Science.gov

Sample records for 8-bp target site

  1. Target sites of anthelmintics.

    PubMed

    Martin, R J; Robertson, A P; Bjorn, H

    1997-01-01

    This paper reviews sites of action of anthelmintic drugs including: (1) levamisole and pyrantel, which act as agonists at nicotinic acetylcholine receptors of nematodes; (2) the avermectins, which potentiate or gate the opening of glutamategated chloride channels found only in invertebrates; (3) piperazine, which acts as an agonist at GABA gated chloride channels on nematode muscle; (4) praziquantel, which increases the permeability of trematode tegument to calcium and results in contraction of the parasite muscle; (5) the benzimidazoles, like thiabendazole, which bind selectively to parasite beta-tubulin and prevents microtubule formation; (6) the proton ionophores, like closantel, which uncouple oxidative phosphorylation; (7) diamphenethide and clorsulon, which selectively inhibit glucose metabolism of Fasciola and; (8) diethylcarbamazine, which appears to interfere with arachidonic acid metabolism of filarial parasites and host. The review concludes with brief comments on the development of anthelmintics in the future. PMID:9309773

  2. Spontaneous 8bp Deletion in Nbeal2 Recapitulates the Gray Platelet Syndrome in Mice

    PubMed Central

    Tomberg, Kärt; Khoriaty, Rami; Westrick, Randal J.; Fairfield, Heather E.; Reinholdt, Laura G.; Brodsky, Gary L.; Davizon-Castillo, Pavel; Ginsburg, David; Di Paola, Jorge

    2016-01-01

    During the analysis of a whole genome ENU mutagenesis screen for thrombosis modifiers, a spontaneous 8 base pair (bp) deletion causing a frameshift in exon 27 of the Nbeal2 gene was identified. Though initially considered as a plausible thrombosis modifier, this Nbeal2 mutation failed to suppress the synthetic lethal thrombosis on which the original ENU screen was based. Mutations in NBEAL2 cause Gray Platelet Syndrome (GPS), an autosomal recessive bleeding disorder characterized by macrothrombocytopenia and gray-appearing platelets due to lack of platelet alpha granules. Mice homozygous for the Nbeal2 8 bp deletion (Nbeal2gps/gps) exhibit a phenotype similar to human GPS, with significantly reduced platelet counts compared to littermate controls (p = 1.63 x 10−7). Nbeal2gps/gps mice also have markedly reduced numbers of platelet alpha granules and an increased level of emperipolesis, consistent with previously characterized mice carrying targeted Nbeal2 null alleles. These findings confirm previous reports, provide an additional mouse model for GPS, and highlight the potentially confounding effect of background spontaneous mutation events in well-characterized mouse strains. PMID:26950939

  3. "Target-Site" Drug Metabolism and Transport.

    PubMed

    Foti, Robert S; Tyndale, Rachel F; Garcia, Kristine L P; Sweet, Douglas H; Nagar, Swati; Sharan, Satish; Rock, Dan A

    2015-08-01

    The recent symposium on "Target-Site" Drug Metabolism and Transport that was sponsored by the American Society for Pharmacology and Experimental Therapeutics at the 2014 Experimental Biology meeting in San Diego is summarized in this report. Emerging evidence has demonstrated that drug-metabolizing enzyme and transporter activity at the site of therapeutic action can affect the efficacy, safety, and metabolic properties of a given drug, with potential outcomes including altered dosing regimens, stricter exclusion criteria, or even the failure of a new chemical entity in clinical trials. Drug metabolism within the brain, for example, can contribute to metabolic activation of therapeutic drugs such as codeine as well as the elimination of potential neurotoxins in the brain. Similarly, the activity of oxidative and conjugative drug-metabolizing enzymes in the lung can have an effect on the efficacy of compounds such as resveratrol. In addition to metabolism, the active transport of compounds into or away from the site of action can also influence the outcome of a given therapeutic regimen or disease progression. For example, organic anion transporter 3 is involved in the initiation of pancreatic β-cell dysfunction and may have a role in how uremic toxins enter pancreatic β-cells and ultimately contribute to the pathogenesis of gestational diabetes. Finally, it is likely that a combination of target-specific metabolism and cellular internalization may have a significant role in determining the pharmacokinetics and efficacy of antibody-drug conjugates, a finding which has resulted in the development of a host of new analytical methods that are now used for characterizing the metabolism and disposition of antibody-drug conjugates. Taken together, the research summarized herein can provide for an increased understanding of potential barriers to drug efficacy and allow for a more rational approach for developing safe and effective therapeutics. PMID:25986849

  4. Characteristics of Food Industry Web Sites and "Advergames" Targeting Children

    ERIC Educational Resources Information Center

    Culp, Jennifer; Bell, Robert A.; Cassady, Diana

    2010-01-01

    Objective: To assess the content of food industry Web sites targeting children by describing strategies used to prolong their visits and foster brand loyalty; and to document health-promoting messages on these Web sites. Design: A content analysis was conducted of Web sites advertised on 2 children's networks, Cartoon Network and Nickelodeon. A…

  5. SSFinder: high throughput CRISPR-Cas target sites prediction tool.

    PubMed

    Upadhyay, Santosh Kumar; Sharma, Shailesh

    2014-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated protein (Cas) system facilitates targeted genome editing in organisms. Despite high demand of this system, finding a reliable tool for the determination of specific target sites in large genomic data remained challenging. Here, we report SSFinder, a python script to perform high throughput detection of specific target sites in large nucleotide datasets. The SSFinder is a user-friendly tool, compatible with Windows, Mac OS, and Linux operating systems, and freely available online. PMID:25089276

  6. Photoaffinity labeling in target- and binding-site identification

    PubMed Central

    Smith, Ewan; Collins, Ian

    2015-01-01

    Photoaffinity labeling (PAL) using a chemical probe to covalently bind its target in response to activation by light has become a frequently used tool in drug discovery for identifying new drug targets and molecular interactions, and for probing the location and structure of binding sites. Methods to identify the specific target proteins of hit molecules from phenotypic screens are highly valuable in early drug discovery. In this review, we summarize the principles of PAL including probe design and experimental techniques for in vitro and live cell investigations. We emphasize the need to optimize and validate probes and highlight examples of the successful application of PAL across multiple disease areas. PMID:25686004

  7. Nuclease Target Site Selection for Maximizing On-target Activity and Minimizing Off-target Effects in Genome Editing.

    PubMed

    Lee, Ciaran M; Cradick, Thomas J; Fine, Eli J; Bao, Gang

    2016-03-01

    The rapid advancement in targeted genome editing using engineered nucleases such as ZFNs, TALENs, and CRISPR/Cas9 systems has resulted in a suite of powerful methods that allows researchers to target any genomic locus of interest. A complementary set of design tools has been developed to aid researchers with nuclease design, target site selection, and experimental validation. Here, we review the various tools available for target selection in designing engineered nucleases, and for quantifying nuclease activity and specificity, including web-based search tools and experimental methods. We also elucidate challenges in target selection, especially in predicting off-target effects, and discuss future directions in precision genome editing and its applications. PMID:26750397

  8. Nuclease Target Site Selection for Maximizing On-target Activity and Minimizing Off-target Effects in Genome Editing

    PubMed Central

    Lee, Ciaran M; Cradick, Thomas J; Fine, Eli J; Bao, Gang

    2016-01-01

    The rapid advancement in targeted genome editing using engineered nucleases such as ZFNs, TALENs, and CRISPR/Cas9 systems has resulted in a suite of powerful methods that allows researchers to target any genomic locus of interest. A complementary set of design tools has been developed to aid researchers with nuclease design, target site selection, and experimental validation. Here, we review the various tools available for target selection in designing engineered nucleases, and for quantifying nuclease activity and specificity, including web-based search tools and experimental methods. We also elucidate challenges in target selection, especially in predicting off-target effects, and discuss future directions in precision genome editing and its applications. PMID:26750397

  9. Expansion of CRISPR targeting sites in Bombyx mori.

    PubMed

    Zeng, Baosheng; Zhan, Shuai; Wang, Yueqiang; Huang, Yuping; Xu, Jun; Liu, Qun; Li, Zhiqian; Huang, Yongping; Tan, Anjiang

    2016-05-01

    The CRISPR/Cas9 system has been proven as a revolutionary genome engineering tool. In most cases, single guide RNA (sgRNA) targeting sites have been designed as GN19NGG or GGN18NGG, because of restriction of the initiation nucleotide for RNA Pol III promoters. Here, we demonstrate that the U6 promoter from a lepidopteran model insect, Bombyx mori, effectively expressed the sgRNA initiated with any nucleotide bases (adenine, thymine, guanine or cytosine), which further expands the CRISPR targeting space. A detailed expansion index in the genome was analysed when N20NGG was set as the CRISPR targeting site instead of GN19NGG, and revealed a significant increase of suitable targets, with the highest increase occurring on the Z sex chromosome. Transfection of different types of N20NGG sgRNAs targeting the enhanced green fluorescent protein (EGFP) combined with Cas9, significantly reduced EGFP expression in the BmN cells. An endogenous gene, BmBLOS2, was also disrupted by using various types of N20NGG sgRNAs, and the cleavage efficiency of N20NGG sgRNAs with different initial nucleotides and GC contents was evaluated in vitro. Furthermore, transgenic silkworms expressing Cas9 and sgRNAs targeting the BmBLOS2 gene were generated with many types of mutagenesis. The typical transparent skin phenotype in knock-out silkworms was stable and inheritable, suggesting that N20NGG sgRNAs function sufficiently in vivo. Our findings represent a renewal of CRISPR/Cas9 target design and will greatly facilitate insect functional genetics research. PMID:27032928

  10. Targeting Different Transthyretin Binding Sites with Unusual Natural Compounds.

    PubMed

    Ortore, Gabriella; Orlandini, Elisabetta; Braca, Alessandra; Ciccone, Lidia; Rossello, Armando; Martinelli, Adriano; Nencetti, Susanna

    2016-08-19

    Misfolding and aggregation of the transthyretin (TTR) protein leads to certain forms of amyloidosis. Some nutraceuticals, such as flavonoids and natural polyphenols, have recently been investigated as modulators of the self-assembly process of TTR, but they generally suffer from limited bioavailability. To discover innovative and more bioavailable natural compounds able to inhibit TTR amyloid formation, a docking study was performed using the crystallographic structure of TTR. This computational strategy was projected as an ad hoc inspection of the possible relationship between binding site location and modulation of the assembly process; interactions with the as-yet-unexplored epigallocatechin gallate (EGCG) sites and with the thyroxine (T4) pocket were simultaneously analyzed. All the compounds studied seem to prefer the traditional T4 binding site, but some interesting results emerged from the screening of an in-house database, used for validating the computational protocol, and of the Herbal Ingredients Targets (HIT) catalogue available on the ZINC database. PMID:27159149

  11. Directing cell therapy to anatomic target sites in vivo with magnetic resonance targeting.

    PubMed

    Muthana, Munitta; Kennerley, Aneurin J; Hughes, Russell; Fagnano, Ester; Richardson, Jay; Paul, Melanie; Murdoch, Craig; Wright, Fiona; Payne, Christopher; Lythgoe, Mark F; Farrow, Neil; Dobson, Jon; Conner, Joe; Wild, Jim M; Lewis, Claire

    2015-01-01

    Cell-based therapy exploits modified human cells to treat diseases but its targeted application in specific tissues, particularly those lying deep in the body where direct injection is not possible, has been problematic. Here we use a magnetic resonance imaging (MRI) system to direct macrophages carrying an oncolytic virus, Seprehvir, into primary and metastatic tumour sites in mice. To achieve this, we magnetically label macrophages with super-paramagnetic iron oxide nanoparticles and apply pulsed magnetic field gradients in the direction of the tumour sites. Magnetic resonance targeting guides macrophages from the bloodstream into tumours, resulting in increased tumour macrophage infiltration and reduction in tumour burden and metastasis. Our study indicates that clinical MRI scanners can not only track the location of magnetically labelled cells but also have the potential to steer them into one or more target tissues. PMID:26284300

  12. Directing cell therapy to anatomic target sites in vivo with magnetic resonance targeting

    PubMed Central

    Muthana, Munitta; Hughes, Russell; Fagnano, Ester; Richardson, Jay; Paul, Melanie; Murdoch, Craig; Wright, Fiona; Payne, Christopher; Lythgoe, Mark F.; Farrow, Neil; Dobson, Jon; Conner, Joe; Wild, Jim M; Lewis, Claire

    2015-01-01

    Cell-based therapy exploits modified human cells to treat diseases but its targeted application in specific tissues, particularly those lying deep in the body where direct injection is not possible, has been problematic. Here we use a magnetic resonance imaging (MRI) system to direct macrophages carrying an oncolytic virus, Seprehvir, into primary and metastatic tumour sites in mice. To achieve this, we magnetically label macrophages with super-paramagnetic iron oxide nanoparticles (SPIOs) and apply pulsed magnetic-field gradients in the direction of the tumour sites. Magnetic resonance targeting guides macrophages from the bloodstream into tumors, resulting in increased tumour macrophage infiltration and reduction in tumor burden and metastasis. Our study indicates that clinical MRI scanners can not only track the location of magnetically labelled cells but also have the potential to steer them into one or more target tissues. PMID:26284300

  13. Target-classification approach applied to active UXO sites

    NASA Astrophysics Data System (ADS)

    Shubitidze, F.; Fernández, J. P.; Shamatava, Irma; Barrowes, B. E.; O'Neill, K.

    2013-06-01

    This study is designed to illustrate the discrimination performance at two UXO active sites (Oklahoma's Fort Sill and the Massachusetts Military Reservation) of a set of advanced electromagnetic induction (EMI) inversion/discrimination models which include the orthonormalized volume magnetic source (ONVMS), joint diagonalization (JD), and differential evolution (DE) approaches and whose power and flexibility greatly exceed those of the simple dipole model. The Fort Sill site is highly contaminated by a mix of the following types of munitions: 37-mm target practice tracers, 60-mm illumination mortars, 75-mm and 4.5'' projectiles, 3.5'', 2.36'', and LAAW rockets, antitank mine fuzes with and without hex nuts, practice MK2 and M67 grenades, 2.5'' ballistic windshields, M2A1-mines with/without bases, M19-14 time fuzes, and 40-mm practice grenades with/without cartridges. The site at the MMR site contains targets of yet different sizes. In this work we apply our models to EMI data collected using the MetalMapper (MM) and 2 × 2 TEMTADS sensors. The data for each anomaly are inverted to extract estimates of the extrinsic and intrinsic parameters associated with each buried target. (The latter include the total volume magnetic source or NVMS, which relates to size, shape, and material properties; the former includes location, depth, and orientation). The estimated intrinsic parameters are then used for classification performed via library matching and the use of statistical classification algorithms; this process yielded prioritized dig-lists that were submitted to the Institute for Defense Analyses (IDA) for independent scoring. The models' classification performance is illustrated and assessed based on these independent evaluations.

  14. Salivary epithelial cells: an unassuming target site for gene therapeutics

    PubMed Central

    Perez, Paola; Rowzee, Anne M.; Zheng, Changyu; Adriaansen, Janik; Baum, Bruce J.

    2010-01-01

    Salivary glands are classical exocrine glands whose external secretions result in the production of saliva. However, in addition to the secretion of exocrine proteins, salivary epithelial cells are also capable of secreting proteins internally, into the bloodstream. This brief review examines the potential for using salivary epithelial cells as a target site for in situ gene transfer, with an ultimate goal of producing therapeutic proteins for treating both systemic and upper gastrointestinal tract disorders. The review discusses the protein secretory pathways reported to be present in salivary epithelial cells, the viral gene transfer vectors shown useful for transducing these cells, model transgenic secretory proteins examined, and some clinical conditions that might benefit from such salivary gland gene transfer. PMID:20219693

  15. Exploring Internal Ribosome Entry Sites as Therapeutic Targets

    PubMed Central

    Komar, Anton A.; Hatzoglou, Maria

    2015-01-01

    Initiation of eukaryotic mRNA translation may proceed via several different routes, each requiring a different subset of factors and relying on different and specific interactions between the mRNA and the ribosome. Two modes predominate: (i) so-called cap-dependent initiation, which requires all canonical initiation factors and is responsible for about 95–97% of all initiation events in eukaryotic cells; and (ii) cap-independent internal initiation, which requires a reduced subset of initiation factors and accounts for up to 5% of the remaining initiation events. Internal initiation relies on the presence of so-called internal ribosome entry site (IRES) elements in the 5′ UTRs of some viral and cellular mRNAs. These elements (often possessing complex secondary and tertiary structures) promote efficient interaction of the mRNA with the 40S ribosome and allow for internal ribosome entry. Internal initiation of translation of specific mRNAs may contribute to development of severe disease and pathological states, such as hepatitis C and cancer. Therefore, this cellular mechanism represents an attractive target for pharmacological modulation. The purpose of this review is to provide insight into current strategies used to target viral and cellular IRESs and discuss the physiological consequences (and potential therapeutic implications) of abrogation/modulation of IRES-mediated translation. PMID:26539410

  16. Initial basalt target site selection evaluation for the Mars penetrator drop test

    NASA Technical Reports Server (NTRS)

    Bunch, T. E.; Quaide, W. L.; Polkowski, G.

    1976-01-01

    Potential basalt target sites for an air drop penetrator test were described and the criteria involved in site selection were discussed. A summary of the background field geology and recommendations for optimum sites are also presented.

  17. Whole genome resequencing reveals natural target site preferences of transposable elements in Drosophila melanogaster.

    PubMed

    Linheiro, Raquel S; Bergman, Casey M

    2012-01-01

    Transposable elements are mobile DNA sequences that integrate into host genomes using diverse mechanisms with varying degrees of target site specificity. While the target site preferences of some engineered transposable elements are well studied, the natural target preferences of most transposable elements are poorly characterized. Using population genomic resequencing data from 166 strains of Drosophila melanogaster, we identified over 8,000 new insertion sites not present in the reference genome sequence that we used to decode the natural target preferences of 22 families of transposable element in this species. We found that terminal inverted repeat transposon and long terminal repeat retrotransposon families present clade-specific target site duplications and target site sequence motifs. Additionally, we found that the sequence motifs at transposable element target sites are always palindromes that extend beyond the target site duplication. Our results demonstrate the utility of population genomics data for high-throughput inference of transposable element targeting preferences in the wild and establish general rules for terminal inverted repeat transposon and long terminal repeat retrotransposon target site selection in eukaryotic genomes. PMID:22347367

  18. Integrative Analysis of CRISPR/Cas9 Target Sites in the Human HBB Gene.

    PubMed

    Luo, Yumei; Zhu, Detu; Zhang, Zhizhuo; Chen, Yaoyong; Sun, Xiaofang

    2015-01-01

    Recently, the clustered regularly interspaced short palindromic repeats (CRISPR) system has emerged as a powerful customizable artificial nuclease to facilitate precise genetic correction for tissue regeneration and isogenic disease modeling. However, previous studies reported substantial off-target activities of CRISPR system in human cells, and the enormous putative off-target sites are labor-intensive to be validated experimentally, thus motivating bioinformatics methods for rational design of CRISPR system and prediction of its potential off-target effects. Here, we describe an integrative analytical process to identify specific CRISPR target sites in the human β-globin gene (HBB) and predict their off-target effects. Our method includes off-target analysis in both coding and noncoding regions, which was neglected by previous studies. It was found that the CRISPR target sites in the introns have fewer off-target sites in the coding regions than those in the exons. Remarkably, target sites containing certain transcriptional factor motif have enriched binding sites of relevant transcriptional factor in their off-target sets. We also found that the intron sites have fewer SNPs, which leads to less variation of CRISPR efficiency in different individuals during clinical applications. Our studies provide a standard analytical procedure to select specific CRISPR targets for genetic correction. PMID:25918715

  19. Integrative Analysis of CRISPR/Cas9 Target Sites in the Human HBB Gene

    PubMed Central

    Luo, Yumei; Zhang, Zhizhuo; Chen, Yaoyong; Sun, Xiaofang

    2015-01-01

    Recently, the clustered regularly interspaced short palindromic repeats (CRISPR) system has emerged as a powerful customizable artificial nuclease to facilitate precise genetic correction for tissue regeneration and isogenic disease modeling. However, previous studies reported substantial off-target activities of CRISPR system in human cells, and the enormous putative off-target sites are labor-intensive to be validated experimentally, thus motivating bioinformatics methods for rational design of CRISPR system and prediction of its potential off-target effects. Here, we describe an integrative analytical process to identify specific CRISPR target sites in the human β-globin gene (HBB) and predict their off-target effects. Our method includes off-target analysis in both coding and noncoding regions, which was neglected by previous studies. It was found that the CRISPR target sites in the introns have fewer off-target sites in the coding regions than those in the exons. Remarkably, target sites containing certain transcriptional factor motif have enriched binding sites of relevant transcriptional factor in their off-target sets. We also found that the intron sites have fewer SNPs, which leads to less variation of CRISPR efficiency in different individuals during clinical applications. Our studies provide a standard analytical procedure to select specific CRISPR targets for genetic correction. PMID:25918715

  20. Rapid screening of endonuclease target site preference using a modified bacterial two-plasmid selection.

    PubMed

    Wolfs, Jason M; Kleinstiver, Benjamin P; Edgell, David R

    2014-01-01

    Homing endonucleases and other site-specific endonucleases have potential applications in genome editing, yet efficient targeting requires a thorough understanding of DNA-sequence specificity. Here, we describe a modified two-plasmid genetic selection in Escherichia coli that allows rapid profiling of nucleotide substitutions within a target site of given endonucleases. The selection utilizes a toxic plasmid (pTox) that encodes a DNA gyrase toxin in addition to the endonuclease target site. Cleavage of the toxic plasmid by an endonuclease expressed from a second plasmid (pEndo) facilitates growth under selective conditions. The modified protocol utilizes competent cells harboring the endonuclease expression plasmid into which target site plasmids are transformed. Replica plating on nonselective and selective media plates identifies cleavable and non-cleavable targets. Thus, a library of randomized target sites, or many individual target sites, can be analyzed using a single transformation. Both cleavable and non-cleavable targets can be analyzed by DNA sequencing to gain information about nucleotide preference in the endonuclease's target site. PMID:24510263

  1. TarPmiR: a new approach for microRNA target site prediction

    PubMed Central

    Ding, Jun; Li, Xiaoman; Hu, Haiyan

    2016-01-01

    Motivation: The identification of microRNA (miRNA) target sites is fundamentally important for studying gene regulation. There are dozens of computational methods available for miRNA target site prediction. Despite their existence, we still cannot reliably identify miRNA target sites, partially due to our limited understanding of the characteristics of miRNA target sites. The recently published CLASH (crosslinking ligation and sequencing of hybrids) data provide an unprecedented opportunity to study the characteristics of miRNA target sites and improve miRNA target site prediction methods. Results: Applying four different machine learning approaches to the CLASH data, we identified seven new features of miRNA target sites. Combining these new features with those commonly used by existing miRNA target prediction algorithms, we developed an approach called TarPmiR for miRNA target site prediction. Testing on two human and one mouse non-CLASH datasets, we showed that TarPmiR predicted more than 74.2% of true miRNA target sites in each dataset. Compared with three existing approaches, we demonstrated that TarPmiR is superior to these existing approaches in terms of better recall and better precision. Availability and Implementation: The TarPmiR software is freely available at http://hulab.ucf.edu/research/projects/miRNA/TarPmiR/. Contacts: haihu@cs.ucf.edu or xiaoman@mail.ucf.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27207945

  2. Using an Old Drug to Target a New Drug Site: Application of Disulfiram to Target the Zn-Site in HCV NS5A Protein.

    PubMed

    Lee, Yu-Ming; Duh, Yulander; Wang, Shih-Ting; Lai, Michael M C; Yuan, Hanna S; Lim, Carmay

    2016-03-23

    In viral proteins, labile Zn-sites, where Zn(2+) is crucial for maintaining the native protein structure but the Zn-bound cysteines are reactive, are promising drug targets. Here, we aim to (i) identify labile Zn-sites in viral proteins using guidelines established from our previous work and (ii) assess if clinically safe Zn-ejecting agents could eject Zn(2+) from the predicted target site and thus inhibit viral replication. As proof-of-concept, we identified a labile Zn-site in the hepatitis C virus (HCV) NS5A protein and showed that the antialcoholism drug, disulfiram, could inhibit HCV replication to a similar extent as the clinically used antiviral agent, ribavirin. The discovery of a novel viral target and a new role for disulfiram in inhibiting HCV replication will enhance the therapeutic armamentarium against HCV. The strategy presented can also be applied to identify labile sites in other bacterial or viral proteins that can be targeted by disulfiram or other clinically safe Zn-ejectors. PMID:26928525

  3. Development of a target-site based regional frequency model using historical information

    NASA Astrophysics Data System (ADS)

    Hamdi, Yasser; Bardet, Lise; Duluc, Claire-Marie; Rebour, Vincent

    2016-04-01

    Nuclear power facilities in France were designed to withstand extreme environmental conditions with a very low probability of failure. Nevertheless, some exceptional surges considered as outliers are not properly addressed by classical frequency analysis models. If available data at the site of interest (target-site) is sufficiently complete on a long period and not characterized by the presence of an outlier, at-site frequency analysis can be used to estimate quantiles with acceptable uncertainties. Otherwise, regional and historical information (HI) may be used to mitigate the lack of data and the influence of the outlier by increasing its representativeness in the sample. several models have been proposed over the last years for regional extreme surges frequency analysis in France to take into account these outliers in the frequency analysis. However, these models do not give a specific weight to the target site and cannot take into account HI. The objective of the present work is to develop a regional frequency model (RFM) centered on a target-site and using HI. The neighborhood between sites is measured by a degree of physical and statistical dependence between observations (with a prior confidence level). Unlike existing models, the obtained region around the target site (and constituting the neighboring sites) is sliding from a target-site to another. In other words, the developed model assigns a region for each target site. The idea behind the construction of a frequency model favoring target sites and the principle of moving regions around these target-sites is the original key point of the developed model. A related issue regards the estimation of missed and/or ungauged surges at target-sites from those of gauged potential neighboring sites, a multiple linear regression (MLR) is used and it can be extended to other reconstitutions models. MLR analysis can be considered conclusive only if available observations at neighboring sites are informative enough

  4. MBSTAR: multiple instance learning for predicting specific functional binding sites in microRNA targets

    NASA Astrophysics Data System (ADS)

    Bandyopadhyay, Sanghamitra; Ghosh, Dip; Mitra, Ramkrishna; Zhao, Zhongming

    2015-01-01

    MicroRNA (miRNA) regulates gene expression by binding to specific sites in the 3'untranslated regions of its target genes. Machine learning based miRNA target prediction algorithms first extract a set of features from potential binding sites (PBSs) in the mRNA and then train a classifier to distinguish targets from non-targets. However, they do not consider whether the PBSs are functional or not, and consequently result in high false positive rates. This substantially affects the follow up functional validation by experiments. We present a novel machine learning based approach, MBSTAR (Multiple instance learning of Binding Sites of miRNA TARgets), for accurate prediction of true or functional miRNA binding sites. Multiple instance learning framework is adopted to handle the lack of information about the actual binding sites in the target mRNAs. Biologically validated 9531 interacting and 973 non-interacting miRNA-mRNA pairs are identified from Tarbase 6.0 and confirmed with PAR-CLIP dataset. It is found that MBSTAR achieves the highest number of binding sites overlapping with PAR-CLIP with maximum F-Score of 0.337. Compared to the other methods, MBSTAR also predicts target mRNAs with highest accuracy. The tool and genome wide predictions are available at http://www.isical.ac.in/~bioinfo_miu/MBStar30.htm.

  5. Target sites for chemical regulation of strigolactone signaling.

    PubMed

    Nakamura, Hidemitsu; Asami, Tadao

    2014-01-01

    Demands for plant growth regulators (PGRs; chemicals that control plant growth) are increasing globally, especially in developing countries. Both positive and negative PGRs are widely used to enhance crop production and to suppress unwanted shoot growth, respectively. Strigolactones (SLs) are multifunctional molecules that function as phytohormones, inhibiting shoot branching and also functioning in the rhizospheric communication with symbiotic fungi and parasitic weeds. Therefore, it is anticipated that chemicals that regulate the functions of SLs will be widely used in agricultural applications. Although the SL biosynthetic pathway is not fully understood, it has been demonstrated that β-carotene isomerases, carotenoid cleavage dioxygenases (CCDs), and a cytochrome P450 monooxygenase are involved in strigolactone biosynthesis. A CCD inhibitor, abamine, which is also an inhibitor of abscisic acid biosynthesis, reduces the levels of SL in several plant species and reduces the germination rate of Orobanche minor seeds grown with tobacco. On the basis of the structure of abamine, several chemicals have been designed to specifically inhibit CCDs during SL synthesis. Cytochrome P450 monooxygenase is another target enzyme in the development of SL biosynthesis inhibitors, and the triazole-derived TIS series of chemicals is known to include SL biosynthesis inhibitors, although their target enzyme has not been identified. Recently, DWARF14 (D14) has been shown to be a receptor for SLs, and the D-ring moiety of SL is essential for its recognition by D14. A variety of SL agonists are currently under development and most agonists commonly contain the D-ring or a D-ring-like moiety. Several research groups have also resolved the crystal structure of D14 in the last two years. It is expected that this information on the D14 structure will be invaluable not only for developing SL agonists with novel structures but also in the design of inhibitors of SL receptors. PMID:25414720

  6. miRTar Hunter: A Prediction System for Identifying Human microRNA Target Sites

    PubMed Central

    Park, Kiejung; Kim, Ki-Bong

    2013-01-01

    MicroRNAs (miRNAs) are important regulators of gene expression and play crucial roles in many biological processes including apoptosis, differentiation, development, and tumorigenesis. Recent estimates suggest that more than 50% of human protein coding genes may be regulated by miRNAs and that each miRNA may bind to 300–400 target genes. Approximately 1, 000 human miRNAs have been identified so far with each having up to hundreds of unique target mRNAs. However, the targets for a majority of these miRNAs have not been identified due to the lack of large-scale experimental detection techniques. Experimental detection of miRNA target sites is a costly and time-consuming process, even though identification of miRNA targets is critical to unraveling their functions in various biological processes. To identify miRNA targets, we developed miRTar Hunter, a novel computational approach for predicting target sites regardless of the presence or absence of a seed match or evolutionary sequence conservation. Our approach is based on a dynamic programming algorithm that incorporates more sequence-specific features and reflects the properties of various types of target sites that determine diverse aspects of complementarities between miRNAs and their targets. We evaluated the performance of our algorithm on 532 known human miRNA:target pairs and 59 experimentally-verified negative miRNA:target pairs, and also compared our method with three popular programs for 481 miRNA:target pairs. miRTar Hunter outperformed three popular existing algorithms in terms of recall and precision, indicating that our unique scheme to quantify the determinants of complementary sites is effective at detecting miRNA targets. miRTar Hunter is now available at http://203.230.194.162/~kbkim. PMID:23475422

  7. Target site choice of the related transposable elements Tc1 and Tc3 of Caenorhabditis elegans.

    PubMed Central

    van Luenen, H G; Plasterk, R H

    1994-01-01

    We have investigated the target choice of the related transposable elements Tc1 and Tc3 of the nematode C. elegans. The exact locations of 204 independent Tc1 insertions and 166 Tc3 insertions in an 1 kbp region of the genome were determined. There was no phenotypic selection for the insertions. All insertions were into the sequence TA. Both elements have a strong preference for certain positions in the 1 kbp region. Hot sites for integration are not clustered or regularly spaced. The orientation of the integrated transposon has no effect on the distribution pattern. We tested several explanations for the target site preference. If simple structural features of the DNA (e.g. bends) would mark hot sites, we would expect the patterns of the two related transposons Tc1 and Tc3 to be similar; however we found them to be completely different. Furthermore we found that the sequence at the donor site has no effect on the choice of the new insertion site, because the insertion pattern of a transposon that jumps from a transgenic donor site is identical to the insertion pattern of transposons jumping from endogenous genomic donor sites. The most likely explanation for the target choice is therefore that the primary sequence of the target site is recognized by the transposase. However, alignment of the Tc1 and Tc3 integration sites does not reveal a strong consensus sequence for either transposon. PMID:8127662

  8. Pollen Expression of Herbicide Target Site Resistance Genes in Annual Ryegrass (Lolium rigidum).

    PubMed Central

    Richter, J.; Powles, S. B.

    1993-01-01

    Herbicide resistance can occur either through target-site insensitivity or by nontarget site-based mechanisms. Two herbicide-resistant biotypes of Lolium rigidum Gaud., one resistant to acetolactate synthase (ALS)-inhibiting herbicides (biotype WLR1) and the other resistant to acetyl CoA carboxylase (ACCase)-inhibiting herbicides (biotype WLR96) through target-site insensitivity at the whole plant and enzymic levels, were found to express this resistance in the pollen. Pollen produced by resistant biotypes grew uninhibited when challenged with herbicide, whereas that from a susceptible biotype was inhibited. A third biotype, SLR31, resistant to ACCase-inhibiting and certain ALS-inhibiting herbicides at the whole plant level through nontarget site-based mechanisms, did not exhibit this expression in the pollen. The technique described may form the basis for a rapid screen for certain nuclear-encoded, target site-based herbicide-resistance mechanisms. PMID:12231886

  9. Targeting and Processing of Site-specific DNA Interstrand Crosslinks

    PubMed Central

    Vasquez, Karen M.

    2010-01-01

    DNA interstrand crosslinks (ICLs) are among the most cytotoxic types of DNA damage, and thus ICL-inducing agents such as cyclophosphamide, melphalan, cisplatin, psoralen and mitomycin C have been used clinically as anti-cancer drugs for decades. ICLs can also be formed endogenously as a consequence of cellular metabolic processes. ICL-inducing agents continue to be among the most effective chemotherapeutic treatments for many cancers; however, treatment with these agents can lead to secondary malignancies, in part due to mutagenic processing of the DNA lesions. The mechanisms of ICL repair have been characterized more thoroughly in bacteria and yeast than in mammalian cells. Thus, a better understanding the molecular mechanisms of ICL processing offers the potential to improve the efficacy of these drugs in cancer therapy. In mammalian cells it is thought that ICLs are repaired by the coordination of proteins from several pathways, including nucleotide excision repair (NER), base excision repair (BER), mismatch repair (MMR), homologous recombination (HR), translesion synthesis (TLS), and proteins involved in Fanconi anemia (FA). In this review, we focus on the potential functions of NER, MMR, and HR proteins in the repair of and response to ICLs in human cells and in mice. We will also discuss a unique approach, using psoralen covalently linked to triplex-forming oligonucleotides to direct ICLs to specific sites in the mammalian genome. PMID:20196133

  10. Diversity-Oriented Synthesis Probe Targets Plasmodium falciparum Cytochrome b Ubiquinone Reduction Site and Synergizes With Oxidation Site Inhibitors

    PubMed Central

    Lukens, Amanda K.; Heidebrecht, Richard W.; Mulrooney, Carol; Beaudoin, Jennifer A.; Comer, Eamon; Duvall, Jeremy R.; Fitzgerald, Mark E.; Masi, Daniela; Galinsky, Kevin; Scherer, Christina A.; Palmer, Michelle; Munoz, Benito; Foley, Michael; Schreiber, Stuart L.; Wiegand, Roger C.; Wirth, Dyann F.

    2015-01-01

    Background. The emergence and spread of drug resistance to current antimalarial therapies remains a pressing concern, escalating the need for compounds that demonstrate novel modes of action. Diversity-Oriented Synthesis (DOS) libraries bridge the gap between conventional small molecule and natural product libraries, allowing the interrogation of more diverse chemical space in efforts to identify probes of novel parasite pathways. Methods. We screened and optimized a probe from a DOS library using whole-cell phenotypic assays. Resistance selection and whole-genome sequencing approaches were employed to identify the cellular target of the compounds. Results. We identified a novel macrocyclic inhibitor of Plasmodium falciparum with nanomolar potency and identified the reduction site of cytochrome b as its cellular target. Combination experiments with reduction and oxidation site inhibitors showed synergistic inhibition of the parasite. Conclusions. The cytochrome b oxidation center is a validated antimalarial target. We show that the reduction site of cytochrome b is also a druggable target. Our results demonstrating a synergistic relationship between oxidation and reduction site inhibitors suggests a future strategy for new combination therapies in the treatment of malaria. PMID:25336726

  11. Recovery of perennial vegetation in military target sites in the eastern Mohave Desert, Arizona

    USGS Publications Warehouse

    Steiger, John W.; Webb, Robert H.

    2000-01-01

    The effect of the age of geomorphic surfaces on the recovery of desert vegetation in military target sites was studied in the Mohave and Cerbat Mountains of northwestern Arizona. The target sites were cleared of all vegetation during military exercises in 1942-1943 and have not been subsequently disturbed. The degree of recovery was measured by calculating percentage-similarity (PS) and correlation-coefficient indices on the basis of differences in cover, density, and volume of species growing in and out of each target site. PS values, ranging from 22.7 to 95.1 percent (100 percent = identical composition), indicate a wide range of recovery that is partially controlled by the edaphic properties of the geomorphic surfaces. Statistical analyses show a strong pattern that indicates a greater variability in the degree of recovery for sites on older surfaces than on younger surfaces and a weak pattern that indicates an inverse relation between the degree of recovery and geomorphic age. Comparisons of the different effects of target site construction on the edaphic characteristics of each target site provides an explanation for these patterns and suggests the soil properties critical to the recovery process. Statistically significant negative or positive response to disturbance for most species are independent of the age of the geomorphic surfaces; however, there is strong evidence for a shift in response for the common perennial species Acamptopappus sphaerocephalus, and to a lesser extent, Salazaria mexicana, Encelia farinosa, and Coldenia canescens, among different geomorphic surfaces.

  12. Functional microRNAs and target sites are created by lineage-specific transposition

    PubMed Central

    Spengler, Ryan M.; Oakley, Clayton K.; Davidson, Beverly L.

    2014-01-01

    Transposable elements (TEs) account for nearly one-half of the sequence content in the human genome, and de novo germline transposition into regulatory or coding sequences of protein-coding genes can cause heritable disorders. TEs are prevalent in and around protein-coding genes, providing an opportunity to impart regulation. Computational studies reveal that microRNA (miRNA) genes and miRNA target sites reside within TE sequences, but there is little experimental evidence supporting a role for TEs in the birth of miRNAs, or as platform for gene regulation by miRNAs. In this work, we validate miRNAs and target sites derived from TE families prevalent in the human genome, including the ancient long interspersed nuclear element 2 (LINE2/L2), mammalian-wide interspersed repeat (MIR) retrotransposons and the primate-specific Alu family. We show that genes with 3′ untranslated region (3′ UTR) MIR elements are enriched for let-7 targets and that these sites are conserved and responsive to let-7 expression. We also demonstrate that 3′ UTR-embedded Alus are a source of miR-24 and miR-122 target sites and that a subset of active genomic Alus provide for de novo target site creation. Finally, we report that although the creation of miRNA genes by Alu elements is relatively uncommon relative to their overall genomic abundance, Alu-derived miR-1285-1 is efficiently processed from its genomic locus and regulates genes with target sites contained within homologous elements. Taken together, our data provide additional evidence for TEs as a source for miRNAs and miRNA target sites, with instances of conservation through the course of mammalian evolution. PMID:24234653

  13. Near Surface Swimming of Salmonella Typhimurium Explains Target-Site Selection and Cooperative Invasion

    PubMed Central

    Kreibich, Saskia; Vonaesch, Pascale; Andritschke, Daniel; Rout, Samuel; Weidner, Kerstin; Sormaz, Milos; Songhet, Pascal; Horvath, Peter; Chabria, Mamta; Vogel, Viola; Spori, Doris M.; Jenny, Patrick; Hardt, Wolf-Dietrich

    2012-01-01

    Targeting of permissive entry sites is crucial for bacterial infection. The targeting mechanisms are incompletely understood. We have analyzed target-site selection by S. Typhimurium. This enteropathogenic bacterium employs adhesins (e.g. fim) and the type III secretion system 1 (TTSS-1) for host cell binding, the triggering of ruffles and invasion. Typically, S. Typhimurium invasion is focused on a subset of cells and multiple bacteria invade via the same ruffle. It has remained unclear how this is achieved. We have studied target-site selection in tissue culture by time lapse microscopy, movement pattern analysis and modeling. Flagellar motility (but not chemotaxis) was required for reaching the host cell surface in vitro. Subsequently, physical forces trapped the pathogen for ∼1.5–3 s in “near surface swimming”. This increased the local pathogen density and facilitated “scanning” of the host surface topology. We observed transient TTSS-1 and fim-independent “stopping” and irreversible TTSS-1-mediated docking, in particular at sites of prominent topology, i.e. the base of rounded-up cells and membrane ruffles. Our data indicate that target site selection and the cooperative infection of membrane ruffles are attributable to near surface swimming. This mechanism might be of general importance for understanding infection by flagellated bacteria. PMID:22911370

  14. Small activating RNA binds to the genomic target site in a seed-region-dependent manner

    PubMed Central

    Meng, Xing; Jiang, Qian; Chang, Nannan; Wang, Xiaoxia; Liu, Chujun; Xiong, Jingwei; Cao, Huiqing; Liang, Zicai

    2016-01-01

    RNA activation (RNAa) is the upregulation of gene expression by small activating RNAs (saRNAs). In order to investigate the mechanism by which saRNAs act in RNAa, we used the progesterone receptor (PR) gene as a model, established a panel of effective saRNAs and assessed the involvement of the sense and antisense strands of saRNA in RNAa. All active saRNAs had their antisense strand effectively incorporated into Ago2, whereas such consistency did not occur for the sense strand. Using a distal hotspot for saRNA targeting at 1.6-kb upstream from the PR transcription start site, we further established that gene activation mediated by saRNA depended on the complementarity of the 5′ region of the antisense strand, and that such activity was largely abolished by mutations in this region of the saRNA. We found markedly reduced RNAa effects when we created mutations in the genomic target site of saRNA PR-1611, thus providing evidence that RNAa depends on the integrity of the DNA target. We further demonstrated that this saRNA bound the target site on promoter DNA. These results demonstrated that saRNAs work via an on-site mechanism by binding to target genomic DNA in a seed-region-dependent manner, reminiscent of miRNA-like target recognition. PMID:26873922

  15. Crops with target-site herbicide resistance for Orobanche and Striga control.

    PubMed

    Gressel, Jonathan

    2009-05-01

    It is necessary to control root parasitic weeds before or as they attach to the crop. This can only be easily achieved chemically with herbicides that are systemic, or with herbicides that are active in soil. Long-term control can only be attained if the crops do not metabolise the herbicide, i.e. have target-site resistance. Such target-site resistances have allowed foliar applications of herbicides inhibiting enol-pyruvylshikimate phosphate synthase (EPSPS) (glyphosate), acetolactate synthase (ALS) (e.g. chlorsulfuron, imazapyr) and dihydropteroate synthase (asulam) for Orobanche control in experimental conditions with various crops. Large-scale use of imazapyr as a seed dressing of imidazolinone-resistant maize has been commercialised for Striga control. Crops with two target-site resistances will be more resilient to the evolution of resistance in the parasite, if well managed. PMID:19280593

  16. Predicting target-ligand interactions using protein ligand-binding site and ligand substructures

    PubMed Central

    2015-01-01

    Background Cell proliferation, differentiation, Gene expression, metabolism, immunization and signal transduction require the participation of ligands and targets. It is a great challenge to identify rules governing molecular recognition between chemical topological substructures of ligands and the binding sites of the targets. Methods We suppose that the ligand-target interactions are determined by ligand substructures as well as the physical-chemical properties of the binding sites. Therefore, we propose a fragment interaction model (FIM) to describe the interactions between ligands and targets, with the purpose of facilitating the chemical interpretation of ligand-target binding. First we extract target-ligand complexes from sc-PDB database, based on which, we get the target binding sites and the ligands. Then we represent each binding site as a fragment vector based on a target fragment dictionary that is composed of 199 clusters (denoted as fragements in this work) obtained by clustering 4200 trimers according to their physical-chemical properties. And then, we represent each ligand as a substructure vector based on a dictionary containing 747 substructures. Finally, we build the FIM by generating the interaction matrix M (representing the fragment interaction network), and the FIM can later be used for predicting unknown ligand-target interactions as well as providing the binding details of the interactions. Results The five-fold cross validation results show that the proposed model can get higher AUC score (92%) than three prevalence algorithms CS-PD (80%), BLM-NII (85%) and RF (85%), demonstrating the remarkable predictive ability of FIM. We also show that the ligand binding sites (local information) overweight the sequence similarities (global information) in ligand-target binding, and introducing too much global information would be harmful to the predictive ability. Moreover, The derived fragment interaction network can provide the chemical insights on

  17. Multiple transcription factor binding sites predict AID targeting in non-immunoglobulin genes

    PubMed Central

    Duke, Jamie L.; Liu, Man; Yaari, Gur; Khalil, Ashraf M.; Tomayko, Mary M.; Shlomchik, Mark J.; Schatz, David G.; Kleinstein, Steven H.

    2013-01-01

    Aberrant targeting of the enzyme Activation Induced Cytidine Deaminase (AID) results in the accumulation of somatic mutations in approximately 25% of expressed genes in germinal center B cells. Observations in Ung−/− Msh2−/− mice suggest that many other genes efficiently repair AID-induced lesions, so that up to 45% of genes may actually be targeted by AID. It is important to understand the mechanisms that recruit AID to certain genes, as this mis-targeting represents an important risk for genome instability. We hypothesize that several mechanisms will combine to target AID to each locus. In order to resolve which mechanisms affect AID targeting, we analyze 7.3Mb of sequence data, along with the regulatory context, from 83 genes in Ung−/− Msh2−/− mice to identify common properties of AID targets. This analysis identifies the involvement of three transcription factor binding sites (E-box motifs, along with YY1 and C/EBP-beta binding sites) that may work together to recruit AID. Based on previous knowledge and these newly discovered features, a classification tree model was built to predict genome-wide AID targeting. Using this predictive model we were able to identify a set of 101 high-interest genes that are likely targets of AID. PMID:23514741

  18. Engineering Factor Xa Inhibitor with Multiple Platelet-Binding Sites Facilitates its Platelet Targeting

    PubMed Central

    Zhu, Yuanjun; Li, Ruyi; Lin, Yuan; Shui, Mengyang; Liu, Xiaoyan; Chen, Huan; Wang, Yinye

    2016-01-01

    Targeted delivery of antithrombotic drugs centralizes the effects in the thrombosis site and reduces the hemorrhage side effects in uninjured vessels. We have recently reported that the platelet-targeting factor Xa (FXa) inhibitors, constructed by engineering one Arg-Gly-Asp (RGD) motif into Ancylostoma caninum anticoagulant peptide 5 (AcAP5), can reduce the risk of systemic bleeding than non-targeted AcAP5 in mouse arterial injury model. Increasing the number of platelet-binding sites of FXa inhibitors may facilitate their adhesion to activated platelets, and further lower the bleeding risks. For this purpose, we introduced three RGD motifs into AcAP5 to generate a variant NR4 containing three platelet-binding sites. NR4 reserved its inherent anti-FXa activity. Protein-protein docking showed that all three RGD motifs were capable of binding to platelet receptor αIIbβ3. Molecular dynamics simulation demonstrated that NR4 has more opportunities to interact with αIIbβ3 than single-RGD-containing NR3. Flow cytometry analysis and rat arterial thrombosis model further confirmed that NR4 possesses enhanced platelet targeting activity. Moreover, NR4-treated mice showed a trend toward less tail bleeding time than NR3-treated mice in carotid artery endothelium injury model. Therefore, our data suggest that engineering multiple binding sites in one recombinant protein is a useful tool to improve its platelet-targeting efficiency. PMID:27432161

  19. Engineering Factor Xa Inhibitor with Multiple Platelet-Binding Sites Facilitates its Platelet Targeting.

    PubMed

    Zhu, Yuanjun; Li, Ruyi; Lin, Yuan; Shui, Mengyang; Liu, Xiaoyan; Chen, Huan; Wang, Yinye

    2016-01-01

    Targeted delivery of antithrombotic drugs centralizes the effects in the thrombosis site and reduces the hemorrhage side effects in uninjured vessels. We have recently reported that the platelet-targeting factor Xa (FXa) inhibitors, constructed by engineering one Arg-Gly-Asp (RGD) motif into Ancylostoma caninum anticoagulant peptide 5 (AcAP5), can reduce the risk of systemic bleeding than non-targeted AcAP5 in mouse arterial injury model. Increasing the number of platelet-binding sites of FXa inhibitors may facilitate their adhesion to activated platelets, and further lower the bleeding risks. For this purpose, we introduced three RGD motifs into AcAP5 to generate a variant NR4 containing three platelet-binding sites. NR4 reserved its inherent anti-FXa activity. Protein-protein docking showed that all three RGD motifs were capable of binding to platelet receptor αIIbβ3. Molecular dynamics simulation demonstrated that NR4 has more opportunities to interact with αIIbβ3 than single-RGD-containing NR3. Flow cytometry analysis and rat arterial thrombosis model further confirmed that NR4 possesses enhanced platelet targeting activity. Moreover, NR4-treated mice showed a trend toward less tail bleeding time than NR3-treated mice in carotid artery endothelium injury model. Therefore, our data suggest that engineering multiple binding sites in one recombinant protein is a useful tool to improve its platelet-targeting efficiency. PMID:27432161

  20. PAM multiplicity marks genomic target sites as inhibitory to CRISPR-Cas9 editing

    PubMed Central

    Malina, Abba; Cameron, Christopher J. F.; Robert, Francis; Blanchette, Mathieu; Dostie, Josée; Pelletier, Jerry

    2015-01-01

    In CRISPR-Cas9 genome editing, the underlying principles for selecting guide RNA (gRNA) sequences that would ensure for efficient target site modification remain poorly understood. Here we show that target sites harbouring multiple protospacer adjacent motifs (PAMs) are refractory to Cas9-mediated repair in situ. Thus we refine which substrates should be avoided in gRNA design, implicating PAM density as a novel sequence-specific feature that inhibits in vivo Cas9-driven DNA modification. PMID:26644285

  1. CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites

    PubMed Central

    Naito, Yuki; Hino, Kimihiro; Bono, Hidemasa; Ui-Tei, Kumiko

    2015-01-01

    Summary: CRISPRdirect is a simple and functional web server for selecting rational CRISPR/Cas targets from an input sequence. The CRISPR/Cas system is a promising technique for genome engineering which allows target-specific cleavage of genomic DNA guided by Cas9 nuclease in complex with a guide RNA (gRNA), that complementarily binds to a ∼20 nt targeted sequence. The target sequence requirements are twofold. First, the 5′-NGG protospacer adjacent motif (PAM) sequence must be located adjacent to the target sequence. Second, the target sequence should be specific within the entire genome in order to avoid off-target editing. CRISPRdirect enables users to easily select rational target sequences with minimized off-target sites by performing exhaustive searches against genomic sequences. The server currently incorporates the genomic sequences of human, mouse, rat, marmoset, pig, chicken, frog, zebrafish, Ciona, fruit fly, silkworm, Caenorhabditis elegans, Arabidopsis, rice, Sorghum and budding yeast. Availability: Freely available at http://crispr.dbcls.jp/. Contact: y-naito@dbcls.rois.ac.jp Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25414360

  2. Coactivation of GR and NFKB alters the repertoire of their binding sites and target genes

    PubMed Central

    Rao, Nagesha A.S.; McCalman, Melysia T.; Moulos, Panagiotis; Francoijs, Kees-Jan; Chatziioannou, Aristotelis; Kolisis, Fragiskos N.; Alexis, Michael N.; Mitsiou, Dimitra J.; Stunnenberg, Hendrik G.

    2011-01-01

    Glucocorticoid receptor (GR) exerts anti-inflammatory action in part by antagonizing proinflammatory transcription factors such as the nuclear factor kappa-b (NFKB). Here, we assess the crosstalk of activated GR and RELA (p65, major NFKB component) by global identification of their binding sites and target genes. We show that coactivation of GR and p65 alters the repertoire of regulated genes and results in their association with novel sites in a mutually dependent manner. These novel sites predominantly cluster with p65 target genes that are antagonized by activated GR and vice versa. Our data show that coactivation of GR and NFKB alters signaling pathways that are regulated by each factor separately and provide insight into the networks underlying the GR and NFKB crosstalk. PMID:21750107

  3. FLP-mediated DNA mobilization to specific target sites in Drosophila chromosomes.

    PubMed Central

    Golic, M M; Rong, Y S; Petersen, R B; Lindquist, S L; Golic, K G

    1997-01-01

    The ability to place a series of gene constructs at a specific site in the genome opens new possibilities for the experimental examination of gene expression and chromosomal position effects. We report that the FLP- FRT site-specific recombination system of the yeast 2mu plasmid can be used to integrate DNA at a chromosomal FRT target site in Drosophila. The technique we used was to first integrate an FRT- flanked gene by standard P element-mediated transformation. FLP was then used to excise the FRT- flanked donor DNA and screen for FLP-mediated re-integration at an FRT target at a different chromosome location. Such events were recovered from up to 5% of the crosses used to screen for mobilization and are easily detectable by altered linkage of a white reporter gene or by the generation of a white + gene upon integration. PMID:9278488

  4. Novel and Viable Acetylcholinesterase Target Site for Developing Effective and Environmentally Safe Insecticides

    PubMed Central

    Pang, Yuan-Ping; Brimijoin, Stephen; Ragsdale, David W; Zhu, Kun Yan; Suranyi, Robert

    2012-01-01

    Insect pests are responsible for human suffering and financial losses worldwide. New and environmentally safe insecticides are urgently needed to cope with these serious problems. Resistance to current insecticides has resulted in a resurgence of insect pests, and growing concerns about insecticide toxicity to humans discourage the use of insecticides for pest control. The small market for insecticides has hampered insecticide development; however, advances in genomics and structural genomics offer new opportunities to develop insecticides that are less dependent on the insecticide market. This review summarizes the literature data that support the hypothesis that an insect-specific cysteine residue located at the opening of the acetylcholinesterase active site is a promising target site for developing new insecticides with reduced off-target toxicity and low propensity for insect resistance. These data are used to discuss the differences between targeting the insect-specific cysteine residue and targeting the ubiquitous catalytic serine residue of acetylcholinesterase from the perspective of reducing off-target toxicity and insect resistance. Also discussed is the prospect of developing cysteine-targeting anticholinesterases as effective and environmentally safe insecticides for control of disease vectors, crop damage, and residential insect pests within the financial confines of the present insecticide market. PMID:22280344

  5. Outreach for Outreach: Targeting social media audiences to promote a NASA kids’ web site

    NASA Astrophysics Data System (ADS)

    Pham, C. C.

    2009-12-01

    The Space Place is a successful NASA web site that benefits upper elementary school students and educators by providing games, activities, and resources to stimulate interest in science, technology, engineering, and mathematics, as well as to inform the audience of NASA’s contributions. As online social networking grows to be a central component of modern communication, The Space Place has explored the benefits of integrating social networks with the web site to increase awareness of materials the web site offers. This study analyzes the capabilities of social networks, and specifically the demographics of Twitter and Facebook. It then compares these results with the content, audience, and perceived demographics of The Space Place web site. Based upon the demographic results, we identified a target constituency that would benefit from the integration of social networks into The Space Place web site. As a result of this study, a Twitter feed has been established that releases a daily tweet from The Space Place. In addition, a Facebook page has been created to showcase new content and prompt interaction among fans of The Space Place. Currently, plans are under way to populate the Space Place Facebook page. Each social network has been utilized in an effort to spark excitement about the content on The Space Place, as well as to attract followers to the main NASA Space Place web site. To pursue this idea further, a plan has been developed to promote NASA Space Place’s social media tools among the target audience.

  6. In Search of Novel Drug Target Sites on Estrogen Receptors Using RNA Aptamers

    PubMed Central

    Xu, Daiying; Chatakonda, Vamsee-Krishna; Kourtidis, Antonis; Conklin, Douglas S.

    2014-01-01

    Estrogen receptor α (ERα) is a well-validated drug target for a majority of breast cancers. But the target sites on this receptor are far from exhaustively defined. Almost all ER antagonists in clinical use function by binding to the ligand-binding pocket to occlude agonist access. Resistance to this type of drugs may develop over time, not caused by the change of ERα itself, but by changes in ER associated proteins. This observation is fueling the development of reagents that downregulate ER activity through novel binding sites. However, it is challenging to find general ER antagonists that act independently from other known ER ligands. In this report, we describe the utility of RNA aptamers in the search for new drug target sites on ERα. We have identified three high affinity aptamers and characterized one of them in detail. This aptamer interacted with ERα in a way not affected by the presence or absence of either the steroidal ligands or the estrogen response DNA elements, and effectively inhibited ER-mediated transcriptional activation in a breast cancer cell line. Serving as a novel drug lead, it may also be used to guide the rational chemical synthesis of small molecule drugs or to perform screens of small molecule libraries for those that are able to displace the aptamer from its binding site. PMID:24588102

  7. Recent discoveries of influenza A drug target sites to combat virus replication.

    PubMed

    Patel, Hershna; Kukol, Andreas

    2016-06-15

    Sequence variations in the binding sites of influenza A proteins are known to limit the effectiveness of current antiviral drugs. Clinically, this leads to increased rates of virus transmission and pathogenicity. Potential influenza A inhibitors are continually being discovered as a result of high-throughput cell based screening studies, whereas the application of computational tools to aid drug discovery has further increased the number of predicted inhibitors reported. This review brings together the aspects that relate to the identification of influenza A drug target sites and the findings from recent antiviral drug discovery strategies. PMID:27284062

  8. PARma: identification of microRNA target sites in AGO-PAR-CLIP data.

    PubMed

    Erhard, Florian; Dölken, Lars; Jaskiewicz, Lukasz; Zimmer, Ralf

    2013-01-01

    PARma is a complete data analysis software for AGO-PAR-CLIP experiments to identify target sites of microRNAs as well as the microRNA binding to these sites. It integrates specific characteristics of the experiments into a generative model. The model and a novel pattern discovery tool are iteratively applied to data to estimate seed activity probabilities, cluster confidence scores and to assign the most probable microRNA. Based on differential PAR-CLIP analysis and comparison to RIP-Chip data, we show that PARma is more accurate than existing approaches. PARma is available from http://www.bio.ifi.lmu.de/PARma. PMID:23895117

  9. PARma: identification of microRNA target sites in AGO-PAR-CLIP data

    PubMed Central

    2013-01-01

    PARma is a complete data analysis software for AGO-PAR-CLIP experiments to identify target sites of microRNAs as well as the microRNA binding to these sites. It integrates specific characteristics of the experiments into a generative model. The model and a novel pattern discovery tool are iteratively applied to data to estimate seed activity probabilities, cluster confidence scores and to assign the most probable microRNA. Based on differential PAR-CLIP analysis and comparison to RIP-Chip data, we show that PARma is more accurate than existing approaches. PARma is available from http://www.bio.ifi.lmu.de/PARma PMID:23895117

  10. Relative position and pose measurement approach of specific operation site of space non-cooperative target

    NASA Astrophysics Data System (ADS)

    Chen, Feng; Zhou, Ying; Li, Ronghua; Huang, Jianming

    2015-12-01

    In order to achieve the rendezvous and capture of the space non-cooperative target, the relative position and pose measurement of non-cooperative target must be resolved. Since the marker is not installed into the non-cooperative target and there is no inter satellite link to transfer the information, so it is very difficult to measure the relative position and pose measurement of non-cooperative target. The solar array connecting frame of non-cooperative targets have their characters and are easy to capture, so the position and pose measurement of specific operation site of non-cooperative target based on stereo vision has been studied in this paper. The method composed of image acquiring, image filtering, edge detection, feature extraction and relative pose measurement. Finally, the relative position and attitude parameters of the solar wing connection were obtained and provided to the control system. The results of simulation and ground verification show that the algorithm is accurate and effective, and can satisfy the technical requirements of the on orbit operation. The measurement approach can be used for engineering implementation.

  11. Targeting Alternative Sites on the Androgen Receptor to Treat Castration-Resistant Prostate Cancer

    PubMed Central

    Lallous, Nada; Dalal, Kush; Cherkasov, Artem; Rennie, Paul S.

    2013-01-01

    Recurrent, metastatic prostate cancer continues to be a leading cause of cancer-death in men. The androgen receptor (AR) is a modular, ligand-inducible transcription factor that regulates the expression of genes that can drive the progression of this disease, and as a consequence, this receptor is a key therapeutic target for controlling prostate cancer. The current drugs designed to directly inhibit the AR are called anti-androgens, and all act by competing with androgens for binding to the androgen/ligand binding site. Unfortunately, with the inevitable progression of the cancer to castration resistance, many of these drugs become ineffective. However, there are numerous other regulatory sites on this protein that have not been exploited therapeutically. The regulation of AR activity involves a cascade of complex interactions with numerous chaperones, co-factors and co-regulatory proteins, leading ultimately to direct binding of AR dimers to specific DNA androgen response elements within the promoter and enhancers of androgen-regulated genes. As part of the family of nuclear receptors, the AR is organized into modular structural and functional domains with specialized roles in facilitating their inter-molecular interactions. These regions of the AR present attractive, yet largely unexploited, drug target sites for reducing or eliminating androgen signaling in prostate cancers. The design of small molecule inhibitors targeting these specific AR domains is only now being realized and is the culmination of decades of work, including crystallographic and biochemistry approaches to map the shape and accessibility of the AR surfaces and cavities. Here, we review the structure of the AR protein and describe recent advancements in inhibiting its activity with small molecules specifically designed to target areas distinct from the receptor’s androgen binding site. It is anticipated that these new classes of anti-AR drugs will provide an additional arsenal to treat

  12. Targeted Isolation of Antibodies Directed against Major Sites of SIV Env Vulnerability.

    PubMed

    Mason, Rosemarie D; Welles, Hugh C; Adams, Cameron; Chakrabarti, Bimal K; Gorman, Jason; Zhou, Tongqing; Nguyen, Richard; O'Dell, Sijy; Lusvarghi, Sabrina; Bewley, Carole A; Li, Hui; Shaw, George M; Sheng, Zizhang; Shapiro, Lawrence; Wyatt, Richard; Kwong, Peter D; Mascola, John R; Roederer, Mario

    2016-04-01

    The simian immunodeficiency virus (SIV) challenge model of lentiviral infection is often used as a model to human immunodeficiency virus type 1 (HIV-1) for studying vaccine mediated and immune correlates of protection. However, knowledge of the structure of the SIV envelope (Env) glycoprotein is limited, as is knowledge of binding specificity, function and potential efficacy of SIV antibody responses. In this study we describe the use of a competitive probe binding sort strategy as well as scaffolded probes for targeted isolation of SIV Env-specific monoclonal antibodies (mAbs). We isolated nearly 70 SIV-specific mAbs directed against major sites of SIV Env vulnerability analogous to broadly neutralizing antibody (bnAb) targets of HIV-1, namely, the CD4 binding site (CD4bs), CD4-induced (CD4i)-site, peptide epitopes in variable loops 1, 2 and 3 (V1, V2, V3) and potentially glycan targets of SIV Env. The range of SIV mAbs isolated includes those exhibiting varying degrees of neutralization breadth and potency as well as others that demonstrated binding but not neutralization. Several SIV mAbs displayed broad and potent neutralization of a diverse panel of 20 SIV viral isolates with some also neutralizing HIV-2(7312A). This extensive panel of SIV mAbs will facilitate more effective use of the SIV non-human primate (NHP) model for understanding the variables in development of a HIV vaccine or immunotherapy. PMID:27064278

  13. Targeted Isolation of Antibodies Directed against Major Sites of SIV Env Vulnerability

    PubMed Central

    Mason, Rosemarie D.; Welles, Hugh C.; Adams, Cameron; Chakrabarti, Bimal K.; Gorman, Jason; Zhou, Tongqing; Nguyen, Richard; O’Dell, Sijy; Lusvarghi, Sabrina; Bewley, Carole A.; Li, Hui; Shaw, George M.; Sheng, Zizhang; Shapiro, Lawrence; Wyatt, Richard; Kwong, Peter D.; Mascola, John R.; Roederer, Mario

    2016-01-01

    The simian immunodeficiency virus (SIV) challenge model of lentiviral infection is often used as a model to human immunodeficiency virus type 1 (HIV-1) for studying vaccine mediated and immune correlates of protection. However, knowledge of the structure of the SIV envelope (Env) glycoprotein is limited, as is knowledge of binding specificity, function and potential efficacy of SIV antibody responses. In this study we describe the use of a competitive probe binding sort strategy as well as scaffolded probes for targeted isolation of SIV Env-specific monoclonal antibodies (mAbs). We isolated nearly 70 SIV-specific mAbs directed against major sites of SIV Env vulnerability analogous to broadly neutralizing antibody (bnAb) targets of HIV-1, namely, the CD4 binding site (CD4bs), CD4-induced (CD4i)-site, peptide epitopes in variable loops 1, 2 and 3 (V1, V2, V3) and potentially glycan targets of SIV Env. The range of SIV mAbs isolated includes those exhibiting varying degrees of neutralization breadth and potency as well as others that demonstrated binding but not neutralization. Several SIV mAbs displayed broad and potent neutralization of a diverse panel of 20 SIV viral isolates with some also neutralizing HIV-27312A. This extensive panel of SIV mAbs will facilitate more effective use of the SIV non-human primate (NHP) model for understanding the variables in development of a HIV vaccine or immunotherapy. PMID:27064278

  14. Searching target sites on DNA by proteins: Role of DNA dynamics under confinement

    PubMed Central

    Mondal, Anupam; Bhattacherjee, Arnab

    2015-01-01

    DNA-binding proteins (DBPs) rapidly search and specifically bind to their target sites on genomic DNA in order to trigger many cellular regulatory processes. It has been suggested that the facilitation of search dynamics is achieved by combining 3D diffusion with one-dimensional sliding and hopping dynamics of interacting proteins. Although, recent studies have advanced the knowledge of molecular determinants that affect one-dimensional search efficiency, the role of DNA molecule is poorly understood. In this study, by using coarse-grained simulations, we propose that dynamics of DNA molecule and its degree of confinement due to cellular crowding concertedly regulate its groove geometry and modulate the inter-communication with DBPs. Under weak confinement, DNA dynamics promotes many short, rotation-decoupled sliding events interspersed by hopping dynamics. While this results in faster 1D diffusion, associated probability of missing targets by jumping over them increases. In contrast, strong confinement favours rotation-coupled sliding to locate targets but lacks structural flexibility to achieve desired specificity. By testing under physiological crowding, our study provides a plausible mechanism on how DNA molecule may help in maintaining an optimal balance between fast hopping and rotation-coupled sliding dynamics, to locate target sites rapidly and form specific complexes precisely. PMID:26400158

  15. Host factors in retroviral integration and the selection of integration target sites

    PubMed Central

    Craigie, Robert; Bushman, Frederic D.

    2015-01-01

    In order to replicate, a retrovirus must integrate a DNA copy of the viral RNA genome into a chromosome of the host cell. The study of retroviral integration has advanced considerably in the last few years. Here we focus on host factor interactions and the linked area of integration targeting. Genome-wide screens for cellular factors affecting HIV replication have identified a series of host cell proteins that may mediate subcellular trafficking of integration complexes, nuclear import, and integration target site selection. The cell transcriptional co-activator protein LEDGF/p75 has been identified as a tethering factor important for HIV integration, and recently, BET proteins (Brd2, 4, and 4) have been identified as tethering factors for the gammaretroviruses. A new class of HIV inhibitors has been developed targeting the HIV-1 IN-LEDGF binding site, though surprisingly these inhibitors appear to block assembly late during replication and do not act at the integration step. Going forward, genome-wide studies of HIV-host interactions offer many new starting points to investigate HIV replication and identify potential new inhibitor targets. PMID:26104434

  16. Programmable Site-Specific Nucleases for Targeted Genome Engineering in Higher Eukaryotes.

    PubMed

    Govindan, Ganesan; Ramalingam, Sivaprakash

    2016-11-01

    Recent advances in the targeted genome engineering enable molecular biologists to generate sequence specific modifications with greater efficiency and higher specificity in complex eukaryotic genomes. Programmable site-specific DNA cleavage reagents and cellular DNA repair mechanisms have made this possible. These reagents have become powerful tools for delivering a site-specific genomic double-strand break (DSB) at the desired chromosomal locus, which produces sequence alterations through error-prone non-homologous end joining (NHEJ) resulting in gene inactivations/knockouts. Alternatively, the DSB can be repaired through homology-directed repair (HDR) using a donor DNA template, which leads to the introduction of desired sequence modifications at the predetermined site. Here, we summarize the role of three classes of nucleases; zinc finger nucleases (ZFNs), transcription activator like effector nucleases (TALENs), and clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR associated protein 9 (Cas9) system in achieving targeted genome modifications. Further, we discuss the progress towards the applications of programmable site-specific nucleases (SSNs) in treating human diseases and other biological applications in economically important higher eukaryotic organisms such as plants and livestock. J. Cell. Physiol. 231: 2380-2392, 2016. © 2016 Wiley Periodicals, Inc. PMID:26945523

  17. Site-targeted mutagenesis for stabilization of recombinant monoclonal antibody expressed in tobacco (Nicotiana tabacum) plants

    PubMed Central

    Hehle, Verena K.; Paul, Matthew J.; Roberts, Victoria A.; van Dolleweerd, Craig J.; Ma, Julian K.-C.

    2016-01-01

    This study examined the degradation pattern of a murine IgG1κ monoclonal antibody expressed in and extracted from transformed Nicotiana tabacum. Gel electrophoresis of leaf extracts revealed a consistent pattern of recombinant immunoglobulin bands, including intact and full-length antibody, as well as smaller antibody fragments. N-terminal sequencing revealed these smaller fragments to be proteolytic cleavage products and identified a limited number of protease-sensitive sites in the antibody light and heavy chain sequences. No strictly conserved target sequence was evident, although the peptide bonds that were susceptible to proteolysis were predominantly and consistently located within or near to the interdomain or solvent-exposed regions in the antibody structure. Amino acids surrounding identified cleavage sites were mutated in an attempt to increase resistance. Different Guy’s 13 antibody heavy and light chain mutant combinations were expressed transiently in N. tabacum and demonstrated intensity shifts in the fragmentation pattern, resulting in alterations to the full-length antibody-to-fragment ratio. The work strengthens the understanding of proteolytic cleavage of antibodies expressed in plants and presents a novel approach to stabilize full-length antibody by site-directed mutagenesis.—Hehle, V. K., Paul, M. J., Roberts, V. A., van Dolleweerd, C. J., Ma, J. K.-C. Site-targeted mutagenesis for stabilization of recombinant monoclonal antibody expressed in tobacco (Nicotiana tabacum) plants. PMID:26712217

  18. Site-targeted mutagenesis for stabilization of recombinant monoclonal antibody expressed in tobacco (Nicotiana tabacum) plants.

    PubMed

    Hehle, Verena K; Paul, Matthew J; Roberts, Victoria A; van Dolleweerd, Craig J; Ma, Julian K-C

    2016-04-01

    This study examined the degradation pattern of a murine IgG1κ monoclonal antibody expressed in and extracted from transformedNicotiana tabacum Gel electrophoresis of leaf extracts revealed a consistent pattern of recombinant immunoglobulin bands, including intact and full-length antibody, as well as smaller antibody fragments. N-terminal sequencing revealed these smaller fragments to be proteolytic cleavage products and identified a limited number of protease-sensitive sites in the antibody light and heavy chain sequences. No strictly conserved target sequence was evident, although the peptide bonds that were susceptible to proteolysis were predominantly and consistently located within or near to the interdomain or solvent-exposed regions in the antibody structure. Amino acids surrounding identified cleavage sites were mutated in an attempt to increase resistance. Different Guy's 13 antibody heavy and light chain mutant combinations were expressed transiently inN. tabacumand demonstrated intensity shifts in the fragmentation pattern, resulting in alterations to the full-length antibody-to-fragment ratio. The work strengthens the understanding of proteolytic cleavage of antibodies expressed in plants and presents a novel approach to stabilize full-length antibody by site-directed mutagenesis.-Hehle, V. K., Paul, M. J., Roberts, V. A., van Dolleweerd, C. J., Ma, J. K.-C. Site-targeted mutagenesis for stabilization of recombinant monoclonal antibody expressed in tobacco (Nicotiana tabacum) plants. PMID:26712217

  19. Membrane blebbing as a recovery manoeuvre in site-specific sonoporation mediated by targeted microbubbles

    PubMed Central

    Leow, Ruen Shan; Wan, Jennifer M. F.; Yu, Alfred C. H.

    2015-01-01

    Site-specific perforation of the plasma membrane can be achieved through ultrasound-triggered cavitation of a single microbubble positioned adjacent to the cell. However, for this perforation approach (sonoporation), the recovery manoeuvres invoked by the cell are unknown. Here, we report new findings on how membrane blebbing can be a recovery manoeuvre that may take place in sonoporation episodes whose pores are of micrometres in diameter. Each sonoporation site was created using a protocol involving single-shot ultrasound exposure (frequency: 1 MHz; pulse length: 30 cycles; peak negative pressure: 0.45 MPa) which triggered inertial cavitation of a single targeted microbubble (diameter: 1–5 µm). Over this process, live confocal microscopy was conducted in situ to monitor membrane dynamics, model drug uptake kinetics and cytoplasmic calcium ion (Ca2+) distribution. Results show that blebbing would occur at a recovering sonoporation site after its resealing, and it may emerge elsewhere along the membrane periphery. The bleb size was correlated with the pre-exposure microbubble diameter, and 99% of blebbing cases at sonoporation sites were inflicted by microbubbles larger than 1.5 µm diameter (analysed over 124 sonoporation episodes). Blebs were not observed at irreversible sonoporation sites or when sonoporation site repair was inhibited via extracellular Ca2+ chelation. Functionally, the bleb volume was found to serve as a buffer compartment to accommodate the cytoplasmic Ca2+ excess brought about by Ca2+ influx during sonoporation. These findings suggest that membrane blebbing would help sonoporated cells restore homeostasis. PMID:25694544

  20. Targeting Large Kinase Active Site with Rigid, Bulky Octahedral Ruthenium Complexes

    SciTech Connect

    Maksimoska, Jasna; Feng, Li; Harms, Klaus; Yi, Chunling; Kissil, Joseph; Marmorstein, Ronen; Meggers, Eric

    2009-09-02

    A strategy for targeting protein kinases with large ATP-binding sites by using bulky and rigid octahedral ruthenium complexes as structural scaffolds is presented. A highly potent and selective GSK3 and Pim1 half-sandwich complex NP309 was successfully converted into a PAK1 inhibitor by making use of the large octahedral compounds {Lambda}-FL172 and {Lambda}-FL411 in which the cyclopentadienyl moiety of NP309 is replaced by a chloride and sterically demanding diimine ligands. A 1.65 {angstrom}cocrystal structure of PAK1 with {Lambda}-FL172 reveals how the large coordination sphere of the ruthenium complex matches the size of the active site and serves as a yardstick to discriminate between otherwise closely related binding sites.

  1. A structure-based approach for targeting the HIV-1 genomic RNA dimerization initiation site.

    PubMed

    Ennifar, Eric; Paillart, Jean-Christophe; Bernacchi, Serena; Walter, Philippe; Pale, Patrick; Decout, Jean-Luc; Marquet, Roland; Dumas, Philippe

    2007-10-01

    Dimerization of the genomic RNA is an important step of the HIV-1 replication cycle. The Dimerization Initiation Site (DIS) promotes dimerization of the viral genome by forming a loop-loop complex between two DIS hairpins. Crystal structures of the DIS loop-loop complex revealed an unexpected and strong similitude with the bacterial 16S ribosomal aminoacyl-tRNA site (A site), which is the target of aminoglycoside antibiotics. As a consequence of these structural and sequence similarities, the HIV-1 DIS also binds some aminoglycosides, not only in vitro, but also ex vivo, in lymphoid cells and in viral particles. Crystal structures of the DIS loop-loop in complex with several aminoglycoside antibiotics provide a detailed-view of the DIS/drug interaction and reveal some hints about possible modifications to increase the drug affinity and/or specificity. PMID:17434658

  2. Protecting Important Sites for Biodiversity Contributes to Meeting Global Conservation Targets

    PubMed Central

    Butchart, Stuart H. M.; Scharlemann, Jörn P. W.; Evans, Mike I.; Quader, Suhel; Aricò, Salvatore; Arinaitwe, Julius; Balman, Mark; Bennun, Leon A.; Bertzky, Bastian; Besançon, Charles; Boucher, Timothy M.; Brooks, Thomas M.; Burfield, Ian J.; Burgess, Neil D.; Chan, Simba; Clay, Rob P.; Crosby, Mike J.; Davidson, Nicholas C.; De Silva, Naamal; Devenish, Christian; Dutson, Guy C. L.; Fernández, David F. Día z; Fishpool, Lincoln D. C.; Fitzgerald, Claire; Foster, Matt; Heath, Melanie F.; Hockings, Marc; Hoffmann, Michael; Knox, David; Larsen, Frank W.; Lamoreux, John F.; Loucks, Colby; May, Ian; Millett, James; Molloy, Dominic; Morling, Paul; Parr, Mike; Ricketts, Taylor H.; Seddon, Nathalie; Skolnik, Benjamin; Stuart, Simon N.; Upgren, Amy; Woodley, Stephen

    2012-01-01

    Protected areas (PAs) are a cornerstone of conservation efforts and now cover nearly 13% of the world's land surface, with the world's governments committed to expand this to 17%. However, as biodiversity continues to decline, the effectiveness of PAs in reducing the extinction risk of species remains largely untested. We analyzed PA coverage and trends in species' extinction risk at globally significant sites for conserving birds (10,993 Important Bird Areas, IBAs) and highly threatened vertebrates and conifers (588 Alliance for Zero Extinction sites, AZEs) (referred to collectively hereafter as ‘important sites’). Species occurring in important sites with greater PA coverage experienced smaller increases in extinction risk over recent decades: the increase was half as large for bird species with>50% of the IBAs at which they occur completely covered by PAs, and a third lower for birds, mammals and amphibians restricted to protected AZEs (compared with unprotected or partially protected sites). Globally, half of the important sites for biodiversity conservation remain unprotected (49% of IBAs, 51% of AZEs). While PA coverage of important sites has increased over time, the proportion of PA area covering important sites, as opposed to less important land, has declined (by 0.45–1.14% annually since 1950 for IBAs and 0.79–1.49% annually for AZEs). Thus, while appropriately located PAs may slow the rate at which species are driven towards extinction, recent PA network expansion has under-represented important sites. We conclude that better targeted expansion of PA networks would help to improve biodiversity trends. PMID:22457717

  3. Moving target indicating radar applications in an integrated site security suite

    SciTech Connect

    Appenzeller, R.C. )

    1991-01-01

    The integration of a small, lightweight, low power consumption radar into a site security sensor suite can provide several key advantages in the ability to detect vehicles and personnel over large ground areas. This paper presents rationale for the inclusion of a man-portable Moving Target Indicator (MTI) radar in several security scenarios and outlines the technical specifics of a candidate radar. The Department of Energy (DOE) is currently investigating the effectiveness of a combination of optical sensors in concert with a scanning narrow beam radar at the Nevada Test Site in Mercury, Nevada. Demonstration results from these previous test activities are included herein. Of particular interest is the complimentary nature of this sensor suite where the large field of view achievable with radar allows the optical sensors to be used as pinpoint target classification devices. The inclusion of a radar minimizes operator fatigue caused by watching cameras scanning in azimuth and elevation. Advances in the areas of nuisance alarm rejection and improved range detection against single personnel targets were made in 1990 and this capability is included in the current production version.

  4. Rational targeting of active-site tyrosine residues using sulfonyl fluoride probes.

    PubMed

    Hett, Erik C; Xu, Hua; Geoghegan, Kieran F; Gopalsamy, Ariamala; Kyne, Robert E; Menard, Carol A; Narayanan, Arjun; Parikh, Mihir D; Liu, Shenping; Roberts, Lee; Robinson, Ralph P; Tones, Michael A; Jones, Lyn H

    2015-04-17

    This work describes the first rational targeting of tyrosine residues in a protein binding site by small-molecule covalent probes. Specific tyrosine residues in the active site of the mRNA-decapping scavenger enzyme DcpS were modified using reactive sulfonyl fluoride covalent inhibitors. Structure-based molecular design was used to create an alkyne-tagged probe bearing the sulfonyl fluoride warhead, thus enabling the efficient capture of the protein from a complex proteome. Use of the probe in competition experiments with a diaminoquinazoline DcpS inhibitor permitted the quantification of intracellular target occupancy. As a result, diaminoquinazoline upregulators of survival motor neuron protein that are used for the treatment of spinal muscular atrophy were confirmed as inhibitors of DcpS in human primary cells. This work illustrates the utility of sulfonyl fluoride probes designed to react with specific tyrosine residues of a protein and augments the chemical biology toolkit by these probes uses in target validation and molecular pharmacology. PMID:25571984

  5. Analysis on establishing Chang'E-3 landing site as a reflectance calibration target

    NASA Astrophysics Data System (ADS)

    Liu, Bin; Fu, Xiaohui; Zeng, Xingguo; Yao, Meijuan; Zhang, Hongbo; Su, Yan; Zhao, Shu; Xue, Xiping; Li, Chunlai; Zou, Yongliao

    2015-04-01

    Recent lunar orbital observations suggested that the surface reflectance calculated based on the Apollo 16 standard area and Apollo 16 sample laboratory measurement is significantly different from its true value [1-3], one reason is the composition and maturity differences between the 62231 sampling site and the Apollo 16 standard site existed, the other reason is the physical properties of the returned lunar sample, such as porosity, have been changed during the sampling operations. So more new standard targets on the Moon, besides the widely used Apollo 16 area, are needed for imaging spectrometers on lunar missions to improve their reflectance calibration accuracies. The Chang'E-3 VIS/NIR Imaging Spectrometer (VNIS), which is just fixed at the front of the Yutu rover [4], equipped with a white spectralon panel as reflectance calibration standard, can perform in situ multispectral observations around the Chang'E-3 landing site without altering the physical and mineralogical natures of lunar soils. Therefore, it provides an opportunity to establish a new reliable standard target for in-flight reflectance calibration. The reflectance calibration target should be compositional homogeneous, the topography of which must be flat, and the reflectance should be identical with no nearby units of other different materials. As we have known, Chang'e-3 probe landed on the Mare Imbrium basin in the east part of Sinus Iridum, the landing site is relatively flat at a spatial coverage of ~660km2, and this region belongs to Eratosthenian low-Ti/high-Ti mare basalts [5-6]. According to much higher resolution topography data, elemental data and reflectance data of Chang'E-2 and Chang'E-3[7-8], we preliminary analyse the possibility on establishing Chang'E-3 landing site as a reflectance calibration target. Firstly, the overall terrain of the 4 km×4 km area around the landing site is flat, but there are still three bigger craters existed. Secondly, the composition on Chang'E-3

  6. De-Novo Identification of PPARγ/RXR Binding Sites and Direct Targets during Adipogenesis

    PubMed Central

    Vega, Vinsensius B.; Thomsen, Jane S.; Kandhadayar, Gopalan Srinivasan; Ng, Patrick Wei Pern; Chiu, Kuo Ping; Pettersson, Sven; Wei, Chia Lin; Ruan, Yijun; Liu, Edison T.

    2009-01-01

    Background The pathophysiology of obesity and type 2 diabetes mellitus is associated with abnormalities in endocrine signaling in adipose tissue and one of the key signaling affectors operative in these disorders is the nuclear hormone transcription factor peroxisome proliferator-activated receptor-γ (PPARγ). PPARγ has pleiotropic functions affecting a wide range of fundamental biological processes including the regulation of genes that modulate insulin sensitivity, adipocyte differentiation, inflammation and atherosclerosis. To date, only a limited number of direct targets for PPARγ have been identified through research using the well established pre-adipogenic cell line, 3T3-L1. In order to obtain a genome-wide view of PPARγ binding sites, we applied the pair end-tagging technology (ChIP-PET) to map PPARγ binding sites in 3T3-L1 preadipocyte cells. Methodology/Principal Findings Coupling gene expression profile analysis with ChIP-PET, we identified in a genome-wide manner over 7700 DNA binding sites of the transcription factor PPARγ and its heterodimeric partner RXR during the course of adipocyte differentiation. Our validation studies prove that the identified sites are bona fide binding sites for both PPARγ and RXR and that they are functionally capable of driving PPARγ specific transcription. Our results strongly indicate that PPARγ is the predominant heterodimerization partner for RXR during late stages of adipocyte differentiation. Additionally, we find that PPARγ/RXR association is enriched within the proximity of the 5′ region of the transcription start site and this association is significantly associated with transcriptional up-regulation of genes involved in fatty acid and lipid metabolism confirming the role of PPARγ as the master transcriptional regulator of adipogenesis. Evolutionary conservation analysis of these binding sites is greater when adjacent to up-regulated genes than down-regulated genes, suggesting the primordial function

  7. GHB receptor targets in the CNS: focus on high-affinity binding sites.

    PubMed

    Bay, Tina; Eghorn, Laura F; Klein, Anders B; Wellendorph, Petrine

    2014-01-15

    γ-Hydroxybutyric acid (GHB) is an endogenous compound in the mammalian brain with both low- and high-affinity receptor targets. GHB is used clinically in the treatment of symptoms of narcolepsy and alcoholism, but also illicitly abused as the recreational drug Fantasy. Major pharmacological effects of exogenous GHB are mediated by GABA subtype B (GABAB) receptors that bind GHB with low affinity. The existence of GHB high-affinity binding sites has been known for more than three decades, but the uncovering of their molecular identity has only recently begun. This has been prompted by the generation of molecular tools to selectively study high-affinity sites. These include both genetically modified GABAB knock-out mice and engineered selective GHB ligands. Recently, certain GABA subtype A (GABAA) receptor subtypes emerged as high-affinity GHB binding sites and potential physiological mediators of GHB effects. In this research update, a description of the various reported receptors for GHB is provided, including GABAB receptors, certain GABAA receptor subtypes and other reported GHB receptors. The main focus will thus be on the high-affinity binding targets for GHB and their potential functional roles in the mammalian brain. PMID:24269284

  8. Construction of a directed hammerhead ribozyme library: towards the identification of optimal target sites for antisense-mediated gene inhibition.

    PubMed Central

    Pierce, M L; Ruffner, D E

    1998-01-01

    Antisense-mediated gene inhibition uses short complementary DNA or RNA oligonucleotides to block expression of any mRNA of interest. A key parameter in the success or failure of an antisense therapy is the identification of a suitable target site on the chosen mRNA. Ultimately, the accessibility of the target to the antisense agent determines target suitability. Since accessibility is a function of many complex factors, it is currently beyond our ability to predict. Consequently, identification of the most effective target(s) requires examination of every site. Towards this goal, we describe a method to construct directed ribozyme libraries against any chosen mRNA. The library contains nearly equal amounts of ribozymes targeting every site on the chosen transcript and the library only contains ribozymes capable of binding to that transcript. Expression of the ribozyme library in cultured cells should allow identification of optimal target sites under natural conditions, subject to the complexities of a fully functional cell. Optimal target sites identified in this manner should be the most effective sites for therapeutic intervention. PMID:9801305

  9. Site-specific integration of adeno-associated virus involves partial duplication of the target locus

    PubMed Central

    Henckaerts, Els; Dutheil, Nathalie; Zeltner, Nadja; Kattman, Steven; Kohlbrenner, Erik; Ward, Peter; Clément, Nathalie; Rebollo, Patricia; Kennedy, Marion; Keller, Gordon M.; Linden, R. Michael

    2009-01-01

    A variety of viruses establish latency by integrating their genome into the host genome. The integration event generally occurs in a nonspecific manner, precluding the prediction of functional consequences from resulting disruptions of affected host genes. The nonpathogenic adeno-associated virus (AAV) is unique in its ability to stably integrate in a site-specific manner into the human MBS85 gene. To gain a better understanding of the integration mechanism and the consequences of MBS85 disruption, we analyzed the molecular structure of AAV integrants in various latently infected human cell lines. Our study led to the observation that AAV integration causes an extensive but partial duplication of the target gene. Intriguingly, the molecular organization of the integrant leaves the possibility that a functional copy of the disrupted target gene could potentially be preserved despite the resulting rearrangements. A latently infected, Mbs85-targeted mouse ES cell line was generated to study the functional consequences of the observed duplication-based integration mechanism. AAV-modified ES cell lines continued to self-renew, maintained their multilineage differentiation potential and contributed successfully to mouse development when injected into blastocysts. Thus, our study reveals a viral strategy for targeted genome addition with the apparent absence of functional consequences. PMID:19372372

  10. Conformational toggling controls target site choice for the heteromeric transposase element Tn7.

    PubMed

    Shi, Qiaojuan; Straus, Marco R; Caron, Jeremy J; Wang, Huasheng; Chung, Yu Seon; Guarné, Alba; Peters, Joseph E

    2015-12-15

    The bacterial transposon Tn7 facilitates horizontal transfer by directing transposition into actively replicating DNA with the element-encoded protein TnsE. Structural analysis of the C-terminal domain of wild-type TnsE identified a novel protein fold including a central V-shaped loop that toggles between two distinct conformations. The structure of a robust TnsE gain-of-activity variant has this loop locked in a single conformation, suggesting that conformational flexibility regulates TnsE activity. Structure-based analysis of a series of TnsE mutants relates transposition activity to DNA binding stability. Wild-type TnsE appears to naturally form an unstable complex with a target DNA, whereas mutant combinations required for large changes in transposition frequency and targeting stabilized this interaction. Collectively, our work unveils a unique structural proofreading mechanism where toggling between two conformations regulates target commitment by limiting the stability of target DNA engagement until an appropriate insertion site is identified. PMID:26384427

  11. Targeting hunter distribution based on host resource selection and kill sites to manage disease risk

    PubMed Central

    Dugal, Cherie J; van Beest, Floris M; Vander Wal, Eric; Brook, Ryan K

    2013-01-01

    Endemic and emerging diseases are rarely uniform in their spatial distribution or prevalence among cohorts of wildlife. Spatial models that quantify risk-driven differences in resource selection and hunter mortality of animals at fine spatial scales can assist disease management by identifying high-risk areas and individuals. We used resource selection functions (RSFs) and selection ratios (SRs) to quantify sex- and age-specific resource selection patterns of collared (n = 67) and hunter-killed (n = 796) nonmigratory elk (Cervus canadensis manitobensis) during the hunting season between 2002 and 2012, in southwestern Manitoba, Canada. Distance to protected area was the most important covariate influencing resource selection and hunter-kill sites of elk (AICw = 1.00). Collared adult males (which are most likely to be infected with bovine tuberculosis (Mycobacterium bovis) and chronic wasting disease) rarely selected for sites outside of parks during the hunting season in contrast to adult females and juvenile males. The RSFs showed selection by adult females and juvenile males to be negatively associated with landscape-level forest cover, high road density, and water cover, whereas hunter-kill sites of these cohorts were positively associated with landscape-level forest cover and increasing distance to streams and negatively associated with high road density. Local-level forest was positively associated with collared animal locations and hunter-kill sites; however, selection was stronger for collared juvenile males and hunter-killed adult females. In instances where disease infects a metapopulation and eradication is infeasible, a principle goal of management is to limit the spread of disease among infected animals. We map high-risk areas that are regularly used by potentially infectious hosts but currently underrepresented in the distribution of kill sites. We present a novel application of widely available data to target hunter distribution based on host resource

  12. Targeting substrate-site in Jak2 kinase prevents emergence of genetic resistance.

    PubMed

    Kesarwani, Meenu; Huber, Erika; Kincaid, Zachary; Evelyn, Chris R; Biesiada, Jacek; Rance, Mark; Thapa, Mahendra B; Shah, Neil P; Meller, Jarek; Zheng, Yi; Azam, Mohammad

    2015-01-01

    Emergence of genetic resistance against kinase inhibitors poses a great challenge for durable therapeutic response. Here, we report a novel mechanism of JAK2 kinase inhibition by fedratinib (TG101348) that prevents emergence of genetic resistance. Using in vitro drug screening, we identified 211 amino-acid substitutions conferring resistance to ruxolitinib (INCB018424) and cross-resistance to the JAK2 inhibitors AZD1480, CYT-387 and lestaurtinib. In contrast, these resistant variants were fully sensitive to fedratinib. Structural modeling, coupled with mutagenesis and biochemical studies, revealed dual binding sites for fedratinib. In vitro binding assays using purified proteins showed strong affinity for the substrate-binding site (Kd = 20 nM) while affinity for the ATP site was poor (Kd = ~8 μM). Our studies demonstrate that mutations affecting the substrate-binding pocket encode a catalytically incompetent kinase, thereby preventing emergence of resistant variants. Most importantly, our data suggest that in order to develop resistance-free kinase inhibitors, the next-generation drug design should target the substrate-binding site. PMID:26419724

  13. Targeting substrate-site in Jak2 kinase prevents emergence of genetic resistance

    PubMed Central

    Kesarwani, Meenu; Huber, Erika; Kincaid, Zachary; Evelyn, Chris R.; Biesiada, Jacek; Rance, Mark; Thapa, Mahendra B.; Shah, Neil P.; Meller, Jarek; Zheng, Yi; Azam, Mohammad

    2015-01-01

    Emergence of genetic resistance against kinase inhibitors poses a great challenge for durable therapeutic response. Here, we report a novel mechanism of JAK2 kinase inhibition by fedratinib (TG101348) that prevents emergence of genetic resistance. Using in vitro drug screening, we identified 211 amino-acid substitutions conferring resistance to ruxolitinib (INCB018424) and cross-resistance to the JAK2 inhibitors AZD1480, CYT-387 and lestaurtinib. In contrast, these resistant variants were fully sensitive to fedratinib. Structural modeling, coupled with mutagenesis and biochemical studies, revealed dual binding sites for fedratinib. In vitro binding assays using purified proteins showed strong affinity for the substrate-binding site (Kd = 20 nM) while affinity for the ATP site was poor (Kd = ~8 μM). Our studies demonstrate that mutations affecting the substrate-binding pocket encode a catalytically incompetent kinase, thereby preventing emergence of resistant variants. Most importantly, our data suggest that in order to develop resistance-free kinase inhibitors, the next-generation drug design should target the substrate-binding site. PMID:26419724

  14. Actin filaments target the oligomeric maturation of the dynamin GTPase Drp1 to mitochondrial fission sites

    PubMed Central

    Ji, Wei-ke; Hatch, Anna L; Merrill, Ronald A; Strack, Stefan; Higgs, Henry N

    2015-01-01

    While the dynamin GTPase Drp1 plays a critical role during mitochondrial fission, mechanisms controlling its recruitment to fission sites are unclear. A current assumption is that cytosolic Drp1 is recruited directly to fission sites immediately prior to fission. Using live-cell microscopy, we find evidence for a different model, progressive maturation of Drp1 oligomers on mitochondria through incorporation of smaller mitochondrially-bound Drp1 units. Maturation of a stable Drp1 oligomer does not forcibly lead to fission. Drp1 oligomers also translocate directionally along mitochondria. Ionomycin, a calcium ionophore, causes rapid mitochondrial accumulation of actin filaments followed by Drp1 accumulation at the fission site, and increases fission rate. Inhibiting actin polymerization, myosin IIA, or the formin INF2 reduces both un-stimulated and ionomycin-induced Drp1 accumulation and mitochondrial fission. Actin filaments bind purified Drp1 and increase GTPase activity in a manner that is synergistic with the mitochondrial protein Mff, suggesting a role for direct Drp1/actin interaction. We propose that Drp1 is in dynamic equilibrium on mitochondria in a fission-independent manner, and that fission factors such as actin filaments target productive oligomerization to fission sites. DOI: http://dx.doi.org/10.7554/eLife.11553.001 PMID:26609810

  15. Actin filaments target the oligomeric maturation of the dynamin GTPase Drp1 to mitochondrial fission sites.

    PubMed

    Ji, Wei-ke; Hatch, Anna L; Merrill, Ronald A; Strack, Stefan; Higgs, Henry N

    2015-01-01

    While the dynamin GTPase Drp1 plays a critical role during mitochondrial fission, mechanisms controlling its recruitment to fission sites are unclear. A current assumption is that cytosolic Drp1 is recruited directly to fission sites immediately prior to fission. Using live-cell microscopy, we find evidence for a different model, progressive maturation of Drp1 oligomers on mitochondria through incorporation of smaller mitochondrially-bound Drp1 units. Maturation of a stable Drp1 oligomer does not forcibly lead to fission. Drp1 oligomers also translocate directionally along mitochondria. Ionomycin, a calcium ionophore, causes rapid mitochondrial accumulation of actin filaments followed by Drp1 accumulation at the fission site, and increases fission rate. Inhibiting actin polymerization, myosin IIA, or the formin INF2 reduces both un-stimulated and ionomycin-induced Drp1 accumulation and mitochondrial fission. Actin filaments bind purified Drp1 and increase GTPase activity in a manner that is synergistic with the mitochondrial protein Mff, suggesting a role for direct Drp1/actin interaction. We propose that Drp1 is in dynamic equilibrium on mitochondria in a fission-independent manner, and that fission factors such as actin filaments target productive oligomerization to fission sites. PMID:26609810

  16. Genome-Wide Assessment of Efficiency and Specificity in CRISPR/Cas9 Mediated Multiple Site Targeting in Arabidopsis.

    PubMed

    Peterson, Brenda A; Haak, David C; Nishimura, Marc T; Teixeira, Paulo J P L; James, Sean R; Dangl, Jeffery L; Nimchuk, Zachary L

    2016-01-01

    Simultaneous multiplex mutation of large gene families using Cas9 has the potential to revolutionize agriculture and plant sciences. The targeting of multiple genomic sites at once raises concerns about the efficiency and specificity in targeting. The model Arabidopsis thaliana is widely used in basic plant research. Previous work has suggested that the Cas9 off-target rate in Arabidopsis is undetectable. Here we use deep sequencing on pooled plants simultaneously targeting 14 distinct genomic loci to demonstrate that multiplex targeting in Arabidopsis is highly specific to on-target sites with no detectable off-target events. In addition, chromosomal translocations are extremely rare. The high specificity of Cas9 in Arabidopsis makes this a reliable method for clean mutant generation with no need to enhance specificity or adopt alternate Cas9 variants. PMID:27622539

  17. A comprehensive assessment of Coprates Chasma on Mars as a target site for future exploration missions

    NASA Astrophysics Data System (ADS)

    Singh, Amit; Mukherjee, Saumitra; Garg, Akshay

    2012-07-01

    Valleys on Mars are one of the least targeted regions in terms of target selection for exploration missions till date. Coprates Chasma, in the eastern part of Valles Marineris, is a region marked by normal faulting, spurs, gullies, horsts, grabens and several other features of interest. There are enough evidences of major rock rearrangements and landslides along its walls. It also has associated floor deposits that are complex in nature. Also, Interior Layered Deposits (ILDs) have been found there associated with sulphates. This work primarily focuses on Coprates Chasma to comprehensively assess its significance as an exploration target representative for valleys on Mars. Morphometric analysis of Coprates Chasma was primarily based on Mars Orbiter Laser Altimeter (MOLA) data and supplemented with additional information from existing literature regarding geology, structure and tectonics. Apart from calculation of terrain metrics several study sites have also been proposed by this study. Navigability of autonomous vehicles over the terrain and associated scientific experimentation opportunities were also evaluated. Shade component constrain was also analyzed from both ground as well as orbital studies perspectives. Coprates Chasma seems to be a perfect candidate to study tectonic activity on Mars, to understand the triggering processes and associated structures. Basal topography and geology are two decisive factors for selection of these study sites. The region is also expected to be associated with possible focusing / amplification of shock waves generated by thermal quakes, landslides and impact cratering by meteorites. It could well provide opportunities to study the complex geological history of Mars and processes leading to the formation of Valles Marineris itself.

  18. Site-targeted acoustic contrast agent detects molecular expression of tissue factor after balloon angioplasty

    NASA Astrophysics Data System (ADS)

    Hall, Christopher S.; Abendschein, Dana R.; Scherrer, David E.; Scott, Michael J.; Marsh, Jon N.; Wickline, Samuel A.; Lanza, Gregory M.

    2000-04-01

    Complex molecular signaling heralds the early stages of pathologies such as angiogenesis, inflammation, and cellular responses to mechanically damaged coronary arteries after balloon angioplasty. In previous studies, we have demonstrated acoustic enhancement of blood clot morphology with the use of a nongaseous, ligand-targeted acoustic nanoparticle emulsion delivered to areas of thrombosis both in vitro and in vivo. In this paper, we characterize the early expression of tissue factor which contributes to subsequent arterial restenosis. Tissue factor is a 42kd glycoprotein responsible for blood coagulation but also plays a well-described role in cancer metastasis, angiogenesis, and vascular restenosis. This study was designed to determine whether the targeted contrast agent could localize tissue factor expressed within the wall of balloon-injured arteries. Both carotid arteries of five pigs (20 kg) were injured using an 8 X 20 mm angioplasty balloon. The carotids were treated in situ with a perfluorocarbon nanoparticle emulsion covalently complexed to either specific anti-tissue factor polyclonal F(ab) fragments (treatment) or non-specific IgG F(ab) fragments (control). Intravascular ultrasound (30 MHz) images of the arteries were obtained before and after exposure to the emulsions. Tissue- factor targeted ultrasonic contrast agent acoustically enhanced the subintima and media at the site of balloon- induced injury compared with control contrast arteries (p less than 0.05). Immunohistochemical staining confirmed the presence of increased tissue factor at the sites of acoustic enhancement. Binding of the targeted agents was demonstrated in vitro by scanning electron microscope images of cultured smooth muscle cells that constitutively express tissue factor. This study demonstrates the concept of molecular imaging and localization of carotid arteries' tissue factor in vivo using a new, nanoparticulate emulsion. Enhancement of the visualization of the molecular

  19. Targeting mechanisms at sites of complement activation for imaging and therapy.

    PubMed

    Holers, V Michael

    2016-06-01

    The complement system plays a key role in many acute injury states as well as chronic autoimmune and inflammatory diseases. Localized complement activation and alternative pathway-mediated amplification on diverse target surfaces promote local recruitment of pro-inflammatory cells and elaboration of other mediators. Despite a general understanding of the architecture of the system, though, many of the mechanisms that underlie site-specific complement activation and amplification in vivo are incompletely understood. In addition, there is no capability yet to measure the level of local tissue site-specific complement activation in patients without performing biopsies to detect products using immunohistochemical techniques. Herein is reviewed emerging evidence obtained through clinical research studies of human rheumatoid arthritis along with translational studies of its disease models which demonstrate that several parallel mechanisms are involved in site-specific amplification of activation of the complement system in vivo. Among these processes are de-regulation of the alternative pathway, effector pathway-catalyzed amplification of proximal complement activation, recognition of injury-associated ligands by components of the lectin pathway, and engagement of pathogenic natural antibodies that recognize a limited set of injury-associated neoepitopes. Studies suggest that each of these inter-related processes can play key roles in amplification of complement-dependent injury on self-tissues in vivo. These findings, in addition to development of an imaging strategy described herein designed to quantitatively measure local complement C3 fixation, have relevance to therapeutic and diagnostic strategies targeting the complement system. PMID:25979851

  20. Interaction of the intron-encoded mobility endonuclease I-PpoI with its target site.

    PubMed Central

    Ellison, E L; Vogt, V M

    1993-01-01

    Endonucleases encoded by mobile group I introns are highly specific DNases that induce a double-strand break near the site to which the intron moves. I-PpoI from the acellular slime mold Physarum polycephalum mediates the mobility of intron 3 (Pp LSU 3) in the extrachromosomal nuclear ribosomal DNA of this organism. We showed previously that cleavage by I-PpoI creates a four-base staggered cut near the point of intron insertion. We have now characterized several further properties of the endonuclease. As determined by deletion analysis, the minimal target site recognized by I-PopI was a sequence of 13 to 15 bp spanning the cleavage site. The purified protein behaved as a globular dimer in sedimentation and gel filtration. In gel mobility shift assays in the presence of EDTA, I-PpoI formed a stable and specific complex with DNA, dissociating with a half-life of 45 min. By footprinting and interference assays with methidiumpropyl-EDTA-iron(II), I-PpoI contacted a 22- to 24-bp stretch of DNA. The endonuclease protected most of the purines found in both the major and minor grooves of the DNA helix from modification by dimethyl sulfate (DMS). However, the reactivity to DMS was enhanced at some purines, suggesting that binding leads to a conformational change in the DNA. The pattern of DMS protection differed fundamentally in the two partially symmetrical halves of the recognition sequence. Images PMID:8246971

  1. Identification of several potential chromatin binding sites of HOXB7 and its downstream target genes in breast cancer

    PubMed Central

    Heinonen, Henna; Lepikhova, Tatiana; Sahu, Biswajyoti; Pehkonen, Henna; Pihlajamaa, Päivi; Louhimo, Riku; Gao, Ping; Wei, Gong‐Hong; Hautaniemi, Sampsa; Jänne, Olli A.

    2015-01-01

    HOXB7 encodes a transcription factor that is overexpressed in a number of cancers and encompasses many oncogenic functions. Previous results have shown it to promote cell proliferation, angiogenesis, epithelial–mesenchymal transition, DNA repair and cell survival. Because of its role in many cancers and tumorigenic processes, HOXB7 has been suggested to be a potential drug target. However, HOXB7 binding sites on chromatin and its targets are poorly known. The aim of our study was to identify HOXB7 binding sites on breast cancer cell chromatin and to delineate direct target genes located nearby these binding sites. We found 1,504 HOXB7 chromatin binding sites in BT‐474 breast cancer cell line that overexpresses HOXB7. Seventeen selected binding sites were validated by ChIP‐qPCR in several breast cancer cell lines. Furthermore, we analyzed expression of a large number of genes located nearby HOXB7 binding sites and found several new direct targets, such as CTNND2 and SCGB1D2. Identification of HOXB7 chromatin binding sites and target genes is essential to understand better the role of HOXB7 in breast cancer and mechanisms by which it regulates tumorigenic processes. PMID:26014856

  2. Formation of target-specific binding sites in enzymes: solid-phase molecular imprinting of HRP

    NASA Astrophysics Data System (ADS)

    Czulak, J.; Guerreiro, A.; Metran, K.; Canfarotta, F.; Goddard, A.; Cowan, R. H.; Trochimczuk, A. W.; Piletsky, S.

    2016-05-01

    Here we introduce a new concept for synthesising molecularly imprinted nanoparticles by using proteins as macro-functional monomers. For a proof-of-concept, a model enzyme (HRP) was cross-linked using glutaraldehyde in the presence of glass beads (solid-phase) bearing immobilized templates such as vancomycin and ampicillin. The cross-linking process links together proteins and protein chains, which in the presence of templates leads to the formation of permanent target-specific recognition sites without adverse effects on the enzymatic activity. Unlike complex protein engineering approaches commonly employed to generate affinity proteins, the method proposed can be used to produce protein-based ligands in a short time period using native protein molecules. These affinity materials are potentially useful tools especially for assays since they combine the catalytic properties of enzymes (for signaling) and molecular recognition properties of antibodies. We demonstrate this concept in an ELISA-format assay where HRP imprinted with vancomycin and ampicillin replaced traditional enzyme-antibody conjugates for selective detection of templates at micromolar concentrations. This approach can potentially provide a fast alternative to raising antibodies for targets that do not require high assay sensitivities; it can also find uses as a biochemical research tool, as a possible replacement for immunoperoxidase-conjugates.Here we introduce a new concept for synthesising molecularly imprinted nanoparticles by using proteins as macro-functional monomers. For a proof-of-concept, a model enzyme (HRP) was cross-linked using glutaraldehyde in the presence of glass beads (solid-phase) bearing immobilized templates such as vancomycin and ampicillin. The cross-linking process links together proteins and protein chains, which in the presence of templates leads to the formation of permanent target-specific recognition sites without adverse effects on the enzymatic activity. Unlike

  3. Fitness Cost Implications of PhiC31-Mediated Site-Specific Integrations in Target-Site Strains of the Mexican Fruit Fly, Anastrepha ludens (Diptera: Tephritidae)

    PubMed Central

    Meza, José S.; Díaz-Fleischer, Francisco; Sánchez-Velásquez, Lázaro R.; Zepeda-Cisneros, Cristina Silvia; Handler, Alfred M.; Schetelig, Marc F.

    2014-01-01

    Site-specific recombination technologies are powerful new tools for the manipulation of genomic DNA in insects that can improve transgenesis strategies such as targeting transgene insertions, allowing transgene cassette exchange and DNA mobilization for transgene stabilization. However, understanding the fitness cost implications of these manipulations for transgenic strain applications is critical. In this study independent piggyBac-mediated attP target-sites marked with DsRed were created in several genomic positions in the Mexican fruit fly, Anastrepha ludens. Two of these strains, one having an autosomal (attP_F7) and the other a Y-linked (attP_2-M6y) integration, exhibited fitness parameters (dynamic demography and sexual competitiveness) similar to wild type flies. These strains were thus selected for targeted insertion using, for the first time in mexfly, the phiC31-integrase recombination system to insert an additional EGFP-marked transgene to determine its effect on host strain fitness. Fitness tests showed that the integration event in the int_2-M6y recombinant strain had no significant effect, while the int_F7 recombinant strain exhibited significantly lower fitness relative to the original attP_F7 target-site host strain. These results indicate that while targeted transgene integrations can be achieved without an additional fitness cost, at some genomic positions insertion of additional DNA into a previously integrated transgene can have a significant negative effect. Thus, for targeted transgene insertions fitness costs must be evaluated both previous to and subsequent to new site-specific insertions in the target-site strain. PMID:25303238

  4. Metabolic and Target-Site Mechanisms Combine to Confer Strong DDT Resistance in Anopheles gambiae

    PubMed Central

    Mitchell, Sara N.; Rigden, Daniel J.; Dowd, Andrew J.; Lu, Fang; Wilding, Craig S.; Weetman, David; Dadzie, Samuel; Jenkins, Adam M.; Regna, Kimberly; Boko, Pelagie; Djogbenou, Luc; Muskavitch, Marc A. T.; Ranson, Hilary; Paine, Mark J. I.; Mayans, Olga; Donnelly, Martin J.

    2014-01-01

    The development of resistance to insecticides has become a classic exemplar of evolution occurring within human time scales. In this study we demonstrate how resistance to DDT in the major African malaria vector Anopheles gambiae is a result of both target-site resistance mechanisms that have introgressed between incipient species (the M- and S-molecular forms) and allelic variants in a DDT-detoxifying enzyme. Sequencing of the detoxification enzyme, Gste2, from DDT resistant and susceptible strains of An. gambiae, revealed a non-synonymous polymorphism (I114T), proximal to the DDT binding domain, which segregated with strain phenotype. Recombinant protein expression and DDT metabolism analysis revealed that the proteins from the susceptible strain lost activity at higher DDT concentrations, characteristic of substrate inhibition. The effect of I114T on GSTE2 protein structure was explored through X-ray crystallography. The amino acid exchange in the DDT-resistant strain introduced a hydroxyl group nearby the hydrophobic DDT-binding region. The exchange does not result in structural alterations but is predicted to facilitate local dynamics and enzyme activity. Expression of both wild-type and 114T alleles the allele in Drosophila conferred an increase in DDT tolerance. The 114T mutation was significantly associated with DDT resistance in wild caught M-form populations and acts in concert with target-site mutations in the voltage gated sodium channel (Vgsc-1575Y and Vgsc-1014F) to confer extreme levels of DDT resistance in wild caught An. gambiae. PMID:24675797

  5. Site-directed gene mutation at mixed sequence targets by psoralen-conjugated pseudo-complementary peptide nucleic acids.

    PubMed

    Kim, Ki-Hyun; Nielsen, Peter E; Glazer, Peter M

    2007-01-01

    Sequence-specific DNA-binding molecules such as triple helix-forming oligonucleotides (TFOs) provide a means for inducing site-specific mutagenesis and recombination at chromosomal sites in mammalian cells. However, the utility of TFOs is limited by the requirement for homopurine stretches in the target duplex DNA. Here, we report the use of pseudo-complementary peptide nucleic acids (pcPNAs) for intracellular gene targeting at mixed sequence sites. Due to steric hindrance, pcPNAs are unable to form pcPNA-pcPNA duplexes but can bind to complementary DNA sequences by Watson-Crick pairing via double duplex-invasion complex formation. We show that psoralen-conjugated pcPNAs can deliver site-specific photoadducts and mediate targeted gene modification within both episomal and chromosomal DNA in mammalian cells without detectable off-target effects. Most of the induced psoralen-pcPNA mutations were single-base substitutions and deletions at the predicted pcPNA-binding sites. The pcPNA-directed mutagenesis was found to be dependent on PNA concentration and UVA dose and required matched pairs of pcPNAs. Neither of the individual pcPNAs alone had any effect nor did complementary PNA pairs of the same sequence. These results identify pcPNAs as new tools for site-specific gene modification in mammalian cells without purine sequence restriction, thereby providing a general strategy for designing gene targeting molecules. PMID:17977869

  6. Formation of target-specific binding sites in enzymes: solid-phase molecular imprinting of HRP.

    PubMed

    Czulak, J; Guerreiro, A; Metran, K; Canfarotta, F; Goddard, A; Cowan, R H; Trochimczuk, A W; Piletsky, S

    2016-06-01

    Here we introduce a new concept for synthesising molecularly imprinted nanoparticles by using proteins as macro-functional monomers. For a proof-of-concept, a model enzyme (HRP) was cross-linked using glutaraldehyde in the presence of glass beads (solid-phase) bearing immobilized templates such as vancomycin and ampicillin. The cross-linking process links together proteins and protein chains, which in the presence of templates leads to the formation of permanent target-specific recognition sites without adverse effects on the enzymatic activity. Unlike complex protein engineering approaches commonly employed to generate affinity proteins, the method proposed can be used to produce protein-based ligands in a short time period using native protein molecules. These affinity materials are potentially useful tools especially for assays since they combine the catalytic properties of enzymes (for signaling) and molecular recognition properties of antibodies. We demonstrate this concept in an ELISA-format assay where HRP imprinted with vancomycin and ampicillin replaced traditional enzyme-antibody conjugates for selective detection of templates at micromolar concentrations. This approach can potentially provide a fast alternative to raising antibodies for targets that do not require high assay sensitivities; it can also find uses as a biochemical research tool, as a possible replacement for immunoperoxidase-conjugates. PMID:27174700

  7. Hyaluronan microspheres for sustained gene delivery and site-specific targeting.

    PubMed

    Yun, Yang H; Goetz, Douglas J; Yellen, Paige; Chen, Weiliam

    2004-01-01

    Hyaluronan is a naturally occurring polymer that has enjoyed wide successes in biomedical and cosmetic applications as coatings, matrices, and hydrogels. For controlled delivery applications, formulating native hyaluronan into microspheres could be advantageous but has been difficult to process unless organic solvents are used or hyaluronan has been modified by etherification. Therefore, we present a novel method of preparing hyaluronan microspheres using adipic dihydrazide mediated crosslinking chemistry. To evaluate their potential for medical applications, hyaluronan microspheres are incorporated with DNA for gene delivery or conjugated with an antigen for cell-specific targeting. The results show that our method, originally developed for preparing hyaluronan hydrogels, generates robust microspheres with a size distribution of 5-20mum. The release of the encapsulated plasmid DNA can be sustained for months and is capable of transfection in vitro and in vivo. Hyaluronan microspheres, conjugated with monoclonal antibodies to E- and P-selectin, demonstrate selective binding to cells expressing these receptors. In conclusion, we have developed a novel microsphere preparation using native hyaluronan that delivers DNA at a controlled rate and adaptable for site-specific targeting. PMID:14580918

  8. Gene duplication in the major insecticide target site, Rdl, in Drosophila melanogaster.

    PubMed

    Remnant, Emily J; Good, Robert T; Schmidt, Joshua M; Lumb, Christopher; Robin, Charles; Daborn, Phillip J; Batterham, Philip

    2013-09-01

    The Resistance to Dieldrin gene, Rdl, encodes a GABA-gated chloride channel subunit that is targeted by cyclodiene and phenylpyrazole insecticides. The gene was first characterized in Drosophila melanogaster by genetic mapping of resistance to the cyclodiene dieldrin. The 4,000-fold resistance observed was due to a single amino acid replacement, Ala(301) to Ser. The equivalent change was subsequently identified in Rdl orthologs of a large range of resistant insect species. Here, we report identification of a duplication at the Rdl locus in D. melanogaster. The 113-kb duplication contains one WT copy of Rdl and a second copy with two point mutations: an Ala(301) to Ser resistance mutation and Met(360) to Ile replacement. Individuals with this duplication exhibit intermediate dieldrin resistance compared with single copy Ser(301) homozygotes, reduced temperature sensitivity, and altered RNA editing associated with the resistant allele. Ectopic recombination between Roo transposable elements is involved in generating this genomic rearrangement. The duplication phenotypes were confirmed by construction of a transgenic, artificial duplication integrating the 55.7-kb Rdl locus with a Ser(301) change into an Ala(301) background. Gene duplications can contribute significantly to the evolution of insecticide resistance, most commonly by increasing the amount of gene product produced. Here however, duplication of the Rdl target site creates permanent heterozygosity, providing unique potential for adaptive mutations to accrue in one copy, without abolishing the endogenous role of an essential gene. PMID:23959864

  9. The BET family of proteins targets Moloney Murine Leukemia Virus integration near transcription start sites

    PubMed Central

    De Rijck, Jan; de Kogel, Christine; Demeulemeester, Jonas; Vets, Sofie; Ashkar, Sara El; Malani, Nirav; Bushman, Frederic D; Landuyt, Bart; Husson, Steven J.; Busschots, Katrien; Gijsbers, Rik; Debyser, Zeger

    2014-01-01

    Summary A hallmark of retroviral replication is integration of the viral genome in the host cell DNA. This characteristic makes retrovirus-based vectors attractive delivery vehicles for gene therapy. However, adverse events in gene therapeutic trials, caused by activation of proto-oncogenes due to Murine Leukemia Virus (MLV)-derived vector integration, hamper their application. Here we show that bromodomain and extraterminal (BET) proteins (BRD2, BRD3 and BRD4) and MLV integrase specifically interact and co-localize within the nucleus of the cell. Inhibition of the BET proteins chromatin interaction via specific bromodomain inhibitors blocks MLV virus replication at the integration step. MLV integration site distribution parallels the chromatin binding profile of BET proteins, and expression of an artificial fusion protein of the BET integrase binding domain with the chromatin interaction domain of the lentiviral targeting factor LEDGF/p75, retargets MLV integration away from TSS and into the body of actively transcribed genes, conform to the Human Immunodeficiency Virus (HIV) integration pattern. Together these data validate BET proteins as MLV integration targeting factors. PMID:24183673

  10. Targeting the Akt1 allosteric site to identify novel scaffolds through virtual screening.

    PubMed

    Yilmaz, Oya Gursoy; Olmez, Elif Ozkirimli; Ulgen, Kutlu O

    2014-02-01

    Preclinical data and tumor specimen studies report that AKT kinases are related to many human cancers. Therefore, identification and development of small molecule inhibitors targeting AKT and its signaling pathway can be therapeutic in treatment of cancer. Numerous studies report inhibitors that target the ATP-binding pocket in the kinase domains, but the similarity of this site, within the kinase family makes selectivity a major problem. The sequence identity amongst PH domains is significantly lower than that in kinase domains and developing more selective inhibitors is possible if PH domain is targeted. This in silico screening study is the first time report toward the identification of potential allosteric inhibitors expected to bind the cavity between kinase and PH domains of Akt1. Structural information of Akt1 was used to develop structure-based pharmacophore models comprising hydrophobic, acceptor, donor and ring features. The 3D structural information of previously identified allosteric Akt inhibitors obtained from literature was employed to develop a ligand-based pharmacophore model. Database was generated with drug like subset of ZINC and screening was performed based on 3D similarity to the selected pharmacophore hypotheses. Binding modes and affinities of the ligands were predicted by Glide software. Top scoring hits were further analyzed considering 2D similarity between the compounds, interactions with Akt1, fitness to pharmacophore models, ADME, druglikeness criteria and Induced-Fit docking. Using virtual screening methodologies, derivatives of 3-methyl-xanthine, quinoline-4-carboxamide and 2-[4-(cyclohexa-1,3-dien-1-yl)-1H-pyrazol-3-yl]phenol were proposed as potential leads for allosteric inhibition of Akt1. PMID:24291487

  11. Decaleside: a new class of natural insecticide targeting tarsal gustatory sites

    NASA Astrophysics Data System (ADS)

    Rajashekar, Yallappa; Rao, Lingamallu J. M.; Shivanandappa, Thimmappa

    2012-10-01

    Natural sources for novel insecticide molecules hold promise in view of their eco-friendly nature, selectivity, and mammalian safety. Recent progress in understanding the biology of insect olfaction and taste offers new strategies for developing selective pest control agents. We have isolated two natural insecticidal molecules from edible roots of Decalepis hamiltonii named Decalesides I and II, which are novel trisaccharides, highly toxic to household insect pests and stored-product insects. We have experimentally shown that insecticidal activity requires contact with tarsi on the legs but is not toxic orally. The insecticidal activity of molecules is lost by hydrolysis, and various sugars modify toxic response, showing that the insecticidal activity is via gustatory sites on the tarsi. Selective toxicity to insects by virtue of their gustatory site of action and the mammalian safety of the new insecticides is inherent in their chemical structure with 1-4 or 1-1 α linkage that is easily hydrolyzed by digestive enzymes of mammals. Decalesides represent a new chemical class of natural insecticides with a unique mode of action targeting tarsal chemosensory/gustatory system of insects.

  12. Combinatorial targeting of ribbon–helix–helix artificial transcription factors to chimeric recognition sites

    PubMed Central

    Zampini, Massimiliano; Hayes, Finbarr

    2012-01-01

    Artificial transcription factors (ATFs) are potent synthetic biology tools for modulating endogenous gene expression and precision genome editing. The ribbon–helix–helix (RHH) superfamily of transcription factors are widespread in bacteria and archaea. The principal DNA binding determinant in this family comprises a two-stranded antiparallel β-sheet (ribbons) in which a pair of eight-residue motifs insert into the major groove. Here, we demonstrate that ribbons of divergent RHH proteins are compact and portable elements that can be grafted into a common α-helical scaffold producing active ATFs. Hybrid proteins cooperatively recognize DNA sites possessing core tetramer boxes whose functional spacing is dictated by interactions between the α-helical backbones. These interactions also promote combinatorial binding of chimeras with different transplanted ribbons, but identical backbones, to synthetic sites bearing cognate boxes for each protein either in vitro or in vivo. The composite assembly of interacting hybrid proteins offers potential advantages associated with combinatorial approaches to DNA recognition compared with ATFs that involve binding of a single protein. Moreover, the new class of RHH ATFs may be utilized to re-engineer transcriptional circuits, or may be enhanced with affinity tags, fluorescent moieties or other elements for targeted genome marking and manipulation in bacteria and archaea. PMID:22492712

  13. Identification of a new JNK inhibitor targeting the JNK-JIP interaction site

    PubMed Central

    Stebbins, John L.; De, Surya K.; Machleidt, Thomas; Becattini, Barbara; Vazquez, Jesus; Kuntzen, Christian; Chen, Li-Hsing; Cellitti, Jason F.; Riel-Mehan, Megan; Emdadi, Aras; Solinas, Giovanni; Karin, Michael; Pellecchia, Maurizio

    2008-01-01

    JNK is a stress-activated protein kinase that modulates pathways implicated in a variety of disease states. JNK-interacting protein-1 (JIP1) is a scaffolding protein that enhances JNK signaling by creating a proximity effect between JNK and upstream kinases. A minimal peptide region derived from JIP1 is able to inhibit JNK activity both in vitro and in cell. We report here a series of small molecules JIP1 mimics that function as substrate competitive inhibitors of JNK. One such compound, BI-78D3, dose-dependently inhibits the phosphorylation of JNK substrates both in vitro and in cell. In animal studies, BI-78D3 not only blocks JNK dependent Con A-induced liver damage but also restores insulin sensitivity in mouse models of type 2 diabetes. Our findings open the way for the development of protein kinase inhibitors targeting substrate specific docking sites, rather than the highly conserved ATP binding sites. In view of its favorable inhibition profile, selectivity, and ability to function in the cellular milieu and in vivo, BI-78D3 represents not only a JNK inhibitor, but also a promising stepping stone toward the development of an innovative class of therapeutics. PMID:18922779

  14. Site-Selective Passivation of Defects in NiO Solar Photocathodes by Targeted Atomic Deposition.

    PubMed

    Flynn, Cory J; McCullough, Shannon M; Oh, EunBi; Li, Lesheng; Mercado, Candy C; Farnum, Byron H; Li, Wentao; Donley, Carrie L; You, Wei; Nozik, Arthur J; McBride, James R; Meyer, Thomas J; Kanai, Yosuke; Cahoon, James F

    2016-02-01

    For nanomaterials, surface chemistry can dictate fundamental material properties, including charge-carrier lifetimes, doping levels, and electrical mobilities. In devices, surface defects are usually the key limiting factor for performance, particularly in solar-energy applications. Here, we develop a strategy to uniformly and selectively passivate defect sites in semiconductor nanomaterials using a vapor-phase process termed targeted atomic deposition (TAD). Because defects often consist of atomic vacancies and dangling bonds with heightened reactivity, we observe-for the widely used p-type cathode nickel oxide-that a volatile precursor such as trimethylaluminum can undergo a kinetically limited selective reaction with these sites. The TAD process eliminates all measurable defects in NiO, leading to a nearly 3-fold improvement in the performance of dye-sensitized solar cells. Our results suggest that TAD could be implemented with a range of vapor-phase precursors and be developed into a general strategy to passivate defects in zero-, one-, and two-dimensional nanomaterials. PMID:26821265

  15. MitoFates: Improved Prediction of Mitochondrial Targeting Sequences and Their Cleavage Sites*

    PubMed Central

    Fukasawa, Yoshinori; Tsuji, Junko; Fu, Szu-Chin; Tomii, Kentaro; Horton, Paul; Imai, Kenichiro

    2015-01-01

    Mitochondria provide numerous essential functions for cells and their dysfunction leads to a variety of diseases. Thus, obtaining a complete mitochondrial proteome should be a crucial step toward understanding the roles of mitochondria. Many mitochondrial proteins have been identified experimentally but a complete list is not yet available. To fill this gap, methods to computationally predict mitochondrial proteins from amino acid sequence have been developed and are widely used, but unfortunately, their accuracy is far from perfect. Here we describe MitoFates, an improved prediction method for cleavable N-terminal mitochondrial targeting signals (presequences) and their cleavage sites. MitoFates introduces novel sequence features including positively charged amphiphilicity, presequence motifs, and position weight matrices modeling the presequence cleavage sites. These features are combined with classical ones such as amino acid composition and physico-chemical properties as input to a standard support vector machine classifier. On independent test data, MitoFates attains better performance than existing predictors in both detection of presequences and in predicting their cleavage sites. We used MitoFates to look for undiscovered mitochondrial proteins from 42,217 human proteins (including isoforms such as alternative splicing or translation initiation variants). MitoFates predicts 1167 genes to have at least one isoform with a presequence. Five-hundred and eighty of these genes were not annotated as mitochondrial in either UniProt or Gene Ontology. Interestingly, these include candidate regulators of parkin translocation to damaged mitochondria, and also many genes with known disease mutations, suggesting that careful investigation of MitoFates predictions may be helpful in elucidating the role of mitochondria in health and disease. MitoFates is open source with a convenient web server publicly available. PMID:25670805

  16. A simple in vitro Tn7-based transposition system with low target site selectivity for genome and gene analysis

    PubMed Central

    Biery, Matthew C.; Stewart, Fiona J.; Stellwagen, Anne E.; Raleigh, Elisabeth A.; Craig, Nancy L.

    2000-01-01

    A robust Tn7-based in vitro transposition system is described that displays little target site selectivity, allowing the efficient recovery of many different transposon insertions in target DNAs ranging from small plasmids to cosmids to whole genomes. Two miniTn7 derivatives are described that are useful for the analysis of genes: one a derivative for making translational and transcriptional target gene fusions and the other a derivative that can generate 15 bp (5 amino acid) insertions in target DNAs (proteins). PMID:10666445

  17. A Chemical Biology Approach to Reveal Sirt6-targeted Histone H3 Sites in Nucleosomes.

    PubMed

    Wang, Wesley Wei; Zeng, Yu; Wu, Bo; Deiters, Alexander; Liu, Wenshe R

    2016-07-15

    As a member of a highly conserved family of NAD(+)-dependent histone deacetylases, Sirt6 is a key regulator of mammalian genome stability, metabolism, and life span. Previous studies indicated that Sirt6 is hardwired to remove histone acetylation at H3K9 and H3K56. However, how Sirt6 recognizes its nucleosome substrates has been elusive due to the difficulty of accessing homogeneous acetyl-nucleosomes and the low activity of Sirt6 toward peptide substrates. Based on the fact that Sirt6 has an enhanced activity to remove long chain fatty acylation from lysine, we developed an approach to recombinantly synthesize histone H3 with a fatty acylated lysine, N(ε)-(7-octenoyl)-lysine (OcK), installed at a number of lysine sites and used these acyl-H3 proteins to assemble acyl-nucleosomes as active Sirt6 substrates. A chemical biology approach that visualizes OcK in nucleosomes and therefore allows direct sensitization of Sirt6 activities on its acyl-nucleosome substrates was also formulated. By combining these two approaches, we showed that Sirt6 actively removes acylation from H3K9, H3K18, and H3K27; has relatively low activities toward H3K4 and K3K23; but sluggishly removes acylation at H3K14, H3K36, H3K56, and H3K79. Overexpressing Sirt6 in 293T cells led to downregulated acetylation at H3K18 and K3K27, confirming these two novel Sirt6-targeted nucleosome lysine sites in cells. Given that downregulation of H3K18 acetylation is correlated with a poor prognosis of several cancer types and H3K27 acetylation antagonizes repressive gene regulation by di- and trimethylation at H3K27, our current study implies that Sirt6 may serve as a target for cancer intervention and regulatory pathway investigation in cells. PMID:27152839

  18. Low Herbivory among Targeted Reforestation Sites in the Andean Highlands of Southern Ecuador

    PubMed Central

    Adams, Marc-Oliver; Fiedler, Konrad

    2016-01-01

    Insect herbivory constitutes an important constraint in the viability and management of targeted reforestation sites. Focusing on young experimental stands at about 2000 m elevation in southern Ecuador, we examined foliar damage over one season as a function of tree species and habitat. Native tree species (Successional hardwood: Cedrela montana and Tabebuia chrysantha; fast-growing pioneer: Heliocarpus americanus) have been planted among prevailing local landcover types (abandoned pasture, secondary shrub vegetation, and a Pinus patula plantation) in 2003/4. Plantation trees were compared to conspecifics in the spontaneous undergrowth of adjacent undisturbed rainforest matched for height and foliar volume. Specifically, we tested the hypotheses that H. americanus as a pioneer species suffers more herbivory compared to the two successional tree species, and that damage is inversely related to habitat complexity. Overall leaf damage caused by folivorous insects (excluding leafcutter ants) was low. Average leaf loss was highest among T. chrysantha (7.50% ± 0.19 SE of leaf area), followed by H. americanus (4.67% ± 0.18 SE) and C. montana (3.18% ± 0.15 SE). Contrary to expectations, leaf area loss was highest among trees in closed-canopy natural rainforest, followed by pine plantation, pasture, and secondary shrub sites. Harvesting activity of leafcutter ants (Acromyrmex sp.) was strongly biased towards T. chrysantha growing in open habitat (mean pasture: 2.5%; shrub: 10.5%) where it could result in considerable damage (> 90.0%). Insect folivory is unlikely to pose a barrier for reforestation in the tropical Andean mountain forest zone at present, but leafcutter ants may become problematic if local temperatures increase in the wake of global warming. PMID:26963395

  19. Inhibitory effects and oxidative target site of dibutyl phthalate on Karenia brevis.

    PubMed

    Li, Feng-min; Wu, Miao; Yao, Yuan; Zheng, Xiang; Zhao, Jian; Wang, Zhen-yu; Xing, Bao-shan

    2015-08-01

    The inhibitory action and possible damage mechanism of dibutyl phthalate (DBP) on the red tide algae Karenia brevis were investigated. The results showed that the algae experienced oxidative stress after exposure to 5mgL(-1) DBP. Malondialdehyde (MDA) peaked after 72h, with a value approximately 2.3 times higher than that observed for untreated cells. The superoxide dismutase (SOD) and catalase (CAT) activities significantly increased as an adaptive reaction after 48h. DBP induced the overproduction of reactive oxygen species (ROS), the OH concentration showed a peak of 33UmL(-1) at 48h, and the highest H2O2 content was approximately 250nmol/10(7) cells at 72h; these latter two values were 2.5 and 4.4 times higher than observed for the control, respectively. TEM images showed that a number of small vacuoles or apical tubers were commonly found around the cell membrane, and the membrane structure was ultimately disintegrated. Further experiments were carried out to locate the original ROS production sites following DBP exposure. The activity of CuZn-SOD (a mainly cytosolic isoform, with some also found in chloroplasts) under DBP exposure was approximately 2.5 times higher than the control, whereas the Mn-SOD (mitochondrial isoform) activity was significantly inhibited. No significant difference was observed in the activity of Fe-SOD (chloroplastic isoform). In addition, dicumarol (an inhibitor of the electron transport chain in the plasma membrane) stimulated DBP-induced ROS production, whereas rotenone (an inhibitor of the mitochondria electron transport chain complex I) decreased DBP-induced ROS production. These results suggested that mitochondria could be the main target sites for DBP attack. PMID:25770834

  20. Low Herbivory among Targeted Reforestation Sites in the Andean Highlands of Southern Ecuador.

    PubMed

    Adams, Marc-Oliver; Fiedler, Konrad

    2016-01-01

    Insect herbivory constitutes an important constraint in the viability and management of targeted reforestation sites. Focusing on young experimental stands at about 2000 m elevation in southern Ecuador, we examined foliar damage over one season as a function of tree species and habitat. Native tree species (Successional hardwood: Cedrela montana and Tabebuia chrysantha; fast-growing pioneer: Heliocarpus americanus) have been planted among prevailing local landcover types (abandoned pasture, secondary shrub vegetation, and a Pinus patula plantation) in 2003/4. Plantation trees were compared to conspecifics in the spontaneous undergrowth of adjacent undisturbed rainforest matched for height and foliar volume. Specifically, we tested the hypotheses that H. americanus as a pioneer species suffers more herbivory compared to the two successional tree species, and that damage is inversely related to habitat complexity. Overall leaf damage caused by folivorous insects (excluding leafcutter ants) was low. Average leaf loss was highest among T. chrysantha (7.50% ± 0.19 SE of leaf area), followed by H. americanus (4.67% ± 0.18 SE) and C. montana (3.18% ± 0.15 SE). Contrary to expectations, leaf area loss was highest among trees in closed-canopy natural rainforest, followed by pine plantation, pasture, and secondary shrub sites. Harvesting activity of leafcutter ants (Acromyrmex sp.) was strongly biased towards T. chrysantha growing in open habitat (mean pasture: 2.5%; shrub: 10.5%) where it could result in considerable damage (> 90.0%). Insect folivory is unlikely to pose a barrier for reforestation in the tropical Andean mountain forest zone at present, but leafcutter ants may become problematic if local temperatures increase in the wake of global warming. PMID:26963395

  1. Target-site basis for resistance to imazethapyr in redroot amaranth (Amaranthus retroflexus L.).

    PubMed

    Huang, Zhaofeng; Chen, Jinyi; Zhang, Chaoxian; Huang, Hongjuan; Wei, Shouhui; Zhou, Xinxin; Chen, Jingchao; Wang, Xu

    2016-03-01

    Experiments were conducted to confirm imazethapyr resistance in redroot amaranth (Amaranthus retroflexus L.) and study the target-site based mechanism for the resistance. Whole-plant response experiments revealed that the resistant (R) population exhibited 19.16 fold resistance to imazethapyr compared with the susceptible (S) population. In vitro ALS activity assay demonstrated that the imazethapyr I50 value of the R population was 21.33 times greater than that of the S population. However, qRT-PCR analysis revealed that there is no difference in ALS gene expression between the R and S populations. Sequence analysis revealed an Asp-376-Glu substitution in ALS in the R population. In order to verify that the imazethapyr resistance was conferred by Asp-376-Glu mutation, the ALS-R and ALS-S genes were fused to the CaMV 35S promoter and introduced into Arabidopsis respectively. The expression of ALS-R in transgenic Arabidopsis plants exhibited 13.79 fold resistance to imazethapyr compared to ALS-S transgenic Arabidopsis. PMID:26969434

  2. Dynamic strategies for target-site search by DNA-binding proteins.

    PubMed

    de la Rosa, Mario A Díaz; Koslover, Elena F; Mulligan, Peter J; Spakowitz, Andrew J

    2010-06-16

    Gene regulatory proteins find their target sites on DNA remarkably quickly; the experimental binding rate for lac repressor is orders-of-magnitude higher than predicted by free diffusion alone. It has been proposed that nonspecific binding aids the search by allowing proteins to slide and hop along DNA. We develop a reaction-diffusion theory of protein translocation that accounts for transport both on and off the strand and incorporates the physical conformation of DNA. For linear DNA modeled as a wormlike chain, the distribution of hops available to a protein exhibits long, power-law tails that make the long-time displacement along the strand superdiffusive. Our analysis predicts effective superdiffusion coefficients for given nonspecific binding and unbinding rate parameters. Translocation rate exhibits a maximum at intermediate values of the binding rate constant, while search efficiency is optimized at larger binding rate constant values. Thus, our theory predicts a region of values of the nonspecific binding and unbinding rate parameters that balance the protein translocation rate and the efficiency of the search. Published data for several proteins falls within this predicted region of parameter values. PMID:20550907

  3. Dynamic Strategies for Target-Site Search by DNA-Binding Proteins

    PubMed Central

    Díaz de la Rosa, Mario A.; Koslover, Elena F.; Mulligan, Peter J.; Spakowitz, Andrew J.

    2010-01-01

    Abstract Gene regulatory proteins find their target sites on DNA remarkably quickly; the experimental binding rate for lac repressor is orders-of-magnitude higher than predicted by free diffusion alone. It has been proposed that nonspecific binding aids the search by allowing proteins to slide and hop along DNA. We develop a reaction-diffusion theory of protein translocation that accounts for transport both on and off the strand and incorporates the physical conformation of DNA. For linear DNA modeled as a wormlike chain, the distribution of hops available to a protein exhibits long, power-law tails that make the long-time displacement along the strand superdiffusive. Our analysis predicts effective superdiffusion coefficients for given nonspecific binding and unbinding rate parameters. Translocation rate exhibits a maximum at intermediate values of the binding rate constant, while search efficiency is optimized at larger binding rate constant values. Thus, our theory predicts a region of values of the nonspecific binding and unbinding rate parameters that balance the protein translocation rate and the efficiency of the search. Published data for several proteins falls within this predicted region of parameter values. PMID:20550907

  4. The influence of target concentration, equilibration rate constant (ke0 ) and pharmacokinetic model on the initial propofol dose delivered in effect-site target-controlled infusion.

    PubMed

    Glen, J B; Engbers, F H M

    2016-03-01

    One advantage of effect-site target-controlled infusion is the administration of a larger initial dose of propofol to speed up the induction of anaesthesia. This dose is determined by the combination of the pharmacokinetic model parameters, the target setting and the blood-effect time-constant, ke0 . With the help of computer simulation, we determined the ke0 values required to deliver a range of initial doses with three pharmacokinetic models for propofol. With an effect site target of 4 μg.ml(-1) , in a 35-year-old, 170-cm tall, 70-kg male subject, the ke0 values delivering a dose of 1.75 mg.kg(-1) with the Marsh, Schnider and Eleveld models were 0.59 min(-1) , 0.20 min(-1) and 0.26 min(-1) , respectively. These ke0 values have the attractive feature that, when used to simulate the administration schemes used in two previous studies, predicted effect site concentrations at loss of consciousness were close to those required for maintenance of anaesthesia. PMID:26682512

  5. Detection of target site resistance to pyrethroids and organophosphates in the horn fly using multiplex polymerase chain reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The horn fly, Haematobia irritans L., is an obligate blood-feeding fly and the primary insect pest parasitizing cattle in the United States. Pesticide resistance has become a huge problem for cattle producers and although several mechanisms of resistance are possible, target site resistance is the m...

  6. RNA interference as a method for target-site screening in the Western Corn Rootworm, Diabrotica virgifera virgifera

    Technology Transfer Automated Retrieval System (TEKTRAN)

    RNA interference (RNAi) is one of the most powerful and extraordinarily-specific means by which to silence genes. The ability of RNAi to silence genes makes it possible to ascertain function from genomic data, thereby making it an excellent choice for target-site screening. To test the efficacy of...

  7. Targeted Mutagenesis, Precise Gene Editing, and Site-Specific Gene Insertion in Maize Using Cas9 and Guide RNA.

    PubMed

    Svitashev, Sergei; Young, Joshua K; Schwartz, Christine; Gao, Huirong; Falco, S Carl; Cigan, A Mark

    2015-10-01

    Targeted mutagenesis, editing of endogenous maize (Zea mays) genes, and site-specific insertion of a trait gene using clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)-guide RNA technology are reported in maize. DNA vectors expressing maize codon-optimized Streptococcus pyogenes Cas9 endonuclease and single guide RNAs were cointroduced with or without DNA repair templates into maize immature embryos by biolistic transformation targeting five different genomic regions: upstream of the liguleless1 (LIG1) gene, male fertility genes (Ms26 and Ms45), and acetolactate synthase (ALS) genes (ALS1 and ALS2). Mutations were subsequently identified at all sites targeted, and plants containing biallelic multiplex mutations at LIG1, Ms26, and Ms45 were recovered. Biolistic delivery of guide RNAs (as RNA molecules) directly into immature embryo cells containing preintegrated Cas9 also resulted in targeted mutations. Editing the ALS2 gene using either single-stranded oligonucleotides or double-stranded DNA vectors as repair templates yielded chlorsulfuron-resistant plants. Double-strand breaks generated by RNA-guided Cas9 endonuclease also stimulated insertion of a trait gene at a site near LIG1 by homology-directed repair. Progeny showed expected Mendelian segregation of mutations, edits, and targeted gene insertions. The examples reported in this study demonstrate the utility of Cas9-guide RNA technology as a plant genome editing tool to enhance plant breeding and crop research needed to meet growing agriculture demands of the future. PMID:26269544

  8. Transportation risk assessment for the shipment of irradiated FFTF tritium target assemblies from the Hanford Site to the Savannah River Site

    SciTech Connect

    Nielsen, D. L.

    1997-11-19

    A Draft Technical Information Document (HNF-1855) is being prepared to evaluate proposed interim tritium and medical isotope production at the Fast Flux Test Facility (FFTF). This report examines the potential health and safety impacts associated with transportation of irradiated tritium targets from FFTF to the Savannah River Site for processing at the Tritium Extraction Facility. Potential risks to workers and members of the public during normal transportation and accident conditions are assessed.

  9. Site-specific gene targeting using transcription activator-like effector (TALE)-based nuclease in Brassica oleracea.

    PubMed

    Sun, Zijian; Li, Nianzu; Huang, Guodong; Xu, Junqiang; Pan, Yu; Wang, Zhimin; Tang, Qinglin; Song, Ming; Wang, Xiaojia

    2013-11-01

    Site-specific recognition modules with DNA nuclease have tremendous potential as molecular tools for genome targeting. The type III transcription activator-like effectors (TALEs) contain a DNA binding domain consisting of tandem repeats that can be engineered to bind user-defined specific DNA sequences. We demonstrated that customized TALE-based nucleases (TALENs), constructed using a method called "unit assembly", specifically target the endogenous FRIGIDA gene in Brassica oleracea L. var. capitata L. The results indicate that the TALENs bound to the target site and cleaved double-strand DNA in vitro and in vivo, whereas the effector binding elements have a 23 bp spacer. The T7 endonuclease I assay and sequencing data show that TALENs made double-strand breaks, which were repaired by a non-homologous end-joining pathway within the target sequence. These data show the feasibility of applying customized TALENs to target and modify the genome with deletions in those organisms that are still in lacking gene target methods to provide germplasms in breeding improvement. PMID:23870552

  10. Selective Targeting of the TPX2 Site of Importin-α Using Fragment-Based Ligand Design.

    PubMed

    Holvey, Rhian S; Valkov, Eugene; Neal, David; Stewart, Murray; Abell, Chris

    2015-07-01

    Protein-protein interactions are difficult therapeutic targets, and inhibiting pathologically relevant interactions without disrupting other essential ones presents an additional challenge. Herein we report how this might be achieved for the potential anticancer target, the TPX2-importin-α interaction. Importin-α is a nuclear transport protein that regulates the spindle assembly protein TPX2. It has two binding sites--major and minor-to which partners bind. Most nuclear transport cargoes use the major site, whereas TPX2 binds principally to the minor site. Fragment-based approaches were used to identify small molecules that bind importin-α, and crystallographic studies identified a lead series that was observed to bind specifically to the minor site, representing the first ligands specific for this site. Structure-guided synthesis informed the elaboration of these fragments to explore the source of ligand selectivity between the minor and major sites. These ligands are starting points for the development of inhibitors of this protein-protein interaction. PMID:25899172

  11. The casposon-encoded Cas1 protein from Aciduliprofundum boonei is a DNA integrase that generates target site duplications.

    PubMed

    Hickman, Alison B; Dyda, Fred

    2015-12-15

    Many archaea and bacteria have an adaptive immune system known as CRISPR which allows them to recognize and destroy foreign nucleic acid that they have previously encountered. Two CRISPR-associated proteins, Cas1 and Cas2, are required for the acquisition step of adaptation, in which fragments of foreign DNA are incorporated into the host CRISPR locus. Cas1 genes have also been found scattered in several archaeal and bacterial genomes, unassociated with CRISPR loci or other cas proteins. Rather, they are flanked by nearly identical inverted repeats and enclosed within direct repeats, suggesting that these genetic regions might be mobile elements ('casposons'). To investigate this possibility, we have characterized the in vitro activities of the putative Cas1 transposase ('casposase') from Aciduliprofundum boonei. The purified Cas1 casposase can integrate both short oligonucleotides with inverted repeat sequences and a 2.8 kb excised mini-casposon into target DNA. Casposon integration occurs without target specificity and generates 14-15 basepair target site duplications, consistent with those found in casposon host genomes. Thus, Cas1 casposases carry out similar biochemical reactions as the CRISPR Cas1-Cas2 complex but with opposite substrate specificities: casposases integrate specific sequences into random target sites, whereas CRISPR Cas1-Cas2 integrates essentially random sequences into a specific site in the CRISPR locus. PMID:26573596

  12. The casposon-encoded Cas1 protein from Aciduliprofundum boonei is a DNA integrase that generates target site duplications

    PubMed Central

    Hickman, Alison B.; Dyda, Fred

    2015-01-01

    Many archaea and bacteria have an adaptive immune system known as CRISPR which allows them to recognize and destroy foreign nucleic acid that they have previously encountered. Two CRISPR-associated proteins, Cas1 and Cas2, are required for the acquisition step of adaptation, in which fragments of foreign DNA are incorporated into the host CRISPR locus. Cas1 genes have also been found scattered in several archaeal and bacterial genomes, unassociated with CRISPR loci or other cas proteins. Rather, they are flanked by nearly identical inverted repeats and enclosed within direct repeats, suggesting that these genetic regions might be mobile elements (‘casposons’). To investigate this possibility, we have characterized the in vitro activities of the putative Cas1 transposase (‘casposase’) from Aciduliprofundum boonei. The purified Cas1 casposase can integrate both short oligonucleotides with inverted repeat sequences and a 2.8 kb excised mini-casposon into target DNA. Casposon integration occurs without target specificity and generates 14–15 basepair target site duplications, consistent with those found in casposon host genomes. Thus, Cas1 casposases carry out similar biochemical reactions as the CRISPR Cas1-Cas2 complex but with opposite substrate specificities: casposases integrate specific sequences into random target sites, whereas CRISPR Cas1-Cas2 integrates essentially random sequences into a specific site in the CRISPR locus. PMID:26573596

  13. Synergistic active targeting of dually integrin αvβ3/CD44-targeted nanoparticles to B16F10 tumors located at different sites of mouse bodies.

    PubMed

    Shi, Sanjun; Zhou, Min; Li, Xin; Hu, Min; Li, Chenwen; Li, Min; Sheng, Fangfang; Li, Zhuoheng; Wu, Guolin; Luo, Minghe; Cui, Huanhuan; Li, Ziwei; Fu, Ruoqiu; Xiang, Mingfeng; Xu, Jing; Zhang, Qian; Lu, Laichun

    2016-08-10

    Conventional enhanced permeation and retention (EPR) mediates the effects of many drugs, including the accumulation of nanocarriers at tumor sites, but its efficiency remains low. In this study, this limitation was overcome by developing a dual-targeting delivery system based on hyaluronan (HA, a major ligand of CD44) and tetraiodothyroacetic acid (tetrac, a specific ligand of αvβ3), which was exploited to carry docetaxel (DTX) for the synergistic active targeting to tumors. First, a tetrac-HA (TeHA) conjugate was synthesized and grafted onto the surfaces of solid lipid nanoparticles (SLNs) (TeHA-SLNs/DTX), with a high encapsulation efficiency of >91.6%. The resulting SLNs exhibited an approximately toroid morphology revealed using TEM. The cellular uptake and cytotoxicity of various formulations on CD44/αvβ3-enriched B16F10 cells were then assessed, and both results confirmed the selective uptake and high cytotoxicity of the TeHA-SLNs/DTX in a TeHA-dependent manner. In vivo imaging and vessel distribution tests revealed the efficiency of synergistic active targeting was higher than that of EPR-mediated passive targeting by the TeHA-SLNs to αvβ3-expressing tumor blood vessels and CD44-expressing tumor cells via selective targeting. Finally, in both xenograft tumor mice and in situ lung metastasis tumor mice, tumor growth was significantly inhibited by TeHA-SLNs/DTX. Therefore, TeHA-SLNs are an efficient system for the dual-targeted delivery of drugs to treat cancer in vivo. PMID:27235150

  14. Analysis of CDS-located miRNA target sites suggests that they can effectively inhibit translation

    PubMed Central

    Hausser, Jean; Syed, Afzal Pasha; Bilen, Biter; Zavolan, Mihaela

    2013-01-01

    Most of what is presently known about how miRNAs regulate gene expression comes from studies that characterized the regulatory effect of miRNA binding sites located in the 3′ untranslated regions (UTR) of mRNAs. In recent years, there has been increasing evidence that miRNAs also bind in the coding region (CDS), but the implication of these interactions remains obscure because they have a smaller impact on mRNA stability compared with miRNA-target interactions that involve 3′ UTRs. Here we show that miRNA-complementary sites that are located in both CDS and 3′-UTRs are under selection pressure and share the same sequence and structure properties. Analyzing recently published data of ribosome-protected fragment profiles upon miRNA transfection from the perspective of the location of miRNA-complementary sites, we find that sites located in the CDS are most potent in inhibiting translation, while sites located in the 3′ UTR are more efficient at triggering mRNA degradation. Our study suggests that miRNAs may combine targeting of CDS and 3′ UTR to flexibly tune the time scale and magnitude of their post-transcriptional regulatory effects. PMID:23335364

  15. Ensemble-Based Virtual Screening and Experimental Validation of Inhibitors Targeting a Novel Site of Human DNMT1.

    PubMed

    Joshi, Manali; Rajpathak, Shriram N; Narwade, Santosh C; Deobagkar, Deepti

    2016-07-01

    Human DNA methyltransferase1 (hDNMT1) is responsible for preserving DNA methylation patterns that play important regulatory roles in differentiation and development. Misregulation of DNA methylation has thus been linked to many syndromes, life style diseases, and cancers. Developing specific inhibitors of hDNMT1 is an important challenge in the area since the currently targeted cofactor and substrate binding site share structural features with various proteins. In this work, we generated a structural model of the active form of hDNMT1 and identified that the 5-methylcytosine (5-mC) binding site of the hDNMT1 is structurally unique to the protein. This site has been previously demonstrated to be critical for methylation activity. We further performed multiple nanosecond time scale atomistic molecular dynamics simulations of the structural model followed by virtual screening of the Asinex database to identify inhibitors targeting the 5-mC site. Two compounds were discovered that inhibited hDNMT1 in vitro, one of which also showed inhibition in vivo corroborating the screening procedure. This study thus identifies and attempts to validate for the first time a unique site of hDNMT1 that could be harnessed for rationally designing highly selective and potent hypomethylating agents. PMID:26850820

  16. Comprehensive profiling of retroviral integration sites using target enrichment methods from historical koala samples without an assembled reference genome.

    PubMed

    Cui, Pin; Löber, Ulrike; Alquezar-Planas, David E; Ishida, Yasuko; Courtiol, Alexandre; Timms, Peter; Johnson, Rebecca N; Lenz, Dorina; Helgen, Kristofer M; Roca, Alfred L; Hartman, Stefanie; Greenwood, Alex D

    2016-01-01

    Background. Retroviral integration into the host germline results in permanent viral colonization of vertebrate genomes. The koala retrovirus (KoRV) is currently invading the germline of the koala (Phascolarctos cinereus) and provides a unique opportunity for studying retroviral endogenization. Previous analysis of KoRV integration patterns in modern koalas demonstrate that they share integration sites primarily if they are related, indicating that the process is currently driven by vertical transmission rather than infection. However, due to methodological challenges, KoRV integrations have not been comprehensively characterized. Results. To overcome these challenges, we applied and compared three target enrichment techniques coupled with next generation sequencing (NGS) and a newly customized sequence-clustering based computational pipeline to determine the integration sites for 10 museum Queensland and New South Wales (NSW) koala samples collected between the 1870s and late 1980s. A secondary aim of this study sought to identify common integration sites across modern and historical specimens by comparing our dataset to previously published studies. Several million sequences were processed, and the KoRV integration sites in each koala were characterized. Conclusions. Although the three enrichment methods each exhibited bias in integration site retrieval, a combination of two methods, Primer Extension Capture and hybridization capture is recommended for future studies on historical samples. Moreover, identification of integration sites shows that the proportion of integration sites shared between any two koalas is quite small. PMID:27069793

  17. Comprehensive profiling of retroviral integration sites using target enrichment methods from historical koala samples without an assembled reference genome

    PubMed Central

    Alquezar-Planas, David E.; Ishida, Yasuko; Courtiol, Alexandre; Timms, Peter; Johnson, Rebecca N.; Lenz, Dorina; Helgen, Kristofer M.; Roca, Alfred L.; Hartman, Stefanie

    2016-01-01

    Background. Retroviral integration into the host germline results in permanent viral colonization of vertebrate genomes. The koala retrovirus (KoRV) is currently invading the germline of the koala (Phascolarctos cinereus) and provides a unique opportunity for studying retroviral endogenization. Previous analysis of KoRV integration patterns in modern koalas demonstrate that they share integration sites primarily if they are related, indicating that the process is currently driven by vertical transmission rather than infection. However, due to methodological challenges, KoRV integrations have not been comprehensively characterized. Results. To overcome these challenges, we applied and compared three target enrichment techniques coupled with next generation sequencing (NGS) and a newly customized sequence-clustering based computational pipeline to determine the integration sites for 10 museum Queensland and New South Wales (NSW) koala samples collected between the 1870s and late 1980s. A secondary aim of this study sought to identify common integration sites across modern and historical specimens by comparing our dataset to previously published studies. Several million sequences were processed, and the KoRV integration sites in each koala were characterized. Conclusions. Although the three enrichment methods each exhibited bias in integration site retrieval, a combination of two methods, Primer Extension Capture and hybridization capture is recommended for future studies on historical samples. Moreover, identification of integration sites shows that the proportion of integration sites shared between any two koalas is quite small. PMID:27069793

  18. Random Tagging Genotyping by Sequencing (rtGBS), an Unbiased Approach to Locate Restriction Enzyme Sites across the Target Genome

    PubMed Central

    Hilario, Elena; Barron, Lorna; Deng, Cecilia H.; Datson, Paul M.; Davy, Marcus W.; Storey, Roy D.

    2015-01-01

    Genotyping by sequencing (GBS) is a restriction enzyme based targeted approach developed to reduce the genome complexity and discover genetic markers when a priori sequence information is unavailable. Sufficient coverage at each locus is essential to distinguish heterozygous from homozygous sites accurately. The number of GBS samples able to be pooled in one sequencing lane is limited by the number of restriction sites present in the genome and the read depth required at each site per sample for accurate calling of single-nucleotide polymorphisms. Loci bias was observed using a slight modification of the Elshire et al. method: some restriction enzyme sites were represented in higher proportions while others were poorly represented or absent. This bias could be due to the quality of genomic DNA, the endonuclease and ligase reaction efficiency, the distance between restriction sites, the preferential amplification of small library restriction fragments, or bias towards cluster formation of small amplicons during the sequencing process. To overcome these issues, we have developed a GBS method based on randomly tagging genomic DNA (rtGBS). By randomly landing on the genome, we can, with less bias, find restriction sites that are far apart, and undetected by the standard GBS (stdGBS) method. The study comprises two types of biological replicates: six different kiwifruit plants and two independent DNA extractions per plant; and three types of technical replicates: four samples of each DNA extraction, stdGBS vs. rtGBS methods, and two independent library amplifications, each sequenced in separate lanes. A statistically significant unbiased distribution of restriction fragment size by rtGBS showed that this method targeted 49% (39,145) of BamH I sites shared with the reference genome, compared to only 14% (11,513) by stdGBS. PMID:26633193

  19. High-performance targeted mass spectrometry with precision data-independent acquisition reveals site-specific glycosylation macroheterogeneity.

    PubMed

    Yeo, K Y Benjamin; Chrysanthopoulos, Panagiotis K; Nouwens, Amanda S; Marcellin, Esteban; Schulz, Benjamin L

    2016-10-01

    Protein glycosylation is a critical post-translational modification that regulates the structure, stability, and function of many proteins. Mass spectrometry is currently the preferred method for qualitative and quantitative characterization of glycosylation. However, the inherent heterogeneity of glycosylation makes its analysis difficult. Quantification of glycosylation occupancy, or macroheterogeneity, has proven to be especially challenging. Here, we used a variation of high-resolution multiple reaction monitoring (MRM(HR)) or pseudo-MRM for targeted data-independent acquisition that we term SWAT (sequential window acquisition of targeted fragment ions). We compared the analytical performance of SWATH (sequential window acquisition of all theoretical fragment ions), SWAT, and SRM (selected reaction monitoring) using a suite of synthetic peptides spiked at various concentrations into a complex yeast tryptic digest sample. SWAT provided superior analytical performance to SWATH in a targeted approach. We then used SWAT to measure site-specific N-glycosylation occupancy in cell wall glycoproteins from yeast with defects in the glycosylation biosynthetic machinery. SWAT provided robust measurement of occupancy at more N-glycosylation sites and with higher precision than SWATH, allowing identification of novel glycosylation sites dependent on the Ost3p and Ost6p regulatory subunits of oligosaccharyltransferase. PMID:27318240

  20. Covalent disulfide-linked anti-CEA diabody allows site-specific conjugation and radiolabeling for tumor targeting applications

    PubMed Central

    Olafsen, Tove; Cheung, Chia-wei; Yazaki, Paul J.; Li, Lin; Sundaresan, Gobalakrishnan; Gambhir, Sanjiv S.; Sherman, Mark A.; Williams, Lawrence E.; Shively, John E.; Raubitschek, Andrew A.; Wu, Anna M.

    2014-01-01

    An engineered anti-carcinoembryonic antigen (CEA) diabody (scFv dimer, 55 kDa) was previously constructed from the murine anti-CEA T84.66 antibody. Tumor targeting, imaging and biodistribution studies in nude mice bearing LS174T xenografts with radiolabeled anti-CEA diabody demonstrated rapid tumor uptake and fast blood clearance, which are favorable properties for an imaging agent. Current radiolabeling approaches result in random modification of the protein surface, which may impair immunoreactivity especially for smaller antibody fragments. Site-specific conjugation approaches can direct modifications to reactive groups located away from the binding site. Here, cysteine residues were introduced into the anti-CEA diabody at three different locations, to provide specific thiol groups for chemical modification. One version (with a C-terminal Gly-Gly-Cys) existed exclusively as a disulfide-bonded dimer. This cysteine-modified diabody (Cys-diabody) retained high binding to CEA and demonstrated tumor targeting and biodistribution properties identical to the non-covalent diabody. Furthermore, following reduction of the disulfide bond, the Cys-diabody could be chemically modified using a thiol-specific bifunctional chelating agent, for radiometal labeling. Thus, the Cys-diabody provides a covalently linked alternative to conventional diabodies, which can be reduced and modified site-specifically. This format will provide a versatile platform for targeting a variety of agents to CEA-positive tumors. PMID:14985534

  1. Disabling the mitotic spindle and tumor growth by targeting a cavity-induced allosteric site of survivin

    PubMed Central

    Berezov, A; Cai, Z; Freudenberg, JA; Zhang, H; Cheng, X; Thompson, T; Murali, R; Greene, MI; Wang, Q

    2012-01-01

    Survivin is a member of the inhibitor of apoptosis protein family and has an essential role in mitosis. Survivin is overexpressed in a large variety of human cancers and represents an attractive target for cancer therapy. Epidermal growth factor receptor and Her/neu-transformed human tumors in particular exhibit high levels of survivin. The survivin protein forms dimers through a conserved region that is critical for subcellular localization and biological functions of the protein. We identified small molecules that target a specific cavity adjacent to the survivin dimerization surfaces. S12, a lead compound identified in the screen, can bind to the survivin protein at the intended target site. Moreover, S12 alters spindle formation, causing mitotic arrest and cell death, and inhibits tumor growth in vitro and in vivo. Cell death occurs in premetaphase stage following mitotic arrest and is not a consequence of general toxicity. Thus, the study validates a novel therapeutic target site in the survivin protein and provides a promising strategy to develop a new class of therapeutic small molecules for the treatment of human cancers. PMID:21892210

  2. sgRNAcas9: A Software Package for Designing CRISPR sgRNA and Evaluating Potential Off-Target Cleavage Sites

    PubMed Central

    Xie, Shengsong; Shen, Bin; Zhang, Chaobao; Huang, Xingxu; Zhang, Yonglian

    2014-01-01

    Although the CRISPR/Cas9/sgRNA system efficiently cleaves intracellular DNA at desired target sites, major concerns remain on potential “off-target” cleavage that may occur throughout the whole genome. In order to improve CRISPR-Cas9 specificity for targeted genome editing and transcriptional control, we describe a bioinformatics tool “sgRNAcas9”, which is a software package developed for fast design of CRISPR sgRNA with minimized off-target effects. This package consists of programs to perform a search for CRISPR target sites (protospacers) with user-defined parameters, predict genome-wide Cas9 potential off-target cleavage sites (POT), classify the POT into three categories, batch-design oligonucleotides for constructing 20-nt (nucleotides) or truncated sgRNA expression vectors, extract desired length nucleotide sequences flanking the on- or off-target cleavage sites for designing PCR primer pairs to validate the mutations by T7E1 cleavage assay. Importantly, by identifying potential off-target sites in silico, the sgRNAcas9 allows the selection of more specific target sites and aids the identification of bona fide off-target sites, significantly facilitating the design of sgRNA for genome editing applications. sgRNAcas9 software package is publicly available at BiooTools website (www.biootools.com) under the terms of the GNU General Public License. PMID:24956386

  3. Onco-Regulon: an integrated database and software suite for site specific targeting of transcription factors of cancer genes

    PubMed Central

    Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B.

    2016-01-01

    Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm), an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5′→3′, 3′ →5′ or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically. Database URL: http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm PMID:27515825

  4. Onco-Regulon: an integrated database and software suite for site specific targeting of transcription factors of cancer genes.

    PubMed

    Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B

    2016-01-01

    Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm), an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5'→3', 3' →5' or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically.Database URL: http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm. PMID:27515825

  5. Site-Directed Conjugation of Antibodies to Apoferritin Nanocarrier for Targeted Drug Delivery to Prostate Cancer Cells.

    PubMed

    Dostalova, Simona; Cerna, Tereza; Hynek, David; Koudelkova, Zuzana; Vaculovic, Tomas; Kopel, Pavel; Hrabeta, Jan; Heger, Zbynek; Vaculovicova, Marketa; Eckschlager, Tomas; Stiborova, Marie; Adam, Vojtech

    2016-06-15

    Herein, we describe a novel approach for targeting of ubiquitous protein apoferritin (APO)-encapsulating doxorubicin (DOX) to prostate cancer using antibodies against prostate-specific membrane antigen (PSMA). The conjugation of anti-PSMA antibodies and APO was carried out using HWRGWVC heptapeptide, providing their site-directed orientation. The prostate-cancer-targeted and nontargeted nanocarriers were tested using LNCaP and HUVEC cell lines. A total of 90% of LNCaP cells died after treatment with DOX (0.25 μM) or DOX in nontargeted and prostate-cancer-targeted APO, proving that the encapsulated DOX toxicity for LNCaP cells remained the same. Free DOX showed higher toxicity for nonmalignant cells, whereas the toxicity was lower after treatment with the same dosage of APO-encapsulated DOX (APODOX) and even more in prostate-cancer-targeted APODOX. Hemolytic assay revealed exceptional hemocompatibility of the entire nanocarrier. The APO encapsulation mechanism ensures applicability using a wide variety of chemotherapeutic drugs, and the presented surface modification enables targeting to various tumors. PMID:27219717

  6. Polymorphisms in MicroRNA Target Sites of Forkhead Box O Genes Are Associated with Hepatocellular Carcinoma

    PubMed Central

    Zeng, Xiaoyun; Yu, Hongping; Li, Anhua; Bei, Chunhua; Qiu, Xiaoqiang

    2015-01-01

    The forkhead box O (FOXO) transcription factors play important roles in various cancer development including Hepatocellular Carcinoma (HCC). In this study we conducted a hospital-based case control study including 1049 cases (HCC patients) and 1052 controls (non-tumor patients) to examine whether single nucleotide polymorphisms (SNPs) within microRNA (miRNA) target sites of FOXO genes confer HCC susceptibility. A total of three miRNA target site SNPs in the 3’ untranslated regions (UTR) of FOXO1 (rs17592236), FOXO3 (rs4946936) and FOXO4 (rs4503258) were analyzed. No statistically significant differences were found in genotype distribution for rs17592236, rs4946936, and rs4503258 between the HCC patient group and the tumor-free control group using single factor chi-square analysis (P>0.05). However, multivariate logistic regression analysis showed that the CT/TT genotype in rs17592236 was significantly associated with decreased risk of HCC development (P = 0.010, OR = 0.699, 95% CI: 0.526–0.927) as compared to the CC genotype in rs17592236. Additionally, a genetic interaction was found between rs17592236 and rs4503258 (P = 0.003, OR = 0.755, 95% CI: 0.628–0.908). Functional dual luciferase reporter assays verified that the rs17592236 SNP was a target site of human miRNA miR-137. Together, these results indicate that the rs17592236 polymorphism is associated with decreasing of HCC hereditary susceptibility likely through modulating the binding affinity of miR-137 to the 3’UTR in FOXO1 messenger RNA (mRNA). Further knowledge obtained from this study may provide important evidence for the prevention and targeted therapy of HCC. PMID:25739100

  7. Nanoparticles Effectively Target Rapamycin Delivery to Sites of Experimental Aortic Aneurysm in Rats

    PubMed Central

    Shirasu, Takuro; Koyama, Hiroyuki; Miura, Yutaka; Hoshina, Katsuyuki; Kataoka, Kazunori; Watanabe, Toshiaki

    2016-01-01

    Several drugs targeting the pathogenesis of aortic aneurysm have shown efficacy in model systems but not in clinical trials, potentially owing to the lack of targeted drug delivery. Here, we designed a novel drug delivery system using nanoparticles to target the disrupted aortic aneurysm micro-structure. We generated poly(ethylene glycol)-shelled nanoparticles incorporating rapamycin that exhibited uniform diameter and long-term stability. When injected intravenously into a rat model in which abdominal aortic aneurysm (AAA) had been induced by infusing elastase, labeled rapamycin nanoparticles specifically accumulated in the AAA. Microscopic analysis revealed that rapamycin nanoparticles were mainly distributed in the media and adventitia where the wall structures were damaged. Co-localization of rapamycin nanoparticles with macrophages was also noted. Rapamycin nanoparticles injected during the process of AAA formation evinced significant suppression of AAA formation and mural inflammation at 7 days after elastase infusion, as compared with rapamycin treatment alone. Correspondingly, the activities of matrix metalloproteinases and the expression of inflammatory cytokines were significantly suppressed by rapamycin nanoparticle treatment. Our findings suggest that the nanoparticle-based delivery system achieves specific delivery of rapamycin to the rat AAA and might contribute to establishing a drug therapy approach targeting aortic aneurysm. PMID:27336852

  8. HIV Develops Indirect Cross-resistance to Combinatorial RNAi Targeting Two Distinct and Spatially Distant Sites

    PubMed Central

    Shah, Priya S; Pham, Nhung P; Schaffer, David V

    2012-01-01

    Resistance to existing HIV therapies is an increasing problem, and alternative treatments are urgently needed. RNA interference (RNAi), an innate mechanism for sequence-specific gene silencing, can be harnessed therapeutically to treat viral infections, yet viral resistance can still emerge. Here, we demonstrate that HIV can develop indirect resistance to individual and combinatorial RNAi-targeting protein-coding regions up to 5,500 nucleotides (nt) downstream of the viral promoter. We identify several variants harboring mutations in the HIV promoter, and not within the RNAi targets, that produce more fully elongated transcripts. Furthermore, these variants are resistant to the RNAi, potentially by stoichiometrically overwhelming this cellular mechanism. Alarmingly, virus resistant to one short hairpin RNA (shRNA) also exhibits cross-resistance to a different shRNA, which targets a distinct and spatially distant region to which the virus has not been previously exposed. To our knowledge, this is the first example of HIV “cross-resistance” to viral inhibitors targeting different loci. Finally, combining anti-HIV RNAi with a small molecule enhancer of RNAi can inhibit the replication of an indirectly resistant mutant. These results suggest that indirect resistance to RNAi is a general mechanism that should be considered when investigating viral resistance and designing combinatorial RNAi therapies. PMID:22294151

  9. Nanoparticles Effectively Target Rapamycin Delivery to Sites of Experimental Aortic Aneurysm in Rats.

    PubMed

    Shirasu, Takuro; Koyama, Hiroyuki; Miura, Yutaka; Hoshina, Katsuyuki; Kataoka, Kazunori; Watanabe, Toshiaki

    2016-01-01

    Several drugs targeting the pathogenesis of aortic aneurysm have shown efficacy in model systems but not in clinical trials, potentially owing to the lack of targeted drug delivery. Here, we designed a novel drug delivery system using nanoparticles to target the disrupted aortic aneurysm micro-structure. We generated poly(ethylene glycol)-shelled nanoparticles incorporating rapamycin that exhibited uniform diameter and long-term stability. When injected intravenously into a rat model in which abdominal aortic aneurysm (AAA) had been induced by infusing elastase, labeled rapamycin nanoparticles specifically accumulated in the AAA. Microscopic analysis revealed that rapamycin nanoparticles were mainly distributed in the media and adventitia where the wall structures were damaged. Co-localization of rapamycin nanoparticles with macrophages was also noted. Rapamycin nanoparticles injected during the process of AAA formation evinced significant suppression of AAA formation and mural inflammation at 7 days after elastase infusion, as compared with rapamycin treatment alone. Correspondingly, the activities of matrix metalloproteinases and the expression of inflammatory cytokines were significantly suppressed by rapamycin nanoparticle treatment. Our findings suggest that the nanoparticle-based delivery system achieves specific delivery of rapamycin to the rat AAA and might contribute to establishing a drug therapy approach targeting aortic aneurysm. PMID:27336852

  10. A Conserved Target Site in HIV-1 Gag RNA is Accessible to Inhibition by Both an HDV Ribozyme and a Short Hairpin RNA

    PubMed Central

    Scarborough, Robert J; Lévesque, Michel V; Boudrias-Dalle, Etienne; Chute, Ian C; Daniels, Sylvanne M; Ouellette, Rodney J; Perreault, Jean-Pierre; Gatignol, Anne

    2014-01-01

    Antisense-based molecules targeting HIV-1 RNA have the potential to be used as part of gene or drug therapy to treat HIV-1 infection. In this study, HIV-1 RNA was screened to identify more conserved and accessible target sites for ribozymes based on the hepatitis delta virus motif. Using a quantitative screen for effects on HIV-1 production, we identified a ribozyme targeting a highly conserved site in the Gag coding sequence with improved inhibitory potential compared to our previously described candidates targeting the overlapping Tat/Rev coding sequence. We also demonstrate that this target site is highly accessible to short hairpin directed RNA interference, suggesting that it may be available for the binding of antisense RNAs with different modes of action. We provide evidence that this target site is structurally conserved in diverse viral strains and that it is sufficiently different from the human transcriptome to limit off-target effects from antisense therapies. We also show that the modified hepatitis delta virus ribozyme is more sensitive to a mismatch in its target site compared to the short hairpin RNA. Overall, our results validate the potential of a new target site in HIV-1 RNA to be used for the development of antisense therapies. PMID:25072692

  11. Virus Capsids as Targeted Nanoscale Delivery Vessels of Photoactive Compounds for Site-Specific Photodynamic Therapy

    NASA Astrophysics Data System (ADS)

    Cohen, Brian A.

    The research presented in this work details the use of a viral capsid as an addressable delivery vessel of photoactive compounds for use in photodynamic therapy. Photodynamic therapy is a treatment that involves the interaction of light with a photosensitizing molecule to create singlet oxygen, a reactive oxygen species. Overproduction of singlet oxygen in cells can cause oxidative damage leading to cytotoxicity and eventually cell death. Challenges with the current generation of FDA-approved photosensitizers for photodynamic therapy primarily stem from their lack of tissue specificity. This work describes the packaging of photoactive cationic porphyrins inside the MS2 bacteriophage capsid, followed by external modification of the capsid with cancer cell-targeting G-quadruplex DNA aptamers to generate a tumor-specific photosensitizing agent. First, a cationic porphyrin is loaded into the capsids via nucleotide-driven packaging, a process that involves charge interaction between the porphyrin and the RNA inside the capsid. Results show that over 250 porphyrin molecules associate with the RNA within each MS2 capsid. Removal of RNA from the capsid severely inhibits the packaging of the cationic porphyrins. Porphyrin-virus constructs were then shown to photogenerate singlet oxygen, and cytotoxicity in non-targeted photodynamic treatment experiments. Next, each porphyrin-loaded capsid is externally modified with approximately 60 targeting DNA aptamers by employing a heterobifunctional crosslinking agent. The targeting aptamer is known to bind the protein nucleolin, a ubiquitous protein that is overexpressed on the cell surface by many cancer cell types. MCF-7 human breast carcinoma cells and MCF-10A human mammary epithelial cells were selected as an in vitro model for breast cancer and normal tissue, respectively. Fluorescently tagged virus-aptamer constructs are shown to selectively target MCF-7 cells versus MCF-10A cells. Finally, results are shown in which porphyrin

  12. Evolutionary Changes of the Target Sites of Two MicroRNAs Encoded in the Hox Gene Cluster of Drosophila and Other Insect Species

    PubMed Central

    Miura, Sayaka; Nozawa, Masafumi; Nei, Masatoshi

    2011-01-01

    MicroRNAs (miRs) are noncoding RNAs that regulate gene expression at the post-transcriptional level. In animals, the target sites of a miR are generally located in the 3′ untranslated regions (UTRs) of messenger RNAs. However, how the target sites change during evolution is largely unknown. MiR-iab-4 and miR-iab-4as are known to regulate the expression of two Hox genes, Abd-A and Ubx, in Drosophila melanogaster. We have therefore studied the evolutionary changes of these two miR genes and their target sites of the Hox genes in Drosophila, other insect species, and Daphnia. Our homology search identified a single copy of each miR gene located in the same genomic position of the Hox gene cluster in all species examined. The seed nucleotide sequence was also the same for all species. Searching for the target sites in all Hox genes, we found several target sites of miR-iab-4 and miR-iab-4as in Antp in addition to Abd-A and Ubx in most insect species examined. Our phylogenetic analysis of target sites in Abd-A, Ubx, and Antp showed that the old target sites, which existed before the divergence of the 12 Drosophila species, have been well maintained in most species under purifying selection. By contrast, new target sites, which were generated during Drosophila evolution, were often lost in some species and mostly located in unalignable regions of the 3′ UTRs. These results indicate that these regions can be a potential source of generating new target sites, which results in multiple target genes for each miR in animals. PMID:21187351

  13. Identification of Thyroid Hormone Receptor Binding Sites and Target Genes Using ChIP-on-Chip in Developing Mouse Cerebellum

    PubMed Central

    Dong, Hongyan; Yauk, Carole L.; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R. Thomas; Lambert, Iain; Wade, Michael G.

    2009-01-01

    Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRβ) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning −8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5′) of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRβ binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding. PMID:19240802

  14. Focal targeting by human β-defensin 2 disrupts localized virulence factor assembly sites in Enterococcus faecalis.

    PubMed

    Kandaswamy, Kumaravel; Liew, Tze Horng; Wang, Charles Y; Huston-Warren, Emily; Meyer-Hoffert, Ulf; Hultenby, Kjell; Schröder, Jens M; Caparon, Michael G; Normark, Staffan; Henriques-Normark, Birgitta; Hultgren, Scott J; Kline, Kimberly A

    2013-12-10

    Virulence factor secretion and assembly occurs at spatially restricted foci in some Gram-positive bacteria. Given the essentiality of the general secretion pathway in bacteria and the contribution of virulence factors to disease progression, the foci that coordinate these processes are attractive antimicrobial targets. In this study, we show in Enterococcus faecalis that SecA and Sortase A, required for the attachment of virulence factors to the cell wall, localize to discrete domains near the septum or nascent septal site as the bacteria proceed through the cell cycle. We also demonstrate that cationic human β-defensins interact with E. faecalis at discrete septal foci, and this exposure disrupts sites of localized secretion and sorting. Modification of anionic lipids by multiple peptide resistance factor, a protein that confers antimicrobial peptide resistance by electrostatic repulsion, renders E. faecalis more resistant to killing by defensins and less susceptible to focal targeting by the cationic antimicrobial peptides. These data suggest a paradigm in which focal targeting by antimicrobial peptides is linked to their killing efficiency and to disruption of virulence factor assembly. PMID:24191013

  15. Portable automatic bioaerosol sampling system for rapid on-site detection of targeted airborne microorganisms.

    PubMed

    Usachev, Evgeny V; Pankova, Anna V; Rafailova, Elina A; Pyankov, Oleg V; Agranovski, Igor E

    2012-10-26

    Bioaerosols could cause various severe human and animal diseases and their opportune and qualitative precise detection and control is becoming a significant scientific and technological topic for consideration. Over the last few decades bioaerosol detection has become an important bio-defense related issue. Many types of portable and stationary bioaerosol samplers have been developed and, in some cases, integrated into automated detection systems utilizing various microbiological techniques for analysis of collected microbes. This paper describes a personal sampler used in conjunction with a portable real-time PCR technique. It was found that a single fluorescent dye could be successfully used in multiplex format for qualitative detection of numerous targeted bioaerosols in one PCR tube making the suggested technology a reliable "first alert" device. This approach has been specifically developed and successfully verified for rapid detection of targeted microorganisms by portable PCR devices, which is especially important under field conditions, where the number of microorganisms of interest usually exceeds the number of available PCR reaction tubes. The approach allows detecting targeted microorganisms and triggering some corresponding sanitary and quarantine procedures to localize possible spread of dangerous infections. Following detailed analysis of the sample under controlled laboratory conditions could be used to exactly identify which particular microorganism out of a targeted group has been rapidly detected in the field. It was also found that the personal sampler has a collection efficiency higher than 90% even for small-sized viruses (>20 nm) and stable performance over extended operating periods. In addition, it was found that for microorganisms used in this project (bacteriophages MS2 and T4) elimination of nucleic acids isolation and purification steps during sample preparation does not lead to the system sensitivity reduction, which is extremely

  16. RNA-RNA Interactions Enable Specific Targeting of Noncoding RNAs to Nascent Pre-mRNAs and Chromatin Sites

    PubMed Central

    Engreitz, Jesse M.; Sirokman, Klara; McDonel, Patrick; Shishkin, Alexander; Surka, Christine; Russell, Pamela; Grossman, Sharon R.; Chow, Amy Y.; Guttman, Mitchell; Lander, Eric S.

    2014-01-01

    Summary Intermolecular RNA-RNA interactions are used by many noncoding RNAs (ncRNAs) to achieve their diverse functions. To aid in identifying these contacts, we developed a method based on RNA Antisense Purification to systematically map RNA-RNA interactions (RAP-RNA) and applied it to investigate two ncRNAs implicated in RNA processing: U1 snRNA, a component of the spliceosome, and Malat1, a lncRNA that localizes to nuclear speckles. U1 and Malat1 interact with nascent transcripts through distinct targeting mechanisms. Using differential crosslinking, we confirmed that U1 directly hybridizes to both 5’ splice sites and 5’-splice-site motifs throughout introns and found that Malat1 interacts with pre-mRNAs indirectly through protein intermediates. Interactions with nascent pre-mRNAs cause U1 and Malat1 to localize proximally to chromatin at active genes, demonstrating that ncRNAs can use RNA-RNA interactions to target specific pre-mRNAs and genomic sites. RAP-RNA is sensitive to lower abundance RNAs as well, making it generally applicable for investigating ncRNAs. PMID:25259926

  17. RNA-RNA interactions enable specific targeting of noncoding RNAs to nascent Pre-mRNAs and chromatin sites.

    PubMed

    Engreitz, Jesse M; Sirokman, Klara; McDonel, Patrick; Shishkin, Alexander A; Surka, Christine; Russell, Pamela; Grossman, Sharon R; Chow, Amy Y; Guttman, Mitchell; Lander, Eric S

    2014-09-25

    Intermolecular RNA-RNA interactions are used by many noncoding RNAs (ncRNAs) to achieve their diverse functions. To identify these contacts, we developed a method based on RNA antisense purification to systematically map RNA-RNA interactions (RAP-RNA) and applied it to investigate two ncRNAs implicated in RNA processing: U1 small nuclear RNA, a component of the spliceosome, and Malat1, a large ncRNA that localizes to nuclear speckles. U1 and Malat1 interact with nascent transcripts through distinct targeting mechanisms. Using differential crosslinking, we confirmed that U1 directly hybridizes to 5' splice sites and 5' splice site motifs throughout introns and found that Malat1 interacts with pre-mRNAs indirectly through protein intermediates. Interactions with nascent pre-mRNAs cause U1 and Malat1 to localize proximally to chromatin at active genes, demonstrating that ncRNAs can use RNA-RNA interactions to target specific pre-mRNAs and genomic sites. RAP-RNA is sensitive to lower abundance RNAs as well, making it generally applicable for investigating ncRNAs. PMID:25259926

  18. Structure-Based Identification of Novel Ligands Targeting Multiple Sites within a Chemokine-G-Protein-Coupled-Receptor Interface.

    PubMed

    Smith, Emmanuel W; Nevins, Amanda M; Qiao, Zhen; Liu, Yan; Getschman, Anthony E; Vankayala, Sai L; Kemp, M Trent; Peterson, Francis C; Li, Rongshi; Volkman, Brian F; Chen, Yu

    2016-05-12

    CXCL12 is a human chemokine that recognizes the CXCR4 receptor and is involved in immune responses and metastatic cancer. Interactions between CXCL12 and CXCR4 are an important drug target but, like other elongated protein-protein interfaces, present challenges for small molecule ligand discovery due to the relatively shallow and featureless binding surfaces. Calculations using an NMR complex structure revealed a binding hot spot on CXCL12 that normally interacts with the I4/I6 residues from CXCR4. Virtual screening was performed against the NMR model, and subsequent testing has verified the specific binding of multiple docking hits to this site. Together with our previous results targeting two other binding pockets that recognize sulfotyrosine residues (sY12 and sY21) of CXCR4, including a new analog against the sY12 binding site reported herein, we demonstrate that protein-protein interfaces can often possess multiple sites for engineering specific small molecule ligands that provide lead compounds for subsequent optimization by fragment based approaches. PMID:27058821

  19. Proposal for a unified nomenclature for target-site mutations associated with resistance to fungicides.

    PubMed

    Mair, Wesley; Lopez-Ruiz, Francisco; Stammler, Gerd; Clark, William; Burnett, Fiona; Hollomon, Derek; Ishii, Hideo; Thind, Tarlochan S; Brown, James Km; Fraaije, Bart; Cools, Hans; Shaw, Michael; Fillinger, Sabine; Walker, Anne-Sophie; Mellado, Emilia; Schnabel, Guido; Mehl, Andreas; Oliver, Richard P

    2016-08-01

    Evolved resistance to fungicides is a major problem limiting our ability to control agricultural, medical and veterinary pathogens and is frequently associated with substitutions in the amino acid sequence of the target protein. The convention for describing amino acid substitutions is to cite the wild-type amino acid, the codon number and the new amino acid, using the one-letter amino acid code. It has frequently been observed that orthologous amino acid mutations have been selected in different species by fungicides from the same mode of action class, but the amino acids have different numbers. These differences in numbering arise from the different lengths of the proteins in each species. The purpose of the present paper is to propose a system for unifying the labelling of amino acids in fungicide target proteins. To do this we have produced alignments between fungicide target proteins of relevant species fitted to a well-studied 'archetype' species. Orthologous amino acids in all species are then assigned numerical 'labels' based on the position of the amino acid in the archetype protein. © 2016 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry. PMID:27148866

  20. Target detection and mapping of aquatic hazardous waste sites in Massachusetts Bay utilizing sidescan sonar

    SciTech Connect

    Keith, D.J.; Capone, V.; Cook, G.S.; Casey, D.A.; Wiley, D.N.

    1992-01-01

    The oceans have frequently been used for disposal for a variety of industrial, chemical, and low-level radioactive wastes. In Massachusetts Bay, several areas have been used for the permitted and possible non-permitted disposal of waste containers with environmentally sensitive materials. During the Summer and Fall of 1991, the Industrial Waste Site (IWS) and the Boston Lightship Dumping Ground (BLDG) in Massachusetts Bay were the subject of intensive surveys to determine the areal extent, distribution and location of waste containers.

  1. Small molecule RL71 targets SERCA2 at a novel site in the treatment of human colorectal cancer

    PubMed Central

    Gao, Jian; Li, Jiahuang; Fan, Lu; Xiang, Gang; Wang, Xingqi; Wang, Xiaoning; Wu, Xuefeng; Sun, Yang; Wu, Xudong; Liang, Guang; Shen, Yan; Xu, Qiang

    2015-01-01

    While targeted agents are an important part of the treatment arsenal for colorectal cancer, there is still a lack of efficient small-molecule targeted agents based on the understanding of pathogenic molecular mechanisms. In this study, curcumin analog RL71 displayed potent cytotoxicity towards human colon cancer cells with an IC50 of 0.8 μM in SW480 cells and inhibited xenotransplanted tumor growth in a dose-dependent manner. Using affinity chromatography, we identified sarco/endoplasmic reticulum calcium-ATPase (SERCA) 2 as the binding target of RL71. Most notably, RL71 demonstrated special binding to SERCA2 at a novel site with the lowest estimated free energy −8.89 kcal mol−1, and the SERCA2 residues critical for RL71 binding were identified. RL71 suppressed the Ca2+-ATPase activity of SERCA2 both in vitro and in vivo, accompanied by the induction of endoplasmic reticulum stress leading to apoptosis and G2/M cycle arrest in SW480 cells. In addition, RL71 showed synergistic cytotoxicity with the pan-SERCA inhibitor thapsigargin. These results suggest that RL71 could be a selective small-molecule inhibitor of SERCA2, and that it may serve as a lead compound for the study of targeted colorectal cancer therapy. PMID:26608678

  2. Theoretical and computational modeling of target-site search kinetics in vitro and in vivo.

    PubMed

    Koslover, Elena F; Díaz de la Rosa, Mario A; Spakowitz, Andrew J

    2011-08-17

    Access to genetically encoded data depends on the dynamics of DNA-binding proteins searching for specific target sites in the genome. This search process is thought to occur by facilitated diffusion-a combination of three-dimensional diffusion and one-dimensional sliding. Although facilitated diffusion is capable of significantly speeding up the search in vitro, the importance of this mechanism in vivo remains unclear. We use numeric simulations and analytical theory to model the target-search dynamics of DNA-binding proteins under a wide range of conditions. Our models reproduce experimental measurements of search-rate enhancement within bulk in vitro experiments, as well as the target search time for transcription factors measured in vivo. We find that facilitated diffusion can accelerate the search process only for a limited range of parameters and only under dilute DNA conditions. We address the role of DNA configuration and confinement, demonstrating that facilitated diffusion does not speed up the search on coiled versus straight DNA. Furthermore, we show that, under in vivo conditions, the search process becomes effectively diffusive and is independent of DNA configuration. We believe our results cast in a new light the role of facilitated diffusion in DNA targeting kinetics within the cell. PMID:21843476

  3. Theoretical and Computational Modeling of Target-Site Search Kinetics In Vitro and In Vivo

    PubMed Central

    Koslover, Elena F.; Díaz de la Rosa, Mario A.; Spakowitz, Andrew J.

    2011-01-01

    Access to genetically encoded data depends on the dynamics of DNA-binding proteins searching for specific target sites in the genome. This search process is thought to occur by facilitated diffusion—a combination of three-dimensional diffusion and one-dimensional sliding. Although facilitated diffusion is capable of significantly speeding up the search in vitro, the importance of this mechanism in vivo remains unclear. We use numeric simulations and analytical theory to model the target-search dynamics of DNA-binding proteins under a wide range of conditions. Our models reproduce experimental measurements of search-rate enhancement within bulk in vitro experiments, as well as the target search time for transcription factors measured in vivo. We find that facilitated diffusion can accelerate the search process only for a limited range of parameters and only under dilute DNA conditions. We address the role of DNA configuration and confinement, demonstrating that facilitated diffusion does not speed up the search on coiled versus straight DNA. Furthermore, we show that, under in vivo conditions, the search process becomes effectively diffusive and is independent of DNA configuration. We believe our results cast in a new light the role of facilitated diffusion in DNA targeting kinetics within the cell. PMID:21843476

  4. Physiological screening for target site insensitivity and localization of Na(+)/K(+)-ATPase in cardenolide-adapted Lepidoptera.

    PubMed

    Petschenka, Georg; Offe, Julia K; Dobler, Susanne

    2012-05-01

    Cardenolides are toxic plant compounds which specifically inhibit Na(+)/K(+)-ATPase, an animal enzyme which is essential for many physiological processes, such as the generation of action potentials. Several adapted insects feeding on cardenolide-containing plants sequester these toxins for their own defence. Some of these insects were shown to possess Na(+)/K(+)-ATPases with a reduced sensitivity towards cardenolides (target site insensitivity). In the present study we screened five species of arctiid moths feeding on cardenolide-containing plants for target site insensitivity towards cardenolides using an in vitro enzyme assay. The derived dose response curves of the respective Na(+)/K(+)-ATPases were compared to the insensitive Na(+)/K(+)-ATPase of the monarch butterfly (Danaus plexippus). Na(+)/K(+)-ATPases of all arctiid species tested were highly sensitive to ouabain, a water-soluble cardenolide which is most widely used in laboratory studies. Nevertheless, we detected substantial amounts of cardenolides in the haemolymph of two of the arctiid species. In caterpillars of the sequestering arctiid Empyreuma pugione and of D. plexippus we localized Na(+)/K(+)-ATPase by immunohistochemistry and western blot (in D. plexippus). Both techniques revealed strong expression of the enzyme in the nervous tissue and indicated weak expression or even absence in other tissues tested. We conclude that instead of target site insensitivity the investigated arctiid species use a different strategy to tolerate cardenolides. Most plausibly, the perineurium surrounding the nervous tissue functions as a barrier which prevents cardenolides from reaching Na(+)/K(+)-ATPase in the ventral nerve cord. PMID:22343317

  5. Binding characterization, synthesis and biological evaluation of RXRα antagonists targeting the coactivator binding site.

    PubMed

    Xu, Dingyu; Guo, Shangjie; Chen, Ziwen; Bao, Yuzhou; Huang, Fengyu; Xu, Dan; Zhang, Xindao; Zeng, Zhiping; Zhou, Hu; Zhang, Xiaokun; Su, Ying

    2016-08-15

    Previously we identified the first retinoid X receptor-alpha (RXRα) modulators that regulate the RXRα biological function via binding to the coregulator-binding site. Here we report the characterization of the interactions between the hit molecule and RXRα through computational modeling, mutagenesis, SAR and biological evaluation. In addition, we reported studies of additional new compounds and identified a molecule that mediated the NF-κB pathway by inhibiting the TNFα-induced IκBα degradation and p65 nuclear translocation. PMID:27450787

  6. Tricyclic covalent inhibitors selectively target Jak3 through an active site thiol.

    PubMed

    Goedken, Eric R; Argiriadi, Maria A; Banach, David L; Fiamengo, Bryan A; Foley, Sage E; Frank, Kristine E; George, Jonathan S; Harris, Christopher M; Hobson, Adrian D; Ihle, David C; Marcotte, Douglas; Merta, Philip J; Michalak, Mark E; Murdock, Sara E; Tomlinson, Medha J; Voss, Jeffrey W

    2015-02-20

    The action of Janus kinases (JAKs) is required for multiple cytokine signaling pathways, and as such, JAK inhibitors hold promise for treatment of autoimmune disorders, including rheumatoid arthritis, inflammatory bowel disease, and psoriasis. However, due to high similarity in the active sites of the four members (Jak1, Jak2, Jak3, and Tyk2), developing selective inhibitors within this family is challenging. We have designed and characterized substituted, tricyclic Jak3 inhibitors that selectively avoid inhibition of the other JAKs. This is accomplished through a covalent interaction between an inhibitor containing a terminal electrophile and an active site cysteine (Cys-909). We found that these ATP competitive compounds are irreversible inhibitors of Jak3 enzyme activity in vitro. They possess high selectivity against other kinases and can potently (IC50 < 100 nm) inhibit Jak3 activity in cell-based assays. These results suggest irreversible inhibitors of this class may be useful selective agents, both as tools to probe Jak3 biology and potentially as therapies for autoimmune diseases. PMID:25552479

  7. Tricyclic Covalent Inhibitors Selectively Target Jak3 through an Active Site Thiol*

    PubMed Central

    Goedken, Eric R.; Argiriadi, Maria A.; Banach, David L.; Fiamengo, Bryan A.; Foley, Sage E.; Frank, Kristine E.; George, Jonathan S.; Harris, Christopher M.; Hobson, Adrian D.; Ihle, David C.; Marcotte, Douglas; Merta, Philip J.; Michalak, Mark E.; Murdock, Sara E.; Tomlinson, Medha J.; Voss, Jeffrey W.

    2015-01-01

    The action of Janus kinases (JAKs) is required for multiple cytokine signaling pathways, and as such, JAK inhibitors hold promise for treatment of autoimmune disorders, including rheumatoid arthritis, inflammatory bowel disease, and psoriasis. However, due to high similarity in the active sites of the four members (Jak1, Jak2, Jak3, and Tyk2), developing selective inhibitors within this family is challenging. We have designed and characterized substituted, tricyclic Jak3 inhibitors that selectively avoid inhibition of the other JAKs. This is accomplished through a covalent interaction between an inhibitor containing a terminal electrophile and an active site cysteine (Cys-909). We found that these ATP competitive compounds are irreversible inhibitors of Jak3 enzyme activity in vitro. They possess high selectivity against other kinases and can potently (IC50 < 100 nm) inhibit Jak3 activity in cell-based assays. These results suggest irreversible inhibitors of this class may be useful selective agents, both as tools to probe Jak3 biology and potentially as therapies for autoimmune diseases. PMID:25552479

  8. Covalent Inhibition of Ubc13 Affects Ubiquitin Signaling and Reveals Active Site Elements Important for Targeting

    PubMed Central

    Hodge, Curtis D.; Edwards, Ross A.; Markin, Craig J.; McDonald, Darin; Pulvino, Mary; Huen, Michael S. Y.; Zhao, Jiyong; Spyracopoulos, Leo; Hendzel, Michael J.; Glover, J.N. Mark

    2015-01-01

    Ubc13 is an E2 ubiquitin conjugating enzyme that functions in nuclear DNA damage signaling and cytoplasmic NF-κB signaling. Here we present the structures of complexes of Ubc13 with two inhibitors, NSC697923 and BAY 11-7082, which inhibit DNA damage and NF-κB signaling in human cells. NSC697923 and BAY 11-7082 both inhibit Ubc13 by covalent adduct formation through a Michael addition at the Ubc13 active site cysteine. The resulting adducts of both compounds exploit a binding groove unique to Ubc13. We developed a Ubc13 mutant which resists NSC697923 inhibition and, using this mutant, we show that the inhibition of cellular DNA damage and NF-κB signaling by NSC697923 is largely due to specific Ubc13 inhibition. We propose that unique structural features near the Ubc13 active site could provide a basis for the rational development and design of specific Ubc13 inhibitors. PMID:25909880

  9. Covalent Inhibition of Ubc13 Affects Ubiquitin Signaling and Reveals Active Site Elements Important for Targeting.

    PubMed

    Hodge, Curtis D; Edwards, Ross A; Markin, Craig J; McDonald, Darin; Pulvino, Mary; Huen, Michael S Y; Zhao, Jiyong; Spyracopoulos, Leo; Hendzel, Michael J; Glover, J N Mark

    2015-07-17

    Ubc13 is an E2 ubiquitin conjugating enzyme that functions in nuclear DNA damage signaling and cytoplasmic NF-κB signaling. Here, we present the structures of complexes of Ubc13 with two inhibitors, NSC697923 and BAY 11-7082, which inhibit DNA damage and NF-κB signaling in human cells. NSC697923 and BAY 11-7082 both inhibit Ubc13 by covalent adduct formation through a Michael addition at the Ubc13 active site cysteine. The resulting adducts of both compounds exploit a binding groove unique to Ubc13. We developed a Ubc13 mutant which resists NSC697923 inhibition and, using this mutant, we show that the inhibition of cellular DNA damage and NF-κB signaling by NSC697923 is largely due to specific Ubc13 inhibition. We propose that unique structural features near the Ubc13 active site could provide a basis for the rational development and design of specific Ubc13 inhibitors. PMID:25909880

  10. Targeting of GLUR4-containing AMPA receptors to synaptic sites during in vitro classical conditioning.

    PubMed

    Mokin, M; Keifer, J

    2004-01-01

    The synaptic delivery of GluR4-containing AMPA receptors during in vitro classical conditioning of a neural correlate of an eyeblink response was examined by fluorescence imaging of punctate staining for glutamate receptor subunits and the presynaptic marker synaptophysin. There was a significant increase in GluR4-containing AMPA receptors to synaptic sites after conditioning as determined by colocalization of GluR4 subunit puncta with synaptophysin. Moreover, the trafficking of these receptor subunits requires NMDA receptor activation as it was blocked by D,L-2-amino-5-phosphonovaleric acid (AP-5). In contrast, colocalization of NR1 subunits with synaptophysin was stable regardless of whether the preparations had undergone conditioning or had been treated by AP-5. The enhanced colocalization of GluR4 and synaptophysin was accompanied by an increase in both the total number and size of puncta for both proteins, suggesting greater synthesis and aggregation during conditioning. Western blot analysis confirmed upregulation of synaptophysin and GluR4 following conditioning. These data support the hypothesis that GluR4-containing AMPA receptors are delivered to synaptic sites during conditioning. Further, they suggest coordinate presynaptic and postsynaptic modifications during in vitro classical conditioning. PMID:15350635

  11. Non-catalytic site HIV-1 integrase inhibitors disrupt core maturation and induce a reverse transcription block in target cells.

    PubMed

    Balakrishnan, Mini; Yant, Stephen R; Tsai, Luong; O'Sullivan, Christopher; Bam, Rujuta A; Tsai, Angela; Niedziela-Majka, Anita; Stray, Kirsten M; Sakowicz, Roman; Cihlar, Tomas

    2013-01-01

    HIV-1 integrase (IN) is the target for two classes of antiretrovirals: i) the integrase strand-transfer inhibitors (INSTIs) and ii) the non-catalytic site integrase inhibitors (NCINIs). NCINIs bind at the IN dimer interface and are thought to interfere primarily with viral DNA (vDNA) integration in the target cell by blocking IN-vDNA assembly as well as the IN-LEDGF/p75 interaction. Herein we show that treatment of virus-producing cells, but not of mature virions or target cells, drives NCINI antiviral potency. NCINIs target an essential late-stage event in HIV replication that is insensitive to LEDGF levels in the producer cells. Virus particles produced in the presence of NCINIs displayed normal Gag-Pol processing and endogenous reverse transcriptase activity, but were defective at initiating vDNA synthesis following entry into the target cell. NCINI-resistant virus carrying a T174I mutation in the IN dimer interface was less sensitive to the compound-induced late-stage effects, including the reverse transcription block. Wild-type, but not T174I virus, produced in the presence of NCINIs exhibited striking defects in core morphology and an increased level of IN oligomers that was not observed upon treatment of mature cell-free particles. Collectively, these results reveal that NCINIs act through a novel mechanism that is unrelated to the previously observed inhibition of IN activity or IN-LEDGF interaction, and instead involves the disruption of an IN function during HIV-1 core maturation and assembly. PMID:24040198

  12. Non-Catalytic Site HIV-1 Integrase Inhibitors Disrupt Core Maturation and Induce a Reverse Transcription Block in Target Cells

    PubMed Central

    Tsai, Luong; O’Sullivan, Christopher; Bam, Rujuta A.; Tsai, Angela; Niedziela-Majka, Anita; Stray, Kirsten M.; Sakowicz, Roman; Cihlar, Tomas

    2013-01-01

    HIV-1 integrase (IN) is the target for two classes of antiretrovirals: i) the integrase strand-transfer inhibitors (INSTIs) and ii) the non-catalytic site integrase inhibitors (NCINIs). NCINIs bind at the IN dimer interface and are thought to interfere primarily with viral DNA (vDNA) integration in the target cell by blocking IN-vDNA assembly as well as the IN-LEDGF/p75 interaction. Herein we show that treatment of virus-producing cells, but not of mature virions or target cells, drives NCINI antiviral potency. NCINIs target an essential late-stage event in HIV replication that is insensitive to LEDGF levels in the producer cells. Virus particles produced in the presence of NCINIs displayed normal Gag-Pol processing and endogenous reverse transcriptase activity, but were defective at initiating vDNA synthesis following entry into the target cell. NCINI-resistant virus carrying a T174I mutation in the IN dimer interface was less sensitive to the compound-induced late-stage effects, including the reverse transcription block. Wild-type, but not T174I virus, produced in the presence of NCINIs exhibited striking defects in core morphology and an increased level of IN oligomers that was not observed upon treatment of mature cell-free particles. Collectively, these results reveal that NCINIs act through a novel mechanism that is unrelated to the previously observed inhibition of IN activity or IN-LEDGF interaction, and instead involves the disruption of an IN function during HIV-1 core maturation and assembly. PMID:24040198

  13. Development and Characterization of Novel Site Specific Hollow Floating Microspheres Bearing 5-Fu for Stomach Targeting

    PubMed Central

    Bhardwaj, Peeyush; Singh, Ranjit; Swarup, Anoop

    2014-01-01

    Multiple-unit-type oral floating hollow microspheres of 5-fluorouracil (5-Fu) were developed using modified solvent evaporation technique to prolong gastric residence time, to target stomach cancer, and to increase drug bioavailability. The prepared microspheres were characterized for micromeritic properties, floating behavior, entrapment efficiency, and scanning electron microscopy (SEM). The in vitro drug release and floating behavior were studied in simulated gastric fluid (SGF) at pH 1.2. The yield of microspheres was obtained up to 84.46 ± 6.47%. Microspheres showed passable flow properties. Based on optical microscopy, particle size was found to be ranging from 158.65 ± 12.02 to 198.67 ± 17.45 μm. SEM confirmed spherical size, perforated smooth surface, and a hollow cavity inside the microspheres. Different kinetic models for drug release were also applied on selected batches. PMID:25383377

  14. Site selection and directional models of deserts used for ERBE validation targets

    NASA Technical Reports Server (NTRS)

    Staylor, W. F.

    1986-01-01

    Broadband shortwave and longwave radiance measurements obtained from the Nimbus 7 Earth Radiation Budget scanner were used to develop reflectance and emittance models for the Sahara, Gibson, and Saudi Deserts. These deserts will serve as in-flight validation targets for the Earth Radiation Budget Experiment being flown on the Earth Radiation Budget Satellite and two National Oceanic and Atmospheric Administration polar satellites. The directional reflectance model derived for the deserts was a function of the sum and product of the cosines of the solar and viewing zenith angles, and thus reciprocity existed between these zenith angles. The emittance model was related by a power law of the cosine of the viewing zenith angle.

  15. Design, synthesis and antiviral activity of entry inhibitors that target the CD4-binding site of HIV-1

    PubMed Central

    Curreli, Francesca; Choudhury, Spreeha; Pyatkin, Ilya; Zagorodnikov, Victor P.; Bulay, Anna Khulianova; Altieri, Andrea; Kwon, Young Do; Kwong, Peter D.; Debnath, Asim K.

    2012-01-01

    The CD4 binding site on HIV-1 gp120 has been validated as a drug target to prevent HIV-1 entry to cells. Previously, we identified two small molecule inhibitors consisting of a 2,2,6,6-tetramethylpiperidine ring linked by an oxalamide to a p-halide-substituted phenyl group, which target this site, specifically, a cavity termed “Phe43 cavity”. Here we use synthetic chemistry, functional assessment and structure-based analysis to explore variants of each region of these inhibitors for improved antiviral properties. Alterations of the phenyl group and of the oxalamide linker indicated that these regions were close to optimal in the original lead compounds. Design of a series of compounds, where the tetramethylpiperidine ring was replaced with new scaffolds, lead to improved antiviral activity. These new scaffolds provide insight into the surface chemistry at the entrance of the cavity and offer additional opportunities by which to optimize further these potential-next-generation therapeutics and microbicides against HIV-1. PMID:22524483

  16. Simultaneous detection of pyrethroid, organophosphate, and cyclodiene target site resistance in Haematobia irritans (Diptera: Muscidae) by multiplex polymerase chain reaction.

    PubMed

    Domingues, Luísa N; Guerrero, Felix D; Foil, Lane D

    2014-09-01

    The horn fly, Haematobia irritans irritans (L., 1758) (Diptera: Muscidae), is an important pest that causes significant economic losses to the livestock industry, but insecticide resistance in horn fly populations has made horn fly control increasingly difficult to achieve. In this study, we developed a multiplex polymerase chain reaction (PCR) assay to simultaneously detect target site resistance to pyrethroids (kdr mutation), organophosphates (G262A acetylcholinesterase mutation), and cyclodienes (Rdl mutation) and used the new procedure to follow the progression of these three mutations after exposure to different insecticide pressure. We assayed flies collected at the Macon Ridge research station, Winnsboro, LA, from 2008 to 2012. The multiplex PCR showed robust results in all our assays. The kdr mutation remained at high frequencies during all years, even after 4 yr with no use of pyrethroids. The G262A acetylcholinesterase mutation fluctuated from 7.5 to 23.8% during the studied years, while the Rdl mutation was rare in 2008, 2009, and June 2010, and then significantly increased after the first use of endosulfan. The possibility of screening for all the known target site resistance mutations in a single PCR reaction makes the multiplex PCR a useful and affordable tool that can be used to help diagnose insecticide resistance. PMID:25276924

  17. Novel Phosphorylation Sites in the S. cerevisiae Cdc13 Protein Reveal New Targets for Telomere Length Regulation

    PubMed Central

    Wu, Yun; DiMaggio, Peter A.; Perlman, David H.; Zakian, Virginia A.; Garcia, Benjamin A.

    2013-01-01

    The S. cerevisiae Cdc13 is a multifunctional protein with key roles in regulation of telomerase, telomere end protection, and conventional telomere replication, all of which are cell cycle-regulated processes. Given that phosphorylation is a key mechanism for regulating protein function, we identified sites of phosphorylation using nano liquid chromatography-tandem mass spectrometry (nanoLC-MS/MS). We also determined phosphorylation abundance on both wild type (WT) and a telomerase deficient form of Cdc13, encoded by the cdc13-2 allele, in both G1 phase cells, when telomerase is not active, and G2/M phase cells, when it is. We identified 21 sites of in vivo phosphorylation, of which only five had been reported previously. In contrast, phosphorylation of two in vitro targets of the ATM-like Tel1 kinase, S249 and S255, was not detected. This result helps resolve conflicting data on the importance of phosphorylation of these residues in telomerase recruitment. multiple residues showed differences in their cell cycle pattern of modification. For example, phosphorylation of S314 was significantly higher in the G2/M compared to the G1 phase and in WT versus mutant Cdc13, and a S314D mutation negatively affected telomere length. Our findings provide new targets in a key telomerase regulatory protein for modulation of telomere dynamics. PMID:23181431

  18. Biochemical and behavioral effects of PDE10A inhibitors: Relationship to target site occupancy.

    PubMed

    Li, Yu-Wen; Seager, Matthew A; Wojcik, Trevor; Heman, Karen; Molski, Thaddeus F; Fernandes, Alda; Langdon, Shaun; Pendri, Annapurna; Gerritz, Samuel; Tian, Yuan; Hong, Yang; Gallagher, Lizbeth; Merritt, James R; Zhang, Chongwu; Westphal, Ryan; Zaczek, Robert; Macor, John E; Bronson, Joanne J; Lodge, Nicholas J

    2016-03-01

    Phosphodiesterase 10A (PDE10A) inhibitors increase the functionality of striatal medium spiny neurons and produce antipsychotic-like effects in rodents by blocking PDE10A mediated hydrolysis of cAMP and/or cGMP. In the current study, we characterized a radiolabeled PDE10A inhibitor, [(3)H]BMS-843496, and developed an ex vivo PDE10 binding autoradiographic assay to explore the relationship between PDE10 binding site occupancy and the observed biochemical and behavioral effects of PDE10 inhibitors in mice. [(3)H]BMS-843496 is a potent PDE10A inhibitor with a binding affinity (KD) of 0.15 nM and a functional selectivity of >100-fold over other PDE subtypes tested. Specific [(3)H]BMS-843496 binding sites were dominant in the basal ganglia, especially the striatum, with low to moderate binding in the cortical and hippocampal areas, of the mouse and monkey brain. Systemic administration of PDE10 inhibitors produced a dose- and plasma/brain concentration-dependent increase in PDE10A occupancy measured in the striatum. PDE10A occupancy was positively correlated with striatal pCREB expression levels. PDE10A occupancy was also correlated with antipsychotic-like effects measured using the conditioned avoidance response model; a minimum of ∼40% occupancy was typically required to achieve efficacy. In contrast, a clear relationship between PDE10A occupancy and catalepsy scores, a potential extrapyramidal symptom readout in rodent, was not evident. PMID:26522433

  19. Influence of Quasi-Specific Sites on Kinetics of Target DNA Search by a Sequence-Specific DNA-Binding Protein

    PubMed Central

    2015-01-01

    Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such “quasi-specific” sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1’s association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins. PMID:26502071

  20. Science Targets in the Landing Ellipse and Lower Mound at the Gale Crater Field Site

    NASA Astrophysics Data System (ADS)

    Anderson, R. B.; Bell, J. F.

    2011-12-01

    The Mars Science Laboratory (MSL) rover Curiosity will land at the ~155 km diameter Gale Crater (4.6°S 137.2°E) in early August of 2012. The landing ellipse is centered in the northwestern floor of the crater on an alluvial fan composed of material from the crater rim. MSL will sample this material and test the hypothesis that the fan was deposited by flowing liquid water, and then drive south toward the base of the >5km tall central mound of layered rocks. Along this traverse, the smooth, low-thermal-inertia surface of the alluvial fan transitions to a fractured, layered, and spectrally neutral high thermal inertia unit. MSL will be able to assess the interpretation of this unit as cemented alluvial material and determine the cementing agent. Fresh craters in the high thermal inertia unit are important targets for MSL because their ejecta has had less exposure to the harsh radiation environment of the surface which can destroy biomarkers. Continuing south, MSL will descend across a short scarp where the units of the crater floor have eroded to expose the underlying basal unit of the mound. This erosion has formed ridged mesas interpreted to be lithified aeolian bedforms that are part of a widespread "mound-skirting" unit. MSL will test the hypothesis that this unit comprises debris shed from the mound during an early stage of erosion. The heavily fractured basal unit is partially obscured by relatively young mafic dunes, which will provide information about modern aeolian processes on Mars. After analyzing the basal unit and the dunes, MSL will begin climbing the layered rocks of the mound, beginning with a light-toned ridge which shows spectral evidence of hydrated sulfates. Beyond this ridge, the rover will encounter a phyllosilicate-bearing surface exposed in a trough paralleling the ridge. These lower mound layers are the primary targets of the MSL traverse. MSL will test the hypothesis that the lower mound sediments were deposited in a lacustrine setting

  1. Opioids and TRPV1 in the peripheral control of neuropathic pain--Defining a target site in the injured nerve.

    PubMed

    Labuz, Dominika; Spahn, Viola; Celik, Melih Özgür; Machelska, Halina

    2016-02-01

    Targeting peripheral neuropathic pain at its origin may prevent the development of hypersensitivity. Recently we showed this can be mediated by opioid receptors at the injured nerve trunk. Here, we searched for the most relevant peripheral site to block transient receptor potential vanilloid 1 (TRPV1), and investigated analgesic interactions between TRPV1 and opioids in neuropathy. In a chronic constriction injury (CCI) of the sciatic nerve in mice, we assessed the effects of μ-, δ- and κ-opioid receptor agonists and TRPV1 antagonist (SB366791) injected at the CCI site or into the injured nerve-innervated paw on spontaneous paw lifting, heat and mechanical sensitivity. We also examined TRPV1 expression in total membrane and plasma membrane fractions from nerves and paws. We found that opioids and SB366791 co-injected in per se nonanalgesic doses at the CCI site or into the paw diminished heat and mechanical sensitivity. SB366791 alone dose-dependently alleviated heat and mechanical sensitivity. TRPV1 blockade in the paw was more effective than at the CCI site. None of the treatments diminished spontaneous paw lifting. TRPV1 expression analysis suggests that the levels of functional TRPV1 do not critically determine the TRPV1 antagonist-mediated analgesia. Together, the identification of the primary action site in damaged nerves is crucial for effective pain control. Contrary to opioids, the TRPV1 blockade in the injured nerve peripheral terminals, rather than at the nerve trunk, appears promising against heat pain. Opioid/TRPV1 antagonist combinations at both locations partially reduced neuropathy-triggered heat and mechanical pain. PMID:26453963

  2. Internal Ribosome Entry Site-Based Bicistronic In Situ Reporter Assays for Discovery of Transcription-Targeted Lead Compounds.

    PubMed

    Lang, Liwei; Ding, Han-Fei; Chen, Xiaoguang; Sun, Shi-Yong; Liu, Gang; Yan, Chunhong

    2015-07-23

    Although transgene-based reporter gene assays have been used to discover small molecules targeting expression of cancer-driving genes, the success is limited due to the fact that reporter gene expression regulated by incomplete cis-acting elements and foreign epigenetic environments does not faithfully reproduce chemical responses of endogenous genes. Here, we present an internal ribosome entry site-based strategy for bicistronically co-expressing reporter genes with an endogenous gene in the native gene locus, yielding an in situ reporter assay closely mimicking endogenous gene expression without disintegrating its function. This strategy combines the CRISPR-Cas9-mediated genome-editing tool with the recombinase-mediated cassette-exchange technology, and allows for rapid development of orthogonal assays for excluding false hits generated from primary screens. We validated this strategy by developing a screening platform for identifying compounds targeting oncogenic eIF4E, and demonstrated that the novel reporter assays are powerful in searching for transcription-targeted lead compounds with high confidence. PMID:26144883

  3. An Effective Molecular Target Site in Hepatitis B Virus S Gene for Cas9 Cleavage and Mutational Inactivation

    PubMed Central

    Li, Hao; Sheng, Chunyu; Liu, Hongbo; Liu, Guangze; Du, Xinying; Du, Juan; Zhan, Linsheng; Li, Peng; Yang, Chaojie; Qi, Lihua; Wang, Jian; Yang, Xiaoxia; Jia, Leili; Xie, Jing; Wang, Ligui; Hao, Rongzhang; Xu, Dongping; Tong, Yigang; Zhou, Yusen; Zhou, Jianjun; Sun, Yansong; Li, Qiao; Qiu, Shaofu; Song, Hongbin

    2016-01-01

    Chronic hepatitis B infection remains incurable because HBV cccDNA can persist indefinitely in patients recovering from acute HBV infection. Given the incidence of HBV infection and the shortcomings of current therapeutic options, a novel antiviral strategy is urgently needed. To inactivate HBV replication and destroy the HBV genome, we employed genome editing tool CRISPR/Cas9. Specifically, we found a CRISPR/Cas9 system (gRNA-S4) that effectively targeted the HBsAg region and could suppress efficiently viral replication with minimal off-target effects and impact on cell viability. The mutation mediated by CRISPR/Cas9 in HBV DNA both in a stable HBV-producing cell line and in HBV transgenic mice had been confirmed and evaluated using deep sequencing. In addition, we demonstrated the reduction of HBV replication was caused by the mutation of S4 site through three S4 region-mutated monoclonal cells. Besides, the gRNA-S4 system could also reduce serum surface-antigen levels by 99.91 ± 0.05% and lowered serum HBV DNA level below the negative threshold in the HBV hydrodynamics mouse model. Together, these findings indicate that the S4 region may be an ideal target for the development of innovative therapies against HBV infection using CRISPR/Cas9. PMID:27570484

  4. An Effective Molecular Target Site in Hepatitis B Virus S Gene for Cas9 Cleavage and Mutational Inactivation.

    PubMed

    Li, Hao; Sheng, Chunyu; Liu, Hongbo; Liu, Guangze; Du, Xinying; Du, Juan; Zhan, Linsheng; Li, Peng; Yang, Chaojie; Qi, Lihua; Wang, Jian; Yang, Xiaoxia; Jia, Leili; Xie, Jing; Wang, Ligui; Hao, Rongzhang; Xu, Dongping; Tong, Yigang; Zhou, Yusen; Zhou, Jianjun; Sun, Yansong; Li, Qiao; Qiu, Shaofu; Song, Hongbin

    2016-01-01

    Chronic hepatitis B infection remains incurable because HBV cccDNA can persist indefinitely in patients recovering from acute HBV infection. Given the incidence of HBV infection and the shortcomings of current therapeutic options, a novel antiviral strategy is urgently needed. To inactivate HBV replication and destroy the HBV genome, we employed genome editing tool CRISPR/Cas9. Specifically, we found a CRISPR/Cas9 system (gRNA-S4) that effectively targeted the HBsAg region and could suppress efficiently viral replication with minimal off-target effects and impact on cell viability. The mutation mediated by CRISPR/Cas9 in HBV DNA both in a stable HBV-producing cell line and in HBV transgenic mice had been confirmed and evaluated using deep sequencing. In addition, we demonstrated the reduction of HBV replication was caused by the mutation of S4 site through three S4 region-mutated monoclonal cells. Besides, the gRNA-S4 system could also reduce serum surface-antigen levels by 99.91 ± 0.05% and lowered serum HBV DNA level below the negative threshold in the HBV hydrodynamics mouse model. Together, these findings indicate that the S4 region may be an ideal target for the development of innovative therapies against HBV infection using CRISPR/Cas9. PMID:27570484

  5. Site-directed point mutations in embryonic stem cells: a gene-targeting tag-and-exchange strategy.

    PubMed Central

    Askew, G R; Doetschman, T; Lingrel, J B

    1993-01-01

    Sequential gene targeting was used to introduce point mutations into one alpha 2 isoform Na,K-ATPase homolog in mouse embryonic stem (ES) cells. In the first round of targeted replacement, the gene was tagged with selectable markers by insertion of a Neor/HSV-tk gene cassette, and this event was selected for by gain of neomycin (G418) resistance. In the second targeted replacement event, the tagged genomic sequence was exchanged with a vector consisting of homologous genomic sequences carrying five site-directed nucleotide substitutions. Embryonic stem cell clones modified by exchange with the mutation vector were selected for loss of the HSV-tk gene by resistance to ganciclovir. Candidate clones were further screened and identified by polymerase chain reaction and Southern blot analysis. By this strategy, the endogenous alpha 2 isoform Na,K-ATPase gene was altered to encode two other amino acids so that the enzyme is resistant to inhibition by cardiac glycosides while maintaining its transmembrane ion-pumping function. Since the initial tagging event and the subsequent mutation-exchange event are independent of one another, a tagged cell line can be used to generate a variety of mutant lines by exchange with various mutation vectors at the tagged locus. This method should be useful for testing specific mutations introduced into the genomes of tissue culture cells and animals and for developing animal models encompassing the mutational variability of known genetic disorders. Images PMID:8391633

  6. Controllable Microfluidic Synthesis of Multiphase Drug-Carrying Lipospheres for Site-Targeted Therapy

    PubMed Central

    Hettiarachchi, Kanaka; Feingold, Steven; Zhang, Shirley; Lee, Abraham P.; Dayton, Paul A.

    2009-01-01

    We report the production of micrometer-sized gas-filled lipospheres using digital microfluidics technology for chemotherapeutic drug delivery. Advantages of on-chip synthesis include a monodisperse size distribution (polydispersity index (σ) values of <5%) with consistent stability and uniform drug loading. Photolithography techniques are applied to fabricate novel PDMS-based microfluidic devices that feature a combined dual hydrodynamic flow-focusing region and expanding nozzle geometry with a narrow orifice. Spherical vehicles are formed through flow-focusing by the self-assembly of phospholipids to a lipid layer around the gas core, followed by a shear-induced break off at the orifice. The encapsulation of an extra oil layer between the outer lipid shell and inner bubble gaseous core allows the safe transport of highly hydrophobic and toxic drugs at high concentrations. Doxorubicin (Dox) entrapment is estimated at 15 mg mL−1 of particles packed in a single ordered layer. In addition, the attachment of targeting ligands to the lipid shell allows for direct vehicle binding to cancer cells. Preliminary acoustic studies of these monodisperse gas lipospheres reveal a highly uniform echo correlation of greater than 95%. The potential exists for localized drug concentration and release with ultrasound energy. PMID:19455647

  7. Prospective Single-Site Experience with Radiofrequency-Targeted Vertebral Augmentation for Osteoporotic Vertebral Compression Fracture

    PubMed Central

    Moser, Franklin G.; Maya, Marcel M.; Blaszkiewicz, Laura; Scicli, Andrea; Miller, Larry E.; Block, Jon E.

    2013-01-01

    Vertebral augmentation procedures are widely used to treat osteoporotic vertebral compression fractures (VCFs). We report our initial experience with radiofrequency-targeted vertebral augmentation (RF-TVA) in 20 patients aged 50 to 90 years with single-level, symptomatic osteoporotic VCF between T10 and L5, back pain severity > 4 on a 0 to 10 scale, Oswestry Disability Index ≥ 21%, 20% to 90% vertebral height loss compared to adjacent vertebral body, and fracture age < 6 months. After treatment, patients were followed through hospital discharge and returned for visits after 1 week, 1 month, and 3 months. Back pain severity improved 66% (P < 0.001), from 7.9 (95% CI: 7.1 to 8.6) at pretreatment to 2.7 (95% CI: 1.5 to 4.0) at 3 months. Back function improved 46% (P < 0.001), from 74 (95% CI: 69% to 79%) at pretreatment to 40 (95% CI: 33% to 47%) at 3 months. The percentage of patients regularly consuming pain medication was 70% at pretreatment and only 21% at 3 months. No adverse events related to the device or procedure were reported. RF-TVA reduces back pain severity, improves back function, and reduces pain medication requirements with no observed complications in patients with osteoporotic VCF. PMID:24228187

  8. Impact of Antibiotics with Various Target Sites on the Metabolome of Staphylococcus aureus

    PubMed Central

    Dörries, Kirsten; Schlueter, Rabea

    2014-01-01

    In this study, global intra- and extracellular metabolic profiles were exploited to investigate the impact of antibiotic compounds with different cellular targets on the metabolome of Staphylococcus aureus HG001. Primary metabolism was largely covered, yet uncommon staphylococcal metabolites were detected in the cytosol of S. aureus, including sedoheptulose-1,7-bisphosphate and the UDP-MurNAc-pentapeptide with an alanine-seryl residue. By comparing the metabolic profiles of unstressed and stressed staphylococcal cells in a time-dependent manner, we found far-ranging effects within the metabolome. For each antibiotic compound, accumulation as well as depletion of metabolites was detected, often comprising whole biosynthetic pathways, such as central carbon and amino acid metabolism and peptidoglycan, purine, and pyrimidine synthesis. Ciprofloxacin altered the pool of (deoxy)nucleotides as well as peptidoglycan precursors, thus linking stalled DNA and cell wall synthesis. Erythromycin tended to increase the amounts of intermediates of the pentose phosphate pathway and lysine. Fosfomycin inhibited the first enzymatic step of peptidoglycan synthesis, which was followed by decreased levels of peptidoglycan precursors but enhanced levels of substrates such as UDP-GlcNAc and alanine-alanine. In contrast, vancomycin and ampicillin inhibited the last stage of peptidoglycan construction on the outer cell surface. As a result, the amounts of UDP-MurNAc-peptides drastically increased, resulting in morphological alterations in the septal region and in an overall decrease in central metabolite levels. Moreover, each antibiotic affected intracellular levels of tricarboxylic acid cycle intermediates. PMID:25224006

  9. NF-Y Binding Site Architecture Defines a C-Fos Targeted Promoter Class

    PubMed Central

    Haubrock, Martin; Hartmann, Fabian; Wingender, Edgar

    2016-01-01

    ChIP-seq experiments detect the chromatin occupancy of known transcription factors in a genome-wide fashion. The comparisons of several species-specific ChIP-seq libraries done for different transcription factors have revealed a complex combinatorial and context-specific co-localization behavior for the identified binding regions. In this study we have investigated human derived ChIP-seq data to identify common cis-regulatory principles for the human transcription factor c-Fos. We found that in four different cell lines, c-Fos targeted proximal and distal genomic intervals show prevalences for either AP-1 motifs or CCAAT boxes as known binding motifs for the transcription factor NF-Y, and thereby act in a mutually exclusive manner. For proximal regions of co-localized c-Fos and NF-YB binding, we gathered evidence that a characteristic configuration of repeating CCAAT motifs may be responsible for attracting c-Fos, probably provided by a nearby AP-1 bound enhancer. Our results suggest a novel regulatory function of NF-Y in gene-proximal regions. Specific CCAAT dimer repeats bound by the transcription factor NF-Y define this novel cis-regulatory module. Based on this behavior we propose a new enhancer promoter interaction model based on AP-1 motif defined enhancers which interact with CCAAT-box characterized promoter regions. PMID:27517874

  10. CID Aircraft in practice flight above target impact site with wing cutters

    NASA Technical Reports Server (NTRS)

    1984-01-01

    In this photograph the B-720 is seen making a practice close approach over the prepared impact site. The wing openers, designed to tear open the wings and spill the fuel, are clearly seen on the ground just at the start of the bed of rocks. In a typical aircraft crash, fuel spilled from ruptured fuel tanks forms a fine mist that can be ignited by a number of sources at the crash site. In 1984 the NASA Dryden Flight Research Facility (after 1994 a full-fledged Center again) and the Federal Aviation Administration (FAA) teamed-up in a unique flight experiment called the Controlled Impact Demonstration (CID), to test crash a Boeing 720 aircraft using standard fuel with an additive designed to supress fire. The additive, FM-9, a high-molecular-weight long-chain polymer, when blended with Jet-A fuel had demonstrated the capability to inhibit ignition and flame propagation of the released fuel in simulated crash tests. This anti-misting kerosene (AMK) cannot be introduced directly into a gas turbine engine due to several possible problems such as clogging of filters. The AMK must be restored to almost Jet-A before being introduced into the engine for burning. This restoration is called 'degradation' and was accomplished on the B-720 using a device called a 'degrader.' Each of the four Pratt & Whitney JT3C-7 engines had a 'degrader' built and installed by General Electric (GE) to break down and return the AMK to near Jet-A quality. In addition to the AMK research the NASA Langley Research Center was involved in a structural loads measurement experiment, which included having instrumented dummies filling the seats in the passenger compartment. Before the final flight on December 1, 1984, more than four years of effort passed trying to set-up final impact conditions considered survivable by the FAA. During those years while 14 flights with crews were flown the following major efforts were underway: NASA Dryden developed the remote piloting techniques necessary for the B-720

  11. The Groucho Co-repressor Is Primarily Recruited to Local Target Sites in Active Chromatin to Attenuate Transcription

    PubMed Central

    Jennings, Barbara H.

    2014-01-01

    Gene expression is regulated by the complex interaction between transcriptional activators and repressors, which function in part by recruiting histone-modifying enzymes to control accessibility of DNA to RNA polymerase. The evolutionarily conserved family of Groucho/Transducin-Like Enhancer of split (Gro/TLE) proteins act as co-repressors for numerous transcription factors. Gro/TLE proteins act in several key pathways during development (including Notch and Wnt signaling), and are implicated in the pathogenesis of several human cancers. Gro/TLE proteins form oligomers and it has been proposed that their ability to exert long-range repression on target genes involves oligomerization over broad regions of chromatin. However, analysis of an endogenous gro mutation in Drosophila revealed that oligomerization of Gro is not always obligatory for repression in vivo. We have used chromatin immunoprecipitation followed by DNA sequencing (ChIP-seq) to profile Gro recruitment in two Drosophila cell lines. We find that Gro predominantly binds at discrete peaks (<1 kilobase). We also demonstrate that blocking Gro oligomerization does not reduce peak width as would be expected if Gro oligomerization induced spreading along the chromatin from the site of recruitment. Gro recruitment is enriched in “active” chromatin containing developmentally regulated genes. However, Gro binding is associated with local regions containing hypoacetylated histones H3 and H4, which is indicative of chromatin that is not fully open for efficient transcription. We also find that peaks of Gro binding frequently overlap the transcription start sites of expressed genes that exhibit strong RNA polymerase pausing and that depletion of Gro leads to release of polymerase pausing and increased transcription at a bona fide target gene. Our results demonstrate that Gro is recruited to local sites by transcription factors to attenuate rather than silence gene expression by promoting histone deacetylation

  12. Rad54B targeting to DNA double-strand break repair sites requires complex formation with S100A11.

    PubMed

    Murzik, Ulrike; Hemmerich, Peter; Weidtkamp-Peters, Stefanie; Ulbricht, Tobias; Bussen, Wendy; Hentschel, Julia; von Eggeling, Ferdinand; Melle, Christian

    2008-07-01

    S100A11 is involved in a variety of intracellular activities such as growth regulation and differentiation. To gain more insight into the physiological role of endogenously expressed S100A11, we used a proteomic approach to detect and identify interacting proteins in vivo. Hereby, we were able to detect a specific interaction between S100A11 and Rad54B, which could be confirmed under in vivo conditions. Rad54B, a DNA-dependent ATPase, is described to be involved in recombinational repair of DNA damage, including DNA double-strand breaks (DSBs). Treatment with bleomycin, which induces DSBs, revealed an increase in the degree of colocalization between S100A11 and Rad54B. Furthermore, S100A11/Rad54B foci are spatially associated with sites of DNA DSB repair. Furthermore, while the expression of p21(WAF1/CIP1) was increased in parallel with DNA damage, its protein level was drastically down-regulated in damaged cells after S100A11 knockdown. Down-regulation of S100A11 by RNA interference also abolished Rad54B targeting to DSBs. Additionally, S100A11 down-regulated HaCaT cells showed a restricted proliferation capacity and an increase of the apoptotic cell fraction. These observations suggest that S100A11 targets Rad54B to sites of DNA DSB repair sites and identify a novel function for S100A11 in p21-based regulation of cell cycle. PMID:18463164

  13. Rad54B Targeting to DNA Double-Strand Break Repair Sites Requires Complex Formation with S100A11

    PubMed Central

    Murzik, Ulrike; Hemmerich, Peter; Weidtkamp-Peters, Stefanie; Ulbricht, Tobias; Bussen, Wendy; Hentschel, Julia; von Eggeling, Ferdinand

    2008-01-01

    S100A11 is involved in a variety of intracellular activities such as growth regulation and differentiation. To gain more insight into the physiological role of endogenously expressed S100A11, we used a proteomic approach to detect and identify interacting proteins in vivo. Hereby, we were able to detect a specific interaction between S100A11 and Rad54B, which could be confirmed under in vivo conditions. Rad54B, a DNA-dependent ATPase, is described to be involved in recombinational repair of DNA damage, including DNA double-strand breaks (DSBs). Treatment with bleomycin, which induces DSBs, revealed an increase in the degree of colocalization between S100A11 and Rad54B. Furthermore, S100A11/Rad54B foci are spatially associated with sites of DNA DSB repair. Furthermore, while the expression of p21WAF1/CIP1 was increased in parallel with DNA damage, its protein level was drastically down-regulated in damaged cells after S100A11 knockdown. Down-regulation of S100A11 by RNA interference also abolished Rad54B targeting to DSBs. Additionally, S100A11 down-regulated HaCaT cells showed a restricted proliferation capacity and an increase of the apoptotic cell fraction. These observations suggest that S100A11 targets Rad54B to sites of DNA DSB repair sites and identify a novel function for S100A11 in p21-based regulation of cell cycle. PMID:18463164

  14. A CXCR4-targeted site-specific antibody-drug conjugate.

    PubMed

    Kularatne, Sumith A; Deshmukh, Vishal; Ma, Jennifer; Tardif, Virginie; Lim, Reyna K V; Pugh, Holly M; Sun, Ying; Manibusan, Anthony; Sellers, Aaron J; Barnett, Richard S; Srinagesh, Shailaja; Forsyth, Jane S; Hassenpflug, Wolf; Tian, Feng; Javahishvili, Tsotne; Felding-Habermann, Brunhilde; Lawson, Brian R; Kazane, Stephanie A; Schultz, Peter G

    2014-10-27

    A chemically defined anti-CXCR4-auristatin antibody-drug conjugate (ADC) was synthesized that selectively eliminates tumor cells overexpressing the CXCR4 receptor. The unnatural amino acid p-acetylphenylalanine (pAcF) was site-specifically incorporated into an anti-CXCR4 immunoglobulin G (IgG) and conjugated to an auristatin through a stable, non-cleavable oxime linkage to afford a chemically homogeneous ADC. The full-length anti-CXCR4 ADC was selectively cytotoxic to CXCR4(+) cancer cells in vitro (half maximal effective concentration (EC50 )≈80-100 pM). Moreover, the anti-CXCR4 ADC eliminated pulmonary lesions from human osteosarcoma cells in a lung-seeding tumor model in mice. No significant overt toxicity was observed but there was a modest decrease in the bone-marrow-derived CXCR4(+) cell population. Because CXCR4 is highly expressed in a majority of metastatic cancers, a CXCR4-auristatin ADC may be useful for the treatment of a variety of metastatic malignancies. PMID:25213874

  15. Brain stem as a target site for the metabolic side effects of olanzapine.

    PubMed

    Anwar, Imran J; Miyata, Kayoko; Zsombok, Andrea

    2016-03-01

    Olanzapine, an atypical antipsychotic, is widely prescribed for the treatment of schizophrenia and bipolar disorder despite causing undesirable metabolic side effects. A variety of mechanisms and brain sites have been proposed as contributors to the side effects; however, the role of the dorsal motor nucleus of the vagus nerve (DMV), which plays a crucial role in the regulation of subdiaphragmatic organs and thus governs energy and glucose homeostasis, is largely unknown. Identifying the effect of olanzapine on the excitability of DMV neurons in both sexes is thus crucial to understanding possible underlying mechanisms. Whole cell patch-clamp electrophysiological recordings were conducted in stomach- and liver-related DMV neurons identified with retrograde viral tracers and in random DMV neurons. The effect of olanzapine on the neuronal excitability of DMV neurons both in male and female mice was established. Our data demonstrate that olanzapine hyperpolarizes the DMV neurons in both sexes and this effect is reversible. The hyperpolarization is associated with decreased firing rate and input resistance. Olanzapine also decreases the excitability of a subset of stomach- and liver-related DMV neurons. Our study demonstrates that olanzapine has a powerful effect on DMV neurons in both sexes, indicating its ability to reduce vagal output to the subdiaphragmatic organs, which likely contributes to the metabolic side effects observed in both humans and experimental models. These findings suggest that the metabolic side effects of olanzapine may partially originate in the DMV. PMID:26719086

  16. Escherichia coli flagellar genes as target sites for integration and expression of genetic circuits.

    PubMed

    Juhas, Mario; Evans, Lewis D B; Frost, Joe; Davenport, Peter W; Yarkoni, Orr; Fraser, Gillian M; Ajioka, James W

    2014-01-01

    E. coli is a model platform for engineering microbes, so genetic circuit design and analysis will be greatly facilitated by simple and effective approaches to introduce genetic constructs into the E. coli chromosome at well-characterised loci. We combined the Red recombinase system of bacteriophage λ and Isothermal Gibson Assembly for rapid integration of novel DNA constructs into the E. coli chromosome. We identified the flagellar region as a promising region for integration and expression of genetic circuits. We characterised integration and expression at four candidate loci, fliD, fliS, fliT, and fliY, of the E. coli flagellar region 3a. The integration efficiency and expression from the four integrations varied considerably. Integration into fliD and fliS significantly decreased motility, while integration into fliT and fliY had only a minor effect on the motility. None of the integrations had negative effects on the growth of the bacteria. Overall, we found that fliT was the most suitable integration site. PMID:25350000

  17. Escherichia coli Flagellar Genes as Target Sites for Integration and Expression of Genetic Circuits

    PubMed Central

    Juhas, Mario; Evans, Lewis D. B.; Frost, Joe; Davenport, Peter W.; Yarkoni, Orr; Fraser, Gillian M.; Ajioka, James W.

    2014-01-01

    E. coli is a model platform for engineering microbes, so genetic circuit design and analysis will be greatly facilitated by simple and effective approaches to introduce genetic constructs into the E. coli chromosome at well-characterised loci. We combined the Red recombinase system of bacteriophage λ and Isothermal Gibson Assembly for rapid integration of novel DNA constructs into the E. coli chromosome. We identified the flagellar region as a promising region for integration and expression of genetic circuits. We characterised integration and expression at four candidate loci, fliD, fliS, fliT, and fliY, of the E. coli flagellar region 3a. The integration efficiency and expression from the four integrations varied considerably. Integration into fliD and fliS significantly decreased motility, while integration into fliT and fliY had only a minor effect on the motility. None of the integrations had negative effects on the growth of the bacteria. Overall, we found that fliT was the most suitable integration site. PMID:25350000

  18. Rictor Phosphorylation on the THR-1135 Site Does Not Require Mammalian Target of Rapamycin Complex 2

    PubMed Central

    Boulbes, Delphine; Chen, Chien-Hung; Shaikenov, Tattym; Agarwal, Nitin K.; Peterson, Timothy R.; Addona, Terri A.; Keshishian, Hasmik; Carr, Steven A.; Magnuson, Mark A.; Sabatini, David M.; Sarbassov, Dos D.

    2010-01-01

    In animal cells growth factors coordinate cell proliferation and survival by regulating the PI3K/Akt signaling pathway. Deregulation of this signaling pathway is common in a variety of human cancers. The PI3K dependent signaling kinase complex defined as mTORC2 functions as a regulatory Ser-473 kinase of Akt. We find that activation of mTORC2 by growth factor signaling is linked to the specific phosphorylation of its component rictor on Thr-1135. The phosphorylation of this site is induced by the growth factor stimulation and expression of the oncogenic forms of ras or PI3K. Rictor phosphorylation is sensitive to inhibition of PI3K, mTOR, or expression of ILK. The substitution of wild-type rictor with its specific phospho-mutants in rictor null mouse embryonic fibroblasts did not alter the growth factor-dependent phosphorylation of Akt indicating that the rictor Thr-1135 phosphorylation is not critical in regulation of the mTORC2 kinase activity. We found that this rictor phosphorylation takes place in the mTORC2-deficient cells suggesting that this modification might play a role in regulation not only mTORC2 but also the mTORC2-independent function of rictor. PMID:20501647

  19. Phage-displayed peptide targeting on the Puumala hantavirus neutralization site.

    PubMed Central

    Heiskanen, T; Lundkvist, A; Vaheri, A; Lankinen, H

    1997-01-01

    We have selected ligands for Puumala hantavirus, the causative agent of nephropathia epidemica, from a seven-amino-acid peptide library flanked by cysteines and displayed on a filamentous phage. To direct the selection to areas on the virus particle which are essential for infection, phages were competitively eluted with neutralizing monoclonal antibodies specific for the viral glycoproteins. The selected phage populations were specific for the same sites as the antibodies and mimicked their functions. The peptide insert, CHWMFSPWC, when displayed on the phages, completely inhibited Puumala virus infection in cell culture at the same effective concentration as the eluting antibody specific for envelope glycoprotein G2. The binding of the phage clones to the virus and inhibition of infection were not necessarily coincident; Pro-6 was critical for virus inhibition, while consensus residues Trp-2 and Phe-4 were essential for binding. The strategy described can be applied to any virus for production of molecules mimicking the effect of neutralizing antibodies. PMID:9094664

  20. Identification of polymorphic and off-target probe binding sites on the Illumina Infinium MethylationEPIC BeadChip.

    PubMed

    McCartney, Daniel L; Walker, Rosie M; Morris, Stewart W; McIntosh, Andrew M; Porteous, David J; Evans, Kathryn L

    2016-09-01

    Genome-wide analysis of DNA methylation has now become a relatively inexpensive technique thanks to array-based methylation profiling technologies. The recently developed Illumina Infinium MethylationEPIC BeadChip interrogates methylation at over 850,000 sites across the human genome, covering 99% of RefSeq genes. This array supersedes the widely used Infinium HumanMethylation450 BeadChip, which has permitted insights into the relationship between DNA methylation and a wide range of conditions and traits. Previous research has identified issues with certain probes on both the HumanMethylation450 BeadChip and its predecessor, the Infinium HumanMethylation27 BeadChip, which were predicted to affect array performance. These issues concerned probe-binding specificity and the presence of polymorphisms at target sites. Using in silico methods, we have identified probes on the Infinium MethylationEPIC BeadChip that are predicted to (i) measure methylation at polymorphic sites and (ii) hybridise to multiple genomic regions. We intend these resources to be used for quality control procedures when analysing data derived from this platform. PMID:27330998

  1. Contact Bioassays with Phenoxybenzyl and Tetrafluorobenzyl Pyrethroids against Target-Site and Metabolic Resistant Mosquitoes

    PubMed Central

    Horstmann, Sebastian; Sonneck, Rainer

    2016-01-01

    Background Mosquito strains that exhibit increased tolerance to the chemical class of compounds with a sodium channel modulator mode of action (pyrethroids and pyrethrins) are typically described as “pyrethroid resistant”. Resistance to pyrethroids is an increasingly important challenge in the control of mosquito-borne diseases, such as malaria or dengue, because one of the main interventions (the distribution of large numbers of long-lasting insecticide-treated bed nets) currently relies entirely on long-lasting pyrethroids. Increasing tolerance of target insects against this class of insecticides lowers their impact in vector control. The current study suggests that the level of metabolic resistance depends on the structure of the molecule and that structurally different compounds may still be effective because detoxifying enzymes are unable to bind to these uncommon structures. Methods Treated surface contact bioassays were performed on susceptible Aedes aegypti, East African knockdown resistance (kdr) Anopheles gambiae (strain RSP-H) and metabolically resistant Anopheles funestus (strain FUMOZ-R) with different pyrethroids, such as cypermethrin, ß-cyfluthrin, deltamethrin, permethrin and transfluthrin (alone and in combination with the synergist piperonyl butoxide). The nonfluorinated form of transfluthrin was also assessed as a single agent and in combination with piperonyl butoxide. Results Although the dosages for pyrethroids containing a phenoxybenzyl moiety have exhibited differences in terms of effectiveness among the three tested mosquito species, the structurally different transfluthrin with a polyfluorobenzyl moiety remained active in mosquitoes with upregulated P450 levels. In trials with transfluthrin mixed with piperonyl butoxide, the added synergist exhibited no efficacy-enhancing effect. Conclusion The results of this study suggest that transfluthrin has the potential to control P450-mediated metabolically resistant mosquitoes because the

  2. Probing the molecular dimensions of general anaesthetic target sites in tadpoles (Xenopus laevis) and model systems using cycloalcohols.

    PubMed Central

    Curry, S.; Moss, G. W.; Dickinson, R.; Lieb, W. R.; Franks, N. P.

    1991-01-01

    1. The series of cycloalcohols C6, C7, C8 and C10 have been used to probe the molecular dimensions of a variety of general anaesthetic target sites. 2. The general anaesthetic EC50 concentrations of the cycloalcohols were determined for tadpoles (Xenopus laevis). All of the cycloalcohols tested were found to be potent general anaesthetics (on average EC50/Csat = 0.03). 3. The effects of the cycloalcohols on highly purified luciferase enzymes from fireflies (Photinus pyralis) and bacteria (Vibrio harveyi) were also investigated. Both enzymes were inhibited competitively, with the cycloalcohols competing with firefly luciferin for binding to the firefly enzyme and with n-decanal for binding to the bacterial enzyme. 4. The binding site on the firefly enzyme could accommodate two molecules of cycloalcohols C6 and C7 but only a single molecule of the larger cycloalcohols (C8 and C10), implying a volume of the binding site of about 250 cm3 mol-1. In contrast, the binding site on the bacterial luciferase could bind only a single cycloalcohol molecule between C6 and C10. 5. While all of the cycloalcohols were potent inhibitors of the firefly luciferase enzyme (on average EC50/Csat = 0.015), they were very weak inhibitors of the bacterial luciferase enzyme (on average EC50/Csat = 0.12). Since both enzymes bind long-chain aliphatic n-alcohols tightly, the differing affinities of the cycloalcohols for the two enzymes is probably a consequence of geometrical factors. 6. The cycloalcohols produced very small effects on lipid bilayers. At EC50 concentrations which produce general anaesthesia, lipid bilayer phase transitions were shifted, on average, by only 0.43 degrees C.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2043920

  3. Peroxisomal Membrane Proteins Contain Common Pex19p-binding Sites that Are an Integral Part of Their Targeting SignalsD⃞

    PubMed Central

    Rottensteiner, Hanspeter; Kramer, Achim; Lorenzen, Stephan; Stein, Katharina; Landgraf, Christiane; Volkmer-Engert, Rudolf; Erdmann, Ralf

    2004-01-01

    Targeting of peroxisomal membrane proteins (PMPs) is a multistep process that requires not only recognition of PMPs in the cytosol but also their insertion into the peroxisomal membrane. As a consequence, targeting signals of PMPs (mPTS) are rather complex. A candidate protein for the PMP recognition event is Pex19p, which interacts with most PMPs. However, the respective Pex19p-binding sites are ill-defined and it is currently disputed whether these sites are contained within mPTS. By using synthetic peptide scans and yeast two-hybrid analyses, we determined and characterized Pex19p-binding sites in Pex11p and Pex13p, two PMPs from Saccharomyces cerevisiae. The sites turned out to be composed of a short helical motif with a minimal length of 11 amino acids. With the acquired data, it proved possible to predict and experimentally verify Pex19p-binding sites in several other PMPs by applying a pattern search and a prediction matrix. A peroxisomally targeted Pex13p fragment became mislocalized to the endoplasmic reticulum in the absence of its Pex19p-binding site. By adding the heterologous binding site of Pex11p, peroxisomal targeting of the Pex13p fragment was restored. We conclude that Pex19p-binding sites are well-defined entities that represent an essential part of the mPTS. PMID:15133130

  4. Geology and MER target site characteristics along the southern rim of Isidis Planitia, Mars

    USGS Publications Warehouse

    Crumpler, L.S.; Tanaka, K.L.

    2003-01-01

    crustal materials, in the form of rocks within the debris fans, and the weathered condition of the rocky material are potential sources for mineralogical evidence of climatic conditions in earliest Martian geologic history. The absence of alteration within rocks would, on the other hand, support the hypothesis that fluvial runoff during the earliest history of Mars was geologically brief rather than long-term and that long-term saturated groundwater flow was not present. Determination of the presence or absence of alteration would have corresponding implications for hypotheses requiring the long-term presence of aqueous solutions (i.e., complex organic compounds and life). A proposed MER site along the margin addresses realistic field science objectives of the Mars Exploration Rover mission and the current goals of the Mars Exploration Program. In situ measurements may be important in deriving estimates of the longevity and intensity of past wetter climates. Copyright 2003 by the American Geophysical Union.

  5. Application of vitamin B(12)-targeting site on Lactobacillus helveticus B-1 to vitamin B(12) assay by chemiluminescence method.

    PubMed

    Sato, Kazuyoshi; Muramatsu, Kumi; Amano, Setsumi

    2002-09-01

    Lactobacillus helveticus B-1 is assumed to have a vitamin B(12)-targeting (or B(12)-binding) site on the cells, since the binding reaction of vitamin B(12) with L. helveticus B-1 cells proceeded instantly and quantitatively. This reaction is specific to complete B(12) compounds, cobalamins, and can be used for a vitamin B(12) assay method by chemiluminescence. The calibration graph was linear from 0.1 to 10.0 ng/mL. The B(12) contents in oyster and sardine were 75.9 and 39.4 microg/100g, respectively. These values were very close to those obtained using a chemilumi-ADVIA Centaur immunoassay system with intrinsic factor and to those obtained by microbiological assays. PMID:12234457

  6. Dengue vector management using insecticide treated materials and targeted interventions on productive breeding-sites in Guatemala

    PubMed Central

    2012-01-01

    Background In view of the epidemiological expansion of dengue worldwide and the availability of new tools and strategies particularly for controlling the primary dengue vector Aedes aegypti, an intervention study was set up to test the efficacy, cost and feasibility of a combined approach of insecticide treated materials (ITMs) alone and in combination with appropriate targeted interventions of the most productive vector breeding-sites. Methods The study was conducted as a cluster randomized community trial using “reduction of the vector population” as the main outcome variable. The trial had two arms: 10 intervention clusters (neighborhoods) and 10 control clusters in the town of Poptun Guatemala. Activities included entomological assessments (characteristics of breeding-sites, pupal productivity, Stegomyia indices) at baseline, 6 weeks after the first intervention (coverage of window and exterior doorways made of PermaNet 2.0 netting, factory treated with deltamethrin at 55 mg/m2, and of 200 L drums with similar treated material) and 6 weeks after the second intervention (combination of treated materials and other suitable interventions targeting productive breeding-sites i.e larviciding with Temephos, elimination etc.). The second intervention took place 17 months after the first intervention. The insecticide residual activity and the insecticidal content were also studied at different intervals. Additionally, information about demographic characteristics, cost of the intervention, coverage of houses protected and satisfaction in the population with the interventions was collected. Results At baseline (during the dry season) a variety of productive container types for Aedes pupae were identified: various container types holding >20 L, 200 L drums, washbasins and buckets (producing 83.7% of all pupae). After covering 100% of windows and exterior doorways and a small number of drums (where the commercial cover could be fixed) in 970 study households, tropical

  7. Chromatin architecture may dictate the target site for DMC1, but not for RAD51, during homologous pairing

    PubMed Central

    Kobayashi, Wataru; Takaku, Motoki; Machida, Shinichi; Tachiwana, Hiroaki; Maehara, Kazumitsu; Ohkawa, Yasuyuki; Kurumizaka, Hitoshi

    2016-01-01

    In eukaryotes, genomic DNA is compacted as chromatin, in which histones and DNA form the nucleosome as the basic unit. DMC1 and RAD51 are essential eukaryotic recombinases that mediate homologous chromosome pairing during homologous recombination. However, the means by which these two recombinases distinctly function in chromatin have remained elusive. Here we found that, in chromatin, the human DMC1-single-stranded DNA complex bypasses binding to the nucleosome, and preferentially promotes homologous pairing at the nucleosome-depleted regions. Consistently, DMC1 forms ternary complex recombination intermediates with the nucleosome-free DNA or the nucleosome-depleted DNA region. Surprisingly, removal of the histone tails improperly enhances the nucleosome binding by DMC1. In contrast, RAD51 does not specifically target the nucleosome-depleted region in chromatin. These are the first demonstrations that the chromatin architecture specifies the sites to promote the homologous recombination reaction by DMC1, but not by RAD51. PMID:27052786

  8. Sarcoidosis in celiac disease: A page written by genetic variants in IL-18 miRNAs target site?

    PubMed

    Mormile, Raffaella

    2016-05-01

    Sarcoidosis is a chronic idiopathic granulomatous disease. Interleukin-18 (IL-18) has been strongly implicated in the pathogenesis of sarcoidosis. Sarcoidosis shows characteristic microRNAs (miRNAs) profiles. MiRNAs have recently emerged as a new class of modulators of gene expression. MiRNAs are involved in susceptibility to a number of autoimmune diseases promoting and inhibiting the gene expression of different Th1 pro-inflammatory cytokines including IL18. Sarcoidosis has been connected with a variety of autoimmune disorders including celiac disease (CD). CD is a chronic, immune-mediated condition of the small intestine caused by permanent intolerance to dietary gluten. IL-18 has been reported to play an important role in inducing and maintaining inflammation after gluten exposure. MiRNAs expression is significantly altered in CD patients. We hypothesize that sarcoidosis and CD may be the result of common genetic variants in IL-18 miRNA target site. PMID:27063085

  9. Comparison of nanoparticle penetration into solid tumors and sites of inflammation: studies using targeted and nontargeted liposomes

    PubMed Central

    Poh, Scott; Chelvam, Venkatesh; Low, Philip S

    2015-01-01

    Aim: The vast majority of nanomedicine research is focused on the use of nanoparticles for the diagnosis and treatment of cancer. However, the dense extracellular matrix of solid tumors restricts nanoparticle penetration, raising the question of whether the best applications of nanomedicines lie in oncology. Materials & methods: In this study, the uptake of folate-conjugated liposomes was compared between folate receptor-expressing tumors and folate receptor+ inflammatory lesions within the same mouse. Results: We demonstrate here that both folate-targeted and nontargeted liposomes accumulate more readily at sites of inflammation than in solid tumors. Conclusion: These data suggest that nanosized imaging and therapeutic agents may be better suited for the treatment and diagnosis of inflammatory/autoimmune diseases than cancer. PMID:25996118

  10. Nanoscale Synaptic Membrane Mimetic Allows Unbiased High Throughput Screen That Targets Binding Sites for Alzheimer’s-Associated Aβ Oligomers

    PubMed Central

    Wilcox, Kyle C.; Marunde, Matthew R.; Das, Aditi; Velasco, Pauline T.; Kuhns, Benjamin D.; Marty, Michael T.; Jiang, Haoming; Luan, Chi-Hao; Sligar, Stephen G.; Klein, William L.

    2015-01-01

    Despite their value as sources of therapeutic drug targets, membrane proteomes are largely inaccessible to high-throughput screening (HTS) tools designed for soluble proteins. An important example comprises the membrane proteins that bind amyloid β oligomers (AβOs). AβOs are neurotoxic ligands thought to instigate the synapse damage that leads to Alzheimer’s dementia. At present, the identities of initial AβO binding sites are highly uncertain, largely because of extensive protein-protein interactions that occur following attachment of AβOs to surface membranes. Here, we show that AβO binding sites can be obtained in a state suitable for unbiased HTS by encapsulating the solubilized synaptic membrane proteome into nanoscale lipid bilayers (Nanodiscs). This method gives a soluble membrane protein library (SMPL)—a collection of individualized synaptic proteins in a soluble state. Proteins within SMPL Nanodiscs showed enzymatic and ligand binding activity consistent with conformational integrity. AβOs were found to bind SMPL Nanodiscs with high affinity and specificity, with binding dependent on intact synaptic membrane proteins, and selective for the higher molecular weight oligomers known to accumulate at synapses. Combining SMPL Nanodiscs with a mix-incubate-read chemiluminescence assay provided a solution-based HTS platform to discover antagonists of AβO binding. Screening a library of 2700 drug-like compounds and natural products yielded one compound that potently reduced AβO binding to SMPL Nanodiscs, synaptosomes, and synapses in nerve cell cultures. Although not a therapeutic candidate, this small molecule inhibitor of synaptic AβO binding will provide a useful experimental antagonist for future mechanistic studies of AβOs in Alzheimer’s model systems. Overall, results provide proof of concept for using SMPLs in high throughput screening for AβO binding antagonists, and illustrate in general how a SMPL Nanodisc system can facilitate drug

  11. Identification of the target binding site of ethanolamine-binding aptamers and its exploitation for ethanolamine detection.

    PubMed

    Heilkenbrinker, Alexandra; Reinemann, Christine; Stoltenburg, Regina; Walter, Johanna-Gabriela; Jochums, André; Stahl, Frank; Zimmermann, Stefan; Strehlitz, Beate; Scheper, Thomas

    2015-01-01

    Aptamers are promising recognition elements for sensitive and specific detection of small molecules. We have previously selected ssDNA aptamers for ethanolamine, one of the smallest aptamer targets so far. The work presented here focuses on the determination of the binding region within the aptamer structure and its exploitation for the development of an aptamer-based assay for detection of ethanolamine. Sequence analysis of the aptamers resulted in the identification of a G-rich consensus sequence, which was able to fold in a typical two- or three-layered G-quartet structure. Experiments with stepwise truncated variants of the aptamers revealed that the consensus sequence is responsible and sufficient for binding to the target. On the basis of the knowledge of the aptamers binding site, we developed an aptamer-based microarray assay relying on competition between ethanolamine and an oligonucleotide complementary to the consensus sequence. Competitive binding of ethanolamine and fluorescently labeled complementary oligonucleotides resulted in fluorescence intensities dependent on ethanolamine concentration with a limit of detection of 10 pM. This method enables detection of small molecules without any labeling of analytes. The competitive assay could potentially be transferred to other aptamers and thus provides a promising system for aptamer-based detection of diverse small molecules. PMID:25435319

  12. Site-1 protease-activated formation of lysosomal targeting motifs is independent of the lipogenic transcription control[S

    PubMed Central

    Klünder, Sarah; Heeren, Jörg; Markmann, Sandra; Santer, René; Braulke, Thomas; Pohl, Sandra

    2015-01-01

    Site-1 protease (S1P) cleaves membrane-bound lipogenic sterol regulatory element-binding proteins (SREBPs) and the α/β-subunit precursor protein of the N-acetylglucosamine-1-phosphotransferase forming mannose 6-phosphate (M6P) targeting markers on lysosomal enzymes. The translocation of SREBPs from the endoplasmic reticulum (ER) to the Golgi-resident S1P depends on the intracellular sterol content, but it is unknown whether the ER exit of the α/β-subunit precursor is regulated. Here, we investigated the effect of cholesterol depletion (atorvastatin treatment) and elevation (LDL overload) on ER-Golgi transport, S1P-mediated cleavage of the α/β-subunit precursor, and the subsequent targeting of lysosomal enzymes along the biosynthetic and endocytic pathway to lysosomes. The data showed that the proteolytic cleavage of the α/β-subunit precursor into mature and enzymatically active subunits does not depend on the cholesterol content. In either treatment, lysosomal enzymes are normally decorated with M6P residues, allowing the proper sorting to lysosomes. In addition, we found that, in fibroblasts of mucolipidosis type II mice and Niemann-Pick type C patients characterized by aberrant cholesterol accumulation, the proteolytic cleavage of the α/β-subunit precursor was not impaired. We conclude that S1P substrate-dependent regulatory mechanisms for lipid synthesis and biogenesis of lysosomes are different. PMID:26108224

  13. Imaging site-specific peptide-targeting in tumor tissues using spectral-domain optical coherence tomography

    NASA Astrophysics Data System (ADS)

    Ma, Lixin; Zhang, Miao; Yu, Ping

    2011-03-01

    We report imaging studies on site-specific peptide-targeting in tumor tissues using newly developed optical peptide probes and spectral-domain optical coherence tomography (SD-OCT). The system used two broadband superluminescent light emission diodes with different central wavelengths. An electro-optic modulation in the reference beam was used to get full-range deep imaging inside tumor tissues. The optical probes were based on Bombesin (BBN) that is a fourteen amino acid peptide. BBN has high binding affinity to gastrin-releasing peptide (GRP) receptors overexpressed on several human cancer cell lines. Fluorescence BBN probes were developed by conjugating the last eight residues of BBN, -Q-W-A-V-G-H-L-M-(NH2), with Alexa Flour 680 or Alexa Fluor 750 dye molecules via amino acid linker -G-G-G. The SD-OCT imaging can identify normal tissue and tumor tissue through the difference in scattering coefficient, and trace the BBN conjugate probes through the absorption of the dye molecules using the twowavelength algorithm. We performed the specific uptake and receptor-blocking experiments of the optical BBN probes in severely compromised immunodeficient mouse model bearing human PC-3 prostate tumor xenografts. Tumor and muscle tissues were collected and used for SD-OCT imaging. The SD-OCT images showed fluorescence traces of the BBN probes in the peptide-targeted tumor tissues. Our results demonstrated that SD-OCT is a potential tool for preclinical and clinical early cancer detection.

  14. MicroRNA-135b has a neuroprotective role via targeting of β-site APP-cleaving enzyme 1

    PubMed Central

    Zhang, Yi; Xing, Hongxia; Guo, Shuangxi; Zheng, Zhiyong; Wang, Haoliang; Xu, Dawei

    2016-01-01

    MicroRNAs (miRs) are a class of endogenous small non-coding RNAs that have been revealed to negatively mediate the expression of their target genes at the post-transcriptional level. Recently, particular miRs have demonstrated an involvement in the pathogenesis of Alzheimer's disease (AD). However, the specific role of miR-135b in AD has yet to be elucidated. The present study aimed to investigate the neuroprotective role of miR-135b, in addition to its underlying mechanism. Herein, reverse transcription-quantitative polymerase chain reaction was conducted to determine miR-135b expression levels in the peripheral blood samples of patients with AD and age-matched normal controls. The data of the present study revealed that the expression levels of miR-135b were significantly reduced in the peripheral blood of AD patients compared with normal controls (P<0.01). In vitro MTT analyses identified that the overexpression of miR-135b significantly enhanced the proliferation of hippocampal cells (P<0.01). Furthermore, in vivo analysis using a Y-maze test indicated that injection with miR-135b mimics into the third ventricle of anesthetized SAMP8 mice significantly enhanced their learning and memory capacities (P<0.01). Molecular mechanism investigations identified β-site APP-cleaving enzyme 1 (BACE1) as a direct target gene of miR-135b, and the latter was identified to negatively mediate the protein expression levels of BACE1 in hippocampal cells, in addition to hippocampal tissues, of SAMP8 mice. Based on the aforementioned findings, we propose that miR-135b has a neuroprotective role via direct targeting of BACE1 and, thus, may be used for the treatment of AD. PMID:27446280

  15. Search by proteins for their DNA target site: 2. The effect of DNA conformation on the dynamics of multidomain proteins

    PubMed Central

    Bhattacherjee, Arnab; Levy, Yaakov

    2014-01-01

    Multidomain transcription factors, which are especially abundant in eukaryotic genomes, are advantageous to accelerate the search kinetics for target site because they can follow the intersegment transfer via the monkey-bar mechanism in which the protein forms a bridged intermediate between two distant DNA regions. Monkey-bar dynamics highly depends on the properties of the multidomain protein (the affinity of each of the constituent domains to the DNA and the length of the linker) and the DNA molecules (their inter-distance and inter-angle). In this study, we investigate using coarse-grained molecular dynamics simulations how the local conformation of the DNA may affect the DNA search performed by a multidomain protein Pax6 in comparison to that of the isolated domains. Our results suggest that in addition to the common rotation-coupled translation along the DNA major groove, for curved DNA the tethered domains may slide in a rotation-decoupled sliding mode. Furthermore, the multidomain proteins move by longer jumps on curved DNA compared with those performed by the single domain protein. The long jumps originate from the DNA curvature bringing two sequentially distant DNA sites into close proximity with each other and they suggest that multidomain proteins may move on highly curved DNA faster than linear DNA. PMID:25324311

  16. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome

    PubMed Central

    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A.

    2015-01-01

    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; http://ttsmi.bii.a-star.edu.sg) database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser. PMID:25324314

  17. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome.

    PubMed

    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A

    2015-01-01

    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; http://ttsmi.bii.a-star.edu.sg) database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser. PMID:25324314

  18. Search by proteins for their DNA target site: 2. The effect of DNA conformation on the dynamics of multidomain proteins.

    PubMed

    Bhattacherjee, Arnab; Levy, Yaakov

    2014-11-10

    Multidomain transcription factors, which are especially abundant in eukaryotic genomes, are advantageous to accelerate the search kinetics for target site because they can follow the intersegment transfer via the monkey-bar mechanism in which the protein forms a bridged intermediate between two distant DNA regions. Monkey-bar dynamics highly depends on the properties of the multidomain protein (the affinity of each of the constituent domains to the DNA and the length of the linker) and the DNA molecules (their inter-distance and inter-angle). In this study, we investigate using coarse-grained molecular dynamics simulations how the local conformation of the DNA may affect the DNA search performed by a multidomain protein Pax6 in comparison to that of the isolated domains. Our results suggest that in addition to the common rotation-coupled translation along the DNA major groove, for curved DNA the tethered domains may slide in a rotation-decoupled sliding mode. Furthermore, the multidomain proteins move by longer jumps on curved DNA compared with those performed by the single domain protein. The long jumps originate from the DNA curvature bringing two sequentially distant DNA sites into close proximity with each other and they suggest that multidomain proteins may move on highly curved DNA faster than linear DNA. PMID:25324311

  19. Enrichment of H3K9me2 on Unsynapsed Chromatin in Caenorhabditis elegans Does Not Target de Novo Sites

    PubMed Central

    Guo, Yiqing; Yang, Bing; Li, Yini; Maine, Eleanor M.

    2015-01-01

    Many organisms alter the chromatin state of unsynapsed chromosomes during meiotic prophase, a phenomenon hypothesized to function in maintaining germline integrity. In Caenorhabditis elegans, histone H3 lysine 9 dimethylation (H3K9me2) is detected by immunolabeling as enriched on unsynapsed meiotic chromosomes. Loss of the SET domain protein, MET-2, greatly reduces H3K9me2 abundance and results in germline mortality. Here, we used him-8 mutations to disable X chromosome synapsis and performed a combination of molecular assays to map the sites of H3K9me2 accumulation, evaluate H3K9me2 abundance in germline vs. whole animals, and evaluate the impact of H3K9me2 loss on the germline transcriptome. Our data indicate that H3K9me2 is elevated broadly across the X chromosome and at defined X chromosomal sites in him-8 adults compared with controls. H3K9me2 levels are also elevated to a lesser degree at sites on synapsed chromosomes in him-8 adults compared with controls. These results suggest that MET-2 activity is elevated in him-8 mutants generally as well as targeted preferentially to the unsynapsed X. Abundance of H3K9me2 and other histone H3 modifications is low in germline chromatin compared with whole animals, which may facilitate genome reprogramming during gametogenesis. Loss of H3K9me2 has a subtle impact on the him-8 germline transcriptome, suggesting H3K9me2 may not be a major regulator of developmental gene expression in C. elegans. We hypothesize H3K9me2 may have a structural function critical for germline immortality, and a greater abundance of these marks may be required when a chromosome does not synapse. PMID:26156747

  20. Enrichment of H3K9me2 on Unsynapsed Chromatin in Caenorhabditis elegans Does Not Target de Novo Sites.

    PubMed

    Guo, Yiqing; Yang, Bing; Li, Yini; Xu, Xia; Maine, Eleanor M

    2015-09-01

    Many organisms alter the chromatin state of unsynapsed chromosomes during meiotic prophase, a phenomenon hypothesized to function in maintaining germline integrity. In Caenorhabditis elegans, histone H3 lysine 9 dimethylation (H3K9me2) is detected by immunolabeling as enriched on unsynapsed meiotic chromosomes. Loss of the SET domain protein, MET-2, greatly reduces H3K9me2 abundance and results in germline mortality. Here, we used him-8 mutations to disable X chromosome synapsis and performed a combination of molecular assays to map the sites of H3K9me2 accumulation, evaluate H3K9me2 abundance in germline vs. whole animals, and evaluate the impact of H3K9me2 loss on the germline transcriptome. Our data indicate that H3K9me2 is elevated broadly across the X chromosome and at defined X chromosomal sites in him-8 adults compared with controls. H3K9me2 levels are also elevated to a lesser degree at sites on synapsed chromosomes in him-8 adults compared with controls. These results suggest that MET-2 activity is elevated in him-8 mutants generally as well as targeted preferentially to the unsynapsed X. Abundance of H3K9me2 and other histone H3 modifications is low in germline chromatin compared with whole animals, which may facilitate genome reprogramming during gametogenesis. Loss of H3K9me2 has a subtle impact on the him-8 germline transcriptome, suggesting H3K9me2 may not be a major regulator of developmental gene expression in C. elegans. We hypothesize H3K9me2 may have a structural function critical for germline immortality, and a greater abundance of these marks may be required when a chromosome does not synapse. PMID:26156747

  1. Targeting distinct tautomerase sites of D-DT and MIF with a single molecule for inhibition of neutrophil lung recruitment

    PubMed Central

    Rajasekaran, Deepa; Zierow, Swen; Syed, Mansoor; Bucala, Richard; Bhandari, Vineet; Lolis, Elias J.

    2014-01-01

    We report a new inflammatory activity for extracellular d-dopachrome tautomerase (D-DT), the recruitment of neutrophils to the lung on D-DT intratracheal installation of C57BL/6J mice with an EC50 of 5.6 μg. We also find that D-DT and macrophage migration inhibitory factor (MIF) have additive effects in neutrophil recruitment. Although the tautomerase site of D-DT and its homologue MIF are biophysically very different, 4-iodo-6-phenylpyrimidine (4-IPP) forms a covalent bond with Pro-1 of both proteins, resulting in a 6-phenylpyrimidine (6-PP) adduct. Recruitment of neutrophils to the lung for the 6-PP adducts of D-DT and MIF are reduced by ∼50% relative to the apo proteins, demonstrating that an unmodified Pro-1 is important for this activity, but there is no cooperativity in inhibition of the proteins together. The differences in the binding mode of the 6-PP adduct for D-DT was determined by crystallographic studies at 1.13 Å resolution and compared to the structure of the MIF–6-PP complex. There are major differences in the location of the 6-PP adduct to the D-DT and MIF active sites that provide insight into the lack of cooperativity by 4-IPP and into tuning the properties of the covalent inhibitors of D-DT and MIF that are necessary for the development of therapeutic small molecules against neutrophil damage from lung infections such as Pseudomonas aeruginosa in cystic fibrosis and immunocompromised patients.—Rajasekaran, D., Zierow, S., Syed, M., Bucala, R., Bhandari, V., Lolis, E. J. Targeting distinct tautomerase sites of D-DT and MIF with a single molecule for inhibition of neutrophil lung recruitment. PMID:25016026

  2. miRdSNP: a database of disease-associated SNPs and microRNA target sites on 3'UTRs of human genes

    PubMed Central

    2012-01-01

    Background Single nucleotide polymorphisms (SNPs) can lead to the susceptibility and onset of diseases through their effects on gene expression at the posttranscriptional level. Recent findings indicate that SNPs could create, destroy, or modify the efficiency of miRNA binding to the 3'UTR of a gene, resulting in gene dysregulation. With the rapidly growing number of published disease-associated SNPs (dSNPs), there is a strong need for resources specifically recording dSNPs on the 3'UTRs and their nucleotide distance from miRNA target sites. We present here miRdSNP, a database incorporating three important areas of dSNPs, miRNA target sites, and diseases. Description miRdSNP provides a unique database of dSNPs on the 3'UTRs of human genes manually curated from PubMed. The current release includes 786 dSNP-disease associations for 630 unique dSNPs and 204 disease types. miRdSNP annotates genes with experimentally confirmed targeting by miRNAs and indexes miRNA target sites predicted by TargetScan and PicTar as well as potential miRNA target sites newly generated by dSNPs. A robust web interface and search tools are provided for studying the proximity of miRNA binding sites to dSNPs in relation to human diseases. Searches can be dynamically filtered by gene name, miRBase ID, target prediction algorithm, disease, and any nucleotide distance between dSNPs and miRNA target sites. Results can be viewed at the sequence level showing the annotated locations for miRNA target sites and dSNPs on the entire 3'UTR sequences. The integration of dSNPs with the UCSC Genome browser is also supported. Conclusion miRdSNP provides a comprehensive data source of dSNPs and robust tools for exploring their distance from miRNA target sites on the 3'UTRs of human genes. miRdSNP enables researchers to further explore the molecular mechanism of gene dysregulation for dSNPs at posttranscriptional level. miRdSNP is freely available on the web at http://mirdsnp.ccr.buffalo.edu. PMID:22276777

  3. Target Site Specificity of the Tos17 Retrotransposon Shows a Preference for Insertion within Genes and against Insertion in Retrotransposon-Rich Regions of the Genome

    PubMed Central

    Miyao, Akio; Tanaka, Katsuyuki; Murata, Kazumasa; Sawaki, Hiromichi; Takeda, Shin; Abe, Kiyomi; Shinozuka, Yoriko; Onosato, Katsura; Hirochika, Hirohiko

    2003-01-01

    Because retrotransposons are the major component of plant genomes, analysis of the target site selection of retrotransposons is important for understanding the structure and evolution of plant genomes. Here, we examined the target site specificity of the rice retrotransposon Tos17, which can be activated by tissue culture. We have produced 47,196 Tos17-induced insertion mutants of rice. This mutant population carries ∼500,000 insertions. We analyzed >42,000 flanking sequences of newly transposed Tos17 copies from 4316 mutant lines. More than 20,000 unique loci were assigned on the rice genomic sequence. Analysis of these sequences showed that insertion events are three times more frequent in genic regions than in intergenic regions. Consistent with this result, Tos17 was shown to prefer gene-dense regions over centromeric heterochromatin regions. Analysis of insertion target sequences revealed a palindromic consensus sequence, ANGTT-TSD-AACNT, flanking the 5-bp target site duplication. Although insertion targets are distributed throughout the chromosomes, they tend to cluster, and 76% of the clusters are located in genic regions. The mechanisms of target site selection by Tos17, the utility of the mutant lines, and the knockout gene database are discussed. PMID:12897251

  4. Evolutionary Origin and Conserved Structural Building Blocks of Riboswitches and Ribosomal RNAs: Riboswitches as Probable Target Sites for Aminoglycosides Interaction

    PubMed Central

    Mehdizadeh Aghdam, Elnaz; Barzegar, Abolfazl; Hejazi, Mohammad Saeid

    2014-01-01

    Purpose: Riboswitches, as noncoding RNA sequences, control gene expression through direct ligand binding. Sporadic reports on the structural relation of riboswitches with ribosomal RNAs (rRNA), raises an interest in possible similarity between riboswitches and rRNAs evolutionary origins. Since aminoglycoside antibiotics affect microbial cells through binding to functional sites of the bacterial rRNA, finding any conformational and functional relation between riboswitches/rRNAs is utmost important in both of medicinal and basic research. Methods: Analysis of the riboswitches structures were carried out using bioinformatics and computational tools. The possible functional similarity of riboswitches with rRNAs was evaluated based on the affinity of paromomycin antibiotic (targeting “A site” of 16S rRNA) to riboswitches via docking method. Results: There was high structural similarity between riboswitches and rRNAs, but not any particular sequence based similarity between them was found. The building blocks including "hairpin loop containing UUU", "peptidyl transferase center conserved hairpin A loop"," helix 45" and "S2 (G8) hairpin" as high identical rRNA motifs were detected in all kinds of riboswitches. Surprisingly, binding energies of paromomycin with different riboswitches are considerably better than the binding energy of paromomycin with “16S rRNA A site”. Therefore the high affinity of paromomycin to bind riboswitches in comparison with rRNA “A site” suggests a new insight about riboswitches as possible targets for aminoglycoside antibiotics. Conclusion: These findings are considered as a possible supporting evidence for evolutionary origin of riboswitches/rRNAs and also their role in the exertion of antibiotics effects to design new drugs based on the concomitant effects via rRNA/riboswitches. PMID:24754005

  5. Systematic Discovery of Molecular Probes Targeting Multiple Non-orthosteric and Spatially Distinct Sites in the Botulinum Neurotoxin Subtype A (BoNT/A)

    PubMed Central

    Dadgar, Saedeh; Floriano, Wely B.

    2015-01-01

    The development of molecular probes targeting proteins has traditionally relied on labeling compounds already known to bind to the protein of interest. These known ligands bind to orthosteric or allosteric sites in their target protein as a way to control their activity. Binding pockets other than known orthosteric or allosteric sites may exist that are large enough to accommodate a ligand without significantly disrupting protein activity. Such sites may provide opportunities to discriminate between subtypes or other closely related proteins, since they are under less evolutionary pressure to be conserved. The Protein Scanning with Virtual Ligand Screening (PSVLS) approach was previously used to identify a novel inhibitor and a fluorescent probe against the catalytic site of the botulinum neurotoxin subtype A (BoNT/A). PSVLS screens compound databases against multiple sites within a target protein, and the results for all the sites probed against BoNT/A, not only the catalytic site, are available online. Here, we analyze the PSVLS data for multiple sites in order to identify molecular probes with affinity for binding pockets other than the catalytic site of BoNT/A. BoNT/A is a large protein with a light (LC) and a heavy (HC) chain that can be assayed separately. We used scintillation proximity assay (SPA) to test experimentally 5 probe candidates predicted computationally to have affinity for different non-orthosteric binding regions within the HC and LC, and one compound predicted not to have affinity for either domain. The binding profiles obtained experimentally confirmed the targeting of multiple and spatially distinct pockets within BoNT/A. Moreover, inhibition assay results indicate that some of these probes do not significantly interfere with the catalytic activity of BoNT/A. PMID:25745992

  6. Final work plan : targeted groundwater sampling and monitoring well installation for potential site reclassification at Barnes, Kansas.

    SciTech Connect

    LaFreniere, L. M.

    2006-07-11

    This ''Work Plan'' outlines the scope of work for a targeted groundwater sampling investigation and monitoring well installation at Barnes, Kansas. This activity is being conducted at the request of the Kansas Department of Health and Environment (KDHE), in accordance with the intergovernmental agreement between the KDHE and the Commodity Credit Corporation (CCC), an agency of the U.S. Department of Agriculture (USDA). Data resulting from the proposed work will be used to determine the hydraulic gradient near the former CCC/USDA facility, delineate the downgradient carbon tetrachloride plume, and determine additional monitoring requirements at Barnes. The overall goal is to establish criteria for monitoring leading to potential site reclassification. The proposed work will be performed on behalf of the CCC/USDA by the Environmental Science Division of Argonne National Laboratory. Argonne is a nonprofit, multidisciplinary research center operated by the University of Chicago for the U.S. Department of Energy (DOE). The Farm Service Agency of the USDA has entered into an interagency agreement with DOE, under which Argonne provides technical assistance with environmental site characterization and remediation at former CCC/USDA grain storage facilities. Argonne issued a ''Master Work Plan'' (Argonne 2002) to provide general guidance for all investigations at former CCC/USDA facilities in Kansas. The ''Master Work Plan'', approved by the KDHE, contains the materials common to investigations at all locations in Kansas. This document must be consulted for the complete details of plans for this work associated with the former CCC/USDA facility at Barnes.

  7. Target site pharmacokinetics of linezolid after single and multiple doses in diabetic patients with soft tissue infection.

    PubMed

    Eslam, Roza Badr; Burian, Angela; Vila, Greisa; Sauermann, Robert; Hammer, Alexandra; Frenzel, Dorothea; Minichmayr, Iris K; Kloft, Charlotte; Matzneller, Peter; Oesterreicher, Zoe; Zeitlinger, Markus

    2014-09-01

    The underlying pathology of diabetic wounds, i.e. impairment of macro- and microcirculation, might also impact target site penetration of antibacterial drugs. To compare tissue concentrations of linezolid in infected and not infected tissue 10 patients suffering from type 2 diabetes with foot infection were included in the study. Tissue penetration of linezolid was assessed using in vivo microdialysis at the site of infection as well as in non-inflamed subcutaneous adipose tissue. All patients were investigated after receiving a single dose of linezolid and five patients in addition at steady state. After a single dose of linezolid significantly higher area under the concentration vs. time curve over 8 hours (AUC0-8 ) and maximum concentrations (Cmax )-values were observed in plasma (65.5 ± 21.2 mg*h/L and 16.4 ± 4.6 mg/L) as compared to inflamed (36.3 ± 22.9  mg*h/L and 6.6 ± 3.6 mg/L) and non-inflamed tissue (33.0 ± 17.7 mg*h/L and 6.7 ± 3.6 mg/L). Multiple administrations of linezolid led to disappearance of significant differences in Cmax and AUC0-8 between plasma, inflamed, and non-inflamed tissue. Approximately 2-fold increase of Cmax and AUC0-8 -values in tissue was observed at steady state as compared to the first administration. Penetration of linezolid is not impaired in diabetic foot infection but equilibrium between plasma and tissue might be delayed. PMID:24677034

  8. Human T-Cell Leukemia Virus Type 1 Integration Target Sites in the Human Genome: Comparison with Those of Other Retroviruses▿ ‡

    PubMed Central

    Derse, David; Crise, Bruce; Li, Yuan; Princler, Gerald; Lum, Nicole; Stewart, Claudia; McGrath, Connor F.; Hughes, Stephen H.; Munroe, David J.; Wu, Xiaolin

    2007-01-01

    Retroviral integration into the host genome is not entirely random, and integration site preferences vary among different retroviruses. Human immunodeficiency virus (HIV) prefers to integrate within active genes, whereas murine leukemia virus (MLV) prefers to integrate near transcription start sites and CpG islands. On the other hand, integration of avian sarcoma-leukosis virus (ASLV) shows little preference either for genes, transcription start sites, or CpG islands. While host cellular factors play important roles in target site selection, the viral integrase is probably the major viral determinant. It is reasonable to hypothesize that retroviruses with similar integrases have similar preferences for target site selection. Although integration profiles are well defined for members of the lentivirus, spumaretrovirus, alpharetrovirus, and gammaretrovirus genera, no members of the deltaretroviruses, for example, human T-cell leukemia virus type 1 (HTLV-1), have been evaluated. We have mapped 541 HTLV-1 integration sites in human HeLa cells and show that HTLV-1, like ASLV, does not specifically target transcription units and transcription start sites. Comparing the integration sites of HTLV-1 with those of ASLV, HIV, simian immunodeficiency virus, MLV, and foamy virus, we show that global and local integration site preferences correlate with the sequence/structure of virus-encoded integrases, supporting the idea that integrase is the major determinant of retroviral integration site selection. Our results suggest that the global integration profiles of other retroviruses could be predicted from phylogenetic comparisons of the integrase proteins. Our results show that retroviruses that engender different insertional mutagenesis risks can have similar integration profiles. PMID:17409138

  9. Determination of Depleted Uranium in Environmental Bio-monitor Samples and Soil from Target sites in Western Balkan Region

    NASA Astrophysics Data System (ADS)

    Sahoo, Sarata K.; Enomoto, Hiroko; Tokonami, Shinji; Ishikawa, Tetsuo; Ujić, Predrag; Čeliković, Igor; Žunić, Zora S.

    2008-08-01

    Lichen and Moss are widely used to assess the atmospheric pollution by heavy metals and radionuclides. In this paper, we report results of uranium and its isotope ratios using mass spectrometric measurements (followed by chemical separation procedure) for mosses, lichens and soil samples from a depleted uranium (DU) target site in western Balkan region. Samples were collected in 2003 from Han Pijesak (Republika Srpska in Bosnia and Hercegovina). Inductively coupled plasma mass spectrometry (ICP-MS) measurements show the presence of high concentration of uranium in some samples. Concentration of uranium in moss samples ranged from 5.2-755.43 Bq/Kg. We have determined 235U/238U isotope ratio using thermal ionization mass spectrometry (TIMS) from the samples with high uranium content and the ratios are in the range of 0.002097-0.002380. TIMS measurement confirms presence of DU in some samples. However, we have not noticed any traces of DU in samples containing lesser amount of uranium or from any samples from the living environment of same area.

  10. Determination of Depleted Uranium in Environmental Bio-monitor Samples and Soil from Target sites in Western Balkan Region

    SciTech Connect

    Sahoo, Sarata K.; Enomoto, Hiroko; Tokonami, Shinji; Ishikawa, Tetsuo; Ujic, Predrag; Celikovic, Igor; Zunic, Zora S.

    2008-08-07

    Lichen and Moss are widely used to assess the atmospheric pollution by heavy metals and radionuclides. In this paper, we report results of uranium and its isotope ratios using mass spectrometric measurements (followed by chemical separation procedure) for mosses, lichens and soil samples from a depleted uranium (DU) target site in western Balkan region. Samples were collected in 2003 from Han Pijesak (Republika Srpska in Bosnia and Hercegovina). Inductively coupled plasma mass spectrometry (ICP-MS) measurements show the presence of high concentration of uranium in some samples. Concentration of uranium in moss samples ranged from 5.2-755.43 Bq/Kg. We have determined {sup 235}U/{sup 238}U isotope ratio using thermal ionization mass spectrometry (TIMS) from the samples with high uranium content and the ratios are in the range of 0.002097-0.002380. TIMS measurement confirms presence of DU in some samples. However, we have not noticed any traces of DU in samples containing lesser amount of uranium or from any samples from the living environment of same area.

  11. Active RNAP pre-initiation sites are highly mutated by cytidine deaminases in yeast, with AID targeting small RNA genes

    PubMed Central

    Taylor, Benjamin JM; Wu, Yee Ling; Rada, Cristina

    2014-01-01

    Cytidine deaminases are single stranded DNA mutators diversifying antibodies and restricting viral infection. Improper access to the genome leads to translocations and mutations in B cells and contributes to the mutation landscape in cancer, such as kataegis. It remains unclear how deaminases access double stranded genomes and whether off-target mutations favor certain loci, although transcription and opportunistic access during DNA repair are thought to play a role. In yeast, AID and the catalytic domain of APOBEC3G preferentially mutate transcriptionally active genes within narrow regions, 110 base pairs in width, fixed at RNA polymerase initiation sites. Unlike APOBEC3G, AID shows enhanced mutational preference for small RNA genes (tRNAs, snoRNAs and snRNAs) suggesting a putative role for RNA in its recruitment. We uncover the high affinity of the deaminases for the single stranded DNA exposed by initiating RNA polymerases (a DNA configuration reproduced at stalled polymerases) without a requirement for specific cofactors. DOI: http://dx.doi.org/10.7554/eLife.03553.001 PMID:25237741

  12. The Sensorless Pore Module of Voltage-gated K+ Channel Family 7 Embodies the Target Site for the Anticonvulsant Retigabine.

    PubMed

    Syeda, Ruhma; Santos, Jose S; Montal, Mauricio

    2016-02-01

    KCNQ (voltage-gated K(+) channel family 7 (Kv7)) channels control cellular excitability and underlie the K(+) current sensitive to muscarinic receptor signaling (the M current) in sympathetic neurons. Here we show that the novel anti-epileptic drug retigabine (RTG) modulates channel function of pore-only modules (PMs) of the human Kv7.2 and Kv7.3 homomeric channels and of Kv7.2/3 heteromeric channels by prolonging the residence time in the open state. In addition, the Kv7 channel PMs are shown to recapitulate the single-channel permeation and pharmacological specificity characteristics of the corresponding full-length proteins in their native cellular context. A mutation (W265L) in the reconstituted Kv7.3 PM renders the channel insensitive to RTG and favors the conductive conformation of the PM, in agreement to what is observed when the Kv7.3 mutant is heterologously expressed. On the basis of the new findings and homology models of the closed and open conformations of the Kv7.3 PM, we propose a structural mechanism for the gating of the Kv7.3 PM and for the site of action of RTG as a Kv7.2/Kv7.3 K(+) current activator. The results validate the modular design of human Kv channels and highlight the PM as a high-fidelity target for drug screening of Kv channels. PMID:26627826

  13. Get3 is a holdase chaperone and moves to deposition sites for aggregated proteins when membrane targeting is blocked

    PubMed Central

    Powis, Katie; Schrul, Bianca; Tienson, Heather; Gostimskaya, Irina; Breker, Michal; High, Stephen; Schuldiner, Maya; Jakob, Ursula; Schwappach, Blanche

    2013-01-01

    Summary The endomembrane system of yeast contains different tail-anchored proteins that are post-translationally targeted to membranes via their C-terminal transmembrane domain. This hydrophobic segment could be hazardous in the cytosol if membrane insertion fails, resulting in the need for energy-dependent chaperoning and the degradation of aggregated tail-anchored proteins. A cascade of GET proteins cooperates in a conserved pathway to accept newly synthesized tail-anchored proteins from ribosomes and guide them to a receptor at the endoplasmic reticulum, where membrane integration takes place. It is, however, unclear how the GET system reacts to conditions of energy depletion that might prevent membrane insertion and hence lead to the accumulation of hydrophobic proteins in the cytosol. Here we show that the ATPase Get3, which accommodates the hydrophobic tail anchor of clients, has a dual function: promoting tail-anchored protein insertion when glucose is abundant and serving as an ATP-independent holdase chaperone during energy depletion. Like the generic chaperones Hsp42, Ssa2, Sis1 and Hsp104, we found that Get3 moves reversibly to deposition sites for protein aggregates, hence supporting the sequestration of tail-anchored proteins under conditions that prevent tail-anchored protein insertion. Our findings support a ubiquitous role for the cytosolic GET complex as a triaging platform involved in cellular proteostasis. PMID:23203805

  14. Phenyl aldehyde and propanoids exert multiple sites of action towards cell membrane and cell wall targeting ergosterol in Candida albicans

    PubMed Central

    2013-01-01

    In the present study, two phyto-compounds phenyl aldehyde (cinnamaldehyde) and propanoid (eugenol) were selected to explore their modes of action against Candida albicans. Electron microscopy, flow cytometry and spectroscopic assays were employed to determine the targets of these compounds. Treatment of C. albicans (CA04) with sub-MICs of cinnamaldehyde (50 μg/mL) and eugenol (200 μg/mL) indicated multiple sites of action including damages to cell walls, cell membranes, cytoplasmic contents and other membranous structures as observed under electron microscopy. Concentration and time dependent increase in the release of cytoplasmic contents accompanied with change in extracellular K+ concentration was recorded. Exposure of Candida cells at 4 × MIC of cinnaamldehyde and eugenol resulted in 40.21% and 50.90% dead cells, respectively as revealed by flow cytometry analysis. Treatment of Candida cells by cinnamaldehyde and eugenol at 0.5 × MIC showed 67.41% and 76.23% reduction in ergosterol biosynthesis, respectively. The binding assays reflected the ability of compounds to bind with the ergosterol. Our findings have suggested that the membrane damaging effects of phenyl aldehyde and propanoids class of compounds is attributed to their ability to inhibit ergosterol biosynthesis and simultaneously binding with ergosterol. Indirect or secondary action of these compounds on cell wall is also expected as revealed by electron microscopic studies. PMID:24010721

  15. Polymorphisms in Non-coding RNA Genes and Their Targets Sites as Risk Factors of Sporadic Colorectal Cancer.

    PubMed

    Vodicka, Pavel; Pardini, Barbara; Vymetalkova, Veronika; Naccarati, Alessio

    2016-01-01

    Colorectal cancer (CRC) is a complex disease that develops as a consequence of both genetic and environmental risk factors in interplay with epigenetic mechanisms, such as microRNAs (miRNAs). CRC cases are predominantly sporadic in which the disease develops with no apparent hereditary syndrome. The last decade has seen the progress of genome-wide association studies (GWAS) that allowed the discovery of several genetic regions and variants associated with weak effects on sporadic CRC. Collectively these variants may enable a more accurate prediction of an individual's risk to the disease and its prognosis. However, the number of variants contributing to CRC is still not fully explored.SNPs in genes encoding the miRNA sequence or in 3'UTR regions of the corresponding binding sites may affect miRNA transcription, miRNA processing, and/or the fidelity of the miRNA-mRNA interaction. These variants could plausibly impact miRNA expression and target mRNA translation into proteins critical for cellular integrity, differentiation, and proliferation.In the present chapter, we describe the different aspects of variations related to miRNAs and other non-coding RNAs (ncRNAs) and evidence from studies investigating these candidate genetic alterations in support to their role in CRC development and progression. PMID:27573898

  16. Secondary structure prediction and in vitro accessibility of mRNA as tools in the selection of target sites for ribozymes

    PubMed Central

    Amarzguioui, Mohammed; Brede, Gaute; Babaie, Eshrat; Grøtli, Morten; Sproat, Brian; Prydz, Hans

    2000-01-01

    We have investigated the relative merits of two commonly used methods for target site selection for ribozymes: secondary structure prediction (MFold program) and in vitro accessibility assays. A total of eight methylated ribozymes with DNA arms were synthesized and analyzed in a transient co-transfection assay in HeLa cells. Residual expression levels ranging from 23 to 72% were obtained with anti-PSKH1 ribozymes compared to cells transfected with an irrelevant control ribozyme. Ribozyme efficacy depended on both ribozyme concentration and the steady state expression levels of the target mRNA. Allylated ribozymes against a subset of the target sites generally displayed poorer efficacy than their methylated counterparts. This effect appeared to be influenced by in vivo accessibility of the target site. Ribozymes designed on the basis of either selection method displayed a wide range of efficacies with no significant differences in the average activities of the two groups of ribozymes. While in vitro accessibility assays had limited predictive power, there was a significant correlation between certain features of the predicted secondary structure of the target sequence and the efficacy of the corresponding ribozyme. Specifically, ribozyme efficacy appeared to be positively correlated with the presence of short stem regions and helices of low stability within their target sequences. There were no correlations with predicted free energy or loop length. PMID:11058107

  17. A glass spherule of questionable impact origin from the Apollo 15 landing site: Unique target mare basalt

    USGS Publications Warehouse

    Ryder, G.; Delano, J.W.; Warren, P.H.; Kallemeyn, G.W.; Dalrymple, G.B.

    1996-01-01

    the young age are perhaps all most consistent with an impact origin, but nonetheless not absolutely definitive. The 15434,28 glass is distinct from the common yellow impact glasses at the Apollo 15 landing site, in particular in its lower abundances of incompatible elements and much younger age. If we accept an impact origin, then the trace element relative abundances preclude both typical KREEP and the common Apollo 15 yellow impact glass from contributing more than a few percent of the incompatible elements to potential mixtures. The melted part of any target must have consisted almost entirely of a variety (or varieties) of mare basalt or glass distinct from any known mare basalts or glasses, including Apollo 15 yellow volcanic glass, or mixtures of them. However, the rind inclusions, similar to materials of local origin, do suggest a source near the Apollo 15 landing site. An impact melt cannot have dissolved much, if any, of such inclusions. A lack of regolith materials in the rind and in the melt component suggest an immature source terrain. Thus, even for an impact origin, there is the possibility (though not requirement) that the volcanic target is younger than most mare plains. The crater Hadley C, 25 km away, is a potential source. If the 15434,28 glass is instead directly of volcanic origin, it represents an extremely young mare magma of a type previously undiscovered on the Moon.

  18. O6-alkylguanine-DNA transferase (SNAP) as capture module for site-specific covalent bioconjugation of targeting protein on nanoparticles

    NASA Astrophysics Data System (ADS)

    Mazzucchelli, Serena; Colombo, Miriam; Galbiati, Elisabetta; Corsi, Fabio; Montenegro, Josè M.; Parak, Wolfgang J.; Prosperi, Davide

    2013-02-01

    A bimodular genetic fusion comprising a delivery module (scFv) and a capture module (SNAP) is proposed as a novel strategy for the biologically mediated site-specific covalent conjugation of targeting proteins to nanoparticles. ScFv800E6, an scFv mutant selective for HER2 antigen overexpressed in breast cancer cells was chosen as targeting ligand. The fusion protein SNAP-scFv was irreversibly immobilized on magnetofluorescent nanoparticles through the recognition between SNAP module and pegylated O6-alkylguanine derivative. The targeting efficiency of the resulting nanoparticle against HER2-positive breast cancer cells was assessed by flow cytometry and immunofluorescence.

  19. Genome-Wide Analysis of Binding Sites and Direct Target Genes of the Orphan Nuclear Receptor NR2F1/COUP-TFI

    PubMed Central

    Montemayor, Celina; Montemayor, Oscar A.; Ridgeway, Alex; Lin, Feng; Wheeler, David A.; Pletcher, Scott D.; Pereira, Fred A.

    2010-01-01

    Background Identification of bona fide direct nuclear receptor gene targets has been challenging but essential for understanding regulation of organismal physiological processes. Results We describe a methodology to identify transcription factor binding sites and target genes in vivo by intersecting microarray data, computational binding site queries, and evolutionary conservation. We provide detailed experimental validation of each step and, as a proof of principle, utilize the methodology to identify novel direct targets of the orphan nuclear receptor NR2F1 (COUP-TFI). The first step involved validation of microarray gene expression profiles obtained from wild-type and COUP-TFI−/− inner ear tissues. Secondly, we developed a bioinformatic tool to search for COUP-TFI DNA binding sites in genomes, using a classification-type Hidden Markov Model trained with 49 published COUP-TF response elements. We next obtained a ranked list of candidate in vivo direct COUP-TFI targets by integrating the microarray and bioinformatics analyses according to the degree of binding site evolutionary conservation and microarray statistical significance. Lastly, as proof-of-concept, 5 specific genes were validated for direct regulation. For example, the fatty acid binding protein 7 (Fabp7) gene is a direct COUP-TFI target in vivo because: i) we identified 2 conserved COUP-TFI binding sites in the Fabp7 promoter; ii) Fapb7 transcript and protein levels are significantly reduced in COUP-TFI−/− tissues and in MEFs; iii) chromatin immunoprecipitation demonstrates that COUP-TFI is recruited to the Fabp7 promoter in vitro and in vivo and iv) it is associated with active chromatin having increased H3K9 acetylation and enrichment for CBP and SRC-1 binding in the newborn brain. Conclusion We have developed and validated a methodology to identify in vivo direct nuclear receptor target genes. This bioinformatics tool can be modified to scan for response elements of transcription factors

  20. Bioinformatic and Genetic Association Analysis of MicroRNA Target Sites in One-Carbon Metabolism Genes

    PubMed Central

    Stone, Nicole; Pangilinan, Faith; Molloy, Anne M.; Shane, Barry; Scott, John M.; Ueland, Per Magne; Mills, James L.; Kirke, Peader N.; Sethupathy, Praveen; Brody, Lawrence C.

    2011-01-01

    One-carbon metabolism (OCM) is linked to DNA synthesis and methylation, amino acid metabolism and cell proliferation. OCM dysfunction has been associated with increased risk for various diseases, including cancer and neural tube defects. MicroRNAs (miRNAs) are ∼22 nt RNA regulators that have been implicated in a wide array of basic cellular processes, such as differentiation and metabolism. Accordingly, mis-regulation of miRNA expression and/or activity can underlie complex disease etiology. We examined the possibility of OCM regulation by miRNAs. Using computational miRNA target prediction methods and Monte-Carlo based statistical analyses, we identified two candidate miRNA “master regulators” (miR-22 and miR-125) and one candidate pair of “master co-regulators” (miR-344-5p/484 and miR-488) that may influence the expression of a significant number of genes involved in OCM. Interestingly, miR-22 and miR-125 are significantly up-regulated in cells grown under low-folate conditions. In a complementary analysis, we identified 15 single nucleotide polymorphisms (SNPs) that are located within predicted miRNA target sites in OCM genes. We genotyped these 15 SNPs in a population of healthy individuals (age 18–28, n = 2,506) that was previously phenotyped for various serum metabolites related to OCM. Prior to correction for multiple testing, we detected significant associations between TCblR rs9426 and methylmalonic acid (p  =  0.045), total homocysteine levels (tHcy) (p  =  0.033), serum B12 (p < 0.0001), holo transcobalamin (p < 0.0001) and total transcobalamin (p < 0.0001); and between MTHFR rs1537514 and red blood cell folate (p < 0.0001). However, upon further genetic analysis, we determined that in each case, a linked missense SNP is the more likely causative variant. Nonetheless, our Monte-Carlo based in silico simulations suggest that miRNAs could play an important role in the regulation of OCM. PMID:21765920

  1. A small RNA regulates multiple ABC transporter mRNAs by targeting C/A-rich elements inside and upstream of ribosome-binding sites

    PubMed Central

    Sharma, Cynthia M.; Darfeuille, Fabien; Plantinga, Titia H.; Vogel, Jörg

    2007-01-01

    The interactions of numerous regulatory small RNAs (sRNAs) with target mRNAs have been characterized, but how sRNAs can regulate multiple, structurally unrelated mRNAs is less understood. Here we show that Salmonella GcvB sRNA directly acts on seven target mRNAs that commonly encode periplasmic substrate-binding proteins of ABC uptake systems for amino acids and peptides. Alignment of GcvB homologs of distantly related bacteria revealed a conserved G/U-rich element that is strictly required for GcvB target recognition. Analysis of target gene fusion regulation in vivo, and in vitro structure probing and translation assays showed that GcvB represses its target mRNAs by binding to extended C/A-rich regions, which may also serve as translational enhancer elements. In some cases (oppA, dppA), GcvB repression can be explained by masking the ribosome-binding site (RBS) to prevent 30S subunit binding. However, GcvB can also effectively repress translation by binding to target mRNAs at upstream sites, outside the RBS. Specifically, GcvB represses gltI mRNA translation at the C/A-rich target site located at positions −57 to −45 relative to the start codon. Taken together, our study suggests highly conserved regions in sRNAs and mRNA regions distant from Shine-Dalgarno sequences as important elements for the identification of sRNA targets. PMID:17974919

  2. CRISPR/Cas9-Mediated Insertion of loxP Sites in the Mouse Dock7 Gene Provides an Effective Alternative to Use of Targeted Embryonic Stem Cells

    PubMed Central

    Bishop, Kathleen A.; Harrington, Anne; Kouranova, Evguenia; Weinstein, Edward J.; Rosen, Clifford J.; Cui, Xiaoxia; Liaw, Lucy

    2016-01-01

    Targeted gene mutation in the mouse is a primary strategy to understand gene function and relation to phenotype. The Knockout Mouse Project (KOMP) had an initial goal to develop a public resource of mouse embryonic stem (ES) cell clones that carry null mutations in all genes. Indeed, many useful novel mouse models have been generated from publically accessible targeted mouse ES cell lines. However, there are limitations, including incorrect targeting or cassette structure, and difficulties with germline transmission of the allele from chimeric mice. In our experience, using a small sample of targeted ES cell clones, we were successful ∼50% of the time in generating germline transmission of a correctly targeted allele. With the advent of CRISPR/Cas9 as a mouse genome modification tool, we assessed the efficiency of creating a conditional targeted allele in one gene, dedicator of cytokinesis 7 (Dock7), for which we were unsuccessful in generating a null allele using a KOMP targeted ES cell clone. The strategy was to insert loxP sites to flank either exons 3 and 4, or exons 3 through 7. By coinjecting Cas9 mRNA, validated sgRNAs, and oligonucleotide donors into fertilized eggs from C57BL/6J mice, we obtained a variety of alleles, including mice homozygous for the null alleles mediated by nonhomologous end joining, alleles with one of the two desired loxP sites, and correctly targeted alleles with both loxP sites. We also found frequent mutations in the inserted loxP sequence, which is partly attributable to the heterogeneity in the original oligonucleotide preparation. PMID:27175020

  3. CRISPR/Cas9-Mediated Insertion of loxP Sites in the Mouse Dock7 Gene Provides an Effective Alternative to Use of Targeted Embryonic Stem Cells.

    PubMed

    Bishop, Kathleen A; Harrington, Anne; Kouranova, Evguenia; Weinstein, Edward J; Rosen, Clifford J; Cui, Xiaoxia; Liaw, Lucy

    2016-01-01

    Targeted gene mutation in the mouse is a primary strategy to understand gene function and relation to phenotype. The Knockout Mouse Project (KOMP) had an initial goal to develop a public resource of mouse embryonic stem (ES) cell clones that carry null mutations in all genes. Indeed, many useful novel mouse models have been generated from publically accessible targeted mouse ES cell lines. However, there are limitations, including incorrect targeting or cassette structure, and difficulties with germline transmission of the allele from chimeric mice. In our experience, using a small sample of targeted ES cell clones, we were successful ∼50% of the time in generating germline transmission of a correctly targeted allele. With the advent of CRISPR/Cas9 as a mouse genome modification tool, we assessed the efficiency of creating a conditional targeted allele in one gene, dedicator of cytokinesis 7 (Dock7), for which we were unsuccessful in generating a null allele using a KOMP targeted ES cell clone. The strategy was to insert loxP sites to flank either exons 3 and 4, or exons 3 through 7. By coinjecting Cas9 mRNA, validated sgRNAs, and oligonucleotide donors into fertilized eggs from C57BL/6J mice, we obtained a variety of alleles, including mice homozygous for the null alleles mediated by nonhomologous end joining, alleles with one of the two desired loxP sites, and correctly targeted alleles with both loxP sites. We also found frequent mutations in the inserted loxP sequence, which is partly attributable to the heterogeneity in the original oligonucleotide preparation. PMID:27175020

  4. Comparative analysis of the Dicer-like gene family reveals loss of miR162 target site in SmDCL1 from Salvia miltiorrhiza

    PubMed Central

    Shao, Fenjuan; Qiu, Deyou; Lu, Shanfa

    2015-01-01

    DCL1, the core component for miRNA biogenesis, is itself regulated by miR162 in Arabidopsis. MiRNA-mediated feedback regulation of AtDCL1 is important to maintain the proper level of DCL1 transcripts. However, it is unknown whether the miRNA-mediated regulation of DCL1 is conserved among plants. We analyzed the SmDCL gene family in Salvia miltiorrhiza, an emerging model plant for Traditional Chinese Medicine (TCM) studies, using a comprehensive approach integrating genome-wide prediction, molecular cloning, gene expression profiling, and posttranscriptional regulation analysis. A total of five SmDCLs were identified. Comparative analysis of SmDCLs and AtDCLs showed an apparent enlargement of SmDCL introns in S. miltiorrhiza. The absence of miR162 in S. miltiorrhiza and the loss of miR162 target site in SmDCL1 were unexpectedly found. Further analysis showed that the miR162 target site was not present in DCL1 from ancient plants and was gained during plant evolution. The gained miR162 target site might be lost in a few modern plants through nucleotide mutations. Our results provide evidence for the gain and loss of miR162 and its target sites in Dicer-like genes during evolution. The data is useful for understanding the evolution of miRNA-mediated feedback regulation of DCLs in plants. PMID:25970825

  5. Comparative analysis of the Dicer-like gene family reveals loss of miR162 target site in SmDCL1 from Salvia miltiorrhiza.

    PubMed

    Shao, Fenjuan; Qiu, Deyou; Lu, Shanfa

    2015-01-01

    DCL1, the core component for miRNA biogenesis, is itself regulated by miR162 in Arabidopsis. MiRNA-mediated feedback regulation of AtDCL1 is important to maintain the proper level of DCL1 transcripts. However, it is unknown whether the miRNA-mediated regulation of DCL1 is conserved among plants. We analyzed the SmDCL gene family in Salvia miltiorrhiza, an emerging model plant for Traditional Chinese Medicine (TCM) studies, using a comprehensive approach integrating genome-wide prediction, molecular cloning, gene expression profiling, and posttranscriptional regulation analysis. A total of five SmDCLs were identified. Comparative analysis of SmDCLs and AtDCLs showed an apparent enlargement of SmDCL introns in S. miltiorrhiza. The absence of miR162 in S. miltiorrhiza and the loss of miR162 target site in SmDCL1 were unexpectedly found. Further analysis showed that the miR162 target site was not present in DCL1 from ancient plants and was gained during plant evolution. The gained miR162 target site might be lost in a few modern plants through nucleotide mutations. Our results provide evidence for the gain and loss of miR162 and its target sites in Dicer-like genes during evolution. The data is useful for understanding the evolution of miRNA-mediated feedback regulation of DCLs in plants. PMID:25970825

  6. Targeted Mutagenesis, Precise Gene Editing, and Site-Specific Gene Insertion in Maize Using Cas9 and Guide RNA[OPEN

    PubMed Central

    Schwartz, Christine; Gao, Huirong; Falco, S. Carl; Cigan, A. Mark

    2015-01-01

    Targeted mutagenesis, editing of endogenous maize (Zea mays) genes, and site-specific insertion of a trait gene using clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)-guide RNA technology are reported in maize. DNA vectors expressing maize codon-optimized Streptococcus pyogenes Cas9 endonuclease and single guide RNAs were cointroduced with or without DNA repair templates into maize immature embryos by biolistic transformation targeting five different genomic regions: upstream of the liguleless1 (LIG1) gene, male fertility genes (Ms26 and Ms45), and acetolactate synthase (ALS) genes (ALS1 and ALS2). Mutations were subsequently identified at all sites targeted, and plants containing biallelic multiplex mutations at LIG1, Ms26, and Ms45 were recovered. Biolistic delivery of guide RNAs (as RNA molecules) directly into immature embryo cells containing preintegrated Cas9 also resulted in targeted mutations. Editing the ALS2 gene using either single-stranded oligonucleotides or double-stranded DNA vectors as repair templates yielded chlorsulfuron-resistant plants. Double-strand breaks generated by RNA-guided Cas9 endonuclease also stimulated insertion of a trait gene at a site near LIG1 by homology-directed repair. Progeny showed expected Mendelian segregation of mutations, edits, and targeted gene insertions. The examples reported in this study demonstrate the utility of Cas9-guide RNA technology as a plant genome editing tool to enhance plant breeding and crop research needed to meet growing agriculture demands of the future. PMID:26269544

  7. Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

    PubMed Central

    Jones, W R; Stone, M P

    1998-01-01

    The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand. PMID:9461470

  8. Targeted Identification of SUMOylation Sites in Human Proteins Using Affinity Enrichment and Paralog-specific Reporter Ions*

    PubMed Central

    Lamoliatte, Frederic; Bonneil, Eric; Durette, Chantal; Caron-Lizotte, Olivier; Wildemann, Dirk; Zerweck, Johannes; Wenshuk, Holger; Thibault, Pierre

    2013-01-01

    Protein modification by small ubiquitin-like modifier (SUMO) modulates the activities of numerous proteins involved in different cellular functions such as gene transcription, cell cycle, and DNA repair. Comprehensive identification of SUMOylated sites is a prerequisite to determine how SUMOylation regulates protein function. However, mapping SUMOylated Lys residues by mass spectrometry (MS) is challenging because of the dynamic nature of this modification, the existence of three functionally distinct human SUMO paralogs, and the large SUMO chain remnant that remains attached to tryptic peptides. To overcome these problems, we created HEK293 cell lines that stably express functional SUMO paralogs with an N-terminal His6-tag and an Arg residue near the C terminus that leave a short five amino acid SUMO remnant upon tryptic digestion. We determined the fragmentation patterns of our short SUMO remnant peptides by collisional activation and electron transfer dissociation using synthetic peptide libraries. Activation using higher energy collisional dissociation on the LTQ-Orbitrap Elite identified SUMO paralog-specific fragment ions and neutral losses of the SUMO remnant with high mass accuracy (< 5 ppm). We exploited these features to detect SUMO modified tryptic peptides in complex cell extracts by correlating mass measurements of precursor and fragment ions using a data independent acquisition method. We also generated bioinformatics tools to retrieve MS/MS spectra containing characteristic fragment ions to the identification of SUMOylated peptide by conventional Mascot database searches. In HEK293 cell extracts, this MS approach uncovered low abundance SUMOylated peptides and 37 SUMO3-modified Lys residues in target proteins, most of which were previously unknown. Interestingly, we identified mixed SUMO-ubiquitin chains with ubiquitylated SUMO proteins (K20 and K32) and SUMOylated ubiquitin (K63), suggesting a complex crosstalk between these two modifications. PMID

  9. A nicotinic acetylcholine receptor mutation conferring target-site resistance to imidacloprid in Nilaparvata lugens (brown planthopper).

    PubMed

    Liu, Zewen; Williamson, Martin S; Lansdell, Stuart J; Denholm, Ian; Han, Zhaojun; Millar, Neil S

    2005-06-14

    Neonicotinoids, such as imidacloprid, are nicotinic acetylcholine receptor (nAChR) agonists with potent insecticidal activity. Since its introduction in the early 1990s, imidacloprid has become one of the most extensively used insecticides for both crop protection and animal health applications. As with other classes of insecticides, resistance to neonicotinoids is a significant threat and has been identified in several pest species, including the brown planthopper, Nilaparvata lugens, a major rice pest in many parts of Asia. In this study, radioligand binding experiments have been conducted with whole-body membranes prepared from imidacloprid-susceptible and imidacloprid-resistant strains of N. lugens. The results reveal a much higher level of [3H]imidacloprid-specific binding to the susceptible strain than to the resistant strain (16.7 +/- 1.0 and 0.34 +/- 0.21 fmol/mg of protein, respectively). With the aim of understanding the molecular basis of imidacloprid resistance, five nAChR subunits (Nlalpha1-Nlalpha4 and Nlbeta1) have been cloned from N. lugens.A comparison of nAChR subunit genes from imidacloprid-sensitive and imidacloprid-resistant populations has identified a single point mutation at a conserved position (Y151S) in two nAChR subunits, Nlalpha1 and Nlalpha3. A strong correlation between the frequency of the Y151S point mutation and the level of resistance to imidacloprid has been demonstrated by allele-specific PCR. By expression of hybrid nAChRs containing N. lugens alpha and rat beta2 subunits, evidence was obtained that demonstrates that mutation Y151S is responsible for a substantial reduction in specific [3H]imidacloprid binding. This study provides direct evidence for the occurrence of target-site resistance to a neonicotinoid insecticide. PMID:15937112

  10. Identification of a novel phosphorylation site in c-jun directly targeted in vitro by protein kinase D

    SciTech Connect

    Waldron, Richard T. . E-mail: rwaldron@mednet.ucla.edu; Whitelegge, Julian P.; Faull, Kym F.; Rozengurt, Enrique

    2007-05-04

    Protein kinase D (PKD) phosphorylates the c-jun amino-terminal in vitro at site(s) distinct from JNK [C. Hurd, R.T. Waldron, E. Rozengurt, Protein kinase D complexes with c-jun N-terminal kinase via activation loop phosphorylation and phosphorylates the c-jun N-terminus, Oncogene 21 (2002) 2154-2160], but the sites have not been identified. Here, metabolic {sup 32}P-labeling of c-jun protein in COS-7 cells indicated that PKD phosphorylates c-jun in vivo at a site(s) between aa 43-93, a region containing important functional elements. On this basis, the PKD-mediated phosphorylation site(s) was further characterized in vitro using GST-c-jun fusion proteins. PKD did not incorporate phosphate into Ser63 and Ser73, the JNK sites in GST-c-jun(1-89). Rather, PKD and JNK could sequentially phosphorylate distinct site(s) simultaneously. By mass spectrometry of tryptic phosphopeptides, Ser58 interposed between the JNK-binding portion of the delta domain and the adjacent TAD1 was identified as a prominent site phosphorylated in vitro by PKD. These data were further supported by kinase reactions using truncations or point-mutations of GST-c-jun. Together, these data suggest that PKD-mediated phosphorylation modulates c-jun at the level of its N-terminal functional domains.

  11. Improved design of hammerhead ribozyme for selective digestion of target RNA through recognition of site-specific adenosine-to-inosine RNA editing

    PubMed Central

    Fukuda, Masatora; Kurihara, Kei; Yamaguchi, Shota; Oyama, Yui; Deshimaru, Masanobu

    2014-01-01

    Adenosine-to-inosine (A-to-I) RNA editing is an endogenous regulatory mechanism involved in various biological processes. Site-specific, editing-state–dependent degradation of target RNA may be a powerful tool both for analyzing the mechanism of RNA editing and for regulating biological processes. Previously, we designed an artificial hammerhead ribozyme (HHR) for selective, site-specific RNA cleavage dependent on the A-to-I RNA editing state. In the present work, we developed an improved strategy for constructing a trans-acting HHR that specifically cleaves target editing sites in the adenosine but not the inosine state. Specificity for unedited sites was achieved by utilizing a sequence encoding the intrinsic cleavage specificity of a natural HHR. We used in vitro selection methods in an HHR library to select for an extended HHR containing a tertiary stabilization motif that facilitates HHR folding into an active conformation. By using this method, we successfully constructed highly active HHRs with unedited-specific cleavage. Moreover, using HHR cleavage followed by direct sequencing, we demonstrated that this ribozyme could cleave serotonin 2C receptor (HTR2C) mRNA extracted from mouse brain, depending on the site-specific editing state. This unedited-specific cleavage also enabled us to analyze the effect of editing state at the E and C sites on editing at other sites by using direct sequencing for the simultaneous quantification of the editing ratio at multiple sites. Our approach has the potential to elucidate the mechanism underlying the interdependencies of different editing states in substrate RNA with multiple editing sites. PMID:24448449

  12. Simultaneous quantification of protein phosphorylation sites using liquid chromatography-tandem mass spectrometry-based targeted proteomics: a linear algebra approach for isobaric phosphopeptides.

    PubMed

    Xu, Feifei; Yang, Ting; Sheng, Yuan; Zhong, Ting; Yang, Mi; Chen, Yun

    2014-12-01

    As one of the most studied post-translational modifications (PTM), protein phosphorylation plays an essential role in almost all cellular processes. Current methods are able to predict and determine thousands of phosphorylation sites, whereas stoichiometric quantification of these sites is still challenging. Liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS)-based targeted proteomics is emerging as a promising technique for site-specific quantification of protein phosphorylation using proteolytic peptides as surrogates of proteins. However, several issues may limit its application, one of which relates to the phosphopeptides with different phosphorylation sites and the same mass (i.e., isobaric phosphopeptides). While employment of site-specific product ions allows for these isobaric phosphopeptides to be distinguished and quantified, site-specific product ions are often absent or weak in tandem mass spectra. In this study, linear algebra algorithms were employed as an add-on to targeted proteomics to retrieve information on individual phosphopeptides from their common spectra. To achieve this simultaneous quantification, a LC-MS/MS-based targeted proteomics assay was first developed and validated for each phosphopeptide. Given the slope and intercept of calibration curves of phosphopeptides in each transition, linear algebraic equations were developed. Using a series of mock mixtures prepared with varying concentrations of each phosphopeptide, the reliability of the approach to quantify isobaric phosphopeptides containing multiple phosphorylation sites (≥ 2) was discussed. Finally, we applied this approach to determine the phosphorylation stoichiometry of heat shock protein 27 (HSP27) at Ser78 and Ser82 in breast cancer cells and tissue samples. PMID:25403019

  13. Characterization of sulfonylurea-resistant Schoenoplectus juncoides having a target-site Asp(376)Glu mutation in the acetolactate synthase.

    PubMed

    Sada, Yoshinao; Ikeda, Hajime; Yamato, Seiji; Kizawa, Satoru

    2013-09-01

    Schoenoplectus juncoides, a noxious weed for paddy rice, is known to become resistant to sulfonylurea (SU) herbicides by a target-site mutation in either of the two acetolactate synthase (ALS) genes (ALS1 and ALS2). SU-resistant S. juncoides plants having an Asp376Glu mutation in ALS2 were found from a paddy rice field in Japan, but their resistance profile has not been quantitatively investigated. In this study, dose-response of the SU-resistant accession was compared with that of a SU-susceptible accession at in vivo whole-plant level as well as at in vitro enzymatic level. In whole-plant tests, resistance factors (RFs) based on 50% growth reduction (GR50) for imazosulfuron (ISF), bensulfuron-methyl (BSM), metsulfuron-methyl (MSM), bispyribac-sodium (BPS), and imazaquin (IMQ) were 176, 40, 14, 5.2 and 1.5, respectively. Thus, the accession having an Asp376Glu mutation in ALS2 was highly resistant to the three SU herbicides and moderately resistant to BPS, but was not substantially resistant to IMQ. This is slightly different from the earlier results reported from other weeds with an Asp376Glu mutation, in which the mutation confers resistance to broadly all the chemical classes of ALS-inhibiting herbicides. In enzymatic tests, ALS2 of S. juncoides was expressed in E. coli; the resultant ALS2 was subjected to an in vitro assay. RFs of the mutated ALS2 based on 50% enzymatic inhibition (I50) for ISF, BSM, MSM, BPS, and IMQ were 3699, 2438, 322, 80, and 4.8, respectively. The RFs of ALS2 were highly correlated with those of the whole-plant; this suggests that the Asp376Glu mutation in ALS2 is a molecular basis for the whole-plant resistance. The presence of two ALS genes in S. juncoides can at least partially explain why the whole-plant RFs were less than those of the expressed ALS2 enzymes. PMID:25149243

  14. Rhodium(II) Proximity-Labeling Identifies a Novel Target Site on STAT3 for Inhibitors with Potent Anti-Leukemia Activity.

    PubMed

    Minus, Matthew B; Liu, Wei; Vohidov, Farrukh; Kasembeli, Moses M; Long, Xin; Krueger, Michael J; Stevens, Alexandra; Kolosov, Mikhail I; Tweardy, David J; Sison, Edward Allan R; Redell, Michele S; Ball, Zachary T

    2015-10-26

    Nearly 40 % of children with acute myeloid leukemia (AML) suffer relapse arising from chemoresistance, often involving upregulation of the oncoprotein STAT3 (signal transducer and activator of transcription 3). Herein, rhodium(II)-catalyzed, proximity-driven modification identifies the STAT3 coiled-coil domain (CCD) as a novel ligand-binding site, and we describe a new naphthalene sulfonamide inhibitor that targets the CCD, blocks STAT3 function, and halts its disease-promoting effects in vitro, in tumor growth models, and in a leukemia mouse model, validating this new therapeutic target for resistant AML. PMID:26480340

  15. Structure-function studies of STAR family Quaking proteins bound to their in vivo RNA target sites

    SciTech Connect

    Teplova, Marianna; Hafner, Markus; Teplov, Dmitri; Essig, Katharina; Tuschl, Thomas; Patel, Dinshaw J.

    2013-09-27

    Mammalian Quaking (QKI) and its Caenorhabditis elegans homolog, GLD-1 (defective in germ line development), are evolutionarily conserved RNA-binding proteins, which post-transcriptionally regulate target genes essential for developmental processes and myelination. We present X-ray structures of the STAR (signal transduction and activation of RNA) domain, composed of Qua1, K homology (KH), and Qua2 motifs of QKI and GLD-1 bound to high-affinity in vivo RNA targets containing YUAAY RNA recognition elements (RREs). The KH and Qua2 motifs of the STAR domain synergize to specifically interact with bases and sugar-phosphate backbones of the bound RRE. Qua1-mediated homodimerization generates a scaffold that enables concurrent recognition of two RREs, thereby plausibly targeting tandem RREs present in many QKI-targeted transcripts. Structure-guided mutations reduced QKI RNA-binding affinity in vitro and in vivo, and expression of QKI mutants in human embryonic kidney cells (HEK293) significantly decreased the abundance of QKI target mRNAs. Overall, our studies define principles underlying RNA target selection by STAR homodimers and provide insights into the post-transcriptional regulatory function of mammalian QKI proteins.

  16. Design of a hairpin polyamide, ZT65B, for targeting the inverted CCAAT box (ICB) site in the multidrug resistant (MDR1) gene.

    PubMed

    Buchmueller, Karen L; Taherbhai, Zarmeen; Howard, Cameron M; Bailey, Suzanna L; Nguyen, Binh; O'Hare, Caroline; Hochhauser, Daniel; Hartley, John A; Wilson, W David; Lee, Moses

    2005-12-01

    A novel hairpin polyamide, ZT65B, containing a 3-methylpicolinate moiety was designed to target the inverted CCAAT box (ICB) of the human multidrug resistance 1 gene (MDR1) promoter. Binding of nuclear factor-Y (NF-Y) to the ICB site upregulates MDR1 gene expression and is, therefore, a good target for anticancer therapeutic agents. However, it is important to distinguish amongst different promoter ICB sites so that only specific genes will be affected. All ICB sites have the same sequence but they differ in the sequence of the flanking base pairs, which can be exploited in the design of sequence-specific polyamides. To test this hypothesis, ten ICB-containing DNA hairpins were designed with different flanking base pairs; the sequences ICBa and ICBb were similar to the 3'-ICB site of MDR1 (TGGCT). Thermal-denaturation studies showed that ZT65B effectively targeted ICBa and ICBb (DeltaTM=6.5 and 7.0 degrees C) in preference to the other DNA hairpins (<3.5 degrees C), with the exception of ICBc (5.0 degrees C). DNase I-footprinting assays were carried out with the topoisomerase IIalpha-promoter sequence, which contains five ICB sites; of these, ICB1 and ICB5 are similar to the ICB site of MDR1. ZT65B was found to selectively bind ICB1 and ICB5; footprints were not observed with ICB2, ICB3, or ICB4. A strong, positive induced ligand band at 325 nm in CD studies confirmed that ZT65B binds in the DNA minor groove. The selectivity of ZT65B binding to hairpins that contained the MDR1 ICB site compared to one that did not (ICBd) was confirmed by surface-plasmon studies, and equilibrium constants of 5x10(6)-1x10(7) and 4.6x10(5) M-1 were obtained with ICB1, ICB5,and ICB2 respectively. ZT65B and the previously published JH37 (J. A. Henry, et al. Biochemistry 2004, 43, 12 249-12 257) serve as prototypes for the design of novel polyamides. These can be used to specifically target the subset of ubiquitous gene elements known as ICBs, and thereby affect the expression of one or

  17. UV cross-link mapping of the substrate-binding site of an RNase P ribozyme to a target mRNA sequence.

    PubMed Central

    Kilani, A F; Liu, F

    1999-01-01

    RNase P ribozyme cleaves an RNA helix that resembles the acceptor stem and T-stem structure of its natural ptRNA substrate. When covalently linked with a guide sequence, the ribozyme can function as a sequence-specific endonuclease and cleave any target RNA sequences that base pair with the guide sequence. Using a site-directed ultraviolet (UV) cross-linking approach, we have mapped the regions of the ribozyme that are in close proximity to a substrate that contains the mRNA sequence encoding thymidine kinase of human herpes simplex virus 1. Our data suggest that the cleavage site of the mRNA substrate is positioned at the same regions of the ribozyme that bind to the cleavage site of a ptRNA. The mRNA-binding domains include regions that interact with the acceptor stem and T-stem and in addition, regions that are unique and not in close contact with a ptRNA. Identification of the mRNA-binding site provides a foundation to study how RNase P ribozymes achieve their sequence specificity and facilitates the development of gene-targeting ribozymes. PMID:10496224

  18. Site-Specific Impact of a Regional Hydrodynamic Injection: Computed Tomography Study during Hydrodynamic Injection Targeting the Swine Liver

    PubMed Central

    Yokoo, Takeshi; Kanefuji, Tsutomu; Suda, Takeshi; Kamimura, Kenya; Liu, Dexi; Terai, Shuji

    2015-01-01

    A hemodynamic study of hydrodynamic gene delivery (HGD) from the tail vein in rodents has inspired a mechanism and an approach to further improve the efficacy of this procedure. However, there is no report on the hemodynamics of a regional HGD, which is an inevitable approach in large animals. Here, we report the hemodynamics of a regional hydrodynamic injection in detail based on 3D volume data and the dynamism of tissue intensity over time by using computed tomography (CT) both during and after a regional hydrodynamic injection that targeted the liver of a pig weighing 15.6 kg. Contrast medium (CM) was injected at a steady speed of 20 mL/s for 7.5 s under the temporal balloon occlusion of the hepatic vein (HV). A retrograde flow formed a wedge-shaped strong enhancement area downstream of the corresponding HV within 2.5 s, which was followed by drainage into another HV beginning from the target area and the portal vein (PV) toward a non-target area of the liver. After the injection, the CM was readily eliminated from the PV outside the target area. These data suggest that an interventional radiology approach is effective in limiting the hydrodynamic impacts in large animals at a target area and that the burden overflowing into the PV is limited. A further investigation that simultaneously evaluates gene delivery efficiency and hemodynamics using CT is needed to establish feasible parameters for a regional HGD in large animals. PMID:26389943

  19. Comprehensive comparison of the interaction of the E2 master regulator with its cognate target DNA sites in 73 human papillomavirus types by sequence statistics

    PubMed Central

    Sánchez, Ignacio E.; Dellarole, Mariano; Gaston, Kevin; de Prat Gay, Gonzalo

    2008-01-01

    Mucosal human papillomaviruses (HPVs) are etiological agents of oral, anal and genital cancer. Properties of high- and low-risk HPV types cannot be reduced to discrete molecular traits. The E2 protein regulates viral replication and transcription through a finely tuned interaction with four sites at the upstream regulatory region of the genome. A computational study of the E2–DNA interaction in all 73 types within the alpha papillomavirus genus, including all known mucosal types, indicates that E2 proteins have similar DNA discrimination properties. Differences in E2–DNA interaction among HPV types lie mostly in the target DNA sequence, as opposed to the amino acid sequence of the conserved DNA-binding alpha helix of E2. Sequence logos of natural and in vitro selected sites show an asymmetric pattern of conservation arising from indirect readout, and reveal evolutionary pressure for a putative methylation site. Based on DNA sequences only, we could predict differences in binding energies with a standard deviation of 0.64 kcal/mol. These energies cluster into six discrete affinity hierarchies and uncovered a fifth E2-binding site in the genome of six HPV types. Finally, certain distances between sites, affinity hierarchies and their eventual changes upon methylation, are statistically associated with high-risk types. PMID:18084026

  20. AADS--an automated active site identification, docking, and scoring protocol for protein targets based on physicochemical descriptors.

    PubMed

    Singh, Tanya; Biswas, D; Jayaram, B

    2011-10-24

    We report here a robust automated active site detection, docking, and scoring (AADS) protocol for proteins with known structures. The active site finder identifies all cavities in a protein and scores them based on the physicochemical properties of functional groups lining the cavities in the protein. The accuracy realized on 620 proteins with sizes ranging from 100 to 600 amino acids with known drug active sites is 100% when the top ten cavity points are considered. These top ten cavity points identified are then submitted for an automated docking of an input ligand/candidate molecule. The docking protocol uses an all atom energy based Monte Carlo method. Eight low energy docked structures corresponding to different locations and orientations of the candidate molecule are stored at each cavity point giving 80 docked structures overall which are then ranked using an effective free energy function and top five structures are selected. The predicted structure and energetics of the complexes agree quite well with experiment when tested on a data set of 170 protein-ligand complexes with known structures and binding affinities. The AADS methodology is implemented on an 80 processor cluster and presented as a freely accessible, easy to use tool at http://www.scfbio-iitd.res.in/dock/ActiveSite_new.jsp . PMID:21877713

  1. Phosphorylation Sites Identified in the NEIL1 DNA Glycosylase Are Potential Targets for the JNK1 Kinase

    PubMed Central

    Prakash, Aishwarya; Cao, Vy Bao; Doublié, Sylvie

    2016-01-01

    The NEIL1 DNA glycosylase is one of eleven mammalian DNA glycosylases that partake in the first step of the base excision repair (BER) pathway. NEIL1 recognizes and cleaves mainly oxidized pyrimidines from DNA. The past decade has witnessed the identification of an increasing number of post-translational modifications (PTMs) in BER enzymes including phosphorylation, acetylation, and sumoylation, which modulate enzyme function. In this work, we performed the first comprehensive analysis of phosphorylation sites in human NEIL1 expressed in human cells. Mass spectrometry (MS) analysis revealed phosphorylation at three serine residues: S207, S306, and a third novel site, S61. We expressed, purified, and characterized phosphomimetic (glutamate) and phosphoablating (alanine) mutants of the three phosphorylation sites in NEIL1 revealed by the MS analysis. All mutant enzymes were active and bound tightly to DNA, indicating that phosphorylation does not affect DNA binding and enzyme activity at these three serine sites. We also characterized phosphomimetic mutants of two other sites of phosphorylation, Y263 and S269, reported previously, and observed that mutation of Y263 to E yielded a completely inactive enzyme. Furthermore, based on sequence motifs and kinase prediction algorithms, we identified the c-Jun N-terminal kinase 1 (JNK1) as the kinase involved in the phosphorylation of NEIL1. JNK1, a member of the mitogen activated protein kinase (MAPK) family, was detected in NEIL1 immunoprecipitates, interacted with NEIL1 in vitro, and was able to phosphorylate the enzyme at residues S207, S306, and S61. PMID:27518429

  2. Synergistic and compensatory effects of two point mutations conferring target-site resistance to fipronil in the insect GABA receptor RDL

    PubMed Central

    Zhang, Yixi; Meng, Xiangkun; Yang, Yuanxue; Li, Hong; Wang, Xin; Yang, Baojun; Zhang, Jianhua; Li, Chunrui; Millar, Neil S.; Liu, Zewen

    2016-01-01

    Insecticide resistance can arise from a variety of mechanisms, including changes to the target site, but is often associated with substantial fitness costs to insects. Here we describe two resistance-associated target-site mutations that have synergistic and compensatory effects that combine to produce high and persistent levels of resistance to fipronil, an insecticide targeting on γ-aminobytyric acid (GABA) receptors. In Nilaparvata lugens, a major pest of rice crops in many parts of Asia, we have identified a single point mutation (A302S) in the GABA receptor RDL that has been identified previously in other species and which confers low levels of resistance to fipronil (23-fold) in N. lugans. In addition, we have identified a second resistance-associated RDL mutation (R300Q) that, in combination with A302S, is associated with much higher levels of resistance (237-fold). The R300Q mutation has not been detected in the absence of A302S in either laboratory-selected or field populations, presumably due to the high fitness cost associated with this mutation. Significantly, it appears that the A302S mutation is able to compensate for deleterious effects of R300Q mutation on fitness cost. These findings identify a novel resistance mechanism and may have important implications for the spread of insecticide resistance. PMID:27557781

  3. The relationship between the target effective site concentration of rocuronium and the degree of recovery from neuromuscular blockade in elderly patients

    PubMed Central

    Fan, Xiaochong; Ma, Minyu; Li, Zhisong; Gong, Shengkai; Zhang, Wei; Wen, Yuanyuan

    2015-01-01

    Objective: To study the relationship between the target effective site concentration (Ce) of rocuronium and the degree of recovery from neuromuscular blockade in elderly patients. Methods: 50 elderly patients (ASA grade II) scheduled for selective surgical procedure under general anaesthesia were randomly divided into two groups, A and B, with 25 cases in each group. The Ce of rocuronium for intubation was 3 μg·ml-1 in both groups, and the Ce during operation were 0.8 and 1.0 μg·ml-1 in group A and B, respectively. When target controlled infusion of rocuronium was stopped, without the administration of reversal agents for neuromuscular blockade, the relationship between Ce and the first twitch height (T1) was studied by regression analysis. Results: There was a significant linear relationship between Ce and T1, and there was no statistical difference in regression coefficient and interception between group A and B (P>0.05). Conclusion: The degree of recovery from neuromuscular blockade could be judged by the target effective site concentration of rocuronium at the time of reversal from neuromuscular blockade in the elderly patients. PMID:26629159

  4. Synergistic and compensatory effects of two point mutations conferring target-site resistance to fipronil in the insect GABA receptor RDL.

    PubMed

    Zhang, Yixi; Meng, Xiangkun; Yang, Yuanxue; Li, Hong; Wang, Xin; Yang, Baojun; Zhang, Jianhua; Li, Chunrui; Millar, Neil S; Liu, Zewen

    2016-01-01

    Insecticide resistance can arise from a variety of mechanisms, including changes to the target site, but is often associated with substantial fitness costs to insects. Here we describe two resistance-associated target-site mutations that have synergistic and compensatory effects that combine to produce high and persistent levels of resistance to fipronil, an insecticide targeting on γ-aminobytyric acid (GABA) receptors. In Nilaparvata lugens, a major pest of rice crops in many parts of Asia, we have identified a single point mutation (A302S) in the GABA receptor RDL that has been identified previously in other species and which confers low levels of resistance to fipronil (23-fold) in N. lugans. In addition, we have identified a second resistance-associated RDL mutation (R300Q) that, in combination with A302S, is associated with much higher levels of resistance (237-fold). The R300Q mutation has not been detected in the absence of A302S in either laboratory-selected or field populations, presumably due to the high fitness cost associated with this mutation. Significantly, it appears that the A302S mutation is able to compensate for deleterious effects of R300Q mutation on fitness cost. These findings identify a novel resistance mechanism and may have important implications for the spread of insecticide resistance. PMID:27557781

  5. Increasing frequencies of site-specific mutagenesis and gene targeting in Arabidopsis by manipulating DNA repair pathways.

    PubMed

    Qi, Yiping; Zhang, Yong; Zhang, Feng; Baller, Joshua A; Cleland, Spencer C; Ryu, Yungil; Starker, Colby G; Voytas, Daniel F

    2013-03-01

    Improved methods for engineering sequence-specific nucleases, including zinc finger nucleases (ZFNs) and TAL effector nucleases (TALENs), have made it possible to precisely modify plant genomes. However, the success of genome modification is largely dependent on the intrinsic activity of the engineered nucleases. In this study, we sought to enhance ZFN-mediated targeted mutagenesis and gene targeting (GT) in Arabidopsis by manipulating DNA repair pathways. Using a ZFN that creates a double-strand break (DSB) at the endogenous ADH1 locus, we analyzed repair outcomes in the absence of DNA repair proteins such as KU70 and LIG4 (both involved in classic nonhomologous end-joining, NHEJ) and SMC6B (involved in sister-chromatid-based homologous recombination, HR). We achieved a fivefold to 16-fold enhancement in HR-based GT in a ku70 mutant and a threefold to fourfold enhancement in GT in the lig4 mutant. Although the NHEJ mutagenesis frequency was not significantly changed in ku70 or lig4, DNA repair was shifted to microhomology-dependent alternative NHEJ. As a result, mutations in both ku70 and lig4 were predominantly large deletions, which facilitates easy screening for mutations by PCR. Interestingly, NHEJ mutagenesis and GT at the ADH1 locus were enhanced by sixfold to eightfold and threefold to fourfold, respectively, in a smc6b mutant. The increase in NHEJ-mediated mutagenesis by loss of SMC6B was further confirmed using ZFNs that target two other Arabidopsis genes, namely, TT4 and MPK8. Considering that components of DNA repair pathways are highly conserved across species, mutations in DNA repair genes likely provide a universal strategy for harnessing repair pathways to achieve desired targeted genome modifications. PMID:23282329

  6. Myosin‑II heavy chain and formin mediate the targeting of myosin essential light chain to the division site before and during cytokinesis.

    PubMed

    Feng, Zhonghui; Okada, Satoshi; Cai, Guoping; Zhou, Bing; Bi, Erfei

    2015-04-01

    MLC1 is a haploinsufficient gene encoding the essential light chain for Myo1, the sole myosin‑II heavy chain in the budding yeast Saccharomyces cerevisiae. Mlc1 defines an essential hub that coordinates actomyosin ring function, membrane trafficking, and septum formation during cytokinesis by binding to IQGAP, myosin‑II, and myosin‑V. However, the mechanism of how Mlc1 is targeted to the division site during the cell cycle remains unsolved. By constructing a GFP‑tagged MLC1 under its own promoter control and using quantitative live‑cell imaging coupled with yeast mutants, we found that septin ring and actin filaments mediate the targeting of Mlc1 to the division site before and during cytokinesis, respectively. Both mechanisms contribute to and are collectively required for the accumulation of Mlc1 at the division site during cytokinesis. We also found that Myo1 plays a major role in the septin‑dependent Mlc1 localization before cytokinesis, whereas the formin Bni1 plays a major role in the actin filament-dependent Mlc1 localization during cytokinesis. Such a two‑tiered mechanism for Mlc1 localization is presumably required for the ordered assembly and robustness of cytokinesis machinery and is likely conserved across species. PMID:25631819

  7. Targeting of Chitin Synthase 3 to Polarized Growth Sites in Yeast Requires Chs5p and Myo2p

    PubMed Central

    Santos, Beatriz; Snyder, Michael

    1997-01-01

    Chitin is an essential structural component of the yeast cell wall whose deposition is regulated throughout the yeast life cycle. The temporal and spatial regulation of chitin synthesis was investigated during vegetative growth and mating of Saccharomyces cerevisiae by localization of the putative catalytic subunit of chitin synthase III, Chs3p, and its regulator, Chs5p. Immunolocalization of epitope-tagged Chs3p revealed a novel localization pattern that is cell cycledependent. Chs3p is polarized as a diffuse ring at the incipient bud site and at the neck between the mother and bud in small-budded cells; it is not found at the neck in large-budded cells containing a single nucleus. In large-budded cells undergoing cytokinesis, it reappears as a ring at the neck. In cells responding to mating pheromone, Chs3p is found throughout the projection. The appearance of Chs3p at cortical sites correlates with times that chitin synthesis is expected to occur. In addition to its localization at the incipient bud site and neck, Chs3p is also found in cytoplasmic patches in cells at different stages of the cell cycle. Epitope-tagged Chs5p also localizes to cytoplasmic patches; these patches contain Kex2p, a late Golgi-associated enzyme. Unlike Chs3p, Chs5p does not accumulate at the incipient bud site or neck. Nearly all Chs3p patches contain Chs5p, whereas some Chs5p patches lack detectable Chs3p. In the absence of Chs5p, Chs3p localizes in cytoplasmic patches, but it is no longer found at the neck or the incipient bud site, indicating that Chs5p is required for the polarization of Chs3p. Furthermore, Chs5p localization is not affected either by temperature shift or by the myo2-66 mutation, however, Chs3p polarization is affected by temperature shift and myo2-66. We suggest a model in which Chs3p polarization to cortical sites in yeast is dependent on both Chs5p and the actin cytoskeleton/Myo2p. PMID:9008706

  8. Dysferlin rescue by spliceosome-mediated pre-mRNA trans-splicing targeting introns harbouring weakly defined 3' splice sites.

    PubMed

    Philippi, Susanne; Lorain, Stéphanie; Beley, Cyriaque; Peccate, Cécile; Précigout, Guillaume; Spuler, Simone; Garcia, Luis

    2015-07-15

    The modification of the pre-mRNA cis-splicing process employing a pre-mRNA trans-splicing molecule (PTM) is an attractive strategy for the in situ correction of genes whose careful transcription regulation and full-length expression is determinative for protein function, as it is the case for the dysferlin (DYSF, Dysf) gene. Loss-of-function mutations of DYSF result in different types of muscular dystrophy mainly manifesting as limb girdle muscular dystrophy 2B (LGMD2B) and Miyoshi muscular dystrophy 1 (MMD1). We established a 3' replacement strategy for mutated DYSF pre-mRNAs induced by spliceosome-mediated pre-mRNA trans-splicing (SmaRT) by the use of a PTM. In contrast to previously established SmaRT strategies, we particularly focused on the identification of a suitable pre-mRNA target intron other than the optimization of the PTM design. By targeting DYSF pre-mRNA introns harbouring differentially defined 3' splice sites (3' SS), we found that target introns encoding weakly defined 3' SSs were trans-spliced successfully in vitro in human LGMD2B myoblasts as well as in vivo in skeletal muscle of wild-type and Dysf(-/-) mice. For the first time, we demonstrate rescue of Dysf protein by SmaRT in vivo. Moreover, we identified concordant qualities among the successfully targeted Dysf introns and targeted endogenous introns in previously reported SmaRT approaches that might facilitate a selective choice of target introns in future SmaRT strategies. PMID:25904108

  9. Open challenges in structure-based virtual screening: Receptor modeling, target flexibility consideration and active site water molecules description.

    PubMed

    Spyrakis, Francesca; Cavasotto, Claudio N

    2015-10-01

    Structure-based virtual screening is currently an established tool in drug lead discovery projects. Although in the last years the field saw an impressive progress in terms of algorithm development, computational performance, and retrospective and prospective applications in ligand identification, there are still long-standing challenges where further improvement is needed. In this review, we consider the conceptual frame, state-of-the-art and recent developments of three critical "structural" issues in structure-based drug lead discovery: the use of homology modeling to accurately model the binding site when no experimental structures are available, the necessity of accounting for the dynamics of intrinsically flexible systems as proteins, and the importance of considering active site water molecules in lead identification and optimization campaigns. PMID:26271444

  10. Analysis of landing site attributes for future missions targeting the rim of the lunar South Pole Aitken basin

    NASA Astrophysics Data System (ADS)

    Koebel, David; Bonerba, Michele; Behrenwaldt, Daniel; Wieser, Matthias; Borowy, Carsten

    2012-11-01

    For the South polar lunar region between -85 and -90° Latitude an updated analyses of the solar illumination and ground station visibility conditions has been performed in the frame of a feasibility study for an ESA Lunar Lander mission. The analyses are based on the refined lunar digital elevation model provided by the Japanese Kaguya/Selene mission, originating from its LASER altimeter instrument. For the South polar region maps of integral solar illumination are presented for a mission epoch in 2016. The analysis modelling was validated with the help of a Kaguya High Definition video. The solar illumination is driving for the power subsystems of any robotic lander craft or manned lunar outpost, in case they rely on conventional photovoltaic power generation with battery buffering of shadowed periods. In addition the visibility of the terrain from a terrestrial ESA ground station was analysed. The results are presented as an integral ground contact duration map, being crucial for the operations of any lunar outpost. Considering these two quality criteria, several possible landing sites for a future lunar mission have been pre-selected. For these sites a detailed analysis of quasi-continuous illumination conditions is presented. This includes magnified maps of the pre-selected areas, showing any location's longest illumination intervals that are allowed to be interrupted by shadows with limited duration only. As a final quality criterion, the terrain topology has been analysed for its impact on the landing trajectory. From a trade-off between the three quality criteria the connecting ridge between the Shackleton and the de Gerlache was determined to provide the most favourable landing site quality. This site is located at 89°28' South, 136°40' West, and 1947 m altitude, and features and integral illumination of 85.7%. With battery energy to sustain shadows of 120 h, total mission duration of 9.37 sidereal months can be guaranteed.

  11. Validation of BKV Large T-antigen ATP-Binding Site as a Target for Drug Discovery

    PubMed Central

    Zheng, Gang; Bueno, Marta; Camachos, Carlos J; Randhawa, Parmjeet

    2009-01-01

    Summary BK virus large T antigen (LTA) is a hexameric protein with a helicase activity that is powered by ATP hydrolysis. A mutant virus with Lys420Ala, Arg421Ala, and Asp504Ala mutations at the ATP binding sites showed marked reduction in viral fitness. This observation indicates that high throughput screening for ATPase inhibitors will be valid strategy to discover anti-BKV drugs. PMID:19084558

  12. Targeted Health Assessment for Wastes Contained at the Niagara Falls Storage Site to Guide Planning for Remedial Action Alternatives - 13428

    SciTech Connect

    Busse, John; Keil, Karen; Staten, Jane; Miller, Neil; Barker, Michelle; MacDonell, Margaret; Peterson, John; Chang, Young-Soo; Durham, Lisa

    2013-07-01

    The U.S. Army Corps of Engineers (USACE) is evaluating potential remedial alternatives at the 191-acre Niagara Falls Storage Site (NFSS) in Lewiston, New York, under the Formerly Utilized Sites Remedial Action Program (FUSRAP). The Manhattan Engineer District (MED) and Atomic Energy Commission (AEC) brought radioactive wastes to the site during the 1940's and 1950's, and the U.S. Department of Energy (US DOE) consolidated these wastes into a 10-acre interim waste containment structure (IWCS) in the southwest portion of the site during the 1980's. The USACE is evaluating remedial alternatives for radioactive waste contained within the IWCS at the NFSS under the Feasibility Study phase of the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) process. A preliminary evaluation of the IWCS has been conducted to assess potential airborne releases associated with uncovered wastes, particularly during waste excavation, as well as direct exposures to uncovered wastes. Key technical issues for this assessment include: (1) limitations in waste characterization data; (2) representative receptors and exposure routes; (3) estimates of contaminant emissions at an early stage of the evaluation process; (4) consideration of candidate meteorological data and air dispersion modeling approaches; and (5) estimates of health effects from potential exposures to both radionuclides and chemicals that account for recent updates of exposure and toxicity factors. Results of this preliminary health risk assessment indicate if the wastes were uncovered and someone stayed at the IWCS for a number of days to weeks, substantial doses and serious health effects could be incurred. Current controls prevent such exposures, and the controls that would be applied to protect onsite workers during remedial action at the IWCS would also effectively protect the public nearby. This evaluation provides framing context for the upcoming development and detailed evaluation of

  13. Search by proteins for their DNA target site: 1. The effect of DNA conformation on protein sliding

    PubMed Central

    Bhattacherjee, Arnab; Levy, Yaakov

    2014-01-01

    The recognition of DNA-binding proteins (DBPs) to their specific site often precedes by a search technique in which proteins slide, hop along the DNA contour or perform inter-segment transfer and 3D diffusion to dissociate and re-associate to distant DNA sites. In this study, we demonstrated that the strength and nature of the non-specific electrostatic interactions, which govern the search dynamics of DBPs, are strongly correlated with the conformation of the DNA. We tuned two structural parameters, namely curvature and the extent of helical twisting in circular DNA. These two factors are mutually independent of each other and can modulate the electrostatic potential through changing the geometry of the circular DNA conformation. The search dynamics for DBPs on circular DNA is therefore markedly different compared with linear B-DNA. Our results suggest that, for a given DBP, the rotation-coupled sliding dynamics is precluded in highly curved DNA (as well as for over-twisted DNA) because of the large electrostatic energy barrier between the inside and outside of the DNA molecule. Under such circumstances, proteins prefer to hop in order to explore interior DNA sites. The change in the balance between sliding and hopping propensities as a function of DNA curvature or twisting may result in different search efficiency and speed. PMID:25324308

  14. Synaptic targeting of AMPA receptors is regulated by a CaMKII site in the first intracellular loop of GluA1

    PubMed Central

    Lu, Wei; Isozaki, Kaname; Roche, Katherine W.; Nicoll, Roger A.

    2010-01-01

    The accumulation of AMPA receptors (AMPARs) at synapses is essential for excitatory synaptic transmission. However, the mechanisms underlying synaptic targeting of AMPARs remain elusive. We have now used a molecular replacement approach on an AMPAR-null background to investigate the targeting mechanisms necessary for regulating AMPAR trafficking in the hippocampus. Although there is an extensive literature on the role of the GluA1 C-tail in AMPAR trafficking, there is no effect of overexpressing the C-tail on basal transmission. Instead, we found that the first intracellular loop domain (Loop1) of GluA1, a previously overlooked region within AMPARs, is critical for receptor targeting to synapses, but not for delivery of receptors to the plasma membrane. We also identified a CaMKII phosphorylation site (S567) in the GluA1 Loop1, which is phosphorylated in vitro and in vivo. Furthermore, we show that S567 is a key residue that regulates Loop1-mediated AMPAR trafficking. Thus, our study reveals a unique mechanism for targeting AMPARs to synapses to mediate synaptic transmission. PMID:21135237

  15. Encapsulation of paclitaxel into lauric acid-O-carboxymethyl chitosan-transferrin micelles for hydrophobic drug delivery and site-specific targeted delivery.

    PubMed

    Nam, Joung-Pyo; Park, Seong-Cheol; Kim, Tae-Hun; Jang, Jae-Yeang; Choi, Changyong; Jang, Mi-Kyeong; Nah, Jae-Woon

    2013-11-30

    Transferrin/PEG/O-carboxymethyl chitosan/fatty acid/paclitaxel (TPOCFP) micelles were tested for suitability as a drug carrier characterized by low cytotoxicity, sustained release, high cellular uptake, and site-specific targeted delivery of hydrophobic drugs. Characterization, drug content, encapsulation efficiency, and in vitro drug release were investigated. When the feeding amount of paclitaxel (PTX) was increased, the drug content increased, but loading efficiency decreased. TPOCFP micelles had a spherical shape, with a particle size of approximately 140-649 nm. In vitro cell cytotoxicity and hemolysis assays were conducted to confirm the safety of the micelles. Anticancer activity and confocal laser scanning microscopy (CLSM) were used to confirm the targeting efficiency of target ligand-modified TPOCFP micelles. Anticancer activity and CLSM results clearly demonstrated that transferrin-modified TPOCFP micelles were quickly taken up by the cell. The endocytic pathway of TPOCFP micelles was analyzed by flow cytometry, revealing transfection via receptor-mediated endocytosis. These results suggest that PTX-encapsulated TPOCFP micelles may be used as an effective cancer-targeting drug delivery system for chemotherapy. PMID:24076228

  16. miR-Synth: a computational resource for the design of multi-site multi-target synthetic miRNAs

    PubMed Central

    Laganà, Alessandro; Acunzo, Mario; Romano, Giulia; Pulvirenti, Alfredo; Veneziano, Dario; Cascione, Luciano; Giugno, Rosalba; Gasparini, Pierluigi; Shasha, Dennis; Ferro, Alfredo; Croce, Carlo Maria

    2014-01-01

    RNAi is a powerful tool for the regulation of gene expression. It is widely and successfully employed in functional studies and is now emerging as a promising therapeutic approach. Several RNAi-based clinical trials suggest encouraging results in the treatment of a variety of diseases, including cancer. Here we present miR-Synth, a computational resource for the design of synthetic microRNAs able to target multiple genes in multiple sites. The proposed strategy constitutes a valid alternative to the use of siRNA, allowing the employment of a fewer number of molecules for the inhibition of multiple targets. This may represent a great advantage in designing therapies for diseases caused by crucial cellular pathways altered by multiple dysregulated genes. The system has been successfully validated on two of the most prominent genes associated to lung cancer, c-MET and Epidermal Growth Factor Receptor (EGFR). (See http://microrna.osumc.edu/mir-synth). PMID:24627222

  17. The Texture of Mars: Observations of Rock and Outcrop Targets Over 360 Martian Sols at the Gale Field Site

    NASA Astrophysics Data System (ADS)

    Aileen Yingst, R.; Edgett, Kenneth; Williams, Rebecca; Hamilton, Victoria; Mangold, Nicolas; Bridges, Nathan

    2014-05-01

    Lithology (typically features 0.5-5 mm in scale, including sedimentary structure, texture, sorting, grain and crystal morphology) is a fundamental identifier for the field geologist, as it serves as a key indicator of rock-forming environments. Over the first 360 sols on the martian surface, the Mars Science Laboratory Curiosity rover interrogated geologic targets at this grain-size scale to identify and interpret the lithologic and textural clues to processes that formed and modified the geologic record. Its primary tool in this task was the Mars Hand Lens Imager (MAHLI). MAHLI is a 2-megapixel focusable macro lens color camera on the turret on Curiosity's robotic arm. MAHLI acquires focused images at working distances of 2.1 cm to infinity; at 2.1 cm the scale is 14 µm/pixel; at 6.9 cm it is 31 µm/pixel, like the Spirit and Opportunity Microscopic Imagers (MI). The Remote Microscopic Imager (RMI) also acquired non-color images at sub-mm scales; these images were also examined for clues to rock texture. Although because of dust and sand obscuration, the observables can sometimes be unclear, fine-grained rock textures are still informative and can be used to assess paleoenvironment. Rock targets observed up to sol 360 can be classified very broadly by texture as: (1) rocks or outcrop composed of poorly-sorted sand-sized grains with larger grains (0.5-1.0 µm) of varying morphology making up 2-5% of the rock by volume (e.g., the target informally named Gillespie Lake); (2) very fine-grained (below MAHLI resolution) dark rocks or outcrop, some of which have larger (0.5-1.5 µm across) round or rounded grains entrained (e.g. the target Wernecke); (3) dark gray fine- to coarse-grained rocks mantled with dust and fine/very fine sand, currently interpreted as igneous (e.g., targets Jake Matijevic, Matthew, and Bathurst Inlet); (4) porphyritic rocks; and (5) rocks abraded by windborne particles (ventifacts), with sub-mm to cm-scale abrasion textures. This last class

  18. Application of Mutated miR-206 Target Sites Enables Skeletal Muscle-specific Silencing of Transgene Expression of Cardiotropic AAV9 Vectors

    PubMed Central

    Geisler, Anja; Schön, Christian; Größl, Tobias; Pinkert, Sandra; Stein, Elisabeth A; Kurreck, Jens; Vetter, Roland; Fechner, Henry

    2013-01-01

    Insertion of completely complementary microRNA (miR) target sites (miRTS) into a transgene has been shown to be a valuable approach to specifically repress transgene expression in non-targeted tissues. miR-122TS have been successfully used to silence transgene expression in the liver following systemic application of cardiotropic adeno-associated virus (AAV) 9 vectors. For miR-206–mediated skeletal muscle-specific silencing of miR-206TS–bearing AAV9 vectors, however, we found this approach failed due to the expression of another member (miR-1) of the same miR family in heart tissue, the intended target. We introduced single-nucleotide substitutions into the miR-206TS and searched for those which prevented miR-1–mediated cardiac repression. Several mutated miR-206TS (m206TS), in particular m206TS-3G, were resistant to miR-1, but remained fully sensitive to miR-206. All these variants had mismatches in the seed region of the miR/m206TS duplex in common. Furthermore, we found that some m206TS, containing mismatches within the seed region or within the 3′ portion of the miR-206, even enhanced the miR-206– mediated transgene repression. In vivo expression of m206TS-3G– and miR-122TS–containing transgene of systemically applied AAV9 vectors was strongly repressed in both skeletal muscle and the liver but remained high in the heart. Thus, site-directed mutagenesis of miRTS provides a new strategy to differentiate transgene de-targeting of related miRs. PMID:23439498

  19. Simultaneous targeting of two ligand-binding sites on VEGFR2 using biparatopic Affibody molecules results in dramatically improved affinity

    PubMed Central

    Fleetwood, Filippa; Klint, Susanne; Hanze, Martin; Gunneriusson, Elin; Frejd, Fredrik Y.; Ståhl, Stefan; Löfblom, John

    2014-01-01

    Angiogenesis plays an important role in cancer and ophthalmic disorders such as age-related macular degeneration and diabetic retinopathy. The vascular endothelial growth factor (VEGF) family and corresponding receptors are regulators of angiogenesis and have been much investigated as therapeutic targets. The aim of this work was to generate antagonistic VEGFR2-specific affinity proteins having adjustable pharmacokinetic properties allowing for either therapy or molecular imaging. Two antagonistic Affibody molecules that were cross-reactive for human and murine VEGFR2 were selected by phage and bacterial display. Surprisingly, although both binders independently blocked VEGF-A binding, competition assays revealed interaction with non-overlapping epitopes on the receptor. Biparatopic molecules, comprising the two Affibody domains, were hence engineered to potentially increase affinity even further through avidity. Moreover, an albumin-binding domain was included for half-life extension in future in vivo experiments. The best-performing of the biparatopic constructs demonstrated up to 180-fold slower dissociation than the monomers. The new Affibody constructs were also able to specifically target VEGFR2 on human cells, while simultaneously binding to albumin, as well as inhibit VEGF-induced signaling. In summary, we have generated small antagonistic biparatopic Affibody molecules with high affinity for VEGFR2, which have potential for both future therapeutic and diagnostic purposes in angiogenesis-related diseases. PMID:25515662

  20. Design and synthesis of fused bicyclic inhibitors targeting the L5 loop site of centromere-associated protein E.

    PubMed

    Hirayama, Takaharu; Okaniwa, Masanori; Banno, Hiroshi; Kakei, Hiroyuki; Ohashi, Akihiro; Ohori, Momoko; Nambu, Tadahiro; Iwai, Kenichi; Kawamoto, Tomohiro; Yokota, Akihiro; Miyamoto, Maki; Ishikawa, Tomoyasu

    2016-09-01

    Centromere-associated protein-E (CENP-E) is a mitotic kinesin which plays roles in cell division, and is regarded as a promising therapeutic target for the next generation of anti-mitotic agents. We designed novel fused bicyclic CENP-E inhibitors starting from previous reported dihydrobenzofuran derivative (S)-(+)-1. Our design concept was to adjust the electron density distribution on the benzene ring of the dihydrobenzofuran moiety to increase the positive charge for targeting the negatively charged L5 loop of CENP-E, using predictions from electrostatic potential map (EPM) analysis. For the efficient synthesis of our 2,3-dihydro-1-benzothiophene 1,1-dioxide derivatives, a new synthetic method was developed. As a result, we discovered 6-cyano-7-trifluoromethyl-2,3-dihydro-1-benzothiophene 1,1-dioxide derivative (+)-5d (Compound A) as a potent CENP-E inhibitor with promising potential for in vivo activity. In this Letter, we discuss the design and synthetic strategy used in the discovery of (+)-5d and structure-activity relationships for its analogs possessing various fused bicyclic L5 binding moieties. PMID:27476141

  1. The same site on the integrase-binding domain of lens epithelium–derived growth factor is a therapeutic target for MLL leukemia and HIV

    PubMed Central

    Murai, Marcelo J.; Pollock, Jonathan; He, Shihan; Miao, Hongzhi; Purohit, Trupta; Yokom, Adam; Hess, Jay L.; Muntean, Andrew G.; Grembecka, Jolanta

    2014-01-01

    Lens epithelium-derived growth factor (LEDGF) is a chromatin-associated protein implicated in leukemia and HIV type 1 infection. LEDGF associates with mixed-lineage leukemia (MLL) fusion proteins and menin and is required for leukemic transformation. To better understand the molecular mechanism underlying the LEDGF integrase-binding domain (IBD) interaction with MLL fusion proteins in leukemia, we determined the solution structure of the MLL-IBD complex. We found a novel MLL motif, integrase domain binding motif 2 (IBM2), which binds to a well-defined site on IBD. Point mutations within IBM2 abolished leukemogenic transformation by MLL-AF9, validating that this newly identified motif is essential for the oncogenic activity of MLL fusion proteins. Interestingly, the IBM2 binding site on IBD overlaps with the binding site for the HIV integrase (IN), and IN was capable of efficiently sequestering IBD from the menin-MLL complex. A short IBM2 peptide binds to IBD directly and inhibits both the IBD-MLL/menin and IBD-IN interactions. Our findings show that the same site on IBD is involved in binding to MLL and HIV-IN, revealing an attractive approach to simultaneously target LEDGF in leukemia and HIV. PMID:25305204

  2. Specific inhibition of ectodomain shedding of glycoprotein Ibα by targeting its juxtamembrane shedding cleavage site

    PubMed Central

    Liang, Xin; Russell, Susan R.; Estelle, Sandra; Jones, Limei H.; Cho, Sungyun; Kahn, Mark L.; Berndt, Michael C.; Bunting, Silvia T.; Ware, Jerry; Li, Renhao

    2013-01-01

    Summary Background Ectodomain shedding of GPIbα, a proteolytic event in which metalloprotease ADAM17 cleaves the Gly464-Val465 bond and releases glycocalicin to the plasma, is considered a critical step in mediating clearance of stored platelets. Supporting evidence has largely come from studies using ADAM17 inhibitors. However, the definitive proof is lacking due to the broad substrate specificity of ADAM17. Objectives To achieve substrate-specific inhibition of GPIbα shedding. Methods Development of monoclonal antibodies that directly bind the sequence around the GPIbα shedding cleavage site and inhibit GPIbα shedding by blocking ADAM17 access to the cleavage site. Results Six anti-GPIbα monoclonal antibodies with varying binding affinities were obtained. The prototypic clone, designated 5G6, and its monomeric Fab fragment, bind specifically purified GPIb-IX complex, human platelets, and transgenic murine platelets expressing human GPIbα. 5G6 showed similar inhibitory potency as a widely used shedding inhibitor GM6001 in both constitutive and induced GPIbα shedding in human platelets. It does not recognize mouse GPIbα. Nor does it inhibit shedding of other platelet receptors. Finally, 5G6 binding displays no detectable effect on platelet activation and aggregation. Conclusion 5G6 specifically inhibits GPIbα shedding with no detectable effect on platelet functions. The method of substrate-specific shedding inhibition by macromolecular binding of the shedding cleavage site can be applicable to many other transmembrane receptors undergoing ectodomain shedding. PMID:24119228

  3. Targeting the GPIbα Binding Site of Thrombin To Simultaneously Induce Dual Anticoagulant and Antiplatelet Effects

    PubMed Central

    2015-01-01

    Exosite 2 of human thrombin contributes to two opposing pathways, the anticoagulant pathway and the platelet aggregation pathway. We reasoned that an exosite 2 directed allosteric thrombin inhibitor should simultaneously induce anticoagulant and antiplatelet effects. To assess this, we synthesized SbO4L based on the sulfated tyrosine-containing sequence of GPIbα. SbO4L was synthesized in three simple steps in high yield and found to be a highly selective, direct inhibitor of thrombin. Michelis–Menten kinetic studies indicated a noncompetitive mechanism of inhibition. Competitive inhibition studies suggested ideal competition with heparin and glycoprotein Ibα, as predicted. Studies with site-directed mutants of thrombin indicated that SbO4L binds to Arg233, Lys235, and Lys236 of exosite 2. SbO4L prevented thrombin-mediated platelet activation and aggregation as expected on the basis of competition with GPIbα. SbO4L presents a novel paradigm of simultaneous dual anticoagulant and antiplatelet effects achieved through the GPIbα binding site of thrombin. PMID:24635452

  4. A Camelid-derived Antibody Fragment Targeting the Active Site of a Serine Protease Balances between Inhibitor and Substrate Behavior.

    PubMed

    Kromann-Hansen, Tobias; Oldenburg, Emil; Yung, Kristen Wing Yu; Ghassabeh, Gholamreza H; Muyldermans, Serge; Declerck, Paul J; Huang, Mingdong; Andreasen, Peter A; Ngo, Jacky Chi Ki

    2016-07-15

    A peptide segment that binds the active site of a serine protease in a substrate-like manner may behave like an inhibitor or a substrate. However, there is sparse information on which factors determine the behavior a particular peptide segment will exhibit. Here, we describe the first x-ray crystal structure of a nanobody in complex with a serine protease. The nanobody displays a new type of interaction between an antibody and a serine protease as it inserts its complementary determining region-H3 loop into the active site of the protease in a substrate-like manner. The unique binding mechanism causes the nanobody to behave as a strong inhibitor as well as a poor substrate. Intriguingly, its substrate behavior is incomplete, as 30-40% of the nanobody remained intact and inhibitory after prolonged incubation with the protease. Biochemical analysis reveals that an intra-loop interaction network within the complementary determining region-H3 of the nanobody balances its inhibitor versus substrate behavior. Collectively, our results unveil molecular factors, which may be a general mechanism to determine the substrate versus inhibitor behavior of other protease inhibitors. PMID:27226628

  5. Two target sites for protein binding in the promoter region of a cell cycle regulated human H1 histone gene.

    PubMed Central

    van Wijnen, A J; Wright, K L; Massung, R F; Gerretsen, M; Stein, J L; Stein, G S

    1988-01-01

    The 5' region of a cell cycle regulated human H1 histone gene appears to contain at least six promoter DNA elements that are shared with some, but not all human core (H2A, H2B, H3 and H4) histone genes. We show that two of these elements represent separate binding sites for two distinct, partially purified factors. The first promoter domain contains A/T rich repeats and is involved in the binding of HiNF-A, a nuclear factor previously found to bind to A/T rich direct repeats in the promoters of human H4 and H3 histone genes. The second domain, containing the general promoter element 5' dACCAAT, acts as a binding site for a two component mosaic factor we have designated HiNF-B. These data suggest that coordinate transcriptional regulation of human H1 and core histone genes may involve two classes of trans-acting factors: those specific for histone gene promoters and those that act on a broad spectrum of human gene promoters. Images PMID:2829131

  6. Mammalian Protein Arginine Methyltransferase 7 (PRMT7) Specifically Targets RXR Sites in Lysine- and Arginine-rich Regions*

    PubMed Central

    Feng, You; Maity, Ranjan; Whitelegge, Julian P.; Hadjikyriacou, Andrea; Li, Ziwei; Zurita-Lopez, Cecilia; Al-Hadid, Qais; Clark, Amander T.; Bedford, Mark T.; Masson, Jean-Yves; Clarke, Steven G.

    2013-01-01

    The mammalian protein arginine methyltransferase 7 (PRMT7) has been implicated in roles of transcriptional regulation, DNA damage repair, RNA splicing, cell differentiation, and metastasis. However, the type of reaction that it catalyzes and its substrate specificity remain controversial. In this study, we purified a recombinant mouse PRMT7 expressed in insect cells that demonstrates a robust methyltransferase activity. Using a variety of substrates, we demonstrate that the enzyme only catalyzes the formation of ω-monomethylarginine residues, and we confirm its activity as the prototype type III protein arginine methyltransferase. This enzyme is active on all recombinant human core histones, but histone H2B is a highly preferred substrate. Analysis of the specific methylation sites within intact histone H2B and within H2B and H4 peptides revealed novel post-translational modification sites and a unique specificity of PRMT7 for methylating arginine residues in lysine- and arginine-rich regions. We demonstrate that a prominent substrate recognition motif consists of a pair of arginine residues separated by one residue (RXR motif). These findings will significantly accelerate substrate profile analysis, biological function study, and inhibitor discovery for PRMT7. PMID:24247247

  7. Site-specific antibody-liposome conjugation through copper-free click chemistry: a molecular biology approach for targeted photodynamic therapy (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Obaid, Girgis; Wang, Yucheng; Kuriakose, Jerrin; Broekgaarden, Mans; Alkhateeb, Ahmed; Bulin, Anne-Laure; Hui, James; Tsourkas, Andrew; Hasan, Tayyaba

    2016-03-01

    Nanocarriers, such as liposomes, have the ability to potentiate photodynamic therapy (PDT) treatment regimens by the encapsulation of high payloads of photosensitizers and enhance their passive delivery to tumors through the enhanced permeability and retention effect. By conjugating targeting moieties to the surface of the liposomal nanoconstructs, cellular selectivity is imparted on them and PDT-based therapies can be performed with significantly higher dose tolerances, as off-target toxicity is simultaneously reduced.1 However, the maximal benefits of conventional targeted nanocarriers, including liposomes, are hindered by practical limitations including chemical instability, non-selective conjugation chemistry, poor control over ligand orientation, and loss of ligand functionality following conjugation, amongst others.2 We have developed a robust, physically and chemically stable liposomal nanoplatform containing benzoporphyrin derivative photosensitizer molecules within the phospholipid bilayer and an optimized surface density of strained cyclooctyne moieties for `click' conjugation to azido-functionalized antibodies.3 The clinical chimeric anti-EGFR antibody Cetuximab is site-specifically photocrosslinked to a recombinant bioengineered that recognizes the antibody's Fc region, containing a terminal azide.4 The copper-free click conjugation of the bioengineered Cetuximab derivative to the optimized photosensitizing liposome provides exceptional control over the antibody's optimal orientation for cellular antigen binding. Importantly, the reaction occurs rapidly under physiological conditions, bioorthogonally (selectively in the presence of other biomolecules) and without the need for toxic copper catalysis.3 Such state-of-the-art conjugation strategies push the boundaries of targeted photodynamic therapy beyond the limitations of traditional chemical coupling techniques to produce more robust and effective targeted therapeutics with applications beyond

  8. Structural Constraints of Vaccine-Induced Tier-2 Autologous HIV Neutralizing Antibodies Targeting the Receptor-Binding Site.

    PubMed

    Bradley, Todd; Fera, Daniela; Bhiman, Jinal; Eslamizar, Leila; Lu, Xiaozhi; Anasti, Kara; Zhang, Ruijung; Sutherland, Laura L; Scearce, Richard M; Bowman, Cindy M; Stolarchuk, Christina; Lloyd, Krissey E; Parks, Robert; Eaton, Amanda; Foulger, Andrew; Nie, Xiaoyan; Karim, Salim S Abdool; Barnett, Susan; Kelsoe, Garnett; Kepler, Thomas B; Alam, S Munir; Montefiori, David C; Moody, M Anthony; Liao, Hua-Xin; Morris, Lynn; Santra, Sampa; Harrison, Stephen C; Haynes, Barton F

    2016-01-01

    Antibodies that neutralize autologous transmitted/founder (TF) HIV occur in most HIV-infected individuals and can evolve to neutralization breadth. Autologous neutralizing antibodies (nAbs) against neutralization-resistant (Tier-2) viruses are rarely induced by vaccination. Whereas broadly neutralizing antibody (bnAb)-HIV-Envelope structures have been defined, the structures of autologous nAbs have not. Here, we show that immunization with TF mutant Envs gp140 oligomers induced high-titer, V5-dependent plasma neutralization for a Tier-2 autologous TF evolved mutant virus. Structural analysis of autologous nAb DH427 revealed binding to V5, demonstrating the source of narrow nAb specificity and explaining the failure to acquire breadth. Thus, oligomeric TF Envs can elicit autologous nAbs to Tier-2 HIVs, but induction of bnAbs will require targeting of precursors of B cell lineages that can mature to heterologous neutralization. PMID:26725118

  9. ATP-site binding inhibitor effectively targets mTORC1 and mTORC2 complexes in glioblastoma.

    PubMed

    Neil, Jayson; Shannon, Craig; Mohan, Avinash; Laurent, Dimitri; Murali, Raj; Jhanwar-Uniyal, Meena

    2016-03-01

    The PI3K-AKT-mTOR signaling axis is central to the transformed phenotype of glioblastoma (GBM) cells, due to frequent loss of tumor suppressor PTEN (phosphatase and tensin homolog deleted on chromosome 10). The mechanistic target of rapamycin (mTOR) kinase is present in two cellular multi-protein complexes, mTORC1 and mTORC2, which have distinct subunit composition, substrates and mechanisms of action. Targeting the mTOR protein is a promising strategy for GBM therapy. However, neither of these complexes is fully inhibited by the allosteric inhibitor of mTOR, rapamycin or its analogs. Herein, we provide evidence that the combined inhibition of mTORC1/2, using the ATP-competitive binding inhibitor PP242, would effectively suppress GBM growth and dissemination as compared to an allosteric binding inhibitor of mTOR. GBM cells treated with PP242 demonstrated significantly decreased activation of mTORC1 and mTORC2, as shown by reduced phosphorylation of their substrate levels, p70 S6KThr389 and AKTSer473, respectively, in a dose-dependent manner. Furthermore, insulin induced activation of these kinases was abrogated by pretreatment with PP242 as compared with rapamycin. Unlike rapamycin, PP242 modestly activates extracellular regulated kinase (ERK1/2), as shown by expression of pERKThr202/Tyr204. Cell proliferation and S-phase entry of GBM cells was significantly suppressed by PP242, which was more pronounced compared to rapamycin treatment. Lastly, PP242 significantly suppressed the migration of GBM cells, which was associated with a change in cellular behavior rather than cytoskeleton loss. In conclusion, these results underscore the potential therapeutic use of the PP242, a novel ATP-competitive binding inhibitor of mTORC1/2 kinase, in suppression of GBM growth and dissemination. PMID:26719046

  10. Calcium-activated potassium channels in insect pacemaker neurons as unexpected target site for the novel fumigant dimethyl disulfide.

    PubMed

    Gautier, Hélène; Auger, Jacques; Legros, Christian; Lapied, Bruno

    2008-01-01

    Dimethyl disulfide (DMDS), a plant-derived insecticide, is a promising fumigant as a substitute for methyl bromide. To further understand the mode of action of DMDS, we examined its effect on cockroach octopaminergic neurosecretory cells, called dorsal unpaired median (DUM) neurons, using whole-cell patch-clamp technique, calcium imaging and antisense oligonucleotide strategy. At low concentration (1 microM), DMDS modified spontaneous regular spike discharge into clear bursting activity associated with a decrease of the amplitude of the afterhyperpolarization. This effect led us to suspect alterations of calcium-activated potassium currents (IKCa) and [Ca(2+)](i) changes. We showed that DMDS reduced amplitudes of both peak transient and sustained components of the total potassium current. IKCa was confirmed as a target of DMDS by using iberiotoxin, cadmium chloride, and pSlo antisense oligonucleotide. In addition, we showed that DMDS induced [Ca(2+)](i) rise in Fura-2-loaded DUM neurons. Using calcium-free solution, and (R,S)-(3,4-dihydro-6,7-dimethoxy-isoquinoline-1-yl)-2-phenyl-N,N-di-[2-(2,3,4-trimethoxy-phenyl)ethyl]-acetamide (LOE 908) [an inhibitor of transient receptor potential (TRP)gamma], we demonstrated that TRPgamma initiated calcium influx. By contrast, omega-conotoxin GVIA (an inhibitor of N-type high-voltage-activated calcium channels), did not affect the DMDS-induced [Ca(2+)](i) rise. Finally, the participation of the calcium-induced calcium release mechanism was investigated using thapsigargin, caffeine, and ryanodine. Our study revealed that DMDS-induced elevation in [Ca(2+)](i) modulated IKCa in an unexpected bell-shaped manner via intracellular calcium. In conclusion, DMDS affects multiple targets, which could be an effective way to improve pest control efficacy of fumigation. PMID:17942746

  11. Search for over 2000 current and legacy micropollutants on a wastewater infiltration site with a UPLC-high resolution MS target screening method.

    PubMed

    Wode, Florian; van Baar, Patricia; Dünnbier, Uwe; Hecht, Fabian; Taute, Thomas; Jekel, Martin; Reemtsma, Thorsten

    2015-02-01

    A target screening method using ultra high performance liquid chromatography-high resolution mass spectrometry (UPLC-HRMS) was developed. The method was applied to 14 groundwater and 11 surface water samples of a former wastewater infiltration site, where raw wastewater was applied until 1985 and treated wastewater is applied since 2005. The measured data are compared with mass spectrometric data of over 2000 organic micropollutants (OMPs), including pharmaceuticals, personal care products, pesticides, industrial chemicals and metabolites of these classes. A total number of 151 and 159 OMPs were detected in groundwater and surface water, respectively, of which 12 have not been reported before in these matrices. Among these 12 compounds were 11 pharmaceuticals and one personal care product. The identity of 55 of the detected OMPs (35%) was verified by analysis of standard compounds. Based on the distribution in the study area, two groups of OMPs were clearly distinguished: current OMPs introduced with treated municipal wastewater since 2005 and legacy OMPs originating from infiltration of untreated wastewater until 1985. A third group included OMPs contained in historic as well as in current wastewater. During infiltration, OMPs with molecular mass >500 g/mol and log DOW > 3.9 were preferentially removed. Speciation had a strong impact with cationic OMPs showing high, neutral OMPs medium and anionic OMPs lowest elimination during infiltration. This target screening method proved useful to study a wide range of compounds, even in retrospect and at sites with poorly documented history and with a complex and variable hydrological situation. PMID:25497426

  12. Insight into PreImplantation Factor (PIF*) Mechanism for Embryo Protection and Development: Target Oxidative Stress and Protein Misfolding (PDI and HSP) through Essential RIPK Binding Site

    PubMed Central

    Barnea, Eytan R.; Lubman, David M.; Liu, Yan-Hui; Absalon-Medina, Victor; Hayrabedyan, Soren; Todorova, Krassimira; Gilbert, Robert O.; Guingab, Joy; Barder, Timothy J.

    2014-01-01

    Background Endogenous PIF, upon which embryo development is dependent, is secreted only by viable mammalian embryos, and absent in non-viable ones. Synthetic PIF (sPIF) administration promotes singly cultured embryos development and protects against their demise caused by embryo-toxic serum. To identify and characterize critical sPIF-embryo protein interactions novel biochemical and bio-analytical methods were specifically devised. Methods FITC-PIF uptake/binding by cultured murine and equine embryos was examined and compared with scrambled FITC-PIF (control). Murine embryo (d10) lysates were fractionated by reversed-phase HPLC, fractions printed onto microarray slides and probed with Biotin-PIF, IDE and Kv1.3 antibodies, using fluorescence detection. sPIF-based affinity column was developed to extract and identify PIF-protein interactions from lysates using peptide mass spectrometry (LC/MS/MS). In silico evaluation examined binding of PIF to critical targets, using mutation analysis. Results PIF directly targets viable cultured embryos as compared with control peptide, which failed to bind. Multistep Biotin-PIF targets were confirmed by single-step PIF-affinity column based isolation. PIF binds protein disulfide isomerases a prolyl-4-hydroxylase β-subunit, (PDI, PDIA4, PDIA6-like) containing the antioxidant thioredoxin domain. PIF also binds protective heat shock proteins (70&90), co-chaperone, BAG-3. Remarkably, PIF targets a common RIPK site in PDI and HSP proteins. Further, single PIF amino acid mutation significantly reduced peptide-protein target bonding. PIF binds promiscuous tubulins, neuron backbones and ACTA-1,2 visceral proteins. Significant anti-IDE, while limited anti-Kv1.3b antibody-binding to Biotin-PIF positive lysates HPLC fractions were documented. Conclusion Collectively, data identifies PIF shared targets on PDI and HSP in the embryo. Such are known to play a critical role in protecting against oxidative stress and protein misfolding. PIF

  13. Targeting Species-Specific Low-Affinity 16S rRNA Binding Sites by Using Peptide Nucleic Acids for Detection of Legionellae in Biofilms

    PubMed Central

    Wilks, Sandra A.; Keevil, C. William

    2006-01-01

    Using fluorescence in situ hybridization to detect bacterial groups has several inherent limitations. DNA probes are generally used, targeting sites on the 16S rRNA. However, much of the 16S rRNA is highly conserved, with variable regions often located in inaccessible areas where secondary structures can restrict probe access. Here, we describe the use of peptide nucleic acid (PNA) probes as a superior alternative to DNA probes, especially when used for environmental samples. A complex bacterial genus (Legionella) was studied, and two probes were designed, one to detect all species and one targeted to Legionella pneumophila. These probes were developed from existing sequences and are targeted to low-binding-affinity sites on the 16S rRNA. In total, 47 strains of Legionella were tested. In all cases, the Legionella spp. PNA probe labeled cells strongly but did not bind to any non-Legionella species. Likewise, the specific L. pneumophila PNA probe labeled only strains of L. pneumophila. By contrast, the equivalent DNA probes performed poorly. To assess the applicability of this method for use on environmental samples, drinking-water biofilms were spiked with a known concentration of L. pneumophila bacteria. Quantifications of the L. pneumophila bacteria were compared using PNA hybridization and standard culture methods. The culture method quantified only 10% of the number of L. pneumophila bacteria found by PNA hybridization. This illustrates the value of this method for use on complex environmental samples, especially where cells may be in a viable but noncultivable state. PMID:16885298

  14. Comparison of Target-Capture and Restriction-Site Associated DNA Sequencing for Phylogenomics: A Test in Cardinalid Tanagers (Aves, Genus: Piranga).

    PubMed

    Manthey, Joseph D; Campillo, Luke C; Burns, Kevin J; Moyle, Robert G

    2016-07-01

    Restriction-site associated DNA sequencing (RAD-seq) and target capture of specific genomic regions, such as ultraconserved elements (UCEs), are emerging as two of the most popular methods for phylogenomics using reduced-representation genomic data sets. These two methods were designed to target different evolutionary timescales: RAD-seq was designed for population-genomic level questions and UCEs for deeper phylogenetics. The utility of both data sets to infer phylogenies across a variety of taxonomic levels has not been adequately compared within the same taxonomic system. Additionally, the effects of uninformative gene trees on species tree analyses (for target capture data) have not been explored. Here, we utilize RAD-seq and UCE data to infer a phylogeny of the bird genus Piranga The group has a range of divergence dates (0.5-6 myr), contains 11 recognized species, and lacks a resolved phylogeny. We compared two species tree methods for the RAD-seq data and six species tree methods for the UCE data. Additionally, in the UCE data, we analyzed a complete matrix as well as data sets with only highly informative loci. A complete matrix of 189 UCE loci with 10 or more parsimony informative (PI) sites, and an approximately 80% complete matrix of 1128 PI single-nucleotide polymorphisms (SNPs) (from RAD-seq) yield the same fully resolved phylogeny of Piranga We inferred non-monophyletic relationships of Piranga lutea individuals, with all other a priori species identified as monophyletic. Finally, we found that species tree analyses that included predominantly uninformative gene trees provided strong support for different topologies, with consistent phylogenetic results when limiting species tree analyses to highly informative loci or only using less informative loci with concatenation or methods meant for SNPs alone. PMID:26821912

  15. Clinical pharmacokinetics of meropenem and biapenem in bile and dosing considerations for biliary tract infections based on site-specific pharmacodynamic target attainment.

    PubMed

    Ikawa, Kazuro; Nakashima, Akira; Morikawa, Norifumi; Ikeda, Kayo; Murakami, Yoshiaki; Ohge, Hiroki; Derendorf, Hartmut; Sueda, Taijiro

    2011-12-01

    The present study investigated the pharmacokinetics of meropenem and biapenem in bile and estimated their pharmacodynamic target attainment at the site. Meropenem (0.5 g) or biapenem (0.3 g) was administered to surgery patients (n = 8 for each drug). Venous blood samples and hepatobiliary tract bile samples were obtained at the end of infusion (0.5 h) and for up to 5 h thereafter. Drug concentrations in plasma and bile were analyzed pharmacokinetically and used for a Monte Carlo simulation to predict the probability of attaining the pharmacodynamic target (40% of the time above the MIC). Both drugs penetrated similarly into bile, with mean bile/plasma ratios of 0.24 to 0.25 (maximum drug concentration) and 0.30 to 0.38 (area under the drug concentration-time curve). The usual regimens of meropenem (0.5 g every 8 h [q8h]) and biapenem (0.3 g q8h) (0.5-h infusions) achieved similar target attainment probabilities in bile (≥ 90%) against Escherichia coli, Klebsiella pneumoniae, and Enterobacter cloacae isolates. However, against Pseudomonas aeruginosa isolates, meropenem at 1 g q8h and biapenem at 0.6 g q8h were required for values of 80.7% and 71.9%, respectively. The biliary pharmacodynamic-based breakpoint (the highest MIC at which the target attainment probability in bile was ≥ 90%) was 1 mg/liter for 0.5 g q8h and 2 mg/liter for 1 g q8h for meropenem and 0.5 mg/liter for 0.3 g q8h and 1 mg/liter for 0.6 g q8h for biapenem. These results help to define the clinical pharmacokinetics of the two carbapenems in bile while also helping to rationalize and optimize the dosing regimens for biliary tract infections based on site-specific pharmacodynamic target attainment. PMID:21947393

  16. Clinical Pharmacokinetics of Meropenem and Biapenem in Bile and Dosing Considerations for Biliary Tract Infections Based on Site-Specific Pharmacodynamic Target Attainment ▿

    PubMed Central

    Ikawa, Kazuro; Nakashima, Akira; Morikawa, Norifumi; Ikeda, Kayo; Murakami, Yoshiaki; Ohge, Hiroki; Derendorf, Hartmut; Sueda, Taijiro

    2011-01-01

    The present study investigated the pharmacokinetics of meropenem and biapenem in bile and estimated their pharmacodynamic target attainment at the site. Meropenem (0.5 g) or biapenem (0.3 g) was administered to surgery patients (n = 8 for each drug). Venous blood samples and hepatobiliary tract bile samples were obtained at the end of infusion (0.5 h) and for up to 5 h thereafter. Drug concentrations in plasma and bile were analyzed pharmacokinetically and used for a Monte Carlo simulation to predict the probability of attaining the pharmacodynamic target (40% of the time above the MIC). Both drugs penetrated similarly into bile, with mean bile/plasma ratios of 0.24 to 0.25 (maximum drug concentration) and 0.30 to 0.38 (area under the drug concentration-time curve). The usual regimens of meropenem (0.5 g every 8 h [q8h]) and biapenem (0.3 g q8h) (0.5-h infusions) achieved similar target attainment probabilities in bile (≥90%) against Escherichia coli, Klebsiella pneumoniae, and Enterobacter cloacae isolates. However, against Pseudomonas aeruginosa isolates, meropenem at 1 g q8h and biapenem at 0.6 g q8h were required for values of 80.7% and 71.9%, respectively. The biliary pharmacodynamic-based breakpoint (the highest MIC at which the target attainment probability in bile was ≥90%) was 1 mg/liter for 0.5 g q8h and 2 mg/liter for 1 g q8h for meropenem and 0.5 mg/liter for 0.3 g q8h and 1 mg/liter for 0.6 g q8h for biapenem. These results help to define the clinical pharmacokinetics of the two carbapenems in bile while also helping to rationalize and optimize the dosing regimens for biliary tract infections based on site-specific pharmacodynamic target attainment. PMID:21947393

  17. Using Geographical Information Systems to identify and target sites for creation and restoration of native woodlands: a case study of the Chiltern Hills, UK.

    PubMed

    Lee, John T; Bailey, Neil; Thompson, Stewart

    2002-01-01

    Rare and threatened habitats in Europe must be restored and enhanced in accordance with the European Union's Habitats and Species Directive. In the United Kingdom, conservation and expansion objectives for species and habitats are outlined in the Species Action Plans and Habitat Action Plans. Site identification for these measures has to date been ad hoc without consideration of either the existing "stock" of the natural resource or the ability of the surrounding land use to deliver the enhancement (enlargement) of a given habitat. Using a Geographical Information System, we outline a targeting system for creating new woodland in association with existing ancient woodland in the Chiltern Hills Area of Outstanding Natural Beauty. The aim was to create woodland blocks of at least 100 ha, as being of the most benefit to biodiversity. We identified existing patches of woodland between 20 and 50 ha as cores for habitat expansion and classified land use in terms of its suitability and proximity to these core areas for tree planting to meet the targets of the statutory body. Our results suggest that the targeting method employed is a useful tool for habitat restoration. PMID:11876071

  18. Intracellular repair of oxidation-damaged α-synuclein fails to target C-terminal modification sites

    PubMed Central

    Binolfi, Andres; Limatola, Antonio; Verzini, Silvia; Kosten, Jonas; Theillet, Francois-Xavier; May Rose, Honor; Bekei, Beata; Stuiver, Marchel; van Rossum, Marleen; Selenko, Philipp

    2016-01-01

    Cellular oxidative stress serves as a common denominator in many neurodegenerative disorders, including Parkinson's disease. Here we use in-cell NMR spectroscopy to study the fate of the oxidation-damaged Parkinson's disease protein alpha-synuclein (α-Syn) in non-neuronal and neuronal mammalian cells. Specifically, we deliver methionine-oxidized, isotope-enriched α-Syn into cultured cells and follow intracellular protein repair by endogenous enzymes at atomic resolution. We show that N-terminal α-Syn methionines Met1 and Met5 are processed in a stepwise manner, with Met5 being exclusively repaired before Met1. By contrast, C-terminal methionines Met116 and Met127 remain oxidized and are not targeted by cellular enzymes. In turn, persisting oxidative damage in the C-terminus of α-Syn diminishes phosphorylation of Tyr125 by Fyn kinase, which ablates the necessary priming event for Ser129 modification by CK1. These results establish that oxidative stress can lead to the accumulation of chemically and functionally altered α-Syn in cells. PMID:26807843

  19. Targeting the Two Oncogenic Functional Sites of the HPV E6 Oncoprotein with a High-Affinity Bivalent Ligand**

    PubMed Central

    Ramirez, Juan; Poirson, Juline; Foltz, Clémence; Chebaro, Yassmine; Schrapp, Maxime; Meyer, Amandine; Bonetta, Anaëlle; Forster, Anne; Jacob, Yves; Masson, Murielle; Deryckère, François; Travé, Gilles

    2015-01-01

    The E6 oncoproteins of high-risk mucosal (hrm) human papillomaviruses (HPVs) contain a pocket that captures LxxLL motifs and a C-terminal motif that recruits PDZ domains, with both functions being crucial for HPV-induced oncogenesis. A chimeric protein was built by fusing a PDZ domain and an LxxLL motif, both known to bind E6. NMR spectroscopy, calorimetry and a mammalian protein complementation assay converged to show that the resulting PDZ-LxxLL chimera is a bivalent nanomolar ligand of E6, while its separated PDZ and LxxLL components are only micromolar binders. The chimera binds to all of the hrm-HPV E6 proteins tested but not to low-risk mucosal or cutaneous HPV E6. Adenovirus-mediated expression of the chimera specifically induces the death of HPV-positive cells, concomitant with increased levels of the tumour suppressor P53, its transcriptional target p21, and the apoptosis marker cleaved caspase 3. The bifunctional PDZ-LxxLL chimera opens new perspectives for the diagnosis and treatment of HPV-induced cancers. PMID:26014966

  20. High-Affinity Self-Reactive Human Antibodies by Design and Selection: Targeting the Integrin Ligand Binding Site

    NASA Astrophysics Data System (ADS)

    Barbas, Carlos F., III; Languino, Lucia R.; Smith, Jeffrey W.

    1993-11-01

    A strategy for the design and selection of human antibodies that bind receptors is described. We have demonstrated the validity of the approach by producing semisynthetic human antibodies that bind integrins α_vβ_3 and αIIbβ_3 with high affinity (10-10 M). The selected antibodies mimic the integrins' natural ligands as demonstrated by their ability to compete with these ligands and Arg-Gly-Asp (RGD)-containing peptides for binding to the integrins. Furthermore, the antibodies bind in a cation-dependent fashion and are functional in cell adhesion assays. Antibodies that are high-affinity inhibitors of cell adhesion receptors should be of use in assessing receptor function and dissecting mechanisms of adhesion. Semisynthetic human antibodies that target integrins are potential therapeutic agents for the treatment of a number of diseases including thrombosis and metastasis. Furthermore, antibodies that are optimized to bind by a single complementarity determining region may be important lead compounds for the design of small molecule pharmaceuticals.

  1. Targeting the cyclin-binding groove site to inhibit the catalytic activity of CDK2/cyclin A complex using p27(KIP1)-derived peptidomimetic inhibitors.

    PubMed

    Karthiga, Arumugasamy; Tripathi, Sunil Kumar; Shanmugam, Ramasamy; Suryanarayanan, Venkatesan; Singh, Sanjeev Kumar

    2015-01-01

    Functionally activated cyclin-dependent kinase 2 (CDK2)/cyclin A complex has been validated as an interesting therapeutic target to develop the efficient antineoplastic drug based on the cell cycle arrest. Cyclin A binds to CDK2 and activates the kinases as well as recruits the substrate and inhibitors using a hydrophobic cyclin-binding groove (CBG). Blocking the cyclin substrate recruitment on CBG is an alternative approach to override the specificity hurdle of the currently available ATP site targeting CDK2 inhibitors. Greater understanding of the interaction of CDK2/cyclin A complex with p27 (negative regulator) reveals that the Leu-Phe-Gly (LFG) motif region of p27 binds with the CBG site of cyclin A to arrest the malignant cell proliferation that induces apoptosis. In the present study, Replacement with Partial Ligand Alternatives through Computational Enrichment (REPLACE) drug design strategies have been applied to acquire LFG peptide-derived peptidomimetics library. The peptidomimetics function is equivalent with respect to substrate p27 protein fashion but does not act as an ATP antagonist. The combined approach of molecular docking, molecular dynamics (MD), and molecular electrostatic potential and ADME/T prediction were carried out to evaluate the peptidomimetics. Resultant interaction and electrostatic potential maps suggested that smaller substituent is desirable at the position of phenyl ring to interact with Trp217, Arg250, and Gln254 residues in the active site. The best docked poses were refined by the MD simulations which resulted in conformational changes. After equilibration, the structure of the peptidomimetic and receptor complex was stable. The results revealed that the various substrate protein-derived peptidomimetics could serve as perfect leads against CDK2 protein. PMID:25584078

  2. Modelling site-specific N2O emission factors from Austrian agricultural soils for targeted mitigation measures (NitroAustria)

    NASA Astrophysics Data System (ADS)

    Amon, Barbara; Zechmeister-Boltenstern, Sophie; Kasper, Martina; Foldal, Cecilie; Schiefer, Jasmin; Kitzler, Barbara; Schwarzl, Bettina; Zethner, Gerhard; Anderl, Michael; Sedy, Katrin; Gaugitsch, Helmut; Dersch, Georg; Baumgarten, Andreas; Haas, Edwin; Kiese, Ralf

    2016-04-01

    Results from a previous project "FarmClim" highlight that the IPCC default emission factor is not able to reflect region specific N2O emissions from Austrian arable soils. The methodology is limited in identifying hot spots and hot moments of N2O emissions. When estimations are based on default emission factors no recommendations can be given on optimisation measures that would lead to a reduction of soil N2O emissions. The better the knowledge is about Nitrogen and Carbon budgets in Austrian agricultural managed soils the better the situation can be reflected in the Austrian GHG emission inventory calculations. Therefore national and regionally modelled emission factors should improve the evidence for national deviation from the IPCC default emission factors and reduce the uncertainties. The overall aim of NitroAustria is to identify the drivers for N2O emissions on a regional basis taking different soil types, climate, and agricultural management into account. We use the LandscapeDNDC model to update the N2O emission factors for N fertilizer and animal manure applied to soils. Key regions in Austria were selected and region specific N2O emissions calculated. The model runs at sub-daily time steps and uses data such as maximum and minimum air temperature, precipitation, radiation, and wind speed as meteorological drivers. Further input data are used to reflect agricultural management practices, e.g., planting/harvesting, tillage, fertilizer application, irrigation and information on soil and vegetation properties for site characterization and model initialization. While at site scale, arable management data (crop cultivation, rotations, timings etc.) is obtained by experimental data from field trials or observations, at regional scale such data need to be generated using region specific proxy data such as land use and management statistics, crop cultivations and yields, crop rotations, fertilizer sales, manure resulting from livestock units etc. The farming

  3. Minicircle microporation-based non-viral gene delivery improved the targeting of mesenchymal stem cells to an injury site.

    PubMed

    Mun, Ji-Young; Shin, Keun Koo; Kwon, Ohsuk; Lim, Yong Taik; Oh, Doo-Byoung

    2016-09-01

    Genetic engineering approaches to improve the therapeutic potential of mesenchymal stem cells (MSCs) have been made by viral and non-viral gene delivery methods. Viral methods have severe limitations in clinical application because of potential oncogenic, pathogenic, and immunogenic risks, while non-viral methods have suffered from low transfection efficiency and transient weak expression as MSCs are hard-to-transfect cells. In this study, minicircle, which is a minimal expression vector free of bacterial sequences, was employed for MSC transfection as a non-viral gene delivery method. The conventional cationic liposome method was not effective for MSC transfection as it resulted in very low transfection efficiency (less than 5%). Microporation, a new electroporation method, greatly improved the transfection efficiency of minicircles by up to 66% in MSCs without any significant loss of cell viability. Furthermore, minicircle microporation generated much stronger and prolonged transgene expression compared with plasmid microporation. When MSCs microporated with minicircle harboring firefly luciferase gene were subcutaneously injected to mice, the bioluminescence continued for more than a week, whereas the bioluminescence of the MSCs induced by plasmid microporation rapidly decreased and disappeared in mice within three days. By minicircle microporation as a non-viral gene delivery, MSCs engineered to overexpress CXCR4 showed greatly increased homing ability toward an injury site as confirmed through in vivo bioluminescence imaging in mice. In summary, the engineering of MSCs through minicircle microporation is expected to enhance the therapeutic potential of MSCs in clinical applications. PMID:27315214

  4. Site-Specific Radioiodination of HER2-Targeting Affibody Molecules using 4-Iodophenethylmaleimide Decreases Renal Uptake of Radioactivity

    PubMed Central

    Strand, Joanna; Nordeman, Patrik; Honarvar, Hadis; Altai, Mohamed; Orlova, Anna; Larhed, Mats; Tolmachev, Vladimir

    2015-01-01

    Affibody molecules are small scaffold-based affinity proteins with promising properties as probes for radionuclide-based molecular imaging. However, a high reabsorption of radiolabeled Affibody molecules in kidneys is an issue. We have shown that the use of 125I-3-iodo-((4-hydroxyphenyl)ethyl)maleimide (IHPEM) for site-specific labeling of cysteine-containing Affibody molecules provides high tumor uptake but low radioactivity retention in kidneys. We hypothesized that the use of 4-iodophenethylmaleimide (IPEM) would further reduce renal retention of radioactivity because of higher lipophilicity of radiometabolites. An anti-human epidermal growth factor receptor type 2 (HER2) Affibody molecule (ZHER2:2395) was labeled using 125I-IPEM with an overall yield of 45±3 %. 125I-IPEM-ZHER2:2395 bound specifically to HER2-expressing human ovarian carcinoma cells (SKOV-3 cell line). In NMRI mice, the renal uptake of 125I-IPEM-ZHER2:2395 (24±2 and 5.7±0.3 % IA g−1at 1 and 4 h after injection, respectively) was significantly lower than uptake of 125I-IHPEM-ZHER2:2395 (50±8 and 12±2 % IA g−1at 1 and 4 h after injection, respectively). In conclusion, the use of a more lipophilic linker for the radioiodination of Affibody molecules reduces renal radioactivity. PMID:25969816

  5. Idarubicin is a broad-spectrum enterovirus replication inhibitor that selectively targets the virus internal ribosomal entry site.

    PubMed

    Hou, Hsin-Yu; Lu, Wen-Wen; Wu, Kuan-Yin; Lin, Cheng-Wen; Kung, Szu-Hao

    2016-05-01

    Enterovirus 71 (EV71) causes life-threatening diseases with neurological manifestations in young children. However, the treatment of EV71 infections remains an unmet medical need. Idarubicin (IDR) is an anthracycline compound that is used therapeutically for certain types of tumour. In this study, we identified IDR as an EV71 inhibitor, which displayed antiviral potency in the submicromolar range and substantially protected cells from the cytopathic effects and cell death caused by EV71 infections. The antiviral effects extended to several other enterovirus (EV) species, and these effects were independent of cytotoxicity or topoisomerase inhibition. Structure-activity relationship studies indicated the importance of the anthracycline scaffold for anti-EV potency. IDR effectively blocked the synthesis of viral protein and RNA, but not the viral proteolysis processes. Moreover, anthracyclines were demonstrated to suppress EV internal ribosomal entry site (IRES)-mediated translation; conversely, the cellular p53 IRES activity was not sensitive to IDR action. Inhibition of IRES-mediated translation by IDR correlated with the affinity of binding between IDR and the particular IRES. Moreover, IDR impaired binding between the EV71 IRES RNA and hnRNP A1, a known host IRES trans-acting factor. In sum, we have identified a USA FDA-approved anticancer drug with the new indication as a selective EV IRES binder and inhibitor. The finding may also provide leads for the development of novel antiviral therapies directed at the EV IRES RNA. PMID:26879094

  6. Site-specific quantification of lysine acetylation in the N-terminal tail of histone H4 using a double-labelling, targeted UHPLC MS/MS approach.

    PubMed

    D'Urzo, Annalisa; Boichenko, Alexander P; van den Bosch, Thea; Hermans, Jos; Dekker, Frank; Andrisano, Vincenza; Bischoff, Rainer

    2016-05-01

    We developed a targeted liquid chromatography-tandem mass spectrometry (LC-MS/MS) method for the site-specific quantification of lysine acetylation in the N-terminal region of histone H4 by combining chemical derivatization at the protein and peptide levels with digestion using chymotrypsin and trypsin. Unmodified ε-amino groups were first modified with propionic acid anhydride and the derivatized protein digested with trypsin and chymotrypsin. The newly formed peptide N-termini were subjected to a second derivatization step with d6- (heavy) or d0- (light) acetic acid anhydride. Samples were mixed at different ratios and peptides monitored by multiple reaction monitoring (MRM) LC-MS/MS. The method was validated in terms of linearity (R (2) ≥ 0.94), precision (RSD ≤ 10 %), and accuracy (≤27 %) and used to assess the effect of the histone deacetylase (HDAC) inhibitors SAHA and MS-275 in the murine macrophage-like cell line RAW 264.7. SAHA and MS-275 showed site-specific effects on the acetylation levels of K5 and K8 with the K5(Ac)-K8 and K5-K8(Ac) peptides increasing 2.5-fold and 5-fold upon treatment with SAHA and MS-275, respectively. Assessing lysine acetylation in a site-specific manner is important for gaining a better understanding of the effects of HDAC inhibitors and for clarifying disease mechanisms where lysine acetylation plays a role. PMID:26968571

  7. Site-Selective Monitoring of the Interaction of the SRA Domain of UHRF1 with Target DNA Sequences Labeled with 2-Aminopurine.

    PubMed

    Greiner, Vanille J; Kovalenko, Lesia; Humbert, Nicolas; Richert, Ludovic; Birck, Catherine; Ruff, Marc; Zaporozhets, Olga A; Dhe-Paganon, Sirano; Bronner, Christian; Mély, Yves

    2015-10-01

    UHRF1 plays a central role in the maintenance and transmission of epigenetic modifications by recruiting DNMT1 to hemimethylated CpG sites via its SET and RING-associated (SRA) domain, ensuring error-free duplication of methylation profiles. To characterize SRA-induced changes in the conformation and dynamics of a target 12 bp DNA duplex as a function of the methylation status, we labeled duplexes by the environment-sensitive probe 2-aminopurine (2-Ap) at various positions near or far from the central CpG recognition site containing either a nonmodified cytosine (NM duplex), a methylated cytosine (HM duplex), or methylated cytosines on both strands (BM duplex). Steady-state and time-resolved fluorescence indicated that binding of SRA induced modest conformational and dynamical changes in NM, HM, and BM duplexes, with only slight destabilization of base pairs, restriction of global duplex flexibility, and diminution of local nucleobase mobility. Moreover, significant restriction of the local motion of residues flanking the methylcytosine in the HM duplex suggested that these residues are more rigidly bound to SRA, in line with a slightly higher affinity of the HM duplex as compared to that of the NM or BM duplex. Our results are consistent with a "reader" role, in which the SRA domain scans DNA sequences for hemimethylated CpG sites without perturbation of the structure of contacted nucleotides. PMID:26368281

  8. Schizophrenia: A genome scan targets chromosomes 3p and 8p as potential sites of susceptibility genes

    SciTech Connect

    Pulver, A.E.; Lasseter, V.K.; Kasch, L.

    1995-06-19

    Using a systematically ascertained sample of 57 families, each having 2 or more members with a consensus diagnosis of schizophrenia (DSM-III-R criteria), we have carried out linkage studies of 520 loci, covering approximately 70% of the genome for susceptibility loci for schizophrenia. A two-stage strategy based on lod score thresholds from simulation studies of our sample identified regions for further exploration. In each region, a dense map of highly informative dinucleotide repeat polymorphisms (heterozygosity greater than .70) was analyzed using dominant, recessive, and {open_quotes}affected only{close_quotes} models and nonparametric sib pair identity-by-descent methods. For one region, 8p22-p21, affected sib-pair analyses gave a P value = .0001, corresponding to a lod score approximately equal to 3.00. For 8p22-p21, the maximum two-point lod score occurred using the {open_quotes}affected only{close_quotes} recessive model (Z{sub max} = 2.35; {theta}{sub M} = {theta}{sub F}); allowing for a constant sex difference in recombination fractions found in reference pedigrees, Z{sub max} = 2.78 ({theta}{sub M}/{theta}{sub F} = 3). For a second region, 3p26-p24, the maximum two-point lod score was 2.34 ({open_quotes}affected only{close_quotes} dominant model), and the affected sib-pair P value was .01. These two regions are worthy of further exploration as potential sites of susceptibility genes for schizophrenia. 59 refs., 2 figs., 4 tabs.

  9. Target site insensitivity mutations in the AChE enzyme confer resistance to organophosphorous insecticides in Leptinotarsa decemlineata (Say).

    PubMed

    Malekmohammadi, M; Galehdari, H

    2016-01-01

    In the present study, we demonstrated the use and optimization of the tetra-primer ARMS-PCR procedure to detect and analyze the frequency of the R30K and I392T mutations in resistant field populations of CPB. The R30K mutation was detected in 72%, 84%, 52% and 64% of Bahar, Dehpiaz, Aliabad and Yengijeh populations, respectively. Overall frequencies of the I392T mutation were 12%, 8% and 16% of Bahar, Aliabad and Yengijeh populations, respectively. No I392T point mutation was found among samples from Dehpiaz field population. Moreover, only 31% and 2% of samples from the resistant field populations were homozygous for R30K and I392T mutations, respectively. No individual simultaneously had both I392T and S291G/R30K point mutations. The incidence of individuals with both S291G and R30K point mutations in the samples from Bahar, Dehpiaz, Aliabad, and Yengijeh populations were 31.5%, 44.7%, 41.6%, and 27.3% respectively. Genotypes determined by the tetra-primer ARMS-PCR method were consistent with those determined by PCR sequencing. There was no significant correlation between the mutation frequencies and resistance levels in the resistant populations, indicating that other mutations may contribute to this variation. Polymorphism in the partial L. decemlineata cDNA AChE gene Ldace2 of four field populations was identified by direct sequencing of PCR-amplified fragments. Among 45 novel mutations detected in this study, T29P mutation was found across all four field populations that likely contribute to the AChE insensitivity. Site-directed mutagenesis and protein expression experiments are needed for a more complete evaluation. PMID:26778439

  10. Mutations in the β-tubulin binding site for peloruside A confer resistance by targeting a cleft significant in side chain binding

    PubMed Central

    Begaye, Adrian; Trostel, Shana; Zhao, Zhiming; Taylor, Richard E; Schriemer, David C

    2011-01-01

    Peloruside A is a microtubule-stabilizing macrolide that binds to β-tubulin at a site distinct from the taxol site. The site was previously identified by H-D exchange mapping and molecular docking as a region close to the outer surface of the microtubule and confined in a cavity surrounded by a continuous loop of protein folded so as to center on Y340. We have isolated a series of peloruside A-resistant lines of the human ovarian carcinoma cell line A2780(1A9) to better characterize this binding site and the consequences of altering residues in it. Four resistant lines (Pel A-D) are described with single-base mutations in class I β-tubulin that result in the following substitutions: R306H, Y340S, N337D and A296S in various combinations. The mutations are localized to peptides previously identified by Hydrogen-Deuterium exchange mapping, and center on a cleft in which the drug side chain appears to dock. The Pel lines are 10–15-fold resistant to peloruside A and show cross resistance to laulimalide but not to any other microtubule stabilizers. They show no cross-sensitivity to any microtubule destabilizers, nor to two drugs with targets unrelated to microtubules. Peloruside A induces G2/M arrest in the Pel cell lines at concentrations 10–15 times that required in the parental line. The cells show notable changes in morphology compared with the parental line. PMID:21926482

  11. A Glass Spherule of Questionable Impact Origin from the Apollo 15 Landing Site: Unique Target Mare Basalt

    NASA Technical Reports Server (NTRS)

    Ryder, Graham; Delano, John W.; Warren, Paul H.; Kallemeyn, Gregory W.; Dalrymple, G. Brent

    1996-01-01

    A 6 mm-diameter dark spherule, 15434,28, from the regolith on the Apennine Front at the Apollo 15 landing site has a homogeneous glass interior with a 200 microns-thick rind of devitrified or crystallized melt. The rind contains abundant small fragments of Apollo 15 olivine-normative mare basalt and rare volcanic Apollo 15 green glass. The glass interior of the spherule has the chemical composition, including a high FeO content and high CaO/Al2O3, of a mare basalt. Whereas the major element and Sc, Ni, and Co abundances are similar to those of low-Ti mare basalts, the incompatible elements and Sr abundances are similar to those of high-Ti mare basaits. The relative abundance patterns of the incompatible trace elements are distinct from any other lunar mare basalts or KREEP; among these distinctions are a much steeper slope of the heavy rare earth elements. The 15434,28 glass has abundances of the volatile element Zn consistent with both impact glasses and crystalline mare basalts, but much lower than in glasses of mare volcanic origin. The glass contains siderophile elements such as Ir in abundances only slightly higher than accepted lunar indigenous levels, and some, such as Au, are just below such upper limits. The age of the glass, determined by the Ar-40/Ar-39 laser incremental heating technique, is 1647 +/- 11 Ma (2 sigma); it is expressed as an age spectrum of seventeen steps over 96% of the Ar-38 released, unusual for an impact glass. Trapped argon is negligible. The undamaged nature of the sphere demonstrates that it must have spent most of its life buried in regolith; Ar-38 cosmic ray exposure data suggest that it was buried at less than 2m but more than a few centimeters if a single depth is appropriate. That the spherule solidified to a glass is surprising; for such a mare composition, cooling at about 50 C/s is required to avoid crystallization, and barely attainable in such a large spherule. The low volatile abundances, slightly high siderophile

  12. B-cell-specific Moloney murine leukemia virus integration site 1: potential stratification factor and therapeutic target for epithelial ovarian cancer.

    PubMed

    Zhao, Qianying; Gui, Ting; Qian, Qiuhong; Li, Lei; Shen, Keng

    2016-01-01

    Epithelial ovarian cancer, a vexing challenge for clinical management, still lacks biomarkers for early diagnosis, precise stratification, and prognostic evaluation of patients. B-cell-specific Moloney murine leukemia virus integration site 1 (BMI1), a member of the polycomb group of proteins, engages in diverse cellular processes, including proliferation, differentiation, senescence, and stem cell renewal. In addition, BMI1, as a cancer stem-cell marker, participates in tumorigenesis through various pathways. Rewardingly, recent studies have also revealed a relationship between BMI1 expression and the clinical grade/stage, therapy response, and survival outcome in a majority of human malignancies, including epithelial ovarian cancer. Therefore, BMI1 might serve as a potential stratification factor and treatment target for epithelial ovarian cancer, pending evidence from further investigations. PMID:27578986

  13. B-cell-specific Moloney murine leukemia virus integration site 1: potential stratification factor and therapeutic target for epithelial ovarian cancer

    PubMed Central

    Zhao, Qianying; Gui, Ting; Qian, Qiuhong; Li, Lei; Shen, Keng

    2016-01-01

    Epithelial ovarian cancer, a vexing challenge for clinical management, still lacks biomarkers for early diagnosis, precise stratification, and prognostic evaluation of patients. B-cell-specific Moloney murine leukemia virus integration site 1 (BMI1), a member of the polycomb group of proteins, engages in diverse cellular processes, including proliferation, differentiation, senescence, and stem cell renewal. In addition, BMI1, as a cancer stem-cell marker, participates in tumorigenesis through various pathways. Rewardingly, recent studies have also revealed a relationship between BMI1 expression and the clinical grade/stage, therapy response, and survival outcome in a majority of human malignancies, including epithelial ovarian cancer. Therefore, BMI1 might serve as a potential stratification factor and treatment target for epithelial ovarian cancer, pending evidence from further investigations. PMID:27578986

  14. A 3'-UTR mutation creates a microRNA target site in the GFPT1 gene of patients with congenital myasthenic syndrome.

    PubMed

    Dusl, Marina; Senderek, Jan; Müller, Juliane S; Vogel, Johannes G; Pertl, Anja; Stucka, Rolf; Lochmüller, Hanns; David, Robert; Abicht, Angela

    2015-06-15

    Mutations in the gene encoding glutamine-fructose-6-phosphate transaminase 1 (GFPT1) cause the neuromuscular disorder limb-girdle congenital myasthenic syndrome (LG-CMS). One recurrent GFPT1 mutation detected in LG-CMS patients is a c.*22C>A transversion in the 3'-untranslated region (UTR). Because this variant does not alter the GFPT1 open reading frame, its pathogenic relevance has not yet been established. We found that GFPT1 protein levels were reduced in myoblast cells of the patients carrying this variant. In silico algorithms predicted that the mutation creates a microRNA target site for miR-206*. Investigation of the expression of this so far unrecognized microRNA confirmed that miR-206* (like its counterpart miR-206) is abundant in skeletal muscle. MiR-206* efficiently reduced the expression of reporter constructs containing the mutated 3'-UTR while no such effect was observed with reporter constructs containing the wild-type 3'-UTR or when a specific anti-miR-206* inhibitor was added. Moreover, anti-miR-206* inhibitor treatment substantially rescued GFPT1 expression levels in patient-derived myoblasts. Our data demonstrate that the c.*22C>A mutation in the GFPT1 gene leads to illegitimate binding of microRNA resulting in reduced protein expression. We confirm that c.*22C>A is a causative mutation and suggest that formation of microRNA target sites might be a relevant pathomechanism in Mendelian disorders. Variants in the 3'-UTRs should be considered in genetic diagnostic procedures. PMID:25765662

  15. A Short Open Reading Frame Encompassing the MicroRNA173 Target Site Plays a Role in trans-Acting Small Interfering RNA Biogenesis.

    PubMed

    Yoshikawa, Manabu; Iki, Taichiro; Numa, Hisataka; Miyashita, Kyoko; Meshi, Tetsuo; Ishikawa, Masayuki

    2016-05-01

    trans-Acting small interfering RNAs (tasiRNAs) participate in the regulation of organ morphogenesis and determination of developmental timing in plants by down-regulating target genes through mRNA cleavage. The production of tasiRNAs is triggered by microRNA173 (miR173) and other specific microRNA-mediated cleavage of 5'-capped and 3'-polyadenylated primary TAS transcripts (pri-TASs). Although pri-TASs are not thought to encode functional proteins, they contain multiple short open reading frames (ORFs). For example, the primary TAS2 transcript (pri-TAS2) contains 11 short ORFs, and the third ORF from the 5' terminus (ORF3) encompasses the miR173 target site. Here, we show that nonsense mutations in ORF3 of pri-TAS2 upstream of the miR173 recognition site suppress tasiRNA accumulation and that ORF3 is translated in vitro. Glycerol gradient centrifugation analysis of Arabidopsis (Arabidopsis thaliana) plant extracts revealed that pri-TAS2 and its miR173-cleaved 5' and 3' fragments are fractionated together in the polysome fractions. These and previous results suggest that the 3' fragment of pri-TAS2, which is a source of tasiRNAs, forms a huge complex containing SGS3, miR173-programmed AGO1 RNA-induced silencing complex, the 5' fragment, and ribosomes. This complex overaccumulated, moderately accumulated, and did not accumulate in rdr6, sde5, and sgs3 mutants, respectively. The sgs3 sde5 and rdr6 sde5 double mutants showed phenotypes similar to those of sgs3 and sde5 single mutants, respectively, with regard to the TAS2-related RNA accumulation, suggesting that the complex is formed in an SGS3-dependent manner, somehow modified and stabilized by SDE5, and becomes competent for RDR6 action. Ribosomes in this complex likely play an important role in this process. PMID:26966170

  16. The antibiotic Furvina® targets the P-site of 30S ribosomal subunits and inhibits translation initiation displaying start codon bias

    PubMed Central

    Fabbretti, Attilio; Brandi, Letizia; Petrelli, Dezemona; Pon, Cynthia L.; Castañedo, Nilo R.; Medina, Ricardo; Gualerzi, Claudio O.

    2012-01-01

    Furvina®, also denominated G1 (MW 297), is a synthetic nitrovinylfuran [2-bromo-5-(2-bromo-2-nitrovinyl)-furan] antibiotic with a broad antimicrobial spectrum. An ointment (Dermofural®) containing G1 as the only active principle is currently marketed in Cuba and successfully used to treat dermatological infections. Here we describe the molecular target and mechanism of action of G1 in bacteria and demonstrate that in vivo G1 preferentially inhibits protein synthesis over RNA, DNA and cell wall synthesis. Furthermore, we demonstrate that G1 targets the small ribosomal subunit, binds at or near the P-decoding site and inhibits its function interfering with the ribosomal binding of fMet-tRNA during 30S initiation complex (IC) formation ultimately inhibiting translation. Notably, this G1 inhibition displays a bias for the nature (purine vs. pyrimidine) of the 3′-base of the codon, occurring efficiently only when the mRNA directing 30S IC formation and translation contains the canonical AUG initiation triplet or the rarely found AUA triplet, but hardly occurs when the mRNA start codon is either one of the non-canonical triplets AUU or AUC. This codon discrimination by G1 is reminiscent, though of opposite type of that displayed by IF3 in its fidelity function, and remarkably does not occur in the absence of this factor. PMID:22941660

  17. The antibiotic Furvina® targets the P-site of 30S ribosomal subunits and inhibits translation initiation displaying start codon bias.

    PubMed

    Fabbretti, Attilio; Brandi, Letizia; Petrelli, Dezemona; Pon, Cynthia L; Castañedo, Nilo R; Medina, Ricardo; Gualerzi, Claudio O

    2012-11-01

    Furvina®, also denominated G1 (MW 297), is a synthetic nitrovinylfuran [2-bromo-5-(2-bromo-2-nitrovinyl)-furan] antibiotic with a broad antimicrobial spectrum. An ointment (Dermofural®) containing G1 as the only active principle is currently marketed in Cuba and successfully used to treat dermatological infections. Here we describe the molecular target and mechanism of action of G1 in bacteria and demonstrate that in vivo G1 preferentially inhibits protein synthesis over RNA, DNA and cell wall synthesis. Furthermore, we demonstrate that G1 targets the small ribosomal subunit, binds at or near the P-decoding site and inhibits its function interfering with the ribosomal binding of fMet-tRNA during 30S initiation complex (IC) formation ultimately inhibiting translation. Notably, this G1 inhibition displays a bias for the nature (purine vs. pyrimidine) of the 3'-base of the codon, occurring efficiently only when the mRNA directing 30S IC formation and translation contains the canonical AUG initiation triplet or the rarely found AUA triplet, but hardly occurs when the mRNA start codon is either one of the non-canonical triplets AUU or AUC. This codon discrimination by G1 is reminiscent, though of opposite type of that displayed by IF3 in its fidelity function, and remarkably does not occur in the absence of this factor. PMID:22941660

  18. RYBP-PRC1 Complexes Mediate H2A Ubiquitylation at Polycomb Target Sites Independently of PRC2 and H3K27me3

    PubMed Central

    Tavares, Lígia; Dimitrova, Emilia; Oxley, David; Webster, Judith; Poot, Raymond; Demmers, Jeroen; Bezstarosti, Karel; Taylor, Stephen; Ura, Hiroki; Koide, Hiroshi; Wutz, Anton; Vidal, Miguel; Elderkin, Sarah; Brockdorff, Neil

    2012-01-01

    Summary Polycomb-repressive complex 1 (PRC1) has a central role in the regulation of heritable gene silencing during differentiation and development. PRC1 recruitment is generally attributed to interaction of the chromodomain of the core protein Polycomb with trimethyl histone H3K27 (H3K27me3), catalyzed by a second complex, PRC2. Unexpectedly we find that RING1B, the catalytic subunit of PRC1, and associated monoubiquitylation of histone H2A are targeted to closely overlapping sites in wild-type and PRC2-deficient mouse embryonic stem cells (mESCs), demonstrating an H3K27me3-independent pathway for recruitment of PRC1 activity. We show that this pathway is mediated by RYBP-PRC1, a complex comprising catalytic subunits of PRC1 and the protein RYBP. RYBP-PRC1 is recruited to target loci in mESCs and is also involved in Xist RNA-mediated silencing, the latter suggesting a wider role in Polycomb silencing. We discuss the implications of these findings for understanding recruitment and function of Polycomb repressors. PMID:22325148

  19. Quantitative Persulfide Site Identification (qPerS-SID) Reveals Protein Targets of H2S Releasing Donors in Mammalian Cells

    PubMed Central

    Longen, Sebastian; Richter, Florian; Köhler, Yvette; Wittig, Ilka; Beck, Karl-Friedrich; Pfeilschifter, Josef

    2016-01-01

    H2S is an important signalling molecule involved in diverse biological processes. It mediates the formation of cysteine persulfides (R-S-SH), which affect the activity of target proteins. Like thiols, persulfides show reactivity towards electrophiles and behave similarly to other cysteine modifications in a biotin switch assay. In this manuscript, we report on qPerS-SID a mass spectrometry-based method allowing the isolation of persulfide containing peptides in the mammalian proteome. With this method, we demonstrated that H2S donors differ in their efficacy to induce persulfides in HEK293 cells. Furthermore, data analysis revealed that persulfide formation affects all subcellular compartments and various cellular processes. Negatively charged amino acids appeared more frequently adjacent to cysteines forming persulfides. We confirmed our proteomic data using pyruvate kinase M2 as a model protein and showed that several cysteine residues are prone to persulfide formation finally leading to its inactivation. Taken together, the site-specific identification of persulfides on a proteome scale can help to identify target proteins involved in H2S signalling and enlightens the biology of H2S and its releasing agents. PMID:27411966

  20. Quantitative Persulfide Site Identification (qPerS-SID) Reveals Protein Targets of H2S Releasing Donors in Mammalian Cells.

    PubMed

    Longen, Sebastian; Richter, Florian; Köhler, Yvette; Wittig, Ilka; Beck, Karl-Friedrich; Pfeilschifter, Josef

    2016-01-01

    H2S is an important signalling molecule involved in diverse biological processes. It mediates the formation of cysteine persulfides (R-S-SH), which affect the activity of target proteins. Like thiols, persulfides show reactivity towards electrophiles and behave similarly to other cysteine modifications in a biotin switch assay. In this manuscript, we report on qPerS-SID a mass spectrometry-based method allowing the isolation of persulfide containing peptides in the mammalian proteome. With this method, we demonstrated that H2S donors differ in their efficacy to induce persulfides in HEK293 cells. Furthermore, data analysis revealed that persulfide formation affects all subcellular compartments and various cellular processes. Negatively charged amino acids appeared more frequently adjacent to cysteines forming persulfides. We confirmed our proteomic data using pyruvate kinase M2 as a model protein and showed that several cysteine residues are prone to persulfide formation finally leading to its inactivation. Taken together, the site-specific identification of persulfides on a proteome scale can help to identify target proteins involved in H2S signalling and enlightens the biology of H2S and its releasing agents. PMID:27411966

  1. Diverse antigenic site targeting of influenza hemagglutinin in the murine antibody recall response to A(H1N1)pdm09 virus.

    PubMed

    Wilson, Jason R; Guo, Zhu; Tzeng, Wen-Pin; Garten, Rebecca J; Xiyan, Xu; Blanchard, Elisabeth G; Blanchfield, Kristy; Stevens, James; Katz, Jacqueline M; York, Ian A

    2015-11-01

    Here we define the epitopes on HA that are targeted by a group of 9 recombinant monoclonal antibodies (rmAbs) isolated from memory B cells of mice, immunized by infection with A(H1N1)pdm09 virus followed by a seasonal TIV boost. These rmAbs were all reactive against the HA1 region of HA, but display 7 distinct binding footprints, targeting each of the 4 known antigenic sites. Although the rmAbs were not broadly cross-reactive, a group showed subtype-specific cross-reactivity with the HA of A/South Carolina/1/18. Screening these rmAbs with a panel of human A(H1N1)pdm09 virus isolates indicated that naturally-occurring changes in HA could reduce rmAb binding, HI activity, and/or virus neutralization activity by rmAb, without showing changes in recognition by polyclonal antiserum. In some instances, virus neutralization was lost while both ELISA binding and HI activity were retained, demonstrating a discordance between the two serological assays traditionally used to detect antigenic drift. PMID:26318247

  2. EBNA2 Drives Formation of New Chromosome Binding Sites and Target Genes for B-Cell Master Regulatory Transcription Factors RBP-jκ and EBF1

    PubMed Central

    Lu, Fang; Chen, Horng-Shen; Kossenkov, Andrew V.; DeWispeleare, Karen; Won, Kyoung-Jae; Lieberman, Paul M.

    2016-01-01

    Epstein-Barr Virus (EBV) transforms resting B-lymphocytes into proliferating lymphoblasts to establish latent infections that can give rise to malignancies. We show here that EBV-encoded transcriptional regulator EBNA2 drives the cooperative and combinatorial genome-wide binding of two master regulators of B-cell fate, namely EBF1 and RBP-jκ. Previous studies suggest that these B-cell factors are statically bound to target gene promoters. In contrast, we found that EBNA2 induces the formation of new binding for both RBP-jκ and EBF1, many of which are in close physical proximity in the cellular and viral genome. These newly induced binding sites co-occupied by EBNA2-EBF1-RBP-jκ correlate strongly with transcriptional activation of linked genes that are important for B-lymphoblast function. Conditional expression or repression of EBNA2 leads to a rapid alteration in RBP-jκ and EBF1 binding. Biochemical and shRNA depletion studies provide evidence for cooperative assembly at co-occupied sites. These findings reveal that EBNA2 facilitate combinatorial interactions to induce new patterns of transcription factor occupancy and gene programming necessary to drive B-lymphoblast growth and survival. PMID:26752713

  3. Comparative analysis of linker histone H1, MeCP2, and HMGD1 on nucleosome stability and target site accessibility.

    PubMed

    Riedmann, Caitlyn; Fondufe-Mittendorf, Yvonne N

    2016-01-01

    Chromatin architectural proteins (CAPs) bind the entry/exit DNA of nucleosomes and linker DNA to form higher order chromatin structures with distinct transcriptional outcomes. How CAPs mediate nucleosome dynamics is not well understood. We hypothesize that CAPs regulate DNA target site accessibility through alteration of the rate of spontaneous dissociation of DNA from nucleosomes. We investigated the effects of histone H1, high mobility group D1 (HMGD1), and methyl CpG binding protein 2 (MeCP2), on the biophysical properties of nucleosomes and chromatin. We show that MeCP2, like the repressive histone H1, traps the nucleosome in a more compact mononucleosome structure. Furthermore, histone H1 and MeCP2 hinder model transcription factor Gal4 from binding to its cognate DNA site within the nucleosomal DNA. These results demonstrate that MeCP2 behaves like a repressor even in the absence of methylation. Additionally, MeCP2 behaves similarly to histone H1 and HMGD1 in creating a higher-order chromatin structure, which is susceptible to chromatin remodeling by ISWI. Overall, we show that CAP binding results in unique changes to nucleosome structure and dynamics. PMID:27624769

  4. [(3) H]-L685,458 binding sites are abundant in multiple peripheral organs in rats: implications for safety assessment of putative γ-secretase targeting drugs.

    PubMed

    Yang, Zhi-Ying; Li, Jian-Ming; Xiao, Ling; Mou, Lin; Cai, Yan; Huang, He; Luo, Xue-Gang; Yan, Xiao-Xin

    2014-12-01

    γ-Secretase is a multimeric enzyme complex that carries out proteolytic processing to a variety of cellular proteins. It is currently explored as a therapeutic target for Alzheimer's disease (AD) and cancer. Mechanism-based toxicity needs to be thoroughly evaluated for γ-secretase inhibitory and/or modulatory drugs. This study comparatively assessed putative γ-secretase catalytic sites in rat peripheral tissues relative to brain and explored an effort of its pharmacological inhibition on hair regeneration. Using [(3) H]-labelled L685,458, a potent γ-secretase inhibitor, as probe, we found more abundant presence of γ-secretase binding sites in the liver, gastrointestinal tract, hair follicle, pituitary gland, ovary and testis, as compared to the brain. Local application of L658,458 delayed vibrissal regrowth following whisker removal. These results suggest that γ-secretase may execute important biological functions in many peripheral systems, as in the brain. The development of γ-secretase inhibitors/modulators for AD and cancer therapy should include close monitoring of toxicological panels for hepatic, gastrointestinal, endocrinal and reproductive functions. PMID:24861611

  5. Design, Synthesis, and Biological Evaluation of 1-Methyl-1,4-dihydroindeno[1,2-c]pyrazole Analogues as Potential Anticancer Agents Targeting Tubulin Colchicine Binding Site.

    PubMed

    Liu, Yan-Na; Wang, Jing-Jing; Ji, Ya-Ting; Zhao, Guo-Dong; Tang, Long-Qian; Zhang, Cheng-Mei; Guo, Xiu-Li; Liu, Zhao-Peng

    2016-06-01

    By targeting a new binding region at the interface between αβ-tubulin heterodimers at the colchicine binding site, we designed a series of 7-substituted 1-methyl-1,4-dihydroindeno[1,2-c]pyrazoles as potential tubulin polymerization inhibitors. Among the compounds synthesized, 2-(6-ethoxy-3-(3-ethoxyphenylamino)-1-methyl-1,4-dihydroindeno[1,2-c]pyrazol-7-yloxy)acetamide 6a and 2-(6-ethoxy-3-(3-ethoxyphenylamino)-1-methyl-1,4-dihydroindeno[1,2-c]pyrazol-7-yloxy)-N-hydroxyacetamide 6n showed noteworthy low nanomolar potency against HepG2, Hela, PC3, and MCF-7 cancer cell lines. In mechanism studies, 6a inhibited tubulin polymerization and disorganized microtubule in A549 cells by binding to tubulin colchicine binding site. 6a arrested A549 cells in G2/M phase that was related to the alterations in the expression of cyclin B1 and p-cdc2. 6a induced A549 cells apoptosis through the activation of caspase-3 and PARP. In addition, 6a inhibited capillary tube formation in a concentration-dependent manner. In nonsmall cell lung cancer xenografts mouse model, 6a suppressed tumor growth by 59.1% at a dose of 50 mg/kg (ip) without obvious toxicity, indicating its in vivo potential as anticancer agent. PMID:27172319

  6. A hepatitis C virus (HCV) internal ribosome entry site (IRES) domain III–IV-targeted aptamer inhibits translation by binding to an apical loop of domain IIId

    PubMed Central

    Kikuchi, Kunio; Umehara, Takuya; Fukuda, Kotaro; Kuno, Atsushi; Hasegawa, Tsunemi; Nishikawa, Satoshi

    2005-01-01

    The hepatitis C virus (HCV) has a positive single-stranded RNA genome, and translation starts within the internal ribosome entry site (IRES) in a cap-independent manner. The IRES is well conserved among HCV subtypes and has a unique structure consisting of four domains. We used an in vitro selection procedure to isolate RNA aptamers capable of binding to the IRES domains III–IV. The aptamers that were obtained shared the consensus sequence ACCCA, which is complementary to the apical loop of domain IIId that is known to be a critical region of IRES-dependent translation. This convergence suggests that domain IIId is preferentially selected in an RNA–RNA interaction. Mutation analysis showed that the aptamer binding was sequence and structure dependent. One of the aptamers inhibited translation both in vitro and in vivo. Our results indicate that domain IIId is a suitable target site for HCV blockage and that rationally designed RNA aptamers have great potential as anti-HCV drugs. PMID:15681618

  7. EBNA2 Drives Formation of New Chromosome Binding Sites and Target Genes for B-Cell Master Regulatory Transcription Factors RBP-jκ and EBF1.

    PubMed

    Lu, Fang; Chen, Horng-Shen; Kossenkov, Andrew V; DeWispeleare, Karen; Won, Kyoung-Jae; Lieberman, Paul M

    2016-01-01

    Epstein-Barr Virus (EBV) transforms resting B-lymphocytes into proliferating lymphoblasts to establish latent infections that can give rise to malignancies. We show here that EBV-encoded transcriptional regulator EBNA2 drives the cooperative and combinatorial genome-wide binding of two master regulators of B-cell fate, namely EBF1 and RBP-jκ. Previous studies suggest that these B-cell factors are statically bound to target gene promoters. In contrast, we found that EBNA2 induces the formation of new binding for both RBP-jκ and EBF1, many of which are in close physical proximity in the cellular and viral genome. These newly induced binding sites co-occupied by EBNA2-EBF1-RBP-jκ correlate strongly with transcriptional activation of linked genes that are important for B-lymphoblast function. Conditional expression or repression of EBNA2 leads to a rapid alteration in RBP-jκ and EBF1 binding. Biochemical and shRNA depletion studies provide evidence for cooperative assembly at co-occupied sites. These findings reveal that EBNA2 facilitate combinatorial interactions to induce new patterns of transcription factor occupancy and gene programming necessary to drive B-lymphoblast growth and survival. PMID:26752713

  8. Site-targeted non-viral gene delivery by direct DNA injection into the pancreatic parenchyma and subsequent in vivo electroporation in mice

    PubMed Central

    Sato, Masahiro; Inada, Emi; Saitoh, Issei; Ohtsuka, Masato; Nakamura, Shingo; Sakurai, Takayuki; Watanabe, Satoshi

    2013-01-01

    The pancreas is considered an important gene therapy target because the organ is the site of several high burden diseases, including diabetes mellitus, cystic fibrosis, and pancreatic cancer. We aimed to develop an efficient in vivo gene delivery system using non-viral DNA. Direct intra-parenchymal injection of a solution containing circular plasmid pmaxGFP DNA was performed on adult anesthetized ICR female mice. The injection site was sandwiched with a pair of tweezer-type electrode disks, and electroporated using a square-pulse generator. Green fluorescent protein (GFP) expression within the injected pancreatic portion was observed one day after gene delivery. GFP expression reduced to baseline within a week of transfection. Application of voltages over 40 V resulted in tissue damage during electroporation. We demonstrate that electroporation is effective for safe and efficient transfection of pancreatic cells. This novel gene delivery method to the pancreatic parenchyma may find application in gene therapy strategies for pancreatic diseases and in investigation of specific gene function in situ. PMID:23946268

  9. MirSNP, a database of polymorphisms altering miRNA target sites, identifies miRNA-related SNPs in GWAS SNPs and eQTLs

    PubMed Central

    2012-01-01

    Background Numerous single nucleotide polymorphisms (SNPs) associated with complex diseases have been identified by genome-wide association studies (GWAS) and expression quantitative trait loci (eQTLs) studies. However, few of these SNPs have explicit biological functions. Recent studies indicated that the SNPs within the 3’UTR regions of susceptibility genes could affect complex traits/diseases by affecting the function of miRNAs. These 3’UTR SNPs are functional candidates and therefore of interest to GWAS and eQTL researchers. Description We developed a publicly available online database, MirSNP (http://cmbi.bjmu.edu.cn/mirsnp), which is a collection of human SNPs in predicted miRNA-mRNA binding sites. We identified 414,510 SNPs that might affect miRNA-mRNA binding. Annotations were added to these SNPs to predict whether a SNP within the target site would decrease/break or enhance/create an miRNA-mRNA binding site. By applying MirSNP database to three brain eQTL data sets, we identified four unreported SNPs (rs3087822, rs13042, rs1058381, and rs1058398), which might affect miRNA binding and thus affect the expression of their host genes in the brain. We also applied the MirSNP database to our GWAS for schizophrenia: seven predicted miRNA-related SNPs (p < 0.0001) were found in the schizophrenia GWAS. Our findings identified the possible functions of these SNP loci, and provide the basis for subsequent functional research. Conclusion MirSNP could identify the putative miRNA-related SNPs from GWAS and eQTLs researches and provide the direction for subsequent functional researches. PMID:23173617

  10. Microtubule-targetable fluorescent probe: site-specific detection and super-resolution imaging of ultratrace tubulin in microtubules of living cancer cells.

    PubMed

    Zhang, Hua; Wang, Caixia; Jiang, Tao; Guo, Haiming; Wang, Ge; Cai, Xinhua; Yang, Lin; Zhang, Yi; Yu, Haichuan; Wang, Hui; Jiang, Kai

    2015-01-01

    Tubulins in microtubules have been recognized as potential targets in cancer chemotherapy for several years. However, their detection and imaging in living cells, especially following exposure to anticancer drugs, remains difficult to achieve. This difficulty is due to the very small cross section of microtubules and the very small changes in tubulin concentration involved. Photoswitchable fluorescent probes combined with the "super-resolution" fluorescence imaging technique present an exciting opportunity for site-specific detection and super-resolution imaging of specific microscopic populations, such as tubulin. In this study, a tubulin specific photoswitchable fluorescent probe (Tu-SP), that labels and detects ultratrace levels of tubulin in microtubules of living biosystems, was designed and evaluated. To realize super-resolution fluorescence imaging, the spiropyran derivative (SP), a classic photoswitch, was introduced to Tu-SP as a fluorophore. To detect ultratrace tubulin, Tu-SP employed the tubulin inhibitor, alkaloid colchicine (Tu), as a recognition unit. Tu-SP exhibited nearly nonintrinsic fluorescence before binding to tubulin, even if there were divalent metal ions and 375 nm lasers, respectively. After binding to tubulin, a dramatic increase in fluorescence was detected within milliseconds when irradiated at 375 nm, this increase is a result of the transformation of Tu-SP into a colored merocyanine (Tu-SP-1) with fluorescence. Tu-SP was successfully used for site-specific imaging of tubulin at a resolution of 20 ± 5 nm in microtubules of living cancer cells. More importantly, the probe was suitable for site-specific and quantitative detection of trace tubulin in microtubules of living biological samples. PMID:25916680

  11. Contemporary evolution of resistance at the major insecticide target site gene Ace-1 by mutation and copy number variation in the malaria mosquito Anopheles gambiae

    PubMed Central

    Weetman, David; Mitchell, Sara N; Wilding, Craig S; Birks, Daniel P; Yawson, Alexander E; Essandoh, John; Mawejje, Henry D; Djogbenou, Luc S; Steen, Keith; Rippon, Emily J; Clarkson, Christopher S; Field, Stuart G; Rigden, Daniel J; Donnelly, Martin J

    2015-01-01

    Functionally constrained genes are ideal insecticide targets because disruption is often fatal, and resistance mutations are typically costly. Synaptic acetylcholinesterase (AChE) is an essential neurotransmission enzyme targeted by insecticides used increasingly in malaria control. In Anopheles and Culex mosquitoes, a glycine–serine substitution at codon 119 of the Ace-1 gene confers both resistance and fitness costs, especially for 119S/S homozygotes. G119S in Anopheles gambiae from Accra (Ghana) is strongly associated with resistance, and, despite expectations of cost, resistant 119S alleles are increasing significantly in frequency. Sequencing of Accra females detected only a single Ace-1 119S haplotype, whereas 119G diversity was high overall but very low at non-synonymous sites, evidence of strong purifying selection driven by functional constraint. Flanking microsatellites showed reduced diversity, elevated linkage disequilibrium and high differentiation of 119S, relative to 119G homozygotes across up to two megabases of the genome. Yet these signals of selection were inconsistent and sometimes weak tens of kilobases from Ace-1. This unexpected finding is attributable to apparently ubiquitous amplification of 119S alleles as part of a large copy number variant (CNV) far exceeding the size of the Ace-1 gene, whereas 119G alleles were unduplicated. Ace-1 CNV was detectable in archived samples collected when the 119S allele was rare in Ghana. Multicopy amplification of resistant alleles has not been observed previously and is likely to underpin the recent increase in 119S frequency. The large CNV compromised localization of the strong selective sweep around Ace-1, emphasizing the need to integrate CNV analysis into genome scans for selection. PMID:25865270

  12. The cytoplasmic domain of the gamete membrane fusion protein HAP2 targets the protein to the fusion site in Chlamydomonas and regulates the fusion reaction

    PubMed Central

    Liu, Yanjie; Pei, Jimin; Grishin, Nick; Snell, William J.

    2015-01-01

    Cell-cell fusion between gametes is a defining step during development of eukaryotes, yet we know little about the cellular and molecular mechanisms of the gamete membrane fusion reaction. HAP2 is the sole gamete-specific protein in any system that is broadly conserved and shown by gene disruption to be essential for gamete fusion. The wide evolutionary distribution of HAP2 (also known as GCS1) indicates it was present in the last eukaryotic common ancestor and, therefore, dissecting its molecular properties should provide new insights into fundamental features of fertilization. HAP2 acts at a step after membrane adhesion, presumably directly in the merger of the lipid bilayers. Here, we use the unicellular alga Chlamydomonas to characterize contributions of key regions of HAP2 to protein location and function. We report that mutation of three strongly conserved residues in the ectodomain has no effect on targeting or fusion, although short deletions that include those residues block surface expression and fusion. Furthermore, HAP2 lacking a 237-residue segment of the cytoplasmic region is expressed at the cell surface, but fails to localize at the apical membrane patch specialized for fusion and fails to rescue fusion. Finally, we provide evidence that the ancient HAP2 contained a juxta-membrane, multi-cysteine motif in its cytoplasmic region, and that mutation of a cysteine dyad in this motif preserves protein localization, but substantially impairs HAP2 fusion activity. Thus, the ectodomain of HAP2 is essential for its surface expression, and the cytoplasmic region targets HAP2 to the site of fusion and regulates the fusion reaction. PMID:25655701

  13. Association of TNP2 Gene Polymorphisms of the bta-miR-154 Target Site with the Semen Quality Traits of Chinese Holstein Bulls

    PubMed Central

    Huang, Jinming; Zhang, Xiaojian; Qi, Chao; Li, Jianbin; Zhong, Jifeng; Li, Guorong; Wang, Changfa

    2014-01-01

    Transition protein 2 (TNP2) participates in removing nucleohistones and the initial condensation of spermatid nucleus during spermiogenesis. This study investigated the relationship between the variants of the bovine TNP2 gene and the semen quality traits of Chinese Holstein bulls. We detected three single nucleotide polymorphisms (SNPs) of the TNP2 gene in 392 Chinese Holstein bulls, namely, g.269 G>A (exon 1), g.480 C>T (intron 1), and g.1536 C>T (3′-UTR). Association analysis showed that the semen quality traits of the Chinese Holstein bulls was significantly affected by the three SNPs. The bulls with the haplotypic combinations H6H4, H6H6, and H6H8 had higher initial semen motility than those with the H7H8 and H8H4 haplotypic combinations (P<0.05). SNPs in the microRNA (miRNA) binding region of the TNP2 gene 3′-UTR may have contributed to the phenotypic differences. The phenotypic differences are caused by the altered expression of the miRNAs and their targets. Bioinformatics analysis predicted that the g.1536 C>T site in the TNP2 3′-UTR is located in the bta-miR-154 binding region. The quantitative real-time polymerase chain reaction results showed that the TNP2 mRNA relative expression in bulls with the CT and CC genotypes was significantly higher than those with the TT genotype (P<0.05) in the g.1536 C>T site. The luciferase assay also indicated that bta-miR-154 directly targets TNP2 in a murine Leydig cell tumor cell line. The SNP g.1536 C>T in the TNP2 3′-UTR, which altered the binding of TNP2 with bta-miR-154, was found to be associated with the semen quality traits of Chinese Holstein bulls. PMID:24416221

  14. Identification of a novel FGFRL1 MicroRNA target site polymorphism for bone mineral density in meta-analyses of genome-wide association studies

    PubMed Central

    Niu, Tianhua; Liu, Ning; Zhao, Ming; Xie, Guie; Zhang, Lei; Li, Jian; Pei, Yu-Fang; Shen, Hui; Fu, Xiaoying; He, Hao; Lu, Shan; Chen, Xiang-Ding; Tan, Li-Jun; Yang, Tie-Lin; Guo, Yan; Leo, Paul J.; Duncan, Emma L.; Shen, Jie; Guo, Yan-Fang; Nicholson, Geoffrey C.; Prince, Richard L.; Eisman, John A.; Jones, Graeme; Sambrook, Philip N.; Hu, Xiang; Das, Partha M.; Tian, Qing; Zhu, Xue-Zhen; Papasian, Christopher J.; Brown, Matthew A.; Uitterlinden, André G.; Wang, Yu-Ping; Xiang, Shuanglin; Deng, Hong-Wen

    2015-01-01

    MicroRNAs (miRNAs) are critical post-transcriptional regulators. Based on a previous genome-wide association (GWA) scan, we conducted a polymorphism in microRNA target sites (poly-miRTS)-centric multistage meta-analysis for lumbar spine (LS)-, total hip (HIP)- and femoral neck (FN)-bone mineral density (BMD). In stage I, 41 102 poly-miRTSs were meta-analyzed in seven cohorts with a genome-wide significance (GWS) α = 0.05/41 102 = 1.22 × 10−6. By applying α = 5 × 10−5 (suggestive significance), 11 poly-miRTSs were selected, with FGFRL1 rs4647940 and PRR5 rs3213550 as top signals for FN-BMD (P = 7.67 × 10−6 and 1.58 × 10−5) in gender-combined sample. In stage II in silico replication (two cohorts), FGFRL1 rs4647940 was the only signal marginally replicated for FN-BMD (P = 5.08 × 10−3) at α = 0.10/11 = 9.09 × 10-3. PRR5 rs3213550 was also selected based on biological significance. In stage III de novo genotyping replication (two cohorts), FGFRL1 rs4647940 was the only signal significantly replicated for FN-BMD (P = 7.55 × 10−6) at α = 0.05/2 = 0.025 in gender-combined sample. Aggregating three stages, FGFRL1 rs4647940 was the single stage I-discovered and stages II- and III-replicated signal attaining GWS for FN-BMD (P = 8.87 × 10−12). Dual-luciferase reporter assays demonstrated that FGFRL1 3′ untranslated region harboring rs4647940 appears to be hsa-miR-140-5p's target site. In a zebrafish microinjection experiment, dre-miR-140-5p is shown to exert a dramatic impact on craniofacial skeleton formation. Taken together, we provided functional evidence for a novel FGFRL1 poly-miRTS rs4647940 in a previously known 4p16.3 locus, and experimental and clinical genetics studies have shown both FGFRL1 and hsa-miR-140-5p are important for bone formation. PMID:25941324

  15. A spinosyn-sensitive Drosophila melanogaster nicotinic acetylcholine receptor identified through chemically induced target site resistance, resistance gene identification, and heterologous expression.

    PubMed

    Watson, Gerald B; Chouinard, Scott W; Cook, Kevin R; Geng, Chaoxian; Gifford, Jim M; Gustafson, Gary D; Hasler, James M; Larrinua, Ignacio M; Letherer, Ted J; Mitchell, Jon C; Pak, William L; Salgado, Vincent L; Sparks, Thomas C; Stilwell, Geoff E

    2010-05-01

    Strains of Drosophila melanogaster with resistance to the insecticides spinosyn A, spinosad, and spinetoram were produced by chemical mutagenesis. These spinosyn-resistant strains were not cross-resistant to other insecticides. The two strains that were initially characterized were subsequently found to have mutations in the gene encoding the nicotinic acetylcholine receptor (nAChR) subunit Dalpha6. Subsequently, additional spinosyn-resistant alleles were generated by chemical mutagenesis and were also found to have mutations in the gene encoding Dalpha6, providing convincing evidence that Dalpha6 is a target site for the spinosyns in D. melanogaster. Although a spinosyn-sensitive receptor could not be generated in Xenopus laevis oocytes simply by expressing Dalpha6 alone, co-expression of Dalpha6 with an additional nAChR subunit, Dalpha5, and the chaperone protein ric-3 resulted in an acetylcholine- and spinosyn-sensitive receptor with the pharmacological properties anticipated for a native nAChR. PMID:19944756

  16. Long-lasting insecticide-treated house screens and targeted treatment of productive breeding-sites for dengue vector control in Acapulco, Mexico

    PubMed Central

    Che-Mendoza, Azael; Guillermo-May, Guillermo; Herrera-Bojórquez, Josué; Barrera-Pérez, Mario; Dzul-Manzanilla, Felipe; Gutierrez-Castro, Cipriano; Arredondo-Jiménez, Juan I.; Sánchez-Tejeda, Gustavo; Vazquez-Prokopec, Gonzalo; Ranson, Hilary; Lenhart, Audrey; Sommerfeld, Johannes; McCall, Philip J.; Kroeger, Axel; Manrique-Saide, Pablo

    2015-01-01

    Background Long-lasting insecticidal net screens (LLIS) fitted to domestic windows and doors in combination with targeted treatment (TT) of the most productive Aedes aegypti breeding sites were evaluated for their impact on dengue vector indices in a cluster-randomised trial in Mexico between 2011 and 2013. Methods Sequentially over 2 years, LLIS and TT were deployed in 10 treatment clusters (100 houses/cluster) and followed up over 24 months. Cross-sectional surveys quantified infestations of adult mosquitoes, immature stages at baseline (pre-intervention) and in four post-intervention samples at 6-monthly intervals. Identical surveys were carried out in 10 control clusters that received no treatment. Results LLIS clusters had significantly lower infestations compared to control clusters at 5 and 12 months after installation, as measured by adult (male and female) and pupal-based vector indices. After addition of TT to the intervention houses in intervention clusters, indices remained significantly lower in the treated clusters until 18 (immature and adult stage indices) and 24 months (adult indices only) post-intervention. Conclusions These safe, simple affordable vector control tools were well-accepted by study participants and are potentially suitable in many regions at risk from dengue worldwide. PMID:25604761

  17. High resolution genetic mapping uncovers chitin synthase-1 as the target-site of the structurally diverse mite growth inhibitors clofentezine, hexythiazox and etoxazole in Tetranychus urticae

    PubMed Central

    Demaeght, Peter; Osborne, Edward J.; Odman-Naresh, Jothini; Grbić, Miodrag; Nauen, Ralf; Merzendorfer, Hans

    2014-01-01

    The acaricides clofentezine, hexythiazox and etoxazole are commonly referred to as ‘mite growth inhibitors’, and clofentezine and hexythiazox have been used successfully for the integrated control of plant mite pests for decades. Although they are still important today, their mode of action has remained elusive. Recently, a mutation in chitin synthase 1 (CHS1) was linked to etoxazole resistance. In this study, we identified and investigated a T. urticae strain (HexR) harboring recessive, monogenic resistance to each of hexythiazox, clofentezine, and etoxazole. To elucidate if there is a common genetic basis for the observed cross-resistance, we adapted a previously developed bulk segregant analysis method to map with high resolution a single, shared resistance locus for all three compounds. This finding indicates that the underlying molecular basis for resistance to all three compounds is identical. This locus is centered on the CHS1 gene, and as supported by additional genetic and biochemical studies, a non-synonymous variant (I1017F) in CHS1 associates with resistance to each of the tested acaricides in HexR. Our findings thus demonstrate a shared molecular mode of action for the chemically diverse mite growth inhibitors clofentezine, hexythiazox and etoxazole as inhibitors of an essential, non-catalytic activity of CHS1. Given the previously documented cross-resistance between clofentezine, hexythiazox and the benzyolphenylurea compounds flufenoxuron and cycloxuron, CHS1 should be also considered as a potential target-site of insecticidal BPUs. PMID:24859419

  18. Occurrence, genetic control and evolution of non-target-site based resistance to herbicides inhibiting acetolactate synthase (ALS) in the dicot weed Papaver rhoeas.

    PubMed

    Scarabel, Laura; Pernin, Fanny; Délye, Christophe

    2015-09-01

    Non-target-site resistance (NTSR) to herbicides is a major issue for the chemical control of weeds. Whilst predominant in grass weeds, NTSR remains largely uninvestigated in dicot weeds. We investigated the occurrence, inheritance and genetic control of NTSR to acetolactate synthase (ALS) inhibitors in Papaver rhoeas (corn poppy) using progenies from plants with potential NTSR to the imidazolinone herbicide imazamox. NTSR to imazamox was inherited from parents over two successive generations. NTSR to tritosulfuron (a sulfonylurea) was observed in F1 generations and inherited in F2 generations. NTSR to florasulam (a triazolopyrimidine) emerged in F2 generations. Our findings suggest NTSR was polygenic and gradually built-up by accumulation over generations of loci with moderate individual effects in single plants. We also demonstrated that ALS alleles conferring herbicide resistance can co-exist with NTSR loci in P. rhoeas plants. Previous research focussed on TSR in P. rhoeas, which most likely caused underestimation of NTSR significance in this species. This may also apply to other dicot species. From our data, resistance to ALS inhibitors in P. rhoeas appears complex, and involves well-known mutant ALS alleles and a set of unknown NTSR loci that confer resistance to ALS inhibitors from different chemical families. PMID:26259184

  19. RNA-Seq analysis of rye-grass transcriptomic response to an herbicide inhibiting acetolactate-synthase identifies transcripts linked to non-target-site-based resistance.

    PubMed

    Duhoux, Arnaud; Carrère, Sébastien; Gouzy, Jérôme; Bonin, Ludovic; Délye, Christophe

    2015-03-01

    Non-target-site resistance (NTSR) to herbicides that disrupts agricultural weed control is a worldwide concern for food security. NTSR is considered a polygenic adaptive trait driven by differential gene regulation in resistant plants. Little is known about its genetic determinism, which precludes NTSR diagnosis and evolutionary studies. We used Illumina RNA-sequencing to investigate transcriptomic differences between plants from the global major weed rye-grass sensitive or resistant to the acetolactate-synthase (ALS) inhibiting herbicide pyroxsulam. Plants were collected before and along a time-course after herbicide application. De novo transcriptome assembly yielded a resource (LOLbase) including 92,381 contigs representing potentially active transcripts that were assigned putative annotations. Early effects of ALS inhibition consistent with the literature were observed in resistant and sensitive plants, proving LOLbase data were relevant to study herbicide response. Comparison of resistant and sensitive plants identified 30 candidate NTSR contigs. Further validation using 212 plants resistant or sensitive to pyroxsulam and/or to the ALS inhibitors iodosulfuron + mesosulfuron confirmed four contigs (two cytochromes P450, one glycosyl-transferase and one glutathione-S-transferase) were NTSR markers which combined expression levels could reliably identify resistant plants. This work confirmed that NTSR is driven by differential gene expression and involves different mechanisms. It provided tools and foundation for subsequent NTSR investigations. PMID:25636204

  20. Two less common human microRNAs miR-875 and miR-3144 target a conserved site of E6 oncogene in most high-risk human papillomavirus subtypes.

    PubMed

    Lin, Lin; Cai, Qingqing; Zhang, Xiaoyan; Zhang, Hongwei; Zhong, Yang; Xu, Congjian; Li, Yanyun

    2015-08-01

    Human papillomaviruses (HPVs) including high-risk (HR) and low-risk (LR) subtypes have distinguishable variation on both genotypes and phenotypes. The co-infection of multiple HR-HPVs, headed by HPV16, is common in cervical cancer in female. Recently accumulating reports have focused on the interaction between virus and host, particularly the role of human microRNAs (miRNAs) in anti-viral defense by targeting viral genome. Here, we found a well-conserved target site of miRNAs in the genomes of most HR-HPVs, not LR-HPVs, by scanning all potential target sites of human miRNAs on 24 HPVs of unambiguous subtypes of risk. The site is targeted by two less common human miRNAs, miR-875 and miR-3144, and is located in E6 oncogene open reading frame (ORF) and overlap with the first alternative splice exon of viral early transcripts. In validation tests, miR-875 and miR-3144 were identified to suppress the target reporter activity markedly and inhibit the expression of both synthetically exogenous E6 and endogenous E6 oncogene. High level of two miRNAs can inhibit cell growth and promote apoptosis in HPV16-positive cervical cancer cells. This study provides a promising common target of miRNAs for most HR-HPVs and highlights the effects of two low expressed human miRNAs on tumour suppression. PMID:25913515

  1. Both the Exact Target Site Sequence and a Long Poly(A) Tail Are Required for Precise Insertion of the 18S Ribosomal DNA-Specific Non-Long Terminal Repeat Retrotransposon R7Ag.

    PubMed

    Nichuguti, Narisu; Hayase, Mayumi; Fujiwara, Haruhiko

    2016-05-15

    Ribosomal elements (R elements) are site-specific non-long terminal repeat (LTR) retrotransposons that target ribosomal DNA (rDNA). To elucidate how R elements specifically access their target sites, we isolated and characterized the 18S rDNA-specific R element R7Ag from Anopheles gambiae Using an in vivo and ex vivo recombinant baculovirus retrotransposition system, we found that the exact host 18S rDNA sequence at the target site is essential for the precise insertion of R7Ag. In addition, a long poly(A) tail is necessary for the accurate initiation of R7Ag reverse transcription, a novel mechanism found in non-LTR elements. We further compared the subcellular localizations of proteins in R7Ag as well as R1Bm, another R element that targets 28S rDNA. Although the open reading frame 1 proteins (ORF1ps) of both R7Ag and R1Bm localized predominantly in the cytoplasm, ORF2 proteins (ORF2ps) colocalized in the nucleus with the nucleolar marker fibrillarin. The ORF1ps and ORF2ps of both R elements colocalized largely in the nuclear periphery and to a lesser extent within the nucleus. These results suggest that R7Ag and R1Bm proteins may access nucleolar rDNA targets in an ORF2p-dependent manner. PMID:26976636

  2. Site-specifically labeled CA19.9-targeted immunoconjugates for the PET, NIRF, and multimodal PET/NIRF imaging of pancreatic cancer

    PubMed Central

    Houghton, Jacob L.; Zeglis, Brian M.; Abdel-Atti, Dalya; Aggeler, Robert; Sawada, Ritsuko; Agnew, Brian J.; Scholz, Wolfgang W.; Lewis, Jason S.

    2015-01-01

    Molecular imaging agents for preoperative positron emission tomography (PET) and near-infrared fluorescent (NIRF)-guided delineation of surgical margins could greatly enhance the diagnosis, staging, and resection of pancreatic cancer. PET and NIRF optical imaging offer complementary clinical applications, enabling the noninvasive whole-body imaging to localize disease and identification of tumor margins during surgery, respectively. We report the development of PET, NIRF, and dual-modal (PET/NIRF) imaging agents, using 5B1, a fully human monoclonal antibody that targets CA19.9, a well-established pancreatic cancer biomarker. Desferrioxamine (DFO) and/or a NIRF dye (FL) were conjugated to the heavy-chain glycans of 5B1, using a robust and reproducible site-specific (ss) labeling methodology to generate three constructs (ssDFO-5B1, ssFL-5B1, and ssdual-5B1) in which the immunoreactivity was not affected by the conjugation of either label. Each construct was evaluated in a s.c. xenograft model, using CA19.9-positive (BxPC3) and -negative (MIAPaCa-2) human pancreatic cancer cell lines. Each construct showed exceptional uptake and contrast in antigen-positive tumors with negligible nonspecific uptake in antigen-negative tumors. Additionally, the dual-modal construct was evaluated in an orthotopic murine pancreatic cancer model, using the human pancreatic cancer cell line, Suit-2. The ssdual-5B1 demonstrated a remarkable capacity to delineate metastases and to map the sentinel lymph nodes via tandem PET-computed tomography (PET/CT) and NIRF imaging. Fluorescence microscopy, histopathology, and autoradiography were performed on representative sections of excised tumors to visualize the distribution of the constructs within the tumors. These imaging tools have tremendous potential for further preclinical research and for clinical translation. PMID:26668398

  3. Targeted Delivery of Lovastatin and Tocotrienol to Fracture Site Promotes Fracture Healing in Osteoporosis Model: Micro-Computed Tomography and Biomechanical Evaluation

    PubMed Central

    Ibrahim, Nurul ‘Izzah; Khamis, Mohd Fadhli; Mod Yunoh, Mohd Faridz; Abdullah, Shahrum; Mohamed, Norazlina; Shuid, Ahmad Nazrun

    2014-01-01

    Osteoporosis is becoming a major health problem that is associated with increased fracture risk. Previous studies have shown that osteoporosis could delay fracture healing. Although there are potential agents available to promote fracture healing of osteoporotic bone such as statins and tocotrienol, studies on direct delivery of these agents to the fracture site are limited. This study was designed to investigate the effects of two potential agents, lovastatin and tocotrienol using targeted drug delivery system on fracture healing of postmenopausal osteoporosis rats. The fracture healing was evaluated using micro CT and biomechanical parameters. Forty-eight Sprague-Dawley female rats were divided into 6 groups. The first group was sham-operated (SO), while the others were ovariectomized (OVx). After two months, the right tibiae of all rats were fractured at metaphysis region using pulsed ultrasound and were fixed with plates and screws. The SO and OVxC groups were given two single injections of lovastatin and tocotrienol carriers. The estrogen group (OVx+EST) was given daily oral gavages of Premarin (64.5 µg/kg). The Lovastatin treatment group (OVx+Lov) was given a single injection of 750 µg/kg lovastatin particles. The tocotrienol group (OVx+TT) was given a single injection of 60 mg/kg tocotrienol particles. The combination treatment group (OVx+Lov+TT) was given two single injections of 750 µg/kg lovastatin particles and 60 mg/kg tocotrienol particles. After 4 weeks of treatment, the fractured tibiae were dissected out for micro-CT and biomechanical assessments. The combined treatment group (OVx+Lov+TT) showed significantly higher callus volume and callus strength than the OVxC group (p<0.05). Both the OVx+Lov and OVx+TT groups showed significantly higher callus strength than the OVxC group (p<0.05), but not for callus volume. In conclusion, combined lovastatin and tocotrienol may promote better fracture healing of osteoporotic bone. PMID:25526611

  4. MicroRNA-29c targets β-site amyloid precursor protein-cleaving enzyme 1 and has a neuroprotective role in vitro and in vivo.

    PubMed

    Yang, Guoshuai; Song, Yanmin; Zhou, Xiaoyan; Deng, Yidong; Liu, Tao; Weng, Guohu; Yu, Dan; Pan, Suyue

    2015-08-01

    Alzheimer's disease (AD), characterized by β-amyloid deposition and neurodegeneration, is the most common cause of dementia worldwide. Emerging evidence suggests that ectopic expression of micro (mi)RNAs is involved in the pathogenesis of AD. There is increasing evidence that miRNAs expressed in the brain are involved in neuronal development, survival and apoptosis. The expression of β-site amyloid precursor protein-cleaving enzyme 1 (BACE1) is regulated by dysregulated miRNAs in the brain. The present study determined the expression levels of the miRNA-29 (miR-29) family in peripheral blood samples of patients with AD and demonstrated a marked decrease in the expression of miR-29c compared with age-matched controls. In addition, a significant increase in the expression of BACE1 was observed in the peripheral blood of patients with AD. Correlation analysis revealed that the expression of miR-29c was negatively correlated with the protein expression of BACE1 in the peripheral blood samples from patients with AD. The present study also investigated the role of miR-29 on hippocampal neurons in vitro and in vivo. The results demonstrated that the upregulation of miR-29c promoted learning and memory behaviors in SAMP8 mice, at least partially, by increasing the activity of protein kinase A/cAMP response element-binding protein, involved in neuroprotection. This evidence suggested that miR-29c may be a promising potential therapeutic target against AD. PMID:25955795

  5. Roles of uptake, biotransformation, and target site sensitivity in determining the differential toxicity of chlorpyrifos to second to fourth instar Chironomous riparius (Meigen)

    USGS Publications Warehouse

    Buchwalter, D.B.; Sandahl, J.F.; Jenkins, J.J.; Curtis, L.R.

    2004-01-01

    Early life stages of aquatic organisms tend to be more sensitive to various chemical contaminants than later life stages. This research attempted to identify the key biological factors that determined sensitivity differences among life stages of the aquatic insect Chironomous riparius. Specifically, second to fourth instar larvae were exposed in vivo to both low and high waterborne concentrations of chlorpyrifos to examine differences in accumulation rates, chlorpyrifos biotransformation, and overall sensitivity among instars. In vitro acetylcholinesterase (AChE) assays were performed with chlorpyrifos and the metabolite, chlorpyrifos-oxon, to investigate potential target site sensitivity differences among instars. Earlier instars accumulated chlorpyrifos more rapidly than later instars. There were no major differences among instars in the biotransformation rates of chlorpyrifos to the more polar metabolites, chlorpyrifos-oxon, and chlorpyridinol (TCP). Homogenate AChE activities from second to fourth instar larvae were refractory to chlorpyrifos, even at high concentrations. In contrast, homogenate AChE activities were responsive in a dose-dependent manner to chlorpyrifos-oxon. In general, it appeared that chlorpyrifos sensitivity differences among second to fourth instar C. riparius were largely determined by differences in uptake rates. In terms of AChE depression, fourth instar homogenates were more sensitive to chlorpyrifos and chlorpyrifos-oxon than earlier instars. However, basal AChE activity in fourth instar larvae was significantly higher than basal AChE activity in second to third instar larvae, which could potentially offset the apparent increased sensitivity to the oxon. ?? 2003 Elsevier B.V. All rights reserved.

  6. Potential natural products for Alzheimer's disease: targeted search using the internal ribosome entry site of tau and amyloid-β precursor protein.

    PubMed

    Tasi, Yun-Chieh; Chin, Ting-Yu; Chen, Ying-Ju; Huang, Chun-Chih; Lee, Shou-Lun; Wu, Tzong-Yuan

    2015-01-01

    Overexpression of the amyloid precursor protein (APP) and the hyperphosphorylation of the tau protein are vital in the understanding of the cause of Alzheimer's disease (AD). As a consequence, regulation of the expression of both APP and tau proteins is one important approach in combating AD. The APP and tau proteins can be targeted at the levels of transcription, translation and protein structural integrity. This paper reports the utilization of a bi-cistronic vector containing either APP or tau internal ribosome entry site (IRES) elements flanked by β-galactosidase gene (cap-dependent) and secreted alkaline phosphatase (SEAP) (cap-independent) to discern the mechanism of action of memantine, an N-methyl-D-aspartate (NMDA) receptor antagonist. Results indicate that memantine could reduce the activity of both the APP and tau IRES at a concentration of ~10 μM (monitored by SEAP activity) without interfering with the cap-dependent translation as monitored by the β-galactosidase assay. Western blot analysis of the tau protein in neuroblastoma (N2A) and rat hippocampal cells confirmed the halting of the expression of the tau proteins. We also employed this approach to identify a preparation named NB34, extracts of Boussingaultia baselloides (madeira-vine) fermented with Lactobacillus spp., which can function similarly to memantine in both IRES of APP and Tau. The water maze test demonstrated that NB34 could improve the spatial memory of a high fat diet induced neurodegeneration in apolipoprotein E-knockout (ApoE-/-) mice. These results revealed that the bi-cistronic vector provided a simple, and effective platform in screening and establishing the mechanistic action of potential compounds for the treatment and management of AD. PMID:25903151

  7. Site-specific conjugation of the quencher on peptide's N-terminal for the synthesis of a targeted non-spreading activatable optical probe.

    PubMed

    Simard, Bryan; Mironov, Gleb G; Tomanek, Boguslaw; van Veggel, Frank C J M; Abulrob, Abedelnasser

    2016-06-01

    Optical imaging offers high sensitivity and portability at low cost. The design of 'smart' or 'activatable' probes can decrease the background noise and increase the specificity of the signal. By conjugating a fluorescent dye and a compatible quencher on each side of an enzyme's substrate, the signal remains in its 'off ' state until it reaches the area where a specific enzyme is expressed. However, the signal can leak from that area unless the dye is attached to a molecule able to bind to a specific target also presented in that area. The aim of this study was to (i) specifically conjugate the quencher on the α-amino group of the peptide's N-terminus, (ii) conjugate the dye on the ε-amino group of a lysine in C-terminus, and (iii) conjugate the carboxyl group of the peptide's C-terminus to an amino group present on an antibody, using carbodiimide chemistry. The use of protecting groups, such as Boc or Fmoc, to allow site-specific conjugation, presents several drawbacks including 'on beads labeling', additional steps required for deprotection and removal from the resin, decreased yield, and dye degradation. A method of preferential labeling of α-amino N-terminal group in slightly acidic solution, proposed by Selo et al. (1996) has partially solved the problem. The present study reports improvements of the method allowing to (i) avoid the homo-bilabeling, (ii) increase the yield of the N-terminal labeling by two folds, and (iii) decrease the cost by 44-fold. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd. PMID:27282138

  8. Engineered In-Situ Precipitation of Technetium and Uranium in Groundwater at the Savannah River Site: Treatment Targeting Long-Term Stability (Invited)

    NASA Astrophysics Data System (ADS)

    Gillow, J. B.; Lutes, C. C.; Frizzell, A.; Clark, B.; Horst, J.

    2009-12-01

    The U.S. Department of Energy (DOE) Savannah River Site (SRS) is a former nuclear weapons facility that is undergoing clean-up of groundwater and soil contamination. Alternatives to conventional pump-and-treat are being evaluated through DOE’s Advanced Remediation Technologies (ART) program as part of the EM-22 Groundwater and Soil Remediation program. A pilot project is underway to evaluate an emerging approach to remediation through the in-situ precipitation of insoluble forms of technetium and uranium. The demonstration involves the injection of organic carbon into the aquifer to stimulate biogeochemical processes leading to the transformation of soluble radionuclides to insoluble forms. However, once carbon addition is ceased and geochemical conditions return to oxidizing, the insoluble radionuclides may re-dissolve. The pilot project will target long term stability by enhancing the creation of reduced mineral forms in and around the precipitated radionuclides to act as both a redox buffer for oxidizing groundwater and as a sorptive medium for any dissolved uranium and technetium. Successful treatment with respect to in situ radionuclide precipitation extends beyond numeric cleanup goals and invokes a standard of care that considers not only short-term solubility achieved during active remediation, but the range of factors that might erode/compromise the stability of the precipitated solids over the long-term. Long-term stability may be achieved by incorporating the targeted radionuclide in a matrix of other precipitates formed through the treatment process. In the short term, this can include the precipitates of other more abundant metals (e.g., iron) that can preferentially scavenge oxygen. Longer term, this is expected to transition to passivation within a matrix of more stable mineral phases, such that rates of rebound dissolution are sufficiently suppressed to maintain dissolved concentrations below remedial targets. The in situ reactive zone (IRZ

  9. An Investigation into the Transportation of Irradiated Uranium/Aluminum Targets from a Foreign Nuclear Reactor to the Chalk River Laboratories Site in Ontario, Canada - 12249

    SciTech Connect

    Clough, Malcolm; Jackson, Austin

    2012-07-01

    This investigation required the selection of a suitable cask and development of a device to hold and transport irradiated targets from a foreign nuclear reactor to the Chalk River Laboratories in Ontario, Canada. The main challenge was to design and validate a target holder to protect the irradiated HEU-Al target pencils during transit. Each of the targets was estimated to have an initial decay heat of 118 W prior to transit. As the targets have little thermal mass the potential for high temperature damage and possibly melting was high. Thus, the primary design objective was to conceive a target holder to dissipate heat from the targets. Other design requirements included securing the targets during transportation and providing a simple means to load and unload the targets while submerged five metres under water. A unique target holder (patent pending) was designed and manufactured together with special purpose experimental apparatus including a representative cask. Aluminum dummy targets were fabricated to accept cartridge heaters, to simulate decay heat. Thermocouples were used to measure the temperature of the test targets and selected areas within the target holder and test cask. After obtaining test results, calculations were performed to compensate for differences between experimental and real life conditions. Taking compensation into consideration the maximum target temperature reached was 231 deg. C which was below the designated maximum of 250 deg. C. The design of the aluminum target holder also allowed generous clearance to insert and unload the targets. This clearance was designed to close up as the target holder is placed into the cavity of the transport cask. Springs served to retain and restrain the targets from movement during transportation as well as to facilitate conductive heat transfer. The target holder met the design requirements and as such provided data supporting the feasibility of transporting targets over a relatively long period of time

  10. Fragment based group QSAR and molecular dynamics mechanistic studies on arylthioindole derivatives targeting the α-β interfacial site of human tubulin

    PubMed Central

    2014-01-01

    Background A number of microtubule disassembly blocking agents and inhibitors of tubulin polymerization have been elements of great interest in anti-cancer therapy, some of them even entering into the clinical trials. One such class of tubulin assembly inhibitors is of arylthioindole derivatives which results in effective microtubule disorganization responsible for cell apoptosis by interacting with the colchicine binding site of the β-unit of tubulin close to the interface with the α unit. We modelled the human tubulin β unit (chain D) protein and performed docking studies to elucidate the detailed binding mode of actions associated with their inhibition. The activity enhancing structural aspects were evaluated using a fragment-based Group QSAR (G-QSAR) model and was validated statistically to determine its robustness. A combinatorial library was generated keeping the arylthioindole moiety as the template and their activities were predicted. Results The G-QSAR model obtained was statistically significant with r2 value of 0.85, cross validated correlation coefficient q2 value of 0.71 and pred_r2 (r2 value for test set) value of 0.89. A high F test value of 65.76 suggests robustness of the model. Screening of the combinatorial library on the basis of predicted activity values yielded two compounds HPI (predicted pIC50 = 6.042) and MSI (predicted pIC50 = 6.001) whose interactions with the D chain of modelled human tubulin protein were evaluated in detail. A toxicity evaluation resulted in MSI being less toxic in comparison to HPI. Conclusions The study provides an insight into the crucial structural requirements and the necessary chemical substitutions required for the arylthioindole moiety to exhibit enhanced inhibitory activity against human tubulin. The two reported compounds HPI and MSI showed promising anti cancer activities and thus can be considered as potent leads against cancer. The toxicity evaluation of these compounds suggests that MSI is a promising

  11. Selective Deletion of Leptin Receptors in Gonadotropes Reveals Activin and GnRH-Binding Sites as Leptin Targets in Support of Fertility

    PubMed Central

    Akhter, Noor; CarlLee, Tyler; Syed, Mohsin M.; Odle, Angela K.; Cozart, Michael A.; Haney, Anessa C.; Allensworth-James, Melody L.; Beneš, Helen

    2014-01-01

    The adipokine, leptin (LEP), is a hormonal gateway, signaling energy stores to appetite-regulatory neurons, permitting reproduction when stores are sufficient. Dual-labeling for LEP receptors (LEPRs) and gonadotropins or GH revealed a 2-fold increase in LEPR during proestrus, some of which was seen in LH gonadotropes. We therefore investigated LEPR functions in gonadotropes with Cre-LoxP technology, deleting the signaling domain of the LEPR (Lepr-exon 17) with Cre-recombinase driven by the rat LH-β promoter (Lhβ-cre). Selectivity of the deletion was validated by organ genotyping and lack of LEPR and responses to LEP by mutant gonadotropes. The mutation had no impact on growth, body weight, the timing of puberty, or pregnancy. Mutant females took 36% longer to produce their first litter and had 50% fewer pups/litter. When the broad impact of the loss of gonadotrope LEPR on all pituitary hormones was studied, mutant diestrous females had reduced serum levels of LH (40%), FSH (70%), and GH (54%) and mRNA levels of Fshβ (59%) and inhibin/activin β A and β B (25%). Mutant males had reduced serum levels of GH (74%), TSH (31%), and prolactin (69%) and mRNA levels of Gh (31%), Ghrhr (30%), Fshβ (22%), and glycoprotein α-subunit (Cga) (22%). Serum levels of LEP and ACTH and mRNA levels of Gnrhr were unchanged. However, binding to GnRH receptors was reduced in LEPR-null LH or FSH gonadotropes by 82% or 89%, respectively, in females (P < .0001) and 27% or 53%, respectively, in males (P < .03). This correlated with reductions in GnRH receptor protein immunolabeling, suggesting that LEP's actions may be posttranscriptional. Collectively, these studies highlight the importance of LEP to gonadotropes with GnRH-binding sites and activin as potential targets. LEP may modulate population growth, adjusting the number of offspring to the availability of food supplies. PMID:25057790

  12. Fragment-Based Design of Ligands Targeting a Novel Site on the Integrase Enzyme of Human Immunodeficiency Virus;#8197;1

    SciTech Connect

    Wielens, Jerome; Headey, Stephen J.; Deadman, John J.; Rhodes, David I.; Parker, Michael W.; Chalmers, David K.; Scanlon, Martin J.

    2011-08-17

    Fragment-based screening has been used to identify a novel ligand binding site on HIV-1 integrase. Crystal structures of fragments bound at this site (shown) have been used to design elaborated second-generation compounds that bind with higher affinity and good ligand efficiency.

  13. Recruiting Injection Drug Users: A Three-Site Comparison of Results and Experiences with Respondent-Driven and Targeted Sampling Procedures

    PubMed Central

    Risser, Jan M. H.; McGoy, Shanell; Becker, Adam B.; Rehman, Hafeez; Jefferson, Mary; Griffin, Vivian; Wolverton, Marcia; Tortu, Stephanie

    2006-01-01

    Several recent studies have utilized respondent-driven sampling (RDS) methods to survey hidden populations such as commercial sex-workers, men who have sex with men (MSM) and injection drug users (IDU). Few studies, however, have provided a direct comparison between RDS and other more traditional sampling methods such as venue-based, targeted or time/space sampling. The current study sampled injection drug users in three U.S. cities using RDS and targeted sampling (TS) methods and compared their effectiveness in terms of recruitment efficiency, logistics, and sample demographics. Both methods performed satisfactorily. The targeted method required more staff time per-recruited respondent and had a lower proportion of screened respondents who were eligible than RDS, while RDS respondents were offered higher incentives for participation. PMID:16933101

  14. Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region.

    PubMed

    Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro

    2011-05-01

    Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼ 70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5'- and 3'-boundaries of the PIC assembly zone. PMID:21288884

  15. Engineering metal-binding sites of bacterial CusF to enhance Zn/Cd accumulation and resistance by subcellular targeting.

    PubMed

    Yu, Pengli; Yuan, Jinhong; Zhang, Hui; Deng, Xin; Ma, Mi; Zhang, Haiyan

    2016-01-25

    The periplasmic protein CusF acts as a metallochaperone to mediate Cu resistance in Escherichia coli. CusF does not contain cysteine residues and barely binds to divalent cations. Here, we addressed effects of cysteine-substitution mutant (named as mCusF) of CusF on zinc/cadmium (Zn/Cd) accumulation and resistance. We targeted mCusF to different subcellular compartments in Arabidopsis. We found that plants expressing vacuole-targeted mCusF were more resistant to excess Zn than WT and plants with cell wall-targeted or cytoplasmic mCusF. Under long-term exposure to excess Zn, all transgenic lines accumulated more Zn (up to 2.3-fold) in shoots than the untransformed plants. Importantly, plants with cytoplasmic mCusF showed higher efficiency of Zn translocation from root to shoot than plants with secretory pathway-targeted-mCusF. Furthermore, the transgenic lines exhibited enhanced resistance to Cd and significant increase in root-to-shoot Cd translocation. We also found all transgenic plants greatly improved manganese (Mn) and iron (Fe) homeostasis under Cd exposure. Our results demonstrate heterologous expression of mCusF could be used to engineer a new phytoremediation strategy for Zn/Cd and our finding also deepen our insights into mechanistic basis for relieving Cd toxicity in plants through proper root/shoot partitioning mechanism and homeostatic accumulation of Mn and Fe. PMID:26476315

  16. Genetic mapping of non-target site resistance to a sulfonylurea herbicide (Envoke®) in Upland cotton (Gossypium hirsutum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Acetolactate synthase (ALS) is responsible for a rate limiting step in the synthesis of essential branched chain amino acids. Resistance to ALS-inhibiting herbicides, such as trifloxysulfuron sodium (Envoke®), can be due to mutations in the target gene itself. Alternatively, plants may exhibit herb...

  17. Tumor site-specific silencing of NF-κB p65 by targeted hollow gold nanospheres-mediated photothermal transfection

    PubMed Central

    Lu, Wei; Zhang, Guodong; Zhang, Rui; Flores, Leo G; Huang, Qian; Gelovani, Juri G; Li, Chun

    2010-01-01

    Nuclear factor-κB (NF-κB) transcription factor is a critical regulator of the expression of genes involved in tumor formation and progression. Successful RNA interference (RNAi) therapeutics targeting NF-κB is challenged by siRNA delivery systems, which can render targeted in vivo delivery, efficient endo-lysosomal escape and dynamic control over activation of RNAi. Here, we report near-infrared light-inducible NF-κB down-regulation through folate receptor-targeted hollow gold nanospheres carrying siRNA recognizing NF-κB p65 subunit. Using micro-positron emission tomography/computed tomography imaging, the targeted nanoconstructs exhibited significantly higher tumor uptake in nude mice-bearing HeLa cervical cancer xenografts than non-targeted nanoparticles following intravenous administration. Mediated by hollow gold nanospheres, controllable cytoplasmic delivery of siRNA was obtained upon near-infrared light irradiation through photothermal effect. Efficient down-regulation of NF-κB p65 was achieved only in tumors irradiated with near-infrared light, but not in non-irradiated tumors grown in the same mice. Liver, spleen, kidney, and lung were not affected by the treatments, in spite of significant uptake of the siRNA nanoparticles in these organs. We term this mode of action “photothermal transfection”. Combined treatments with p65 siRNA photothermal transfection and irinotecan caused substantially enhanced tumor apoptosis and significant tumor growth delay compared with other treatment regimens. Therefore, photothermal transfection of NF-κB p65 siRNA could effectively sensitize the tumor to chemotherapeutic agents. Because NIR light can penetrate skin and be delivered with high spatiotemporal control, therapeutic RNAi may benefit from this novel transfection strategy while avoiding unwanted side effect. PMID:20388791

  18. Target-controlled formation of silver nanoclusters in abasic site-incorporated duplex DNA for label-free fluorescence detection of theophylline

    NASA Astrophysics Data System (ADS)

    Park, Ki Soo; Oh, Seung Soo; Soh, H. Tom; Park, Hyun Gyu

    2014-08-01

    A novel, label-free, fluorescence based sensor for theophylline has been developed. In the new sensor system, an abasic site-incorporated duplex DNA probe serves as both a pocket for recognition of theophylline and a template for the preparation of fluorescent silver nanoclusters. The strategy relies on theophylline-controlled formation of fluorescent silver nanoclusters from abasic site-incorporated duplex DNA. When theophylline is not present, silver ions interact with the cytosine groups opposite to the abasic site in duplex DNA. This interaction leads to efficient formation of intensely red fluorescent silver nanoclusters. In contrast, when theophylline is bound at the abasic site through pseudo base-pairing with appropriately positioned cytosines, silver ion binding to the cytosine nucleobase is prevented. Consequently, fluorescent silver nanoclusters are not formed causing a significant reduction of the fluorescence signal. By employing this new sensor, theophylline can be highly selectively detected at a concentration as low as 1.8 μM. Finally, the diagnostic capability and practical application of this sensor were demonstrated by its use in detecting theophylline in human blood serum.A novel, label-free, fluorescence based sensor for theophylline has been developed. In the new sensor system, an abasic site-incorporated duplex DNA probe serves as both a pocket for recognition of theophylline and a template for the preparation of fluorescent silver nanoclusters. The strategy relies on theophylline-controlled formation of fluorescent silver nanoclusters from abasic site-incorporated duplex DNA. When theophylline is not present, silver ions interact with the cytosine groups opposite to the abasic site in duplex DNA. This interaction leads to efficient formation of intensely red fluorescent silver nanoclusters. In contrast, when theophylline is bound at the abasic site through pseudo base-pairing with appropriately positioned cytosines, silver ion binding to

  19. Target-controlled formation of silver nanoclusters in abasic site-incorporated duplex DNA for label-free fluorescence detection of theophylline.

    PubMed

    Park, Ki Soo; Oh, Seung Soo; Soh, H Tom; Park, Hyun Gyu

    2014-09-01

    A novel, label-free, fluorescence based sensor for theophylline has been developed. In the new sensor system, an abasic site-incorporated duplex DNA probe serves as both a pocket for recognition of theophylline and a template for the preparation of fluorescent silver nanoclusters. The strategy relies on theophylline-controlled formation of fluorescent silver nanoclusters from abasic site-incorporated duplex DNA. When theophylline is not present, silver ions interact with the cytosine groups opposite to the abasic site in duplex DNA. This interaction leads to efficient formation of intensely red fluorescent silver nanoclusters. In contrast, when theophylline is bound at the abasic site through pseudo base-pairing with appropriately positioned cytosines, silver ion binding to the cytosine nucleobase is prevented. Consequently, fluorescent silver nanoclusters are not formed causing a significant reduction of the fluorescence signal. By employing this new sensor, theophylline can be highly selectively detected at a concentration as low as 1.8 μM. Finally, the diagnostic capability and practical application of this sensor were demonstrated by its use in detecting theophylline in human blood serum. PMID:24901073

  20. Seasat over-land scatterometer data. II - Selection of extended area land-target sites for the calibration of spaceborne scatterometers

    NASA Technical Reports Server (NTRS)

    Kennett, Rosemary G.; Li, Fuk K.

    1989-01-01

    The post-launch performance verification for future scatterometers can use extended area land targets to calibrate antenna gain patterns and to verify and monitor deployment configurations. For the Ku-band Seasat scatterometer, a region of tropical rain forest in the Amazon basin was used as a homogeneous extended-area land target. As this region is continuously being deforested, other regions are investigated for calibrating scatterometers. The global backscatter coefficients (sigma0) are compared to classifications of natural vegetation and cultivation intensity and the variability with time during the three-month mission is studied. The statistical variability of sigma0 is compared with prior estimates resulting from the known variability of the instrument parameters and communication noise. Data from selected forested regions with relatively homogeneous sigma0 and little time-dependence are presented.

  1. The mode of action and the structure of a herbicide in complex with its target: binding of activated hydantocidin to the feedback regulation site of adenylosuccinate synthetase.

    PubMed Central

    Fonné-Pfister, R; Chemla, P; Ward, E; Girardet, M; Kreuz, K E; Honzatko, R B; Fromm, H J; Schär, H P; Grütter, M G; Cowan-Jacob, S W

    1996-01-01

    (+)-Hydantocidin, a recently discovered natural spironucleoside with potent herbicidal activity, is shown to be a proherbicide that, after phosphorylation at the 5' position, inhibits adenylosuccinate synthetase, an enzyme involved in de novo purine synthesis. The mode of binding of hydantocidin 5'-monophosphate to the target enzyme was analyzed by determining the crystal structure of the enzyme-inhibitor complex at 2.6-A resolution. It was found that adenylosuccinate synthetase binds the phosphorylated compound in the same fashion as it does adenosine 5'-monophosphate, the natural feedback regulator of this enzyme. This work provides the first crystal structure of a herbicide-target complex reported to date. Images Fig. 4 Fig. 5 PMID:8790347

  2. A Retinoblastoma Allele That Is Mutated at Its Common E2F Interaction Site Inhibits Cell Proliferation in Gene-Targeted Mice

    PubMed Central

    Cecchini, Matthew J.; Thwaites, Michael J.; Talluri, Srikanth; MacDonald, James I.; Passos, Daniel T.; Chong, Jean-Leon; Cantalupo, Paul; Stafford, Paul M.; Sáenz-Robles, M. Teresa; Francis, Sarah M.; Pipas, James M.; Leone, Gustavo; Welch, Ian

    2014-01-01

    The retinoblastoma protein (pRB) is best known for regulating cell proliferation through E2F transcription factors. In this report, we investigate the properties of a targeted mutation that disrupts pRB interactions with the transactivation domain of E2Fs. Mice that carry this mutation endogenously (Rb1ΔG) are defective for pRB-dependent repression of E2F target genes. Except for an accelerated entry into S phase in response to serum stimulation, cell cycle regulation in Rb1ΔG/ΔG mouse embryonic fibroblasts (MEFs) strongly resembles that of the wild type. In a serum deprivation-induced cell cycle exit, Rb1ΔG/ΔG MEFs display a magnitude of E2F target gene derepression similar to that of Rb1−/− cells, even though Rb1ΔG/ΔG cells exit the cell cycle normally. Interestingly, cell cycle arrest in Rb1ΔG/ΔG MEFs is responsive to p16 expression and gamma irradiation, indicating that alternate mechanisms can be activated in G1 to arrest proliferation. Some Rb1ΔG/ΔG mice die neonatally with a muscle degeneration phenotype, while the others live a normal life span with no evidence of spontaneous tumor formation. Most tissues appear histologically normal while being accompanied by derepression of pRB-regulated E2F targets. This suggests that non-E2F-, pRB-dependent pathways may have a more relevant role in proliferative control than previously identified. PMID:24662053

  3. Prospective Randomized Double-Blind Pilot Study of Site-Specific Consensus Atlas Implementation for Rectal Cancer Target Volume Delineation in the Cooperative Group Setting

    SciTech Connect

    Fuller, Clifton D.; Nijkamp, Jasper; Duppen, Joop C.; Rasch, Coen R.N.; Thomas, Charles R.; Wang, Samuel J.; Okunieff, Paul; Jones, William E.; Baseman, Daniel; Patel, Shilpen; Demandante, Carlo G.N.; Harris, Anna M.; Smith, Benjamin D.; Katz, Alan W.; McGann, Camille

    2011-02-01

    Purpose: Variations in target volume delineation represent a significant hurdle in clinical trials involving conformal radiotherapy. We sought to determine the effect of a consensus guideline-based visual atlas on contouring the target volumes. Methods and Materials: A representative case was contoured (Scan 1) by 14 physician observers and a reference expert with and without target volume delineation instructions derived from a proposed rectal cancer clinical trial involving conformal radiotherapy. The gross tumor volume (GTV), and two clinical target volumes (CTVA, including the internal iliac, presacral, and perirectal nodes, and CTVB, which included the external iliac nodes) were contoured. The observers were randomly assigned to receipt (Group A) or nonreceipt (Group B) of a consensus guideline and atlas for anorectal cancers and then instructed to recontour the same case/images (Scan 2). Observer variation was analyzed volumetrically using the conformation number (CN, where CN = 1 equals total agreement). Results: Of 14 evaluable contour sets (1 expert and 7 Group A and 6 Group B observers), greater agreement was found for the GTV (mean CN, 0.75) than for the CTVs (mean CN, 0.46-0.65). Atlas exposure for Group A led to significantly increased interobserver agreement for CTVA (mean initial CN, 0.68, after atlas use, 0.76; p = .03) and increased agreement with the expert reference (initial mean CN, 0.58; after atlas use, 0.69; p = .02). For the GTV and CTVB, neither the interobserver nor the expert agreement was altered after atlas exposure. Conclusion: Consensus guideline atlas implementation resulted in a detectable difference in interobserver agreement and a greater approximation of expert volumes for the CTVA but not for the GTV or CTVB in the specified case. Visual atlas inclusion should be considered as a feature in future clinical trials incorporating conformal RT.

  4. Derivation of a target level of lead in soil at residential sites corresponding to a de minimis contribution to blood lead concentration

    SciTech Connect

    Stern, A.H. )

    1994-12-01

    Inability to define either a clear toxicologic threshold or a stochastic all-or-nothing (cancer-type) response model for the noncarcinogenic effects of lead (Pb) in young children has posed difficulties for derivation of risk-based target levels of Pb in residential soil. Approaches based on empirical relationships between Pb levels in blood (PbB) and Pb in soil suffer from inability to specify the numerous variables which mediate between these two quantities. Approaches based on achieving a toxicologically de minimis target PbB level (e.g., 10 [mu]g/dl) are subject to large uncertainty in estimating the distribution of existing PbB levels in a specific exposed population and in estimating the relative contribution from nonsoil sources of Pb. The multisource contribution to the distribution of PbB makes this approach unsuited for determination of a target Pb level in a single medium. An alternative approach is presented based on achieving a de minimis contribution to PbB ([Delta]PbB) from soil. Contributions to Pb exposure from outdoor soil and indoor soil-derived dust (ISDD) are modeled and appropriate values are suggested for input parameters. This analysis predicts that chronic exposure of young children to 200 [mu]g Pb/g (ppm) in residential soil will result in a [Delta]PbB of 2 [mu]g Pb/dl blood. This concentration of Pb in soil may provide an appropriate target level for residential soil when other significant sources of Pb exposure are present. In other cases, this approach can be used to predict a soil concentration of Pb corresponding to an appropriate non-de minimis [Delta]PbB. 39 refs., 1 tab.

  5. Tenfibgen Ligand Nanoencapsulation Delivers Bi-Functional Anti-CK2 RNAi Oligomer to Key Sites for Prostate Cancer Targeting Using Human Xenograft Tumors in Mice

    PubMed Central

    Trembley, Janeen H.; Unger, Gretchen M.; Korman, Vicci L.; Abedin, Md. Joynal; Nacusi, Lucas P.; Vogel, Rachel I.; Slaton, Joel W.; Kren, Betsy T.; Ahmed, Khalil

    2014-01-01

    Protected and specific delivery of nucleic acids to malignant cells remains a highly desirable approach for cancer therapy. Here we present data on the physical and chemical characteristics, mechanism of action, and pilot therapeutic efficacy of a tenfibgen (TBG)-shell nanocapsule technology for tumor-directed delivery of single stranded DNA/RNA chimeric oligomers targeting CK2αα' to xenograft tumors in mice. The sub-50 nm size TBG nanocapsule (s50-TBG) is a slightly negatively charged, uniform particle of 15 - 20 nm size which confers protection to the nucleic acid cargo. The DNA/RNA chimeric oligomer (RNAi-CK2) functions to decrease CK2αα' expression levels via both siRNA and antisense mechanisms. Systemic delivery of s50-TBG-RNAi-CK2 specifically targets malignant cells, including tumor cells in bone, and at low doses reduces size and CK2-related signals in orthotopic primary and metastatic xenograft prostate cancer tumors. In conclusion, the s50-TBG nanoencapsulation technology together with the chimeric oligomer targeting CK2αα' offer significant promise for systemic treatment of prostate malignancy. PMID:25333839

  6. Identification of target genes regulated by homeotic proteins in Drosophila melanogaster through genetic selection of Ultrabithorax protein-binding sites in yeast

    SciTech Connect

    Mastick, G.S.; McKay, R.; Oligino, T.

    1995-01-01

    A method based on the transcriptional activation of a selectable reporter in yeast cells was used to identify genes regulated by the Utrabithorax homeoproteins in Drosophila melanogaster. Fifty-three DNA fragments that can mediate activation by UBX isoform Ia in this test were recovered after screening 15% of the Drosophila genome. Half of these fragments represent single-copy sequences in the genome. Six single-copy fragments were investigated in detail, and each was found to reside near a transcription unit whose expression in the embryo is segmentally modulated as expected for targets of homeotic genes. Four of these putative target genes are expressed in patterns that suggest roles in the development of regional specializations within mesoderm derivatives; in three cases these expression patterns depend on Ultrabithorax function. Extrapolation from this pilot study indicates that 85-170 candidate target genes can be identified by screening the entire Drosophila genome with UBX isoform Ia. With appropriate modifications, this approach should be applicable to other transcriptional regulators in diverse organisms. 69 refs., 9 figs., 2 tabs.

  7. PAPERCLIP Identifies MicroRNA Targets and a Role of CstF64/64tau in Promoting Non-canonical poly(A) Site Usage.

    PubMed

    Hwang, Hun-Way; Park, Christopher Y; Goodarzi, Hani; Fak, John J; Mele, Aldo; Moore, Michael J; Saito, Yuhki; Darnell, Robert B

    2016-04-12

    Accurate and precise annotation of 3' UTRs is critical for understanding how mRNAs are regulated by microRNAs (miRNAs) and RNA-binding proteins (RBPs). Here, we describe a method, poly(A) binding protein-mediated mRNA 3' end retrieval by crosslinking immunoprecipitation (PAPERCLIP), that shows high specificity for mRNA 3' ends and compares favorably with existing 3' end mapping methods. PAPERCLIP uncovers a previously unrecognized role of CstF64/64tau in promoting the usage of a selected group of non-canonical poly(A) sites, the majority of which contain a downstream GUKKU motif. Furthermore, in the mouse brain, PAPERCLIP discovers extended 3' UTR sequences harboring functional miRNA binding sites and reveals developmentally regulated APA shifts, including one in Atp2b2 that is evolutionarily conserved in humans and results in the gain of a functional binding site of miR-137. PAPERCLIP provides a powerful tool to decipher post-transcriptional regulation of mRNAs through APA in vivo. PMID:27050522

  8. PAPERCLIP identifies microRNA targets and a role of CstF64/64tau in promoting non-canonical poly(A) site usage

    PubMed Central

    Hwang, Hun-Way; Park, Christopher Y.; Goodarzi, Hani; Fak, John J.; Mele, Aldo; Moore, Michael J.; Saito, Yuhki; Darnell, Robert B.

    2016-01-01

    Accurate and precise annotation of the 3′ untranslated regions (3′ UTRs) is critical in understanding how mRNAs are regulated by microRNAs (miRNAs) and RNA-binding proteins (RBPs). Here we describe a method, PAPERCLIP (Poly(A) binding Protein-mediated mRNA 3′ End Retrieval by CrossLinking ImmunoPrecipitation), which shows high specificity for the mRNA 3′ ends and compares favorably to existing 3′ end mapping methods. PAPERCLIP uncovers a previously unrecognized role of CstF64/64tau in promoting the usage of a selected group of non-canonical poly(A) sites, the majority of them containing a downstream GUKKU motif. Furthermore, in mouse brain, PAPERCLIP discovers extended 3′ UTR sequences harboring functional miRNA binding sites and reveals developmentally regulated APA shifts including one in Atp2b2 that is evolutionarily conserved in human and results in a gain of a functional binding site of miR-137. PAPERCLIP provides a powerful tool to decipher post-transcriptional regulation of mRNAs through APA in vivo. PMID:27050522

  9. Mapping Targetable Sites on Human Telomerase RNA Pseudoknot/Template Domain Using 2′-OMe RNA-interacting Polynucleotide (RIPtide) Microarrays*

    PubMed Central

    Gude, Lourdes; Berkovitch, Shaunna S.; Santos, Webster L.; Kutchukian, Peter S.; Pawloski, Adam R.; Kuimelis, Robert; McGall, Glenn; Verdine, Gregory L.

    2012-01-01

    Most cellular RNAs engage in intrastrand base-pairing that gives rise to complex three-dimensional folds. This self-pairing presents an impediment toward binding of the RNA by nucleic acid-based ligands. An important step in the discovery of RNA-targeting ligands is therefore to identify those regions in a folded RNA that are accessible toward the nucleic acid-based ligand. Because the folding of RNA targets can involve interactions between nonadjacent regions and employ both Watson-Crick and non-Watson-Crick base-pairing, screening of candidate binder ensembles is typically necessary. Microarray-based screening approaches have shown great promise in this regard and have suggested that achieving complete sequence coverage would be a valuable attribute of a next generation system. Here, we report a custom microarray displaying a library of RNA-interacting polynucleotides comprising all possible 2′-OMe RNA sequences from 4- to 8-nucleotides in length. We demonstrate the utility of this array in identifying RNA-interacting polynucleotides that bind tightly and specifically to the highly conserved, functionally essential template/pseudoknot domain of human telomerase RNA and that inhibit telomerase function in vitro. PMID:22451672

  10. Inhibition of SCF ubiquitin ligases by engineered ubiquitin variants that target the Cul1 binding site on the Skp1–F-box interface

    PubMed Central

    Gorelik, Maryna; Orlicky, Stephen; Sartori, Maria A.; Tang, Xiaojing; Marcon, Edyta; Kurinov, Igor; Greenblatt, Jack F.; Tyers, Mike; Moffat, Jason; Sicheri, Frank; Sidhu, Sachdev S.

    2016-01-01

    Skp1–Cul1–F-box (SCF) E3 ligases play key roles in multiple cellular processes through ubiquitination and subsequent degradation of substrate proteins. Although Skp1 and Cul1 are invariant components of all SCF complexes, the 69 different human F-box proteins are variable substrate binding modules that determine specificity. SCF E3 ligases are activated in many cancers and inhibitors could have therapeutic potential. Here, we used phage display to develop specific ubiquitin-based inhibitors against two F-box proteins, Fbw7 and Fbw11. Unexpectedly, the ubiquitin variants bind at the interface of Skp1 and F-box proteins and inhibit ligase activity by preventing Cul1 binding to the same surface. Using structure-based design and phage display, we modified the initial inhibitors to generate broad-spectrum inhibitors that targeted many SCF ligases, or conversely, a highly specific inhibitor that discriminated between even the close homologs Fbw11 and Fbw1. We propose that most F-box proteins can be targeted by this approach for basic research and for potential cancer therapies. PMID:26976582

  11. Global mapping of binding sites for Nrf2 identifies novel targets in cell survival response through ChIP-Seq profiling and network analysis

    PubMed Central

    Malhotra, Deepti; Portales-Casamar, Elodie; Singh, Anju; Srivastava, Siddhartha; Arenillas, David; Happel, Christine; Shyr, Casper; Wakabayashi, Nobunao; Kensler, Thomas W.; Wasserman, Wyeth W.; Biswal, Shyam

    2010-01-01

    The Nrf2 (nuclear factor E2 p45-related factor 2) transcription factor responds to diverse oxidative and electrophilic environmental stresses by circumventing repression by Keap1, translocating to the nucleus, and activating cytoprotective genes. Nrf2 responses provide protection against chemical carcinogenesis, chronic inflammation, neurodegeneration, emphysema, asthma and sepsis in murine models. Nrf2 regulates the expression of a plethora of genes that detoxify oxidants and electrophiles and repair or remove damaged macromolecules, such as through proteasomal processing. However, many direct targets of Nrf2 remain undefined. Here, mouse embryonic fibroblasts (MEF) with either constitutive nuclear accumulation (Keap1−/−) or depletion (Nrf2−/−) of Nrf2 were utilized to perform chromatin-immunoprecipitation with parallel sequencing (ChIP-Seq) and global transcription profiling. This unique Nrf2 ChIP-Seq dataset is highly enriched for Nrf2-binding motifs. Integrating ChIP-Seq and microarray analyses, we identified 645 basal and 654 inducible direct targets of Nrf2, with 244 genes at the intersection. Modulated pathways in stress response and cell proliferation distinguish the inducible and basal programs. Results were confirmed in an in vivo stress model of cigarette smoke-exposed mice. This study reveals global circuitry of the Nrf2 stress response emphasizing Nrf2 as a central node in cell survival response. PMID:20460467

  12. Identification of a potent antiandrogen that targets the BF3 site of the androgen receptor and inhibits enzalutamide-resistant prostate cancer.

    PubMed

    Munuganti, Ravi S N; Hassona, Mohamed D H; Leblanc, Eric; Frewin, Kate; Singh, Kriti; Ma, Dennis; Ban, Fuqiang; Hsing, Michael; Adomat, Hans; Lallous, Nada; Andre, Christophe; Jonadass, Jon Paul Selvam; Zoubeidi, Amina; Young, Robert N; Guns, Emma Tomlinson; Rennie, Paul S; Cherkasov, Artem

    2014-11-20

    There has been a resurgence of interest in the development of androgen receptor (AR) inhibitors with alternative modes of action to overcome the development of resistance to current therapies. We demonstrated previously that one promising strategy for combatting mutation-driven drug resistance is to target the Binding Function 3 (BF3) pocket of the receptor. Here we report the development of a potent BF3 inhibitor, 3-(2,3-dihydro-1H-indol-2-yl)-1H-indole, which demonstrates excellent antiandrogen potency and anti-PSA activity and abrogates the androgen-induced proliferation of androgen-sensitive (LNCaP) and enzalutamide-resistant (MR49F) PCa cell lines. Moreover, this compound effectively reduces the expression of AR-dependent genes in PCa cells and effectively inhibits tumor growth in vivo in both LNCaP and MR49F xenograft models. These findings provide evidence that targeting the AR BF3 pocket represents a viable therapeutic approach to treat patients with advanced and/or resistant prostate cancer. PMID:25459660

  13. Traces of DU in samples of environmental bio-monitors (non-flowering plants, fungi) and soil from target sites of the Western Balkan region.

    PubMed

    Zunić, Zora S; Mietelski, Jerzy W; Błazej, Sylwia; Gaca, Paweł; Tomankiewicz, Ewa; Ujić, Predrag; Celiković, Igor; Cuknić, Olivera; Demajo, Miroslav

    2008-08-01

    This paper reports results of gamma and alpha spectrometric measurements for mosses, lichens, fungi and soil samples from areas in the Balkans targeted by depleted uranium (DU). Samples were collected in 2002 and 2003 in the vicinity of several villages, principally Han Pijesak (Bosnia and Herzegovina, hit by DU in 1995) and Bratoselce (South Serbia, hit by DU in 1999) and in lesser numbers from Gornja Stubla, Kosovo (which is identified as a high natural radon/thoron area) and Presevo close to the Kosovo border. In the course of gamma spectrometric measurements some results suggested samples with unusual high uranium contents which might be considered to be a signature for the presence of DU, although many samples had very high detection limits. Alpha spectrometric measurements directly proved the presence of DU for five samples, all from directly targeted places. These were samples of mosses, lichens and soil. For some samples homogeneity tests were applied which showed a rather even distribution of DU in these samples. No trace of DU was found in any sample from a dwelling. PMID:18502546

  14. A new nonhydrolyzable reactive cGMP analogue, (Rp)-Guanosine-3′, 5′-cyclic-S-(4-bromo-2, 3-dioxobutyl)monophosphorothioate, which targets the cGMP binding site of human platelet PDE3A

    PubMed Central

    Hung, Su H.; Liu, Andy H.; Pixley, Robin A.; Francis, Penelope; Williams, LaTeeka D.; Matsko, Christopher M.; Barnes, Karine D.; Sivendran, Sharmila; Colman, Roberta F.; Colman, Robert W.

    2008-01-01

    The amino acids involved in substrate (cAMP) binding to human platelet cGMP-inhibited cAMP phosphodiesterase (PDE3A) are identified. Less is known about the inhibitor (cGMP) binding site. We have now synthesized a nonhydrolyzable reactive cGMP analog, Rp-guanosine-3′, 5′-cyclic-S-(4-bromo-2, 3-dioxobutyl)monophosphorothioate (Rp-cGMPS-BDB). Rp-cGMPS-BDB irreversibly inactivates PDE3A (KI = 43.4 ± 7.2 μM and kcart = 0.007 ± 0.0006 min−1). The effectiveness of protectants in decreasing the rate of inactivation by Rp-cGMPS-BDB is: Rp-cGMPS (Kd = 72 μM) > Sp-cGMPS (124), Sp-cAMPS (182) > GMP (1517), Rp-cAMPS (3762), AMP (4370 μM). NAD+, neither a substrate nor an inhibitor of PDE3A, does not protect. Nonhydrolyzable cGMP analogs exhibit greater affinity than the cAMP analogs. These results indicate that Rp-cGMPS-BDB targets favorably the cGMP binding site consistent with a docking model of PDE3A-Rp-cGMPS-BDB active site. We conclude that Rp-cGMPS-BDB is an effective active site-directed affinity label for PDE3A with potential for other cGMP-dependent enzymes. PMID:18394675

  15. Advanced Algorithms and High-Performance Testbed for Large-Scale Site Characterization and Subsurface Target Detecting Using Airborne Ground Penetrating SAR

    NASA Technical Reports Server (NTRS)

    Fijany, Amir; Collier, James B.; Citak, Ari

    1997-01-01

    A team of US Army Corps of Engineers, Omaha District and Engineering and Support Center, Huntsville, let Propulsion Laboratory (JPL), Stanford Research Institute (SRI), and Montgomery Watson is currently in the process of planning and conducting the largest ever survey at the Former Buckley Field (60,000 acres), in Colorado, by using SRI airborne, ground penetrating, Synthetic Aperture Radar (SAR). The purpose of this survey is the detection of surface and subsurface Unexploded Ordnance (UXO) and in a broader sense the site characterization for identification of contaminated as well as clear areas. In preparation for such a large-scale survey, JPL has been developing advanced algorithms and a high-performance restbed for processing of massive amount of expected SAR data from this site. Two key requirements of this project are the accuracy (in terms of UXO detection) and speed of SAR data processing. The first key feature of this testbed is a large degree of automation and a minimum degree of the need for human perception in the processing to achieve an acceptable processing rate of several hundred acres per day. For accurate UXO detection, novel algorithms have been developed and implemented. These algorithms analyze dual polarized (HH and VV) SAR data. They are based on the correlation of HH and VV SAR data and involve a rather large set of parameters for accurate detection of UXO. For each specific site, this set of parameters can be optimized by using ground truth data (i.e., known surface and subsurface UXOs). In this paper, we discuss these algorithms and their successful application for detection of surface and subsurface anti-tank mines by using a data set from Yuma proving Ground, A7, acquired by SRI SAR.

  16. Advanced algorithms and high-performance testbed for large-scale site characterization and subsurface target detection using airborne ground-penetrating SAR

    NASA Astrophysics Data System (ADS)

    Fijany, Amir; Collier, James B.; Citak, Ari

    1999-08-01

    A team of US Army Corps of Engineers, Omaha District and Engineering and Support Center, Huntsville, JPL, Stanford Research Institute (SRI), and Montgomery Watson is currently in the process of planning and conducting the largest ever survey at the Former Buckley Field, in Colorado, by using SRI airborne, ground penetrating, SAR. The purpose of this survey is the detection of surface and subsurface Unexploded Ordnance (UXO) and in a broader sense the site characterization for identification of contaminated as well as clear areas. In preparation for such a large-scale survey, JPL has been developing advanced algorithms and a high-performance testbed for processing of massive amount of expected SAR data from this site. Two key requirements of this project are the accuracy and speed of SAR data processing. The first key feature of this testbed is a large degree of automation and maximum degree of the need for human perception in the processing to achieve an acceptable processing rate of several hundred acres per day. For accuracy UXO detection, novel algorithms have been developed and implemented. These algorithms analyze dual polarized SAR data. They are based on the correlation of HH and VV SAR data and involve a rather large set of parameters for accurate detection of UXO. For each specific site, this set of parameters can be optimized by using ground truth data. In this paper, we discuss these algorithms and their successful application for detection of surface and subsurface anti-tank mines by using a data set from Yuma Proving Ground, AZ, acquired by SRI SAR.

  17. Synthesis and Discovery of Water Soluble Microtubule Targeting Agents that Bind to the Colchicine Site on Tubulin and Circumvent Pgp Mediated Resistance

    PubMed Central

    Gangjee, Aleem; Zhao, Ying; Lin, Lu; Raghavan, Sudhir; Roberts, Elizabeth G.; Risinger, April L.; Hamel, Ernest; Mooberry, Susan L.

    2010-01-01

    Two classes of molecules were designed and synthesized based on a 6-CH3 cyclopenta[d]pyrimidine scaffold and a pyrrolo[2,3-d]pyrimidine scaffold. The pyrrolo[2,3-d]pyrimidines were synthesized by reacting ethyl 2-cyano-4,4-diethoxybutanate and acetamidine, which in turn was chlorinated and reacted with the appropriate anilines to afford 1 and 2. The cyclopenta[d]pyrimidineswere obtained from 3-methyladapic acid, followed by reaction with acetamidine to afford the cyclopenta[d]pyrimidine scaffold. Chlorination and reaction with appropriate anilines afforded (±)-3•HCl – (±)-7.HCl. Compounds 1 (add chemical compound designation) and (±)-3•HCl (add compound chemical designation) had potent antiproliferative activities in the nanomolar range. Compound (±)-3•HCl is significantly more potent than 1. Mechanistic studies showed that 1 and (±)-3•HCl cause loss of cellular microtubles, inhibit the polymerization of purified tubulin, and inhibit colchicine binding. Modeling studies show interactions of these compounds within the colchicine site. The identification of these new inhibitors that can also overcome clinically relevant mechanisms of drug resistence provides new scaffolds for colchicine site agents. PMID:20973488

  18. The alloantigenic sites of alpha3alpha4alpha5(IV) collagen: pathogenic X-linked alport alloantibodies target two accessible conformational epitopes in the alpha5NC1 domain.

    PubMed

    Kang, Jeong Suk; Kashtan, Clifford E; Turner, A Neil; Heidet, Laurence; Hudson, Billy G; Borza, Dorin-Bogdan

    2007-04-01

    Anti-glomerular basement membrane (GBM) antibody nephritis is caused by an autoimmune or alloimmune reaction to the NC1 domains of alpha3alpha4alpha5(IV) collagen. Some patients with X-linked Alport syndrome (XLAS) develop post-transplant nephritis mediated by pathogenic anti-GBM alloantibodies to collagen IV chains present in the renal allograft but absent from the tissues of the patient. In this work, the epitopes targeted by alloantibodies from these patients were identified and characterized. All XLAS alloantibodies recognized conformational epitopes in the NC1 domain of alpha5(IV) collagen, which were mapped using chimeric alpha1/alpha5 NC1 domains expressed in mammalian cells. Allograft-eluted alloantibodies mainly targeted two conformational alloepitopes mapping to alpha5NC1 residues 1-45 and 114-168. These regions also encompassed the major epitopes of circulating XLAS alloantibodies, which in some patients additionally targeted alpha5NC1 residues 169-229. Both kidney-eluted and circulating alloantibodies to alpha5NC1 distinctively targeted epitopes accessible in the alpha3alpha4alpha5NC1 hexamers of human GBM, unlike anti-GBM autoantibodies, which targeted sequestered alpha3NC1 epitopes. The results identify two immunodominant alpha5NC1 epitopes as major alloantigenic sites of alpha3alpha4alpha5(IV) collagen specifically implicated in the pathogenesis of post-transplant nephritis in XLAS patients. The contrast between the accessibility of these alloepitopes and the crypticity of autoepitopes indicates that distinct molecular forms of antigen may initiate the immunopathogenic processes in the two forms of anti-GBM disease. PMID:17293596

  19. Folic acid-targeted disulfide-based cross-linking micelle for enhanced drug encapsulation stability and site-specific drug delivery against tumors.

    PubMed

    Zhang, Yumin; Zhou, Junhui; Yang, Cuihong; Wang, Weiwei; Chu, Liping; Huang, Fan; Liu, Qiang; Deng, Liandong; Kong, Deling; Liu, Jianfeng; Liu, Jinjian

    2016-01-01

    Although the shortcomings of small molecular antitumor drugs were efficiently improved by being entrapped into nanosized vehicles, premature drug release and insufficient tumor targeting demand innovative approaches that boost the stability and tumor responsiveness of drug-loaded nanocarriers. Here, we show the use of the core cross-linking method to generate a micelle with enhanced drug encapsulation ability and sensitivity of drug release in tumor. This kind of micelle could increase curcumin (Cur) delivery to HeLa cells in vitro and improve tumor accumulation in vivo. We designed and synthesized the core cross-linked micelle (CCM) with polyethylene glycol and folic acid-polyethylene glycol as the hydrophilic units, pyridyldisulfide as the cross-linkable and hydrophobic unit, and disulfide bond as the cross-linker. CCM showed spherical shape with a diameter of 91.2 nm by the characterization of dynamic light scattering and transmission electron microscope. Attributed to the core cross-linking, drug-loaded CCM displayed higher Nile Red or Cur-encapsulated stability and better sensitivity to glutathione than noncross-linked micelle (NCM). Cellular uptake and in vitro antitumor studies proved the enhanced endocytosis and better cytotoxicity of CCM-Cur against HeLa cells, which had a high level of glutathione. Meanwhile, the folate receptor-mediated drug delivery (FA-CCM-Cur) further enhanced the endocytosis and cytotoxicity. Ex vivo imaging studies showed that CCM-Cur and FA-CCM-Cur possessed higher tumor accumulation until 24 hours after injection. Concretely, FA-CCM-Cur exhibited the highest tumor accumulation with 1.7-fold of noncross-linked micelle Cur and 2.8-fold of free Cur. By combining cross-linking of the core with active tumor targeting of FA, we demonstrated a new and effective way to design nanocarriers for enhanced drug encapsulation, smart tumor responsiveness, and elevated tumor accumulation. PMID:27051287

  20. Folic acid-targeted disulfide-based cross-linking micelle for enhanced drug encapsulation stability and site-specific drug delivery against tumors

    PubMed Central

    Zhang, Yumin; Zhou, Junhui; Yang, Cuihong; Wang, Weiwei; Chu, Liping; Huang, Fan; Liu, Qiang; Deng, Liandong; Kong, Deling; Liu, Jianfeng; Liu, Jinjian

    2016-01-01

    Although the shortcomings of small molecular antitumor drugs were efficiently improved by being entrapped into nanosized vehicles, premature drug release and insufficient tumor targeting demand innovative approaches that boost the stability and tumor responsiveness of drug-loaded nanocarriers. Here, we show the use of the core cross-linking method to generate a micelle with enhanced drug encapsulation ability and sensitivity of drug release in tumor. This kind of micelle could increase curcumin (Cur) delivery to HeLa cells in vitro and improve tumor accumulation in vivo. We designed and synthesized the core cross-linked micelle (CCM) with polyethylene glycol and folic acid-polyethylene glycol as the hydrophilic units, pyridyldisulfide as the cross-linkable and hydrophobic unit, and disulfide bond as the cross-linker. CCM showed spherical shape with a diameter of 91.2 nm by the characterization of dynamic light scattering and transmission electron microscope. Attributed to the core cross-linking, drug-loaded CCM displayed higher Nile Red or Cur-encapsulated stability and better sensitivity to glutathione than noncross-linked micelle (NCM). Cellular uptake and in vitro antitumor studies proved the enhanced endocytosis and better cytotoxicity of CCM-Cur against HeLa cells, which had a high level of glutathione. Meanwhile, the folate receptor-mediated drug delivery (FA-CCM-Cur) further enhanced the endocytosis and cytotoxicity. Ex vivo imaging studies showed that CCM-Cur and FA-CCM-Cur possessed higher tumor accumulation until 24 hours after injection. Concretely, FA-CCM-Cur exhibited the highest tumor accumulation with 1.7-fold of noncross-linked micelle Cur and 2.8-fold of free Cur. By combining cross-linking of the core with active tumor targeting of FA, we demonstrated a new and effective way to design nanocarriers for enhanced drug encapsulation, smart tumor responsiveness, and elevated tumor accumulation. PMID:27051287

  1. Identifying targets of selection in mosaic genomes with machine learning: applications in Anopheles gambiae for detecting sites within locally adapted chromosomal inversions.

    PubMed

    He, Qixin; Knowles, L Lacey

    2016-05-01

    Chromosomal inversions are important structural changes that may facilitate divergent selection when they capture co-adaptive loci in the face of gene flow. However, identifying selection targets within inversions can be challenging. The high degrees of differentiation between heterokaryotypes, as well as the differences in demographic histories of collinear regions compared with inverted ones, reduce the power of traditional outlier analyses for detecting selected loci. Here, we develop a new approach that uses discriminant functions informed from inversion-specific expectations to classify loci that are under selection (or drift). Analysis of RAD sequencing data we collected in a classic dipteran species with polymorphic inversion clines-Anopheles gambiae, a malaria vector species from sub-Saharan Africa-demonstrates the benefits of the approach compared with traditional outlier analyses. We focus specifically on two polymorphic inversions, the 2La and 2Rb arrangements that predominate in dry habitats and the 2L+(a) and 2R+(b) arrangements in wet habitats, which contrast with the minimal geographic structure of SNPs from collinear regions. With our approach, we identify two strongly selected regions within 2La associated with dry habitat. Moreover, we also show that the prevalence of selection is greater in the arrangement 2L+(a) that is associated with wet habitat (unlike presumed importance of selective divergence associated with the shift of the mosquitoes into dry habitats). We discuss the implications of these results with respect to studies of rapid adaptation in these malaria vectors, and in particular, the insights our newly developed approach offers for identifying not only potential targets of selection, but also the population that has undergone adaptive change. PMID:26994406

  2. Targeting of mTOR catalytic site inhibits multiple steps of the HIV-1 lifecycle and suppresses HIV-1 viremia in humanized mice.

    PubMed

    Heredia, Alonso; Le, Nhut; Gartenhaus, Ronald B; Sausville, Edward; Medina-Moreno, Sandra; Zapata, Juan C; Davis, Charles; Gallo, Robert C; Redfield, Robert R

    2015-07-28

    HIV necessitates host factors for successful completion of its life cycle. Mammalian target of rapamycin (mTOR) is a conserved serine/threonine kinase that forms two complexes, mTORC1 and mTORC2. Rapamycin is an allosteric inhibitor of mTOR that selectively inhibits mTORC1. Rapamycin interferes with viral entry of CCR5 (R5)-tropic HIV and with basal transcription of the HIV LTR, potently inhibiting replication of R5 HIV but not CXCR4 (X4)-tropic HIV in primary cells. The recently developed ATP-competitive mTOR kinase inhibitors (TOR-KIs) inhibit both mTORC1 and mTORC2. Using INK128 as a prototype TOR-KI, we demonstrate potent inhibition of both R5 and X4 HIV in primary lymphocytes (EC50 < 50 nM), in the absence of toxicity. INK128 inhibited R5 HIV entry by reducing CCR5 levels. INK128 also inhibited both basal and induced transcription of HIV genes, consistent with inhibition of mTORC2, whose activity is critical for phosphorylation of PKC isoforms and, in turn, induction of NF-κB. INK128 enhanced the antiviral potency of the CCR5 antagonist maraviroc, and had favorable antiviral interactions with HIV inhibitors of reverse transcriptase, integrase and protease. In humanized mice, INK128 decreased plasma HIV RNA by >2 log10 units and partially restored CD4/CD8 cell ratios. Targeting of cellular mTOR with INK128 (and perhaps others TOR-KIs) provides a potential strategy to inhibit HIV, especially in patients with drug resistant HIV strains. PMID:26170311

  3. A gain-of-function ACTC1 3′UTR mutation that introduces a miR-139-5p target site may be associated with a dominant familial atrial septal defect

    PubMed Central

    Wang, Ye; Du, Xinwei; Zhou, Zaiwei; Jiang, Jun; Zhang, Zhen; Ye, Lincai; Hong, Haifa

    2016-01-01

    The ostium secundum atrial septal defect (ASDII) is the most common type of congenital heart disease and is characterized by a left to right shunting of oxygenated blood caused by incomplete closure of the septum secundum. We identified a familial form of isolated ASDII that affects four individuals in a family of five and shows autosomal dominant inheritance. By whole genome sequencing, we discovered a new mutation (c.*1784T > C) in the 3′-untranslated region (3′UTR) of ACTC1, which encodes the predominant actin in the embryonic heart. Further analysis demonstrated that the c.*1784T > C mutation results in a new target site for miRNA-139-5p, a microRNA that is involved in cell migration, invasion, and proliferation. Functional analysis demonstrated that the c.*1784T > C mutation specifically downregulates gene expression in a luciferase assay. Additionally, miR-139-5p mimic causes further decrease, whereas miR-139-5p inhibitor can dramatically rescue the decline in gene expression caused by this mutation. These findings suggest that the familial ASDII may be a result of an ACTC1 3′UTR gain-of-function mutation caused by the introduction of a new miR-139-5p target site. Our results provide the first evidence of a pathogenic mutation in the ACTC1 3′UTR that may be associated with familial isolated ASDII. PMID:27139165

  4. A gain-of-function ACTC1 3'UTR mutation that introduces a miR-139-5p target site may be associated with a dominant familial atrial septal defect.

    PubMed

    Wang, Ye; Du, Xinwei; Zhou, Zaiwei; Jiang, Jun; Zhang, Zhen; Ye, Lincai; Hong, Haifa

    2016-01-01

    The ostium secundum atrial septal defect (ASDII) is the most common type of congenital heart disease and is characterized by a left to right shunting of oxygenated blood caused by incomplete closure of the septum secundum. We identified a familial form of isolated ASDII that affects four individuals in a family of five and shows autosomal dominant inheritance. By whole genome sequencing, we discovered a new mutation (c.*1784T > C) in the 3'-untranslated region (3'UTR) of ACTC1, which encodes the predominant actin in the embryonic heart. Further analysis demonstrated that the c.*1784T > C mutation results in a new target site for miRNA-139-5p, a microRNA that is involved in cell migration, invasion, and proliferation. Functional analysis demonstrated that the c.*1784T > C mutation specifically downregulates gene expression in a luciferase assay. Additionally, miR-139-5p mimic causes further decrease, whereas miR-139-5p inhibitor can dramatically rescue the decline in gene expression caused by this mutation. These findings suggest that the familial ASDII may be a result of an ACTC1 3'UTR gain-of-function mutation caused by the introduction of a new miR-139-5p target site. Our results provide the first evidence of a pathogenic mutation in the ACTC1 3'UTR that may be associated with familial isolated ASDII. PMID:27139165

  5. Recruitment of HIV-1 target cells at topical mucosal sites: a sensitive and early marker for determining the safety of microbicide candidates

    PubMed Central

    Li, Liangzhu; Ben, Yinyin; Yuan, Songhua; Liu, Aiping; Wu, Huanmei; Xu, Jianqing; Zhang, Xiaoyan

    2013-01-01

    To explore early biomarkers for establishing more sensitive safety evaluation assays in preclinical settings that determine the potential risks during the application of microbicide candidates, three representative microbicide candidates (cellulose sulphate, nonoxynol-9 and tenofovir), whose safety profiles have been well established in clinical trials, were included to gauge the sensitivities of different assays. Both mouse models and cell lines were employed to determine the sensitivities. The recruitment of immune cells at topical mucosal sites and the upregulation of HIV receptor/coreceptors in vitro were identified as highly sensitive biomarkers of the impact of microbicide candidates. Our data suggest that different evaluations/assays have their inherent sensitivities, and at least one assay from each sensitivity level should be included in the safety evaluation algorithm. PMID:26038476

  6. Recruitment of HIV-1 target cells at topical mucosal sites: a sensitive and early marker for determining the safety of microbicide candidates.

    PubMed

    Li, Liangzhu; Ben, Yinyin; Yuan, Songhua; Liu, Aiping; Wu, Huanmei; Xu, Jianqing; Zhang, Xiaoyan

    2013-07-01

    To explore early biomarkers for establishing more sensitive safety evaluation assays in preclinical settings that determine the potential risks during the application of microbicide candidates, three representative microbicide candidates (cellulose sulphate, nonoxynol-9 and tenofovir), whose safety profiles have been well established in clinical trials, were included to gauge the sensitivities of different assays. Both mouse models and cell lines were employed to determine the sensitivities. The recruitment of immune cells at topical mucosal sites and the upregulation of HIV receptor/coreceptors in vitro were identified as highly sensitive biomarkers of the impact of microbicide candidates. Our data suggest that different evaluations/assays have their inherent sensitivities, and at least one assay from each sensitivity level should be included in the safety evaluation algorithm. PMID:26038476

  7. Single-nucleotide polymorphism in microRNA-binding site of SULF1 target gene as a protective factor against the susceptibility to breast cancer: a case-control study

    PubMed Central

    Zhou, Qiong; Jiang, Yiwei; Yin, Wenjin; Wang, Yaohui; Lu, Jinsong

    2016-01-01

    Purpose Numerous clinical studies have suggested that chemopreventive drugs for breast cancer such as tamoxifen and exemestane can effectively reduce the incidence of estrogen receptor (ER)-positive breast cancer. However, it remains unclear how to identify those who are susceptible to ER-positive breast cancer. Accordingly, there is a great demand for a probe into the predisposing factors so as to provide precise chemoprevention. Recent evidence has indicated that ERα expression can be regulated by microRNAs (miRNAs), such as miR-206, in breast cancer. We assumed that single-nucleotide polymorphisms (SNPs) in the miR-206-binding sites of the target genes may be associated with breast cancer susceptibility with different ER statuses. Methods We genotyped the SNPs that reside in and around the miR-206-binding sites of two target genes – heparan sulfatase 1 (SULF1) and RPTOR-independent companion of mammalian target of rapamycin Complex 2 (RICTOR) – which were related to the progression or metastasis of breast cancer cells in 710 breast cancer patients and 294 controls by the matrix-assisted laser desorption ionization-time of flight mass spectrometry method. Modified odds ratios (ORs) with their 95% confidence intervals (CIs) were calculated by a multivariate logistic regression analysis to evaluate the potential association between the SNPs and breast cancer susceptibility. Results For rs3802278, which is located in the 3′-untranslated region (3′-UTR) of SULF1, the frequency of the AA genotype was less in breast cancer patients than that in the controls as compared to that of the GG + GA genotype not only for ER-positive breast cancer patients (adjusted OR =0.663, P=0.032) but also for hormone receptor-positive breast cancer patients (adjusted OR =0.610, P=0.018). Besides, the frequency of the AA genotype was less than that of the GG genotype between the ER-positive breast cancer patients and the controls (adjusted OR =0.791, P=0.038). For rs66916453

  8. Targeting HER2+ breast cancer cells: lysosomal accumulation of anti-HER2 antibodies is influenced by antibody binding site and conjugation to polymeric nanoparticles.

    PubMed

    Owen, Shawn C; Patel, Nish; Logie, Jennifer; Pan, Guohua; Persson, Helena; Moffat, Jason; Sidhu, Sachdev S; Shoichet, Molly S

    2013-12-10

    Humanized monoclonal antibodies (mAb) against HER2 are being engineered to treat cancer. We utilized phage-display technology to generate a novel anti-HER2 mAb (named 73JIgG) that binds an epitope of HER2 distinct from that of trastuzumab. Although these mAbs bind to the same cell surface receptor, they have different cell distribution profiles. After 3h of incubation, almost 10% of the total 73JIgG reaches the lysosome compared to less than 3% of trastuzumab. Interestingly, 73JIgG disassociates from HER2 whereas trastuzumab remains bound to the receptor. Importantly, HER2 distribution is not affected by the antibody binding epitope, thus negating this mechanism as the reason for the difference in intracellular trafficking of 73JIgG versus trastuzumab. Each of trastuzumab and 73JIgG was chemically-modified with either a small molecule or polymeric nanoparticle to better understand the influence of conjugation on cellular localization. Relative to antibody alone, antibody-nanoparticle conjugates resulted in a higher concentration of antibodies in the lysosome whereas antibody-small molecule conjugates did not affect cell trafficking to the lysosome. Given the importance of lysosomal targeting, these results demonstrate the importance of understanding the influence of the antibody-conjugate on cell trafficking for ultimate optimization of treatment selection. PMID:23880472

  9. A combination of computational and experimental approaches identifies DNA sequence constraints associated with target site binding specificity of the transcription factor CSL.

    PubMed

    Torella, Rubben; Li, Jinghua; Kinrade, Eddie; Cerda-Moya, Gustavo; Contreras, Ashley N; Foy, Robert; Stojnic, Robert; Glen, Robert C; Kovall, Rhett A; Adryan, Boris; Bray, Sarah J

    2014-01-01

    Regulation of transcription is fundamental to development and physiology, and occurs through binding of transcription factors to specific DNA sequences in the genome. CSL (CBF1/Suppressor of Hairless/LAG-1), a core component of the Notch signaling pathway, is one such transcription factor that acts in concert with co-activators or co-repressors to control the activity of associated target genes. One fundamental question is how CSL can recognize and select among different DNA sequences available in vivo and whether variations between selected sequences can influence its function. We have therefore investigated CSL-DNA recognition using computational approaches to analyze the energetics of CSL bound to different DNAs and tested the in silico predictions with in vitro and in vivo assays. Our results reveal novel aspects of CSL binding that may help explain the range of binding observed in vivo. In addition, using molecular dynamics simulations, we show that domain-domain correlations within CSL differ significantly depending on the DNA sequence bound, suggesting that different DNA sequences may directly influence CSL function. Taken together, our results, based on computational chemistry approaches, provide valuable insights into transcription factor-DNA binding, in this particular case increasing our understanding of CSL-DNA interactions and how these may impact on its transcriptional control. PMID:25114055

  10. A genetic variation in microRNA target site of ETS2 is associated with clinical outcomes of paclitaxel-cisplatin chemotherapy in non-small cell lung cancer

    PubMed Central

    Lee, Shin Yup; Choi, Jin Eun; Jin, Cheng Cheng; Kang, Hyo Jung; Baek, Sun Ah; Lee, So Yeon; Shin, Kyung Min; Jeong, Ji Yun; Lee, Won Kee; Yoo, Seung Soo; Lee, Jaehee; Cha, Seung Ick; Kim, Chang Ho; Son, Ji Woong

    2016-01-01

    The present study was performed to investigate the association of single nucleotide polymorphisms (SNPs) located in the miRNA target sites with the clinical outcomes of first line paclitaxel-cisplatin chemotherapy in advanced NSCLC. Eighty SNPs in miRNA binding sites of cancer related genes selected from 18,500 miRNA:target bindings in crosslinking, ligation, and sequencing of hybrids (CLASH) data were investigated in 379 advanced NSCLC patients using a sequenom mass spectrometry-based genotype assay. qRT-PCR and luciferase assay were conducted to examine functional relevance of potentially functional SNPs in miRNA binding sites. Of the 80 SNPs analyzed, 16 SNPs were significantly associated with the clinical outcomes after chemotherapy. Among these, ANAPC1 rs3814026C>T, ETS2 rs461155A>G, SORBS1 rs7081076C>A and POLR2A rs2071504C>T could predict both chemotherapy response and survival. Notably, ETS2 rs461155A>G was significantly associated with decreased ETS2 mRNA expression in both tumor and paired normal lung tissues (Ptrend = 4 × 10−7, and 3 × 10−4, respectively). Consistently, a decreased expression of the reporter gene for the G allele of rs461155 compared with the A allele was observed by luciferase assay. These findings suggest that the four SNPs, especially ETS2 rs461155A>G, could be used as biomarkers predicting the clinical outcomes of NSCLC patients treated with first-line paclitaxel-cisplatin chemotherapy. PMID:26893365

  11. A genetic variation in microRNA target site of ETS2 is associated with clinical outcomes of paclitaxel-cisplatin chemotherapy in non-small cell lung cancer.

    PubMed

    Hong, Mi Jeong; Lee, Shin Yup; Choi, Jin Eun; Jin, Cheng Cheng; Kang, Hyo Jung; Baek, Sun Ah; Lee, So Yeon; Shin, Kyung Min; Jeong, Ji Yun; Lee, Won Kee; Yoo, Seung Soo; Lee, Jaehee; Cha, Seung Ick; Kim, Chang Ho; Son, Ji Woong; Park, Jae Yong

    2016-03-29

    The present study was performed to investigate the association of single nucleotide polymorphisms (SNPs) located in the miRNA target sites with the clinical outcomes of first line paclitaxel-cisplatin chemotherapy in advanced NSCLC. Eighty SNPs in miRNA binding sites of cancer related genes selected from 18,500 miRNA:target bindings in crosslinking, ligation, and sequencing of hybrids (CLASH) data were investigated in 379 advanced NSCLC patients using a sequenom mass spectrometry-based genotype assay. qRT-PCR and luciferase assay were conducted to examine functional relevance of potentially functional SNPs in miRNA binding sites. Of the 80 SNPs analyzed, 16 SNPs were significantly associated with the clinical outcomes after chemotherapy. Among these, ANAPC1 rs3814026C>T, ETS2 rs461155A>G, SORBS1 rs7081076C>A and POLR2A rs2071504C>T could predict both chemotherapy response and survival. Notably, ETS2 rs461155A>G was significantly associated with decreased ETS2 mRNA expression in both tumor and paired normal lung tissues (Ptrend = 4 × 10-7, and 3 × 10-4, respectively). Consistently, a decreased expression of the reporter gene for the G allele of rs461155 compared with the A allele was observed by luciferase assay. These findings suggest that the four SNPs, especially ETS2 rs461155A>G, could be used as biomarkers predicting the clinical outcomes of NSCLC patients treated with first-line paclitaxel-cisplatin chemotherapy. PMID:26893365

  12. Demethylase Inhibitor Fungicide Resistance in Pyrenophora teres f. sp. teres Associated with Target Site Modification and Inducible Overexpression of Cyp51

    PubMed Central

    Mair, Wesley J.; Deng, Weiwei; Mullins, Jonathan G. L.; West, Samuel; Wang, Penghao; Besharat, Naghmeh; Ellwood, Simon R.; Oliver, Richard P.; Lopez-Ruiz, Francisco J.

    2016-01-01

    Pyrenophora teres f. sp. teres is the cause of net form of net blotch (NFNB), an economically important foliar disease in barley (Hordeum vulgare). Net and spot forms of net blotch are widely controlled using site-specific systemic fungicides. Although resistance to succinate dehydrogenase inhibitors and quinone outside inhibitors has been addressed before in net blotches, mechanisms controlling demethylation inhibitor resistance have not yet been reported at the molecular level. Here we report the isolation of strains of NFNB in Australia since 2013 resistant to a range of demethylase inhibitor fungicides. Cyp51A:KO103-A1, an allele with the mutation F489L, corresponding to the archetype F495I in Aspergillus fumigatus, was only present in resistant strains and was correlated with resistance factors to various demethylase inhibitors ranging from 1.1 for epoxiconazole to 31.7 for prochloraz. Structural in silico modeling of the sensitive and resistant CYP51A proteins docked with different demethylase inhibitor fungicides showed how the interaction of F489L within the heme cavity produced a localized constriction of the region adjacent to the docking site that is predicted to result in lower binding affinities. Resistant strains also displayed enhanced induced expression of the two Cyp51A paralogs and of Cyp51B genes. While Cyp51B was found to be constitutively expressed in the absence of fungicide, Cyp51A was only detected at extremely low levels. Under fungicide induction, expression of Cyp51B, Cyp51A2, and Cyp51A1 was shown to be 1.6-, 3,- and 5.3-fold higher, respectively in the resistant isolate compared to the wild type. These increased levels of expression were not supported by changes in the promoters of any of the three genes. The implications of these findings on demethylase inhibitor activity will require current net blotch management strategies to be reconsidered in order to avoid the development of further resistance and preserve the lifespan of

  13. Demethylase Inhibitor Fungicide Resistance in Pyrenophora teres f. sp. teres Associated with Target Site Modification and Inducible Overexpression of Cyp51.

    PubMed

    Mair, Wesley J; Deng, Weiwei; Mullins, Jonathan G L; West, Samuel; Wang, Penghao; Besharat, Naghmeh; Ellwood, Simon R; Oliver, Richard P; Lopez-Ruiz, Francisco J

    2016-01-01

    Pyrenophora teres f. sp. teres is the cause of net form of net blotch (NFNB), an economically important foliar disease in barley (Hordeum vulgare). Net and spot forms of net blotch are widely controlled using site-specific systemic fungicides. Although resistance to succinate dehydrogenase inhibitors and quinone outside inhibitors has been addressed before in net blotches, mechanisms controlling demethylation inhibitor resistance have not yet been reported at the molecular level. Here we report the isolation of strains of NFNB in Australia since 2013 resistant to a range of demethylase inhibitor fungicides. Cyp51A:KO103-A1, an allele with the mutation F489L, corresponding to the archetype F495I in Aspergillus fumigatus, was only present in resistant strains and was correlated with resistance factors to various demethylase inhibitors ranging from 1.1 for epoxiconazole to 31.7 for prochloraz. Structural in silico modeling of the sensitive and resistant CYP51A proteins docked with different demethylase inhibitor fungicides showed how the interaction of F489L within the heme cavity produced a localized constriction of the region adjacent to the docking site that is predicted to result in lower binding affinities. Resistant strains also displayed enhanced induced expression of the two Cyp51A paralogs and of Cyp51B genes. While Cyp51B was found to be constitutively expressed in the absence of fungicide, Cyp51A was only detected at extremely low levels. Under fungicide induction, expression of Cyp51B, Cyp51A2, and Cyp51A1 was shown to be 1.6-, 3,- and 5.3-fold higher, respectively in the resistant isolate compared to the wild type. These increased levels of expression were not supported by changes in the promoters of any of the three genes. The implications of these findings on demethylase inhibitor activity will require current net blotch management strategies to be reconsidered in order to avoid the development of further resistance and preserve the lifespan of

  14. Designing Allosteric Regulators of Thrombin. Exosite 2 Features Multiple Sub-Sites That Can Be Targeted By Sulfated Small Molecules for Inducing Inhibition

    PubMed Central

    Sidhu, Preetpal Singh; Abdel Aziz, May H.; Sarkar, Aurijit; Mehta, Akul Y.; Zhou, Qibing; Desai, Umesh R.

    2013-01-01

    We recently designed a group of novel exosite 2-directed, sulfated, small, allosteric inhibitors of thrombin. To develop more potent inhibitors, monosulfated benzofuran tri- and tetrameric homologs of the parent designed dimers were synthesized in 7–8 steps and found to exhibit a wide range of potencies. Among these, trimer 9a was found to be nearly 10-fold more potent than the first generation molecules. Michaelis-Menten studies indicated an allosteric mechanism of inhibition. Competitive studies using a hirudin peptide (exosite 1 ligand) and, unfractionated heparin, heparin octasaccharide and γ′-fibrinogen peptide (exosite 2 ligands), demonstrated exosite 2 recognition in a manner different from the parent dimers. Alanine scanning mutagenesis of 12 Arg/Lys residues of exosite 2 revealed a defect in 9a potency for Arg233Ala thrombin only confirming the major difference in site of recognition between the two structurally related sulfated benzofurans. The results suggest that multiple avenues are available within exosite 2 for inducing thrombin inhibition. PMID:23718540

  15. Design, Synthesis, in Vitro, and in Vivo Anticancer and Antiangiogenic Activity of Novel 3-Arylaminobenzofuran Derivatives Targeting the Colchicine Site on Tubulin

    PubMed Central

    Romagnoli, Romeo; Baraldi, Pier Giovanni; Salvador, Maria Kimatrai; Prencipe, Filippo; Lopez-Cara, Carlota; Ortega, Santiago Schiaffino; Brancale, Andrea; Hamel, Ernest; Castagliuolo, Ignazio; Mitola, Stefania; Ronca, Roberto; Bortolozzi, Roberta; Porcù, Elena; Basso, Giuseppe; Viola, Giampietro

    2015-01-01

    A new series of compounds characterized by the presence of a 2-methoxy/ethoxycarbonyl group, combined with either no substituent or a methoxy group at each of the four possible positions of the benzene portion of the 3-(3′,4′,5′-trimethoxyanilino)benzo[b]furan skeleton, were evaluated for antiproliferative activity against cancer cells in culture and, for selected, highly active compounds, inhibition of tubulin polymerization, cell cycle effects, and in vivo potency. The greatest antiproliferative activity occurred with a methoxy group introduced at the C-6 position, the least with this substituent at C-4. Thus far, the most promising compound in this series was 2-methoxycarbonyl-3-(3′,4′,5′-trimethoxyanilino)-6-methoxybenzo-[b]furan (3g), which inhibited cancer cell growth at nanomolar concentrations (IC50 values of 0.3–27 nM), bound to the colchicine site of tubulin, induced apoptosis, and showed, both in vitro and in vivo, potent vascular disrupting properties derived from the effect of this compound on vascular endothelial cells. Compound 3g had in vivo antitumor activity in a murine model comparable to the activity obtained with combretastatin A-4 phosphate. PMID:25785605

  16. Design, synthesis, in vitro, and in vivo anticancer and antiangiogenic activity of novel 3-arylaminobenzofuran derivatives targeting the colchicine site on tubulin.

    PubMed

    Romagnoli, Romeo; Baraldi, Pier Giovanni; Salvador, Maria Kimatrai; Prencipe, Filippo; Lopez-Cara, Carlota; Schiaffino Ortega, Santiago; Brancale, Andrea; Hamel, Ernest; Castagliuolo, Ignazio; Mitola, Stefania; Ronca, Roberto; Bortolozzi, Roberta; Porcù, Elena; Basso, Giuseppe; Viola, Giampietro

    2015-04-01

    A new series of compounds characterized by the presence of a 2-methoxy/ethoxycarbonyl group, combined with either no substituent or a methoxy group at each of the four possible positions of the benzene portion of the 3-(3',4',5'-trimethoxyanilino)benzo[b]furan skeleton, were evaluated for antiproliferative activity against cancer cells in culture and, for selected, highly active compounds, inhibition of tubulin polymerization, cell cycle effects, and in vivo potency. The greatest antiproliferative activity occurred with a methoxy group introduced at the C-6 position, the least with this substituent at C-4. Thus far, the most promising compound in this series was 2-methoxycarbonyl-3-(3',4',5'-trimethoxyanilino)-6-methoxybenzo[b]furan (3g), which inhibited cancer cell growth at nanomolar concentrations (IC50 values of 0.3-27 nM), bound to the colchicine site of tubulin, induced apoptosis, and showed, both in vitro and in vivo, potent vascular disrupting properties derived from the effect of this compound on vascular endothelial cells. Compound 3g had in vivo antitumor activity in a murine model comparable to the activity obtained with combretastatin A-4 phosphate. PMID:25785605

  17. Structure-Function Analysis of the Glioma Targeting NFL-TBS.40-63 Peptide Corresponding to the Tubulin-Binding Site on the Light Neurofilament Subunit

    PubMed Central

    Berges, Raphael; Balzeau, Julien; Takahashi, Masayuki; Prevost, Chantal; Eyer, Joel

    2012-01-01

    We previously reported that a 24 amino acid peptide (NFL-TBS.40-63) corresponding to the tubulin-binding site located on the light neurofilament subunit, selectively enters in glioblastoma cells where it disrupts their microtubule network and inhibits their proliferation. Here, we analyzed the structure-function relationships using an alanine-scanning strategy, in order to identify residues essential for these biological activities. We showed that the majority of modified peptides present a decreased or total loss to penetrate in these cells, or to alter microtubules. Correspondingly, circular dichroism measurements showed that this peptide forms either β-sheet or α-helix structures according to the solvent and that alanine substitution modified or destabilized the structure, in relation with changes in the biological activities. Moreover, substitution of serine residues by phosphoserine or aspartic acid concomitantly decreased the cell penetrating activity and the structure stability. These results indicate the importance of structure for the activities, including selectivity to glioblastoma cells of this peptide, and its regulation by phosphorylation. PMID:23152907

  18. On-site sensor recalibration of a spinning multi-beam LiDAR system using automatically-detected planar targets.

    PubMed

    Chen, Chia-Yen; Chien, Hsiang-Jen

    2012-01-01

    This paper presents a fully-automated method to establish a calibration dataset from on-site scans and recalibrate the intrinsic parameters of a spinning multi-beam 3-D scanner. The proposed method has been tested on a Velodyne HDL-64E S2 LiDAR system, which contains 64 rotating laser rangefinders. By time series analysis, we found that the collected range data have random measurement errors of around ±25 mm. In addition, the layered misalignment of scans among the rangefinders, which is identified as a systematic error, also increases the difficulty to accurately locate planar surfaces. We propose a temporal-spatial range data fusion algorithm, along with a robust RANSAC-based plane detection algorithm to address these issues. Furthermore, we formulate an alternative geometric interpretation of sensory data using linear parameters, which is advantageous for the calibration procedure. The linear representation allows the proposed method to be generalized to any LiDAR system that follows the rotating beam model. We also confirmed in this paper, that given effective calibration datasets, the pre-calibrated factory parameters can be further tuned to achieve significantly improved performance. After the optimization, the systematic error is noticeable lowered, and evaluation shows that the recalibrated parameters outperform the factory parameters with the RMS planar errors reduced by up to 49%. PMID:23202019

  19. Specificity of Bacillus thuringiensis endotoxins is correlated with the presence of high-affinity binding sites in the brush border membrane of target insect midguts

    SciTech Connect

    Hofmann, C.; Vanderbruggen, H.; Hoefte, H.; Van Rie, J.; Jansens, S.; Van Mellaert, H. )

    1988-11-01

    Binding studies were performed with two {sup 125}I-labeled Bacillus thuringiensis {delta}-endotoxins on brush border membrane vesicles prepared from the larval midgut of the tobacco hornworm Manduca sexta or the cabbage butterfly Pieris brassicae. One {delta}-endotoxin, Bt2-protoxin, is a 130-kDa recombinant crystalline protein from B. thuringiensis subsp. berliner. It kills larvae of both insect species. The active Bt2-toxin is a 60-kDa proteolytic fragment of the Bt2-protoxin. It binds saturably and with high affinity to brush border membrane vesicles from the midgut of both species. The other {delta}-endotoxin, Bt4412-protoxin, is a 136-kDa crystalline protein from B. thuringiensis subsp. thuringiensis, which is highly toxic for P. brassicae, but not for M. sexta larvae. Bt4412-toxin, obtained after proteolytic activation of Bt4412-protoxin, shows high-affinity saturable binding to P. brassicae vesicles but not to M. sexta vesicles. The correlation between toxicity and specific binding is further strengthened by competition studies. Other B. thuringiensis {delta}-endotoxins active against M. sexta compete for binding of {sup 125}I-labeled Bt2-toxin to M. sexta vesicles, whereas toxins active against dipteran or coleopteran larvae do not compete. Bt2-toxin and Bt4412-toxin bind to different sites on P. brassicae vesicles.

  20. On-Site Sensor Recalibration of a Spinning Multi-Beam LiDAR System Using Automatically-Detected Planar Targets

    PubMed Central

    Chen, Chia-Yen; Chien, Hsiang-Jen

    2012-01-01

    This paper presents a fully-automated method to establish a calibration dataset from on-site scans and recalibrate the intrinsic parameters of a spinning multi-beam 3-D scanner. The proposed method has been tested on a Velodyne HDL-64E S2 LiDAR system, which contains 64 rotating laser rangefinders. By time series analysis, we found that the collected range data have random measurement errors of around ±25 mm. In addition, the layered misalignment of scans among the rangefinders, which is identified as a systematic error, also increases the difficulty to accurately locate planar surfaces. We propose a temporal-spatial range data fusion algorithm, along with a robust RANSAC-based plane detection algorithm to address these issues. Furthermore, we formulate an alternative geometric interpretation of sensory data using linear parameters, which is advantageous for the calibration procedure. The linear representation allows the proposed method to be generalized to any LiDAR system that follows the rotating beam model. We also confirmed in this paper, that given effective calibration datasets, the pre-calibrated factory parameters can be further tuned to achieve significantly improved performance. After the optimization, the systematic error is noticeable lowered, and evaluation shows that the recalibrated parameters outperform the factory parameters with the RMS planar errors reduced by up to 49%. PMID:23202019

  1. Brother of the regulator of the imprinted site (BORIS) variant subfamily 6 is involved in cervical cancer stemness and can be a target of immunotherapy

    PubMed Central

    Asano, Takuya; Hirohashi, Yoshihiko; Torigoe, Toshihiko; Mariya, Tasuku; Horibe, Ryota; Kuroda, Takafumi; Tabuchi, Yuta; Saijo, Hiroshi; Yasuda, Kazuyo; Mizuuchi, Masahito; Takahashi, Akari; Asanuma, Hiroko; Hasegawa, Tadashi; Saito, Tsuyoshi; Sato, Noriyuki

    2016-01-01

    Cervical cancer is a major cause of cancer death in females worldwide. Cervical cancer stem-like cells (CSCs)/cancer-initiating cells (CICs) are resistant to conventional radiotherapy and chemotherapy, and CSCs/CICs are thought to be responsible for recurrence. Eradication of CSCs/CICs is thus essential to cure cervical cancer. In this study, we isolated cervical CSCs/CICs by sphere culture, and we identified a cancer testis (CT) antigen, CTCFL/BORIS, that is expressed in cervical CSCs/CICs. BORIS has 23 mRNA isoform variants classified by 6 subfamilies (sfs), and they encode 17 different BORIS peptides. BORIS sf1 and sf4 are expressed in both CSCs/CICs and non-CSCs/CICs, whereas BORIS sf6 is expressed only in CSCs/CICs. Overexpression of BORIS sf6 in cervical cancer cells increased sphere formation and tumor-initiating ability compared with those in control cells, whereas overexpression of BORIS sf1 and BORIS sf4 resulted in only slight increases. Thus, BORIS sf6 is a cervical CSC/CIC-specific subfamily and has a role in the maintenance of cervical CSCs/CICs. BORIS sf6 contains a specific c-terminal domain (C34), and we identified a human leukocyte antigen (HLA)-A2-restricted antigenic peptide, BORIS C34_24(9) encoded by BORIS sf6. A BORIS C34_24(9)-specific cytotoxic T cell (CTL) clone showed cytotoxicity for BORIS sf6-overexpressing cervical cancer cells. Furthermore, the CTL clone significantly suppressed sphere formation of CaSki cells. Taken together, the results indicate that the CT antigen BORIS sf6 is specifically expressed in cervical CSCs/CICs, that BORIS sf6 has a role in the maintenance of CSCs/CICs, and that BORIS C34_24(9) peptide is a promising candidate for cervical CSC/CIC-targeting immunotherapy. PMID:26849232

  2. Brother of the regulator of the imprinted site (BORIS) variant subfamily 6 is involved in cervical cancer stemness and can be a target of immunotherapy.

    PubMed

    Asano, Takuya; Hirohashi, Yoshihiko; Torigoe, Toshihiko; Mariya, Tasuku; Horibe, Ryota; Kuroda, Takafumi; Tabuchi, Yuta; Saijo, Hiroshi; Yasuda, Kazuyo; Mizuuchi, Masahito; Takahashi, Akari; Asanuma, Hiroko; Hasegawa, Tadashi; Saito, Tsuyoshi; Sato, Noriyuki

    2016-03-01

    Cervical cancer is a major cause of cancer death in females worldwide. Cervical cancer stem-like cells (CSCs)/cancer-initiating cells (CICs) are resistant to conventional radiotherapy and chemotherapy, and CSCs/CICs are thought to be responsible for recurrence. Eradication of CSCs/CICs is thus essential to cure cervical cancer. In this study, we isolated cervical CSCs/CICs by sphere culture, and we identified a cancer testis (CT) antigen, CTCFL/BORIS, that is expressed in cervical CSCs/CICs. BORIS has 23 mRNA isoform variants classified by 6 subfamilies (sfs), and they encode 17 different BORIS peptides. BORIS sf1 and sf4 are expressed in both CSCs/CICs and non-CSCs/CICs, whereas BORIS sf6 is expressed only in CSCs/CICs. Overexpression of BORIS sf6 in cervical cancer cells increased sphere formation and tumor-initiating ability compared with those in control cells, whereas overexpression of BORIS sf1 and BORIS sf4 resulted in only slight increases. Thus, BORIS sf6 is a cervical CSC/CIC-specific subfamily and has a role in the maintenance of cervical CSCs/CICs. BORIS sf6 contains a specific c-terminal domain (C34), and we identified a human leukocyte antigen (HLA)-A2-restricted antigenic peptide, BORIS C34_24(9) encoded by BORIS sf6. A BORIS C34_24(9)-specific cytotoxic T cell (CTL) clone showed cytotoxicity for BORIS sf6-overexpressing cervical cancer cells. Furthermore, the CTL clone significantly suppressed sphere formation of CaSki cells. Taken together, the results indicate that the CT antigen BORIS sf6 is specifically expressed in cervical CSCs/CICs, that BORIS sf6 has a role in the maintenance of CSCs/CICs, and that BORIS C34_24(9) peptide is a promising candidate for cervical CSC/CIC-targeting immunotherapy. PMID:26849232

  3. Mitoxantrone targets the ATP-binding site of FAK, binds the FAK kinase domain and decreases FAK, Pyk-2, c-Src, and IGF-1R in vitro kinase activities.

    PubMed

    Golubovskaya, Vita M; Ho, Baotran; Zheng, Min; Magis, Andrew; Ostrov, David; Cance, William G

    2013-05-01

    Focal Adhesion Kinase (FAK) is a non-receptor kinase that is overexpressed in many types of tumors and plays a key role in cell adhesion, spreading, motility, proliferation, invasion, angiogenesis, and survival. Recently, FAK has been proposed as a target for cancer therapy, and we performed computer modeling and screening of the National Cancer Institute (NCI) small molecule compounds database to target the ATP-binding site of FAK, K454. More than 140,000 small molecule compounds were docked into the crystal structure of the kinase domain of FAK in 100 different orientations using DOCK5.1 that identified small molecule compounds, targeting the K454 site, called A-compounds. To find the therapeutic efficacy of these compounds, we examined the effect of twenty small molecule compounds on cell viability by MTT assays in different cancer cell lines. One compound, A18 (1,4-bis(diethylamino)-5,8- dihydroxy anthraquinon) was a mitoxantrone derivative and significantly decreased viability in most of the cells comparable to the to the level of FAK kinase inhibitors TAE-226 (Novartis, Inc) and PF-573,228 (Pfizer). The A18 compound specifically blocked autophosphorylation of FAK like TAE-226 and PF-228. ForteBio Octet Binding assay demonstrated that mitoxantrone (1,4-dihydroxy- 5,8-bis[2-(2-hydroxyethylamino) ethylamino] anthracene-9,10-dione directly binds the FAK-kinase domain. In addition, mitoxantrone significantly decreased the viability of breast cancer cells in a dose-dependent manner and inhibited the kinase activity of FAK and Y56/577 FAK phosphorylation at 10-20 μM. Mitoxantrone did not affect phosphorylation of EGFR, but decreased Pyk-2, c-Src, and IGF-1R kinase activities. The data demonstrate that mitoxantrone decreases cancer viability, binds FAK-Kinase domain, inhibits its kinase activity, and also inhibits in vitro kinase activities of Pyk-2 and IGF-1R. Thus, this novel function of the mitoxantrone drug can be critical for future development of anti

  4. Mutation of Glycosylation Sites in BST-2 Leads to Its Accumulation at Intracellular CD63-Positive Vesicles without Affecting Its Antiviral Activity against Multivesicular Body-Targeted HIV-1 and Hepatitis B Virus

    PubMed Central

    Han, Zhu; Lv, Mingyu; Shi, Ying; Yu, Jinghua; Niu, Junqi; Yu, Xiao-Fang; Zhang, Wenyan

    2016-01-01

    BST-2/tetherin blocks the release of various enveloped viruses including HIV-1 with a “physical tethering” model. The detailed contribution of N-linked glycosylation to this model is controversial. Here, we confirmed that mutation of glycosylation sites exerted an effect of post-translational mis-trafficking, leading to an accumulation of BST-2 at intracellular CD63-positive vesicles. BST-2 with this phenotype potently inhibited the release of multivesicular body-targeted HIV-1 and hepatitis B virus, without affecting the co-localization of BST-2 with EEA1 and LAMP1. These results suggest that N-linked glycosylation of human BST-2 is dispensable for intracellular virion retention and imply that this recently discovered intracellular tethering function may be evolutionarily distinguished from the canonical antiviral function of BST-2 by tethering nascent virions at the cell surface. PMID:26938549

  5. Dual Site-Controlled and Lysosome-Targeted Intramolecular Charge Transfer-Photoinduced Electron Transfer-Fluorescence Resonance Energy Transfer Fluorescent Probe for Monitoring pH Changes in Living Cells.

    PubMed

    Dong, Baoli; Song, Xuezhen; Wang, Chao; Kong, Xiuqi; Tang, Yonghe; Lin, Weiying

    2016-04-01

    Acidic pH is a critical physiological factor for controlling the activities and functions of lysosome. Herein, we report a novel dual site-controlled and lysosome-targeted intramolecular charge transfer-photoinduced electron transfer-Fluorescence resonance energy transfer (ICT-PET-FRET) fluorescent probe (CN-pH), which was essentially the combination of a turn-on pH probe (CN-1) and a turn-off pH probe (CN-2) by a nonconjugated linker. Coumarin and naphthalimide fluorophores were selected as donor and acceptor to construct the FRET platform. Hydroxyl group and morpholine were simultaneously employed as the two pH sensing sites and controlled the fluorescence of coumarin and naphthalimide units by ICT and PET, respectively. The sensing mechanism of CN-pH to pH was essentially an integration of ICT, PET, and FRET processes. Meanwhile, the morpholine also can serve as a lysosome-targeted group. By combining the two data analysis approaches of the ratios of the two emission intensities (R) and the reverse ratio R' (R' = 1/R), the fluorescent ratio of CN-pH can show proportional relationship to pH values in a very broad range from pH 4.0 to 8.0 with high sensitivity. The probe has been successfully applied for the fluorescence imaging of the lysosomal pH values, as well as ratiometrically visualizing chloroquine-stimulated changes of intracellular pH in living cells. These features demonstrate that the probe can afford practical application in biological systems. PMID:26987045

  6. Characterization of the Ends and Target Sites of the Novel Conjugative Transposon Tn5397 from Clostridium difficile: Excision and Circularization Is Mediated by the Large Resolvase, TndX

    PubMed Central

    Wang, Hongmei; Roberts, Adam P.; Lyras, Dena; Rood, Julian I.; Wilks, Mark; Mullany, Peter

    2000-01-01

    Tn5397 is a conjugative transposon that was originally isolated from Clostridium difficile. Previous analysis had shown that the central region of Tn5397 was closely related to the conjugative transposon Tn916. However, in this work we obtained the DNA sequence of the ends of Tn5397 and showed that they are completely different to those of Tn916. Tn5397 did not contain the int and xis genes, which are required for the excision and integration of Tn916. Instead, the right end of Tn5397 contained a gene, tndX, that appears to encode a member of the large resolvase family of site-specific recombinases. TndX is closely related to the TnpX resolvase from the mobilizable but nonconjugative chloramphenicol resistance transposons, Tn4451 from Clostridium perfringens and Tn4453 from C. difficile. Like the latter elements, inserted copies of Tn5397 were flanked by a direct repeat of a GA dinucleotide. The Tn5397 target sites were also shown to contain a central GA dinucleotide. Excision of the element in C. difficile completely regenerated the original target sequence. A circular form of the transposon, in which the left and right ends of the element were separated by a GA dinucleotide, was detected by PCR in both Bacillus subtilis and C. difficile. A Tn5397 mutant in which part of tndX was deleted was constructed in B. subtilis. This mutant was nonconjugative and did not produce the circular form of Tn5397, indicating that the TndX resolvase has an essential role in the excision and transposition of Tn5397 and is thus the first example of a member of the large resolvase family of recombinases being involved in conjugative transposon mobility. Finally, we showed that introduction of Tn916 into a strain containing Tn5397 induced the loss of the latter element in 95.6% of recipients. PMID:10850994

  7. SETI target selection.

    NASA Astrophysics Data System (ADS)

    Latham, D. W.; Soderblom, D. R.

    1995-06-01

    The NASA High Resolution Microwave Survey consists of two complementary elements: a Sky Survey of the entire sky to a moderate level of sensitivity; and a Targeted Search of nearby stars, one at a time, to a much deeper level of sensitivity. The authors propose strategies for target selection with two goals: to improve the chances of successful detection of signals from technical civilizations that inhabit planets around solar-type stars, and to minimize the chances of missing signals from unexpected sites.

  8. Sputter target

    DOEpatents

    Gates, Willard G.; Hale, Gerald J.

    1980-01-01

    The disclosure relates to an improved sputter target for use in the deposition of hard coatings. An exemplary target is given wherein titanium diboride is brazed to a tantalum backing plate using a gold-palladium-nickel braze alloy.

  9. Commercial Web Site Links.

    ERIC Educational Resources Information Center

    Thelwall, Mike

    2001-01-01

    Discusses business use of the Web and related search engine design issues as well as research on general and academic links before reporting on a survey of the links published by a collection of business Web sites. Results indicate around 66% of Web sites do carry external links, most of which are targeted at a specific purpose, but about 17%…

  10. Biotin-labelled peptidyl diazomethane inhibitors derived from the substrate-like sequence of cystatin: targeting of the active site of cruzipain, the major cysteine proteinase of Trypanosoma cruzi.

    PubMed Central

    Lalmanach, G; Mayer, R; Serveau, C; Scharfstein, J; Gauthier, F

    1996-01-01

    Biotin-labelled peptidyl diazomethane inhibitors of cysteine proteinases, based on the N-terminal substrate-like segment of human cystatin C, a natural inhibitor of cysteine proteinases, were synthesized. These synthetic derivatives were tested as irreversible inhibitors of cruzipain, the major cysteine proteinase of Trypanosoma cruzi, to compare the kinetics of the inhibition of the parasite proteinase with that of the mammalian cathepsins B and L. The accessibility of the active sites of these proteinases to these probes was also investigated. The inhibition of cruzipain by Biot-LVG-CHN2 (where Biot represents biotinyl and L,V and G are single-letter amino acid residue abbreviations) and Biot-Ahx-LVG-CHN2 (where Ahx represents 6-aminohexanoic acid) was similar to that of unlabelled inhibitor. Biotin labelling of the inhibitor slowed the inhibition of both cathepsin B and cathepsin L. Adding a spacer arm (Ahx) between the biotin and the peptide moiety of the derivative increased the inhibition of cathepsin B but not that of cathepsin L. The discrimination provided by this spacer is probably due to differences in the topologies of the binding sites of proteinases, a feature that can be exploited to improve targeting of individual cysteine proteinases. Analysis of the blotted proteinases revealed marked differences in the accessibility of extravidin-peroxidase conjugate to the proteinase-bound biotinylated inhibitor. Cruzipain molecules exposed to Biot-LVG-CHN2 or Biot-Ahx-LVG-CHN2 were readily identified, but the reaction was much stronger when the enzyme was treated with the spacer-containing inhibitor. In contrast with the parasite enzyme, rat cathepsin B and cathepsin L treated with either Biot-LVG-CHN2 or Biot-Ahx-LVG-CHN2 produced no detectable bands. Papain, the archetype of this family of proteinases, was poorly labelled with Biot-LVG-CHN2, but strong staining was obtained with Biot-Ahx-LVG-CHN2. These findings suggest that optimized biotinylated

  11. Target capture and target ghosts

    NASA Astrophysics Data System (ADS)

    Auerbach, Steven P.

    1996-05-01

    Optimal detection methods for small targets rely on whitened matched filters, which convolve the measured data with the signal model, and whiten the result with the noise covariance. In real-world implementations of such filters, the noise covariance must be estimated from the data, and the resulting covariance estimate may be corrupted by presence of the target. The resulting loss in SNR is called 'target capture'. Target capture is often thought to be a problem only for bright targets. This presentation shows that target capture also arises for dim targets, leading to an SNR loss which is independent of target strength and depends on the averaging method used to estimate the noise covariance. This loss is due to a 'coherent beat' between the true noise and that portion of the estimated noise covariance due to the target. This beat leads to 'ghost targets', which diminish the target SNR by producing a negative target ghost at the target's position. A quantitative estimate of this effect will be given, and shown to agree with numerical results. The effect of averaging on SNR is also discussed for data scenes with synthetic injected targets, in cases where the noise covariance is estimated using 'no target' data. For these cases, it is shown that the so-called 'optimal' filter, which uses the true noise covariance, is actually worse than a 'sub-optimal' filter which estimates the noise from scene. This apparent contradiction is resolved by showing that the optimal filter is best if the same filter is used for many scenes, but is outperformed by a filter adapted to a specific scene.

  12. Rapid improvement in passive tuberculosis case detection and tuberculosis treatment outcomes after implementation of a bundled laboratory diagnostic and on-site training intervention targeting mid-level providers.

    PubMed

    Manabe, Yukari C; Zawedde-Muyanja, Stella; Burnett, Sarah M; Mugabe, Frank; Naikoba, Sarah; Coutinho, Alex

    2015-01-01

    Background.  Tuberculosis (TB) control is a public health priority with 3 million cases unrecognized by the public health system each year. We assessed the impact of improved TB diagnostics and on-site training on TB case detection and treatment outcomes in rural healthcare facilities. Methods.  Fluorescence microscopy, Xpert MTB/RIF, and on-site training were introduced at 10 healthcare facilities. Using quasi-experimental methods, these 10 intervention healthcare facilities were compared with 2 controls and their own performance the previous year. Results.  From January to October 2012, 186 357 and 32 886 outpatients were seen in the 10 intervention and 2 control facilities, respectively. The intervention facilities had a 52.04% higher proportion of presumptive TB cases with a sputum examination (odds ratio [OR] = 12.65; 95% confidence interval [CI], 5.60-28.55). After adjusting for age group and gender, the proportion of smear-positive patients initiated on treatment was 37.76% higher in the intervention than in the control facilities (adjusted OR [AOR], 7.59; 95% CI, 2.19-26.33). After adjusting for the factors above, as well as human immunodeficiency virus and TB retreatment status, the proportion of TB cases who completed treatment was 29.16% higher (AOR, 4.89; 95% CI, 2.24-10.67) and the proportion of TB cases who were lost to follow-up was 66.98% lower (AOR, 0.04; 95% CI, 0.01-0.09). When compared with baseline performance, the intervention facilities had a significantly higher proportion of presumptive TB cases with a sputum examination (64.70% vs 3.44%; OR, 23.95; 95% CI, 12.96-44.25), and these facilities started 56.25% more smear-positive TB cases on treatment during the project period (AOR, 15.36; 95% CI, 6.57-35.91). Conclusions.  Optimizing the existing healthcare workforce through a bundled diagnostics and on-site training intervention for nonphysician healthcare workers will rapidly improve TB case detection and outcomes towards global

  13. Rapid Improvement in Passive Tuberculosis Case Detection and Tuberculosis Treatment Outcomes After Implementation of a Bundled Laboratory Diagnostic and On-Site Training Intervention Targeting Mid-Level Providers

    PubMed Central

    Manabe, Yukari C.; Zawedde-Muyanja, Stella; Burnett, Sarah M.; Mugabe, Frank; Naikoba, Sarah; Coutinho, Alex

    2015-01-01

    Background. Tuberculosis (TB) control is a public health priority with 3 million cases unrecognized by the public health system each year. We assessed the impact of improved TB diagnostics and on-site training on TB case detection and treatment outcomes in rural healthcare facilities. Methods. Fluorescence microscopy, Xpert MTB/RIF, and on-site training were introduced at 10 healthcare facilities. Using quasi-experimental methods, these 10 intervention healthcare facilities were compared with 2 controls and their own performance the previous year. Results. From January to October 2012, 186 357 and 32 886 outpatients were seen in the 10 intervention and 2 control facilities, respectively. The intervention facilities had a 52.04% higher proportion of presumptive TB cases with a sputum examination (odds ratio [OR] = 12.65; 95% confidence interval [CI], 5.60–28.55). After adjusting for age group and gender, the proportion of smear-positive patients initiated on treatment was 37.76% higher in the intervention than in the control facilities (adjusted OR [AOR], 7.59; 95% CI, 2.19–26.33). After adjusting for the factors above, as well as human immunodeficiency virus and TB retreatment status, the proportion of TB cases who completed treatment was 29.16% higher (AOR, 4.89; 95% CI, 2.24–10.67) and the proportion of TB cases who were lost to follow-up was 66.98% lower (AOR, 0.04; 95% CI, 0.01–0.09). When compared with baseline performance, the intervention facilities had a significantly higher proportion of presumptive TB cases with a sputum examination (64.70% vs 3.44%; OR, 23.95; 95% CI, 12.96–44.25), and these facilities started 56.25% more smear-positive TB cases on treatment during the project period (AOR, 15.36; 95% CI, 6.57–35.91). Conclusions. Optimizing the existing healthcare workforce through a bundled diagnostics and on-site training intervention for nonphysician healthcare workers will rapidly improve TB case detection and outcomes towards

  14. Silencing of hepatitis C virus replication by a non-viral vector based on solid lipid nanoparticles containing a shRNA targeted to the internal ribosome entry site (IRES).

    PubMed

    Torrecilla, Josune; Del Pozo-Rodríguez, Ana; Solinís, María Ángeles; Apaolaza, Paola S; Berzal-Herranz, Beatriz; Romero-López, Cristina; Berzal-Herranz, Alfredo; Rodríguez-Gascón, Alicia

    2016-10-01

    Gene silencing mediated by RNAi has gained increasing interest as an alternative for the treatment of infectious diseases such as refractory hepatitis C virus (HCV) infection. In this work we have designed and evaluated a non-viral vector based on solid lipid nanoparticles (SLN) bearing hyaluronic acid, protamine and a short hairpin RNA (shRNA74) targeted to the Internal Ribosome Entry Site (IRES) of the HCV. The vector was able to inhibit the expression of the HCV IRES in Huh-7 cells, with the inhibition level dependent on the shRNA74 to SLN ratio and on the shRNA74 dose added to the culture cells. The nanocarrier was also able to inhibit the replication in human hepatoma cells supporting a subgenomic HCV replicon (Huh-7 NS3-3'). The vector was quickly and efficiently internalized by the cells, and endocytosis was the most productive uptake mechanism for silencing. Clathrin-mediated endocytosis and to a lesser extent caveolae/lipid raft-mediated endocytosis were identified as endocytic mechanisms involved in the cell uptake. Internalization via the CD44 receptor was also involved, although this entry route seems to be less productive for silencing than endocytosis. The vector did not induce either hemolysis or agglutination of red cells in vitro, which was indicative of good biocompatibility. In summary, we have shown for the first time the ability of a non-viral SLN-based vector to silence a HCV replicon. PMID:27451369

  15. Capture of flanking DNA by a P element in Drosophila melanogaster: Creation of a transposable element

    SciTech Connect

    Tsubota, Stuart, I.; Huong Dangvu )

    1991-02-01

    A 6.1-kilobase nsertion into the rudimentary (r) gene was cloned and partially sequenced. The insertion consists of a 703-base-pair (bp) P element next to a 5.4-kilobase single-copy sequence. The normal positon of the single-copy sequence is near the tip of the X chromosome. Upon insertion into the r gene, this chimeric element generated an 8-bp target-site duplication, characteristic of P elements. At the non-P-element end of the insertion, the first 8 bp are identical to the first 8 bp of the inverted terminal repeats of the P element. Thus, this element has inverted terminal repeats of 8 bp. This large element can excise from the r gene under conditions of hybrid dysgenesis, which indicates that it behaves like a normal P element. These data support the conclusion that a normally stable single-copy sequence has now become unstable and duplicated within the genome.

  16. LIQUID TARGET

    DOEpatents

    Martin, M.D.; Salsig, W.W. Jr.

    1959-01-13

    A liquid handling apparatus is presented for a liquid material which is to be irradiated. The apparatus consists essentially of a reservoir for the liquid, a target element, a drain tank and a drain lock chamber. The target is in the form of a looped tube, the upper end of which is adapted to be disposed in a beam of atomic particles. The lower end of the target tube is in communication with the liquid in the reservoir and a means is provided to continuously circulate the liquid material to be irradiated through the target tube. Means to heat the reservoir tank is provided in the event that a metal is to be used as the target material. The apparatus is provided with suitable valves and shielding to provide maximum safety in operation.

  17. U-Pb isotopic results for single shocked and polycrystalline zircons record 550-65.5-Ma ages for a K-T target site and 2700-1850-Ma ages for the Sudbury impact event

    NASA Technical Reports Server (NTRS)

    Krogh, T. E.; Kamo, S. L.; Bohor, B. F.

    1992-01-01

    The refractory mineral zircon develops distinct morphological features during shock metamorphism and retains these features under conditions that would anneal them in other minerals. In addition, weakly shocked zircon grains give primary ages for the impact site, while highly reconstituted (polycrystalline) single grains give ages that approach the age of the impact event. Data for a series of originally coeval grains will define a mixing line that gives both of these ages providing that no subsequent geological disturbances have overprinted the isotopic systematics. In this study, we have shown that the three zircon grain types described by Bohor, from both K-T distal ejecta (Fireball layer, Raton Basin, Colorado) and the Onaping Formation, represent a progressive increase in impact-related morphological change that coincides with a progressive increase in isotopic resetting in zircons from the ejecta and basement rocks. Unshocked grains are least affected by isotopic resetting while polycrystalline grains are most affected. U-Pb isotopic results for 12 of 14 single zircon grains from the Fireball layer plot on or close to a line recording a primary age of 550 +/- 10 Ma and a secondary age of 65.5 +/- 3 Ma. Data for the least and most shocked grains plot closest to the primary and secondary ages respectively. The two other grains each give ages between 300 and 350 Ma. This implies that the target ejecta was dominated by 550-Ma rocks and that the recrystallization features of the zircon were superimposed during the impact event at 65.5 Ma. A predominant age of 550 Ma for zircons from the Fireball layer provides an excellent opportunity to identify the impact site and to test the hypothesis that multiple impacts occurred at this time. A volcanic origin for the Fireball layer is ruled out by shock-related morphological changes in zircon and the fact that the least shocked grains are old. Basement Levack gneisses north of the Sudbury structure have a primary age of

  18. An archaebacterial RNA polymerase binding site and transcription initiation of the hisA gene in Methanococcus vannielii.

    PubMed Central

    Brown, J W; Thomm, M; Beckler, G S; Frey, G; Stetter, K O; Reeve, J N

    1988-01-01

    Transcription initiation of the hisA gene in vivo in the archaebacterium Methanococcus vannielii, as determined by nuclease S1 and primer extension analyses, occurs 73 base pairs (bp) upstream of the translation initiation site. Binding of M. vannielii RNA polymerase protects 43 bp of DNA, from 35 bp upstream (-35) to 8 bp downstream (+8) of the hisA mRNA initiation site, from digestion by DNase I and exonuclease III. An A + T rich region, with a sequence which conforms to the consensus sequence for promoters of stable RNA-encoding genes in methanogens, is found at the same location (-25) upstream of the polypeptide-encoding hisA gene. It appears therefore that a TATA-like sequence is also an element of promoters which direct transcription of polypeptide-encoding genes in this archaebacterium. Images PMID:2829115

  19. Effect of Azone upon the in vivo antiviral efficacy of cidofovir or acyclovir topical formulations in treatment/prevention of cutaneous HSV-1 infections and its correlation with skin target site free drug concentration in hairless mice.

    PubMed

    Afouna, Mohsen I; Fincher, Timothy K; Zaghloul, Abdel-Azim A; Reddy, Indra K

    2003-03-01

    The purpose of this study is to examine the influence of Azone upon the skin target site free drug concentration (C(*)) and its correlation with the in vivo antiviral efficacies of cidofovir (HPMPC) and acyclovir (ACV) against HSV-1 infections. Formulations of HPMPC and ACV with or without Azone were used. The in vitro skin flux experiments were performed and the C(*) values were calculated. For the in vivo efficacy studies, hairless mice cutaneously infected with HSV-1 were used and three different treatment protocols were carried out. The protocols were chosen based upon when therapy is initiated and terminated in such a way to assess the efficacy of the test drug to cure and/or prevent HSV-1 infections. A finite dose of the formulation was topically applied twice a day for the predetermined time course for each protocol and the lesions were scored on the fifth day. For ACV formulation with Azone, the C(*) values and hence the in vivo efficacy were much higher than those for that without Azone. In protocol #1, however, early treatment did not increase the in vivo efficacy of ACV when compared with the standard treatment protocol #3. In protocol #2 where the treatment was terminated on the day of virus inoculation, the efficacies for both ACV formulations were completely absent. Although the estimated C(*) values for HPMPC formulations with and without Azone were comparable, formulation with Azone was much more effective than that without Azone in all treatment protocols. HPMPC formulations with Azone at similar flux values were much more effective in "treating and preventing" HSV-1 infections than those without Azone. For ACV formulations, in contrast, addition of Azone has failed to show any effect on the preventive in vivo antiviral efficacy and the enhancement of ACV in vivo antiviral efficacy was merely the skin permeation enhancement effect of Azone. PMID:12593946

  20. Intensity Modulated Radiotherapy Improves Target Coverage and Parotid Gland Sparing When Delivering Total Mucosal Irradiation in Patients With Squamous Cell Carcinoma of Head and Neck of Unknown Primary Site

    SciTech Connect

    Bhide, Shreerang Clark, Catherine; Harrington, Kevin; Nutting, Christopher M.

    2007-10-01

    Head and neck squamous cell carcinoma with occult primary site represents a controversial clinical problem. Conventional total mucosal irradiation (TMI) maximizes local control, but at the expense of xerostomia. IMRT has been shown to spare salivary tissue in head and cancer patients. This study has been performed to investigate the potential of IMRT to perform nodal and TMI and also allow parotid gland sparing in this patient group. Conventional radiotherapy (CRT) and IMRT plans were produced for six patients to treat the ipsilateral (involved) post-operative neck (PTV1) and the un-operated contralateral neck and mucosal axis (PTV2). Plans were produced with and without the inclusion of nasopharynx in the PTV2. The potential to improve target coverage and spare the parotid glands was investigated for the IMRT plans. There was no significant difference in the mean doses to the PTV1 using CRT and IMRT (59.7 and 60.0 respectively, p = 0.5). The maximum doses to PTV1 and PTV2 were lower for the IMRT technique as compared to CRT (P = 0.008 and P < 0.0001), respectively, and the minimum doses to PTV1 and PTV2 were significantly higher for IMRT as compared to CRT (P = 0.001 and P = 0.001), respectively, illustrating better dose homogeneity with IMRT. The mean dose to the parotid gland contralateral to PTV1 was significantly lower for IMRT (23.21 {+-} 0.7) as compared to CRT (50.5 {+-} 5.8) (P < 0.0001). There was a significant difference in parotid dose between plans with and without the inclusion of the nasopharynx. IMRT offers improved dose homogeneity in PTV1 and PTV2 and allows for parotid sparing.

  1. Integrin cytoplasmic domain-associated protein 1alpha (ICAP-1alpha ) interacts directly with the metastasis suppressor nm23-H2, and both proteins are targeted to newly formed cell adhesion sites upon integrin engagement.

    PubMed

    Fournier, Henri-Noël; Dupé-Manet, Sandra; Bouvard, Daniel; Lacombe, Marie-Lise; Marie, Christiane; Block, Marc R; Albiges-Rizo, Corinne

    2002-06-01

    Cell adhesion-dependent signaling implicates cytoplasmic proteins interacting with the intracellular tails of integrins. Among those, the integrin cytoplasmic domain-associated protein 1alpha (ICAP-1alpha) has been shown to interact specifically with the beta(1) integrin cytoplasmic domain. Although it is likely that this protein plays an important role in controlling cell adhesion and migration, little is known about its actual function. To search for potential ICAP-1alpha-binding proteins, we used a yeast two-hybrid screen and identified the human metastatic suppressor protein nm23-H2 as a new partner of ICAP-1alpha. This direct interaction was confirmed in vitro, using purified recombinant ICAP-1alpha and nm23-H2, and by co-immunoprecipitation from CHO cell lysates over-expressing ICAP-1alpha. The physiological relevance of this interaction is provided by confocal fluorescence microscopy, which shows that ICAP-1alpha and nm23-H2 are co-localized in lamellipodia during the early stages of cell spreading. These adhesion sites are enriched in occupied beta(1) integrins and precede the formation of focal adhesions devoid of ICAP-1alpha and nm23-H2, indicating the dynamic segregation of components of matrix adhesions. This peripheral staining of ICAP-1alpha and nm23-H2 is only observed in cells spreading on fibronectin and collagen and is absent in cells spreading on poly-l-lysine, vitronectin, or laminin. This is consistent with the fact that targeting of both ICAP-1alpha and nm23-H2 to the cell periphery is dependent on beta(1) integrin engagement rather than being a consequence of cell adhesion. This finding represents the first evidence that the tumor suppressor nm23-H2 could act on beta(1) integrin-mediated cell adhesion by interacting with one of the integrin partners, ICAP-1alpha. PMID:11919189

  2. Targeting the tumor microenvironment

    PubMed Central

    Bournazou, Eirini; Bromberg, Jacqueline

    2013-01-01

    Persistent JAK-STAT3 signaling is implicated in many aspects of tumorigenesis. Apart from its tumor-intrinsic effects, STAT3 also exerts tumor-extrinsic effects, supporting tumor survival and metastasis. These involve the regulation of paracrine cytokine signaling, alterations in metastatic sites rendering these permissive for the growth of cancer cells and subversion of host immune responses to create an immunosuppressive environment. Targeting this signaling pathway is considered a novel promising therapeutic approach, especially in the context of tumor immunity. In this article, we will review to what extent JAK-STAT3-targeted therapies affect the tumor microenvironment and whether the observed effects underlie responsiveness to therapy. PMID:24058812

  3. Targeted Nanotechnology for Cancer Imaging

    PubMed Central

    Toy, Randall; Bauer, Lisa; Hoimes, Christopher; Ghaghada, Ketan B.; Karathanasis, Efstathios

    2014-01-01

    Targeted nanoparticle imaging agents provide many benefits and new opportunities to facilitate accurate diagnosis of cancer and significantly impact patient outcome. Due to the highly engineerable nature of nanotechnology, targeted nanoparticles exhibit significant advantages including increased contrast sensitivity, binding avidity and targeting specificity. Considering the various nanoparticle designs and their adjustable ability to target a specific site and generate detectable signals, nanoparticles can be optimally designed in terms of biophysical interactions (i.e., intravascular and interstitial transport) and biochemical interactions (i.e., targeting avidity towards cancer-related biomarkers) for site-specific detection of very distinct microenvironments. This review seeks to illustrate that the design of a nanoparticle dictates its in vivo journey and targeting of hard-to-reach cancer sites, facilitating early and accurate diagnosis and interrogation of the most aggressive forms of cancer. We will report various targeted nanoparticles for cancer imaging using X-ray computed tomography, ultrasound, magnetic resonance imaging, nuclear imaging and optical imaging. Finally, to realize the full potential of targeted nanotechnology for cancer imaging, we will describe the challenges and opportunities for the clinical translation and widespread adaptation of targeted nanoparticles imaging agents. PMID:25116445

  4. A cis-regulatory site downregulates PTHLH in translocation t(8;12)(q13;p11.2) and leads to Brachydactyly Type E

    PubMed Central

    Maass, Philipp G.; Wirth, Jutta; Aydin, Atakan; Rump, Andreas; Stricker, Sigmar; Tinschert, Sigrid; Otero, Miguel; Tsuchimochi, Kaneyuki; Goldring, Mary B.; Luft, Friedrich C.; Bähring, Sylvia

    2010-01-01

    Parathyroid hormone-like hormone (PTHLH) is an important chondrogenic regulator; however, the gene has not been directly linked to human disease. We studied a family with autosomal-dominant Brachydactyly Type E (BDE) and identified a t(8;12)(q13;p11.2) translocation with breakpoints (BPs) upstream of PTHLH on chromosome 12p11.2 and a disrupted KCNB2 on 8q13. We sequenced the BPs and identified a highly conserved Activator protein 1 (AP-1) motif on 12p11.2, together with a C-ets-1 motif translocated from 8q13. AP-1 and C-ets-1 bound in vitro and in vivo at the derivative chromosome 8 breakpoint [der(8) BP], but were differently enriched between the wild-type and BP allele. We differentiated fibroblasts from BDE patients into chondrogenic cells and found that PTHLH and its targets, ADAMTS-7 and ADAMTS-12 were downregulated along with impaired chondrogenic differentiation. We next used human and murine chondrocytes and observed that the AP-1 motif stimulated, whereas der(8) BP or C-ets-1 decreased, PTHLH promoter activity. These results are the first to identify a cis-directed PTHLH downregulation as primary cause of human chondrodysplasia. PMID:20015959

  5. Association of the Serotonin Receptor 3E Gene as a Functional Variant in the MicroRNA-510 Target Site with Diarrhea Predominant Irritable Bowel Syndrome in Chinese Women

    PubMed Central

    Zhang, Yu; Li, Yaoyao; Hao, Zhenfeng; Li, Xiangming; Bo, Ping; Gong, Weijuan

    2016-01-01

    Background/Aims The functional variant (rs56109847) in the 3′-untranslated regions (3′-UTR) of the serotonin receptor 3E (HTR3E) gene is associated with female diarrhea predominant irritable bowel syndrome (IBS-D) in British populations. However, the relationship of the polymorphism both to HTR3E expression in the intestine and to the occurrence of Chinese functional gastrointestinal disorders has yet to be examined. Methods Polymerase chain reaction amplification and restriction fragment length polymorphism analyses were employed to detect polymorphisms among Chinese Han women, particularly 107 patients with IBS-D, 99 patients with functional dyspepsia (FD), 115 patients with mixed IBS and 69 patients with IBS-D + FD. We also assessed microRNA-510 (miR-510) and HTR3E expression in human colonic mucosal tissues with immunohistochemistry and other methods. Dual-luciferase reporter assays were conducted to examine the binding ability of miR-510 and HTR3E 3′-UTR. Results Genotyping data showed the variant rs56109847 was significantly associated with IBS-D, but not with FD, mixed-IBS, or FD + IBS-D. HTR3E was abundantly expressed around the colonic mucosal glands but less expressed in the stroma. miR-510 expression decreased, whereas HTR3E expression increased in the colonic mucosal tissue of patients with IBS-D compared with those in controls. HTR3E expression was significantly higher in patients with the GA genotype than that in patients with the GG genotype. The single-nucleotide polymorphisms disrupted the binding site of miR-510 and significantly upregulated luciferase expression in HEK293 and HT-29 cells. Conclusions The single-nucleotide polymorphisms rs56109847 led to reduced microRNA binding and overexpression of the target gene in intestinal cells, thereby increasing IBS-D risk in the Chinese Han population. The decreased expression of miR-510 might contribute to IBS-D. PMID:26787495

  6. Tackling Targets.

    ERIC Educational Resources Information Center

    Further Education Unit, London (England).

    This document is designed to help British training and enterprise councils (TECs) and further education (FE) colleges develop and implement strategies for achieving the National Targets for Education and Training (NTET), which were developed by the Confederation of British Industry in 1992 and endorsed by the British government. The findings from…

  7. Rotating Target Development for SNS Second Target Station

    SciTech Connect

    McManamy, Thomas J; Rennich, Mark J; Crawford, Roy K; Geoghegan, Patrick J; Janney, Jim G

    2010-01-01

    A rotating target for the second target station (STS) at SNS has been identified as an option along with a mercury target. Evaluation of the rotating target alternative for STS has started at 1.5 MW which is considered an upper bound for the power. Previous preconceptual design work for a 3 MW rotating target is being modified for the lower power level. Transient thermal analysis for a total loss of active water cooling has been done for a simplified 2D model of the target and shielding monolith which shows that peak temperatures are well below the level at which tungsten vaporization by steam could exceed site boundary dose limits. Design analysis and integration configuration studies have been done for the target-moderator-reflector assembly which maximizes the number of neutron beam lines and provides for replacement of the target and moderators. Target building hot cell arrangement for this option will be described. An option for operation in rough vacuum without a proton beam window using Ferro fluid seals on a vertical shaft is being developed. A full scale prototypic drive module based on the 3 MW preconceptual design has been fabricated and successfully tested with a shaft and mock up target supplied by the ESS-Bilbao team. Overall planning leading to decision between mercury and the rotating target in 2011 will be discussed

  8. Target assembly

    DOEpatents

    Lewis, Richard A.

    1980-01-01

    A target for a proton beam which is capable of generating neutrons for absorption in a breeding blanket includes a plurality of solid pins formed of a neutron emissive target material disposed parallel to the path of the beam and which are arranged axially in a plurality of layers so that pins in each layer are offset with respect to pins in all other layers, enough layers being used so that each proton in the beam will strike at least one pin with means being provided to cool the pins. For a 300 mA, 1 GeV beam (300 MW), stainless steel pins, 12 inches long and 0.23 inches in diameter are arranged in triangular array in six layers with one sixth of the pins in each layer, the number of pins being such that the entire cross sectional area of the beam is covered by the pins with minimum overlap of pins.

  9. SITE RANK

    EPA Science Inventory

    Site rank is formulated for ranking the relative hazard of contamination sources and vulnerability of drinking water wells. Site rank can be used with a variety of groundwater flow and transport models.

  10. Bombing Target Identification from Limited Transect Data

    SciTech Connect

    Roberts, Barry L.; Hathaway, John E.; Pulsipher, Brent A.; McKenna, Sean A.

    2006-08-07

    A series of sensor data combined with geostatistical techniques were used to determine likely target areas for a historic military aerial bombing range. Primary data consisted of magnetic anomaly information from limited magnetometer transects across the site. Secondary data included airborne LIDAR, orthophotography, and other general site characterization information. Identification of likely target areas relied primarily upon kriging estimates of magnetic anomaly densities across the site. Secondary information, such as impact crater locations, was used to refine the boundary delineations.

  11. A small molecule focal adhesion kinase (FAK) inhibitor, targeting Y397 site: 1-(2-hydroxyethyl)-3, 5, 7-triaza-1-azoniatricyclo [3.3.1.1(3,7)]decane; bromide effectively inhibits FAK autophosphorylation activity and decreases cancer cell viability, clonogenicity and tumor growth in vivo.

    PubMed

    Golubovskaya, Vita M; Figel, Sheila; Ho, Baotran T; Johnson, Christopher P; Yemma, Michael; Huang, Grace; Zheng, Min; Nyberg, Carl; Magis, Andrew; Ostrov, David A; Gelman, Irwin H; Cance, William G

    2012-05-01

    Focal adhesion kinase (FAK) is a protein tyrosine kinase that is overexpressed in most solid types of tumors and plays an important role in the survival signaling. Recently, we have developed a novel computer modeling combined with a functional assay approach to target the main autophosphorylation site of FAK (Y397). Using these approaches, we identified 1-(2-hydroxyethyl)-3, 5, 7-triaza-1-azoniatricyclo [3.3.1.1(3,7)]decane; bromide, called Y11, a small molecule inhibitor targeting Y397 site of FAK. Y11 significantly and specifically decreased FAK autophosphorylation, directly bound to the N-terminal domain of FAK. In addition, Y11 decreased Y397-FAK autophosphorylation, inhibited viability and clonogenicity of colon SW620 and breast BT474 cancer cells and increased detachment and apoptosis in vitro. Moreover, Y11 significantly decreased tumor growth in the colon cancer cell mouse xenograft model. Finally, tumors from the Y11-treated mice demonstrated decreased Y397-FAK autophosphorylation and activation of poly (ADP ribose) polymerase and caspase-3. Thus, targeting the major autophosphorylation site of FAK with Y11 inhibitor is critical for development of cancer therapeutics and carcinogenesis field. PMID:22402131

  12. Accelerator target

    SciTech Connect

    Schlyer, D.J.; Ferrieri, R.A.; Koehler, C.

    1999-06-29

    A target includes a body having a depression in a front side for holding a sample for irradiation by a particle beam to produce a radioisotope. Cooling fins are disposed on a backside of the body opposite the depression. A foil is joined to the body front side to cover the depression and sample therein. A perforate grid is joined to the body atop the foil for supporting the foil and for transmitting the particle beam therethrough. A coolant is circulated over the fins to cool the body during the particle beam irradiation of the sample in the depression. 5 figs.

  13. Accelerator target

    DOEpatents

    Schlyer, David J.; Ferrieri, Richard A.; Koehler, Conrad

    1999-01-01

    A target includes a body having a depression in a front side for holding a sample for irradiation by a particle beam to produce a radioisotope. Cooling fins are disposed on a backside of the body opposite the depression. A foil is joined to the body front side to cover the depression and sample therein. A perforate grid is joined to the body atop the foil for supporting the foil and for transmitting the particle beam therethrough. A coolant is circulated over the fins to cool the body during the particle beam irradiation of the sample in the depression.

  14. Design of ligand-targeted nanoparticles for enhanced cancer targeting

    NASA Astrophysics Data System (ADS)

    Stefanick, Jared F.

    Ligand-targeted nanoparticles are increasingly used as drug delivery vehicles for cancer therapy, yet have not consistently produced successful clinical outcomes. Although these inconsistencies may arise from differences in disease models and target receptors, nanoparticle design parameters can significantly influence therapeutic efficacy. By employing a multifaceted synthetic strategy to prepare peptide-targeted nanoparticles with high purity, reproducibility, and precisely controlled stoichiometry of functionalities, this work evaluates the roles of polyethylene glycol (PEG) coating, ethylene glycol (EG) peptide-linker length, peptide hydrophilicity, peptide density, and nanoparticle size on tumor targeting in a systematic manner. These parameters were analyzed in multiple disease models by targeting human epidermal growth factor receptor 2 (HER2) in breast cancer and very late antigen-4 (VLA-4) in multiple myeloma to demonstrate the widespread applicability of this approach. By increasing the hydrophilicity of the targeting peptide sequence and simultaneously optimizing the EG peptide-linker length, the in vitro cellular uptake of targeted liposomes was significantly enhanced. Specifically, including a short oligolysine chain adjacent to the targeting peptide sequence effectively increased cellular uptake ~80-fold using an EG6 peptide-linker compared to ~10-fold using an EG45 linker. In vivo, targeted liposomes prepared in a traditional manner lacking the oligolysine chain demonstrated similar biodistribution and tumor uptake to non-targeted liposomes. However, by including the oligolysine chain, targeted liposomes using an EG45 linker significantly improved tumor uptake ~8-fold over non-targeted liposomes, while the use of an EG6 linker decreased tumor accumulation and uptake, owing to differences in cellular uptake kinetics, clearance mechanisms, and binding site barrier effects. To further improve tumor targeting and enhance the selectivity of targeted

  15. AraR, an l-Arabinose-Responsive Transcriptional Regulator in Corynebacterium glutamicum ATCC 31831, Exerts Different Degrees of Repression Depending on the Location of Its Binding Sites within the Three Target Promoter Regions

    PubMed Central

    Kuge, Takayuki; Teramoto, Haruhiko

    2015-01-01

    ABSTRACT In Corynebacterium glutamicum ATCC 31831, a LacI-type transcriptional regulator AraR, represses the expression of l-arabinose catabolism (araBDA), uptake (araE), and the regulator (araR) genes clustered on the chromosome. AraR binds to three sites: one (BSB) between the divergent operons (araBDA and galM-araR) and two (BSE1 and BSE2) upstream of araE. l-Arabinose acts as an inducer of the AraR-mediated regulation. Here, we examined the roles of these AraR-binding sites in the expression of the AraR regulon. BSB mutation resulted in derepression of both araBDA and galM-araR operons. The effects of BSE1 and/or BSE2 mutation on araE expression revealed that the two sites independently function as the cis elements, but BSE1 plays the primary role. However, AraR was shown to bind to these sites with almost the same affinity in vitro. Taken together, the expression of araBDA and araE is strongly repressed by binding of AraR to a single site immediately downstream of the respective transcriptional start sites, whereas the binding site overlapping the −10 or −35 region of the galM-araR and araE promoters is less effective in repression. Furthermore, downregulation of araBDA and araE dependent on l-arabinose catabolism observed in the BSB mutant and the AraR-independent araR promoter identified within galM-araR add complexity to regulation of the AraR regulon derepressed by l-arabinose. IMPORTANCE Corynebacterium glutamicum has a long history as an industrial workhorse for large-scale production of amino acids. An important aspect of industrial microorganisms is the utilization of the broad range of sugars for cell growth and production process. Most C. glutamicum strains are unable to use a pentose sugar l-arabinose as a carbon source. However, genes for l-arabinose utilization and its regulation have been recently identified in C. glutamicum ATCC 31831. This study elucidates the roles of the multiple binding sites of the transcriptional repressor AraR in the

  16. Targeted Nanodelivery of Drugs and Diagnostics

    PubMed Central

    Phillips, Margaret A.; Gran, Martin L.; Peppas, Nicholas A.

    2010-01-01

    Nanomaterials for targeted delivery are uniquely capable of localizing delivery of therapeutics and diagnostics to diseased tissues. The ability to achieve high, local concentrations of drugs or image contrast agents at a target site provides the opportunity for improved system performance and patient outcomes along with reduced systemic dosing. In this review, the design of targeted nanodelivery systems is discussed with an emphasis on in vivo performance, the physicochemical properties that affect localization at the target site, and the incorporation of therapeutic drugs into these systems. PMID:20543895

  17. Site characterization techniques

    USGS Publications Warehouse

    U.S. Geological Survey

    1995-01-01

    Geoelectrical methods have been used since the 1920's to search for metallic ore deposits. During the last decade, traditional mining geophysical techniques have been adapted for environmental site characterization. Geoelectrical geophysics is now a well developed engineering specialty, with different methods to focus both on a range of targets and on depths below the surface. Most methods have also been adapted to borehole measurements.

  18. Value siting

    SciTech Connect

    Ferrar, T.A.; Howes, J.A.

    1995-02-01

    Finding an appropriate site is becoming an increasing challenge in building new power projects. One of the first orders of business in project development is identifying a site that offers the maximum spread between the cost of fuel and net power price. The collection of sites that exhibit an adequate spread - presenting a first-order, acceptable economic expectation - must now be subjected to an ever increasing number of political, societal, technical, and economic exclusion screens. The barriers can include cooling water constraints, community resistance, visual incompatibility, archaeological concerns and endangered species preservation issues. Most power siting difficulties can be substantially mitigated by gaining access to developed, but under-used sites, whose current owners are bound by circumstances - political or financial - that prevent them from using such locations. There are two such categories of sites: Utilities that have sites on which depreciated power production assets rest; and, The federal government, with numerous sites throughout the country, particularly military bases subject to closure under the Base Realignment and Closure (BRAC) proceedings. It is in the interests of developers, as well as consumers, investors and taxpayers, ti undertake a thorough examination of these overlooked pearls of opportunities and develop their potential.

  19. Targeted epidural patch with n-butyl cyanoacrylate (n-BCA) through a single catheter access site for treatment of a cerebral spinal fluid leak causing spontaneous intracranial hypotension.

    PubMed

    Woolen, Sean; Gemmete, Joseph J; Pandey, Aditya S; Chaudhary, Neeraj

    2015-01-01

    Spontaneous intracranial hypotension (SIH) usually occurs in the setting of a spontaneous cerebral spinal fluid (CSF) leak. We report the first description of a case of SIH caused by a CSF leak which improved after a targeted epidural patch with n-butyl cyanoacrylate (n-BCA) at the right T1-T2 level. An 81-year-old woman presented with an orthostatic headache for 6 days. MRI of the brain with contrast demonstrated low lying cerebellar tonsils, an engorged transverse sinus flow void, bifrontal small subdural fluid collections, and diffuse dural enhancement. CT myelography showed extravasation of intrathecal contrast at the right T1-T2 level. A targeted epidural patch was performed by injection of n-BCA through a catheter at the right T1-T2 level. After treatment, the patient's symptoms immediately improved and she was without a headache at 1-year follow-up. PMID:26038380

  20. Targeted epidural patch with n-butyl cyanoacrylate (n-BCA) through a single catheter access site for treatment of a cerebral spinal fluid leak causing spontaneous intracranial hypotension.

    PubMed

    Woolen, Sean; Gemmete, Joseph J; Pandey, Aditya S; Chaudhary, Neeraj

    2016-07-01

    Spontaneous intracranial hypotension (SIH) usually occurs in the setting of a spontaneous cerebral spinal fluid (CSF) leak. We report the first description of a case of SIH caused by a CSF leak which improved after a targeted epidural patch with n-butyl cyanoacrylate (n-BCA) at the right T1-T2 level. An 81-year-old woman presented with an orthostatic headache for 6 days. MRI of the brain with contrast demonstrated low lying cerebellar tonsils, an engorged transverse sinus flow void, bifrontal small subdural fluid collections, and diffuse dural enhancement. CT myelography showed extravasation of intrathecal contrast at the right T1-T2 level. A targeted epidural patch was performed by injection of n-BCA through a catheter at the right T1-T2 level. After treatment, the patient's symptoms immediately improved and she was without a headache at 1-year follow-up. PMID:26047904

  1. Dual targeting of peroxisomal proteins

    PubMed Central

    Ast, Julia; Stiebler, Alina C.; Freitag, Johannes; Bölker, Michael

    2013-01-01

    Cellular compartmentalization into organelles serves to separate biological processes within the environment of a single cell. While some metabolic reactions are specific to a single organelle, others occur in more than one cellular compartment. Specific targeting of proteins to compartments inside of eukaryotic cells is mediated by defined sequence motifs. To achieve multiple targeting to different compartments cells use a variety of strategies. Here, we focus on mechanisms leading to dual targeting of peroxisomal proteins. In many instances, isoforms of peroxisomal proteins with distinct intracellular localization are encoded by separate genes. But also single genes can give rise to differentially localized proteins. Different isoforms can be generated by use of alternative transcriptional start sites, by differential splicing or ribosomal read-through of stop codons. In all these cases different peptide variants are produced, of which only one carries a peroxisomal targeting signal. Alternatively, peroxisomal proteins contain additional signals that compete for intracellular targeting. Dual localization of proteins residing in both the cytoplasm and in peroxisomes may also result from use of inefficient targeting signals. The recent observation that some bona fide cytoplasmic enzymes were also found in peroxisomes indicates that dual targeting of proteins to both the cytoplasm and the peroxisome might be more widespread. Although current knowledge of proteins exhibiting only partial peroxisomal targeting is far from being complete, we speculate that the metabolic capacity of peroxisomes might be larger than previously assumed. PMID:24151469

  2. Adenovirus type 5 E4 Orf3 protein targets promyelocytic leukaemia (PML) protein nuclear domains for disruption via a sequence in PML isoform II that is predicted as a protein interaction site by bioinformatic analysis.

    PubMed

    Leppard, Keith N; Emmott, Edward; Cortese, Marc S; Rich, Tina

    2009-01-01

    Human adenovirus type 5 infection causes the disruption of structures in the cell nucleus termed promyelocytic leukaemia (PML) protein nuclear domains or ND10, which contain the PML protein as a critical component. This disruption is achieved through the action of the viral E4 Orf3 protein, which forms track-like nuclear structures that associate with the PML protein. This association is mediated by a direct interaction of Orf3 with a specific PML isoform, PMLII. We show here that the Orf3 interaction properties of PMLII are conferred by a 40 aa residue segment of the unique C-terminal domain of the protein. This segment was sufficient to confer interaction on a heterologous protein. The analysis was informed by prior application of a bioinformatic tool for the prediction of potential protein interaction sites within unstructured protein sequences (predictors of naturally disordered region analysis; PONDR). This tool predicted three potential molecular recognition elements (MoRE) within the C-terminal domain of PMLII, one of which was found to form the core of the Orf3 interaction site, thus demonstrating the utility of this approach. The sequence of the mapped Orf3-binding site on PML protein was found to be relatively poorly conserved across other species; however, the overall organization of MoREs within unstructured sequence was retained, suggesting the potential for conservation of functional interactions. PMID:19088278

  3. SETI target selection.

    PubMed

    Latham, D W; Soderblom, D R

    1995-01-01

    The NASA High Resolution Microwave Survey consists of two complementary elements: a Sky Survey of the entire sky to a moderate level of sensitivity; and a Targeted Search of nearby stars, one at a time, to a much deeper level of sensitivity. In this paper we propose strategies for target selection. We have two goals: to improve the chances of successful detection of signals from technical civilizations that inhabit planets around solar-type stars, and to minimize the chances of missing signals from unexpected sites. For the main Targeted Search survey of approximately 1000 nearby solar-type stars, we argue that the selection criteria should be heavily biased by what we know about the origin and evolution of life here on Earth. We propose that observations of stars with stellar companions orbiting near the habitable zone should be de-emphasized, because such companions would prevent the formation of habitable planets. We also propose that observations of stars younger than about three billion years should be de-emphasized in favor of older stars, because our own technical civilization took longer than three billion years to evolve here on Earth. To provide the information needed for the preparation of specific target lists, we have undertaken an inventory of a large sample of solar-type stars out to a distance of 60 pc, with the goal of characterizing the relevant astrophysical properties of these stars, especially their ages and companionship. To complement the main survey, we propose that a modest sample of the nearest stars should be observed without any selection biases whatsoever. Finally, we argue that efforts to identify stars with planetary systems should be expanded. If found, such systems should receive intensive scrutiny. PMID:11540737

  4. Site selection for Mars exobiology

    NASA Technical Reports Server (NTRS)

    Farmer, J.; Des Marais, D.; Greeley, R.; Landheim, R.; Klein, H.

    1995-01-01

    The selection of sites on Mars that have a high priority for exobiological research is fundamental for planning future exploration. The most immediate need is to identify targets for high resolution orbital imaging during the Mars Observer and Mars '94/'96 missions that can be used to refined site priorities for surface exploration. We present an objective approach to site selection whereby individual sites are selected and scored, based on the presence of key geological features which indicate high priority environments. Prime sites are those that show evidence for the prolonged activity of liquid water and which have sedimentary deposits that are likely to have accumulated in environments favorable for life. High priority areas include fluvio-lacustrine (stream-fed lake systems), springs, and periglacial environments. Sites where mineralization may have occurred in the presence of organisms (e.g. springs) are given high priority in the search for a fossil record on Mars. A systematic review of Viking data for 83 sites in the Mars Landing Site Catalog (MLSC) resulted in the selection of 13 as being of exobiological interest. The descriptions of these sites were expanded to address exobiological concerns. An additional five sites were identified for inclusion in the second edition of the MLSC. We plan to broaden our site selection activities to include a systematic global reconnaissance of Mars using Viking data, and will continue to refine site priorities for exobiological research based on data from future missions in order to define strategies for surface exploration.

  5. Direct targeted glycation of the free sulfhydryl group of cysteine residue (Cys-34) of BSA. Mapping of the glycation sites of the anti-tumor Thomsen-Friedenreich neoglycoconjugate vaccine prepared by Michael addition reaction.

    PubMed

    Demian, Wael L L; Kottari, Naresh; Shiao, Tze Chieh; Randell, Edward; Roy, René; Banoub, Joseph H

    2014-12-01

    We present in this manuscript the characterization of the exact glycation sites of the Thomsen-Friedenreich antigen-BSA vaccine (TF antigen:BSA) prepared using a Michael addition reaction between the saccharide antigen as an electrophilic acceptor and the nucleophilic thiol and L-Lysine ε-amino groups of BSA using different ligation conditions. Matrix laser desorption ionization time-of-flight mass spectrometry of the neoglycoconjugates prepared with TF antigen:protein ratios of 2:1 and 8:1, allowed to observe, respectively, the protonated molecules for each neoglycoconjugates: [M + H](+) at m/z 67,599 and 70,905. The measurements of these molecular weights allowed us to confirm exactly the carbohydrate:protein ratios of these two synthetic vaccines. These were found to be closely formed by a TF antigen:BSA ratios of 2:1 and 8:1, respectively. Trypsin digestion and liquid chromatography coupled with electrospray ionization mass spectrometry allowed us to identify the series of released glycopeptide and peptide fragments. De novo sequencing affected by low-energy collision dissociation tandem mass spectrometry was then employed to unravel the precise glycation sites of these neoglycoconjugate vaccines. Finally, we identified, respectively, three diagnostic and characteristic glycated peptides for the synthetic glycoconjugate possessing a TF antigen:BSA ratio 2:1, whereas we have identified for the synthetic glycoconjugate having a TF:BSA ratio 8:1 a series of 14 glycated peptides. The net increase in the occupancy sites of these neoglycoconjugates was caused by the large number of glycoforms produced during the chemical ligation of the synthetic carbohydrate antigen onto the protein carrier. PMID:25476939

  6. The 50 Constellation Priority Sites

    NASA Technical Reports Server (NTRS)

    Noble, S.; Joosten, K.; Eppler, D.; Gruener, J.; Mendell, W.; French, R.; Plescia, J.; Spudis, P.; Wargo, M.; Robinson, M.; Lucey, P.

    2009-01-01

    The Constellation program (CxP) has developed a list of 50 sites of interest on the Moon which will be targeted by the LRO narrow angle camera. The list has also been provided to the M team to supplement their targeting list. This list does not represent a "site selection" process; rather the goal was to find "representative" sites and terrains to understand the range of possible surface conditions for human lunar exploration to aid engineering design and operational planning. The list compilers leveraged heavily on past site selection work (e.g. Geoscience and a Lunar Base Workshop - 1988, Site Selection Strategy for a Lunar Outpost - 1990, Exploration Systems Architecture Study (ESAS) - 2005). Considerations included scientific, resource utilization, and operational merits, and a desire to span lunar terrain types. The targets have been organized into two "tiers" of 25 sites each to provide a relative priority ranking in the event of mutual interference. A LEAG SAT (special action team) was established to validate and recommend modifications to the list. This SAT was chaired by Dr. Paul Lucey. They provided their final results to CxP in May. Dr. Wendell Mendell will organize an on-going analysis of the data as they come down to ensure data quality and determine if and when a site has sufficient data to be retired from the list. The list was compiled using the best available data, however, it is understood that with the flood of new lunar data, minor modifications or adjustments may be required.

  7. Targeted drugs and nanomedicine: present and future.

    PubMed

    Debbage, Paul

    2009-01-01

    Packaging small-molecule drugs into nanoparticles improves their bio-availability, bio-compatibility and safety profiles. Multifunctional particles carrying large drug payloads for targeted transport, immune evasion and favourable drug release kinetics at the target site, require a certain minimum size usually 30-300 nm diameter, so are nanoparticles. Targeting particles to a disease site can signal the presence of the disease site, block a function there, or deliver a drug to it. Targeted nanocarriers must navigate through blood-tissue barriers, varying in strength between organs and highest in the brain, to reach target cells. They must enter target cells to contact cytoplasmic targets; specific endocytotic and transcytotic transport mechanisms can be used as trojan horses to ferry nanoparticles across cellular barriers. Specific ligands to cell surface receptors, antibodies and antibody fragments, and aptamers can all access such transport mechanisms to ferry nanoparticles to their targets. The pharmacokinetics and pharmacodynamics of the targeted drug-bearing particle depend critically on particle size, chemistry, surface charge and other parameters. Particle types for targeting include liposomes, polymer and protein nanoparticles, dendrimers, carbon-based nanoparticles e.g. fullerenes, and others. Immunotargeting by use of monoclonal antibodies, chimeric antibodies and humanized antibodies has now reached the stage of clinical application. High-quality targeting groups are emerging: antibody engineering enables generation of human/like antibody (fragments) and facilitates the search for clinically relevant biomarkers; conjugation of nanocarriers to specific ligands and to aptamers enables specific targeting with improved clinical efficacy. Future developments depend on identification of clinically relevant targets and on raising targeting efficiency of the multifunctional nanocarriers. PMID:19149610

  8. Site Construction.

    ERIC Educational Resources Information Center

    Richardson, Eric C.

    1996-01-01

    Presents a guide to planning and building a Web site, with an emphasis on setting up a Web server. Discussion includes hiring a consultant, contracts and payment, assembly of teams, training, development of a business plan, registration of domain name, purchase of hardware and software, local area networks, and types of Internet connection. (JKP)

  9. Climatological targets for Mars Pathfinder

    NASA Technical Reports Server (NTRS)

    Zent, Aaron P.

    1994-01-01

    Four areas fit within the elevation and latitude constraints: Chryse, Elysium, Amazonis, and Isidis. There is geomorphic evidence that all have supported standing water. In some cases it would be difficult to pick a landing site that had no hope of teaching us about the climatic history of Mars. The southeast Elysium Basin provides an optimal target in which a variety of materials may be accessible in a near-shore environment. The albedo of the region is moderately low, and the thermal inertia is indicative of moderate rock coverage or some consolidation of fines, arguing that the site has not been covered with eolian dust deposits.

  10. Correlation between the phospholipids domains of the target cell membrane and the extent of Naja kaouthia PLA(2)-induced membrane damage: evidence of distinct catalytic and cytotoxic sites in PLA(2) molecules.

    PubMed

    Mukherjee, Ashis K

    2007-02-01

    Two phospholipase A(2) (PLA(2)) enzymes (NK-PLA(2)-A and NK-PLA(2)-B) were purified from the venom of the monocled cobra Naja kaouthia. The molecular weights of NK-PLA(2)-A and NK-PLA(2)-B, as estimated by mass spectrometry, were 13,619 and 13,303 Da respectively. Both phospholipases were highly thermostable, had maximum catalytic activity at basic pH, and showed preferential hydrolysis of phosphatidylcholine. Intravenous injection of either PLA(2) up to a dose of 10 mg/kg body weight was non-toxic to mice and did not show neurotoxic symptoms. The N. kaouthia PLA(2)s displayed anticoagulant and cytotoxic activity, but poor hemolytic activity. Both the PLA(2)s were more toxic to Sf9 and Tn cells compared to VERO cells. NK-PLA(2) exhibited selective lysis of wild-type baculovirus-infected Sf9 cells compared to normal cells. Amino acid modification studies and heating experiments suggest that separate sites in the NK-PLA(2) molecules are responsible for their catalytic, anticoagulant and cytotoxic activities. PMID:17127009

  11. Site-directed mutagenesis, in vivo electroporation and mass spectrometry in search for determinants of the subcellular targeting of Rab7b paralogue in the model eukaryote Paramecium octaurelia.

    PubMed

    Wyroba, E; Kwaśniak, P; Miller, K; Kobyłecki, K; Osińska, M

    2016-01-01

    Protein products of the paralogous genes resulting from the whole genome duplication may acquire new function. The role of post-translational modifications (PTM) in proper targeting of Paramecium Rab7b paralogue - distinct from that of Rab7a directly involved in phagocytosis - was studied using point mutagenesis, proteomic analysis and double immunofluorescence after in vivo electroporation of the mutagenized protein. Here we show that substitution of Thr200 by Ala200 resulted in diminished incorporation of [P32] by 37.4% and of 32 [C14-]UDP-glucose by 24%, respectively, into recombinant Rab7b_200 in comparison to the non-mutagenized control. Double confocal imaging revealed that Rab7b_200 was mistargeted upon electroporation into living cells contrary to non- mutagenized recombinant Rab7b correctly incorporated in the cytostome area. We identified the peptide ion at m/z=677.63+ characteristic for the glycan group attached to Thr200 in Rab7b using nano LC-MS/MS and comparing the peptide map of this protein with that after deglycosylation with the mixture of five enzymes of different specificity. Based on the mass of this peptide ion and quantitative radioactive assays with [P32]and  [C14-]UDP- glucose, the suggested composition of the adduct attached to Thr200 might be (Hex)1(HexNAc)1(Phos)3 or (HexNAc)1 (Deoxyhexose)1 (Phos)1 (HexA)1. These data indicate that PTM of Thr200 located in the hypervariable C-region of Rab7b in Paramecium is crucial for the proper localization/function of this protein. Moreover, these proteins differ also in other PTM: the number of phosphorylated amino acids in Rab7b is much higher than in Rab7a. PMID:27349314

  12. Site-Directed Mutagenesis, in Vivo Electroporation and Mass Spectrometry in Search for Determinants of the Subcellular Targeting of Rab7b Paralogue in the Model Eukaryote Paramecium Octaurelia

    PubMed Central

    Wyroba, E.; Kwaśniak, P.; Miller, K.; Kobyłecki, K.; Osińska, M.

    2016-01-01

    Protein products of paralogous genes resulting from whole genome duplication may acquire new functions. The role of post-translational modifications (PTM) in proper targeting of Paramecium Rab7b paralogue (distinct from that of Rab7a directly involved in phagocytosis) was studied using point mutagenesis, proteomic analysis and double immunofluorescence after in vivo electroporation of the mutagenized protein. Here we show that substitution of Thr200 by Ala diminished the incorporation of [P32] by 37% and of [C14-]UDP-glucose by 24% into recombinant Rab7b_200 in comparison to the non-mutagenized control. Double confocal imaging revealed that Rab7b_200 was mistargeted upon electroporation into living cells in contrast to non-mutagenized recombinant Rab7b correctly incorporated in the cytostome area. Using nano LC-MS/MS to compare the peptide map of Rab7b with that after deglycosylation with a mixture of five enzymes of different specificity we identified a peptide ion at m/z=677.63+ representing a glycan group attached to Thr200. Based on its mass and quantitative assays with [P32] and [C14]UDP-glucose, the suggested composition of the adduct attached to Thr200 is (Hex)1(HexNAc)1(Phos)3 or (HexNAc)1 (Deoxyhexose)1 (Phos)1 (HexA)1. These data indicate that PTM of Thr200 located in the hypervariable C-region of Paramecium octaurelia Rab7b is crucial for the proper localization/function of this protein. Moreover, the two Rab7 paralogues differ also in another PTM: substantially more phosphorylated amino acid residues are in Rab7b than in Rab7a. PMID:27349314

  13. Targeted therapies for cancer

    MedlinePlus

    ... page: //medlineplus.gov/ency/patientinstructions/000902.htm Targeted therapies for cancer To use the sharing features on ... cells so they cannot spread. How Does Targeted Therapy Work? Targeted therapy drugs work in a few ...

  14. Differences in the chemical and catalytic characteristics of two crystallographically 'identical' enzyme catalytic sites. Characterization of actinidin and papain by a combination of pH-dependent substrate catalysis kinetics and reactivity probe studies targeted on the catalytic-site thiol group and its immediate microenvironment.

    PubMed Central

    Salih, E; Malthouse, J P; Kowlessur, D; Jarvis, M; O'Driscoll, M; Brocklehurst, K

    1987-01-01

    The characteristics of actinidin (EC 3.4.22.14) and papain (EC 3.4.22.2), two cysteine proteinases whose catalytic-site regions appear to superimpose to a degree that approaches atomic co-ordinate accuracy of both crystal structures, were evaluated by determining (a) the pH-dependence in acid media of the acylation process of the catalytic act (k+2/Ks) using N alpha-benzoyl-L-arginine p-nitroanilide (L-Bz-Arg-Nan) as substrate and (b) the sensitivity of the reactivity of the catalytic-site thiol group and its pH-dependence to structural change in small, thiol-specific, two-protonic-state reactivity probes (2,2'-dipyridyl disulphide and methyl 2-pyridyl disulphide) where enzyme-probe contacts should be restricted to areas close to the catalytic site. Distortion of the catalytic sites of the two enzymes at pH less than 4 was evaluated over time-scales appropriate for both stopped-flow reactivity probe kinetics (less than or equal to 1-2 s) and steady-state substrate catalysis kinetics (3-5 min) by using the 2,2'-dipyridyl disulphide monocation as a titrant for non-distorted catalytic sites. This permitted a lower pH limit to be defined for valid kinetic analysis of both types. The behaviour of the enzymes at pH less than 4 requires a kinetic model in which the apparently biomolecular reaction of enzyme with probe reagent is separated from the process leading to loss of conformational integrity by a potentially reversible step. The acylation of actinidin with L-Bz-Arg-Nan in acidic media occurs in two protonic states, one produced by raising the pH across pKa less than 4 which probably characterizes the formation of -S-/-ImH+ ion pair (pKa approx. 3) and the other, of higher reactivity, produced by raising the pH across pKa 5.5, which may characterize rearrangement of catalytic-site geometry. The pH-dependence of the acylation of papain by L-Bz-Arg-Nan is quite different and is not influenced by protonic dissociation with pKa values in the range 5-6. The earlier

  15. Microtubule-targeting-dependent reorganization of filopodia.

    PubMed

    Schober, Joseph M; Komarova, Yulia A; Chaga, Oleg Y; Akhmanova, Anna; Borisy, Gary G

    2007-04-01

    Interaction between the microtubule system and actin cytoskeleton has emerged as a fundamental process required for spatial regulation of cell protrusion and retraction activities. In our current studies, analysis of digital fluorescence images revealed targeting of microtubules to filopodia in B16F1 melanoma cells and fibroblasts. We investigated the functional consequence of targeting on filopodia reorganization and examined mechanisms by which microtubules may be guided to, or interact with, filopodia. Live cell imaging studies show that targeting events in lamellipodia wings temporally correlated with filopodia turning toward the lamellipodium midline and with filopodia merging. Rapid uncoupling of targeting with nocodazole decreased filopodia merging events and increased filopodia density. Total internal reflection fluorescence microscopy identified microtubules near the ventral surface and upward movement of targeted filopodia. The role of adhesion sites and microtubule plus-end proteins in targeting was investigated. Correlation of adhesion sites with microtubule targeting to filopodia was not observed and depletion of microtubule plus-end proteins did not significantly alter targeting frequency. We propose that microtubules target filopodia, independent of focal adhesions and plus-end proteins, causing filopodia movement and microtubules regulate filopodia density in lamellipodia wings through filopodia merging events. PMID:17356063

  16. Characterization of the Streptococcus suis XerS recombinase and its unconventional cleavage of the difSL site.

    PubMed

    Leroux, Maxime; Jia, Fuli; Szatmari, George

    2011-11-01

    XerC and XerD are members of the tyrosine recombinase family and mediate site-specific recombination that contributes to the stability of circular chromosomes in bacteria by resolving plasmid multimers and chromosome dimers to monomers prior to cell division. Homologues of xerC/xerD genes have been found in many bacteria, and in the lactococci and streptococci, a single recombinase called XerS can perform the functions of XerC and XerD. The xerS gene of Streptococcus suis was cloned, overexpressed and purified as a maltose-binding protein (MBP) fusion. The purified MBP-XerS fusion showed specific DNA-binding activity to both halves of the dif site of S. suis, and covalent protein-DNA complexes were also detected with dif site suicide substrates. These substrates were also cleaved in a specific fashion by MBP-XerS, generating cleavage products separated by an 11-bp spacer region, unlike the traditional 6-8-bp spacer observed in most tyrosine recombinases. Furthermore, xerS mutants of S. suis showed significant growth and morphological changes. PMID:22092814

  17. Shallow magma targets in the western US

    SciTech Connect

    Hardee, H.C.

    1984-10-01

    Within the next few years a hole will be drilled into a shallow magma body in the western US for the purpose of evaluating the engineering feasibility of magma energy. This paper examines potential drilling sites for these engineering feasibility experiments. Target sites high on the list are ones that currently exhibit good geophysical and geological data for shallow magma and also have reasonable operational requirements. Top ranked sites for the first magma energy well are Long Valley, CA, and Coso/Indian Wells, CA. Kilauea, HI, also in the top group, is an attractive site for some limited field experiments. A number of additional sites offer promise as eventual magma energy sites, but sparsity of geophysical data presently prevents these sites from being considered for the first magma energy well.

  18. Integrin Targeted Delivery of Chemotherapeutics

    PubMed Central

    Chen, Kai; Chen, Xiaoyuan

    2011-01-01

    Targeted delivery of chemotherapeutics is defined in the sense, that is, to maximize the therapeutic index of a chemotherapeutic agent by strictly localizing its pharmacological activity to the site or tissue of action. Integrins are a family of heterodimeric transmembrane glycoproteins involved in a wide range of cell-to-extracellular matrix (ECM) and cell-to-cell interactions. As cell surface receptors, integrins readily interact with extracellular ligands and play a vital role in angiogenesis, leukocytes function and tumor development, which sets up integrins as an excellent target for chemotherapy treatment. The peptide ligands containing the arginine-glycine-aspartic acid (RGD), which displays a strong binding affinity and selectivity to integrins, particularly to integrin αvβ3, have been developed to conjugate with various conventional chemotherapeutic agents, such as small molecules, peptides and proteins, and nanoparticle-carried drugs for integtrin targeted therapeutic studies. This review highlights the recent advances in integrin targeted delivery of chemotherapeutic agents with emphasis on target of integrin αvβ3, and describes the considerations for the design of the diverse RGD peptide-chemotherapeutics conjugates and their major applications. PMID:21547159

  19. Electrically charged targets

    DOEpatents

    Goodman, Ronald K.; Hunt, Angus L.

    1984-01-01

    Electrically chargeable laser targets and method for forming such charged targets in order to improve their guidance along a predetermined desired trajectory. This is accomplished by the incorporation of a small amount of an additive to the target material which will increase the electrical conductivity thereof, and thereby enhance the charge placed upon the target material for guidance thereof by electrostatic or magnetic steering mechanisms, without adversely affecting the target when illuminated by laser energy.

  20. Polarized internal target apparatus

    DOEpatents

    Holt, R.J.

    1984-10-10

    A polarized internal target apparatus with a polarized gas target of improved polarization and density (achieved by mixing target gas atoms with a small amount of alkali metal gas atoms, and passing a high intensity polarized light source into the mixture to cause the alkali metal gas atoms to become polarized which interact in spin exchange collisions with target gas atoms yielding polarized target gas atoms) is described.

  1. Polarized internal target apparatus

    DOEpatents

    Holt, Roy J.

    1986-01-01

    A polarized internal target apparatus with a polarized gas target of improved polarization and density achieved by mixing target gas atoms with a small amount of alkali metal gas atoms, and passing a high intensity polarized light source into the mixture to cause the alkali metal gas atoms to become polarized which interact in spin exchange collisions with target gas atoms yielding polarized target gas atoms.

  2. Structural flexibility of intrinsically disordered proteins induces stepwise target recognition

    NASA Astrophysics Data System (ADS)

    Shirai, Nobu C.; Kikuchi, Macoto

    2013-12-01

    An intrinsically disordered protein (IDP) lacks a stable three-dimensional structure, while it folds into a specific structure when it binds to a target molecule. In some IDP-target complexes, not all target binding surfaces are exposed on the outside, and intermediate states are observed in their binding processes. We consider that stepwise target recognition via intermediate states is a characteristic of IDP binding to targets with "hidden" binding sites. To investigate IDP binding to hidden target binding sites, we constructed an IDP lattice model based on the HP model. In our model, the IDP is modeled as a chain and the target is modeled as a highly coarse-grained object. We introduced motion and internal interactions to the target to hide its binding sites. In the case of unhidden binding sites, a two-state transition between the free states and a bound state is observed, and we consider that this represents coupled folding and binding. Introducing hidden binding sites, we found an intermediate bound state in which the IDP forms various structures to temporarily stabilize the complex. The intermediate state provides a scaffold for the IDP to access the hidden binding site. We call this process multiform binding. We conclude that structural flexibility of IDPs enables them to access hidden binding sites and this is a functional advantage of IDPs.

  3. Subject Gateway Sites and Search Engine Ranking.

    ERIC Educational Resources Information Center

    Thelwall, Mike

    2002-01-01

    Discusses subject gateway sites and commercial search engines for the Web and presents an explanation of Google's PageRank algorithm. The principle question addressed is the conditions under which a gateway site will increase the likelihood that a target page is found in search engines. (LRW)

  4. Targeted genome modification via triple helix formation.

    PubMed

    Ricciardi, Adele S; McNeer, Nicole A; Anandalingam, Kavitha K; Saltzman, W Mark; Glazer, Peter M

    2014-01-01

    Triplex-forming oligonucleotides (TFOs) are capable of coordinating genome modification in a targeted, site-specific manner, causing mutagenesis or even coordinating homologous recombination events. Here, we describe the use of TFOs such as peptide nucleic acids for targeted genome modification. We discuss this method and its applications and describe protocols for TFO design, delivery, and evaluation of activity in vitro and in vivo. PMID:25030921

  5. Materials considerations in accelerator targets

    SciTech Connect

    Peacock, H.B. Jr.; Iyer, N.C.; Louthan, M.R. Jr.

    1994-08-01

    Future nuclear materials production and/or the burn-up of long lived radioisotopes may be accomplished through the capture of spallation produced neutrons in accelerators. Aluminum clad-lead and/or lead alloys has been proposed as a spallation target. Aluminum was the cladding choice because of the low neutron absorption cross section, fast radioactivity decay, high thermal conductivity, and excellent fabricability. Metallic lead and lead oxide powders were considered for the target core with the fabrication options being casting or powder metallurgy (PM). Scoping tests to evaluate gravity casting, squeeze casting, and casting and swaging processes showed that, based on fabricability and heat transfer considerations, squeeze casting was the preferred option for manufacture of targets with initial core cladding contact. Thousands of aluminum clad aluminum-lithium alloy core targets and control rods for tritium production have been fabricated by coextrusion processes and successfully irradiated in the SRS reactors. Tritium retention in, and release from the coextruded product was modeled from experimental and operational data. Newly produced tritium atoms were trapped by lithium atoms to form a lithium tritide. The effective tritium pressure required for trap or tritide stability was the equilibrium decomposition pressure of tritium over a lithium tritide-aluminum mixture. The temperature dependence of tritium release was determined by the permeability of the cladding to tritium and the local equilibrium at the trap sites. The model can be used to calculate tritium release from aluminum clad, aluminum-lithium alloy targets during postulated accelerator operational and accident conditions. This paper describes the manufacturing technologies evaluated and presents the model for tritium retention in aluminum clad, aluminum-lithium alloy tritium production targets.

  6. Magnetically attached sputter targets

    DOEpatents

    Makowiecki, D.M.; McKernan, M.A.

    1994-02-15

    An improved method and assembly for attaching sputtering targets to cathode assemblies of sputtering systems which includes a magnetically permeable material is described. The magnetically permeable material is imbedded in a target base that is brazed, welded, or soldered to the sputter target, or is mechanically retained in the target material. Target attachment to the cathode is achieved by virtue of the permanent magnets and/or the pole pieces in the cathode assembly that create magnetic flux lines adjacent to the backing plate, which strongly attract the magnetically permeable material in the target assembly. 11 figures.

  7. Magnetically attached sputter targets

    DOEpatents

    Makowiecki, Daniel M.; McKernan, Mark A.

    1994-01-01

    An improved method and assembly for attaching sputtering targets to cathode assemblies of sputtering systems which includes a magnetically permeable material. The magnetically permeable material is imbedded in a target base that is brazed, welded, or soldered to the sputter target, or is mechanically retained in the target material. Target attachment to the cathode is achieved by virtue of the permanent magnets and/or the pole pieces in the cathode assembly that create magnetic flux lines adjacent to the backing plate, which strongly attract the magnetically permeable material in the target assembly.

  8. Human target acquisition performance

    NASA Astrophysics Data System (ADS)

    Teaney, Brian P.; Du Bosq, Todd W.; Reynolds, Joseph P.; Thompson, Roger; Aghera, Sameer; Moyer, Steven K.; Flug, Eric; Espinola, Richard; Hixson, Jonathan

    2012-06-01

    The battlefield has shifted from armored vehicles to armed insurgents. Target acquisition (identification, recognition, and detection) range performance involving humans as targets is vital for modern warfare. The acquisition and neutralization of armed insurgents while at the same time minimizing fratricide and civilian casualties is a mounting concern. U.S. Army RDECOM CERDEC NVESD has conducted many experiments involving human targets for infrared and reflective band sensors. The target sets include human activities, hand-held objects, uniforms & armament, and other tactically relevant targets. This paper will define a set of standard task difficulty values for identification and recognition associated with human target acquisition performance.

  9. Vascular Targeting of a Gold Nanoparticle to Breast Cancer Metastasis.

    PubMed

    Peiris, Pubudu M; Deb, Partha; Doolittle, Elizabeth; Doron, Gilad; Goldberg, Amy; Govender, Priya; Shah, Shruti; Rao, Swetha; Carbone, Sarah; Cotey, Thomas; Sylvestre, Meilyn; Singh, Sohaj; Schiemann, William P; Lee, Zhenghong; Karathanasis, Efstathios

    2015-08-01

    The vast majority of breast cancer deaths are due to metastatic disease. Although deep tissue targeting of nanoparticles is suitable for some primary tumors, vascular targeting may be a more attractive strategy for micrometastasis. This study combined a vascular targeting strategy with the enhanced targeting capabilities of a nanoparticle to evaluate the ability of a gold nanoparticle (AuNP) to specifically target the early spread of metastatic disease. As a ligand for the vascular targeting strategy, we utilized a peptide targeting alpha(v) beta(3) integrin, which is functionally linked to the development of micrometastases at a distal site. By employing a straightforward radiolabeling method to incorporate Technetium-99m into the AuNPs, we used the high sensitivity of radionuclide imaging to monitor the longitudinal accumulation of the nanoparticles in metastatic sites. Animal and histological studies showed that vascular targeting of the nanoparticle facilitated highly accurate targeting of micrometastasis in the 4T1 mouse model of breast cancer metastasis using radionuclide imaging and a low dose of the nanoparticle. Because of the efficient targeting scheme, 14% of the injected AuNP deposited at metastatic sites in the lungs within 60 min after injection, indicating that the vascular bed of metastasis is a viable target site for nanoparticles. PMID:26036431

  10. Vascular targeting of a gold nanoparticle to breast cancer metastasis

    PubMed Central

    Peiris, Pubudu M.; Deb, Partha; Doolittle, Elizabeth; Doron, Gilad; Goldberg, Amy; Govender, Priya; Shah, Shruti; Rao, Swetha; Carbone, Sarah; Cotey, Thomas; Sylvestre, Meilyn; Singh, Sohaj; Schiemann, William P.; Lee, Zhenghong; Karathanasis, Efstathios

    2015-01-01

    The vast majority of breast cancer deaths are due to metastatic disease. While deep tissue targeting of nanoparticles is suitable for some primary tumors, vascular targeting may be a more attractive strategy for micrometastasis. This study combined a vascular targeting strategy with the enhanced targeting capabilities of a nanoparticle to evaluate the ability of a gold nanoparticle to specifically target the early spread of metastatic disease. As a ligand for the vascular targeting strategy, we utilized a peptide targeting alpha(v) beta(3) integrin, which is functionally linked to the development of micrometastases at a distal site. By employing a straightforward radiolabeling method to incorporate Technetium-99m into the gold nanoparticles, we used the high sensitivity of radionuclide imaging to monitor the longitudinal accumulation of the nanoparticles in metastatic sites. Animal and histological studies showed that vascular targeting of the nanoparticle facilitated highly accurate targeting of micrometastasis in the 4T1 mouse model of breast cancer metastasis using radionuclide imaging and a low dose of the nanoparticle. Due to the efficient targeting scheme, 14% of the injected AuNP deposited at metastatic sites in the lungs within 60 min after injection, indicating that the vascular bed of metastasis is a viable target site for nanoparticles. PMID:26036431

  11. Intelligent Unmanned Monitoring of Remediated Sites

    SciTech Connect

    Emile Fiesler, Ph.D.

    2001-06-01

    During this Phase I project, IOS demonstrated the feasibility of combining digital signal processing and neural network analysis to analyze spectral signals from pure samples of several typical contaminants. We fabricated and tested a prototype system by automatically analyzing Raman spectral data taken in the Vadose zone at the 321 M site in the M area of DOE's Savannah River Site in South Carolina. This test demonstration proved the ability of IOS's technology to detect the target contaminants, tetrachloroethylene (PCE) and trichloroethylene (TCE), in isolation, and to detect the spectra of these contaminants in real-world noisy samples taken from a mixture of materials obtained from this typical remediation target site.

  12. Scrutinizing the Cybersell: Teen-Targeted Web Sites as Texts

    ERIC Educational Resources Information Center

    Crovitz, Darren

    2007-01-01

    Darren Crovitz explains that the explosive growth of Web-based content and communication in recent years compels us to teach students how to examine the "rhetorical nature and ethical dimensions of the online world." He demonstrates successful approaches to accomplish this goal through his analysis of the selling techniques of two Web sites…

  13. Description of the Northwest hazardous waste site data base and preliminary analysis of site characteristics

    SciTech Connect

    Woodruff, D.L.; Hartz, K.E.; Triplett, M.B.

    1988-08-01

    The Northwest Hazardous Waste RD and D Center (the Center) conducts research, development, and demonstration (RD and D) activities for hazardous and radioactive mixed-waste technologies applicable to remediating sites in the states of Idaho, Montana, Oregon, and Washington. To properly set priorities for these RD and D activities and to target development efforts it is necessary to understand the nature of the sites requiring remediation. A data base of hazardous waste site characteristics has been constructed to facilitate this analysis. The data base used data from EPA's Region X Comprehensive Environmental Response, Compensation, and Liability Information System (CERCLIS) and from Preliminary Assessment/Site Investigation (PA/SI) forms for sites in Montana. The Center's data base focuses on two sets of sites--those on the National Priorities List (NPL) and other sites that are denoted as ''active'' CERCLIS sites. Active CERCLIS sites are those sites that are undergoing active investigation and analysis. The data base contains information for each site covering site identification and location, type of industry associated with the site, waste categories present (e.g., heavy metals, pesticides, etc.), methods of disposal (e.g., tanks, drums, land, etc.), waste forms (e.g., liquid, solid, etc.), and hazard targets (e.g., surface water, groundwater, etc.). As part of this analysis, the Northwest region was divided into three geographic subregions to identify differences in disposal site characteristics within the Northwest. 2 refs., 18 figs., 5 tabs.

  14. FLIR target screening

    NASA Technical Reports Server (NTRS)

    Aggarwal, R.

    1982-01-01

    Methods for the segmentation and recognition of individual targets sensed with forward looking infrared detectors are discussed. Particular attention is given to an adaptive multi-scenario target screener.

  15. Plasma sheath driven targets

    NASA Astrophysics Data System (ADS)

    Brownell, J. H.; Freeman, B. L.

    1980-02-01

    Plasma focus driven target implosions are simulated using hydrodynamic-burn codes. Support is given to the idea that the use of a target in a plasma focus should allow 'impedance matching' between the fuel and gun, permitting larger fusion yields from a focus-target geometry than the scaling laws for a conventional plasma focus would predict.

  16. An actionable climate target

    NASA Astrophysics Data System (ADS)

    Geden, Oliver

    2016-05-01

    The Paris Agreement introduced three mitigation targets. In the future, the main focus should not be on temperature targets such as 2 or 1.5 °C, but on the target with the greatest potential to effectively guide policy: net zero emissions.

  17. High Power Cryogenic Targets

    SciTech Connect

    Gregory Smith

    2011-08-01

    The development of high power cryogenic targets for use in parity violating electron scattering has been a crucial ingredient in the success of those experiments. As we chase the precision frontier, the demands and requirements for these targets have grown accordingly. We discuss the state of the art, and describe recent developments and strategies in the design of the next generation of these targets.

  18. Target Capture during Mos1 Transposition*

    PubMed Central

    Pflieger, Aude; Jaillet, Jerôme; Petit, Agnès; Augé-Gouillou, Corinne; Renault, Sylvaine

    2014-01-01

    DNA transposition contributes to genomic plasticity. Target capture is a key step in the transposition process, because it contributes to the selection of new insertion sites. Nothing or little is known about how eukaryotic mariner DNA transposons trigger this step. In the case of Mos1, biochemistry and crystallography have deciphered several inverted terminal repeat-transposase complexes that are intermediates during transposition. However, the target capture complex is still unknown. Here, we show that the preintegration complex (i.e., the excised transposon) is the only complex able to capture a target DNA. Mos1 transposase does not support target commitment, which has been proposed to explain Mos1 random genomic integrations within host genomes. We demonstrate that the TA dinucleotide used as the target is crucial both to target recognition and in the chemistry of the strand transfer reaction. Bent DNA molecules are better targets for the capture when the target DNA is nicked two nucleotides apart from the TA. They improve strand transfer when the target DNA contains a mismatch near the TA dinucleotide. PMID:24269942

  19. MicroRNA targets in Drosophila

    PubMed Central

    Enright, Anton J; John, Bino; Gaul, Ulrike; Tuschl, Thomas; Sander, Chris; Marks, Debora S

    2004-01-01

    Background The recent discoveries of microRNA (miRNA) genes and characterization of the first few target genes regulated by miRNAs in Caenorhabditis elegans and Drosophila melanogaster have set the stage for elucidation of a novel network of regulatory control. We present a computational method for whole-genome prediction of miRNA target genes. The method is validated using known examples. For each miRNA, target genes are selected on the basis of three properties: sequence complementarity using a position-weighted local alignment algorithm, free energies of RNA-RNA duplexes, and conservation of target sites in related genomes. Application to the D. melanogaster, Drosophila pseudoobscura and Anopheles gambiae genomes identifies several hundred target genes potentially regulated by one or more known miRNAs. Results These potential targets are rich in genes that are expressed at specific developmental stages and that are involved in cell fate specification, morphogenesis and the coordination of developmental processes, as well as genes that are active in the mature nervous system. High-ranking target genes are enriched in transcription factors two-fold and include genes already known to be under translational regulation. Our results reaffirm the thesis that miRNAs have an important role in establishing the complex spatial and temporal patterns of gene activity necessary for the orderly progression of development and suggest additional roles in the function of the mature organism. In addition the results point the way to directed experiments to determine miRNA functions. Conclusions The emerging combinatorics of miRNA target sites in the 3' untranslated regions of messenger RNAs are reminiscent of transcriptional regulation in promoter regions of DNA, with both one-to-many and many-to-one relationships between regulator and target. Typically, more than one miRNA regulates one message, indicative of cooperative translational control. Conversely, one miRNA may have

  20. CASP9 Target Classification

    PubMed Central

    Kinch, Lisa N.; Shi, Shuoyong; Cheng, Hua; Cong, Qian; Pei, Jimin; Mariani, Valerio; Schwede, Torsten; Grishin, Nick V.

    2011-01-01

    The Critical Assessment of Protein Structure Prediction round 9 (CASP9) aimed to evaluate predictions for 129 experimentally determined protein structures. To assess tertiary structure predictions, these target structures were divided into domain-based evaluation units that were then classified into two assessment categories: template based modeling (TBM) and template free modeling (FM). CASP9 targets were split into domains of structurally compact evolutionary modules. For the targets with more than one defined domain, the decision to split structures into domains for evaluation was based on server performance. Target domains were categorized based on their evolutionary relatedness to existing templates as well as their difficulty levels indicated by server performance. Those target domains with sequence-related templates and high server prediction performance were classified as TMB, while those targets without identifiable templates and low server performance were classified as FM. However, using these generalizations for classification resulted in a blurred boundary between CASP9 assessment categories. Thus, the FM category included those domains without sequence detectable templates (25 target domains) as well as some domains with difficult to detect templates whose predictions were as poor as those without templates (5 target domains). Several interesting examples are discussed, including targets with sequence related templates that exhibit unusual structural differences, targets with homologous or analogous structure templates that are not detectable by sequence, and targets with new folds. PMID:21997778

  1. Wake Shield Target Protection

    SciTech Connect

    Valmianski, Emanuil I.; Petzoldt, Ronald W.; Alexander, Neil B.

    2003-05-15

    The heat flux from both gas convection and chamber radiation on a direct drive target must be limited to avoid target damage from excessive D-T temperature increase. One of the possibilities of protecting the target is a wake shield flying in front of the target. A shield will also reduce drag force on the target, thereby facilitating target tracking and position prediction. A Direct Simulation Monte Carlo (DSMC) code was used to calculate convection heat loads as boundary conditions input into ANSYS thermal calculations. These were used for studying the quality of target protection depending on various shapes of shields, target-shield distance, and protective properties of the shield moving relative to the target. The results show that the shield can reduce the convective heat flux by a factor of 2 to 5 depending on pressure, temperature, and velocity. The protective effect of a shield moving relative to the target is greater than the protective properties of a fixed shield. However, the protective effect of a shield moving under the drag force is not sufficient for bringing the heat load on the target down to the necessary limit. Some other ways of diminishing heat flux using a protective shield are discussed.

  2. Higher-dimensional targeting

    SciTech Connect

    Kostelich, E.J. ); Grebogi, C. Department of Mathematics and Institute for Physical Science and Technology, University of Maryland, College Park, Maryland 20742 ); Ott, E. Department of Electrical Engineering, University of Maryland, College Park, Maryland 20742 ); Yorke, J.A. )

    1993-01-01

    This paper describes a procedure to steer rapidly successive iterates of an initial condition on a chaotic attractor to a small target region about any prespecified point on the attractor using only small controlling perturbations. Such a procedure is called targeting.'' Previous work on targeting for chaotic attractors has been in the context of one- and two-dimensional maps. Here it is shown that targeting can also be done in higher-dimensional cases. The method is demonstrated with a mechanical system described by a four-dimensional mapping whose attractor has two positive Lyapunov exponents and a Lyapunov dimension of 2.8. The target is reached by making very small successive changes in a single control parameter. In one typical case, 35 iterates on average are required to reach a target region of diameter 10[sup [minus]4], as compared to roughly 10[sup 11] iterates without the use of the targeting procedure.

  3. Chimeric DNA methyltransferases target DNA methylation to specific DNA sequences and repress expression of target genes

    PubMed Central

    Li, Fuyang; Papworth, Monika; Minczuk, Michal; Rohde, Christian; Zhang, Yingying; Ragozin, Serg