-terminal domains G4 and G5 in common with alpha 2. Unlike the LAMA3 gene, LAMA4 appears to encode only a single transcript, as determined by 5' rapid amplification of cDNA ends. The cDNA sequence encodes 1816 amino acids, which include a 24-residue signal peptide. The gene is expressed in skin, placenta, heart, lung, skeletal muscle, and pancreas. We have also shown that the mRNA can be readily reverse transcribed and amplified from cultured dermal fibroblasts. PMID:8706685

  6. alpha-decay half-lives and Q{sub a}lpha values of superheavy nuclei

    SciTech Connect

    Dong Jianmin; Zuo Wei; Gu Jianzhong; Wang Yanzhao; Peng Bangbao

    2010-06-15

    The alpha-decay half-lives of recently synthesized superheavy nuclei (SHN) are investigated by employing a unified fission model (UFM) where a new method to calculate the assault frequency of alpha emission is used. The excellent agreement with the experimental data indicates the UFM is a useful tool to investigate these alpha decays. It is found that the alpha-decay half-lives become more and more insensitive to the Q{sub a}lpha values as the atomic number increases on the whole, which is favorable for us to predict the half-lives of SHN. In addition, a formula is proposed to compute the Q{sub a}lpha values for the nuclei with Z>=92 and N>=140 with a good accuracy, according to which the long-lived SHN should be neutron rich. Several weeks ago, two isotopes of a new element with atomic number Z=117 were synthesized and their alpha-decay chains have been observed. The Q{sub a}lpha formula is found to work well for these nuclei, confirming its predictive power. The experimental half-lives are well reproduced by employing the UFM with the experimental Q{sub a}lpha values. This fact that the experimental half-lives are compatible with experimental Q{sub a}lpha values supports the synthesis of a new element 117 and the experimental measurements to a certain extent.

  7. Characterization and functional properties of the alpha-amylase inhibitor (alpha-AI) from kidney bean (Phaseolus vulgaris) seeds.

    PubMed

    Le Berre-Anton, V; Bompard-Gilles, C; Payan, F; Rougé, P

    1997-11-14

    Alpha-amylase inhibitor (alpha-AI) from kidney bean (Phaseolus vulgaris L. cv Tendergreen) seeds has been purified to homogeneity by heat treatment in acidic medium, ammonium sulphate fractionation, chromatofocusing and gel filtration. Two isoforms, alpha-AI1 and alpha-AI1', of 43 kDa have been isolated which differ from each other by their isoelectric points and neutral sugar contents. The major isoform alpha-AI1 inhibited human and porcine pancreatic alpha-amylases (PPA) but was devoid of activity on alpha-amylases of bacterial or fungal origins. As shown on the Lineweaver-Burk plots, the nature of the inhibition is explained by a mixed non-competitive inhibition mechanism. Alpha-AI1 formed a 1:2 stoichiometric complex with PPA which showed an optimum pH of 4.5 at 30 degrees C. Owing to the low optimum pH found for alpha-AI activity, inhibitor-containing diets such as beans or transgenic plants expressing alpha-AI should be devoid of any harmful effect on human health. PMID:9428656

  8. A cis-proline in alpha-hemoglobin stabilizing protein directs the structural reorganization of alpha-hemoglobin.

    PubMed

    Gell, David A; Feng, Liang; Zhou, Suiping; Jeffrey, Philip D; Bendak, Katerina; Gow, Andrew; Weiss, Mitchell J; Shi, Yigong; Mackay, Joel P

    2009-10-23

    alpha-Hemoglobin (alphaHb) stabilizing protein (AHSP) is expressed in erythropoietic tissues as an accessory factor in hemoglobin synthesis. AHSP forms a specific complex with alphaHb and suppresses the heme-catalyzed evolution of reactive oxygen species by converting alphaHb to a conformation in which the heme is coordinated at both axial positions by histidine side chains (bis-histidyl coordination). Currently, the detailed mechanism by which AHSP induces structural changes in alphaHb has not been determined. Here, we present x-ray crystallography, NMR spectroscopy, and mutagenesis data that identify, for the first time, the importance of an evolutionarily conserved proline, Pro(30), in loop 1 of AHSP. Mutation of Pro(30) to a variety of residue types results in reduced ability to convert alphaHb. In complex with alphaHb, AHSP Pro(30) adopts a cis-peptidyl conformation and makes contact with the N terminus of helix G in alphaHb. Mutations that stabilize the cis-peptidyl conformation of free AHSP, also enhance the alphaHb conversion activity. These findings suggest that AHSP loop 1 can transmit structural changes to the heme pocket of alphaHb, and, more generally, highlight the importance of cis-peptidyl prolyl residues in defining the conformation of regulatory protein loops.

  9. Solution conformation of alpha-conotoxin GIC, a novel potent antagonist of alpha3beta2 nicotinic acetylcholine receptors.

    PubMed Central

    Chi, Seung-Wook; Kim, Do-Hyoung; Olivera, Baldomero M; McIntosh, J Michael; Han, Kyou-Hoon

    2004-01-01

    Alpha-conotoxin GIC is a 16-residue peptide isolated from the venom of the cone snail Conus geographus. Alpha-conotoxin GIC potently blocks the alpha3beta2 subtype of human nicotinic acetylcholine receptor, showing a high selectivity for neuronal versus muscle subtype [McIntosh, Dowell, Watkins, Garrett, Yoshikami, and Olivera (2002) J. Biol. Chem. 277, 33610-33615]. We have now determined the three-dimensional solution structure of alpha-conotoxin GIC by NMR spectroscopy. The structure of alpha-conotoxin GIC is well defined with backbone and heavy atom root mean square deviations (residues 2-16) of 0.53 A and 0.96 A respectively. Structure and surface comparison of alpha-conotoxin GIC with the other alpha4/7 subfamily conotoxins reveals unique structural aspects of alpha-conotoxin GIC. In particular, the structural comparison between alpha-conotoxins GIC and MII indicates molecular features that may confer their similar receptor specificity profile, as well as those that provide the unique binding characteristics of alpha-conotoxin GIC. PMID:14992691

  10. Taraxacum officinale induces cytotoxicity through TNF-alpha and IL-1alpha secretion in Hep G2 cells.

    PubMed

    Koo, Hyun-Na; Hong, Seung-Heon; Song, Bong-Keun; Kim, Cheorl-Ho; Yoo, Young-Hyun; Kim, Hyung-Min

    2004-01-16

    Taraxacum officinale (TO) has been frequently used as a remedy for women's disease (e.g. breast and uterus cancer) and disorders of the liver and gallbladder. Several earlier studies have indicated that TO exhibits anti-tumor properties, but its mechanism remains to be elucidated. In this study, we investigated the effect of TO on the cytotoxicity and production of cytokines in human hepatoma cell line, Hep G2. Our results show that TO decreased the cell viability by 26%, and significantly increased the tumor necrosis factor (TNF)-alpha and interleukin (IL)-1alpha production compared with media control (about 1.6-fold for TNF-alpha, and 2.4-fold for IL-1alpha, P < 0.05). Also, TO strongly induced apoptosis of Hep G2 cells as determined by flow cytometry. Increased amounts of TNF-alpha and IL-1alpha contributed to TO-induced apoptosis. Anti-TNF-alpha and IL-1alpha antibodies almost abolished it. These results suggest that TO induces cytotoxicity through TNF-alpha and IL-1alpha secretion in Hep G2 cells.

  11. Experimental and theoretical electron density distribution of alpha,alpha-trehalose dihydrate.

    PubMed

    Stevens, Edwin D; Dowd, Michael K; Johnson, Glenn P; French, Alfred D

    2010-07-01

    alpha,alpha-Trehalose is of interest because of its cryoprotective and antidessicant properties, and because it possesses various technical anomalies such as (13)C NMR spectra that give misleading indications of intramolecular structural symmetry. It is a non-reducing disaccharide, with the glycosidic oxygen atom shared by the anomeric carbon atoms of the two glucose rings, and is therefore subject to a proposed 'overlapping'exo-anomeric effect. We report here a study of the electron density of trehalose with X-ray diffraction and quantum mechanics calculations, similar to a recent study of sucrose, also a non-reducing molecule. In particular we studied the electron density around the glycosidic linkage and the hydrogen bonding with both deformation density and Atoms in Molecules (AIM) analyses. A total of 129,952 single crystal X-ray intensity measurements were collected on alpha,alpha-trehalose dihydrate to a resolution of sintheta/lambda=1.18A(-1) at 100K and refined with an aspherical multipole model to a final agreement factor of R(1)=0.0160. Wavefunctions were calculated at three levels of theory. Redistribution of electron density due to anomeric effects was reduced in trehalose, compared to sucrose. Five new C-Hcdots, three dots, centeredO hydrogen bonds were confirmed with bond critical points and bond paths from AIM analyses, as were the previously proposed O-Hcdots, three dots, centeredO hydrogen bonds. PMID:20381017

  12. Tumor Necrosis Factor alpha (TNF{alpha}) regulates CD40 expression through SMAR1 phosphorylation

    SciTech Connect

    Singh, Kamini; Sinha, Surajit; Malonia, Sunil Kumar; Chattopadhyay, Samit

    2010-01-08

    CD40 plays an important role in mediating inflammatory response and is mainly induced by JAK/STAT phosphorylation cascade. TNF{alpha} is the key cytokine that activates CD40 during inflammation and tumorigenesis. We have earlier shown that SMAR1 can repress the transcription of Cyclin D1 promoter by forming a HDAC1 dependent repressor complex. In this study, we show that SMAR1 regulates the transcription of NF-{kappa}B target gene CD40. SMAR1 recruits HDAC1 and forms a repressor complex on CD40 promoter and keeps its basal transcription in check. Further, we show that TNF{alpha} stimulation induces SMAR1 phosphorylation at Ser-347 and promotes its cytoplasmic translocation, thus releasing its negative effect. Concomitantly, TNF{alpha} induced phosphorylation of STAT1 at Tyr-701 by JAK1 facilitates its nuclear translocation and activation of CD40 through p300 recruitment and core Histone-3 acetylation. Thus, TNF{alpha} mediated regulation of CD40 expression occurs by dual phosphorylation of SMAR1 and STAT1.

  13. Aqueous chemical growth of alpha-Fe2O3-alpha-Cr203 nanocompositethin films

    SciTech Connect

    Vayssieres, Lionel; Guo, Jinghua; Nordgren, Joseph

    2001-06-30

    We are reporting here on the inexpensive fabrication and optical properties of an iron(III) oxide chromium(III) oxide nanocomposite thin film of corundum crystal structure. Its novel and unique-designed architecture consists of uniformed, well-defined and oriented nanorods of Hematite (alpha-Fe2O3) of 50 nm in diameter and 500nm in length and homogeneously distributed nonaggregated monodisperse spherical nanoparticles of Eskolaite (alpha-Cr2O3) of 250 nm in diameter. This alpha-Fe2O3 alpha-Cr2O3 nanocomposite thin film is obtained by growing, directly onto transparent polycrystalline conducting substrate, an oriented layer of hematite nanorods and growing subsequently, the eskolaite layer. The synthesis is carried out by a template-free, low-temperature, multilayer thin film coating process using aqueous solution of metal salts as precursors. Almost 100 percent of the light is absorbed by the composite film between 300 and 525 nm and 40 percent at 800 nm which yields great expectations as photoanode materials for photovoltaic cells and photocatalytic devices.

  14. Arachidonic acid mediates the formation of abundant alpha-helical multimers of alpha-synuclein

    NASA Astrophysics Data System (ADS)

    Iljina, Marija; Tosatto, Laura; Choi, Minee L.; Sang, Jason C.; Ye, Yu; Hughes, Craig D.; Bryant, Clare E.; Gandhi, Sonia; Klenerman, David

    2016-09-01

    The protein alpha-synuclein (αS) self-assembles into toxic beta-sheet aggregates in Parkinson’s disease, while it is proposed that αS forms soluble alpha-helical multimers in healthy neurons. Here, we have made αS multimers in vitro using arachidonic acid (ARA), one of the most abundant fatty acids in the brain, and characterized them by a combination of bulk experiments and single-molecule Fӧrster resonance energy transfer (sm-FRET) measurements. The data suggest that ARA-induced oligomers are alpha-helical, resistant to fibril formation, more prone to disaggregation, enzymatic digestion and degradation by the 26S proteasome, and lead to lower neuronal damage and reduced activation of microglia compared to the oligomers formed in the absence of ARA. These multimers can be formed at physiologically-relevant concentrations, and pathological mutants of αS form less multimers than wild-type αS. Our work provides strong biophysical evidence for the formation of alpha-helical multimers of αS in the presence of a biologically relevant fatty acid, which may have a protective role with respect to the generation of beta-sheet toxic structures during αS fibrillation.

  15. Arachidonic acid mediates the formation of abundant alpha-helical multimers of alpha-synuclein

    PubMed Central

    Iljina, Marija; Tosatto, Laura; Choi, Minee L.; Sang, Jason C.; Ye, Yu; Hughes, Craig D.; Bryant, Clare E.; Gandhi, Sonia; Klenerman, David

    2016-01-01

    The protein alpha-synuclein (αS) self-assembles into toxic beta-sheet aggregates in Parkinson’s disease, while it is proposed that αS forms soluble alpha-helical multimers in healthy neurons. Here, we have made αS multimers in vitro using arachidonic acid (ARA), one of the most abundant fatty acids in the brain, and characterized them by a combination of bulk experiments and single-molecule Fӧrster resonance energy transfer (sm-FRET) measurements. The data suggest that ARA-induced oligomers are alpha-helical, resistant to fibril formation, more prone to disaggregation, enzymatic digestion and degradation by the 26S proteasome, and lead to lower neuronal damage and reduced activation of microglia compared to the oligomers formed in the absence of ARA. These multimers can be formed at physiologically-relevant concentrations, and pathological mutants of αS form less multimers than wild-type αS. Our work provides strong biophysical evidence for the formation of alpha-helical multimers of αS in the presence of a biologically relevant fatty acid, which may have a protective role with respect to the generation of beta-sheet toxic structures during αS fibrillation. PMID:27671749

  16. Tumor necrosis factor-alpha antagonist-induced sarcoidosis.

    PubMed

    Clementine, Rochelle Robicheaux; Lyman, Justin; Zakem, Jerald; Mallepalli, Jyothi; Lindsey, Stephen; Quinet, Robert

    2010-09-01

    Sarcoidosis is a multisystem granulomatous disease of unknown etiology. Tumor necrosis factor (TNF)-alpha is an important player in granuloma formation, and recent clinical trials have investigated the efficacy of TNF-alpha inhibitors in sarcoidosis. Paradoxically, there are several case reports in the medical literature describing the development of sarcoidosis in patients treated with TNF-alpha inhibitors. We describe 3 cases of TNF-alpha antagonist-induced sarcoidosis: 1 case of pulmonary, ocular and cutaneous sarcoidosis developing in a patient receiving infliximab for erosive rheumatoid arthritis, 1 case of etanercept-induced sarcoidosis in a patient with seronegative rheumatoid arthritis, and 1 case of sarcoidosis developing in a patient receiving etanercept for erosive rheumatoid arthritis. We also provide a brief discussion on the role of TNF alpha in granuloma formation and implications in the use of TNF-alpha antagonists in autoimmune disease.

  17. Turbulent transport of alpha particles in reactor plasmas

    SciTech Connect

    Estrada-Mila, C.; Candy, J.; Waltz, R. E.

    2006-11-15

    A systematic study of the behavior of energetic ions in reactor plasmas is presented. Using self-consistent gyrokinetic simulations, in concert with an analytic asymptotic theory, it is found that alpha particles can interact significantly with core ion-temperature-gradient turbulence. Specifically, the per-particle flux of energetic alphas is comparable to the per-particle flux of thermal species (deuterium or helium ash). This finding opposes the conventional wisdom that energetic ions, because of their large gyroradii, do not interact with the turbulence. For the parameters studied, a turbulent modification of the alpha-particle density profile appears to be stronger than turbulent modification of the alpha-particle pressure profile. Crude estimates indicate that the alpha density modification, which is directly proportional to the core turbulence intensity, could be in the range of 15% at midradius in a reactor. The corresponding modification of the alpha-particle pressure profile is predicted to be smaller (in the 1% range)

  18. Technical Equivalency Documentation for a New Alpha Spectroscopy System

    SciTech Connect

    Hickman, D P; Fisher, S K; Zeman, R A; Hann, P R

    2005-04-05

    The response of a new Canberra{trademark} Alpha Analyst (Chamber No.'s 101-124) used by the Hazards Control, Radiation Safety Section, WBC/Spectroscopy Team has been studied with respect to an existing Canberra system. The existing Canberra system consists of thirty six Model 7401 alpha spectrometry chambers (Chamber No.'s 1-36) and has been DOELAP qualified for the routine Alpha Spectroscopy program used in LLNL's in vitro bioassay program. The new Alpha Analyst system is an automated system that is controlled by the same software and computer system as that used for the existing Canberra system. This document compares results from the existing Alpha System with the newer Alpha Analyst system.

  19. DNA polymerase alpha and beta in the California urchin.

    PubMed Central

    Racine, F M; Morris, P W

    1978-01-01

    DNA polymerase alpha and beta were identified in the urchin, Strongylocentrotus purpuratus. The DNA polymerase beta sedimented at 3.4 S, constituted 5% of total DNA polymerase activity, and was resistant to N-ethylmaleimide and high ionic strength. The polymerase alpha sedimented at 6--8 S, was inhibited by N-ethylmalemide or 0.1 M (NH4)2SO4, and was dependent upon glycerol for preservation of activity. Both the polymerases alpha and beta were nuclear associated in embryos. The DNA polymerase alpha was markedly heterogeneous on DEAE-Sephadex ion exchange and showed three modal polymerase species. These polymerase alpha species were indistinguishable by template activity assays but the DNA polymerase associated ribonucleotidyl transferase (Biochemistry 75 : 3106-3113, 1976) was found predominantly with only one of the DNA polymerase alpha species. PMID:569291

  20. Nonlinear feedback control for high alpha flight

    NASA Technical Reports Server (NTRS)

    Stalford, Harold

    1990-01-01

    Analytical aerodynamic models are derived from a high alpha 6 DOF wind tunnel model. One detail model requires some interpolation between nonlinear functions of alpha. One analytical model requires no interpolation and as such is a completely continuous model. Flight path optimization is conducted on the basic maneuvers: half-loop, 90 degree pitch-up, and level turn. The optimal control analysis uses the derived analytical model in the equations of motion and is based on both moment and force equations. The maximum principle solution for the half-loop is poststall trajectory performing the half-loop in 13.6 seconds. The agility induced by thrust vectoring capability provided a minimum effect on reducing the maneuver time. By means of thrust vectoring control the 90 degrees pitch-up maneuver can be executed in a small place over a short time interval. The agility capability of thrust vectoring is quite beneficial for pitch-up maneuvers. The level turn results are based currently on only outer layer solutions of singular perturbation. Poststall solutions provide high turn rates but generate higher losses of energy than that of classical sustained solutions.

  1. L-alpha intensity in coronal streamers

    NASA Technical Reports Server (NTRS)

    Noci, G.; Poletto, G.; Suess, S. T.; Wang, A.-H.; Wu, S. T.

    1993-01-01

    White-light images are presently the primary source of information on physical conditions in the solar corona at distances greater than a few tenths of a solar radius above the limb. As a consequence, we still only have an incomplete description of structures extending beyond the solar limb. In particular, streamers, although observed for decades, represent a poorly known phenomenon. SOHO, to be launched in 1995, will be able to make long-term observations of these features up to heights of a few solar radii, both in white light and UV. In this paper we present simulations of L-alpha intensity in coronal streamers, based on the two-dimensional (2D) model developed by Wang et at. (1992, 1993) via a time-dependent numerical relaxation approach. Because the model is 2D, we make an a priori hypothesis about the extension of streamers in the third dimension. L-alpha data, obtained from a rocket (Kohl et al., 1983), allowed us to identify a shape which fits the observations.

  2. Clearings in Ly-alpha forests

    NASA Astrophysics Data System (ADS)

    Kovner, Israel; Rees, Martin J.

    1989-10-01

    At sufficient resolution, QSO spectra can be examined for patches of reduced H I column density in Ly-alpha clouds. Statistics of these clearings can constrain the fraction of the ionizing background contributed by compact sources and (possibly) their lifetimes and beaming. This is demonstrated first in a simple Euclidean setup and then in a model which takes into account the expansion of the universe and the cosmological evolution of the factors involved. The expected number of clearings in a Ly-alpha forest extending back to the formation epoch of compact sources of ionizing radiation (CSIRs) is about 1/4, if the CSIRs are important ionizing agents, and if the transience of CSIRs is unimportant. The particular properties of the CSIR population, e.g., their luminosity function, have little importance. However, expected number of clearings can be much larger if the CSIR lifetimes are short compared to the light crossing times of the domains of dominance, or if the CSIRs turned on sharply at a time when the ionization rate due to competing processes was low.

  3. MFTF-. cap alpha. + T progress report

    SciTech Connect

    Nelson, W.D.

    1985-04-01

    Early in FY 1983, several upgrades of the Mirror Fusion Test Facility (MFTF-B) at Lawrence Livermore National Laboratory (LLNL) were proposed to the fusion community. The one most favorably received was designated MFTF-..cap alpha..+T. The engineering design of this device, guided by LLNL, has been a principal activity of the Fusion Engineering Design Center during FY 1983. This interim progress report represents a snapshot of the device design, which was begun in FY 1983 and will continue for several years. The report is organized as a complete design description. Because it is an interim report, some parts are incomplete; they will be supplied as the design study proceeds. As described in this report, MFTF-..cap alpha..+T uses existing facilities, many MFTF-B components, and a number of innovations to improve on the physics parameters of MFTF-B. It burns deuterium-tritium and has a central-cell Q of 2, a wall loading GAMMA/sub n/ of 2 MW/m/sup 2/ (with a central-cell insert module), and an availability of 10%. The machine is fully shielded, allows hands-on maintenance of components outside the vacuum vessel 24 h after shutdown, and has provisions for repair of all operating components.

  4. L-alpha intensity in coronal streamers

    NASA Astrophysics Data System (ADS)

    Noci, G.; Poletto, G.; Suess, S. T.; Wang, A.-H.; Wu, S. T.

    1993-09-01

    White-light images are presently the primary source of information on physical conditions in the solar corona at distances greater than a few tenths of a solar radius above the limb. As a consequence, we still only have an incomplete description of structures extending beyond the solar limb. In particular, streamers, although observed for decades, represent a poorly known phenomenon. SOHO, to be launched in 1995, will be able to make long-term observations of these features up to heights of a few solar radii, both in white light and UV. In this paper we present simulations of L-alpha intensity in coronal streamers, based on the two-dimensional (2D) model developed by Wang et at. (1992, 1993) via a time-dependent numerical relaxation approach. Because the model is 2D, we make an a priori hypothesis about the extension of streamers in the third dimension. L-alpha data, obtained from a rocket (Kohl et al., 1983), allowed us to identify a shape which fits the observations.

  5. {alpha} decay of {sup 194}At

    SciTech Connect

    Andreyev, A. N.; Antalic, S.; Streicher, B.; Saro, S.; Venhart, M.; Ackermann, D.; Heinz, S.; Hessberger, F. P.; Kojouharov, I.; Kindler, B.; Lommel, B.; Mann, R.; Sulignano, B.; Bianco, L.; Page, R. D.; Sapple, P.; Thomson, J.; Franchoo, S.; Hofmann, S.; Huyse, M.

    2009-06-15

    Detailed {alpha}-decay studies of the neutron-deficient isotope {sup 194}At have been performed in the complete fusion reaction {sup 56}Fe+{sup 141}Pr{yields}{sup 194}At+3n at the velocity filter SHIP. Two {alpha}-decaying isomeric states with half-lives of T{sub 1/2}({sup 194}At{sup m1})=310(8) ms and T{sub 1/2}({sup 194}At{sup m2})=253(10) ms were identified in this nucleus. Their complex decays to the states in the daughter nucleus {sup 190}Bi are discussed in the article. We propose that similar to the case of the neighboring {sup 191,192,193,195}At isotopes, the oblate-deformed configurations based on the proton 1/2{sup +}[440] and/or 7/2{sup -}[514] Nilsson orbitals become important in {sup 194}At. A new isomeric state with the half-life of 175(8) ns was observed in {sup 190}Bi.

  6. Processing of sintered alpha SiC

    NASA Technical Reports Server (NTRS)

    Storm, R. S.

    1984-01-01

    Processing methods of sintered alpha SiC for engine applications are developed in a cost effective manner, using a submicron sized powder blended with sintering aids (boron and carbon). The processes for forming a green powder compact, such as dry pressing, cold isostatic pressing and green machining, slip casting, aqueous extrusion, plastic extrusion, and injection molding, are described. Dry pressing is the simplest route to component fabrication, and is carried out at approximately 10,000 psi pressure, while in the cold isostatic method the pressure could go as high as 20,000 psi. Surfactants are added to control settling rates and casting characteristics in the slip casting. The aqueous extrusion process is accomplished by a hydraulic ram forcing the aqueous mixture through a die. The plastic forming processes of extrusion and injection molding offer the potential of greater diversity in shape capacity. The physical properties of sintered alpha SiC (hardness, Young's modulus, shear modulus, and thermal diffusivity) are extensively tested. Corrosion resistance test results of silicon carbide are included.

  7. Waves for Alpha-Channeling in Mirror Machines

    SciTech Connect

    A. I. Zhmoginov and N. J. Fisch

    2009-07-08

    Alpha-channeling can, in principle, be implemented in mirror machines via exciting weaklydamped modes in the ion cyclotron frequency range with perpendicular wavelengths smaller than the alpha particle gyroradius. Assuming quasi-longitudinal or quasi-transverse wave propagation, we search systematically for suitable modes in mirror plasmas. Considering two device designs, a proof-of-principle facility and a fusion rector prototype, we in fact identify candidate modes suitable for alpha-channeling.

  8. Lateralized modulation of posterior alpha oscillations in children.

    PubMed

    Vollebregt, Madelon A; Zumer, Johanna M; Ter Huurne, Niels; Castricum, Jesminne; Buitelaar, Jan K; Jensen, Ole

    2015-12-01

    The evidence for a functionally inhibitory role of alpha oscillations is growing stronger, mostly derived from studies in healthy adults investigating spatial attention. It remains unexplored if the modulation of alpha band oscillations plays a similar functional role in typically developing children. The aim of this study was to characterize alpha modulations in children in relation to attentional performance. To this end, the posterior alpha activity (8-12Hz) in children between 7 and 10years old was measured using EEG while they performed a visuospatial covert attention task. We found that the alpha activity decreased in the hemisphere contralateral to the attended hemifield, whereas it relatively increased in the other hemisphere. In addition, we found that the degree of lateralized alpha modulation predicted performance on the attention task by negatively predicting the response time on invalid trials. Of note, children who were behaviorally less influenced by spatial cueing also were children with a clear lateralized alpha modulation pattern, with a significantly stronger alpha lateralization in the left hemisphere than children who were influenced more by spatial cueing. In addition, a bias to the right visual field such as that commonly observed in children, was significantly smaller or absent in the children influenced least by spatial cueing. Among all children, the magnitude of this visual field bias was positively related to the ability to modulate alpha activity. In conclusion, we have shown that the pattern of alpha oscillations modulated by attention is already present in 7-10year old typically developing children. Although a similar pattern is observed in adults, the consequences for behavior are different. The fact that alpha modulation is already present at this age opens up the possibility of using hemispheric alpha lateralization as a tool to study the physiological basis of attention deficits in clinical disorders such as ADHD.

  9. Alpha inelastic scattering and cluster structures in {sup 24}Mg

    SciTech Connect

    Kawabata, T.; Ishiguro, Y.; Nozawa, Y.; Tomida, N.; Yokota, N.; Adachi, T.; Fujiwara, M.; Hatanaka, K.; Tamii, A.; Yasuda, Y.; Zenihiro, J.; Itoh, M.; Takahashi, T.; Yoshida, H. P.; Maeda, Y.; Miyasako, H.; Saito, T.; Matsubara, H.; Sasamoto, Y.; Tokieda, H.

    2011-05-06

    The alpha inelastic scattering from {sup 24}Mg was measured to obtain the isoscalar natural-parity excitation strengths and to search for the {alpha}-condensed states. The multipole decomposition analysis for the measured cross sections was performed. The strength distributions for the {Delta}L = 0-3 were successfully obtained and the possible candidates for the {alpha}-condensed states around the {sup 16}O core were found.

  10. Alpha particle destabilization of the toroidicity-induced Alfven eigenmodes

    SciTech Connect

    Cheng, C.Z.

    1990-10-01

    The high frequency, low mode number toroidicity-induced Alfven eigenmodes (TAE) are shown to be driven unstable by the circulating and/or trapped {alpha}-particles through the wave-particle resonances. Satisfying the resonance condition requires that the {alpha}-particle birth speed v{sub {alpha}} {ge} v{sub A}/2{vert bar}m-nq{vert bar}, where v{sub A} is the Alfven speed, m is the poloidal model number, and n is the toroidal mode number. To destabilize the TAE modes, the inverse Landau damping associated with the {alpha}-particle pressure gradient free energy must overcome the velocity space Landau damping due to both the {alpha}-particles and the core electrons and ions. The growth rate was studied analytically with a perturbative formula derived from the quadratic dispersion relation, and numerically with the aid of the NOVA-K code. Stability criteria in terms of the {alpha}-particle beta {beta}{sub {alpha}}, {alpha}-particle pressure gradient parameter ({omega}{sub {asterisk}}/{omega}{sub A}) ({omega}{sub {asterisk}} is the {alpha}-particle diamagnetic drift frequency), and (v{sub {alpha}}/v{sub A}) parameters will be presented for TFTR, CIT, and ITER tokamaks. The volume averaged {alpha}-particle beta threshold for TAE instability also depends sensitively on the core electron and ion temperature. Typically the volume averaged {alpha}-particle beta threshold is in the order of 10{sup {minus}4}. Typical growth rates of the n=1 TAE mode can be in the order of 10{sup {minus}2}{omega}{sub A}, where {omega}{sub A}=v{sub A}/qR. Other types of global Alfven waves are stable in D-T tokamaks due to toroidal coupling effects.

  11. Evidence for Alpha Receptors in the Human Ureter

    NASA Astrophysics Data System (ADS)

    Madeb, Ralph; Knopf, Joy; Golijanin, Dragan; Bourne, Patricia; Erturk, Erdal

    2007-04-01

    An immunohistochemical and western blot expression analysis of human ureters was performed in order to characterize the alpha-1-adrenergic receptor distribution along the length of the human ureteral wall. Mapping the distribution will assist in understanding the potential role alpha -1-adrenergic receptors and their subtype density might have in the pathophysiology of ureteral colic and stone passage. Patients diagnosed with renal cancer or bladder cancer undergoing nephrectomy, nephroureterectomy, or cystectomy had ureteral specimens taken from the proximal, mid, distal and tunneled ureter. Tissues were processed for fresh frozen examination and fixed in formalin. None of the ureteral specimens were involved with cancer. Serial histologic sections and immunohistochemical studies were performed using antibodies specific for alpha-1-adrenergic receptor subtypes (alpha 1a, alpha 1b, alpha 1d). The sections were examined under a light microscope and scored as positive or negative. In order to validate and quantify the alpha receptor subtypes along the human ureter. Western blotting techniques were applied. Human ureter stained positively for alpha -1-adrenergic receptors. Immunostaining appeared red, with intense reaction in the smooth muscle of the ureter and endothelium of the neighboring blood vessels. There was differential expression between all the receptors with the highest staining for alpha-1D subtype. The highest protein expression for all three subtypes was in the renal pelvis and decreased with advancement along the ureter to the distal ureter. At the distal ureter, there was marked increase in expression as one progressed towards the ureteral orifice. The same pattern of protein expression was exhibited for all three alpha -1-adrenergic receptor subtypes. We provide preliminary evidence for the ability to detect and quantify the alpha-1-receptor subtypes along the human ureter which to the best of our knowledge has never been done with

  12. Self-consistent alpha-particle transport in ignition scenarios

    SciTech Connect

    Kamelander, G.; Woloch, F.; Sdouz, G. )

    1994-05-01

    Recently, fast alpha-particle-driven kinetic Alfven waves were investigated by means of a nonlinear turbulent theory, and an analytic expression for the corresponding diffusion coefficient was derived. This diffusion coefficient is introduced in a kinetic alpha-particle transport code based on the solution of a special Fokker-Planck equation by means of a multigroup formalism. The structure of D[sub [alpha

  13. 5 alpha-reductase deficiency in patients with micropenis.

    PubMed

    Gad, Y Z; Nasr, H; Mazen, I; Salah, N; el-Ridi, R

    1997-03-01

    The enzyme 5 alpha-reductase (5 alpha R), by virtue of its peripheral 5 alpha-reduction of testosterone (T) to dihydrotestosterone (DHT), is believed to play a major role in the differentiation and the subsequent growth of the penis. However, recent studies have reported 5 alpha R deficiency (5 alpha RD) in patients with isolated micropenis and hypothesized that 5 alpha RD is not invariably associated with genital ambiguity. In Egypt, 5 alpha RD has been reported frequently among intersex patients. The aim of this study was to assess the role of 5 alpha RD in the development of micropenis among Egyptian patients with abnormal sexual development. The study included 29 patients who were categorized into three groups (isolated micropenis, 9 patients; microphallus with genital ambiguity, 11 patients; genital ambiguity with normal-sized phallus, 9 patients). Activity of 5 alpha R was assessed by estimating T/DHT ratios in the basal state in pubertal subjects and following human chorionic gonadotropin (HCG) stimulation test in prepubertals. The results showed that the incidence of 5 alpha RD was much higher in cases of ambiguous genitalia with micropenis (5 families out of 10, 50%) than in those with isolated microphallus (1/9, 11.1%) or those with ambiguous genitalia and normal-sized phallus (1/8, 12.5%). In conclusion, the study showed that isolated micropenis is a heterogeneous disorder and that 5 alpha RD, despite its relative prevalence in Egypt, has a minimal role in the aetiology. On the other hand, 5 alpha RD seems to correlate with penile length in intersex cases.

  14. Evolution of the alpha particle driven toroidicity induced Alfven mode

    SciTech Connect

    Wu, Y.; White, R.B.; Cheng, C.Z.

    1994-04-01

    The interaction of alpha particles with a toroidicity induced Alfven eigenmode is investigated self-consistently by using a kinetic dispersion relation. All important poloidal harmonics and their radial mode profiles are included. A Hamiltonian guiding center code is used to simulate the alpha particle motion. The simulations include particle orbit width, nonlinear particle dynamics and the effects of the modes on the particles. Modification of the particle distribution leading to mode saturation is observed. There is no significant alpha particle loss.

  15. Studies of alpha-induced astrophysical reactions at CRIB

    SciTech Connect

    Yamaguchi, H.; Hashimoto, T.; Hayakawa, S.; Binh, D. N.; Kahl, D.; Kubono, S.

    2010-08-12

    CRIB (CNS Radioactive Ion Beam separator) is a low-energy RI beam separator at the Center for Nuclear Study (CNS) of the University of Tokyo. Using the RI beams at CRIB, many measurements on proton alpha resonance scatterings, ({alpha},p) reactions, and others were performed in recent years mainly for studying astrophysical reactions and exotic nuclear structure. Among them, the results on the {sup 7}Li+{alpha} resonance scatterings are presented.

  16. Summary of second generation alpha CAM testing performed at Hanford

    SciTech Connect

    Johnson, M.L.; Sisk, D.R.; Goles, R.W.; Swinth, K.L.; Tinker, M.R.; Hickey, E.E.

    1994-05-01

    Pacific Northwest Laboratory and Westinghouse Hanford Company tested six models of commercially available alpha continuous air monitors (CAMs): the Canberra Alpha Sentry, Eberline Alpha 6A-1, Merlin Gerin A-CAM, NE America CAM1A, SAIC/RADeCO Model 452, and Victoreen Model 758. The CAMs were tested for calibration and workmanship, performance in various environments, and human factors for field use.

  17. Exogenous tumor necrosis factor alpha and interleukin-1 alpha increase resistance to Salmonella typhimurium: efficacy is influenced by the Ity and Lps loci.

    PubMed Central

    Morrissey, P J; Charrier, K; Vogel, S N

    1995-01-01

    Interleukin-1 alpha (IL-1 alpha) or tumor necrosis factor alpha (TNF-alpha) administered prior to infection with Salmonella typhimurium increases survival in mice that are Ityr, not in susceptible Lpsd or Itys mice. Combined IL-1 alpha and TNF-alpha pretreatment results in greater survival than that seen with either cytokine alone in Ityr mice. Treatment after infection with TNF-alpha and/or IL-1 alpha increases the mean time to death but not the survival fraction of Lpsd mice and was ineffective in either Ityr or Itys mice. PMID:7622247

  18. Specificity of G alpha q and G alpha 11 gene expression in platelets and erythrocytes. Expressions of cellular differentiation and species differences.

    PubMed Central

    Johnson, G J; Leis, L A; Dunlop, P C

    1996-01-01

    G alpha q and G alpha 11, members of the Gq family of G-proteins, transduce signals from receptors to the beta isoenzymes of phosphatidyl-inositol-specific phospholipase C (PI-PLC). The receptor specificity of these alpha subunits is unknown. G alpha q and G alpha 11 are ubiquitously expressed in tissues; however, there have been conflicting reports of the presence or absence of G alpha 11 protein in haematopoietic cells. Platelet thromboxane A2/prostaglandin H2 (TXA2/PGH2) receptors activate PI-PLC via G alpha q, but the role of G alpha 11 is uncertain. To define their roles in platelet activation we studied G alpha q and G alpha 11 gene expression by immunotransfer blotting and by reverse transcription of mRNA followed by PCR (RT-PCR) and direct sequencing. An antiserum specific for mouse G alpha 11 failed to identify G alpha 11 in dog or human platelets or in dog liver, a tissue known to contain G alpha 11. RT-PCR performed with gene-specific primers demonstrated G alpha q mRNA, but not G alpha 11 mRNA, in normal human and mouse platelets and in thromboxane-sensitive and thromboxane-insensitive dog platelets. Studies of mouse and dog liver and human retina confirmed that the cDNA, primers and probes used could amplify and recognize G alpha 11 in other tissues. However, species-specific oligonucleotide primers and probes were essential to demonstrate G alpha 11, but not G alpha q, mRNA. Compared with mouse cDNA, dog and human G alpha 11 cDNA had twice as many nucleotide substitutions (approx. 12% compared with approx. 6%) as G alpha q, G alpha q mRNA was also found in mature erythrocytes but G alpha 11 mRNA was not identified, whereas both G alpha q and G alpha 11 mRNAs were found in bone marrow stem cells. Therefore G alpha 11 gene expression in haematopoietic cells is linked with cellular differentiation. The lack of G alpha 11 indicates that signal transduction from platelet TXA2/PGH2 receptors to PI-PLC occurs via G alpha q, and that G alpha 11 deficiency is

  19. Two new 11alpha,12alpha-epoxy-ursan-28,13beta-olides and other triterpenes from Cecropia catharinensis.

    PubMed

    Machado, E C; Yunes, R A; Malheiros, A; Gomez, E C; Delle Monache, F

    2008-01-01

    Three new triterpenes, 2alpha-acetoxy-3beta,19alpha-dihydroxy-11alpha,12alpha-epoxy-ursan-28,13beta-olide, 3beta-acetoxy-2alpha,19alpha-dihydroxy-11alpha,12alpha-epoxy-ursan-28,13beta-olide and 2-O-acetyl-euscaphic acid together eight known triterpenes were isolated from the roots and stems of Cecropia catharinensis. Their structures were determined by detailed analysis of NMR spectra and the relative configurations established by difference nOe experiments. In addition, four flavonoid glucosides (vitexin, isovitexin, orientin and isoorientin) were found in the leaves.

  20. Crystallographic variant selection in {alpha}-{beta} brass

    SciTech Connect

    Stanford, N.; Bate, P.S. . E-mail: pete.bate@man.ac.uk

    2005-02-01

    The transformation texture of {alpha}/{beta} brass with a diffusional Widmanstaetten {alpha} growth morphology has been investigated. Electron micrographs and electron backscattered diffraction was used to determine that the orientation relationship between the {beta} phase and the {alpha} associated with nucleation at {beta} grain boundaries was 44.3 deg <1 1 6>. Crystallographic variant selection was observed across those prior {beta}/{beta} grain boundaries, but this has little effect on the transformation texture due to the crystal symmetry. The effect of the crystallographic variant selection on texture is further weakened by nucleation of diffusional transformed {alpha} in the grain interior.

  1. Anisotropic. cap alpha. -emission of on-line separated isotopes

    SciTech Connect

    Wouters, J.; Vandeplassche, D.; van Walle, E.; Severijns, N.; Van Haverbeke, J.; Vanneste, L.

    1987-12-10

    The technical realization of particle detection at very low temperatures (4K) has made it possible to study for the first time the anisotropic ..cap alpha..-decay of oriented nuclei which have been produced, separated and implanted on line. The measured ..cap alpha..-angular distributions reveal surprising new results on nuclear aspects as well as in solid state physics. The nuclear structure information from these data questions the older ..cap alpha..-decay theoretical interpretation and urges for a reaxamination of the earliest work on anisotropic ..cap alpha..-decay.

  2. Identification of tryptophan oxidation products in bovine alpha-crystallin.

    PubMed Central

    Finley, E. L.; Dillon, J.; Crouch, R. K.; Schey, K. L.

    1998-01-01

    Oxidation is known to affect the structure, activity, and rate of degradation of proteins, and is believed to contribute to a variety of pathological conditions. Metal-catalyzed oxidation (MCO) is a primary oxidizing system in many cell types. In this study, the oxidative effects of a MCO system (the Fenton reaction) on the structure of the tryptophan residues of alpha-crystallin were determined. Tandem mass spectrometry (MS/MS) was utilized to identify specific tryptophan and methionine oxidation products in the bovine alpha-crystallin sequence. After oxidative exposure, alpha-crystallin was digested with trypsin, and the resulting peptides were fractionated by reverse-phase HPLC. Structural analysis by mass spectrometry revealed that tryptophan 9 of alphaA- and tryptophan 60 of alphaB-crystallin were each converted into hydroxytryptophans (HTRP), N-formylkynurenine (NFK), and kynurenine (KYN). However, only HTRP and KYN formation were detected at residue 9 of alphaB-crystallin. Oxidation of methionine 1 of alphaA- and methionine 1 and 68 of alphaB-crystallin was also detected. The products NFK and KYN are of particular importance in the lens, as they themselves are photosensitizers that can generate reactive oxygen species (ROS) upon UV light absorption. The unambiguous identification of HTRP, NFK, and KYN in intact alpha-crystallin represents the first structural proof of the formation of these products in an intact protein, and provides a basis for detailed structural analysis of oxidized proteins generated in numerous pathological conditions. PMID:9828005

  3. A catalog of stellar Lyman-alpha fluxes

    NASA Technical Reports Server (NTRS)

    Landsman, Wayne; Simon, Theodore

    1993-01-01

    We present a catalog of stellar Ly-alpha emission fluxes, based on new and archival images obtained with the IUE spacecraft. The catalog includes 227 stars with detectable Ly-alpha emission fluxes, and upper limits on the Ly-alpha emission flux for another 48 stars. Multiple flux measurements are given for 52 stars. We present a model for correcting the observed Ly-alpha flux for attenuation by the local interstellar medium, and we apply this model to derive intrinsic Ly-alpha fluxes for 149 catalog stars which are located in low H I column density directions of the local interstellar medium. In our catalog, there are 14 late-A and early-F stars at B-V = 0.29 or less that show detectable emission at Ly-alpha. We find a linear correlation between the intrinsic Ly-alpha flux and C II 1335 A flux for stars with B-V greater than 0.60, but the A and F stars deviate from this relation in the sense that their Ly-alpha flux is too low. We also find a good correlation between Ly-alpha strength and coronal X-ray emission. This correlation holds over most of the H-R diagram, even for the F stars, where an X-ray deficit has previously been found relative to the transition region lines of C II and C IV.

  4. T cell responses in calcineurin A alpha-deficient mice

    PubMed Central

    1996-01-01

    We have created embryonic stem (ES) cells and mice lacking the predominant isoform (alpha) of the calcineurin A subunit (CNA alpha) to study the role of this serine/threonine phosphatase in the immune system. T and B cell maturation appeared to be normal in CNA alpha -/- mice. CNA alpha -/- T cells responded normally to mitogenic stimulation (i.e., PMA plus ionomycin, concanavalin A, and anti-CD3 epsilon antibody). However, CNA alpha -/- mice generated defective antigen- specific T cell responses in vivo. Mice produced from CNA alpha -/- ES cells injected into RAG-2-deficient blastocysts had a similar defective T cell response, indicating that CNA alpha is required for T cell function per se, rather than for an activity of other cell types involved in the immune response. CNA alpha -/- T cells remained sensitive to both cyclosporin A and FK506, suggesting that CNA beta or another CNA-like molecule can mediate the action of these immunosuppressive drugs. CNA alpha -/- mice provide an animal model for dissecting the physiologic functions of calcineurin as well as the effects of FK506 and CsA. PMID:8627154

  5. Adsorption properties of. cap alpha. -modification of boron nitride

    SciTech Connect

    Gavrilova, T.B.; Kiselev, A.V.; Parshina, I.V.; Roshchina, T.M.

    1986-11-01

    The adsorption properties of four samples of ..cap alpha..-BN were studied by means of gas chromatography. The particles of ..cap alpha..-BN particles, according to data obtained by electron microscopy, have the shape of thin platelets. A sample of ..cap alpha..-BN prepared from magnesium polyboride was found to be the most nearly homogeneous adsorbent. For a number of n-alkanes, benzene, and alkylbenzenes, data have been obtained on the retention volumes (Henry constants) and the differential heats of adsorption for surface coverages approaching zero. These thermodynamic data on the adsorption showed that ..cap alpha..-BN, like graphitized thermal carbon black, is a nonspecific adsorbent.

  6. Dielectric relaxation of alpha -tocopherol acetate (vitamin E).

    PubMed

    Kaminski, K; Maslanka, S; Ziolo, J; Paluch, M; McGrath, K J; Roland, C M

    2007-01-01

    Dielectric loss spectra are reported for alpha -tocopherol acetate (an isomer of vitamin E) in the supercooled and glassy states. The alpha -relaxation times, tau_{alpha} , measured over a 190 degrees range of temperatures, T , at pressures, P , up to 400MPa can be expressed as a single function of TV3.9 ( V is specific volume, measured herein as a function of T and P ). At ambient pressure, there is no dynamic crossover over eight decades of measured tau_{alpha} . The relaxation spectra above the glass transition temperature T_{g} show ionic conductivity and an excess wing on the high-frequency flank of the alpha -relaxation loss peak. Temperature-pressure superpositioning is valid for the alpha process; moreover, the peak shape is constant (stretch exponent equal to 0.65). However, application of pressure changes the shape of the dielectric spectrum at higher frequencies due to the shift of the excess wing to form a resolved peak. Additionally, another relaxation process, absent at atmospheric pressure, emerges on the high-frequency side of the alpha -process. We propose that this new peak reflects a more compact conformation of the alpha -tocopherol acetate molecule. Drawing on the coupling model, the experimentally determined relaxation times, activation energy, and activation volume for the Johari-Goldstein process are compared to values calculated from the properties of the alpha relaxation. The agreement is generally satisfactory, at least for T

  7. {alpha} decay of even-even superheavy elements

    SciTech Connect

    Denisov, V. Yu.; Khudenko, A. A.

    2010-03-15

    The {alpha}-decay half-lives of even-even superheavy elements within the range of proton number 104<=Z<=126, which can be formed by possible cold and hot fusion reactions, are calculated in the framework of various approaches for {alpha}-decay half-life evaluation and by using the Q values of {alpha} transitions obtained within different approximations for atomic masses. The dependencies of {alpha}-decay half-lives of superheavy elements on model approaches for both the Q values and half-life calculations are discussed in detail.

  8. alpha-thalassemia mutations in Khuzestan Province, Southwest Iran.

    PubMed

    Zandian, Khodamorad; Nateghi, Jamal; Keikhaie, Bijan; Pedram, Mohammad; Hafezi-Nejad, Nima; Hadavi, Valeh; Oberkanins, Christian; Azarkeivan, Azita; Law, Hai-Yang; Najmabadi, Hossein

    2008-01-01

    Although alpha-thalassemia (alpha-thal) is the most common hereditary hemoglobin (Hb) disorder in Iran, no comprehensive data are so far available on the prevalence of the disease in the province of Khuzestan in Southwest Iran. This study investigates the spectrum of alpha-thal mutations in this region. One hundred and twenty-one subjects from Khuzestan Province, Iran, were initially tested for the three most common Iranian alpha-thal mutations (- alpha3.7, -alpha4.2, and --MED) by gap-polymerase chain reaction (gap-PCR). Reverse hybridization test strips and DNA sequencing were used to identify additional alpha-globin mutations. A total of 131 mutated alpha-globin alleles were identified in these patients. Of the 13 mutations that were detected in Khuzestan Province, Iran, the - alpha3.7 single gene deletion was the most frequently identified variant, representing 62.6% of the total; we also observed significant numbers of individuals with compound heterozygous mutations. On the basis of our results, we strongly recommend screening for the most common mutations to improve the molecular diagnosis of anemia in this region.

  9. [Extraction and properties of microcapsulated alpha-chymotrypsin].

    PubMed

    Aĭsina, R B; Kazanskaia, N F; Lukasheva, E V; Berezin, I V

    1976-09-01

    A method of microencapsulating of the proteolytic enzyme alpha-chymotrypsin into semi-permeable nylon membranes is worked out. The membrane is a polimer of 1,6-hexamethylenediamine and sebacoyl chloride. alpha-Chymotrypsin is enclosed into the capsule together with polyethyleneimine, capable of joining the walls of microcapsules and making the membrane more stable. The optimal concentrations of polyenthyleneimine and alpha-chymotrypsin are 5% and 1% correspondingly. The highest yield of microencapsulated enzyme was obtained for completely acetylated delta-chymotrypsin. The kinetic properties of microencapsulated alpha-chymotrypsin change very slightly as compared to those of the native one.

  10. Alpha migration through air filters: A numerical simulation

    NASA Astrophysics Data System (ADS)

    Biermann, Arthur H.; Daroza, Robert A.; Chang, Yun

    1991-12-01

    This theoretical study investigates the migration of alpha-emitting particles through high-efficiency particulate air (HEPA) filters. As part of the study, a review of previous research relating to the alpha-migration phenomena was conducted. As a result of the literature review, a numerical model was developed to simulate the migration of alpha-emitting radionuclide aerosols through HEPA filters. This model predicts the filter performance with regard to particle penetration. It can be used to better estimate the penetration of alpha radioactive species through filter systems for environmental concerns, to aid in the use of current filter systems, and to design new filter systems.

  11. Biophysical Modeling of Alpha Rhythms During Halothane-Induced Unconsciousness.

    PubMed

    Vijayan, Sujith; Ching, ShiNung; Purdon, Patrick L; Brown, Emery N; Kopell, Nancy J

    2013-01-01

    During the induction of general anesthesia there is a shift in power from the posterior regions of the brain to the frontal cortices; this shift in power is called anteriorization. For many anesthetics, a prominent feature of anteriorization is a shift specifically in the alpha band (8-13 Hz) from posterior to frontal cortices. Here we present a biophysical computational model that describes thalamocortical circuit-level dynamics underlying anteriorization of the alpha rhythm in the case of halothane. Halothane potentiates GABAA and increases potassium leak conductances. According to our model, an increase in potassium leak conductances hyperpolarizes and silences the high-threshold thalamocortical (HTC) cells, a specialized subset of thalamocortical cells that fire at the alpha frequency at relatively depolarized membrane potentials (>-60 mV) and are thought to be the generators of quiet awake occipital alpha. At the same time the potentiation of GABAA imposes an alpha time scale on both the cortical and the thalamic component of the frontal portion of our model. The alpha activity in the frontal component is further strengthened by reciprocal thalamocortical feedback. Thus, we argue that the dual molecular targets of halothane induce the anteriorization of the alpha rhythm by increasing potassium leak conductances, which abolishes occipital alpha, and by potentiating GABAA, which induces frontal alpha. These results provide a computational modeling formulation for studying highly detailed biophysical mechanisms of anesthetic action in silico.

  12. Tumor necrosis factor alpha-induced pulmonary vascular endothelial injury.

    PubMed Central

    Goldblum, S E; Hennig, B; Jay, M; Yoneda, K; McClain, C J

    1989-01-01

    Tumor necrosis factor alpha (TNF-alpha) mediates components of the acute-phase response, stimulates granulocyte metabolism, and induces endothelial cell surface changes. We studied whether human recombinant TNF-alpha (rTNF-alpha) could increase pulmonary edema formation and pulmonary vascular permeability. Rabbits preinfused with 125I-albumin were administered rTNF-alpha or saline. Animals were sacrificed, and lung wet/dry weight ratios as well as bronchoalveolar lavage fluid and plasma 125I activities were determined. rTNF-alpha increased lung wet/dry weight ratios by 151% (P less than 0.02) and bronchoalveolar lavage fluid/plasma 125I activity ratios by 376% (P less than 0.01) compared with values for saline controls. Electron microscopy of lung sections demonstrated endothelial injury, perivascular edema, and extravasation of an ultrastructural permeability tracer. To demonstrate that rTNF-alpha could directly increase pulmonary vascular endothelial permeability in vitro, we studied albumin transfer across cultured porcine pulmonary artery endothelial cell monolayers. rTNF-alpha induced time-dependent dose-response increments in transendothelial albumin flux in the absence of granulocyte effector cells. These observations suggest that rTNF-alpha can provoke acute pulmonary vascular endothelial injury in vivo as well as in vitro. Images PMID:2925247

  13. Preparation of specific antisera to 15alpha-hydroxyestrogens.

    PubMed

    Suzuki, E; Nakagomi, M; Hashimoto, M; Agui, M; Iida, S; Konno, K; Hara, Y; Kurihara, H; Matsuki, Y; Imai, K; Ono, H

    1999-08-01

    The synthesis of haptens of 15alpha-hydroxyestrone, 15alpha-hydroxyestradiol, and 15alpha-hydroxyestriol (estetrol) was undertaken, to obtain specific antisera required for enzyme immunoassay. 3-(1-Carboxypropyl) ethers of these 15alpha-hydroxyestrogens were prepared and conjugated with bovine serum albumin and horseradish peroxidase. The specificity of antisera elicited against bovine serum albumin conjugates was checked by the enzyme immunoassay by using horseradish peroxidase-labeled antigen, and proved to be satisfactory in terms of cross-reactivities to related compounds. PMID:10493601

  14. Radiation cross-linking of ethylene vinyl alcohol copolymer functionalized with m-isopropenyl-{alpha},{alpha}-dimethyl benzyl isocyanate

    SciTech Connect

    Ekman, K.B.; Naesman, J.H.

    1993-12-31

    In order to allow radiation cross-linking at low radiation doses, pendant unsaturation was introduced by reactive processing of ethylene vinyl alcohol copolymer and m-isopropenyl-{alpha},{alpha}-dimethyl benzyl isocyanate. Oxygen permeability of ethylene vinyl alcohol copolymer decreased with increasing degree of functionalization, while irradiation of the samples form trapped radicals, which act as oxygen scavengers and consequently no oxygen permeability was detected. However, radical activity was inhibited by annealing the samples at 110{degrees}C for 2.5 h, resulting in a 24% higher oxygen permeability value for the irradiated unfunctionalized copolymer, while the oxygen permeability values of the irradiated functionalized samples were 13% lower. Laminates, of m-isopropenyl-{alpha},{alpha}-dimethyl benzyl isocyanate functionalized ethylene vinyl alcohol copolymer and m-isopropenyl-{alpha},{alpha}-dimethyl benzyl isocyanate functionalized ethylene hydroxyethyl methacrylate copolymer acquired improved adhesive strength both at dry and wet conditions as well as at elevated temperatures upon exposure to radiation.

  15. Effects of excitation laser wavelength on Ly-{alpha} and He-{alpha} line emission from nitrogen plasmas

    SciTech Connect

    Harilal, S. S.; Miloshevsky, G. V.; Sizyuk, T.; Hassanein, A.

    2013-01-15

    Laser-produced nitrogen plasmas emitting radiation at 2.48 nm (Ly-{alpha}) and 2.88 nm (He-{alpha}) are considered potential efficient sources for water-window (WW) microscopy. The atomic and optical properties of nitrogen plasma and influence of the laser wavelength on the line emission in the WW range are investigated. It is found that the optimal temperatures for maximum emission from Ly-{alpha} and He-{alpha} spectral lines are 40-60 eV and 80-100 eV, respectively. The WW line emission and the conversion efficiency (CE) are estimated for three distinct Nd:YAG laser wavelengths (1064 nm, 532 nm, and 266 nm). The calculated CEs are compared with experimentally observed CE values. It is found that 1064 nm wavelength provides the highest CE from laser to Ly-{alpha} and He-{alpha} radiation.

  16. Alpha-human atrial natriuretic polypeptide (. cap alpha. -hANP) specific binding sites in bovine adrenal gland

    SciTech Connect

    Higuchi, K.; Nawata, H.; Kato, K.I.; Ibayashi, H.; Matsuo, H.

    1986-06-13

    The effects of synthetic ..cap alpha..-human atrial natriuretic polypeptide (..cap alpha..-hANP) on steroidogenesis in bovine adrenocortical cells in primary monolayer culture were investigated. ..cap alpha..-hANP did not inhibit basal aldosterone secretion. ..cap alpha..-hANP induced a significant dose-dependent inhibition of basal levels of cortisol and dehydroepiandrosterone (DHEA) secretion and also of aCTH (10/sup -8/M)-stimulated increases in aldosterone, cortisol and DHEA secretion. Visualization of (/sup 125/I) ..cap alpha..-hANP binding sites in bovine adrenal gland by an in vitro autoradiographic technique demonstrated that these sites were highly localized in the adrenal cortex, especially the zona glomerulosa. These results suggest that the adrenal cortex may be a target organ for direct receptor-mediated actions of ..cap alpha..-hANP.

  17. Fc alpha receptors mediate release of tumour necrosis factor-alpha and interleukin-6 by human monocytes following receptor aggregation.

    PubMed Central

    Patry, C; Herbelin, A; Lehuen, A; Bach, J F; Monteiro, R C

    1995-01-01

    The functional capacity of the human monocyte receptor for the Fc portion of IgA (Fc alpha R) in mediating signal transduction was evaluated by cytokine release. F(ab')2 fragments of anti-Fc alpha R monoclonal antibodies (mAb) were used as specific probes to induce release of tumour necrosis factor-alpha (TNF-alpha) and interleukin-6 (IL-6). Multivalent cross-linking by a secondary anti-mouse antibody [F(ab')2 fragments] induced a significant release of TNF-alpha and IL-6 by human blood mononuclear cells, indicating requirements for Fc alpha R aggregation on the cell surface to transmit signals. Both cytokines were released exclusively by adherent cells, identifying monocytes as the responding cells within the mononuclear cell population. This cytokine release could not be due to contaminating endotoxins, because it was not abolished by polymyxin B, a lipopolysaccharide (LPS) inhibitor. Moreover, purified recombinant soluble Fc alpha R inhibited the anti-Fc alpha R mAb-mediated cytokine release from blood monocytes, demonstrating that TNF-alpha and IL-6 were released in a receptor-specific manner. Our data suggest that Fc alpha R, through its capacity to mediate secretion of IL-6, may play an important role in B-cell proliferation and immunoglobulin production. On the other hand, release of TNF-alpha following stimulation of Fc alpha R molecules directly implicates these receptors in amplification and regulation of the inflammatory process occurring during IgA-mediated host defence. PMID:7590867

  18. Affinity chromatography of alpha/sub 2/-adrenergic receptors (. cap alpha. /sub 2/AR) from pig cerebral cortex

    SciTech Connect

    Repaske, M.G.; Limbird, L.E.

    1986-03-01

    A high capacity, ..cap alpha../sub 2/AR-selective affinity resin (YOH. ag) has been prepared by coupling yohimbinic acid to diaminodipropylamine agarose with 1,3 dicyclohexylcarbodiimide. Unreacted amino groups on the agarose matrix are blocked subsequently by acetylation. One volume of YOH. ag adsorbs 75% of the ..cap alpha../sub 2/AR from 50 volumes of digitonin-solubilized preparation containing 0.2 pmol ..cap alpha../sub 2/AR/mg protein. Digitonin-solubilized preparations are derived from cholate extracts of porcine cerebral cortex containing approx. 0.075 pmol ..cap alpha../sub 2/AR/mg protein. Adsorption of ..cap alpha../sub 2/AR to YOH. ag is selective and thus is blocked by the ..cap alpha..-adrenergic antagonist phentolamine. Adsorbed ..cap alpha../sub 2/AR are eluted with 10 ..mu..M phentolamine (20% yield) after removal of non-related proteins with NaCl gradients. Following hydroxylapatite chromatography to concentrate ..cap alpha..''AR and to remove phentolamine, the ..cap alpha..AR is present at 200-400 pmol/mg protein, assayed using sub-saturating concentrations of (/sup 3/H)-yohimbine. (It is estimated that the specific activity of a homogeneous ..cap alpha../sub 2/AR preparation would be 12,000-16,000 pmol/mg protein.) The availability of large quantities of cortical ..cap alpha../sub 2/AR and a resin easily prepared from commercially-supplied reagents suggests that purification of quantities of ..cap alpha../sub 2/AR sufficient for subsequent biochemical studies is feasible.

  19. Compartmentation of alpha 1 and alpha 2 GABA(A) receptor subunits within rat extended amygdala: implications for benzodiazepine action.

    PubMed

    Kaufmann, Walter A; Humpel, Christian; Alheid, George F; Marksteiner, Josef

    2003-02-21

    The extended amygdala, a morphological and functional entity within the basal forebrain, is a neuronal substrate for emotional states like fear and anxiety. Anxiety disorders are commonly treated by benzodiazepines that mediate their action via GABA(A) receptors. The binding properties and action of benzodiazepines depend on the alpha-subunit profile of the hetero-pentameric receptors: whereas the alpha1 subunit is associated with benzodiazepine type I pharmacology and reportedly mediates sedative as well as amnesic actions of benzodiazepines, the alpha2 subunit confers benzodiazepine type II pharmacology and mediates the anxiolytic actions of benzodiazepines. We determined the localization of alpha1 and alpha2 subunits within the extended amygdala, identified by secretoneurin immunostaining, to define the morphological substrates for the diverse benzodiazepine actions. A moderate expression of the alpha1 subunit could be detected in compartments of the medial subdivision and a strong expression of the alpha2 subunit throughout the central subdivision. It is concluded that the alpha1 and alpha2 subunits are differentially expressed within the extended amygdala, indicating that this structure is compartmentalized with respect to function and benzodiazepine action. PMID:12573516

  20. [Uniform method for determining the alpha 1-antitrypsin and alpha 2-macroglobulin activity in human blood serum (plasma)].

    PubMed

    Nartikova, V F; Paskhina, T S

    1979-01-01

    A modified spectrophotometric method is developed for simultaneous estimation of alpha 1-antitrypsin and alpha 2-macroglobulin in human blood serum (plasma); the method is based on dissimilar interaction of these inhibitors with trypsin in the systems with a low molecular substrate N-alpha-benzoyl-l-arginine ethyl ester. alpha 1-Antitrypsin was estimated by inhibition of the arginine esterase activity of trypsin in a mixture containing human blood serum diluted 50-fold. alpha 2-Macroglobulin was estimated by maintained arginine esterase activity of the trypsin-alpha 2-macroglobulin complex, formed after interaction of an excess of trypsin with blood serum, diluted 10-fold and after subsequent inactivation of free, unbound with alpha 2-macroglobulin, trypsin by treatment with the soy bean inhibitor of trypsin. alpha 1-Antitrypsin and alpha 2-macrog-obulin were estimated by means of the method described in blood serum of healthy persons and in patients with burns or with carcinoma of pancreas. The method enables to estimate two main inhibitors of blood plasma proteinases in a small volume of blood serum (0.1 ml) very rapidly and specifically using commercially available substrate; the method might be recommended for routine clinical analysis.