Science.gov

Sample records for a-dna

  1. Ligand inducible assembly of a DNA tetrahedron.

    PubMed

    Dohno, Chikara; Atsumi, Hiroshi; Nakatani, Kazuhiko

    2011-03-28

    Here we show that a small synthetic ligand can be used as a key building component for DNA nanofabrication. Using naphthyridinecarbamate dimer (NCD) as a molecular glue for DNA hybridization, we demonstrate NCD-triggered formation of a DNA tetrahedron.

  2. DAPI: a DNA-specific fluorescent probe.

    PubMed

    Kapuscinski, J

    1995-09-01

    DAPI (4',6-diamidino-2-phenylindole) is a DNA-specific probe which forms a fluorescent complex by attaching in the minor grove of A-T rich sequences of DNA. It also forms nonfluorescent intercalative complexes with double-stranded nucleic acids. The physicochemical properties of the dye and its complexes with nucleic acids and history of the development of this dye as a biological stain are described. The application of DAPI as a DNA-specific probe for flow cytometry, chromosome staining, DNA visualization and quantitation in histochemistry and biochemistry is reviewed. The mechanisms of DAPI-nucleic acid complex formation including minor groove binding, intercalation and condensation are discussed.

  3. DNA encoding a DNA repair protein

    DOEpatents

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-08-15

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  4. Antibody specific for a DNA repair protein

    DOEpatents

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-07-11

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  5. Recognition Imaging with a DNA Aptamer

    PubMed Central

    Lin, Liyun; Wang, Hongda; Liu, Yan; Yan, Hao; Lindsay, Stuart

    2006-01-01

    We have used a DNA-aptamer tethered to an atomic force microscope probe to carry out recognition imaging of IgE molecules attached to a mica substrate. The recognition was efficient (∼90%) and specific, being blocked by injection of IgE molecules in solution, and not being interfered with by high concentrations of a second protein. The signal/noise ratio of the recognition signal was better than that obtained with antibodies, despite the fact that the average force required to break the aptamer-protein bonds was somewhat smaller. PMID:16513776

  6. Protein synthesis editing by a DNA aptamer.

    PubMed Central

    Hale, S P; Schimmel, P

    1996-01-01

    Potential errors in decoding genetic information are corrected by tRNA-dependent amino acid recognition processes manifested through editing reactions. One example is the rejection of difficult-to-discriminate misactivated amino acids by tRNA synthetases through hydrolytic reactions. Although several crystal structures of tRNA synthetases and synthetase-tRNA complexes exist, none of them have provided insight into the editing reactions. Other work suggested that editing required active amino acid acceptor hydroxyl groups at the 3' end of a tRNA effector. We describe here the isolation of a DNA aptamer that specifically induced hydrolysis of a misactivated amino acid bound to a tRNA synthetase. The aptamer had no effect on the stability of the correctly activated amino acid and was almost as efficient as the tRNA for inducing editing activity. The aptamer has no sequence similarity to that of the tRNA effector and cannot be folded into a tRNA-like structure. These and additional data show that active acceptor hydroxyl groups in a tRNA effector and a tRNA-like structure are not essential for editing. Thus, specific bases in a nucleic acid effector trigger the editing response. Images Fig. 3 Fig. 4 PMID:8610114

  7. A DNA enzyme that cleaves RNA

    NASA Technical Reports Server (NTRS)

    Breaker, R. R.; Joyce, G. F.; Hoyce, G. F. (Principal Investigator)

    1994-01-01

    BACKGROUND: Several types of RNA enzymes (ribozymes) have been identified in biological systems and generated in the laboratory. Considering the variety of known RNA enzymes and the similarity of DNA and RNA, it is reasonable to imagine that DNA might be able to function as an enzyme as well. No such DNA enzyme has been found in nature, however. We set out to identify a metal-dependent DNA enzyme using in vitro selection methodology. RESULTS: Beginning with a population of 10(14) DNAs containing 50 random nucleotides, we carried out five successive rounds of selective amplification, enriching for individuals that best promote the Pb(2+)-dependent cleavage of a target ribonucleoside 3'-O-P bond embedded within an otherwise all-DNA sequence. By the fifth round, the population as a whole carried out this reaction at a rate of 0.2 min-1. Based on the sequence of 20 individuals isolated from this population, we designed a simplified version of the catalytic domain that operates in an intermolecular context with a turnover rate of 1 min-1. This rate is about 10(5)-fold increased compared to the uncatalyzed reaction. CONCLUSIONS: Using in vitro selection techniques, we obtained a DNA enzyme that catalyzes the Pb(2+)-dependent cleavage of an RNA phosphoester in a reaction that proceeds with rapid turnover. The catalytic rate compares favorably to that of known RNA enzymes. We expect that other examples of DNA enzymes will soon be forthcoming.

  8. A DNA enzyme that cleaves RNA

    NASA Technical Reports Server (NTRS)

    Breaker, R. R.; Joyce, G. F.; Hoyce, G. F. (Principal Investigator)

    1994-01-01

    BACKGROUND: Several types of RNA enzymes (ribozymes) have been identified in biological systems and generated in the laboratory. Considering the variety of known RNA enzymes and the similarity of DNA and RNA, it is reasonable to imagine that DNA might be able to function as an enzyme as well. No such DNA enzyme has been found in nature, however. We set out to identify a metal-dependent DNA enzyme using in vitro selection methodology. RESULTS: Beginning with a population of 10(14) DNAs containing 50 random nucleotides, we carried out five successive rounds of selective amplification, enriching for individuals that best promote the Pb(2+)-dependent cleavage of a target ribonucleoside 3'-O-P bond embedded within an otherwise all-DNA sequence. By the fifth round, the population as a whole carried out this reaction at a rate of 0.2 min-1. Based on the sequence of 20 individuals isolated from this population, we designed a simplified version of the catalytic domain that operates in an intermolecular context with a turnover rate of 1 min-1. This rate is about 10(5)-fold increased compared to the uncatalyzed reaction. CONCLUSIONS: Using in vitro selection techniques, we obtained a DNA enzyme that catalyzes the Pb(2+)-dependent cleavage of an RNA phosphoester in a reaction that proceeds with rapid turnover. The catalytic rate compares favorably to that of known RNA enzymes. We expect that other examples of DNA enzymes will soon be forthcoming.

  9. Assessment of a DNA Vaccine Encoding Burkholderia pseudomallei Bacterioferritin

    DTIC Science & Technology

    2007-08-01

    bacterioferritin gene from Brucella abortus, when delivered to mice as a DNA vaccine, evokes a potent Th1 immune response, including strong IFN-γ...blocking buffer containing goat anti-mouse IgG alkaline phosphatase conjugate (Sigma) at a dilution of 1:30000 for 1hr at room temperature. Following...Walravens, and J. J. Letesson. 2001. Induction of immune response in BALB/c mice with a DNA vaccine encoding bacterioferritin or P39 of Brucella

  10. Construction of a DNA Nano-Object Directly Demonstrates Computation

    PubMed Central

    Wu, Gang; Jonoska, Natasha; Seeman, Nadrian C.

    2009-01-01

    We demonstrate a computing method in which a DNA nano-object representing the solution of a problem emerges as a result of self-assembly. We report an experiment in which three-vertex colorability for a 6-vertex graph with 9 edges is solved by constructing a DNA molecule representing the colored graph itself. Our findings show that computation based on “shape processing” is a viable alternative to symbol processing when computing by molecular self-assembly. PMID:19607875

  11. Methods to alter levels of a DNA repair protein

    DOEpatents

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-10-17

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  12. Theoretical description of biomolecular hydration - Application to A-DNA

    SciTech Connect

    Garcia, A.E.; Hummer, G.; Soumpasis, D.M.

    1994-12-31

    The local density of water molecules around a biomolecule is constructed from calculated two- and three-points correlation functions of polar solvents in water using a Potential-of-Mean-Force (PMF) expansion. As a simple approximation, the hydration of all polar (including charged) groups in a biomolecule is represented by the hydration of water oxygen in bulk water, and the effect of non-polar groups on hydration are neglected, except for excluded volume effects. Pair and triplet correlation functions are calculated by molecular dynamics simulations. We present calculations of the structural hydration for ideal A-DNA molecules with sequences [d(CG){sub 5}]{sub 2} and [d(C{sub 5}G{sub 5})]{sub 2}. We find that this method can accurately reproduce the hydration patterns of A-DNA observed in neutron diffraction experiments on oriented DNA fibers.

  13. NMR at the Picomole Level of a DNA Adduct

    PubMed Central

    Kautz, Roger; Wang, Poguang; Giese, Roger W.

    2014-01-01

    We investigate the limit of detection for obtaining NMR data of a DNA adduct using modern microscale NMR instrumentation, once the adduct has been isolated at the pmol level. Eighty nanograms (130 pmol) of a DNA adduct standard, N-(2′-deoxyguanosin-8-yl)-2-acetylaminofluorene 5′-monophosphate (AAF-dGMP), in 1.5 μL of D2O with 10% methanol-d4, in a vial, was completely picked up as a droplet suspended in a fluorocarbon liquid, and loaded efficiently into a microcoil probe. This work demonstrates a practical manual method of droplet microfluidic sample loading, previously demonstrated using automated equipment, which provides a several-fold advantage over conventional flow injection. Eliminating dilution during injection and confining the sample into the observed volume realizes the full theoretical mass sensitivity of a microcoil, comparable to a micro-cryo probe. With 80 ng, an NMR spectrum acquired over 40 hr showed all of the resonances seen in a standard spectrum of AAF-dGMP, with a S/N of at least 10, despite broadening due to previously-noted effects of conformational exchange. Also a 2D TOCSY spectrum (total correlation spectroscopy) was acquired on 1.6 μg in 18 hr. This work helps to define the utility of NMR in combination with other analytical methods for the structural characterization of a small amount of a DNA adduct. PMID:24028148

  14. MD studies on conformational behavior of a DNA photolyase enzyme

    NASA Astrophysics Data System (ADS)

    Dushanov, E.; Kholmurodov, Kh.; Yasuoka, K.; Krasavin, E.

    2013-11-01

    In this work, molecular dynamics (MD) simulations were performed on a DNA photolyase protein with two cofactors, FAD (flavin adenine dinucleotide) and MTHF (methenyltetrahydrofolate), inside the enzyme pocket. A DNA photolyase is a highly efficient light-driven enzyme that repairs the UV-induced cyclobutane-pyrimidine dimer in damaged DNA. We were aimed to compare the conformational changes of the FAD cofactor and other constituent fragments of the molecular system under consideration. The conformational behavior of the FAD molecule is very important for understanding the functional and structural properties of the DNA repair protein photolyase. The photoactive FAD is an essential cofactor both for specificial binding to damaged DNA and for catalysis. The second chromophore (MTHF or 8-HDF) is not necessary for catalysis and has no effect on specific enzyme—substrate binding. The obtained results were discussed to gain insight into the light-driven mechanism of DNA repair by a DNA photolyase enzyme—based on the enzyme structure, the FAD mobility, and conformation shape.

  15. Controlling charge current through a DNA based molecular transistor

    NASA Astrophysics Data System (ADS)

    Behnia, S.; Fathizadeh, S.; Ziaei, J.

    2017-01-01

    Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I-V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive.

  16. Theory of electron conductance across a DNA basepair

    NASA Astrophysics Data System (ADS)

    Lee, Myeong; Sankey, Otto

    2008-03-01

    In recent years, research on electron tunneling through DNA basepairs has become more important due to its potential application in DNA sequencing technology. The goal is to recognize and identify a specific DNA base by measuring the hydrogen bond mediated tunneling current across a DNA basepair junction. In this talk, we discuss the results of density functional theory on the intrinsic conduction through DNA basepairs (Watson-Crick basepairs, Wobble basepairs, etc), and in particular the role of the hydrogen bond on the tunneling current.

  17. Operation of a DNA-Based Autocatalytic Network in Serum

    NASA Astrophysics Data System (ADS)

    Graugnard, Elton; Cox, Amber; Lee, Jeunghoon; Jorcyk, Cheryl; Yurke, Bernard; Hughes, William L.

    The potential for inferring the presence of cancer by the detection of miRNA in human blood has motivated research into the design and operation of DNA-based chemical amplifiers that can operate in bodily fluids. As a first step toward this goal, we have tested the operation of a DNA-based autocatalytic network in human serum and mouse serum. With the addition of sodium dodecyl sulfate to prevent degradation by nuclease activity, the network was found to operate successfully with both DNA and RNA catalysts.

  18. Developmental self-assembly of a DNA tetrahedron.

    PubMed

    Sadowski, John P; Calvert, Colby R; Zhang, David Yu; Pierce, Niles A; Yin, Peng

    2014-04-22

    Kinetically controlled isothermal growth is fundamental to biological development, yet it remains challenging to rationally design molecular systems that self-assemble isothermally into complex geometries via prescribed assembly and disassembly pathways. By exploiting the programmable chemistry of base pairing, sophisticated spatial and temporal control have been demonstrated in DNA self-assembly, but largely as separate pursuits. By integrating temporal with spatial control, here we demonstrate the "developmental" self-assembly of a DNA tetrahedron, where a prescriptive molecular program orchestrates the kinetic pathways by which DNA molecules isothermally self-assemble into a well-defined three-dimensional wireframe geometry. In this reaction, nine DNA reactants initially coexist metastably, but upon catalysis by a DNA initiator molecule, navigate 24 individually characterizable intermediate states via prescribed assembly pathways, organized both in series and in parallel, to arrive at the tetrahedral final product. In contrast to previous work on dynamic DNA nanotechnology, this developmental program coordinates growth of ringed substructures into a three-dimensional wireframe superstructure, taking a step toward the goal of kinetically controlled isothermal growth of complex three-dimensional geometries.

  19. Passive entry of a DNA molecule into a small pore

    PubMed Central

    de Gennes, Pierre-Gilles

    1999-01-01

    I consider a vesicle with an open pore of small radius rp, exposed to a DNA solution. The crucial moment is the entry, when a chain end faces the pore and enters it. I discuss qualitatively the following three characteristic times: (i) the duration of the entry of one chain end (defining the minimum lifetime of the pore) τe ∼ 10−4 sec, (ii) the transfection time τt (the time required to be sure that one chain has gone in) τt ∼ hours, and (iii) the sliding time τS (the time between entry of one end and entry of the other end) ∼ 1 sec. A fortunate feature is that sliding may proceed even if the pore tends to close itself after entry. PMID:10377402

  20. Reversible structural switching of a DNA-DDAB film.

    PubMed

    Neumann, Thorsten; Gajria, Surekha; Tirrell, Matthew; Jaeger, Luc

    2009-03-18

    We describe the novel structure and behavior of a DNA-DDAB complex film cast from an organic solvent and exhibiting a structural switching transition as it is dried or wetted with water. The film was easily prepared by formation of a complex between the negatively charged phosphate groups of DNA and the positively charged headgroup of the surfactant DDAB. This complex was then purified, dried, dissolved in 2-propanol, and cast onto a glass slide to form a self-standing film by means of slow evaporation. While the structure of the dried film was found to be composed of single-stranded DNA and a monolayer of DDAB, upon hydration of the film, the structure switched to double-stranded DNA complexed to a bilayer of DDAB. We expect this phenomenon to serve as a useful model for the design of new responsive materials and programmable self-assembly.

  1. Strandwise translocation of a DNA glycosylase on undamaged DNA

    SciTech Connect

    Qi, Yan; Nam, Kwangho; Spong, Marie C.; Banerjee, Anirban; Sung, Rou-Jia; Zhang, Michael; Karplus, Martin; Verdine, Gregory L.

    2012-05-14

    Base excision repair of genotoxic nucleobase lesions in the genome is critically dependent upon the ability of DNA glycosylases to locate rare sites of damage embedded in a vast excess of undamaged DNA, using only thermal energy to fuel the search process. Considerable interest surrounds the question of how DNA glycosylases translocate efficiently along DNA while maintaining their vigilance for target damaged sites. Here, we report the observation of strandwise translocation of 8-oxoguanine DNA glycosylase, MutM, along undamaged DNA. In these complexes, the protein is observed to translocate by one nucleotide on one strand while remaining untranslocated on the complementary strand. We further report that alterations of single base-pairs or a single amino acid substitution (R112A) can induce strandwise translocation. Molecular dynamics simulations confirm that MutM can translocate along DNA in a strandwise fashion. These observations reveal a previously unobserved mode of movement for a DNA-binding protein along the surface of DNA.

  2. Reversibly switching the surface porosity of a DNA tetrahedron.

    PubMed

    Zhang, Chuan; Tian, Cheng; Li, Xiang; Qian, Hang; Hao, Chenhui; Jiang, Wen; Mao, Chengde

    2012-07-25

    The ability to reversibly switch the surface porosity of nanocages would allow controllable matter transport in and out of the nanocages. This would be a desirable property for many technological applications, such as drug delivery. To achieve such capability, however, is challenging. Herein we report a strategy for reversibly changing the surface porosity of a self-assembled DNA nanocage (a DNA tetrahedron) that is based on DNA hydridization and strand displacement. The involved DNA nanostructures were thoroughly characterized by multiple techniques, including polyacrylamide gel electrophoresis, dynamic light scattering, atomic force microscopy, and cryogenic electron microscopy. This work may lead to the design and construction of stimuli-responsive nanocages that might find applications as smart materials.

  3. A DNA enzyme with N-glycosylase activity

    NASA Technical Reports Server (NTRS)

    Sheppard, T. L.; Ordoukhanian, P.; Joyce, G. F.

    2000-01-01

    In vitro evolution was used to develop a DNA enzyme that catalyzes the site-specific depurination of DNA with a catalytic rate enhancement of about 10(6)-fold. The reaction involves hydrolysis of the N-glycosidic bond of a particular deoxyguanosine residue, leading to DNA strand scission at the apurinic site. The DNA enzyme contains 93 nucleotides and is structurally complex. It has an absolute requirement for a divalent metal cation and exhibits optimal activity at about pH 5. The mechanism of the reaction was confirmed by analysis of the cleavage products by using HPLC and mass spectrometry. The isolation and characterization of an N-glycosylase DNA enzyme demonstrates that single-stranded DNA, like RNA and proteins, can form a complex tertiary structure and catalyze a difficult biochemical transformation. This DNA enzyme provides a new approach for the site-specific cleavage of DNA molecules.

  4. A DNA enzyme with N-glycosylase activity

    NASA Technical Reports Server (NTRS)

    Sheppard, T. L.; Ordoukhanian, P.; Joyce, G. F.

    2000-01-01

    In vitro evolution was used to develop a DNA enzyme that catalyzes the site-specific depurination of DNA with a catalytic rate enhancement of about 10(6)-fold. The reaction involves hydrolysis of the N-glycosidic bond of a particular deoxyguanosine residue, leading to DNA strand scission at the apurinic site. The DNA enzyme contains 93 nucleotides and is structurally complex. It has an absolute requirement for a divalent metal cation and exhibits optimal activity at about pH 5. The mechanism of the reaction was confirmed by analysis of the cleavage products by using HPLC and mass spectrometry. The isolation and characterization of an N-glycosylase DNA enzyme demonstrates that single-stranded DNA, like RNA and proteins, can form a complex tertiary structure and catalyze a difficult biochemical transformation. This DNA enzyme provides a new approach for the site-specific cleavage of DNA molecules.

  5. Recognition Imaging of Acetylated Chromatin Using a DNA Aptamer

    PubMed Central

    Lin, Liyun; Fu, Qiang; Williams, Berea A.R.; Azzaz, Abdelhamid M.; Shogren-Knaak, Michael A.; Chaput, John C.; Lindsay, Stuart

    2009-01-01

    Histone acetylation plays an important role in the regulation of gene expression. A DNA aptamer generated by in vitro selection to be highly specific for histone H4 protein acetylated at lysine 16 was used as a recognition element for atomic force microscopy-based recognition imaging of synthetic nucleosomal arrays with precisely controlled acetylation. The aptamer proved to be reasonably specific at recognizing acetylated histones, with recognition efficiencies of 60% on-target and 12% off-target. Though this selectivity is much poorer than the >2000:1 equilibrium specificity of the aptamer, it is a large improvement on the performance of a ChIP-quality antibody, which is not selective at all in this application, and it should permit high-fidelity recognition with repeated imaging. The ability to image the precise location of posttranslational modifications may permit nanometer-scale investigation of their effect on chromatin structure. PMID:19751687

  6. Structure of fluorescent metal clusters on a DNA template.

    NASA Astrophysics Data System (ADS)

    Vdovichev, A. A.; Sych, T. S.; Reveguk, Z. V.; Smirnova, A. A.; Maksimov, D. A.; Ramazanov, R. R.; Kononov, A. I.

    2016-08-01

    Luminescent metal clusters are a subject of growing interest in recent years due to their bright emission from visible to near infrared range. Detailed structure of the fluorescent complexes of Ag and other metal clusters with ligands still remains a challenging task. In this joint experimental and theoretical study we synthesized Ag-DNA complexes on a DNA oligonucleotide emitting in violet- green spectral range. The structure of DNA template was determined by means of various spectral measurements (CD, MS, XPS). Comparison of the experimental fluorescent excitation spectra and calculated absorption spectra for different QM/MM optimized structures allowed us to determine the detailed structure of the green cluster containing three silver atoms in the stem of the DNA hairpin structure stabilized by cytosine-Ag+-cytosine bonds.

  7. A DNA element in the slo gene modulates ethanol tolerance.

    PubMed

    Krishnan, Harish R; Li, Xiaolei; Ghezzi, Alfredo; Atkinson, Nigel S

    2016-03-01

    In Drosophila, the slo gene encodes BK-type Ca(2+)-activated K(+) channels and is involved in producing rapid functional tolerance to sedation with ethanol. Drosophila are ideal for the study of functional ethanol tolerance because the adult does not acquire metabolic ethanol tolerance (Scholz, Ramond, Singh, & Heberlein, 2000). It has been shown that mutations in slo block the capacity to acquire tolerance, that sedation with ethanol vapor induces slo gene expression in the nervous system, and that transgenic induction of slo can phenocopy tolerance (Cowmeadow, Krishnan, & Atkinson, 2005; Cowmeadow et al., 2006). Here we use ethanol-induced histone acetylation to map a DNA regulatory element in the slo transcriptional control region and functionally test the element for a role in producing ethanol tolerance. Histone acetylation is commonly associated with activating transcription factors. We used the chromatin immunoprecipitation assay to map histone acetylation changes following ethanol sedation to identify an ethanol-responsive DNA element. Ethanol sedation induced an increase in histone acetylation over a 60 n DNA element called 6b, which is situated between the two ethanol-responsive neural promoters of the slo gene. Removal of the 6b element from the endogenous slo gene affected the production of functional ethanol tolerance as assayed in an ethanol-vapor recovery from sedation assay. Removal of element 6b extended the period of functional ethanol tolerance from ∼10 days to more than 21 days after a single ethanol-vapor sedation. This study demonstrates that mapping the position of ethanol-induced histone acetylation is an effective way to identify DNA regulatory elements that help to mediate the response of a gene to ethanol. Using this approach, we identified a DNA element, which is conserved among Drosophila species, and which is important for producing a behaviorally relevant ethanol response.

  8. A DNA aptamer recognising a malaria protein biomarker can function as part of a DNA origami assembly.

    PubMed

    Godonoga, Maia; Lin, Ting-Yu; Oshima, Azusa; Sumitomo, Koji; Tang, Marco S L; Cheung, Yee-Wai; Kinghorn, Andrew B; Dirkzwager, Roderick M; Zhou, Cunshan; Kuzuya, Akinori; Tanner, Julian A; Heddle, Jonathan G

    2016-02-19

    DNA aptamers have potential for disease diagnosis and as therapeutics, particularly when interfaced with programmable molecular technology. Here we have combined DNA aptamers specific for the malaria biomarker Plasmodium falciparum lactate dehydrogenase (PfLDH) with a DNA origami scaffold. Twelve aptamers that recognise PfLDH were integrated into a rectangular DNA origami and atomic force microscopy demonstrated that the incorporated aptamers preserve their ability to specifically bind target protein. Captured PfLDH retained enzymatic activity and protein-aptamer binding was observed dynamically using high-speed AFM. This work demonstrates the ability of DNA aptamers to recognise a malaria biomarker whilst being integrated within a supramolecular DNA scaffold, opening new possibilities for malaria diagnostic approaches based on DNA nanotechnology.

  9. A DNA aptamer recognising a malaria protein biomarker can function as part of a DNA origami assembly

    PubMed Central

    Godonoga, Maia; Lin, Ting-Yu; Oshima, Azusa; Sumitomo, Koji; Tang, Marco S. L.; Cheung, Yee-Wai; Kinghorn, Andrew B.; Dirkzwager, Roderick M.; Zhou, Cunshan; Kuzuya, Akinori; Tanner, Julian A.; Heddle, Jonathan G.

    2016-01-01

    DNA aptamers have potential for disease diagnosis and as therapeutics, particularly when interfaced with programmable molecular technology. Here we have combined DNA aptamers specific for the malaria biomarker Plasmodium falciparum lactate dehydrogenase (PfLDH) with a DNA origami scaffold. Twelve aptamers that recognise PfLDH were integrated into a rectangular DNA origami and atomic force microscopy demonstrated that the incorporated aptamers preserve their ability to specifically bind target protein. Captured PfLDH retained enzymatic activity and protein-aptamer binding was observed dynamically using high-speed AFM. This work demonstrates the ability of DNA aptamers to recognise a malaria biomarker whilst being integrated within a supramolecular DNA scaffold, opening new possibilities for malaria diagnostic approaches based on DNA nanotechnology. PMID:26891622

  10. Does a DNA-less cellular organism exist on Earth?

    PubMed

    Hiyoshi, Akira; Miyahara, Kohji; Kato, Chiaki; Ohshima, Yasumi

    2011-12-01

    All the self-reproducing cellular organisms so far examined have DNA as the genome. However, a DNA-less organism carrying an RNA genome is suggested by the fact that many RNA viruses exist and the widespread view that an RNA world existed before the present DNA world. Such a possibility is most plausible in the microbial world where biological diversity is enormous and most organisms have not been identified. We have developed experimental methodology to search DNA-less microorganisms, which is based on cultivation with drugs that inhibit replication or expression of DNA, detection of DNA in colonies with a fluorescent dye and double staining for DNA and RNA at a cellular level. These methods have been applied for about 100 microbial samples from various waters including hot springs, soils including deep sea sediments, and organisms. We found many colonies and cells which apparently looked DNA-less and examined them further. So far, all such colonies that reformed colonies on isolation were identified to be DNA-positive. However, considering the difficulty in cultivation, we think it possible for DNA-less microorganisms to live around us. We believe that our ideas and results will be of interest and useful to discover one in the future. © 2011 The Authors. Journal compilation © 2011 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

  11. Force regulated dynamics of RPA on a DNA fork

    PubMed Central

    Kemmerich, Felix E.; Daldrop, Peter; Pinto, Cosimo; Levikova, Maryna; Cejka, Petr; Seidel, Ralf

    2016-01-01

    Replication protein A (RPA) is a single-stranded DNA binding protein, involved in most aspects of eukaryotic DNA metabolism. Here, we study the behavior of RPA on a DNA substrate that mimics a replication fork. Using magnetic tweezers we show that both yeast and human RPA can open forked DNA when sufficient external tension is applied. In contrast, at low force, RPA becomes rapidly displaced by the rehybridization of the DNA fork. This process appears to be governed by the binding or the release of an RPA microdomain (toehold) of only few base-pairs length. This gives rise to an extremely rapid exchange dynamics of RPA at the fork. Fork rezipping rates reach up to hundreds of base-pairs per second, being orders of magnitude faster than RPA dissociation from ssDNA alone. Additionally, we show that RPA undergoes diffusive motion on ssDNA, such that it can be pushed over long distances by a rezipping fork. Generally the behavior of both human and yeast RPA homologs is very similar. However, in contrast to yeast RPA, the dissociation of human RPA from ssDNA is greatly reduced at low Mg2+ concentrations, such that human RPA can melt DNA in absence of force. PMID:27016742

  12. Probing Nucleosome Stability with a DNA Origami Nanocaliper.

    PubMed

    Le, Jenny V; Luo, Yi; Darcy, Michael A; Lucas, Christopher R; Goodwin, Michelle F; Poirier, Michael G; Castro, Carlos E

    2016-07-26

    The organization of eukaryotic DNA into nucleosomes and chromatin undergoes dynamic structural changes to regulate genome processing, including transcription and DNA repair. Critical chromatin rearrangements occur over a wide range of distances, including the mesoscopic length scale of tens of nanometers. However, there is a lack of methodologies that probe changes over this mesoscopic length scale within chromatin. We have designed, constructed, and implemented a DNA-based nanocaliper that probes this mesoscopic length scale. We developed an approach of integrating nucleosomes into our nanocaliper at two attachment points with over 50% efficiency. Here, we focused on attaching the two DNA ends of the nucleosome to the ends of the two nanocaliper arms, so the hinge angle is a readout of the nucleosome end-to-end distance. We demonstrate that nucleosomes integrated with 6, 26, and 51 bp linker DNA are partially unwrapped by the nanocaliper by an amount consistent with previously observed structural transitions. In contrast, the nucleosomes integrated with the longer 75 bp linker DNA remain fully wrapped. We found that the nanocaliper angle is a sensitive measure of nucleosome disassembly and can read out transcription factor (TF) binding to its target site within the nucleosome. Interestingly, the nanocaliper not only detects TF binding but also significantly increases the probability of TF occupancy at its site by partially unwrapping the nucleosome. These studies demonstrate the feasibility of using DNA nanotechnology to both detect and manipulate nucleosome structure, which provides a foundation of future mesoscale studies of nucleosome and chromatin structural dynamics.

  13. A DNA Barcoding Approach to Characterize Pollen Collected by Honeybees

    PubMed Central

    Bruni, Ilaria; Scaccabarozzi, Daniela; Sandionigi, Anna; Barbuto, Michela; Casiraghi, Maurizio; Labra, Massimo

    2014-01-01

    In the present study, we investigated DNA barcoding effectiveness to characterize honeybee pollen pellets, a food supplement largely used for human nutrition due to its therapeutic properties. We collected pollen pellets using modified beehives placed in three zones within an alpine protected area (Grigna Settentrionale Regional Park, Italy). A DNA barcoding reference database, including rbcL and trnH-psbA sequences from 693 plant species (104 sequenced in this study) was assembled. The database was used to identify pollen collected from the hives. Fifty-two plant species were identified at the molecular level. Results suggested rbcL alone could not distinguish among congeneric plants; however, psbA-trnH identified most of the pollen samples at the species level. Substantial variability in pollen composition was observed between the highest elevation locality (Alpe Moconodeno), characterized by arid grasslands and a rocky substrate, and the other two sites (Cornisella and Ortanella) at lower altitudes. Pollen from Ortanella and Cornisella showed the presence of typical deciduous forest species; however in samples collected at Ortanella, pollen of the invasive Lonicera japonica, and the ornamental Pelargonium x hortorum were observed. Our results indicated pollen composition was largely influenced by floristic local biodiversity, plant phenology, and the presence of alien flowering species. Therefore, pollen molecular characterization based on DNA barcoding might serve useful to beekeepers in obtaining honeybee products with specific nutritional or therapeutic characteristics desired by food market demands. PMID:25296114

  14. A novel method for ABO genotyping using a DNA chip.

    PubMed

    Watanabe, Ken; Ikegaya, Hiroshi; Hirayama, Koichi; Motani, Hisako; Iwase, Hirotaro; Kaneko, Hiroto; Fukushima, Hisayo; Akutsu, Tomoko; Sakurada, Koichi

    2011-01-01

    ABO genotyping is often performed to identify the blood type of decomposed samples, which is difficult to be determined by a serological test. In this study, we developed a simple method for ABO genotyping using a DNA chip. In this method, polymerase chain reaction-amplified and fluorescent-labeled fragments in the ABO gene and primate-specific D17Z1 were hybridized with DNA probes on a chip designed to detect single nucleotide polymorphisms (SNPs) in the ABO gene and part of the D17Z1 sequence. Using blood samples from 42 volunteers and 10 animal species, we investigated whether the chip could be used to detect SNPs in the ABO gene and the D17Z1 sequence. This method was then applied to various forensic samples, and it was confirmed that this method was suitable for the simultaneous analyses of ABO genotyping and species identification. This method fulfills the recent need for the development of rapid and convenient methods for criminal investigations.

  15. A DNA origami nanorobot controlled by nucleic acid hybridization.

    PubMed

    Torelli, Emanuela; Marini, Monica; Palmano, Sabrina; Piantanida, Luca; Polano, Cesare; Scarpellini, Alice; Lazzarino, Marco; Firrao, Giuseppe

    2014-07-23

    A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators.

  16. Arduino-based automation of a DNA extraction system.

    PubMed

    Kim, Kyung-Won; Lee, Mi-So; Ryu, Mun-Ho; Kim, Jong-Won

    2015-01-01

    There have been many studies to detect infectious diseases with the molecular genetic method. This study presents an automation process for a DNA extraction system based on microfluidics and magnetic bead, which is part of a portable molecular genetic test system. This DNA extraction system consists of a cartridge with chambers, syringes, four linear stepper actuators, and a rotary stepper actuator. The actuators provide a sequence of steps in the DNA extraction process, such as transporting, mixing, and washing for the gene specimen, magnetic bead, and reagent solutions. The proposed automation system consists of a PC-based host application and an Arduino-based controller. The host application compiles a G code sequence file and interfaces with the controller to execute the compiled sequence. The controller executes stepper motor axis motion, time delay, and input-output manipulation. It drives the stepper motor with an open library, which provides a smooth linear acceleration profile. The controller also provides a homing sequence to establish the motor's reference position, and hard limit checking to prevent any over-travelling. The proposed system was implemented and its functionality was investigated, especially regarding positioning accuracy and velocity profile.

  17. A DNA barcoding approach to characterize pollen collected by honeybees.

    PubMed

    Galimberti, Andrea; De Mattia, Fabrizio; Bruni, Ilaria; Scaccabarozzi, Daniela; Sandionigi, Anna; Barbuto, Michela; Casiraghi, Maurizio; Labra, Massimo

    2014-01-01

    In the present study, we investigated DNA barcoding effectiveness to characterize honeybee pollen pellets, a food supplement largely used for human nutrition due to its therapeutic properties. We collected pollen pellets using modified beehives placed in three zones within an alpine protected area (Grigna Settentrionale Regional Park, Italy). A DNA barcoding reference database, including rbcL and trnH-psbA sequences from 693 plant species (104 sequenced in this study) was assembled. The database was used to identify pollen collected from the hives. Fifty-two plant species were identified at the molecular level. Results suggested rbcL alone could not distinguish among congeneric plants; however, psbA-trnH identified most of the pollen samples at the species level. Substantial variability in pollen composition was observed between the highest elevation locality (Alpe Moconodeno), characterized by arid grasslands and a rocky substrate, and the other two sites (Cornisella and Ortanella) at lower altitudes. Pollen from Ortanella and Cornisella showed the presence of typical deciduous forest species; however in samples collected at Ortanella, pollen of the invasive Lonicera japonica, and the ornamental Pelargonium x hortorum were observed. Our results indicated pollen composition was largely influenced by floristic local biodiversity, plant phenology, and the presence of alien flowering species. Therefore, pollen molecular characterization based on DNA barcoding might serve useful to beekeepers in obtaining honeybee products with specific nutritional or therapeutic characteristics desired by food market demands.

  18. Generation and Applications of a DNA Aptamer against Gremlin-1.

    PubMed

    Li, Qian; Huo, Yongwei; Guo, Yonghong; Zheng, Xiaoyan; Sun, Wengang; Hao, Zhiming

    2017-04-28

    Gremlin-1, a highly conserved glycosylated and phosphorylated secretory protein, plays important roles in diverse biological processes including early embryonic development, fibrosis, tumorigenesis, and renal pathophysiology. Aptamers, which are RNA or DNA single-stranded oligonucleotides capable of binding specifically to different targets ranging from small organics to whole cells, have potential applications in targeted imaging, diagnosis and therapy. In this study, we obtained a DNA aptamer against Gremlin-1 (G-ap49) using in vitro Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Binding assay and dot-blot showed that G-ap49 had high affinity for Gremlin-1. Further experiments indicated that G-ap49 was quite stable in a cell culture system and could be used in South-Western blot analysis, enzyme-linked aptamer sorbent assay (ELASA), and aptamer-based cytochemistry and histochemistry staining to detect Gremlin-1. Moreover, our study demonstrated that G-ap49 is capable of revealing the subcellular localization of Gremlin-1. These data indicate that G-ap49 can be used as an alternative to antibodies in detecting Gremlin-1.

  19. A DNA methylation fingerprint of 1628 human samples

    PubMed Central

    Fernandez, Agustin F.; Assenov, Yassen; Martin-Subero, Jose Ignacio; Balint, Balazs; Siebert, Reiner; Taniguchi, Hiroaki; Yamamoto, Hiroyuki; Hidalgo, Manuel; Tan, Aik-Choon; Galm, Oliver; Ferrer, Isidre; Sanchez-Cespedes, Montse; Villanueva, Alberto; Carmona, Javier; Sanchez-Mut, Jose V.; Berdasco, Maria; Moreno, Victor; Capella, Gabriel; Monk, David; Ballestar, Esteban; Ropero, Santiago; Martinez, Ramon; Sanchez-Carbayo, Marta; Prosper, Felipe; Agirre, Xabier; Fraga, Mario F.; Graña, Osvaldo; Perez-Jurado, Luis; Mora, Jaume; Puig, Susana; Prat, Jaime; Badimon, Lina; Puca, Annibale A.; Meltzer, Stephen J.; Lengauer, Thomas; Bridgewater, John; Bock, Christoph; Esteller, Manel

    2012-01-01

    Most of the studies characterizing DNA methylation patterns have been restricted to particular genomic loci in a limited number of human samples and pathological conditions. Herein, we present a compromise between an extremely comprehensive study of a human sample population with an intermediate level of resolution of CpGs at the genomic level. We obtained a DNA methylation fingerprint of 1628 human samples in which we interrogated 1505 CpG sites. The DNA methylation patterns revealed show this epigenetic mark to be critical in tissue-type definition and stemness, particularly around transcription start sites that are not within a CpG island. For disease, the generated DNA methylation fingerprints show that, during tumorigenesis, human cancer cells underwent a progressive gain of promoter CpG-island hypermethylation and a loss of CpG methylation in non-CpG-island promoters. Although transformed cells are those in which DNA methylation disruption is more obvious, we observed that other common human diseases, such as neurological and autoimmune disorders, had their own distinct DNA methylation profiles. Most importantly, we provide proof of principle that the DNA methylation fingerprints obtained might be useful for translational purposes by showing that we are able to identify the tumor type origin of cancers of unknown primary origin (CUPs). Thus, the DNA methylation patterns identified across the largest spectrum of samples, tissues, and diseases reported to date constitute a baseline for developing higher-resolution DNA methylation maps and provide important clues concerning the contribution of CpG methylation to tissue identity and its changes in the most prevalent human diseases. PMID:21613409

  20. Untangling taxonomy: a DNA barcode reference library for Canadian spiders.

    PubMed

    Blagoev, Gergin A; deWaard, Jeremy R; Ratnasingham, Sujeevan; deWaard, Stephanie L; Lu, Liuqiong; Robertson, James; Telfer, Angela C; Hebert, Paul D N

    2016-01-01

    Approximately 1460 species of spiders have been reported from Canada, 3% of the global fauna. This study provides a DNA barcode reference library for 1018 of these species based upon the analysis of more than 30,000 specimens. The sequence results show a clear barcode gap in most cases with a mean intraspecific divergence of 0.78% vs. a minimum nearest-neighbour (NN) distance averaging 7.85%. The sequences were assigned to 1359 Barcode index numbers (BINs) with 1344 of these BINs composed of specimens belonging to a single currently recognized species. There was a perfect correspondence between BIN membership and a known species in 795 cases, while another 197 species were assigned to two or more BINs (556 in total). A few other species (26) were involved in BIN merges or in a combination of merges and splits. There was only a weak relationship between the number of specimens analysed for a species and its BIN count. However, three species were clear outliers with their specimens being placed in 11-22 BINs. Although all BIN splits need further study to clarify the taxonomic status of the entities involved, DNA barcodes discriminated 98% of the 1018 species. The present survey conservatively revealed 16 species new to science, 52 species new to Canada and major range extensions for 426 species. However, if most BIN splits detected in this study reflect cryptic taxa, the true species count for Canadian spiders could be 30-50% higher than currently recognized. © 2015 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  1. Development of a DNA vaccine targeting Merkel cell polyomavirus.

    PubMed

    Zeng, Qi; Gomez, Bianca P; Viscidi, Raphael P; Peng, Shiwen; He, Liangmei; Ma, Barbara; Wu, T-C; Hung, Chien-Fu

    2012-02-08

    Merkel cell carcinoma (MCC) is a rare but devastating skin disease that is increasing in incidence within the United States. The poor prognosis of MCC patients and limited understanding of MCC pathogenesis warrants innovative treatments to control MCC. Several lines of evidence have pointed to Merkel cell polyomavirus (MCPyV) as the etiological agent of MCC. In particular, the amino terminus of MCPyV large T antigen (LT) (aa1-258) is expressed in all MCPyV-positive tumors and plays an important role in MCC oncogenesis, rendering it an ideal therapeutic target for vaccination. In the current study, we developed a DNA vaccine encoding MCPyV LT aa1-258 (pcDNA3-LT). Within our pcDNA3-LT DNA vaccine, we identified that MCPyV LT aa136-160 likely contains an LT-specific CD4+ T helper epitope. We have also created an LT-expressing B16/LT tumor model using B16, a murine melanoma cell line, to characterize the potency of our DNA vaccine. Using this tumorigenic B16/LT tumor model, we found that pcDNA3-LT DNA vaccine generates antitumor effects mainly mediated by CD4+ T cells against B16/LT tumors in vaccinated C57BL/6 mice. Thus, immunotherapy using pcDNA3-LT DNA vaccine may represent a promising approach for the control of MCPyV-associated lesions. The B16/LT tumor model further serves as a useful model for testing various vaccine strategies against MCC.

  2. The molecular electrostatic potential and steric accessibility of A-DNA.

    PubMed Central

    Lavery, R; Pullman, B

    1981-01-01

    The molecular electrostatic potential and steric accessibility of A-DNA are computed for base sequences (dG.dC)n and (dA.dT)n. An interpretation of the results in terms of the structure of A-DNA is provided and differences with respect to other forms of DNA, namely B-DNA and Z-DNA, are discussed. PMID:7301586

  3. Autonomous Multistep Organic Synthesis in a Single Isothermal Solution Mediated by a DNA Walker

    PubMed Central

    He, Yu; Liu, David R.

    2010-01-01

    Multistep synthesis in the laboratory typically requires numerous reaction vessels, each containing a different set of reactants. In contrast, cells are capable of performing highly efficient and selective multistep biosynthesis under mild conditions with all reactants simultaneously present in solution. If the latter approach could be applied in the laboratory, it may improve the ease, speed, and efficiency of multistep reaction sequences. Here we show that a DNA mechanical device— a DNA walker moving along a DNA track— can be used to perform a series of amine acylation reactions in a single solution without any external intervention. The multistep products generated by this primitive ribosome mimetic are programmed by the sequence of the DNA track, are unrelated to the structure of DNA, and are formed with speeds and overall yields significantly greater than those previously achieved by multistep DNA-templated small-molecule synthesis. PMID:20935654

  4. Partial purification and characterization of a DNA helicase from chloroplasts of Glycine max.

    PubMed

    Cannon, G C; Heinhorst, S

    1990-09-01

    A DNA helicase activity was detected in extracts of purified chloroplasts from the SB-1 cell line of Glycine max and partially purified by column chromatography on DEAE cellulose, phosphocellulose, and single-stranded DNA cellulose. The chloroplast helicase has a DNA-dependent ATPase activity, and its strand displacement activity is strictly dependent upon the presence of a nucleoside triphosphate and Mg2+ or Mn2+. Strand displacement activity does not require a free unannealed single-strand or replication fork-like structure.

  5. Use PCR and a Single Hair To Produce a "DNA Fingerprint."

    ERIC Educational Resources Information Center

    Campbell, A. Malcolm; And Others

    1997-01-01

    Presents a laboratory procedure that involves students extracting their own DNA from a single hair follicle, using the polymerase chain reaction (PCR) to amplify a polymorphic locus, performing electrophoresis on the PCR products on an agarose gel, and visualizing the alleles to generate a "DNA fingerprint." Discusses theoretical background,…

  6. p53 inhibits DNA replication in vitro in a DNA-binding-dependent manner

    SciTech Connect

    Miller, S.D.; Farmer, G.; Prives, C.

    1995-12-01

    This report discusses new findings that the tumor supressor gene product p53 may play a role as a DNA-binding-dependent regulator of DNA replication. The results were obtained using polyomavirus in replication assays. Details regarding effects on cell growth arrest and transcriptional activation are discussed. 61 refs., 7 figs.

  7. A-DNA and B-DNA: Comparing Their Historical X-Ray Fiber Diffraction Images

    ERIC Educational Resources Information Center

    Lucas, Amand A.

    2008-01-01

    A-DNA and B-DNA are two secondary molecular conformations (among other allomorphs) that double-stranded DNA drawn into a fiber can assume, depending on the relative water content and other chemical parameters of the fiber. They were the first two forms to be observed by X-ray fiber diffraction in the early 1950s, respectively by Wilkins and…

  8. 78 FR 58514 - Availability of an Environmental Assessment for Field Testing of a DNA Immunostimulant

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-24

    ... of a DNA Immunostimulant AGENCY: Animal and Plant Health Inspection Service, USDA. ACTION: Notice of... then to field test, an unlicensed DNA Immunostimulant recommended for reduction in morbidity and.... Product: DNA Immunostimulant. Possible Field Test Locations: Texas, Mississippi, and Georgia for poultry...

  9. Human DNA polymerase α in binary complex with a DNA:DNA template-primer.

    PubMed

    Coloma, Javier; Johnson, Robert E; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K

    2016-04-01

    The Polα/primase complex assembles the short RNA-DNA fragments for priming of lagging and leading strand DNA replication in eukaryotes. As such, the Polα polymerase subunit encounters two types of substrates during primer synthesis: an RNA:DNA helix and a DNA:DNA helix. The engagement of the polymerase subunit with the DNA:DNA helix has been suggested as the of basis for primer termination in eukaryotes. However, there is no structural information on how the Polα polymerase subunit actually engages with a DNA:DNA helix during primer synthesis. We present here the first crystal structure of human Polα polymerase subunit in complex with a DNA:DNA helix. Unexpectedly, we find that portion of the DNA:DNA helix in contact with the polymerase is not in a B-form but in a hybrid A-B form. Almost all of the contacts observed previously with an RNA primer are preserved with a DNA primer--with the same set of polymerase residues tracking the sugar-phosphate backbone of the DNA or RNA primer. Thus, rather than loss of specific contacts, the free energy cost of distorting DNA from B- to hybrid A-B form may augur the termination of primer synthesis in eukaryotes.

  10. A-DNA and B-DNA: Comparing Their Historical X-Ray Fiber Diffraction Images

    ERIC Educational Resources Information Center

    Lucas, Amand A.

    2008-01-01

    A-DNA and B-DNA are two secondary molecular conformations (among other allomorphs) that double-stranded DNA drawn into a fiber can assume, depending on the relative water content and other chemical parameters of the fiber. They were the first two forms to be observed by X-ray fiber diffraction in the early 1950s, respectively by Wilkins and…

  11. Use PCR and a Single Hair To Produce a "DNA Fingerprint."

    ERIC Educational Resources Information Center

    Campbell, A. Malcolm; And Others

    1997-01-01

    Presents a laboratory procedure that involves students extracting their own DNA from a single hair follicle, using the polymerase chain reaction (PCR) to amplify a polymorphic locus, performing electrophoresis on the PCR products on an agarose gel, and visualizing the alleles to generate a "DNA fingerprint." Discusses theoretical background,…

  12. A DNA nanocapsule with aptamer-controlled open-closure function for targeted delivery

    PubMed Central

    2012-01-01

    A DNA capsule fitted with aptamer controlled target sensing has been “woven” using a 7308-base single-stranded DNA “thread” and 196 staple oligonucleotides. The capsule enables logic-gated molecular cargo delivery to targeted cell surfaces. PMID:22679527

  13. Disruption of a Topoisomerase-DNA Cleavage Complex by a DNA Helicase

    NASA Astrophysics Data System (ADS)

    Howard, Michael T.; Neece, Sue H.; Matson, Steven W.; Kreuzer, Kenneth N.

    1994-12-01

    The type II DNA topoisomerases are targets for a variety of chemotherapeutic agents, including the antibacterial quinolones and several families of antitumor drugs. These agents stabilize an enzyme-DNA cleavage complex that consists of the topoisomerase covalently linked to the 5' phosphates of a double-stranded DNA break. Although the drug-stabilized cleavage complex is readily reversible, it can result in cell death by a mechanism that remains uncertain. Here we demonstrate that the action of a DNA helicase can convert the cleavage complex into a nonreversible DNA break by displacing DNA strands from the complex. Formation of a nonreversible DNA break, induced by a DNA helicase, could explain the cytotoxicity of these topoisomerase poisons.

  14. Ab initio study of electron transport in dry poly(G)-poly(C) A -DNA strands

    NASA Astrophysics Data System (ADS)

    Pemmaraju, C. D.; Rungger, I.; Chen, X.; Rocha, A. R.; Sanvito, S.

    2010-09-01

    The bias-dependent transport properties of short poly(G)-poly(C) A -DNA strands attached to Au electrodes are investigated with first-principles electronic-transport methods. By using the nonequilibrium Green’s function approach combined with self-interaction-corrected density-functional theory, we calculate the fully self-consistent coherent I-V curve of various double-strand polymeric DNA fragments. We show that electronic wave-function localization, induced either by the native electrical dipole and/or by the electrostatic disorder originating from the first few water solvation layers, drastically suppresses the magnitude of the elastic conductance of A -DNA oligonucleotides. We then argue that electron transport through DNA is the result of sequence-specific short-range tunneling across a few bases combined with general diffusive/inelastic processes.

  15. Ancient pathogens in museal dry bone specimens: analysis of paleocytology and aDNA.

    PubMed

    Gaul, Johanna Sophia; Winter, Eduard; Grossschmidt, Karl

    2015-04-01

    Bone samples investigated in this study derive from the pathologic-anatomical collection of the Natural History Museum of Vienna. In order to explore the survival of treponemes and treponemal ancient DNA in museal dry bone specimens, we analyzed three individuals known to have been infected with Treponema pallidum pallidum. No reproducible evidence of surviving pathogen's ancient DNA (aDNA) was obtained, despite the highly sensitive extraction and amplification techniques (TPP15 and arp). Additionally, decalcification fluid of bone sections was smear stained with May-Gruenwald-Giemsa. The slides were examined using direct light microscope and dark field illumination. Remnants of spirochetal structures were detectable in every smear. Our results demonstrate that aDNA is unlikely to survive, but spirochetal remains are stainable and thus detectable.

  16. Identification of a DNA polymerase β-like form in Drosophila melanogaster adult flies

    PubMed Central

    Furia, Maria; Polito, Lino C.; Locorotondo, Giovanni; Grippo, Pasquale

    1979-01-01

    DNA polymerase β is widely distributed in the eukariotes. So far, few examples are known in which a DNA polymerase α -like form alone is reported. Surprisingly, DNA polymerase β was not detected in Drosophila embryos, while it is present in the cells of multicellular species from sponge to mammals. In view of the relevance of Drosophila as a model biological system for studying the role of the various DNA metabolism enzymes in vivo we have reinvestigated the presence of the DNA polymerase β-like form in Drosophila adult flies. Here we report the occurrence in Drosophila melanogaster adult flies of a DNA polymerase activity that, for its NEM1 resistance, template specificity, sensitivity to ddTTP, sedimentation coefficient and nuclear localization can be classified as a β-like form. PMID:113777

  17. Probing physical properties of a DNA-protein complex using nanofluidic channels.

    PubMed

    Frykholm, Karolin; Alizadehheidari, Mohammadreza; Fritzsche, Joachim; Wigenius, Jens; Modesti, Mauro; Persson, Fredrik; Westerlund, Fredrik

    2014-03-12

    A method to investigate physical properties of a DNA-protein complex in solution is demonstrated. By using tapered nanochannels and lipid passivation the persistence length of a RecA filament formed on double-stranded DNA is determined to 1.15 μm, in agreement with the literature, without attaching protein or DNA to any handles or surfaces. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. A DNA Crystal Designed to Contain Two Molecules per Asymmetric Unit

    SciTech Connect

    T Wang; R Sha; J Birktoft; J Zheng; C Mao; N Seeman

    2011-12-31

    We describe the self-assembly of a DNA crystal that contains two tensegrity triangle molecules per asymmetric unit. We have used X-ray crystallography to determine its crystal structure. In addition, we have demonstrated control over the colors of the crystals by attaching either Cy3 dye (pink) or Cy5 dye (blue-green) to the components of the crystal, yielding crystals of corresponding colors. Attaching the pair of dyes to the pair of molecules yields a purple crystal.

  19. From a structural average to the conformational ensemble of a DNA bulge

    PubMed Central

    Shi, Xuesong; Beauchamp, Kyle A.; Harbury, Pehr B.; Herschlag, Daniel

    2014-01-01

    Direct experimental measurements of conformational ensembles are critical for understanding macromolecular function, but traditional biophysical methods do not directly report the solution ensemble of a macromolecule. Small-angle X-ray scattering interferometry has the potential to overcome this limitation by providing the instantaneous distance distribution between pairs of gold-nanocrystal probes conjugated to a macromolecule in solution. Our X-ray interferometry experiments reveal an increasing bend angle of DNA duplexes with bulges of one, three, and five adenosine residues, consistent with previous FRET measurements, and further reveal an increasingly broad conformational ensemble with increasing bulge length. The distance distributions for the AAA bulge duplex (3A-DNA) with six different Au-Au pairs provide strong evidence against a simple elastic model in which fluctuations occur about a single conformational state. Instead, the measured distance distributions suggest a 3A-DNA ensemble with multiple conformational states predominantly across a region of conformational space with bend angles between 24 and 85 degrees and characteristic bend directions and helical twists and displacements. Additional X-ray interferometry experiments revealed perturbations to the ensemble from changes in ionic conditions and the bulge sequence, effects that can be understood in terms of electrostatic and stacking contributions to the ensemble and that demonstrate the sensitivity of X-ray interferometry. Combining X-ray interferometry ensemble data with molecular dynamics simulations gave atomic-level models of representative conformational states and of the molecular interactions that may shape the ensemble, and fluorescence measurements with 2-aminopurine-substituted 3A-DNA provided initial tests of these atomistic models. More generally, X-ray interferometry will provide powerful benchmarks for testing and developing computational methods. PMID:24706812

  20. Development of a diagnostic test for Johne's disease using a DNA hybridization probe.

    PubMed Central

    Hurley, S S; Splitter, G A; Welch, R A

    1989-01-01

    A DNA probe, M13 mpHAW71, that detects Mycobacterium paratuberculosis in the fecal material of infected animals was developed for use in the diagnosis of Johne's disease. The probe detected as few as 10(5) M. paratuberculosis when hybridized under stringent conditions to total genomic DNA purified from bovine fecal material. When the probe was used diagnostically, it did not differentiate members of the Mycobacterium avium-M. intracellulare-M. paratuberculosis complex. Compared with culturing, the DNA probe identified 34.4% more mycobacterium-containing fecal samples, and testing took only 72 h to complete. Images PMID:2768445

  1. A DNA-binding protein from Ustilago maydis prefers duplex DNA without chain interruptions.

    PubMed Central

    Rusche, J R; Holloman, W K

    1983-01-01

    Using a nitrocellulose filter binding assay, we have partially purified a protein from mitotic cells of Ustilago maydis that binds preferentially to covalently closed circular duplex DNA. DNA containing single- or double-strand breaks is bound poorly by the protein. Once formed, the DNA-protein complex is stable, resisting dissociation in high salt. However, when a DNA strand is broken, the complex appears to dissociate. The protein binds equally well to form I DNA of phi X174 or the plasmid pBR322, but has a higher affinity for a hybrid plasmid containing a cloned region of Drosophila melanogaster satellite DNA. Images PMID:6304499

  2. Improved Production of l-Threonine in Escherichia coli by Use of a DNA Scaffold System

    PubMed Central

    Lee, Jun Hyoung; Jung, Suk-Chae; Bui, Le Minh; Kang, Kui Hyeon; Song, Ji-Joon

    2013-01-01

    Despite numerous approaches for the development of l-threonine-producing strains, strain development is still hampered by the intrinsic inefficiency of metabolic reactions caused by simple diffusion and random collisions of enzymes and metabolites. A scaffold system, which can promote the proximity of metabolic enzymes and increase the local concentration of intermediates, was reported to be one of the most promising solutions. Here, we report an improvement in l-threonine production in Escherichia coli using a DNA scaffold system, in which a zinc finger protein serves as an adapter for the site-specific binding of each enzyme involved in l-threonine production to a precisely ordered location on a DNA double helix to increase the proximity of enzymes and the local concentration of metabolites to maximize production. The optimized DNA scaffold system for l-threonine production significantly increased the efficiency of the threonine biosynthetic pathway in E. coli, substantially reducing the production time for l-threonine (by over 50%). In addition, this DNA scaffold system enhanced the growth rate of the host strain by reducing the intracellular concentration of toxic intermediates, such as homoserine. Our DNA scaffold system can be used as a platform technology for the construction and optimization of artificial metabolic pathways as well as for the production of many useful biomaterials. PMID:23160128

  3. Structural insight into negative DNA supercoiling by DNA gyrase, a bacterial type 2A DNA topoisomerase.

    PubMed

    Papillon, Julie; Ménétret, Jean-François; Batisse, Claire; Hélye, Reynald; Schultz, Patrick; Potier, Noëlle; Lamour, Valérie

    2013-09-01

    Type 2A DNA topoisomerases (Topo2A) remodel DNA topology during replication, transcription and chromosome segregation. These multisubunit enzymes catalyze the transport of a double-stranded DNA through a transient break formed in another duplex. The bacterial DNA gyrase, a target for broad-spectrum antibiotics, is the sole Topo2A enzyme able to introduce negative supercoils. We reveal here for the first time the architecture of the full-length Thermus thermophilus DNA gyrase alone and in a cleavage complex with a 155 bp DNA duplex in the presence of the antibiotic ciprofloxacin, using cryo-electron microscopy. The structural organization of the subunits of the full-length DNA gyrase points to a central role of the ATPase domain acting like a 'crossover trap' that may help to sequester the DNA positive crossover before strand passage. Our structural data unveil how DNA is asymmetrically wrapped around the gyrase-specific C-terminal β-pinwheel domains and guided to introduce negative supercoils through cooperativity between the ATPase and β-pinwheel domains. The overall conformation of the drug-induced DNA binding-cleavage complex also suggests that ciprofloxacin traps a DNA pre-transport conformation.

  4. Structural insight into negative DNA supercoiling by DNA gyrase, a bacterial type 2A DNA topoisomerase

    PubMed Central

    Papillon, Julie; Ménétret, Jean-François; Batisse, Claire; Hélye, Reynald; Schultz, Patrick; Potier, Noëlle; Lamour, Valérie

    2013-01-01

    Type 2A DNA topoisomerases (Topo2A) remodel DNA topology during replication, transcription and chromosome segregation. These multisubunit enzymes catalyze the transport of a double-stranded DNA through a transient break formed in another duplex. The bacterial DNA gyrase, a target for broad-spectrum antibiotics, is the sole Topo2A enzyme able to introduce negative supercoils. We reveal here for the first time the architecture of the full-length Thermus thermophilus DNA gyrase alone and in a cleavage complex with a 155 bp DNA duplex in the presence of the antibiotic ciprofloxacin, using cryo-electron microscopy. The structural organization of the subunits of the full-length DNA gyrase points to a central role of the ATPase domain acting like a ‘crossover trap’ that may help to sequester the DNA positive crossover before strand passage. Our structural data unveil how DNA is asymmetrically wrapped around the gyrase-specific C-terminal β-pinwheel domains and guided to introduce negative supercoils through cooperativity between the ATPase and β-pinwheel domains. The overall conformation of the drug-induced DNA binding–cleavage complex also suggests that ciprofloxacin traps a DNA pre-transport conformation. PMID:23804759

  5. A DNA vaccine against dolphin morbillivirus is immunogenic in bottlenose dolphins.

    PubMed

    Vaughan, Kerrie; Del Crew, Jason; Hermanson, Gary; Wloch, Mary K; Riffenburgh, Robert H; Smith, Cynthia R; Van Bonn, William G

    2007-12-15

    The immunization of exotic species presents considerable challenges. Nevertheless, for facilities like zoos, animal parks, government facilities and non-profit conservation groups, the protection of valuable and endangered species from infectious disease is a growing concern. The rationale for immunization in these species parallels that for human and companion animals; to decrease the incidence of disease. The U.S. Navy Marine Mammal Program, in collaboration with industry and academic partners, has developed and evaluated a DNA vaccine targeting a marine viral pathogen - dolphin morbillivirus (DMV). The DMV vaccine consists of the fusion (F) and hemagglutinin (H) genes of DMV. Vaccine constructs (pVR-DMV-F and pVR-DMV-H) were evaluated for expression in vitro and then for immunogenicity in mice. Injection protocols were designed for application in Atlantic bottlenose dolphins (Tursiops truncatus) to balance vaccine effectiveness with clinical utility. Six dolphins were inoculated, four animals received both pDMV-F and pDMV-H and two animals received a mock vaccine (vector alone). All animals received an inoculation week 0, followed by two booster injections weeks 8 and 14. Vaccine-specific immune responses were documented in all four vaccinated animals. To our knowledge, this is the first report of pathogen-specific immunogenicity to a DNA vaccine in an aquatic mammal species.

  6. Designing and Development of a DNA Vaccine Based On Structural Proteins of Hepatitis C Virus

    PubMed Central

    Teimourpour, Roghayeh; Tajani, Amineh Sadat; Askari, Vahid Reza; Rostami, Sina; Meshkat, Zahra

    2016-01-01

    Background: Hepatitis C virus (HCV) infection is one of the most prevalent infectious diseases responsible for high morbidity and mortality worldwide. Therefore, designing new and effective therapeutics is of great importance. The aim of the current study was to construct a DNA vaccine containing structural proteins of HCV and evaluation of its expression in a eukaryotic system. Methods: Structural proteins of HCV (core, E1, and E2) were isolated and amplified from JFH strain of HCV genotype 2a using PCR method. The PCR product was cloned into pCDNA3.1 (+) vector and finally were confirmed by restriction enzyme analysis and sequencing methods. The eukaryotic expression of the vector was confirmed by RT-PCR. Results: A recombinant vector containing 2241bp fragment of HCV structural genes was constructed. The desired plasmid was sequenced and corresponded to 100% identity with the submitted sequences in GenBank. RT-PCR results indicated that the recombinant plasmid could be expressed efficiently in the eukaryotic expression system. Conclusion: Successful cloning of structural viral genes in pCDNA3.1 (+) vector and their expression in the eukaryotic expression system facilitates the development of new DNA vaccines against HCV. A DNA vaccine encoding core-E1-E2 antigens was designed. The desired expression vector can be used for further attempts in the development of vaccines. PMID:27799971

  7. A-DNA and B-DNA: Comparing Their Historical X-ray Fiber Diffraction Images

    NASA Astrophysics Data System (ADS)

    Lucas, Amand A.

    2008-05-01

    A-DNA and B-DNA are two secondary molecular conformations (among other allomorphs) that double-stranded DNA drawn into a fiber can assume, depending on the relative water content and other chemical parameters of the fiber. They were the first two forms to be observed by X-ray fiber diffraction in the early 1950s, respectively by Wilkins and Gosling and by Franklin and Gosling. Their corresponding historical diffraction diagrams played an equally crucial role in the discovery of the primary double-helical structure of the DNA molecule by Watson and Crick in 1953. This paper provides a comparative explanation of the structural content of the two diagrams treated on the same footing. The analysis of the diagrams is supported by the optical transform method with which both A-DNA and B-DNA X-ray images can be simulated optically. The simulations use a simple laser pointer and a dozen optical diffraction gratings, all held on a single diffraction slide. The gratings have been specially designed to pinpoint just which of the structural elements of the molecule is responsible for each of the revealing features of the fiber diffraction images.

  8. Purification and characterization of a DNA polymerase from the cyanobacterium Anacystis nidulans R2.

    PubMed

    Lin, H J; Cannon, G C; Heinhorst, S

    1990-11-25

    A DNA polymerase has been highly purified from Anacystis nidulans R2. Electrophoretic analysis in sodium dodecyl sulfate-polyacrylamide gels revealed that the final fraction contains three bands of Mr 107,000, 93,000, and 51,000, respectively. Analysis of purified DNA polymerase activity in situ indicates that of the three polypeptides the Mr 107,000 species has the catalytic activities. The native molecular weight of the enzyme was estimated by glycerol gradient sedimentation to be 100,000. The enzyme has an absolute requirement for a divalent cation. Mg2+ can be replaced with Mn2+, but the DNA polymerase is less active. Potassium chloride stimulates the enzyme, while potassium phosphate has no apparent effect. The enzyme is active over a pH range from 7.5 to 9.5 in 50mM Tris-HCl buffer. The ability of the cyanobacterial DNA polymerase to use activated DNA as a template, its associated 3'----5' and 5'----3' exonuclease activities, as well as its resistance to N-ethylmaleimide, dideoxynucleotides, arabinosyl-CTP and aphidicolin suggest a similarity between this enzyme and E. coli DNA polymerase I. This is the first characterization of a DNA polymerase from a cyanobacterium.

  9. Purification and characterization of a DNA polymerase from the cyanobacterium Anacystis nidulans R2.

    PubMed Central

    Lin, H J; Cannon, G C; Heinhorst, S

    1990-01-01

    A DNA polymerase has been highly purified from Anacystis nidulans R2. Electrophoretic analysis in sodium dodecyl sulfate-polyacrylamide gels revealed that the final fraction contains three bands of Mr 107,000, 93,000, and 51,000, respectively. Analysis of purified DNA polymerase activity in situ indicates that of the three polypeptides the Mr 107,000 species has the catalytic activities. The native molecular weight of the enzyme was estimated by glycerol gradient sedimentation to be 100,000. The enzyme has an absolute requirement for a divalent cation. Mg2+ can be replaced with Mn2+, but the DNA polymerase is less active. Potassium chloride stimulates the enzyme, while potassium phosphate has no apparent effect. The enzyme is active over a pH range from 7.5 to 9.5 in 50mM Tris-HCl buffer. The ability of the cyanobacterial DNA polymerase to use activated DNA as a template, its associated 3'----5' and 5'----3' exonuclease activities, as well as its resistance to N-ethylmaleimide, dideoxynucleotides, arabinosyl-CTP and aphidicolin suggest a similarity between this enzyme and E. coli DNA polymerase I. This is the first characterization of a DNA polymerase from a cyanobacterium. Images PMID:2123541

  10. Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.

    PubMed

    van Loenhout, Marijn T J; De Vlaminck, Iwijn; Flebus, Benedetta; den Blanken, Johan F; Zweifel, Ludovit P; Hooning, Koen M; Kerssemakers, Jacob W J; Dekker, Cees

    2013-01-01

    The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.

  11. Scanning a DNA Molecule for Bound Proteins Using Hybrid Magnetic and Optical Tweezers

    PubMed Central

    van Loenhout, Marijn T. J.; De Vlaminck, Iwijn; Flebus, Benedetta; den Blanken, Johan F.; Zweifel, Ludovit P.; Hooning, Koen M.; Kerssemakers, Jacob W. J.; Dekker, Cees

    2013-01-01

    The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ∼17 nm spatial resolution. An offset of 33±5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions. PMID:23755219

  12. Building a DNA barcode library of Alaska's non-marine arthropods.

    PubMed

    Sikes, Derek S; Bowser, Matthew; Morton, John M; Bickford, Casey; Meierotto, Sarah; Hildebrandt, Kyndall

    2017-03-01

    Climate change may result in ecological futures with novel species assemblages, trophic mismatch, and mass extinction. Alaska has a limited taxonomic workforce to address these changes. We are building a DNA barcode library to facilitate a metabarcoding approach to monitoring non-marine arthropods. Working with the Canadian Centre for DNA Barcoding, we obtained DNA barcodes from recently collected and authoritatively identified specimens in the University of Alaska Museum (UAM) Insect Collection and the Kenai National Wildlife Refuge collection. We submitted tissues from 4776 specimens, of which 81% yielded DNA barcodes representing 1662 species and 1788 Barcode Index Numbers (BINs), of primarily terrestrial, large-bodied arthropods. This represents 84% of the species available for DNA barcoding in the UAM Insect Collection. There are now 4020 Alaskan arthropod species represented by DNA barcodes, after including all records in Barcode of Life Data Systems (BOLD) of species that occur in Alaska - i.e., 48.5% of the 8277 Alaskan, non-marine-arthropod, named species have associated DNA barcodes. An assessment of the identification power of the library in its current state yielded fewer species-level identifications than expected, but the results were not discouraging. We believe we are the first to deliberately begin development of a DNA barcode library of the entire arthropod fauna for a North American state or province. Although far from complete, this library will become increasingly valuable as more species are added and costs to obtain DNA sequences fall.

  13. Direct analysis of Holliday junction resolving enzyme in a DNA origami nanostructure

    PubMed Central

    Suzuki, Yuki; Endo, Masayuki; Cañas, Cristina; Ayora, Silvia; Alonso, Juan C.; Sugiyama, Hiroshi; Takeyasu, Kunio

    2014-01-01

    Holliday junction (HJ) resolution is a fundamental step for completion of homologous recombination. HJ resolving enzymes (resolvases) distort the junction structure upon binding and prior cleavage, raising the possibility that the reactivity of the enzyme can be affected by a particular geometry and topology at the junction. Here, we employed a DNA origami nano-scaffold in which each arm of a HJ was tethered through the base-pair hybridization, allowing us to make the junction core either flexible or inflexible by adjusting the length of the DNA arms. Both flexible and inflexible junctions bound to Bacillus subtilis RecU HJ resolvase, while only the flexible junction was efficiently resolved into two duplexes by this enzyme. This result indicates the importance of the structural malleability of the junction core for the reaction to proceed. Moreover, cleavage preferences of RecU-mediated reaction were addressed by analyzing morphology of the reaction products. PMID:24792171

  14. Molecular force spectroscopy with a DNA origami-based nanoscopic force clamp.

    PubMed

    Nickels, Philipp C; Wünsch, Bettina; Holzmeister, Phil; Bae, Wooli; Kneer, Luisa M; Grohmann, Dina; Tinnefeld, Philip; Liedl, Tim

    2016-10-21

    Forces in biological systems are typically investigated at the single-molecule level with atomic force microscopy or optical and magnetic tweezers, but these techniques suffer from limited data throughput and their requirement for a physical connection to the macroscopic world. We introduce a self-assembled nanoscopic force clamp built from DNA that operates autonomously and allows massive parallelization. Single-stranded DNA sections of an origami structure acted as entropic springs and exerted controlled tension in the low piconewton range on a molecular system, whose conformational transitions were monitored by single-molecule Förster resonance energy transfer. We used the conformer switching of a Holliday junction as a benchmark and studied the TATA-binding protein-induced bending of a DNA duplex under tension. The observed suppression of bending above 10 piconewtons provides further evidence of mechanosensitivity in gene regulation.

  15. Ultrasensitive detection of microRNA through rolling circle amplification on a DNA tetrahedron decorated electrode.

    PubMed

    Miao, Peng; Wang, Bidou; Meng, Fanyu; Yin, Jian; Tang, Yuguo

    2015-03-18

    MicroRNAs are a class of evolutionally conserved, small noncoding RNAs involved in the regulation of gene expression and affect a variety of biological processes including cellular differentiation, immunological response, tumor development, and so on. Recently, microRNAs have been identified as promising disease biomarkers. In this work, we have fabricated a novel electrochemical method for ultrasensitive detection of microRNA. Generally, a DNA tetrahedron decorated gold electrode is employed as the recognition interface. Then, hybridizations between DNA tetrahedron, microRNA, and primer probe initiate rolling circle amplification (RCA) on the electrode surface. Silver nanoparticles attached to the RCA products provide significant electrochemical signals and a limit of detection as low as 50 aM is achieved. Moreover, homology microRNA family members with only one or two mismatches can be successfully distinguished. Therefore, this proposed method reveals great advancements toward improved disease diagnosis and prognosis.

  16. A DNA Bubble-Mediated Gene Regulation System Based on Thrombin-Bound DNA Aptamers.

    PubMed

    Wang, Jing; Yang, Le; Cui, Xun; Zhang, Zhe; Dong, Lichun; Guan, Ningzi

    2017-05-19

    We describe here a novel approach to enhance the transcription of a target gene in cell-free systems by symmetrically introducing duplex aptamers upstream to a T7 promoter in both the sense and antisense strands of double-stranded plasmids, which leads to the formation of a DNA bubble due to the none-complementary state of the ssDNA region harboring the aptamer sequences. With the presence of thrombins, the DNA bubble would be enlarged due to the binding of aptamers with thrombins. Consequently, the recognition region of the promoter contained in the DNA bubble can be more easily recognized and bound by RNA polymerases, and the separation efficiency of the unwinding region can also be significantly improved, leading to the enhanced expression of the target gene at the transcriptional level. The effectiveness of the proposed gene regulation system was demonstrated by enhancing the expression of gfp and ecaA genes in cell-free systems.

  17. Sequence Discrimination by Alternatively Spliced Isoforms of a DNA Binding Zinc Finger Domain

    NASA Astrophysics Data System (ADS)

    Gogos, Joseph A.; Hsu, Tien; Bolton, Jesse; Kafatos, Fotis C.

    1992-09-01

    Two major developmentally regulated isoforms of the Drosophila chorion transcription factor CF2 differ by an extra zinc finger within the DNA binding domain. The preferred DNA binding sites were determined and are distinguished by an internal duplication of TAT in the site recognized by the isoform with the extra finger. The results are consistent with modular interactions between zinc fingers and trinucleotides and also suggest rules for recognition of AT-rich DNA sites by zinc finger proteins. The results show how modular finger interactions with trinucleotides can be used, in conjunction with alternative splicing, to alter the binding specificity and increase the spectrum of sites recognized by a DNA binding domain. Thus, CF2 may potentially regulate distinct sets of target genes during development.

  18. Regulation at a distance of biomolecular interactions using a DNA origami nanoactuator.

    PubMed

    Ke, Yonggang; Meyer, Travis; Shih, William M; Bellot, Gaetan

    2016-03-18

    The creation of nanometre-sized structures that exhibit controllable motions and functions is a critical step towards building nanomachines. Recent developments in the field of DNA nanotechnology have begun to address these goals, demonstrating complex static or dynamic nanostructures made of DNA. Here we have designed and constructed a rhombus-shaped DNA origami 'nanoactuator' that uses mechanical linkages to copy distance changes induced on one half ('the driver') to be propagated to the other half ('the mirror'). By combining this nanoactuator with split enhanced green fluorescent protein (eGFP), we have constructed a DNA-protein hybrid nanostructure that demonstrates tunable fluorescent behaviours via long-range allosteric regulation. In addition, the nanoactuator can be used as a sensor that responds to specific stimuli, including changes in buffer composition and the presence of restriction enzymes or specific nucleic acids.

  19. Structure of Bacterial LigD -phosphoesterase Unveils a DNA Repair Superfamily

    SciTech Connect

    Nair, P.; Smith, P; Shuman, S

    2010-01-01

    The DNA ligase D (LigD) 3{prime}-phosphoesterase (PE) module is a conserved component of the bacterial nonhomologous end-joining (NHEJ) apparatus that performs 3{prime} end-healing reactions at DNA double-strand breaks. Here we report the 1.9 {angstrom} crystal structure of Pseudomonas aeruginosa PE, which reveals that PE exemplifies a unique class of DNA repair enzyme. PE has a distinctive fold in which an eight stranded {beta} barrel with a hydrophobic interior supports a crescent-shaped hydrophilic active site on its outer surface. Six essential side chains coordinate manganese and a sulfate mimetic of the scissile phosphate. The PE active site and mechanism are unique vis a vis other end-healing enzymes. We find PE homologs in archaeal and eukaryal proteomes, signifying that PEs comprise a DNA repair superfamily.

  20. Direct analysis of Holliday junction resolving enzyme in a DNA origami nanostructure.

    PubMed

    Suzuki, Yuki; Endo, Masayuki; Cañas, Cristina; Ayora, Silvia; Alonso, Juan C; Sugiyama, Hiroshi; Takeyasu, Kunio

    2014-06-01

    Holliday junction (HJ) resolution is a fundamental step for completion of homologous recombination. HJ resolving enzymes (resolvases) distort the junction structure upon binding and prior cleavage, raising the possibility that the reactivity of the enzyme can be affected by a particular geometry and topology at the junction. Here, we employed a DNA origami nano-scaffold in which each arm of a HJ was tethered through the base-pair hybridization, allowing us to make the junction core either flexible or inflexible by adjusting the length of the DNA arms. Both flexible and inflexible junctions bound to Bacillus subtilis RecU HJ resolvase, while only the flexible junction was efficiently resolved into two duplexes by this enzyme. This result indicates the importance of the structural malleability of the junction core for the reaction to proceed. Moreover, cleavage preferences of RecU-mediated reaction were addressed by analyzing morphology of the reaction products.

  1. Molecular simulations of ultra-low-energy nitrogen ion bombardment of A-DNA in vacuum.

    PubMed

    Ngaojampa, Chanisorn; Nimmanpipug, Piyarat; Yu, Liangdeng; Anuntalabhochai, Somboon; Lee, Vannajan Sanghiran

    2010-02-26

    For investigating mechanisms involved in low-energy ion beam induced mutation, besides experiments using low-energy and low-fluence ions to bombard naked DNA, molecular simulations were carried out as an effort towards the insight in molecular interactions between ions and DNA. In the current study, Monte Carlo (MC) and molecular dynamics (MD) simulations were applied. The results of MC simulations provide some clues about the interaction energies and sites of preference of N-ion bombardment on an A-DNA short duplex strand. MD simulations of a single N-ion moving towards the same DNA strand with different linear velocities corresponding to bombardment energies of 0.1, 1, 10 and 100 eV revealed information about changes in bond lengths and visibly distorted structures of bombarded nucleotides. The simulations demonstrated that ion-bombardment-induced DNA change in structure was not a random but preferential effect. Copyright 2009 Elsevier Inc. All rights reserved.

  2. Yeast redoxyendonuclease, a DNA repair enzyme similar to Escherichia coli endonuclease III

    SciTech Connect

    Gossett, J.; Lee, K.; Cunningham, R.P.; Doetsch, P.W.

    1988-04-05

    A DNA repair endonuclease (redoxyendonuclease) was isolated from bakers' yeast (Saccharomyces cerevisiae). The enzyme has been purified by a series of column chromatography steps and cleaves OsO/sub 4/-damaged, double-stranded DNA at sites of thymine glycol and heavily UV-irradiated DNA at sites of cytosine, thymine, and guanine photoproducts. The base specificity and mechanism of phosphodiester bond cleavage for the yeast redoxyendonuclease appear to be identical with those of Escherichia coli endonuclease III when thymine glycol containing, end-labeled DNA fragments of defined sequence are employed as substrates. Yeast redoxyendonuclease has an apparent molecular size of 38,000-42,000 daltons and is active in the absence of divalent metal cations. The identification of such an enzyme in yeast may be of value in the elucidation of the biochemical basis for radiation sensitivity in certain yeast mutants.

  3. Accuracy of the Clinical Diagnosis of Vaginitis Compared to a DNA Probe Laboratory Standard

    PubMed Central

    Lowe, Nancy K.; Neal, Jeremy L.; Ryan-Wenger, Nancy A.

    2009-01-01

    Objective To estimate the accuracy of the clinical diagnosis of the three most common causes of acute vulvovaginal symptoms (bacterial vaginosis, candidiasis vaginitis, and trichomoniasis vaginalis) using a traditional, standardized clinical diagnostic protocol compared to a DNA probe laboratory standard. Methods This prospective clinical comparative study had a sample of 535 active duty United States military women presenting with vulovaginal symptoms. Clinical diagnoses were made by research staff using a standardized protocol of history, physical examination including pelvic examination, determination of vaginal pH, vaginal fluid amines test, and wet-prep microscopy. Vaginal fluid samples were obtained for DNA analysis. The research clinicians were blinded to the DNA results. Results The participants described a presenting symptom of abnormal discharge (50%), itching/irritation (33%), malodor (10%), burning (4%), or others such as vulvar pain and vaginal discomfort. According to laboratory standard, there were 225 cases (42%) of bacterial vaginosis 76 cases (14%) of candidiasis vaginitis, 8 cases (1.5%) of trichomoniasis vaginalis, 87 cases of mixed infections (16%), and 139 negative cases (26%). For each single infection, the clinical diagnosis had a sensitivity and specificity of 80.8% and 70.0% for bacterial vaginosis; 83.8% and 84.8% for candidiasis vaginitis; and 84.6% and 99.6% for trichomoniasis vaginalis when compared to the DNA probe standard. Conclusion Compared to a DNA probe standard, clinical diagnosis is 81-85% sensitive and 70- 99% specific for bacterial vaginosis, candida vaginitis, and trichomoniasis. Even under research conditions that provided clinicians with sufficient time and materials to conduct a thorough and standardized clinical evaluation, the diagnosis and therefore, subsequent treatment of these common vaginal problems remains difficult. PMID:19104364

  4. Arg-Gingipain A DNA Vaccine Induces Protective Immunity against Infection by Porphyromonas gingivalis in a Murine Model

    PubMed Central

    Yonezawa, Hideo; Ishihara, Kazuyuki; Okuda, Katsuji

    2001-01-01

    Arginine-specific cysteine proteinases (RgpA and RgpB) produced by the periodontal pathogen Porphyromonas gingivalis are suspected virulence factors and are involved in interrupting host defense mechanisms as well as in penetrating and destroying periodontal connective tissues. To induce a protective immune response against P. gingivalis, we constructed an rgpA DNA vaccine. BALB/c mice were immunized intradermally by Gene Gun with plasmid DNA carrying rgpA. Antibody responses against P. gingivalis were determined by an enzyme-linked immunosorbent assay. The rgpA DNA vaccine induced high levels of serum antibodies against P. gingivalis. Sera from the rgpA DNA vaccine-immunized mice diminished the proteolytic activity of RgpA and RgpB and inhibited the binding of P. gingivalis to a type I collagen sponge. Moreover, the sera effectively reduced the hemagglutination of P. gingivalis, indicating that the hemagglutinin activity of the organism is associated with RgpA. We found with a murine abscess model that mice immunized with the rgpA DNA vaccine were resistant to an invasive P. gingivalis W50 challenge. These results suggest that the rgpA DNA vaccine induced specific antibodies against the enzyme and that this vaccine could confer protective immunity against P. gingivalis infection. PMID:11292699

  5. Characterization of IS6110 insertions in the dnaA-dnaN intergenic region of Mycobacterium tuberculosis clinical isolates.

    PubMed

    Turcios, L; Casart, Y; Florez, I; de Waard, J; Salazar, L

    2009-02-01

    Mycobacterium tuberculosis isolates with identical IS6110 restriction fragment length polymorphism (RFLP) patterns are considered to be clonally related. The presence of IS6110 in the dnaA-dnaN intergenic region, one preferential locus for the integration of IS6110, was evaluated in 125 M. tuberculosis isolates. Five isolates had IS6110 inserted in this region, and two consisted of a mix of isogenic strains that putatively have evolved during a single infection. Strains from the same isolate had identical spoligo and mycobacterial interspersed repetitive unit-variable-number tandem repeat profiles, but had slight variations in IS6110 RFLP patterns, due to the presence of IS6110 in the dnaA-dnaN intergenic region. Duplication of the dnaA-dnaN intergenic region was found in one isogenic strain.

  6. A DNA-centered explanation of the DNA polymerase translocation mechanism.

    PubMed

    Arias-Gonzalez, J Ricardo

    2017-08-08

    DNA polymerase couples chemical energy to translocation along a DNA template with a specific directionality while it replicates genetic information. According to single-molecule manipulation experiments, the polymerase-DNA complex can work against loads greater than 50 pN. It is not known, on the one hand, how chemical energy is transduced into mechanical motion, accounting for such large forces on sub-nanometer steps, and, on the other hand, how energy consumption in fidelity maintenance integrates in this non-equilibrium cycle. Here, we propose a translocation mechanism that points to the flexibility of the DNA, including its overstretching transition, as the principal responsible for the DNA polymerase ratcheting motion. By using thermodynamic analyses, we then find that an external load hardly affects the fidelity of the copying process and, consequently, that translocation and fidelity maintenance are loosely coupled processes. The proposed translocation mechanism is compatible with single-molecule experiments, structural data and stereochemical details of the DNA-protein complex that is formed during replication, and may be extended to RNA transcription.

  7. Methods for transforming and expression screening of filamentous fungal cells with a DNA library

    DOEpatents

    Teter, Sarah; Lamsa, Michael; Cherry, Joel; Ward, Connie

    2015-06-02

    The present invention relates to methods for expression screening of filamentous fungal transformants, comprising: (a) isolating single colony transformants of a DNA library introduced into E. coli; (b) preparing DNA from each of the single colony E. coli transformants; (c) introducing a sample of each of the DNA preparations of step (b) into separate suspensions of protoplasts of a filamentous fungus to obtain transformants thereof, wherein each transformant contains one or more copies of an individual polynucleotide from the DNA library; (d) growing the individual filamentous fungal transformants of step (c) on selective growth medium, thereby permitting growth of the filamentous fungal transformants, while suppressing growth of untransformed filamentous fungi; and (e) measuring activity or a property of each polypeptide encoded by the individual polynucleotides. The present invention also relates to isolated polynucleotides encoding polypeptides of interest obtained by such methods, to nucleic acid constructs, expression vectors, and recombinant host cells comprising the isolated polynucleotides, and to methods of producing the polypeptides encoded by the isolated polynucleotides.

  8. Polymerization and mechanical properties of single RecA-DNA filaments.

    PubMed

    Hegner, M; Smith, S B; Bustamante, C

    1999-08-31

    The polymerization of individual RecA-DNA filaments, containing either single-stranded or double-stranded DNA, was followed in real time, and their mechanical properties were characterized with force-measuring laser tweezers. It was found that the stretch modulus of a filament is dominated by its (central) DNA component, while its bending rigidity is controlled by its (eccentric) protein component. The longitudinal stiffness of DNA increases 6- to 12-fold when the DNA is contained in the protein helix. Both the stretch modulus and the bending rigidity of a fiber change in the presence of various nucleotide cofactors-e.g., [gamma-thio]ATP, ATP, and ADP-indicating a substantial re-arrangement of spatial relationships between the nucleic acid and the protein scaffold. In particular, when complexed with ATP, a fiber becomes twice as extensible as a [gamma-thio]ATP fiber, suggesting that 32% of the DNA-binding sites have been released in its core. Such release may enable easy rotation of the DNA within the protein helix or slippage of the DNA through the center of the protein helix.

  9. Horses for courses: a DNA-based test for race distance aptitude in thoroughbred racehorses.

    PubMed

    Hill, Emmeline W; Ryan, Donal P; MacHugh, David E

    2012-12-01

    Variation at the myostatin (MSTN) gene locus has been shown to influence racing phenotypes in Thoroughbred horses, and in particular, early skeletal muscle development and the aptitude for racing at short distances. Specifically, a single nucleotide polymorphism (SNP) in the first intron of MSTN (g.66493737C/T) is highly predictive of best race distance among Flat racing Thoroughbreds: homozygous C/C horses are best suited to short distance races, heterozygous C/T horses are best suited to middle distance races, and homozygous T/T horses are best suited to longer distance races. Patent applications for this gene marker association, and other linked markers, have been filed. The information contained within the patent applications is exclusively licensed to the commercial biotechnology company Equinome Ltd, which provides a DNA-based test to the international Thoroughbred horse racing and breeding industry. The application of this information in the industry enables informed decision making in breeding and racing and can be used to assist selection to accelerate the rate of change of genetic types among distinct populations (Case Study 1) and within individual breeding operations (Case Study 2).

  10. A DNA Mini-Barcoding System for Authentication of Processed Fish Products

    PubMed Central

    Shokralla, Shadi; Hellberg, Rosalee S.; Handy, Sara M.; King, Ian; Hajibabaei, Mehrdad

    2015-01-01

    Species substitution is a form of seafood fraud for the purpose of economic gain. DNA barcoding utilizes species-specific DNA sequence information for specimen identification. Previous work has established the usability of short DNA sequences—mini-barcodes—for identification of specimens harboring degraded DNA. This study aims at establishing a DNA mini-barcoding system for all fish species commonly used in processed fish products in North America. Six mini-barcode primer pairs targeting short (127–314 bp) fragments of the cytochrome c oxidase I (CO1) DNA barcode region were developed by examining over 8,000 DNA barcodes from species in the U.S. Food and Drug Administration (FDA) Seafood List. The mini-barcode primer pairs were then tested against 44 processed fish products representing a range of species and product types. Of the 44 products, 41 (93.2%) could be identified at the species or genus level. The greatest mini-barcoding success rate found with an individual primer pair was 88.6% compared to 20.5% success rate achieved by the full-length DNA barcode primers. Overall, this study presents a mini-barcoding system that can be used to identify a wide range of fish species in commercial products and may be utilized in high throughput DNA sequencing for authentication of heavily processed fish products. PMID:26516098

  11. A DNA minor groove electronegative potential genome map based on photo-chemical probing.

    PubMed

    Lindemose, Søren; Nielsen, Peter Eigil; Hansen, Morten; Møllegaard, Niels Erik

    2011-08-01

    The double-stranded DNA of the genome contains both sequence information directly relating to the protein and RNA coding as well as functional and structural information relating to protein recognition. Only recently is the importance of DNA shape in this recognition process being fully appreciated, and it also appears that minor groove electronegative potential may contribute significantly in guiding proteins to their cognate binding sites in the genome. Based on the photo-chemical probing results, we have derived an algorithm that predicts the minor groove electronegative potential in a DNA helix of any given sequence. We have validated this model on a series of protein-DNA binding sites known to involve minor groove electrostatic recognition as well as on stable nucleosome core complexes. The algorithm allows for the first time a full minor groove electrostatic description at the nucleotide resolution of any genome, and it is illustrated how such detailed studies of this sequence dependent, inherent property of the DNA may reflect on genome organization, gene expression and chromosomal condensation.

  12. Head-on collision between a DNA replication apparatus and RNA polymerase transcription complex.

    PubMed

    Liu, B; Alberts, B M

    1995-02-24

    An in vitro system reconstituted from purified proteins has been used to examine what happens when the DNA replication apparatus of bacteriophage T4 collides with an Escherichia coli RNA polymerase ternary transcription complex that is poised to move in the direction opposite to that of the moving replication fork. In the absence of a DNA helicase, the replication fork stalls for many minutes after its encounter with the RNA polymerase. However, when the T4 gene 41 DNA helicase is present, the replication fork passes the RNA polymerase after a pause of a few seconds. This brief pause is longer than the pause observed for a codirectional collision between the same two polymerases, suggesting that there is an inherent disadvantage to having replication and transcription directions oriented head to head. As for a codirectional collision, the RNA polymerase remains competent to resume faithful RNA chain elongation after the DNA replication fork passes; most strikingly, the RNA polymerase has switched from its original template strand to use the newly synthesized daughter DNA strand as the template.

  13. A DNA-Inspired Encryption Methodology for Secure, Mobile Ad Hoc Networks

    NASA Technical Reports Server (NTRS)

    Shaw, Harry

    2012-01-01

    Users are pushing for greater physical mobility with their network and Internet access. Mobile ad hoc networks (MANET) can provide an efficient mobile network architecture, but security is a key concern. A figure summarizes differences in the state of network security for MANET and fixed networks. MANETs require the ability to distinguish trusted peers, and tolerate the ingress/egress of nodes on an unscheduled basis. Because the networks by their very nature are mobile and self-organizing, use of a Public Key Infra structure (PKI), X.509 certificates, RSA, and nonce ex changes becomes problematic if the ideal of MANET is to be achieved. Molecular biology models such as DNA evolution can provide a basis for a proprietary security architecture that achieves high degrees of diffusion and confusion, and resistance to cryptanalysis. A proprietary encryption mechanism was developed that uses the principles of DNA replication and steganography (hidden word cryptography) for confidentiality and authentication. The foundation of the approach includes organization of coded words and messages using base pairs organized into genes, an expandable genome consisting of DNA-based chromosome keys, and a DNA-based message encoding, replication, and evolution and fitness. In evolutionary computing, a fitness algorithm determines whether candidate solutions, in this case encrypted messages, are sufficiently encrypted to be transmitted. The technology provides a mechanism for confidential electronic traffic over a MANET without a PKI for authenticating users.

  14. Breather trapping and breather transmission in a DNA model with an interface

    NASA Astrophysics Data System (ADS)

    Alvarez, A.; Romero, F. R.; Archilla, J. F. R.; Cuevas, J.; Larsen, P. V.

    2006-05-01

    We study the dynamics of moving discrete breathers in an interfaced piecewise DNA molecule. This is a DNA chain in which all the base pairs are identical and there exists an interface such that the base pairs dipole moments at each side are oriented in opposite directions. The Hamiltonian of the Peyrard-Bishop model is augmented with a term that includes the dipole-dipole coupling between base pairs. Numerical simulations show the existence of two dynamical regimes. If the translational kinetic energy of a moving breather launched towards the interface is below a critical value, it is trapped in a region around the interface collecting vibrational energy. For an energy larger than the critical value, the breather is transmitted and continues travelling along the double strand with lower velocity. Reflection phenomena never occur. The same study has been carried out when a single dipole is oriented in opposite direction to the other ones. When moving breathers collide with the single inverted dipole, the same effects appear. These results emphasize the importance of this simple type of local inhomogeneity as it creates a mechanism for the trapping of energy. Finally, the simulations show that, under favorable conditions, several launched moving breathers can be trapped successively at the interface region producing an accumulation of vibrational energy. Moreover, an additional colliding moving breather can produce a saturation of energy and a moving breather with all the accumulated energy is transmitted to the chain.

  15. Selection-by-function: efficient enrichment of cathepsin E inhibitors from a DNA library.

    PubMed

    Naimuddin, Mohammed; Kitamura, Koichirou; Kinoshita, Yasunori; Honda-Takahashi, Yoko; Murakami, Marina; Ito, Masato; Yamamoto, Kenji; Hanada, Kazunori; Husimi, Yuzuru; Nishigaki, Koichi

    2007-01-01

    A method for efficient enrichment of protease inhibitors out of a DNA library was developed by introducing SF-link technology. A two-step selection strategy was designed consisting of the initial enrichment of aptamers based on binding function while the second enrichment step was based on the inhibitory activity to a protease, cathepsin E (CE). The latter was constructed by covalently linking of a biotinylated peptide substrate to each of the ssDNA molecule contained in the preliminarily selected DNA library, generating 'SF-link'. Gradual enrichment of inhibitory DNAs was attained in the course of selection. One molecule, SFR-6-3, showed an IC(50) of around 30 nM, a K(d) of around 15 nM and high selectivity for CE. Sequence and structure analysis revealed a C-rich sequence without any guanine and possibly an i-motif structure, which must be novel to be found in in vitro-selected aptamers. SF-link technology, which is novel as the screening technology, provided a remarkable enrichment of specific protease inhibitors and has a potential to be further developed.

  16. A DNA Mini-Barcoding System for Authentication of Processed Fish Products.

    PubMed

    Shokralla, Shadi; Hellberg, Rosalee S; Handy, Sara M; King, Ian; Hajibabaei, Mehrdad

    2015-10-30

    Species substitution is a form of seafood fraud for the purpose of economic gain. DNA barcoding utilizes species-specific DNA sequence information for specimen identification. Previous work has established the usability of short DNA sequences-mini-barcodes-for identification of specimens harboring degraded DNA. This study aims at establishing a DNA mini-barcoding system for all fish species commonly used in processed fish products in North America. Six mini-barcode primer pairs targeting short (127-314 bp) fragments of the cytochrome c oxidase I (CO1) DNA barcode region were developed by examining over 8,000 DNA barcodes from species in the U.S. Food and Drug Administration (FDA) Seafood List. The mini-barcode primer pairs were then tested against 44 processed fish products representing a range of species and product types. Of the 44 products, 41 (93.2%) could be identified at the species or genus level. The greatest mini-barcoding success rate found with an individual primer pair was 88.6% compared to 20.5% success rate achieved by the full-length DNA barcode primers. Overall, this study presents a mini-barcoding system that can be used to identify a wide range of fish species in commercial products and may be utilized in high throughput DNA sequencing for authentication of heavily processed fish products.

  17. Cross-linking of DNA through HMGA1 suggests a DNA scaffold

    PubMed Central

    Vogel, Benjamin; Löschberger, Anna; Sauer, Markus; Hock, Robert

    2011-01-01

    Binding of proteins to DNA is usually considered 1D with one protein bound to one DNA molecule. In principle, proteins with multiple DNA binding domains could also bind to and thereby cross-link different DNA molecules. We have investigated this possibility using high-mobility group A1 (HMGA1) proteins, which are architectural elements of chromatin and are involved in the regulation of multiple DNA-dependent processes. Using direct stochastic optical reconstruction microscopy (dSTORM), we could show that overexpression of HMGA1a-eGFP in Cos-7 cells leads to chromatin aggregation. To investigate if HMGA1a is directly responsible for this chromatin compaction we developed a DNA cross-linking assay. We were able to show for the first time that HMGA1a can cross-link DNA directly. Detailed analysis using point mutated proteins revealed a novel DNA cross-linking domain. Electron microscopy indicates that HMGA1 proteins are able to create DNA loops and supercoils in linearized DNA confirming the cross-linking ability of HMGA1a. This capacity has profound implications for the spatial organization of DNA in the cell nucleus and suggests cross-linking activities for additional nuclear proteins. PMID:21596776

  18. Average probability that a "cold hit" in a DNA database search results in an erroneous attribution.

    PubMed

    Song, Yun S; Patil, Anand; Murphy, Erin E; Slatkin, Montgomery

    2009-01-01

    We consider a hypothetical series of cases in which the DNA profile of a crime-scene sample is found to match a known profile in a DNA database (i.e., a "cold hit"), resulting in the identification of a suspect based only on genetic evidence. We show that the average probability that there is another person in the population whose profile matches the crime-scene sample but who is not in the database is approximately 2(N - d)p(A), where N is the number of individuals in the population, d is the number of profiles in the database, and p(A) is the average match probability (AMP) for the population. The AMP is estimated by computing the average of the probabilities that two individuals in the population have the same profile. We show further that if a priori each individual in the population is equally likely to have left the crime-scene sample, then the average probability that the database search attributes the crime-scene sample to a wrong person is (N - d)p(A).

  19. A histone modification identifies a DNA element controlling slo BK channel gene expression in muscle

    PubMed Central

    Li, Xiaolei; Ghezzi, Alfredo; Krishnan, Harish R.; Pohl, Jascha B.; Bohm, Arun Y.; Atkinson, Nigel S.

    2016-01-01

    The slo gene encodes BK type Ca2+-activated K+ channels. In Drosophila, expression of slo is induced by organic solvent sedation (benzyl alcohol and ethanol) and this increase in neural slo expression contributes to the production of functional behavioral tolerance (inducible resistance) to these drugs. Within the slo promoter region, we observed that benzyl alcohol sedation produces a localized spike of histone acetylation over a 65 n conserved DNA element called 55b. Changes in histone acetylation are commonly the consequence of transcription factor activity and previously, a localized histone acetylation spike was used to successfully map a DNA element involved in benzyl alcohol-induced slo expression. To determine whether the 55b element was also involved in benzyl alcohol-induced neural expression of slo we deleted it from the endogenous slo gene by homologous recombination. Flies lacking the 55b element were normal with respect to basal and benzyl alcohol-induced neural slo expression, the capacity to acquire and maintain functional tolerance, their threshold for electrically-induced seizures and most slo-related behaviors. Removal of the 55b element did however increase the level of basal expression from the muscle/tracheal cell-specific slo core promoter and produced a slight increase in overall locomotor activity. We conclude that the 55b element is involved in control of slo expression from the muscle and tracheal-cell promoter but is not involved in the production of functional benzyl alcohol tolerance. PMID:25967280

  20. The formation of A-DNA in NaDNA films is suppressed by netropsin.

    PubMed Central

    Fritzsche, H; Brandes, R; Rupprecht, A; Song, Z; Weidlich, T; Kearns, D R

    1992-01-01

    Oriented films of NaDNA complexed with netropsin were studied with deuterium nuclear magnetic resonance (2H NMR), X-ray diffraction and ultraviolet (UV) linear dichroism to obtain information about the influence of netropsin on the structural arrangement of the DNA bases and on the B-A transition. The results of these studies clearly demonstrate a strong suppression of the formation of A-DNA at relative humidities (RHs) down to about 50%. The suppression was complete in the NaDNA-netropsin complex studied with 2H NMR which had a netropsin input ratio, r, of 0.22 drug/base pair. The sample used for UV linear dichroism had a similar input ratio while the X-ray diffraction samples had input ratios between 0.033 and 0.39 drug/base pair. Together, the results of these studies are in agreement with previous infrared (IR) linear dichroism studies of the conformation of the sugar-phosphate backbone in NaDNA-netropsin complexes, which showed that the B-A transition is suppressed for r-values down to approximately 0.1 drug/base pair (Fritzsche, H., Rupprecht, A. and Richter, M., Nucleic Acids Res. 12 (1984) 9165-9177). Images PMID:1313963

  1. Definition of a DNA repair domain in the genomic region containing the human p53 gene.

    PubMed

    Tolbert, D M; Kantor, G J

    1996-07-15

    The human p53 gene is repaired in UV (254 nm)-irradiated xeroderma pigmentosum group C (XP-C) cells as part of a large genomic region that is about twice the size of the gene. Surrounding genomic regions are not repaired. Through DNA cloning and measurements of DNA repair, we mapped the location of the repair domain, including the terminal regions, relative to the topological features of the gene. The domain includes only the DNA strand that is transcribed and extends in both 3' and 5' directions beyond the promoter and transcription termination sites. No transcriptional activity other than that associated with the p53 gene was detected. The results suggest that nontranscribed regions adjacent to the p53 transcribed regions are efficiently repaired in XP-C cells. This means that factors associated with transcription other than RNA polymerase II and the associated transcription repair coupling factor must also play a role in the selective repair process in XP-C cells. We also found that a DNA fragment that contains the p53 promoters is nearly twice as sensitive to cyclobutane pyrimidine dimer induction by UV irradiation than are the surrounding fragments, which have the expected sensitivity.

  2. Structure of the LexA-DNA complex and implications for SOS box measurement

    SciTech Connect

    Zhang, Adrianna P.P.; Pigli, Ying Z; Rice, Phoebe A

    2010-09-08

    The eubacterial SOS system is a paradigm of cellular DNA damage and repair, and its activation can contribute to antibiotic resistance. Under normal conditions, LexA represses the transcription of many DNA repair proteins by binding to SOS 'boxes' in their operators. Under genotoxic stress, accumulating complexes of RecA, ATP and single-stranded DNA (ssDNA) activate LexA for autocleavage. To address how LexA recognizes its binding sites, we determined three crystal structures of Escherichia coli LexA in complex with SOS boxes. Here we report the structure of these LexA-DNA complexes. The DNA-binding domains of the LexA dimer interact with the DNA in the classical fashion of a winged helix-turn-helix motif. However, the wings of these two DNA-binding domains bind to the same minor groove of the DNA. These wing-wing contacts may explain why the spacing between the two half-sites of E. coli SOS boxes is invariant.

  3. A DNA Origami Mechanical Device for the Regulation of Microcosmic Structural Rigidity.

    PubMed

    Wan, Neng; Hong, Zhouping; Wang, Huading; Fu, Xin; Zhang, Ziyue; Li, Chao; Xia, Han; Fang, Yan; Li, Maoteng; Zhan, Yi; Yang, Xiangliang

    2017-09-13

    DNA origami makes it feasible to fabricate a tremendous number of DNA nanostructures with various geometries, dimensions, and functionalities. Moreover, an increasing amount of research on DNA nanostructures is focused on biological and biomedical applications. Here, the reversible regulation of microcosmic structural rigidity is accomplished using a DNA origami device in vitro. The designed DNA origami monomer is composed of an internal central axis and an external sliding tube. Due to the external tube sliding, the device transforms between flexible and rigid states. By transporting the device into the liposome, the conformational change of the origami device induces a structural change in the liposome. The results obtained demonstrate that the programmed DNA origami device can be applied to regulate the microcosmic structural rigidity of liposomes. Because microcosmic structural rigidity is important to cell proliferation and function, the results obtained potentially provide a foundation for the regulation of cell microcosmic structural rigidity using DNA nanostructures. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Immunoglobulin variable region hypermutation is associated with a DNA repair deficit

    SciTech Connect

    Valles-Ayoub, Y.; Govan, H.L. III; Braun, J. )

    1991-03-11

    The molecular mechanism of Ig variable region hypermutation is unknown, but has been hypothesized to involve an error-prone DNA repair process. In this study, the authors used a novel PCR-based assay to compare repair of UV-induced DNA damage in mantle zone versus germinal center B lymphocytes. They observed that DNA repair activity within rearranged VDJ loci was sluggish in germinal center B lymphocytes compared to repair activity monitored in mantle zone B lymphocytes. In contrast, DNA repair times within the germline V{sub H}5 gene family, the variable region J{sub H}{endash}C{sub H} intron, and the N-ras gene was rapid and similar in both germinal center and mantle zone B cells. These results reflect a DNA repair deficit which, as expected for hypermutation, is selective for rearranged Ig VDG in germinal center cells. To directly measure the fidelity of DNA repair, the repaired PCR-amplified gene segments were analyzed for sequence changes by restriction enzyme digestion. In experiments thus far, repair of germline V{sub H}5 was error-free in both germinal center and mantle zone B cells. However, while rearranged V{sub H}5 segments were also error-free in mantle zone cells, they were highly mutated in germinal center cells. These findings provide direct biochemical evidence for the role of a sequence- and stage-specific error-prone DNA repair pathway in Ig V gene hypermutation.

  5. Mechanism of Facilitated Diffusion during a DNA Search in Crowded Environments.

    PubMed

    Krepel, Dana; Gomez, David; Klumpp, Stefan; Levy, Yaakov

    2016-11-03

    The key feature explaining the rapid recognition of a DNA target site by its protein lies in the combination of one- and three-dimensional (1D and 3D) diffusion, which allows efficient scanning of the many alternative sites. This facilitated diffusion mechanism is expected to be affected by cellular conditions, particularly crowding, given that up to 40% of the total cellular volume may by occupied by macromolecules. Using coarse-grained molecular dynamics and Monte Carlo simulations, we show that the crowding particles can enhance facilitated diffusion and accelerate search kinetics. This effect originates from a trade-off between 3D and 1D diffusion. The 3D diffusion coefficient is lower under crowded conditions, but it has little influence because the excluded volume effect of molecular crowding restricts its use. Largely prevented from using 3D diffusion, the searching protein dramatically increases its use of the hopping search mode, which results in a higher linear diffusion coefficient. The coefficient of linear diffusion also increases under crowded conditions as a result of increased collisions between the crowding particles and the searching protein. Overall, less 3D diffusion coupled with an increase in the use of the hopping and speed of 1D diffusion results in faster search kinetics under crowded conditions. Our study shows that the search kinetics and mechanism are modulated not only by the crowding occupancy but also by the properties of the crowding particles and the salt concentration.

  6. The Methanothermobacter thermautotrophicus ExoIII homologue Mth212 is a DNA uridine endonuclease

    PubMed Central

    Georg, Jens; Schomacher, Lars; Chong, James P. J.; Majerník, Alan I.; Raabe, Monika; Urlaub, Henning; Müller, Sabine; Ciirdaeva, Elena; Kramer, Wilfried; Fritz, Hans-Joachim

    2006-01-01

    The genome of Methanothermobacter thermautotrophicus, as a hitherto unique case, is apparently devoid of genes coding for general uracil DNA glycosylases, the universal mediators of base excision repair following hydrolytic deamination of DNA cytosine residues. We have now identified protein Mth212, a member of the ExoIII family of nucleases, as a possible initiator of DNA uracil repair in this organism. This enzyme, in addition to bearing all the enzymological hallmarks of an ExoIII homologue, is a DNA uridine endonuclease (U-endo) that nicks double-stranded DNA at the 5′-side of a 2′-d-uridine residue, irrespective of the nature of the opposing nucleotide. This type of activity has not been described before; it is absent from the ExoIII homologues of Escherichia coli, Homo sapiens and Methanosarcina mazei, all of which are equipped with uracil DNA repair glycosylases. The U-endo activity of Mth212 is served by the same catalytic center as its AP-endo activity. PMID:17012282

  7. HIF3A DNA Methylation Is Associated with Childhood Obesity and ALT

    PubMed Central

    Wang, Shuo; Song, Jieyun; Yang, Yide; Zhang, Yining; Wang, Haijun; Ma, Jun

    2015-01-01

    Gene polymorphisms associated so far with body mass index (BMI) can explain only 1.18–1.45% of observed variation in BMI. Recent studies suggest that epigenetic modifications, especially DNA methylation, could contribute to explain part of the missing heritability, and two epigenetic genome-wide analysis studies (EWAS) have reported that Hypoxia Inducible Factor 3 Alpha Subunit (HIF3A) methylation was associated with BMI or BMI change. We therefore assessed whether the HIF3A methylation is associated with obesity and other obesity-related phenotypes in Chinese children. The subjects included 110 severe obese cases aged 7–17y and 110 normal-weight controls matched by age and gender for measurement of blood DNA methylation levels at the HIF3A gene locus using the Sequenom’s MassARRAY system. We observed significantly higher methylation levels in obese children than in controls at positions 46801642 and 46801699 in HIF3A gene (P<0.05), and found positive associations between methylation and alanine aminotransferase (ALT) levels adjusted by gender, age and BMI at the position 46801699 (r = 0.226, P = 0.007). These results suggest that HIF3A DNA methylation is associated with childhood obesity, and has a BMI-independent association with ALT. The results provide evidence for identifying epigenetic factors of elivated ALT and may be useful for risk assessment and personalized medicine of liver diseases such as non-alcoholic fatty liver disease (NAFLD). PMID:26717317

  8. HIF3A DNA Methylation Is Associated with Childhood Obesity and ALT.

    PubMed

    Wang, Shuo; Song, Jieyun; Yang, Yide; Zhang, Yining; Wang, Haijun; Ma, Jun

    2015-01-01

    Gene polymorphisms associated so far with body mass index (BMI) can explain only 1.18-1.45% of observed variation in BMI. Recent studies suggest that epigenetic modifications, especially DNA methylation, could contribute to explain part of the missing heritability, and two epigenetic genome-wide analysis studies (EWAS) have reported that Hypoxia Inducible Factor 3 Alpha Subunit (HIF3A) methylation was associated with BMI or BMI change. We therefore assessed whether the HIF3A methylation is associated with obesity and other obesity-related phenotypes in Chinese children. The subjects included 110 severe obese cases aged 7-17y and 110 normal-weight controls matched by age and gender for measurement of blood DNA methylation levels at the HIF3A gene locus using the Sequenom's MassARRAY system. We observed significantly higher methylation levels in obese children than in controls at positions 46801642 and 46801699 in HIF3A gene (P<0.05), and found positive associations between methylation and alanine aminotransferase (ALT) levels adjusted by gender, age and BMI at the position 46801699 (r = 0.226, P = 0.007). These results suggest that HIF3A DNA methylation is associated with childhood obesity, and has a BMI-independent association with ALT. The results provide evidence for identifying epigenetic factors of elivated ALT and may be useful for risk assessment and personalized medicine of liver diseases such as non-alcoholic fatty liver disease (NAFLD).

  9. Development of a DNA microarray for species identification of quarantine aphids.

    PubMed

    Lee, Won Sun; Choi, Hwalran; Kang, Jinseok; Kim, Ji-Hoon; Lee, Si Hyeock; Lee, Seunghwan; Hwang, Seung Yong

    2013-12-01

    Aphid pests are being brought into Korea as a result of increased crop trading. Aphids exist on growth areas of plants, and thus plant growth is seriously affected by aphid pests. However, aphids are very small and have several sexual morphs and life stages, so it is difficult to identify species on the basis of morphological features. This problem was approached using DNA microarray technology. DNA targets of the cytochrome c oxidase subunit I gene were generated with a fluorescent dye-labelled primer and were hybridised onto a DNA microarray consisting of specific probes. After analysing the signal intensity of the specific probes, the unique patterns from the DNA microarray, consisting of 47 species-specific probes, were obtained to identify 23 aphid species. To confirm the accuracy of the developed DNA microarray, ten individual blind samples were used in blind trials, and the identifications were completely consistent with the sequencing data of all individual blind samples. A microarray has been developed to distinguish aphid species. DNA microarray technology provides a rapid, easy, cost-effective and accurate method for identifying aphid species for pest control management. © 2013 Society of Chemical Industry.

  10. Single-molecule observations of RNA-RNA kissing interactions in a DNA nanostructure.

    PubMed

    Takeuchi, Yosuke; Endo, Masayuki; Suzuki, Yuki; Hidaka, Kumi; Durand, Guillaume; Dausse, Eric; Toulmé, Jean-Jacques; Sugiyama, Hiroshi

    2016-01-01

    RNA molecules uniquely form a complex through specific hairpin loops, called a kissing complex. The kissing complex is widely investigated and used for the construction of RNA nanostructures. Molecular switches have also been created by combining a kissing loop and a ligand-binding aptamer to control the interactions of RNA molecules. In this study, we incorporated two kinds of RNA molecules into a DNA origami structure and used atomic force microscopy to observe their ligand-responsive interactions at the single-molecule level. We used a designed RNA aptamer called GTPswitch, which has a guanosine triphosphate (GTP) responsive domain and can bind to the target RNA hairpin named Aptakiss in the presence of GTP. We observed shape changes of the DNA/RNA strands in the DNA origami, which are induced by the GTPswitch, into two different shapes in the absence and presence of GTP, respectively. We also found that the switching function in the nanospace could be improved by using a cover strand over the kissing loop of the GTPswitch or by deleting one base from this kissing loop. These newly designed ligand-responsive aptamers can be used for the controlled assembly of the various DNA and RNA nanostructures.

  11. Tailored protein encapsulation into a DNA host using geometrically organized supramolecular interactions.

    PubMed

    Sprengel, Andreas; Lill, Pascal; Stegemann, Pierre; Bravo-Rodriguez, Kenny; Schöneweiß, Elisa-C; Merdanovic, Melisa; Gudnason, Daniel; Aznauryan, Mikayel; Gamrad, Lisa; Barcikowski, Stephan; Sanchez-Garcia, Elsa; Birkedal, Victoria; Gatsogiannis, Christos; Ehrmann, Michael; Saccà, Barbara

    2017-02-16

    The self-organizational properties of DNA have been used to realize synthetic hosts for protein encapsulation. However, current strategies of DNA-protein conjugation still limit true emulation of natural host-guest systems, whose formation relies on non-covalent bonds between geometrically matching interfaces. Here we report one of the largest DNA-protein complexes of semisynthetic origin held in place exclusively by spatially defined supramolecular interactions. Our approach is based on the decoration of the inner surface of a DNA origami hollow structure with multiple ligands converging to their corresponding binding sites on the protein surface with programmable symmetry and range-of-action. Our results demonstrate specific host-guest recognition in a 1:1 stoichiometry and selectivity for the guest whose size guarantees sufficient molecular diffusion preserving short intermolecular distances. DNA nanocontainers can be thus rationally designed to trap single guest molecules in their native form, mimicking natural strategies of molecular recognition and anticipating a new method of protein caging.

  12. Gating-like Motions and Wall Porosity in a DNA Nanopore Scaffold Revealed by Molecular Simulations.

    PubMed

    Maingi, Vishal; Lelimousin, Mickaël; Howorka, Stefan; Sansom, Mark S P

    2015-11-24

    Recently developed synthetic membrane pores composed of folded DNA enrich the current range of natural and engineered protein pores and of nonbiogenic channels. Here we report all-atom molecular dynamics simulations of a DNA nanotube (DNT) pore scaffold to gain fundamental insight into its atomic structure, dynamics, and interactions with ions and water. Our multiple simulations of models of DNTs that are composed of a six-duplex bundle lead to a coherent description. The central tube lumen adopts a cylindrical shape while the mouth regions at the two DNT openings undergo gating-like motions which provide a possible molecular explanation of a lower conductance state observed in our previous experimental study on a membrane-spanning version of the DNT (ACS Nano 2015, 9, 1117-26). Similarly, the central nanotube lumen is filled with water and ions characterized by bulk diffusion coefficients while the gating regions exhibit temporal fluctuations in their aqueous volume. We furthermore observe that the porous nature of the walls allows lateral leakage of ions and water. This study will benefit rational design of DNA nanopores of enhanced stability of relevance for sensing applications, of nanodevices with tunable gating properties that mimic gated ion channels, or of nanopores featuring defined permeation behavior.

  13. A DNA Aptamer Recognizes the Asp f 1 Allergen of Aspergillus fumigatus

    PubMed Central

    Low, Swee Yang; Hill, Jane E.; Peccia, Jordan

    2009-01-01

    Allergies are caused by the binding of IgE antibodies onto specific sites on allergens. However, in the assessment of exposure to airborne allergens, current techniques such as whole spore counts fail to account for the presence of these allergenic epitopes that trigger allergic reactions. The objective of the research is to develop a DNA aptamer for the Asp f 1 allergen of the pathogenic fungus Aspergillus fumigatus, using an IgE-binding epitope of the allergen as the target for aptamer selection. Through in vitro SELEX, an aptamer has been produced that binds with nanomolar affinity to the Asp f 1 IgE-epitope. The aptamer is also able to recognize the native Asp f 1 allergen, and does not bind to allergenic proteins from non-target mold species such as Alternaria alternata. Production of this aptamer provides proof-of-principle that allergen measurement methods can be developed to indicate the potent fraction, or allergenicity, of allergens. PMID:19545545

  14. Priming of microglia in a DNA-repair deficient model of accelerated aging.

    PubMed

    Raj, Divya D A; Jaarsma, Dick; Holtman, Inge R; Olah, Marta; Ferreira, Filipa M; Schaafsma, Wandert; Brouwer, Nieske; Meijer, Michel M; de Waard, Monique C; van der Pluijm, Ingrid; Brandt, Renata; Kreft, Karim L; Laman, Jon D; de Haan, Gerald; Biber, Knut P H; Hoeijmakers, Jan H J; Eggen, Bart J L; Boddeke, Hendrikus W G M

    2014-09-01

    Aging is associated with reduced function, degenerative changes, and increased neuroinflammation of the central nervous system (CNS). Increasing evidence suggests that changes in microglia cells contribute to the age-related deterioration of the CNS. The most prominent age-related change of microglia is enhanced sensitivity to inflammatory stimuli, referred to as priming. It is unclear if priming is due to intrinsic microglia ageing or induced by the ageing neural environment. We have studied this in Ercc1 mutant mice, a DNA repair-deficient mouse model that displays features of accelerated aging in multiple tissues including the CNS. In Ercc1 mutant mice, microglia showed hallmark features of priming such as an exaggerated response to peripheral lipopolysaccharide exposure in terms of cytokine expression and phagocytosis. Specific targeting of the Ercc1 deletion to forebrain neurons resulted in a progressive priming response in microglia exemplified by phenotypic alterations. Summarizing, these data show that neuronal genotoxic stress is sufficient to switch microglia from a resting to a primed state.

  15. A DNA helicase activity is associated with an MCM4, -6, and -7 protein complex.

    PubMed

    Ishimi, Y

    1997-09-26

    All six minichromosome maintenance (MCM) proteins have DNA-dependent ATPase motifs in the central domain which is conserved from yeast to mammals. Our group purified MCM protein complexes consisting of MCM2, -4 (Cdc21), -6 (Mis5), and -7 (CDC47) proteins from HeLa cells by using histone-Sepharose column chromatography (Ishimi, Y., Ichinose, S., Omori, A., Sato K., and Kimura, H. (1996) J. Biol. Chem. 271, 24115-24122). The present study revealed that both ATPase activity and DNA helicase activity that displaces oligonucleotides annealed to single-stranded circular DNA are associated with an MCM protein complex. Both ATPase and DNA helicase activities were co-purified with a 600-kDa protein complex that is consisted of equal amounts of MCM4, -6, and -7 proteins. An immunodepletion of the MCM protein complex from the purified fraction using anti-MCM4 antibody resulted in the severe reduction of the DNA helicase activity. Displacement of DNA fragments by the DNA helicase suggested that it migrated along single-stranded DNA in the 3' to 5' direction, and the DNA helicase activity was detected only in the presence of hydrolyzable ATP or dATP. These results suggest that this helicase may be involved in the initiation of DNA replication as a DNA unwinding enzyme.

  16. Real-time electrochemical PCR with a DNA intercalating redox probe.

    PubMed

    Deféver, Thibaut; Druet, Michel; Evrard, David; Marchal, Damien; Limoges, Benoit

    2011-03-01

    The proof-of-principle of a nonoptical real-time PCR method based on the electrochemical monitoring of a DNA intercalating redox probe that becomes considerably less easily electrochemically detectable once intercalated to the amplified double-stranded DNA is demonstrated. This has been made possible thanks to the finding of a redox intercalator that (i) strongly and specifically binds to the amplified double-stranded DNA, (ii) does not significantly inhibit PCR, (iii) is chemically stable under PCR cycling, and (iv) is sensitively detected by square wave voltammetry during PCR cycling. Among the different DNA intercalating redox probes that we have investigated, namely, methylene blue, Os[(bpy)(2)phen](2+), Os[(bpy)(2)DPPZ](2+), Os[(4,4'-dimethyl-bpy)(2)DPPZ](2+) and Os[(4,4'-diamino-bpy)(2)DPPZ](2+) (with bpy = 2,2'-bipyridine, phen = phenanthroline, and DPPZ = dipyrido[3,2-a:2',3'-c]phenazine), the one and only compound with which it has been possible to demonstrate the proof-of-concept is the Os[(bpy)(2)DPPZ](2+). In terms of analytical performances, the methodology described here compares well with optical-based real-time PCRs, offering finally the same advantages than the popular and routinely used SYBR Green-based real-time fluorescent PCR, but with the additional incomes of being potentially much cheaper and easier to integrate in a hand-held miniaturized device.

  17. Protective immunity induced by a DNA vaccine encoding Eimeria tenella rhomboid against homologous challenge.

    PubMed

    Liu, Yingli; Zheng, Jun; Li, Jianhua; Gong, Pengtao; Zhang, Xichen

    2013-01-01

    Rhomboid protein in Apicomplexa was associated with the process of host cell invasion. To evaluate the potential of the protein in eliciting protective immunity against challenge, a DNA vaccine pVAX1-Rho encoding Eimeria tenella rhomboid was constructed. Recombinant protein was expressed in Hela cells and verified by indirect immunofluorescence and western blotting analysis. In vivo experiments, 1-week-old chickens were randomly divided into three groups. Experimental group of chickens were immunized with DNA vaccines while control group of chickens were injected with pVAX1 plasmid alone or sterile water. Two weeks following the booster dose, all chickens were inoculated orally with 5 × 10(4) sporulated oocysts of E. tenella. The host immunity and protective efficacy of this vaccine against E. tenella challenge in broilers were evaluated. Results showed that specific antibody, the levels of interleukin-2 (IL-2), interferon-γ (IFN-γ), and the percentages of CD4(+) and CD8(+) T lymphocyte cells were significantly increased in the pVAX1-Rho group. Challenge experiments demonstrated that pVAX1-Rho vaccination could reduce oocyst excretion, decrease cecal lesion, increase bodyweight gains and provide chickens with oocysts decrease ratio around 75.8 %. These results suggest that the pVAX1-Rho was able to induce humoral and cellular responses and generate protective immunity against E. tenella infection.

  18. Evaluating the immunogenicity and protective efficacy of a DNA vaccine encoding Lassa virus nucleoprotein.

    PubMed

    Rodriguez-Carreno, Maria P; Nelson, Michael S; Botten, Jason; Smith-Nixon, Kim; Buchmeier, Michael J; Whitton, J Lindsay

    2005-04-25

    Several viruses in the Arenavirus genus of the family Arenaviridae cause severe, often fatal, hemorrhagic fever. One such virus, Lassa virus (LV), is a frequent cause of disease in Africa, and survivors often are left with substantial neurological impairment. The feasibility of protective immunization against LV infection, and the associated disease, has been demonstrated in animal models, using recombinant vaccinia viruses to deliver Lassa proteins. Circumstantial evidence implicates cellular immunity in this Lassa-induced protection, but this has not been confirmed. Here, we describe DNA vaccines that encode LV proteins. A single inoculation of a plasmid encoding full-length Lassa nucleoprotein (LNP) can induce CD8(+) T cell responses in mice and can protect against challenge with two arenaviruses, lymphocytic choriomeningitis virus (LCMV) and Pichinde virus (PV). A DNA minigene vaccine encoding a 9 amino acid sequence from LNP also induces CD8(+) T cells and protects against arenavirus challenge, thus confirming prior speculation that protective cellular immunity is induced by LV proteins.

  19. A DNA dot hybridization model for molecular diagnosis of parasitic keratitis.

    PubMed

    Huang, Fu-Chin; Hsieh, Hsin-Yi; Chang, Tsung C; Su, Shu-Li; Tseng, Shin-Ling; Lai, Yu-Hsuan; Kuo, Ming-Tse

    2017-01-01

    Developing a DNA dot hybridization model for diagnosing parasitic keratitis. Newly designed oligonucleotide probes for detecting Acanthamoeba and microsporidia were tested with target reference strains of Acanthamoeba (n = 20) and microsporidia (n = 3), and non-target microorganisms, including bacteria (n = 20) and fungi (n = 20). These probes, which had passed the preliminary tests, were then assembled as a parasite dot hybridization (PDH) model for assessing 33 clinical samples from patients with clinically suspected Acanthamoeba and microsporidia keratitis, including eight positives for Acanthamoeba, 13 positives for microsporidia, and 12 negatives for both pathogens. Two probes for detecting Acanthamoeba and two for detecting microsporidia passed the tests using target and non-target strains and then were assembled in the PDH model. For clinical samples, one Acanthamoeba-positive sample (proved with pathology) was falsely negative according to the PDH assay. The sensitivity and specificity of the PDH assay for diagnosing Acanthamoeba keratitis were 87.5% and 100%, respectively, while the sensitivity and specificity for diagnosing microsporidia keratitis were 100%. The infectious agent of all clinical samples of microsporidia keratitis was identified as Vittaforma corneae with DNA sequencing, while those of Acanthamoeba keratitis were caused by four species of Acanthamoeba, with Acanthamoeba castellanii found in four samples (50%, 4/8). The PDH model has the potential to be a molecular assay for diagnosing Acanthamoeba and microsporidia keratitis. However, a prospective clinical study might be needed before the model is adopted in routine clinical practice.

  20. A DNA unwinding element and an ARS consensus comprise a replication origin within a yeast chromosome.

    PubMed Central

    Huang, R Y; Kowalski, D

    1993-01-01

    We have defined a replication origin, ORI305, within chromosome III of Saccharomyces cerevisiae by means of mutational analysis. cis-acting elements required for origin activity in the chromosome, as assayed by two-dimensional gel electrophoresis of replication intermediates, are the same as those required for the function of an autonomously replicating sequence, ARS305, in a plasmid. Essential elements include (i) an 11 bp sequence that is a near match to the ARS consensus and (ii) a broad sequence directly 3' to the consensus near match. Origin function is inactivated by point mutations in the essential near match sequence, suggesting that the sequence contributes to specifying the origin in the chromosome. Other consensus near matches with different sequences are present but are not required. The essential 3'-flanking sequence exhibits DNA helical instability and is sensitive to deletion mutations that stabilize the DNA helix. The wild-type 3'-flanking sequence can be functionally substituted by dissimilar sequences that also exhibit helical instability. The requirement for DNA helical instability indicates that the essential 3'-flanking sequence serves as a DNA unwinding element in the chromosome. Images PMID:8223462

  1. Functional protein expression from a DNA based wheat germ cell-free system.

    PubMed

    Zhao, Kate Qin; Hurst, Robin; Slater, Michael R; Bulleit, Robert F

    2007-12-01

    Wheat germ based eukaryotic cell-free systems have been shown to be applicable for both functional and structural analyses of proteins. However, the existing methods might require specialized instrumentation and/or a separate mRNA synthesis step. We have developed a DNA based, highly productive, coupled transcription/translation wheat germ cell-free system that incorporates the normally separate mRNA synthesis step and does not require specialized instrumentation. Using a small-volume batch reaction with fluorescence labeling, DNA templates predicted to encode proteins could be quickly screened for their ability to direct the expression of proteins of the appropriate size. Protein yield can be increased as much as 2 to 4-fold in this system using a dialysis reaction, reaching approximately 200-440 microg/ml in 10-20 h. Furthermore, enzyme activities can be assayed directly in the extract without further purification. Simple purification with affinity tags can be achieved in one-step and with minor modifications, efficient SeMet and [U-15N] labeling of >95% can be accomplished in this system. Thus, this efficient cell-free expression system can facilitate both functional and structural proteomics.

  2. Tailored protein encapsulation into a DNA host using geometrically organized supramolecular interactions

    PubMed Central

    Sprengel, Andreas; Lill, Pascal; Stegemann, Pierre; Bravo-Rodriguez, Kenny; Schöneweiß, Elisa-C.; Merdanovic, Melisa; Gudnason, Daniel; Aznauryan, Mikayel; Gamrad, Lisa; Barcikowski, Stephan; Sanchez-Garcia, Elsa; Birkedal, Victoria; Gatsogiannis, Christos; Ehrmann, Michael; Saccà, Barbara

    2017-01-01

    The self-organizational properties of DNA have been used to realize synthetic hosts for protein encapsulation. However, current strategies of DNA–protein conjugation still limit true emulation of natural host–guest systems, whose formation relies on non-covalent bonds between geometrically matching interfaces. Here we report one of the largest DNA–protein complexes of semisynthetic origin held in place exclusively by spatially defined supramolecular interactions. Our approach is based on the decoration of the inner surface of a DNA origami hollow structure with multiple ligands converging to their corresponding binding sites on the protein surface with programmable symmetry and range-of-action. Our results demonstrate specific host–guest recognition in a 1:1 stoichiometry and selectivity for the guest whose size guarantees sufficient molecular diffusion preserving short intermolecular distances. DNA nanocontainers can be thus rationally designed to trap single guest molecules in their native form, mimicking natural strategies of molecular recognition and anticipating a new method of protein caging. PMID:28205515

  3. A DNA Barcode Library for North American Pyraustinae (Lepidoptera: Pyraloidea: Crambidae)

    PubMed Central

    Yang, Zhaofu; Landry, Jean-François; Hebert, Paul D. N.

    2016-01-01

    Although members of the crambid subfamily Pyraustinae are frequently important crop pests, their identification is often difficult because many species lack conspicuous diagnostic morphological characters. DNA barcoding employs sequence diversity in a short standardized gene region to facilitate specimen identifications and species discovery. This study provides a DNA barcode reference library for North American pyraustines based upon the analysis of 1589 sequences recovered from 137 nominal species, 87% of the fauna. Data from 125 species were barcode compliant (>500bp, <1% n), and 99 of these taxa formed a distinct cluster that was assigned to a single BIN. The other 26 species were assigned to 56 BINs, reflecting frequent cases of deep intraspecific sequence divergence and a few instances of barcode sharing, creating a total of 155 BINs. Two systems for OTU designation, ABGD and BIN, were examined to check the correspondence between current taxonomy and sequence clusters. The BIN system performed better than ABGD in delimiting closely related species, while OTU counts with ABGD were influenced by the value employed for relative gap width. Different species with low or no interspecific divergence may represent cases of unrecognized synonymy, whereas those with high intraspecific divergence require further taxonomic scrutiny as they may involve cryptic diversity. The barcode library developed in this study will also help to advance understanding of relationships among species of Pyraustinae. PMID:27736878

  4. Encounter and extrusion of an intrahelical lesion by a DNA repair enzyme

    SciTech Connect

    Qi, Yan; Spong, Marie C.; Nam, Kwangho; Banerjee, Anirban; Jiralerspong, Sao; Karplus, Martin; Verdine, Gregory L.; Harvard-Med; Harvard

    2010-01-12

    How living systems detect the presence of genotoxic damage embedded in a million-fold excess of undamaged DNA is an unresolved question in biology. Here we have captured and structurally elucidated a base-excision DNA repair enzyme, MutM, at the stage of initial encounter with a damaged nucleobase, 8-oxoguanine (oxoG), nested within a DNA duplex. Three structures of intrahelical oxoG-encounter complexes are compared with sequence-matched structures containing a normal G base in place of an oxoG lesion. Although the protein-DNA interfaces in the matched complexes differ by only two atoms - those that distinguish oxoG from G - their pronounced structural differences indicate that MutM can detect a lesion in DNA even at the earliest stages of encounter. All-atom computer simulations show the pathway by which encounter of the enzyme with the lesion causes extrusion from the DNA duplex, and they elucidate the critical free energy difference between oxoG and G along the extrusion pathway.

  5. Selection and analysis of a DNA aptamer binding α-amanitin from Amanita phalloides.

    PubMed

    Muszyńska, Klaudia; Ostrowska, Dominika; Bartnicki, Filip; Kowalska, Ewa; Bodaszewska-Lubaś, Małgorzata; Hermanowicz, Paweł; Faulstich, Heinz; Strzałka, Wojciech

    2017-08-09

    Mushroom foraging is very popular in some regions of the world. Sometimes toxic and edible mushrooms are mistaken by mushroom collectors, leading to serious human poisoning. The group of mushrooms highly dangerous for human health includes Amanita phalloides. This mushroom produces a toxic octapeptide called α-amanitin which is an inhibitor of nuclear RNA polymerase II. The inhibition of this polymerase results in the abortion of mRNA synthesis. The ingestion of A. phalloides causes liver failure due to the fact that most of the toxin is uptaken by hepatocytes. The hospitalization of poisoned patients involves the removal of the toxin from the digestive tract, its dilution in the circulatory system and the administration of therapeutic adjuvants. Since there is no effective antidote against amanitin poisoning, in this study we developed a DNA aptamer exhibiting specific binding to α-amanitin. This aptamer was selected using the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) method. Next, its ability of toxin removal from aqueous solution was confirmed by pull-down assay. The aptamer region sufficient for α-amanitin binding was determined. Finally, the dissociation constant of the α-amanitin/DNA aptamer complex was calculated.

  6. Inactivation of a DNA methylation pathway in maize reproductive organs results in apomixis-like phenotypes.

    PubMed

    Garcia-Aguilar, Marcelina; Michaud, Caroline; Leblanc, Olivier; Grimanelli, Daniel

    2010-10-01

    Apomictic plants reproduce asexually through seeds by avoiding both meiosis and fertilization. Although apomixis is genetically regulated, its core genetic component(s) has not been determined yet. Using profiling experiments comparing sexual development in maize (Zea mays) to apomixis in maize-Tripsacum hybrids, we identified six loci that are specifically downregulated in ovules of apomictic plants. Four of them share strong homology with members of the RNA-directed DNA methylation pathway, which in Arabidopsis thaliana is involved in silencing via DNA methylation. Analyzing loss-of-function alleles for two maize DNA methyltransferase genes belonging to that subset, dmt102 and dmt103, which are downregulated in the ovules of apomictic plants and are homologous to the Arabidopsis CHROMOMETHYLASEs and DOMAINS REARRANGED METHYLTRANSFERASE families, revealed phenotypes reminiscent of apomictic development, including the production of unreduced gametes and formation of multiple embryo sacs in the ovule. Loss of DMT102 activity in ovules resulted in the establishment of a transcriptionally competent chromatin state in the archesporial tissue and in the egg cell that mimics the chromatin state found in apomicts. Interestingly, dmt102 and dmt103 expression in the ovule is found in a restricted domain in and around the germ cells, indicating that a DNA methylation pathway active during reproduction is essential for gametophyte development in maize and likely plays a critical role in the differentiation between apomictic and sexual reproduction.

  7. A fluorescent aptasensor based on a DNA pyramid nanostructure for ultrasensitive detection of ochratoxin A.

    PubMed

    Nameghi, Morteza Alinezhad; Danesh, Noor Mohammad; Ramezani, Mohammad; Hassani, Faezeh Vahdati; Abnous, Khalil; Taghdisi, Seyed Mohammad

    2016-08-01

    Analytical techniques for detection of ochratoxin A (OTA) in food products and blood serum are of great significance. In this study, a fluorescent aptasensor was developed for sensitive and specific detection of OTA, based on a DNA pyramid nanostructure (DPN) and PicoGreen (PG) dye. The designed aptasensor inherits characteristics of DPN, such as high stability and capacity for PG loading. PG, as a fluorescent dye, could bind to double-stranded DNA (dsDNA). In the absence of OTA, the pyramid structure of DPN remains intact, leading to a very strong fluorescence emission. Because of higher affinity of aptamer for its target relative to its complementary strand, upon addition of target, the pyramid structure of DPN is disassembled, leading to a weak fluorescence emission. The presented aptasensor showed high specificity toward OTA with a limit of detection (LOD) as low as 0.135 nM. Besides, the designed sensing strategy was successfully utilized to recognize OTA in serum and grape juice with LODs of 0.184 and 0.149 nM, respectively.

  8. Tailored protein encapsulation into a DNA host using geometrically organized supramolecular interactions

    NASA Astrophysics Data System (ADS)

    Sprengel, Andreas; Lill, Pascal; Stegemann, Pierre; Bravo-Rodriguez, Kenny; Schöneweiß, Elisa-C.; Merdanovic, Melisa; Gudnason, Daniel; Aznauryan, Mikayel; Gamrad, Lisa; Barcikowski, Stephan; Sanchez-Garcia, Elsa; Birkedal, Victoria; Gatsogiannis, Christos; Ehrmann, Michael; Saccà, Barbara

    2017-02-01

    The self-organizational properties of DNA have been used to realize synthetic hosts for protein encapsulation. However, current strategies of DNA-protein conjugation still limit true emulation of natural host-guest systems, whose formation relies on non-covalent bonds between geometrically matching interfaces. Here we report one of the largest DNA-protein complexes of semisynthetic origin held in place exclusively by spatially defined supramolecular interactions. Our approach is based on the decoration of the inner surface of a DNA origami hollow structure with multiple ligands converging to their corresponding binding sites on the protein surface with programmable symmetry and range-of-action. Our results demonstrate specific host-guest recognition in a 1:1 stoichiometry and selectivity for the guest whose size guarantees sufficient molecular diffusion preserving short intermolecular distances. DNA nanocontainers can be thus rationally designed to trap single guest molecules in their native form, mimicking natural strategies of molecular recognition and anticipating a new method of protein caging.

  9. Limited Protection Conferred by a DNA Vaccine against a Lethal Pseudorabies Virus Infection at Day 5 Postvaccination▿

    PubMed Central

    Dory, Daniel; Torché, Anne-Marie; Béven, Véronique; Cariolet, Roland; Jestin, André

    2007-01-01

    No pseudorabies virus (PRV)-specific neutralizing or immunoglobulin G1-type antibodies were detected in sera 5 days after injection of a DNA vaccine against PRV infection in pigs. PRV-stimulated peripheral blood mononuclear cells produced gamma interferon mRNA in vitro. Two out of five pigs recovered from lethal PRV infection without attenuation of nasal viral excretion. PMID:17301217

  10. Investigating the Effects of a DNA Fingerprinting Workshop on 10th Grade Students' Self Efficacy and Attitudes toward Science.

    ERIC Educational Resources Information Center

    Sonmez, Duygu; Simcox, Amanda

    The purpose of this study was investigate the effects of a DNA Fingerprinting Workshop on 10th grade students' self efficacy and attitudes toward science. The content of the workshop based on high school science curriculum and includes multimedia instruction, laboratory experiment and participation of undergraduate students as mentors. N=93…

  11. Detection of an en masse and reversible B- to A-DNA conformational transition in prokaryotes in response to desiccation.

    PubMed

    Whelan, Donna R; Hiscox, Thomas J; Rood, Julian I; Bambery, Keith R; McNaughton, Don; Wood, Bayden R

    2014-08-06

    The role that DNA conformation plays in the biochemistry of cells has been the subject of intensive research since DNA polymorphism was discovered. B-DNA has long been considered the native form of DNA in cells although alternative conformations of DNA are thought to occur transiently and along short tracts. Here, we report the first direct observation of a fully reversible en masse conformational transition between B- and A-DNA within live bacterial cells using Fourier transform infrared (FTIR) spectroscopy. This biospectroscopic technique allows for non-invasive and reagent-free examination of the holistic biochemistry of samples. For this reason, we have been able to observe the previously unknown conformational transition in all four species of bacteria investigated. Detection of this transition is evidence of a previously unexplored biological significance for A-DNA and highlights the need for new research into the role that A-DNA plays as a cellular defence mechanism and in stabilizing the DNA conformation. Such studies are pivotal in understanding the role of A-DNA in the evolutionary pathway of nucleic acids. Furthermore, this discovery demonstrates the exquisite capabilities of FTIR spectroscopy and opens the door for further investigations of cell biochemistry with this under-used technique.

  12. A DNA tetrahedron-based molecular beacon for tumor-related mRNA detection in living cells.

    PubMed

    Xie, Nuli; Huang, Jin; Yang, Xiaohai; Yang, Yanjing; Quan, Ke; Wang, He; Ying, Le; Ou, Min; Wang, Kemin

    2016-02-07

    Due to its low cytotoxicity, high resistance to enzymatic degradation, and cellular permeability, a DNA tetrahedron-based molecular beacon (DTMB) is designed for tumor-related TK1 mRNA detection in living cells, where the target sequence can induce the tetrahedron from contraction to extension, resulting in fluorescence restoration.

  13. Detection of an en masse and reversible B- to A-DNA conformational transition in prokaryotes in response to desiccation

    PubMed Central

    Whelan, Donna R.; Hiscox, Thomas J.; Rood, Julian I.; Bambery, Keith R.; McNaughton, Don; Wood, Bayden R.

    2014-01-01

    The role that DNA conformation plays in the biochemistry of cells has been the subject of intensive research since DNA polymorphism was discovered. B-DNA has long been considered the native form of DNA in cells although alternative conformations of DNA are thought to occur transiently and along short tracts. Here, we report the first direct observation of a fully reversible en masse conformational transition between B- and A-DNA within live bacterial cells using Fourier transform infrared (FTIR) spectroscopy. This biospectroscopic technique allows for non-invasive and reagent-free examination of the holistic biochemistry of samples. For this reason, we have been able to observe the previously unknown conformational transition in all four species of bacteria investigated. Detection of this transition is evidence of a previously unexplored biological significance for A-DNA and highlights the need for new research into the role that A-DNA plays as a cellular defence mechanism and in stabilizing the DNA conformation. Such studies are pivotal in understanding the role of A-DNA in the evolutionary pathway of nucleic acids. Furthermore, this discovery demonstrates the exquisite capabilities of FTIR spectroscopy and opens the door for further investigations of cell biochemistry with this under-used technique. PMID:24898023

  14. Traditional Mold Analysis Compared to a DNA-based Method of Mold Analysis with Applications in Asthmatics' Homes

    EPA Science Inventory

    Traditional environmental mold analysis is based-on microscopic observations and counting of mold structures collected from the air on a sticky surface or culturing of molds on growth media for identification and quantification. A DNA-based method of mold analysis called mol...

  15. Investigating the Effects of a DNA Fingerprinting Workshop on 10th Grade Students' Self Efficacy and Attitudes toward Science.

    ERIC Educational Resources Information Center

    Sonmez, Duygu; Simcox, Amanda

    The purpose of this study was investigate the effects of a DNA Fingerprinting Workshop on 10th grade students' self efficacy and attitudes toward science. The content of the workshop based on high school science curriculum and includes multimedia instruction, laboratory experiment and participation of undergraduate students as mentors. N=93…

  16. Using a DNA microarray to investigate the distribution of insect virulence factors in strains of photorhabdus bacteria.

    PubMed

    Marokhazi, Judit; Waterfield, Nicholas; LeGoff, Gaelle; Feil, Edward; Stabler, Richard; Hinds, Jason; Fodor, Andras; ffrench-Constant, Richard H

    2003-08-01

    Photorhabdus is an insect-pathogenic bacterium in which oral toxicity to insects is found in two distinct taxonomic groups. Using a DNA microarray and comparative genomics, we show that oral toxicity is associated with toxin complex genes tcaABC and that this locus can be mobilized or deleted within different strains.

  17. Using a DNA Microarray To Investigate the Distribution of Insect Virulence Factors in Strains of Photorhabdus Bacteria

    PubMed Central

    Marokhazi, Judit; Waterfield, Nicholas; LeGoff, Gaelle; Feil, Edward; Stabler, Richard; Hinds, Jason; Fodor, Andras; ffrench-Constant, Richard H.

    2003-01-01

    Photorhabdus is an insect-pathogenic bacterium in which oral toxicity to insects is found in two distinct taxonomic groups. Using a DNA microarray and comparative genomics, we show that oral toxicity is associated with toxin complex genes tcaABC and that this locus can be mobilized or deleted within different strains.   PMID:12867479

  18. Traditional Mold Analysis Compared to a DNA-based Method of Mold Analysis with Applications in Asthmatics' Homes

    EPA Science Inventory

    Traditional environmental mold analysis is based-on microscopic observations and counting of mold structures collected from the air on a sticky surface or culturing of molds on growth media for identification and quantification. A DNA-based method of mold analysis called mol...

  19. Shotgun metagenomics indicates novel family A DNA polymerases predominate within marine virioplankton.

    PubMed

    Schmidt, Helen F; Sakowski, Eric G; Williamson, Shannon J; Polson, Shawn W; Wommack, K Eric

    2014-01-01

    Virioplankton have a significant role in marine ecosystems, yet we know little of the predominant biological characteristics of aquatic viruses that influence the flow of nutrients and energy through microbial communities. Family A DNA polymerases, critical to DNA replication and repair in prokaryotes, are found in many tailed bacteriophages. The essential role of DNA polymerase in viral replication makes it a useful target for connecting viral diversity with an important biological feature of viruses. Capturing the full diversity of this polymorphic gene by targeted approaches has been difficult; thus, full-length DNA polymerase genes were assembled out of virioplankton shotgun metagenomic sequence libraries (viromes). Within the viromes novel DNA polymerases were common and found in both double-stranded (ds) DNA and single-stranded (ss) DNA libraries. Finding DNA polymerase genes in ssDNA viral libraries was unexpected, as no such genes have been previously reported from ssDNA phage. Surprisingly, the most common virioplankton DNA polymerases were related to a siphovirus infecting an α-proteobacterial symbiont of a marine sponge and not the podoviral T7-like polymerases seen in many other studies. Amino acids predictive of catalytic efficiency and fidelity linked perfectly to the environmental clades, indicating that most DNA polymerase-carrying virioplankton utilize a lower efficiency, higher fidelity enzyme. Comparisons with previously reported, PCR-amplified DNA polymerase sequences indicated that the most common virioplankton metagenomic DNA polymerases formed a new group that included siphoviruses. These data indicate that slower-replicating, lytic or lysogenic phage populations rather than fast-replicating, highly lytic phages may predominate within the virioplankton.

  20. Molecular and immunological characterization of a DNA-launched yellow fever virus 17D infectious clone.

    PubMed

    Jiang, Xiaohong; Dalebout, Tim J; Lukashevich, Igor S; Bredenbeek, Peter J; Franco, David

    2015-04-01

    Yellow fever virus (YFV)-17D is an empirically developed, highly effective live-attenuated vaccine that has been administered to human beings for almost a century. YFV-17D has stood as a paradigm for a successful viral vaccine, and has been exploited as a potential virus vector for the development of recombinant vaccines against other diseases. In this study, a DNA-launched YFV-17D construct (pBeloBAC-FLYF) was explored as a new modality to the standard vaccine to combine the commendable features of both DNA vaccine and live-attenuated viral vaccine. The DNA-launched YFV-17D construct was characterized extensively both in cell culture and in mice. High titres of YFV-17D were generated upon transfection of the DNA into cells, whereas a mutant with deletion in the capsid-coding region (pBeloBAC-YF/ΔC) was restricted to a single round of infection, with no release of progeny virus. Homologous prime-boost immunization of AAD mice with both pBeloBAC-FLYF and pBeloBAC-YF/ΔC elicited specific dose-dependent cellular immune response against YFV-17D. Vaccination of A129 mice with pBeloBAC-FLYF resulted in the induction of YFV-specific neutralizing antibodies in all vaccinated subjects. These promising results underlined the potential of the DNA-launched YFV both as an alternative to standard YFV-17D vaccination and as a vaccine platform for the development of DNA-based recombinant YFV vaccines. © 2015.

  1. Development of a DNA Barcoding System for Seagrasses: Successful but Not Simple

    PubMed Central

    Lucas, Christina; Thangaradjou, Thirunavakkarasu; Papenbrock, Jutta

    2012-01-01

    Seagrasses, a unique group of submerged flowering plants, profoundly influence the physical, chemical and biological environments of coastal waters through their high primary productivity and nutrient recycling ability. They provide habitat for aquatic life, alter water flow, stabilize the ground and mitigate the impact of nutrient pollution. at the coast region. Although on a global scale seagrasses represent less than 0.1% of the angiosperm taxa, the taxonomical ambiguity in delineating seagrass species is high. Thus, the taxonomy of several genera is unsolved. While seagrasses are capable of performing both, sexual and asexual reproduction, vegetative reproduction is common and sexual progenies are always short lived and epimeral in nature. This makes species differentiation often difficult, especially for non-taxonomists since the flower as a distinct morphological trait is missing. Our goal is to develop a DNA barcoding system assisting also non-taxonomists to identify regional seagrass species. The results will be corroborated by publicly available sequence data. The main focus is on the 14 described seagrass species of India, supplemented with seagrasses from temperate regions. According to the recommendations of the Consortium for the Barcoding of Life (CBOL) rbcL and matK were used in this study. After optimization of the DNA extraction method from preserved seagrass material, the respective sequences were amplified from all species analyzed. Tree- and character-based approaches demonstrate that the rbcL sequence fragment is capable of resolving up to family and genus level. Only matK sequences were reliable in resolving species and partially the ecotype level. Additionally, a plastidic gene spacer was included in the analysis to confirm the identification level. Although the analysis of these three loci solved several nodes, a few complexes remained unsolved, even when constructing a combined tree for all three loci. Our approaches contribute to the

  2. A DNA Metabarcoding Study of a Primate Dietary Diversity and Plasticity across Its Entire Fragmented Range

    PubMed Central

    Quéméré, Erwan; Hibert, Fabrice; Miquel, Christian; Lhuillier, Emeline; Rasolondraibe, Emmanuel; Champeau, Julie; Rabarivola, Clément; Nusbaumer, Louis; Chatelain, Cyrille; Gautier, Laurent; Ranirison, Patrick; Crouau-Roy, Brigitte; Taberlet, Pierre; Chikhi, Lounès

    2013-01-01

    In tropical regions, most primary ecosystems have been replaced by mosaic landscapes in which species must cope with a large shift in the distribution of their habitat and associated food resources. Primates are particularly vulnerable to habitat modifications. Most species persist in small fragments surrounded by complex human-mediated matrices whose structure and connectivity may strongly influence their dispersal and feeding behavior. Behavioral plasticity appears to be a crucial parameter governing the ability of organisms to exploit the resources offered by new matrix habitats and thus to persist in fragmented habitats. In this study, we were interested in the dietary plasticity of the golden-crowned sifaka (Propithecus tattersalli), an endangered species of lemur, found only in the Daraina region in north-eastern Madagascar. We used a DNA-based approach combining the barcoding concept and Illumina next-generation sequencing to (i) describe the species diet across its entire range and (ii) evaluate the influence of landscape heterogeneity on diet diversity and composition. Faeces from 96 individuals were sampled across the entire species range and their contents were analyzed using the trnL metabarcoding approach. In parallel, we built a large DNA reference database based on a checklist of the plant species of the Daraina region. Our results suggest that golden-crowned sifakas exhibit remarkable dietary diversity with at least 130 plant species belonging to 80 genera and 49 different families. We highlighted an influence of both habitat type and openness on diet composition suggesting a high flexibility of foraging strategies. Moreover, we observed the presence of numerous cultivated and naturalized plants in the faeces of groups living in forest edge areas. Overall, our findings support our initial expectation that P. tattersalli is able to cope with the current level of alteration of the landscape and confirm our previous results on the distribution and the

  3. Low Dose Iron Treatments Induce a DNA Damage Response in Human Endothelial Cells within Minutes

    PubMed Central

    Mollet, Inês G.; Giess, Adam; Paschalaki, Koralia; Periyasamy, Manikandan; Lidington, Elaine C.; Mason, Justin C.; Jones, Michael D.; Game, Laurence; Ali, Simak; Shovlin, Claire L.

    2016-01-01

    , and induce a DNA damage response. PMID:26866805

  4. Protein–DNA charge transport: Redox activation of a DNA repair protein by guanine radical

    PubMed Central

    Yavin, Eylon; Boal, Amie K.; Stemp, Eric D. A.; Boon, Elizabeth M.; Livingston, Alison L.; O'Shea, Valerie L.; David, Sheila S.; Barton, Jacqueline K.

    2005-01-01

    DNA charge transport (CT) chemistry provides a route to carry out oxidative DNA damage from a distance in a reaction that is sensitive to DNA mismatches and lesions. Here, DNA-mediated CT also leads to oxidation of a DNA-bound base excision repair enzyme, MutY. DNA-bound Ru(III), generated through a flash/quench technique, is found to promote oxidation of the [4Fe-4S]2+ cluster of MutY to [4Fe-4S]3+ and its decomposition product [3Fe-4S]1+. Flash/quench experiments monitored by EPR spectroscopy reveal spectra with g = 2.08, 2.06, and 2.02, characteristic of the oxidized clusters. Transient absorption spectra of poly(dGC) and [Ru(phen)2dppz]3+ (dppz = dipyridophenazine), generated in situ, show an absorption characteristic of the guanine radical that is depleted in the presence of MutY with formation instead of a long-lived species with an absorption at 405 nm; we attribute this absorption also to formation of the oxidized [4Fe-4S]3+ and [3Fe-4S]1+ clusters. In ruthenium-tethered DNA assemblies, oxidative damage to the 5′-G of a 5′-GG-3′ doublet is generated from a distance but this irreversible damage is inhibited by MutY and instead EPR experiments reveal cluster oxidation. With ruthenium-tethered assemblies containing duplex versus single-stranded regions, MutY oxidation is found to be mediated by the DNA duplex, with guanine radical as an intermediate oxidant; guanine radical formation facilitates MutY oxidation. A model is proposed for the redox activation of DNA repair proteins through DNA CT, with guanine radicals, the first product under oxidative stress, in oxidizing the DNA-bound repair proteins, providing the signal to stimulate DNA repair. PMID:15738421

  5. Development and Testing of a DNA Macroarray To Assess Nitrogenase (nifH) Gene Diversity

    PubMed Central

    Steward, Grieg F.; Jenkins, Bethany D.; Ward, Bess B.; Zehr, Jonathan P.

    2004-01-01

    A DNA macroarray was developed and evaluated for its potential to distinguish variants of the dinitrogenase reductase (nifH) gene. Diverse nifH gene fragments amplified from a clone library were spotted onto nylon membranes. Amplified, biotinylated nifH fragments from individual clones or a natural picoplankton community were hybridized to the array and detected by chemiluminescence. A hybridization test with six individual targets mixed in equal proportions resulted in comparable relative signal intensities for the corresponding probes (standard deviation, 14%). When the targets were mixed in unequal concentrations, there was a predictable, but nonlinear, relationship between target concentration and relative signal intensity. Results implied a detection limit of roughly 13 pg of target ml−1, a half-saturation of signal at 0.26 ng ml−1, and a dynamic range of about 2 orders of magnitude. The threshold for cross-hybridization varied between 78 and 88% sequence identity. Hybridization patterns were reproducible with significant correlations between signal intensities of duplicate probes (r = 0.98, P < 0.0001, n = 88). A mixed nifH target amplified from a natural Chesapeake Bay water sample hybridized strongly to 6 of 88 total probes and weakly to 17 additional probes. The natural community results were well simulated (r = 0.941, P < 0.0001, n = 88) by hybridizing a defined mixture of six individual targets corresponding to the strongly hybridizing probes. Our results indicate that macroarray hybridization can be a highly reproducible, semiquantitative method for assessing the diversity of functional genes represented in mixed pools of PCR products amplified from the environment. PMID:15006766

  6. Structural Insights into the Post-Chemistry Steps of Nucleotide Incorporation Catalyzed by a DNA Polymerase.

    PubMed

    Reed, Andrew J; Vyas, Rajan; Raper, Austin T; Suo, Zucai

    2017-01-11

    DNA polymerases are essential enzymes that faithfully and efficiently replicate genomic information.1-3 The mechanism of nucleotide incorporation by DNA polymerases has been extensively studied structurally and kinetically, but several key steps following phosphodiester bond formation remain structurally uncharacterized due to utilization of natural nucleotides. It is thought that the release of pyrophosphate (PPi) triggers reverse conformational changes in a polymerase in order to complete a full catalytic cycle as well as prepare for DNA translocation and subsequent incorporation events. Here, by using the triphosphates of chain-terminating antiviral drugs lamivudine ((-)3TC-TP) and emtricitabine ((-)FTC-TP), we structurally reveal the correct sequence of post-chemistry steps during nucleotide incorporation by human DNA polymerase β (hPolβ) and provide a structural basis for PPi release. These post-catalytic structures reveal hPolβ in an open conformation with PPi bound in the active site, thereby strongly suggesting that the reverse conformational changes occur prior to PPi release. The results also help to refine the role of the newly discovered third divalent metal ion for DNA polymerase-catalyzed nucleotide incorporation. Furthermore, a post-chemistry structure of hPolβ in the open conformation, following incorporation of (-)3TC-MP, with a second (-)3TC-TP molecule bound to the active site in the absence of PPi, suggests that nucleotide binding stimulates PPi dissociation and occurs before polymerase translocation. Our structural characterization defines the order of the elusive post-chemistry steps in the canonical mechanism of a DNA polymerase.

  7. A DNA double-strand break kinetic rejoining model based on the local effect model.

    PubMed

    Tommasino, F; Friedrich, T; Scholz, U; Taucher-Scholz, G; Durante, M; Scholz, M

    2013-11-01

    We report here on a DNA double-strand break (DSB) kinetic rejoining model applicable to a wide range of radiation qualities based on the DNA damage pattern predicted by the local effect model (LEM). In the LEM this pattern is derived from the SSB and DSB yields after photon irradiation in combination with an amorphous track structure approach. Together with the assumption of a giant-loop organization to describe the higher order chromatin structure this allows the definition of two different classes of DSB. These classes are defined by the level of clustering on a micrometer scale, i.e., "isolated DSB" (iDSB) are characterized by a single DSB in a giant loop and "clustered DSB" (cDSB) by two or more DSB in a loop. Clustered DSB are assumed to represent a more difficult challenge for the cell repair machinery compared to isolated DSB, and we thus hypothesize here that the fraction of isolated DSB can be identified with the fast component of rejoining, whereas clustered DSB are identified with the slow component of rejoining. The resulting predicted bi-exponential decay functions nicely reproduce the experimental curves of DSB rejoining over time obtained by means of gel electrophoresis elution techniques as reported by different labs, involving different cell types and a wide spectrum of radiation qualities. New experimental data are also presented aimed at investigating the effects of the same ion species accelerated at different energies. The results presented here further support the relevance of the proposed two classes of DSB as a basis for understanding cell response to ion irradiation. Importantly the density of DSB within DNA giant loops of around 2 Mbp size, i.e., on a micrometer scale, is identified as a key parameter for the description of radiation effectiveness.

  8. TEX15: A DNA repair gene associated with prostate cancer risk in Han Chinese.

    PubMed

    Lin, Xiaoling; Chen, Zhongzhong; Gao, Peng; Gao, Zhimei; Chen, Haitao; Qi, Jun; Liu, Fang; Ye, Dingwei; Jiang, Haowen; Na, Rong; Yu, Hongjie; Shi, Rong; Lu, Daru; Zheng, Siqun Lilly; Mo, Zengnan; Sun, Yinghao; Ding, Qiang; Xu, Jianfeng

    2017-09-01

    Both common and rare genetic variants may contribute to risk of developing prostate cancer. Genome-wide association studies (GWASs) have identified ∼100 independent, common variants associated with prostate cancer risk. However, little is known about the association of rare variants (minor allele frequency [MAF] <1%) in the genome with prostate cancer risk. A two-stage study was used to test the association of rare, deleterious coding variants, annotated using predictive algorithms, with prostate cancer risk in Chinese men. Predicted rare, deleterious coding variants in the Illumina HumanExome-12 v1.1 beadchip were first evaluated in 1343 prostate cancer patients and 1008 controls. Significant variants were then validated in an additional 1816 prostate cancer patients and 1549 controls. In the discovery stage, 14 predicted rare, deleterious coding variants were significantly associated with prostate cancer risk (P < 0.01). In the confirmation stage, Q1631H in TEX15 (rs142485241), a DNA repair gene, was significantly associated with prostate cancer risk (P = 0.0069). The estimated odds ratio (OR) of the variant in the combined analysis was 3.24 (95% Confidence Interval 1.85-6.06), P = 8.81 × 10(-5) . Additionally, rs28756990 (V741F) at MLH3 (P = 0.06) and rs2961144 (I126V) at OR2A5 (P = 0.065) were marginally associated with prostate cancer risk in the replication stage. Our study provided preliminary evidence that the rare variant Q1631H in DNA repair gene TEX15 is associated with prostate cancer risk. This finding complements known common prostate cancer risk-associated variants and suggests the possible role of DNA repair genes in prostate cancer development. © 2017 Wiley Periodicals, Inc.

  9. Differentiating between fluorescence-quenching metal ions with polyfluorophore sensors built on a DNA backbone.

    PubMed

    Tan, Samuel S; Kim, Su Jeong; Kool, Eric T

    2011-03-02

    A common problem in detecting metal ions with fluorescentchemosensors is the emission-suppressing effects of fluorescence-quenching metal ions. This quenching tendency makes it difficult to design sensors with turn-on signal, and differentiate between several metal ions that may yield a strong quenching response. To address these challenges, we investigate a new sensor design strategy, incorporating fluorophores and metal ligands as DNA base replacements in DNA-like oligomers, for generating a broader range of responses for quenching metal ions. The modular molecular design enabled rapid synthesis and discovery of sensors from libraries on PEG-polystyrene beads. Using this approach, water-soluble sensors 1-5 were identified as strong responders to a set of eight typically quenching metal ions (Co(2+), Ni(2+), Cu(2+), Hg(2+), Pb(2+), Ag(+), Cr(3+), and Fe(3+)). They were synthesized and characterized for sensing responses in solution. Cross-screening with the full set of metal ions showed that they have a wide variety of responses, including emission enhancements and red- and blue-shifts. The diversity of sensor responses allows as few as two sensors (1 and 2) to be used together to successfully differentiate these eight metals. As a test, a set of unknown metal ion solutions in blind studies were also successfully identified based on the response pattern of the sensors. The modular nature of the sensor design strategy suggests a broadly applicable approach to finding sensors for differentiating many different cations by pattern-based recognition, simply by varying the sequence and composition of ligands and fluorophores on a DNA synthesizer.

  10. A DNA expression array to detect toxic stress response in European flounder (Platichthys flesus).

    PubMed

    Williams, T D; Gensberg, K; Minchin, S D; Chipman, J K

    2003-10-29

    As a first stage in developing a DNA array-based approach to investigating the effects of pollutants on an environmentally relevant European fish species, we have constructed a 160-gene custom microarray for European flounder. Degenerate primers were used to amplify 110 different fragments of stress-related and other genes from European flounder cDNA and genomic DNA. Additionally, 22 fragments were obtained by suppressive subtractive hybridisation (SSH). These fragments were cloned and sequenced, then, with additional control genes, used to create a cDNA microarray for flounder. After optimisation of the arraying process, hepatic mRNA was isolated from flounder caught in the polluted Tyne and relatively unpolluted Alde estuaries. Fluorescent cDNA probes were synthesised from the mRNA and used in dual-colour hybridisations to the microarray. A number of transcripts were differentially expressed between Tyne and Alde female flounder but these changes were not significant, due to high inter-individual variation. However, in comparisons between Tyne and Alde male flounder, 11 transcripts were found to significantly differ in expression (P<0.05). Seven transcripts were more highly expressed in the Tyne male fish (CYP1A, UDPGT, alpha-2HS-glycoprotein, dihydropyrimidine dehydrogenase, Cu/Zn SOD, aldehyde dehydrogenase and paraoxonase). Four transcripts (Elongation factor 1 (EF1), EF2, Int-6 and complement component C3) were found to be significantly less abundant in the Tyne male fish. Selected genes were assayed by real-time PCR, then normalised to alpha-tubulin. These assays confirmed the significance of the array results for CYP1A, UDPGT and EF1, but not for Cu/Zn SOD. This study provides a link between traditional single-gene biomarker studies and the emerging field of eco-toxicogenomics, demonstrating the utility of microarray studies on environmentally sampled, non-model organisms.

  11. Performance evaluation of a DNA chip assay in the identification of major genitourinary pathogens.

    PubMed

    Kweon, Oh Joo; Choi, Jee-Hye; Song, Un Heung; Park, Ae Ja

    2015-02-01

    To prevent the recurrence of genitourinary infections and to reduce the risks of their complications, accurate and rapid diagnosis are required. STDetect® Chip is a DNA chip which allows for the simultaneous detection of 13 major genitourinary pathogens in a single vaginal swab or urine specimen. We evaluated the analytical performance of the STDetect® Chip for detecting target pathogens that commonly cause genitourinary infections. The target pathogens of the STDetect® Chip are Chlamydia trachomatis, Candida albicans, Enterococcus faecalis, Gardnerella vaginalis, Mycoplasma hominis, Neisseria gonorrhoeae, Mycoplasma genitalium, Ureaplasma urealyticum, Staphylococcus aureus, Klebsiella pneumoniae, Trichomonas vaginalis, and Herpes simplex virus types 1 and 2. Performance of the STDetect® Chip for the detection of target pathogens was evaluated comparing with the result of direct sequencing and conventional multiplex PCR assay. And precision tests for STDetect® Chip were performed with quality control materials. The STDetect® Chip showed high sensitivities (95.1%-100%), specificities (93.4% to 100%), concordance rates (95.0%-100%), positive predictive values (69.8%-100%), and negative predictive values (93.1%-100%) in its identification of 13 target pathogens. The STDetect® Chip had a particularly excellent concordance rate (96.5%) for the 4 major pathogens, C. albicans, G. vaginalis, M. hominis, and U. urealyticum, compared with direct sequencing. Comparing to multiplex PCR assay, STDetect® Chip showed better sensitivity for detecting M. hominis (97.0% vs. 54.5%) and U. urealyticum (93.2% vs. 65.9%). In precision tests, coefficients of variations for signal intensities were ranged from 11.2% to 26.2%. The STDetect® Chip showed excellent analytical performance, and its result was in good agreement with that obtained by direct sequencing. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Electrochemical aptasensor for human osteopontin detection using a DNA aptamer selected by SELEX.

    PubMed

    Meirinho, Sofia G; Dias, Luís G; Peres, António M; Rodrigues, Lígia R

    2017-09-22

    A DNA aptamer with affinity and specificity for human osteopontin (OPN), a potential breast cancer biomarker, was selected using the SELEX process, considering its homology rate and the stability of its secondary structures. This aptamer exhibited a satisfactory affinity towards OPN, showing dissociation constants lower than 2.5 nM. It was further used to develop a simple, label-free electrochemical aptasensor against OPN. The aptasensor showed good sensitivity towards OPN in standard solutions, being the square wave voltammetry (SWV), compared to the cyclic voltammetry, the most sensitive technique with detection and quantification limits of 1.4 ± 0.4 nM and 4.2 ± 1.1 nM, respectively. It showed good reproducibility and acceptable selectivity, exhibiting low signal interferences from other proteins, as thrombin, with 2.6-10 times lower current signals-off than for OPN. The aptasensor also successfully detected OPN in spiked synthetic human plasma. Using SWV, detection and quantification limits (1.3 ± 0.1 and 3.9 ± 0.4 nM) within the OPN plasma levels reported for patients with breast cancer (0.4-4.5 nM) or with metastatic or recurrent breast cancer (0.9-8.4 nM) were found. Moreover, preliminary assays, using a sample of human plasma, showed that the aptasensor and the standard ELISA method quantified similar OPN levels (2.2 ± 0.7 and 1.7 ± 0.1 nM, respectively). Thus, our aptasensor coupled with SWV represents a promising alternative for the detection of relevant breast cancer biomarkers. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Multispectral labeling of antibodies with polyfluorophores on a DNA backbone and application in cellular imaging

    PubMed Central

    Guo, Jia; Wang, Shenliang; Dai, Nan; Teo, Yin Nah; Kool, Eric T.

    2011-01-01

    Most current approaches to multiantigen fluorescent imaging require overlaying of multiple images taken with separate filter sets as a result of differing dye excitation requirements. This requirement for false-color composite imaging prevents the user from visualizing multiple species in real time and disallows imaging of rapidly moving specimens. To address this limitation, here we investigate the use of oligodeoxyfluoroside (ODF) fluorophores as labels for antibodies. ODFs are short DNA-like oligomers with fluorophores replacing the DNA bases and can be assembled in many colors with excitation at a single wavelength. A DNA synthesizer was used to construct several short ODFs carrying a terminal alkyne group and having emission maxima of 410–670 nm. We developed a new approach to antibody conjugation, using Huisgen–Sharpless cycloaddition, which was used to react the alkynes on ODFs with azide groups added to secondary antibodies. Multiple ODF-tagged secondary antibodies were then used to mark primary antibodies. The set of antibodies was tested for spectral characteristics in labeling tubulin in HeLa cells and revealed a wide spectrum of colors, ranging from violet-blue to red with excitation through a single filter (340–380 nm). Selected sets of the differently labeled secondary antibodies were then used to simultaneously mark four antigens in fixed cells, using a single image and filter set. We also imaged different surface tumor markers on two live cell lines. Experiments showed that all colors could be visualized simultaneously by eye under the microscope, yielding multicolor images of multiple cellular antigens in real time. PMID:21321224

  14. Efficacy of a DNA Vaccine Carrying Eimeria maxima Gam56 Antigen Gene against Coccidiosis in Chickens

    PubMed Central

    Xu, Jinjun; Zhang, Yan

    2013-01-01

    To control coccidiosis without using prophylactic medications, a DNA vaccine targeting the gametophyte antigen Gam56 from Eimeria maxima in chickens was constructed, and the immunogenicity and protective effects were evaluated. The ORF of Gam56 gene was cloned into an eukaryotic expression vector pcDNA3.1(zeo)+. Expression of Gam56 protein in COS-7 cells transfected with recombinant plasmid pcDNA-Gam56 was confirmed by indirect immunofluorescence assay. The DNA vaccine was injected intramuscularly to yellow feathered broilers of 1-week old at 3 dosages (25, 50, and 100 µg/chick). Injection was repeated once 1 week later. One week after the second injection, birds were challenged orally with 5×104 sporulated oocysts of E. maxima, then weighed and killed at day 8 post challenge. Blood samples were collected and examined for specific peripheral blood lymphocyte proliferation activity and serum antibody levels. Compared with control groups, the administration of pcDNA-Gam56 vaccine markedly increased the lymphocyte proliferation activity (P<0.05) at day 7 and 14 after the first immunization. The level of lymphocyte proliferation started to decrease on day 21 after the first immunization. A similar trend was seen in specific antibody levels. Among the 3 pcDNA-Gam56 immunized groups, the median dosage group displayed the highest lymphocyte proliferation and antibody levels (P<0.05). The median dosage group had the greatest relative body weight gain (89.7%), and the greatest oocyst shedding reduction (53.7%). These results indicate that median dosage of DNA vaccine had good immunogenicity and immune protection effects, and may be used in field applications for coccidiosis control. PMID:23710081

  15. Structural features of an exocyclic adduct positioned opposite an abasic site in a DNA duplex

    SciTech Connect

    Kouchakdjian, M.; Patel, D.J. ); Eisenberg, M.; Johnson, F.; Grollman, A.P. )

    1991-04-02

    Structural studies have been extended to dual lesions where an exocyclic adduct is positioned opposite an abasic site in the center of a DNA oligomer duplex. NMR and energy minimization studies were performed on the 1,N{sup 2}-propanodeoxyguanosine exocyclic adduct (X) positioned opposite a tetrahydrofuran abasic site (F) with the dual lesions located in the center of the (C1-A2-T3-G4-X5-G6-T7-A8-C9){center dot}(G10-T11-A12-C13-F14-C15-A16-T17-G18) X{center dot}F 9-mer duplex. Two-dimensional NMR experiments establish that the X{center dot}F 9-mer helix is right-handed with Watson-Crick A{center dot}T and G{center dot}C base pairing on either side of the lesion site. NOEs are detected from the methylene protons of the exocyclic ring of X5 to the imino protons of G4{center dot}C15 and G6{center dot}C13 which flank the lesion site, as well as to the H1{prime} and H1{double prime} protons of the cross strand F14 tetrahydrofuran moiety. These NMR results establish that the exocyclic adduct X5 is positioned between flanking G4{center dot}C15 and G6{center dot}C13 base pairs and directed toward the abasic lesion F14 on the partner strand. These studies establish that the exocyclic ring of the 1,N{sup 2}-propanodeoxyguanosine adduct fits into the cavity generated by the abasic site.

  16. In vitro gene expression data supporting a DNA non-reactive genotoxic mechanism for ochratoxin A

    SciTech Connect

    Arbillaga, Leire; Lopez de Cerain, Adela . E-mail: acerain@unav.es

    2007-04-15

    Ochratoxin A (OTA) is a mycotoxin often found in cereals and agricultural products. There is unequivocal evidence of renal carcinogenicity of OTA in male rats, although the mechanism of action is unknown. At present, available data support an epigenetic mechanism (DNA non-reactive) resulting from oxidative stress and cytotoxicity, because a direct OTA interaction with DNA has not been demonstrated. Genotoxic mechanism (DNA-reactive vs. DNA non-reactive) may have implications on human risk assessment. Therefore, the aim of the present work was to identify biological pathways modulated by OTA in vitro in a human renal cell line (HK-2) to contribute to the elucidation of the mechanism of OTA toxicity. For that purpose, cells were exposed to 50 {mu}M OTA during 6 and 24 h, and gene expression profiles were analyzed using Affymetrix Human Genome U133 A 2.0 Gene Chips. Under the same experimental conditions, genotoxicity was evaluated by the modified comet assay using FPG and Endo III to detect oxidative DNA damage, and intracellular ROS level by the H{sub 2}DCF assay. After 6 h, with slight cytotoxicity (83% survival), genes involved in mitochondrial electron transport chain were up-regulated; and after 24 h, with a more pronounced cytotoxicity (51% survival), genes implicated in oxidative stress response were also up-regulated. Increase in intracellular ROS level and oxidative DNA damage was evident at both exposure times being more pronounced with high cytotoxicity. On the contrary, up-regulation of genes implicated in DNA damage response, as cell cycle control or apoptosis, was not detected at any exposure time. In conclusion, these results support a DNA non-reactive mechanism of OTA genotoxicity.

  17. ITS1: a DNA barcode better than ITS2 in eukaryotes?

    PubMed

    Wang, Xin-Cun; Liu, Chang; Huang, Liang; Bengtsson-Palme, Johan; Chen, Haimei; Zhang, Jian-Hui; Cai, Dayong; Li, Jian-Qin

    2015-05-01

    A DNA barcode is a short piece of DNA sequence used for species determination and discovery. The internal transcribed spacer (ITS/ITS2) region has been proposed as the standard DNA barcode for fungi and seed plants and has been widely used in DNA barcoding analyses for other biological groups, for example algae, protists and animals. The ITS region consists of both ITS1 and ITS2 regions. Here, a large-scale meta-analysis was carried out to compare ITS1 and ITS2 from three aspects: PCR amplification, DNA sequencing and species discrimination, in terms of the presence of DNA barcoding gaps, species discrimination efficiency, sequence length distribution, GC content distribution and primer universality. In total, 85 345 sequence pairs in 10 major groups of eukaryotes, including ascomycetes, basidiomycetes, liverworts, mosses, ferns, gymnosperms, monocotyledons, eudicotyledons, insects and fishes, covering 611 families, 3694 genera, and 19 060 species, were analysed. Using similarity-based methods, we calculated species discrimination efficiencies for ITS1 and ITS2 in all major groups, families and genera. Using Fisher's exact test, we found that ITS1 has significantly higher efficiencies than ITS2 in 17 of the 47 families and 20 of the 49 genera, which are sample-rich. By in silico PCR amplification evaluation, primer universality of the extensively applied ITS1 primers was found superior to that of ITS2 primers. Additionally, shorter length of amplification product and lower GC content was discovered to be two other advantages of ITS1 for sequencing. In summary, ITS1 represents a better DNA barcode than ITS2 for eukaryotic species.

  18. Unique and Universal Features of Epsilonproteobacterial Origins of Chromosome Replication and DnaA-DnaA Box Interactions

    PubMed Central

    Jaworski, Pawel; Donczew, Rafal; Mielke, Thorsten; Thiel, Marcel; Oldziej, Stanislaw; Weigel, Christoph; Zawilak-Pawlik, Anna

    2016-01-01

    In bacteria, chromosome replication is initiated by the interaction of the initiator protein DnaA with a defined region of a chromosome at which DNA replication starts (oriC). While DnaA proteins share significant homology regardless of phylogeny, oriC regions exhibit more variable structures. The general architecture of oriCs is universal, i.e., they are composed of a cluster of DnaA binding sites, a DNA-unwinding element, and sequences that bind regulatory proteins. However, detailed structures of oriCs are shared by related species while being significantly different in unrelated bacteria. In this work, we characterized Epsilonproteobacterial oriC regions. Helicobacter pylori was the only species of the class for which oriC was characterized. A few unique features were found such as bipartite oriC structure, not encountered in any other Gram-negative species, and topology-sensitive DnaA-DNA interactions, which have not been found in any other bacterium. These unusual H. pylori oriC features raised questions of whether oriC structure and DnaA-DNA interactions are unique to this bacterium or whether they are common to related species. By in silico and in vitro analyses we identified putative oriCs in three Epsilonproteobacterial species: pathogenic Arcobacter butzleri, symbiotic Wolinella succinogenes, and free-living Sulfurimonas denitrificans. We propose that oriCs typically co-localize with ruvC-dnaA-dnaN in Epsilonproteobacteria, with the exception of Helicobacteriaceae species. The clusters of DnaA boxes localize upstream (oriC1) and downstream (oriC2) of dnaA, and they likely constitute bipartite origins. In all cases, DNA unwinding was shown to occur in oriC2. Unlike the DnaA box pattern, which is not conserved in Epsilonproteobacterial oriCs, the consensus DnaA box sequences and the mode of DnaA-DnaA box interactions are common to the class. We propose that the typical Epsilonproteobacterial DnaA box consists of the core nucleotide sequence 5′-TTCAC-3

  19. Approaches to enzyme and substrate design of the murine Dnmt3a DNA methyltransferase.

    PubMed

    Jurkowska, Renata Z; Siddique, Abu Nasar; Jurkowski, Tomasz P; Jeltsch, Albert

    2011-07-04

    Dnmt3a-C, the catalytic domain of the Dnmt3a DNA-(cytosine-C5)-methyltransferase, is active in an isolated form but, like the full-length Dnmt3a, shows only weak DNA methylation activity. To improve this activity by directed evolution, we set up a selection system in which Dnmt3a-C methylated its own expression plasmid in E. coli, and protected it from cleavage by methylation-sensitive restriction enzymes. However, despite screening about 400 clones that were selected in three rounds from a random mutagenesis library of 60 000 clones, we were not able to isolate a variant with improved activity, most likely because of a background of uncleaved plasmids and plasmids that had lost the restriction sites. To improve the catalytic activity of Dnmt3a-C by optimization of the sequence of the DNA substrate, we analyzed its flanking-sequence preference in detail by bisulfite DNA-methylation analysis and sequencing of individual clones. Based on the enrichment and depletion of certain bases in the positions flanking >1300 methylated CpG sites, we were able to define a sequence-preference profile for Dnmt3a-C from the -6 to the +6 position of the flanking sequence. This revealed preferences for T over a purine at position -2, A over G at -1, a pyrimidine at +1, and A and T over G at +3. We designed one "good" substrate optimized for methylation and one "bad" substrate designed not to be efficiently methylated, and showed that the optimized substrate is methylated >20 times more rapidly at its central CpG site. The optimized Dnmt3a-C substrate can be applied in enzymatic high-throughput assays with Dnmt3a-C (e.g., for inhibitor screening), because the increased activity provides an improved dynamic range and better signal/noise ratio. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. DBD2BS: connecting a DNA-binding protein with its binding sites

    PubMed Central

    Chien, Ting-Ying; Lin, Chih-Kang; Lin, Chih-Wei; Weng, Yi-Zhong; Chen, Chien-Yu; Chang, Darby Tien-Hao

    2012-01-01

    By binding to short and highly conserved DNA sequences in genomes, DNA-binding proteins initiate, enhance or repress biological processes. Accurately identifying such binding sites, often represented by position weight matrices (PWMs), is an important step in understanding the control mechanisms of cells. When given coordinates of a DNA-binding domain (DBD) bound with DNA, a potential function can be used to estimate the change of binding affinity after base substitutions, where the changes can be summarized as a PWM. This technique provides an effective alternative when the chromatin immunoprecipitation data are unavailable for PWM inference. To facilitate the procedure of predicting PWMs based on protein–DNA complexes or even structures of the unbound state, the web server, DBD2BS, is presented in this study. The DBD2BS uses an atom-level knowledge-based potential function to predict PWMs characterizing the sequences to which the query DBD structure can bind. For unbound queries, a list of 1066 DBD–DNA complexes (including 1813 protein chains) is compiled for use as templates for synthesizing bound structures. The DBD2BS provides users with an easy-to-use interface for visualizing the PWMs predicted based on different templates and the spatial relationships of the query protein, the DBDs and the DNAs. The DBD2BS is the first attempt to predict PWMs of DBDs from unbound structures rather than from bound ones. This approach increases the number of existing protein structures that can be exploited when analyzing protein–DNA interactions. In a recent study, the authors showed that the kernel adopted by the DBD2BS can generate PWMs consistent with those obtained from the experimental data. The use of DBD2BS to predict PWMs can be incorporated with sequence-based methods to discover binding sites in genome-wide studies. Available at: http://dbd2bs.csie.ntu.edu.tw/, http://dbd2bs.csbb.ntu.edu.tw/, and http://dbd2bs.ee.ncku.edu.tw. PMID:22693214

  1. Inhibition of Pseudomonas aeruginosa ExsA DNA-Binding Activity by N-Hydroxybenzimidazoles.

    PubMed

    Marsden, Anne E; King, Jessica M; Spies, M Ashley; Kim, Oak K; Yahr, Timothy L

    2016-02-01

    The Pseudomonas aeruginosa type III secretion system (T3SS) is a primary virulence determinant and a potential target for antivirulence drugs. One candidate target is ExsA, a member of the AraC family of DNA-binding proteins required for expression of the T3SS. A previous study identified small molecules based on an N-hydroxybenzimidazole scaffold that inhibit the DNA-binding activity of several AraC proteins, including ExsA. In this study, we further characterized a panel of N-hydroxybenzimidazoles. The half-maximal inhibitory concentrations (IC50s) for the tested N-hydroxybenzimidazoles ranged from 8 to 45 μM in DNA-binding assays. Each of the N-hydroxybenzimidazoles protected mammalian cells from T3SS-dependent cytotoxicity, and protection correlated with reduced T3SS gene expression in a coculture infection model. Binding studies with the purified ExsA DNA-binding domain (i.e., lacking the amino-terminal self-association domain) confirmed that the activity of N-hydroxybenzimidazoles results from interactions with the DNA-binding domain. The interaction is specific, as an unrelated DNA-binding protein (Vfr) was unaffected by N-hydroxybenzimidazoles. ExsA homologs that control T3SS gene expression in Yersinia pestis, Aeromonas hydrophila, and Vibrio parahaemolyticus were also sensitive to N-hydroxybenzimidazoles. Although ExsA and Y. pestis LcrF share 79% sequence identity in the DNA-binding domain, differential sensitivities to several of the N-hydroxybenzimidazoles were observed. Site-directed mutagenesis based on in silico docking of inhibitors to the DNA-binding domain, and on amino acid differences between ExsA and LcrF, resulted in the identification of several substitutions that altered the sensitivity of ExsA to N-hydroxybenzimidazoles. Development of second-generation compounds targeted to the same binding pocket could lead to drugs with improved pharmacological properties.

  2. Quantification of Plasmodiophora brassicae Using a DNA-Based Soil Test Facilitates Sustainable Oilseed Rape Production

    PubMed Central

    Wallenhammar, Ann-Charlotte; Gunnarson, Albin; Hansson, Fredrik; Jonsson, Anders

    2016-01-01

    Outbreaks of clubroot disease caused by the soil-borne obligate parasite Plasmodiophora brassicae are common in oilseed rape (OSR) in Sweden. A DNA-based soil testing service that identifies fields where P. brassicae poses a significant risk of clubroot infection is now commercially available. It was applied here in field surveys to monitor the prevalence of P. brassicae DNA in field soils intended for winter OSR production and winter OSR field experiments. In 2013 in Scania, prior to planting, P. brassicae DNA was detected in 60% of 45 fields on 10 of 18 farms. In 2014, P. brassicae DNA was detected in 44% of 59 fields in 14 of 36 farms, in the main winter OSR producing region in southern Sweden. P. brassicae was present indicative of a risk for >10% yield loss with susceptible cultivars (>1300 DNA copies g soil−1) in 47% and 44% of fields in 2013 and 2014 respectively. Furthermore, P. brassicae DNA was indicative of sites at risk of complete crop failure if susceptible cultivars were grown (>50 000 copies g−1 soil) in 14% and 8% of fields in 2013 and 2014, respectively. A survey of all fields at Lanna research station in western Sweden showed that P. brassicae was spread throughout the farm, as only three of the fields (20%) showed infection levels below the detection limit for P.brassicae DNA, while the level was >50,000 DNA copies g−1 soil in 20% of the fields. Soil-borne spread is of critical importance and soil scraped off footwear showed levels of up to 682 million spores g−1 soil. Soil testing is an important tool for determining the presence of P. brassicae and providing an indication of potential yield loss, e.g., in advisory work on planning for a sustainable OSR crop rotation. This soil test is gaining acceptance as a tool that increases the likelihood of success in precision agriculture and in applied research conducted in commercial oilseed fields and at research stations. The present application highlights the importance of prevention of

  3. Electrochemical characterization of thin film electrodes toward developing a DNA transistor.

    PubMed

    Harrer, Stefan; Ahmed, Shafaat; Afzali-Ardakani, Ali; Luan, Binquan; Waggoner, Philip S; Shao, Xiaoyan; Peng, Hongbo; Goldfarb, Dario L; Martyna, Glenn J; Rossnagel, Stephen M; Deligianni, Lili; Stolovitzky, Gustavo A

    2010-12-21

    The DNA-Transistor is a device designed to control the translocation of single-stranded DNA through a solid-state nanopore. Functionality of the device is enabled by three electrodes exposed to the DNA-containing electrolyte solution within the pore and the application of a dynamic electrostatic potential well between the electrodes to temporarily trap a DNA molecule. Optimizing the surface chemistry and electrochemical behavior of the device is a necessary (but by no means sufficient) step toward the development of a functional device. In particular, effects to be eliminated are (i) electrochemically induced surface alteration through corrosion or reduction of the electrode surface and (ii) formation of hydrogen or oxygen bubbles inside the pore through water decomposition. Even though our motivation is to solve problems encountered in DNA transistor technology, in this paper we report on generic surface chemistry results. We investigated a variety of electrode-electrolyte-solvent systems with respect to their capability of suppressing water decomposition and maintaining surface integrity. We employed cyclic voltammetry and long-term amperometry as electrochemical test schemes, X-ray photoelectron spectroscopy, atomic force microscopy, and scanning, as well as transmission electron microscopy as analytical tools. Characterized electrode materials include thin films of Ru, Pt, nonstoichiometric TiN, and nonstoichiometric TiN carrying a custom-developed titanium oxide layer, as well as custom-oxidized nonstoichiometric TiN coated with a monolayer of hexadecylphosphonic acid (HDPA). We used distilled water as well as aqueous solutions of poly(ethylene glycol) (PEG-300) and glycerol as solvents. One millimolar KCl was employed as electrolyte in all solutions. Our results show that the HDPA-coated custom-developed titanium oxide layer effectively passivates the underlying TiN layer, eliminating any surface alterations through corrosion or reduction within a voltage

  4. DBD2BS: connecting a DNA-binding protein with its binding sites.

    PubMed

    Chien, Ting-Ying; Lin, Chih-Kang; Lin, Chih-Wei; Weng, Yi-Zhong; Chen, Chien-Yu; Chang, Darby Tien-Hao

    2012-07-01

    By binding to short and highly conserved DNA sequences in genomes, DNA-binding proteins initiate, enhance or repress biological processes. Accurately identifying such binding sites, often represented by position weight matrices (PWMs), is an important step in understanding the control mechanisms of cells. When given coordinates of a DNA-binding domain (DBD) bound with DNA, a potential function can be used to estimate the change of binding affinity after base substitutions, where the changes can be summarized as a PWM. This technique provides an effective alternative when the chromatin immunoprecipitation data are unavailable for PWM inference. To facilitate the procedure of predicting PWMs based on protein-DNA complexes or even structures of the unbound state, the web server, DBD2BS, is presented in this study. The DBD2BS uses an atom-level knowledge-based potential function to predict PWMs characterizing the sequences to which the query DBD structure can bind. For unbound queries, a list of 1066 DBD-DNA complexes (including 1813 protein chains) is compiled for use as templates for synthesizing bound structures. The DBD2BS provides users with an easy-to-use interface for visualizing the PWMs predicted based on different templates and the spatial relationships of the query protein, the DBDs and the DNAs. The DBD2BS is the first attempt to predict PWMs of DBDs from unbound structures rather than from bound ones. This approach increases the number of existing protein structures that can be exploited when analyzing protein-DNA interactions. In a recent study, the authors showed that the kernel adopted by the DBD2BS can generate PWMs consistent with those obtained from the experimental data. The use of DBD2BS to predict PWMs can be incorporated with sequence-based methods to discover binding sites in genome-wide studies. Available at: http://dbd2bs.csie.ntu.edu.tw/, http://dbd2bs.csbb.ntu.edu.tw/, and http://dbd2bs.ee.ncku.edu.tw.

  5. Quantification of Plasmodiophora brassicae Using a DNA-Based Soil Test Facilitates Sustainable Oilseed Rape Production.

    PubMed

    Wallenhammar, Ann-Charlotte; Gunnarson, Albin; Hansson, Fredrik; Jonsson, Anders

    2016-04-22

    Outbreaks of clubroot disease caused by the soil-borne obligate parasite Plasmodiophora brassicae are common in oilseed rape (OSR) in Sweden. A DNA-based soil testing service that identifies fields where P. brassicae poses a significant risk of clubroot infection is now commercially available. It was applied here in field surveys to monitor the prevalence of P. brassicae DNA in field soils intended for winter OSR production and winter OSR field experiments. In 2013 in Scania, prior to planting, P. brassicae DNA was detected in 60% of 45 fields on 10 of 18 farms. In 2014, P. brassicae DNA was detected in 44% of 59 fields in 14 of 36 farms, in the main winter OSR producing region in southern Sweden. P. brassicae was present indicative of a risk for >10% yield loss with susceptible cultivars (>1300 DNA copies g soil(-1)) in 47% and 44% of fields in 2013 and 2014 respectively. Furthermore, P. brassicae DNA was indicative of sites at risk of complete crop failure if susceptible cultivars were grown (>50 000 copies g(-1) soil) in 14% and 8% of fields in 2013 and 2014, respectively. A survey of all fields at Lanna research station in western Sweden showed that P. brassicae was spread throughout the farm, as only three of the fields (20%) showed infection levels below the detection limit for P.brassicae DNA, while the level was >50,000 DNA copies g(-1) soil in 20% of the fields. Soil-borne spread is of critical importance and soil scraped off footwear showed levels of up to 682 million spores g(-1) soil. Soil testing is an important tool for determining the presence of P. brassicae and providing an indication of potential yield loss, e.g., in advisory work on planning for a sustainable OSR crop rotation. This soil test is gaining acceptance as a tool that increases the likelihood of success in precision agriculture and in applied research conducted in commercial oilseed fields and at research stations. The present application highlights the importance of prevention of

  6. Integrating a DNA Strand Displacement Reaction with a Whispering Gallery Mode Sensor for Label-Free Mercury (II) Ion Detection.

    PubMed

    Wu, Fengchi; Wu, Yuqiang; Niu, Zhongwei; Vollmer, Frank

    2016-07-29

    Mercury is an extremely toxic chemical pollutant of our environment. It has attracted the world's attention due to its high mobility and the ease with which it accumulates in organisms. Sensitive devices and methods specific for detecting mercury ions are, hence, in great need. Here, we have integrated a DNA strand displacement reaction with a whispering gallery mode (WGM) sensor for demonstrating the detection of Hg(2+) ions. Our approach relies on the displacement of a DNA hairpin structure, which forms after the binding of mercury ions to an aptamer DNA sequence. The strand displacement reaction of the DNA aptamer provides highly specific and quantitative means for determining the mercury ion concentration on a label-free WGM sensor platform. Our approach also shows the possibility for manipulating the kinetics of a strand displacement reaction with specific ionic species.

  7. Integrating a DNA Strand Displacement Reaction with a Whispering Gallery Mode Sensor for Label-Free Mercury (II) Ion Detection

    PubMed Central

    Wu, Fengchi; Wu, Yuqiang; Niu, Zhongwei; Vollmer, Frank

    2016-01-01

    Mercury is an extremely toxic chemical pollutant of our environment. It has attracted the world’s attention due to its high mobility and the ease with which it accumulates in organisms. Sensitive devices and methods specific for detecting mercury ions are, hence, in great need. Here, we have integrated a DNA strand displacement reaction with a whispering gallery mode (WGM) sensor for demonstrating the detection of Hg2+ ions. Our approach relies on the displacement of a DNA hairpin structure, which forms after the binding of mercury ions to an aptamer DNA sequence. The strand displacement reaction of the DNA aptamer provides highly specific and quantitative means for determining the mercury ion concentration on a label-free WGM sensor platform. Our approach also shows the possibility for manipulating the kinetics of a strand displacement reaction with specific ionic species. PMID:27483277

  8. Mathematical Analysis of Copy Number Variation in a DNA Sample Using Digital PCR on a Nanofluidic Device

    PubMed Central

    Dube, Simant; Qin, Jian; Ramakrishnan, Ramesh

    2008-01-01

    Copy Number Variations (CNVs) of regions of the human genome have been associated with multiple diseases. We present an algorithm which is mathematically sound and computationally efficient to accurately analyze CNV in a DNA sample utilizing a nanofluidic device, known as the digital array. This numerical algorithm is utilized to compute copy number variation and the associated statistical confidence interval and is based on results from probability theory and statistics. We also provide formulas which can be used as close approximations. PMID:18682853

  9. Molecular Mechanism of Dioxin Action: Molecular Cloning of the Ah Receptor Using a DNA Recognition Site Probe

    DTIC Science & Technology

    1992-01-13

    analysis of AhR binding to the DRE (see attached manuscript an the following brief description of these results) and have bequn the library screening . Although...relatively rapidly as to whether they represent AhR clones or not. As mentioned above, we have only recently begun the library screening . We have obtained a...DNA oligonucleotides, identify the DRE oligonucleotide with the highest binding affinity, optimize the screening protocol and begin the actual library

  10. Simultaneous binding to the tracking strand, displaced strand and the duplex of a DNA fork enhances unwinding by Dda helicase

    PubMed Central

    Aarattuthodiyil, Suja; Byrd, Alicia K.; Raney, Kevin D.

    2014-01-01

    Interactions between helicases and the tracking strand of a DNA substrate are well-characterized; however, the role of the displaced strand is a less understood characteristic of DNA unwinding. Dda helicase exhibited greater processivity when unwinding a DNA fork compared to a ss/ds DNA junction substrate. The lag phase in the unwinding progress curve was reduced for the forked DNA compared to the ss/ds junction. Fewer kinetic steps were required to unwind the fork compared to the ss/ds junction, suggesting that binding to the fork leads to disruption of the duplex. DNA footprinting confirmed that interaction of Dda with a fork leads to two base pairs being disrupted whereas no disruption of base pairing was observed with the ss/ds junction. Neutralization of the phosphodiester backbone resulted in a DNA-footprinting pattern similar to that observed with the ss/ds junction, consistent with disruption of the interaction between Dda and the displaced strand. Several basic residues in the 1A domain which were previously proposed to bind to the incoming duplex DNA were replaced with alanines, resulting in apparent loss of interaction with the duplex. Taken together, these results suggest that Dda interaction with the tracking strand, displaced strand and duplex coordinates DNA unwinding. PMID:25249618

  11. Simultaneous binding to the tracking strand, displaced strand and the duplex of a DNA fork enhances unwinding by Dda helicase.

    PubMed

    Aarattuthodiyil, Suja; Byrd, Alicia K; Raney, Kevin D

    2014-10-01

    Interactions between helicases and the tracking strand of a DNA substrate are well-characterized; however, the role of the displaced strand is a less understood characteristic of DNA unwinding. Dda helicase exhibited greater processivity when unwinding a DNA fork compared to a ss/ds DNA junction substrate. The lag phase in the unwinding progress curve was reduced for the forked DNA compared to the ss/ds junction. Fewer kinetic steps were required to unwind the fork compared to the ss/ds junction, suggesting that binding to the fork leads to disruption of the duplex. DNA footprinting confirmed that interaction of Dda with a fork leads to two base pairs being disrupted whereas no disruption of base pairing was observed with the ss/ds junction. Neutralization of the phosphodiester backbone resulted in a DNA-footprinting pattern similar to that observed with the ss/ds junction, consistent with disruption of the interaction between Dda and the displaced strand. Several basic residues in the 1A domain which were previously proposed to bind to the incoming duplex DNA were replaced with alanines, resulting in apparent loss of interaction with the duplex. Taken together, these results suggest that Dda interaction with the tracking strand, displaced strand and duplex coordinates DNA unwinding.

  12. ampliPHOX Colorimetric Detection on a DNA Microarray for Influenza

    PubMed Central

    Moulton, Kevin R.; Taylor, Amber W.; Rowlen, Kathy L.; Dawson, Erica D.

    2011-01-01

    DNA microarrays have emerged as a powerful tool for pathogen detection.1-5 For instance, many examples of the ability to type and subtype influenza virus have been demonstrated.6-11 The identification and subtyping of influenza on DNA microarrays has applications in both public health and the clinic for early detection, rapid intervention, and minimizing the impact of an influenza pandemic. Traditional fluorescence is currently the most commonly used microarray detection method. However, as microarray technology progresses towards clinical use,1 replacing expensive instrumentation with low cost detection technology exhibiting similar performance characteristics to fluorescence will make microarray assays more attractive and cost-effective. The ampliPHOX colorimetric detection technology is intended for research applications, and has a limit of detection within one order of magnitude of traditional fluorescence11, with a main advantage being an approximate ten-fold lower instrument cost compared to the confocal microarray scanners required for fluorescence microarray detection. Another advantage is the compact size of the instrument which allows for portability and flexibility, unlike traditional fluorescence instruments. Because the polymerization technology is not as inherently linear as fluorescence detection, however, it is best suited for lower density microarray applications in which a yes/no answer for the presence of a certain sequence is desired, such as for pathogen detection arrays. Currently the maximum spot density compatible with ampliPHOX detection is ˜1800 spots/array. Because of the spot density limitations, higher density microarrays are not suitable for ampliPHOX detection. Here, we present ampliPHOX colorimetric detection technology as a method of signal amplification on a low density microarray developed for the detection and characterization of influenza viruses (FluChip). Although this protocol uses the FluChip (a DNA microarray) as one

  13. Probing the recognition surface of a DNA triplex: Binding studies with intercalator-neomycin conjugates

    PubMed Central

    Xue, Liang; Xi, Hongjuan; Kumar, Sunil; Gray, David; Davis, Erik; Hamilton, Paris; Skirba, Michael; Arya, Dev P.

    2012-01-01

    Thermodynamic studies on the interactions between intercalator-neomycin conjugates and a DNA polynucleotide triplex [poly(dA)•2poly(dT)] were conducted. To draw a complete picture of such interactions, naphthalenedimide-neomycin (3) and anthraquinone-neomycin (4) were synthesized and used together with two other analogues, previously synthesized pyrene-neomycin (1) and BQQ-neomycin (2), in our investigations. A combination of experiments including UV denaturation, circular dichroism (CD) titration, differential scanning calorimetry (DSC), and isothermal titration calorimetry (ITC) revealed that all four conjugates (1–4) stabilized poly(dA)•2poly(dT) much greater than its parent compound, neomycin. UV melting experiments clearly showed that the temperature (Tm3→2) at which poly(dA)•2poly(dT) dissociated into poly(dA)•poly(dT) and poly(dT) increased dramatically (> 12 °C) in the presence of intercalator-neomycin (1–4) even at a very low concentration (2 µM). In contrast to intercalator-neomycin conjugates, the increment of Tm3→2 of poly(dA)•2poly(dT) induced by neomycin was negligible under the same conditions. The binding preference of intercalator-neomycin (1–4) to poly(dA)•2poly(dT) was also confirmed by competition dialysis and fluorescent intercalator displacement assay. Circular dichroism titration studies revealed that compound 1–4 had slightly larger binding site size (~7–7.5) with poly(dA)•2poly(dT) as compared to neomycin (~6.5). The thermodynamic parameters of these intercalator-neomycin conjugates with poly(dA)•2poly(dT) were derived from an integrated van’t Hoff equation using the Tm3→2 values, the binding site size numbers, and other parameters obtained from DSC and ITC. The binding affinity of all tested ligands with poly(dA)•2poly(dT) increased in the order neomycin < 1 < 3 < 4 < 2. Amongst them, the binding constant [(2.7 ± 0.3) × 108 M−1] of 2 with poly(dA)•2poly(dT) was the highest, almost 1000 fold more

  14. Probing the recognition surface of a DNA triplex: binding studies with intercalator-neomycin conjugates.

    PubMed

    Xue, Liang; Xi, Hongjuan; Kumar, Sunil; Gray, David; Davis, Erik; Hamilton, Paris; Skriba, Michael; Arya, Dev P

    2010-07-06

    Thermodynamic studies on the interactions between intercalator-neomycin conjugates and a DNA polynucleotide triplex [poly(dA).2poly(dT)] were conducted. To draw a complete picture of such interactions, naphthalene diimide-neomycin (3) and anthraquinone-neomycin (4) conjugates were synthesized and used together with two other analogues, previously synthesized pyrene-neomycin (1) and BQQ-neomycin (2) conjugates, in our investigations. A combination of experiments, including UV denaturation, circular dichroism (CD) titration, differential scanning calorimetry (DSC), and isothermal titration calorimetry (ITC), revealed that all four conjugates (1-4) stabilized poly(dA).2poly(dT) much more than its parent compound, neomycin. UV melting experiments clearly showed that the temperature (T(m3-->2)) at which poly(dA).2poly(dT) dissociated into poly(dA).poly(dT) and poly(dT) increased dramatically (>12 degrees C) in the presence of intercalator-neomycin conjugates (1-4) even at a very low concentration (2 muM). In contrast to intercalator-neomycin conjugates, the increment of T(m3-->2) of poly(dA).2poly(dT) induced by neomycin was negligible under the same conditions. The binding preference of intercalator-neomycin conjugates (1-4) to poly(dA).2poly(dT) was also confirmed by competition dialysis and a fluorescent intercalator displacement assay. Circular dichroism titration studies revealed that compounds 1-4 had slightly larger binding site size ( approximately 7-7.5) with poly(dA).2poly(dT) as compared to neomycin ( approximately 6.5). The thermodynamic parameters of these intercalator-neomycin conjugates with poly(dA).2poly(dT) were derived from an integrated van't Hoff equation using the T(m3-->2) values, the binding site size numbers, and other parameters obtained from DSC and ITC. The binding affinity of all tested ligands with poly(dA).2poly(dT) increased in the following order: neomycin < 1 < 3 < 4 < 2. Among them, the binding constant [(2.7 +/- 0.3) x 10(8) M(-1)] of

  15. Examining the effects of a DNA fingerprinting workshop on science teachers' professional development and student learning

    NASA Astrophysics Data System (ADS)

    Sonmez, Duygu

    behavior. The goal is to understand what factors affect teachers' decision making to implement the new knowledge and skills in their classrooms. For this purpose, the study focuses on the effects of a DNA fingerprinting workshop, which has been developed and is regularly offered by a large Midwestern university in the United States for secondary science teachers and their students through cooperation between the university and a large Midwestern public school district. The workshop focuses on the biotechnology applications of genetics---specifically, use of DNA fingerprinting technology in different areas of social life---while forensic science is emphasized. Results indicate that the teachers' motivation to attend the DNA Fingerprinting professional development workshop was mainly influenced by two variables: (1) the need to improve content knowledge and skills, and (2) requirements associated with current educational policies. Level of content knowledge was also found to be a factor contributing to teachers' motivation to implement the workshop. Concerns related to student maturity and classroom management were also identified as factors influencing teachers' implementation behavior. Evidence that the DNA Fingerprinting workshop can be successfully implemented by classroom teachers was obtained. The DNA fingerprinting workshop was found to be a successful model for packaging professional development experiences for content intensive areas.

  16. Two-step polymerase chain reactions and restriction endonuclease analyses detect and differentiate ompA DNA of Chlamydia spp.

    PubMed Central

    Kaltenboeck, B; Kousoulas, K G; Storz, J

    1992-01-01

    Specific and sensitive amplification of major outer membrane protein (MOMP) gene (ompA) DNA sequences of Chlamydia species with various MOMP genotypes was achieved by a two-step polymerase chain reaction (PCR). Degenerate, inosine-containing oligonucleotide primers homologous to the 5' and 3' ends of the translated regions of all chlamydial MOMP genes were used in a PCR to amplify a DNA fragment of approximately 1,120 bp. A portion of this DNA fragment was amplified in a second genus-specific reaction that yielded a DNA fragment of approximately 930 bp. A pair of degenerate oligonucleotide primers homologous to internal sequences of the primary DNA fragment was used in this PCR. This method detected three cognate chlamydial genomes in a background of 1 microgram of unrelated DNA. MOMP genes of 13 representative chlamydial MOMP genotypes of the species C. trachomatis, C. pneumoniae, and C. psittaci were amplified. In a secondary PCR, group-specific detection was achieved by the simultaneous use of one genus-specific primer and three primers derived from different fingerprint regions of three major groups of chlamydiae. This multiplex PCR differentiated the groups by the length of the amplified DNA fragments and detected the simultaneous presence of DNA sequences of the Chlamydia spp. with different MOMP genotypes. Further differentiation as ompA restriction fragment length polymorphism types among all chlamydial strains with the various MOMP genotypes analyzed here was achieved by restriction endonuclease analysis of the secondary PCR products. DNA sequences corresponding to the ompA restriction fragment length polymorphism type B577 of C. psittaci were detected in two of seven milk samples from cases of bovine mastitis. Images PMID:1349899

  17. Positive and negative regulatory elements in the dnaA-dnaN-recF operon of Escherichia coli.

    PubMed

    Pérez-Roger, I; García-Sogo, M; Navarro-Aviñó, J P; López-Acedo, C; Macián, F; Armengod, M E

    1991-01-01

    The recF gene of E coli lies within a cluster of genes which play essential roles in DNA replication; the gene order is dnaA dnaN recF gyrB. Each of these genes has its own promoters which, with the exception of dnaA promoters, reside entirely within the translated region of the respective preceding gene. In this report, we analyze the effect of the dnaA and dnaN promoters on recF expression by translational fusions between recF and the lacZ reporter gene. Our results indicate that recF is a distal gene of the dnaA operon, and support the previous proposal that dnaN and recF constitute a transcriptional unit under control of the dnaN promoters. They also suggest that dnaA, dnaN and recF are predominantly expressed from the same mRNA although transcriptional and/or post-transcriptional mechanisms should be specifically involved in lowering expression of the recF gene. Recently, we have localized 3 tandem transcription termination sites in the second half of the dnaN gene, downstream from the recF promoters. Neither of them shows the typical features of simple terminators and apparently they do not work in a minimal system of in vitro transcription. In this report, we present evidence that only one of them is dependent on the Rho protein. Although the operon structure allows coordinate expression of dnaA, dnaN and recF, the presence of internal promoters (the dnaN and recF promoters), which appear to be inducible by DNA damage, and intracistronic terminators, whose activity is inversely proportional to the efficiency of translation, permits expression of individual genes to be independently regulated in response to altered growth conditions.

  18. Tankyrase 1 Inhibitors with Drug-like Properties Identified by Screening a DNA-Encoded Chemical Library.

    PubMed

    Samain, Florent; Ekblad, Torun; Mikutis, Gediminas; Zhong, Nan; Zimmermann, Mauro; Nauer, Angela; Bajic, Davor; Decurtins, Willy; Scheuermann, Jörg; Brown, Peter J; Hall, Jonathan; Gräslund, Susanne; Schüler, Herwig; Neri, Dario; Franzini, Raphael M

    2015-06-25

    We describe the synthesis and screening of a DNA-encoded chemical library containing 76230 compounds. In this library, sets of amines and carboxylic acids are directly linked producing encoded compounds with compact structures and drug-like properties. Affinity screening of this library yielded inhibitors of the potential pharmaceutical target tankyrase 1, a poly(ADP-ribose) polymerase. These compounds have drug-like characteristics, and the most potent hit compound (X066/Y469) inhibited tankyrase 1 with an IC50 value of 250 nM.

  19. Invertebrate Iridescent Virus 6, a DNA Virus, Stimulates a Mammalian Innate Immune Response through RIG-I-Like Receptors

    PubMed Central

    Ahlers, Laura R. H.; Bastos, Reginaldo G.; Hiroyasu, Aoi

    2016-01-01

    Insects are not only major vectors of mammalian viruses, but are also host to insect-restricted viruses that can potentially be transmitted to mammals. While mammalian innate immune responses to arboviruses are well studied, less is known about how mammalian cells respond to viruses that are restricted to infect only invertebrates. Here we demonstrate that IIV-6, a DNA virus of the family Iridoviridae, is able to induce a type I interferon-dependent antiviral immune response in mammalian cells. Although IIV-6 is a DNA virus, we demonstrate that the immune response activated during IIV-6 infection is mediated by the RIG-I-like receptor (RLR) pathway, and not the canonical DNA sensing pathway via cGAS/STING. We further show that RNA polymerase III is required for maximal IFN-β secretion, suggesting that viral DNA is transcribed by this enzyme into an RNA species capable of activating the RLR pathway. Finally, we demonstrate that the RLR-driven mammalian innate immune response to IIV-6 is functionally capable of protecting cells from subsequent infection with the arboviruses Vesicular Stomatitis virus and Kunjin virus. These results represent a novel example of an invertebrate DNA virus activating a canonically RNA sensing pathway in the mammalian innate immune response, which reduces viral load of ensuing arboviral infection. PMID:27824940

  20. Development of a DNA macroarray for simultaneous detection of multiple foodborne pathogenic bacteria in fresh chicken meat.

    PubMed

    Kupradit, Chanida; Rodtong, Sureelak; Ketudat-Cairns, Mariena

    2013-12-01

    A DNA macroarray was developed to provide the ability to detect multiple foodborne pathogens in fresh chicken meat. Probes targeted to the 16S rRNA and genus- and species-specific genes, including fimY, ipaH, prfA, and uspA, were selected for the specific detection of Salmonella spp., Shigella spp., Listeria monocytogenes, and Escherichia coli, respectively. The combination of target gene amplification by PCR and a DNA macroarray in our system was able to distinguish all target bacteria from pure cultures with a detection sensitivity of 10⁵ c.f.u. ml⁻¹. The DNA macroarray was also applied to 10 fresh chicken meat samples. The assay validation demonstrated that by combining the enrichment steps for the target bacteria and the DNA macroarray, all 4 target bacteria could be detected simultaneously from the fresh chicken samples. The sensitivity of L. monocytogenes and Shigella boydii detection in the fresh chicken samples was at least 10 and 3 c.f.u. of the initial contamination in 25 g samples, respectively. The advantages of our developed protocol are high accuracy and time reduction when compared to conventional culture. The macroarray developed in our investigation was cost effective compared to modern oligonucleotide microarray techniques because there was no expensive equipment required for the detection of multiple foodborne pathogens.

  1. Patient identification error among prostate needle core biopsy specimens--are we ready for a DNA time-out?

    PubMed

    Suba, Eric J; Pfeifer, John D; Raab, Stephen S

    2007-10-01

    Patient identification errors in surgical pathology often involve switches of prostate or breast needle core biopsy specimens among patients. We assessed strategies for decreasing the occurrence of these uncommon and yet potentially catastrophic events. Root cause analyses were performed following 3 cases of patient identification error involving prostate needle core biopsy specimens. Patient identification errors in surgical pathology result from slips and lapses of automatic human action that may occur at numerous steps during pre-laboratory, laboratory and post-laboratory work flow processes. Patient identification errors among prostate needle biopsies may be difficult to entirely prevent through the optimization of work flow processes. A DNA time-out, whereby DNA polymorphic microsatellite analysis is used to confirm patient identification before radiation therapy or radical surgery, may eliminate patient identification errors among needle biopsies.

  2. A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases

    PubMed Central

    Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

    2008-01-01

    Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases. This article was reviewed by Eugene Koonin and Mark Ragan. PMID:18834537

  3. A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases.

    PubMed

    Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

    2008-10-04

    Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases.

  4. Imaging of transverse electron transfer through a DNA molecule by simultaneous scanning tunneling and frequency-modulation atomic force microscopy.

    PubMed

    Maeda, Yasushi; Matsumoto, Takuya; Kawai, Tomoji

    2011-04-26

    Simultaneous scanning tunneling and frequency-modulation atomic force microscopy (STM/FM-AFM) was applied to a DNA molecule on a Cu(111) surface to analyze transverse electron transfer which is related to the electron transfer and the electrical contact in DNA-based devices. In particular, we demonstrated correlation mapping of the electron transfer parameters by visualizing specific combinations of the decay constant β and the contact conductance G. The results clearly revealed that electron transfer across the DNA strand varies spatially in the DNA molecule. This spatial variation is probably correlated with deformation of DNA on the surface. From quantitative analysis, the decay constant β was estimated to be 3.3 nm(-1), which is consistent with previously reported values for π-conjugated molecules.

  5. Nano-formulation of a photosensitizer using a DNA tetrahedron and its potential for in vivo photodynamic therapy.

    PubMed

    Kim, Kyoung-Ran; Bang, Duhee; Ahn, Dae-Ro

    2016-04-01

    Photodynamic therapy (PDT) is a cytotoxic treatment using singlet oxygen produced by photosensitizers. Approved porphyrinoid PDT still suffers from a lack of robust production methods and low water solubility. Methylene blue (MB) is a good candidate for the PDT drug, because the dye is an effective photosensitizer, can be easily synthesized, and is already being used in other clinical fields. However, its poor cell/tissue penetration and low stability against the reducible biological conditions should be addressed by using a proper delivery vehicle. Here, we employed a DNA tetrahedron, a self-assembled nanostructure as the carrier for intracellular delivery of MB by taking advantage of the DNA binding property of the photosensitizer and demonstrated photo-induced cytotoxicity by the MB delivered by the DNA nanocarrier. We also evaluated the PDT potency of the MB-loaded DNA nanoconstruct in vivo tumor model to suppress tumor growth.

  6. Correction of the DNA repair defect in xeroderma pigmentosum group E by injection of a DNA damage-binding protein

    SciTech Connect

    Keeney, S.; Brody, T.; Linn, S.; Eker, A.P.M.; Vermeulen, W.; Bootsma, D.; Hoeijmakers, J.H.J.

    1994-04-26

    Cells from a subset of patients with the DNA-repair-defective disease xeroderma pigmentosum complementation group E (XP-E) are known to lack a DNA damage-binding (DDB) activity. Purified human DDB protein was injected into XP-E cells to test whether the DNA-repair defect in these cells is caused by a defect in DDB activity. Injected DDB protein stimulated DNA repair to normal levels in those strains that lack the DDB activity but did not stimulate repair in cells from other xeroderma pigmentosum groups or in XP-E cells that contain the activity. These results provide direct evidence that defective DDB activity causes the repair defect in a subset of XP-E patients, which in turn establishes a role for this activity in nucleotide-excision repair in vivo.

  7. Rad25p, a DNA helicase subunit of yeast transcription factor TFIIH, is required for promoter escape in vivo.

    PubMed

    Ostapenko, D; Gileadi, O

    2000-03-07

    The general transcription factor TFIIH is required for initial DNA unwinding and promoter escape by RNA polymerase II in vitro. We examined whether Rad25p, a DNA helicase subunit of TFIIH, mediates promoter opening and promoter escape in the yeast Saccharomyces cerevisiae. DNA unwinding was probed with an in vivo permanganate reactivity assay, in a temperature-sensitive mutant of RAD25. The consequences of Rad25p inactivation were promoter-specific. Whereas in the TDH2 promoter permanganate reactivity was entirely abolished, the reactivity at the GAL1 and GAL10 promoter regions was only moderately affected. In the GAL genes permanganate reactivity uniformly decreased downstream of the transcription start site, indicating that progression of RNA polymerase II to this region was impaired. Our results suggest that in yeast cells, promoter opening is not sufficient for productive initiation and that Rad25p-mediated promoter escape may be a limiting step in the transcription of some promoters.

  8. Discovery of TNF inhibitors from a DNA-encoded chemical library based on diels-alder cycloaddition.

    PubMed

    Buller, Fabian; Zhang, Yixin; Scheuermann, Jörg; Schäfer, Juliane; Bühlmann, Peter; Neri, Dario

    2009-10-30

    DNA-encoded chemical libraries are promising tools for the discovery of ligands toward protein targets of pharmaceutical relevance. DNA-encoded small molecules can be enriched in affinity-based selections and their unique DNA "barcode" allows the amplification and identification by high-throughput sequencing. We describe selection experiments using a DNA-encoded 4000-compound library generated by Diels-Alder cycloadditions. High-throughput sequencing enabled the identification and relative quantification of library members before and after selection. Sequence enrichment profiles corresponding to the "bar-coded" library members were validated by affinity measurements of single compounds. We were able to affinity mature trypsin inhibitors and identify a series of albumin binders for the conjugation of pharmaceuticals. Furthermore, we discovered a ligand for the antiapoptotic Bcl-xL protein and a class of tumor necrosis factor (TNF) binders that completely inhibited TNF-mediated killing of L-M fibroblasts in vitro.

  9. Development of a DNA probe for the myxosporean parasite, Ceratomyxa shasta, using the polymerase chain reaction with arbitrary primers

    USGS Publications Warehouse

    Bartholomew, Jerri L; Rodriguez, Rusty J.; Arakawa, Cindy K.

    1995-01-01

    The arbitrarily primed polymerase chain reaction (PCR) was used to generate a DNA marker specific for the myxosporean parasite Ceratomyxa shasta. The [32~]-labeled marker hybridized to purified C. shasta DNA and to parasite DNA combined with salmonid DNA in a dot blot assay, demonstrating its potential as a diagnostic tool. The amplified DNA segment was cloned and sequenced, and primers specific for the marker were designed. When these primers were used in a standard PCR assay, DNA was amplified from C. shasta and from infected fish tissues, but not from uninfected fish tissues or from 2 other myxosporean parasites. The sensitivity of the PCR assay will permit detection of low levels of C. shasta from infected fish or oligochaetes and will be useful in defining the parasite's life cycle as well as examining its impact on salmonid populatiosn

  10. A DNA Vaccine Formulated with Chemical Adjuvant Provides Partial Protection against Bovine Herpes Virus Infection in Cattle.

    PubMed

    Quattrocchi, Valeria; Soria, Ivana; Langellotti, Cecilia Ana; Gnazzo, Victoria; Gammella, Mariela; Moore, Dadin P; Zamorano, Patricia I

    2017-01-01

    Bovine herpesvirus-1 (BoHV-1) is the causative agent of bovine infectious rhinotracheitis, an important disease worldwide. Although conventional BoHV-1 vaccines, including those based on the use of modified live virus and also inactivated vaccines, are currently used in many countries, they have several disadvantages. DNA vaccines have emerged as an attractive approach since they have the potential to induce both humoral and cellular immune response; nevertheless, it is largely known that potency of naked DNA vaccines is limited. We demonstrated previously, in the murine model, that the use of adjuvants in combination with a DNA vaccine against BoHV-1 is immunologically beneficial. In this study, we evaluate the immune response and protection against challenge elicited in bovines, by a DNA vaccine carrying the sequence of secreted version of glycoprotein D (gD) of BoHV-1 formulated with chemical adjuvants. Bovines were vaccinated with formulations containing the sequence of gD alone or in combination with adjuvants ESSAI 903110 or Montanide™ 1113101PR. After prime vaccination and two boosters, animals were challenged with infectious BoHV-1. Formulations containing adjuvants Montanide™ 1113101PR and ESSAI 903110 were both, capable of increasing humoral immune response against the virus and diminishing clinical symptoms. Nevertheless, only formulations containing adjuvant Montanide™ 1113101PR was capable of improving cellular immune response and diminishing viral excretion. To our knowledge, it is the first time that a BoHV-1 DNA vaccine is combined with adjuvants and tested in cattle. These results could be useful to design a vaccine for the control of bovine rhinotracheitis.

  11. A calmodulin binding protein from Arabidopsis is induced by ethylene and contains a DNA-binding motif

    NASA Technical Reports Server (NTRS)

    Reddy, A. S.; Reddy, V. S.; Golovkin, M.

    2000-01-01

    Calmodulin (CaM), a key calcium sensor in all eukaryotes, regulates diverse cellular processes by interacting with other proteins. To isolate CaM binding proteins involved in ethylene signal transduction, we screened an expression library prepared from ethylene-treated Arabidopsis seedlings with 35S-labeled CaM. A cDNA clone, EICBP (Ethylene-Induced CaM Binding Protein), encoding a protein that interacts with activated CaM was isolated in this screening. The CaM binding domain in EICBP was mapped to the C-terminus of the protein. These results indicate that calcium, through CaM, could regulate the activity of EICBP. The EICBP is expressed in different tissues and its expression in seedlings is induced by ethylene. The EICBP contains, in addition to a CaM binding domain, several features that are typical of transcription factors. These include a DNA-binding domain at the N terminus, an acidic region at the C terminus, and nuclear localization signals. In database searches a partial cDNA (CG-1) encoding a DNA-binding motif from parsley and an ethylene up-regulated partial cDNA from tomato (ER66) showed significant similarity to EICBP. In addition, five hypothetical proteins in the Arabidopsis genome also showed a very high sequence similarity with EICBP, indicating that there are several EICBP-related proteins in Arabidopsis. The structural features of EICBP are conserved in all EICBP-related proteins in Arabidopsis, suggesting that they may constitute a new family of DNA binding proteins and are likely to be involved in modulating gene expression in the presence of ethylene.

  12. rgpA DNA vaccine induces antibody response and prevents alveolar bone loss in experimental peri-implantitis.

    PubMed

    Fan, Xin; Wang, Zhifeng; Ji, Ping; Bian, Yuanyuan; Lan, Jing

    2013-06-01

    Peri-implantitis is one of many reasons for dental implant failure. This study is designed to prevent experimental peri-implantitis by arginine-specific gingipain A (rgpA) DNA vaccine. The bilateral mandibular second and third premolars from 15 male beagle dogs were extracted, and 60 implants were immediately implanted. Three months after implantation, the animals were randomly divided into groups A, B, and C and immunized with plasmid vector-rgpA, heat-killed Porphyromonas gingivalis, and plasmid vector, respectively. Cotton ligatures infiltrated with P. gingivalis were placed in the submarginal position around the neck of the implants to induce peri-implantitis. Clinical measurements, including probing depth (PD) and bleeding on probing, were recorded every 2 weeks postoperatively, and P. gingivalis-specific immunoglobulin G (IgG) in serum and secretory IgA (sIgA) in saliva were quantitatively analyzed by enzyme-linked immunosorbent assay at the same time. Animals were sacrificed after 6 weeks, 50-μm undecalcified histologic sections were prepared using methylene blue dye, and bone loss around implants was measured. Higher levels of IgG in serum and sIgA in saliva could be measured in groups A and B but not in group C after immunization. There were statistical differences (P <0.05) between, before, and after immunization, but no difference was found between groups A and B (P >0.05). Both peri-implant PD and bone loss in group A were significantly less than in groups B and C. IgG and sIgA could be generated by immunization with rgpA DNA vaccine, which could significantly slow down bone loss in the experimental peri-implantitis canine model.

  13. A DNA Vaccine Formulated with Chemical Adjuvant Provides Partial Protection against Bovine Herpes Virus Infection in Cattle

    PubMed Central

    Quattrocchi, Valeria; Soria, Ivana; Langellotti, Cecilia Ana; Gnazzo, Victoria; Gammella, Mariela; Moore, Dadin P.; Zamorano, Patricia I.

    2017-01-01

    Bovine herpesvirus-1 (BoHV-1) is the causative agent of bovine infectious rhinotracheitis, an important disease worldwide. Although conventional BoHV-1 vaccines, including those based on the use of modified live virus and also inactivated vaccines, are currently used in many countries, they have several disadvantages. DNA vaccines have emerged as an attractive approach since they have the potential to induce both humoral and cellular immune response; nevertheless, it is largely known that potency of naked DNA vaccines is limited. We demonstrated previously, in the murine model, that the use of adjuvants in combination with a DNA vaccine against BoHV-1 is immunologically beneficial. In this study, we evaluate the immune response and protection against challenge elicited in bovines, by a DNA vaccine carrying the sequence of secreted version of glycoprotein D (gD) of BoHV-1 formulated with chemical adjuvants. Bovines were vaccinated with formulations containing the sequence of gD alone or in combination with adjuvants ESSAI 903110 or Montanide™ 1113101PR. After prime vaccination and two boosters, animals were challenged with infectious BoHV-1. Formulations containing adjuvants Montanide™ 1113101PR and ESSAI 903110 were both, capable of increasing humoral immune response against the virus and diminishing clinical symptoms. Nevertheless, only formulations containing adjuvant Montanide™ 1113101PR was capable of improving cellular immune response and diminishing viral excretion. To our knowledge, it is the first time that a BoHV-1 DNA vaccine is combined with adjuvants and tested in cattle. These results could be useful to design a vaccine for the control of bovine rhinotracheitis. PMID:28179907

  14. A calmodulin binding protein from Arabidopsis is induced by ethylene and contains a DNA-binding motif

    NASA Technical Reports Server (NTRS)

    Reddy, A. S.; Reddy, V. S.; Golovkin, M.

    2000-01-01

    Calmodulin (CaM), a key calcium sensor in all eukaryotes, regulates diverse cellular processes by interacting with other proteins. To isolate CaM binding proteins involved in ethylene signal transduction, we screened an expression library prepared from ethylene-treated Arabidopsis seedlings with 35S-labeled CaM. A cDNA clone, EICBP (Ethylene-Induced CaM Binding Protein), encoding a protein that interacts with activated CaM was isolated in this screening. The CaM binding domain in EICBP was mapped to the C-terminus of the protein. These results indicate that calcium, through CaM, could regulate the activity of EICBP. The EICBP is expressed in different tissues and its expression in seedlings is induced by ethylene. The EICBP contains, in addition to a CaM binding domain, several features that are typical of transcription factors. These include a DNA-binding domain at the N terminus, an acidic region at the C terminus, and nuclear localization signals. In database searches a partial cDNA (CG-1) encoding a DNA-binding motif from parsley and an ethylene up-regulated partial cDNA from tomato (ER66) showed significant similarity to EICBP. In addition, five hypothetical proteins in the Arabidopsis genome also showed a very high sequence similarity with EICBP, indicating that there are several EICBP-related proteins in Arabidopsis. The structural features of EICBP are conserved in all EICBP-related proteins in Arabidopsis, suggesting that they may constitute a new family of DNA binding proteins and are likely to be involved in modulating gene expression in the presence of ethylene.

  15. Persistence of DNA of Gaeumannomyces graminis var. tritici in soil as measured by a DNA-based assay.

    PubMed

    Herdina; Neate, Stephen; Jabaji-Hare, Suha; Ophel-Keller, Kathy

    2004-02-01

    There are an increasing number of assays available for fungal plant pathogens based on DNA technology. We have developed such an assay for Gaeumannomyces graminis var. tritici (Ggt) in soil, using slot-blot hybridisation. To ensure the validity of DNA-based soil assays for the fungus, it is important to determine the stability of Ggt DNA in soil. This study was undertaken to quantify the DNA degradation of dead Ggt in soil using a DNA-based assay. Mycelia were killed using various treatments, then DNA was extracted and estimated by a slot-blot hybridisation technique using the specific Ggt DNA probe, pG158. Mycelia were also killed using a fungicide (triadimefon) at a concentration of 150-250 microg ml(-1). The amount of detectable DNA of Ggt, killed using triadimefon, declined by 82-93%. Inoculum in the form of diseased wheat roots, artificially inoculated ryegrass seed, particulate soil organic matter and whole soil was killed using heat-treatment. The amount of detectable DNA of Ggt declined markedly (90%) in both heat-treated roots and inoculated ryegrass seeds, and declined by 50% in both treated soil and soil organic matter. The rate of DNA degradation of Ggt in soil varied with the type of inoculum. The amount of detectable DNA of Ggt in dead mycelia declined by 99.8% after 4 days of incubation in soil. No DNA was detected after 8 days of incubation. In contrast, Ggt DNA in live mycelia declined by 70% after 8 days of incubation and declined to 10% of original DNA level after 32 days. In ground ryegrass seed inoculum, DNA in both killed and live Ggt declined by 50% after 8 days. In diseased roots, DNA from both live and killed Ggt did not appear to decline over 16 days. Estimates of the amount of Ggt in the soil using a DNA-based assay reflect both live and dead populations of the fungus. The rate of breakdown of DNA of the dead fungus is very high and the presence of dead fungi in roots probably a rare event so the DNA from dead fungus probably contributes

  16. A DNA biosensor based on a morpholino oligomer coated indium-tin oxide electrode and a cationic redox polymer.

    PubMed

    Gao, Zhiqiang; Ting, Boon Ping

    2009-05-01

    A simple and ultrasensitive electrochemical biosensor employing a morpholino oligomer as capture probe and a cationic redox polymer as signal generator for direct detection of DNA is presented in this report. It is based on the immobilization of the morpholino oligomer on an indium-tin oxide (ITO) electrode and amperometric detection of target DNA by forming a DNA/cationic redox polymer bilayer on the ITO electrode. After hybridizing the morpholino capture probe (MCP) to the target DNA, the cationic redox polymer was introduced to the ITO electrode via electrostatic interaction with the hybridized DNA. The deposited redox polymer exhibited excellent electrocatalytic activity towards the oxidation of ascorbic acid (AA), allowing for direct voltammetric and amperometric detection of DNA. Under optimized experimental conditions, a detection limit of 1.0 pM and linear current-concentration relationship up to 500 pM were obtained in amperometry. The resulting biosensors offered much better mismatch discrimination against mismatch sequences than their DNA counterparts.

  17. A microenvironment-sensitive fluorescent pyrimidine ribonucleoside analogue: synthesis, enzymatic incorporation, and fluorescence detection of a DNA abasic site.

    PubMed

    Tanpure, Arun A; Srivatsan, Seergazhi G

    2011-11-04

    Base-modified fluorescent ribonucleoside-analogue probes are valuable tools in monitoring RNA structure and function because they closely resemble the structure of natural nucleobases. Especially, 2-aminopurine, a highly environment-sensitive adenosine analogue, is the most extensively utilized fluorescent nucleoside analogue. However, only a few isosteric pyrimidine ribonucleoside analogues that are suitable for probing the structure and recognition properties of RNA molecules are available. Herein, we describe the synthesis and photophysical characterization of a small series of base-modified pyrimidine ribonucleoside analogues derived from tagging indole, N-methylindole, and benzofuran onto the 5-position of uracil. One of the analogues, based on a 5-(benzofuran-2-yl)pyrimidine core, shows emission in the visible region with a reasonable quantum yield and, importantly, displays excellent solvatochromism. The corresponding triphosphate substrate is effectively incorporated into oligoribonucleotides by T7 RNA polymerase to produce fluorescent oligoribonucleotide constructs. Steady-state and time-resolved spectroscopic studies with fluorescent oligoribonucleotide constructs demonstrate that the fluorescent ribonucleoside photophysically responds to subtle changes in its environment brought about by the interaction of the chromophore with neighboring bases. In particular, the emissive ribonucleoside, if incorporated into an oligoribonucleotide, positively reports the presence of a DNA abasic site with an appreciable enhancement in fluorescence intensity. The straightforward synthesis, amicability to enzymatic incorporation, and sensitivity to changes in the microenvironment highlight the potential of the benzofuran-conjugated pyrimidine ribonucleoside as an efficient fluorescent probe to investigate nucleic acid structure, dynamics, and recognition events.

  18. In Vitro Synthesis of Rous Sarcoma Virus-Specific RNA is Catalyzed by a DNA-Dependent RNA Polymerase

    PubMed Central

    Rymo, L.; Parsons, J. T.; Coffin, J. M.; Weissmann, C.

    1974-01-01

    Synthesis of Rous sarcoma virus RNA was examined in vitro with a new assay for radioactive virus-specific RNA. Nuclei from infected and uninfected cells were incubated with ribonucleoside [α-32P]triphosphates, Mn++, Mg++ and (NH4)2SO4. Incorporation into total and viral RNA proceeded with similar kinetics for up to 25 min at 37°. About 0.5% of the RNA synthesized by the infected system was scored as virus-specific, compared to 0.03% of the RNA from the uninfected system and 0.005% of the RNA synthesized by monkey kidney cell nuclei. Preincubation with DNase or actinomycin D completely suppressed total and virus-specific RNA synthesis. α-Amanitin, a specific inhibitor of eukaryotic RNA polymerase II, completely inhibited virus-specific RNA synthesis, while reducing total RNA synthesis by only 50%. We conclude that tumor virus-specific RNA is synthesized on a DNA template, most probably by the host's RNA polymerase II. PMID:4368801

  19. Direct visualization of the reaction transformation and signal amplification in a DNA molecular machine with total internal reflection fluorescence microscopy

    PubMed Central

    Ren, Rui; Wang, Haiyan; Liu, Rui; Zhang, Shusheng

    2013-01-01

    In this study, as a proof of concept, the signal amplification in an artificial DNA molecular machine was directly visualized via total internal reflection fluorescence microscopy (TIRFM). The molecular machine brought about obvious morphology change in DNA nanostructures as well as signal amplifications. On one hand, through a triggered and autonomically repeated RCA, a DNA nano-complex featuring a “locked” circular DNA template (serving as raw feed) was converted into a long periodically repeated strand, i.e., the RCA products. On the other hand, this RCA was repeated in three controllable reaction phases, bring about progressive signal amplification. It was testified that the RCA products (presented as long thread-like fluorescent objects) can be easily distinguished from the inputted DNA probes (presented as fluorescent dots), thus the transformation in reaction can be visualized. Also, by quantitive counting of the aforementioned fluorescence objects, the progress of the reaction through the phases, along with time, and over the lysozyme concentration can be demonstrated through TIRFM visualization. Overall, it was demonstrated that TIRFM is an efficient approach to quantitatively visualize the biochemical processes at single-molecule level. PMID:24790951

  20. The structure of M.EcoKI Type I DNA methyltransferase with a DNA mimic antirestriction protein.

    PubMed

    Kennaway, Christopher K; Obarska-Kosinska, Agnieszka; White, John H; Tuszynska, Irina; Cooper, Laurie P; Bujnicki, Janusz M; Trinick, John; Dryden, David T F

    2009-02-01

    Type-I DNA restriction-modification (R/M) systems are important agents in limiting the transmission of mobile genetic elements responsible for spreading bacterial resistance to antibiotics. EcoKI, a Type I R/M enzyme from Escherichia coli, acts by methylation- and sequence-specific recognition, leading to either methylation of DNA or translocation and cutting at a random site, often hundreds of base pairs away. Consisting of one specificity subunit, two modification subunits, and two DNA translocase/endonuclease subunits, EcoKI is inhibited by the T7 phage antirestriction protein ocr, a DNA mimic. We present a 3D density map generated by negative-stain electron microscopy and single particle analysis of the central core of the restriction complex, the M.EcoKI M(2)S(1) methyltransferase, bound to ocr. We also present complete atomic models of M.EcoKI in complex with ocr and its cognate DNA giving a clear picture of the overall clamp-like operation of the enzyme. The model is consistent with a large body of experimental data on EcoKI published over 40 years.

  1. The structure of M.EcoKI Type I DNA methyltransferase with a DNA mimic antirestriction protein

    PubMed Central

    Kennaway, Christopher K.; Obarska-Kosinska, Agnieszka; White, John H.; Tuszynska, Irina; Cooper, Laurie P.; Bujnicki, Janusz M.; Trinick, John; Dryden, David T. F.

    2009-01-01

    Type-I DNA restriction–modification (R/M) systems are important agents in limiting the transmission of mobile genetic elements responsible for spreading bacterial resistance to antibiotics. EcoKI, a Type I R/M enzyme from Escherichia coli, acts by methylation- and sequence-specific recognition, leading to either methylation of DNA or translocation and cutting at a random site, often hundreds of base pairs away. Consisting of one specificity subunit, two modification subunits, and two DNA translocase/endonuclease subunits, EcoKI is inhibited by the T7 phage antirestriction protein ocr, a DNA mimic. We present a 3D density map generated by negative-stain electron microscopy and single particle analysis of the central core of the restriction complex, the M.EcoKI M2S1 methyltransferase, bound to ocr. We also present complete atomic models of M.EcoKI in complex with ocr and its cognate DNA giving a clear picture of the overall clamp-like operation of the enzyme. The model is consistent with a large body of experimental data on EcoKI published over 40 years. PMID:19074193

  2. Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

    PubMed Central

    Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

    2013-01-01

    Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

  3. Development of a DNA Array for the Simple Identification of Major Filamentous Fungi in the Beverage Manufacturing Environment.

    PubMed

    Aoyama, Fuyuki; Miyamoto, Takahisa

    2016-01-01

    Filamentous fungi were isolated from the indoor environment of a soft drink manufacturing plant and ordinary residences. The isolated strains were identified based on morphological observation and the nucleotide sequences of the region near the D2 region of the 26S rDNA. Three genera (Aspergillus, Penicillium, and Cladosporium) accounted for 48.1% of the fungal strains detected in the manufacturing plant and 75.3% in residences. A DNA array for identification of 15 genera and 26 species of filamentous fungi that were most frequently isolated from the manufacturing plant was developed. Genus- and species-specific probes with 13- to 20-mer were designed on the basis of the nucleotide sequences in the D2 region. The probes were affixed to a microscope slide after modifying an amino group at the 5'or 3'end. To prevent erroneous identification, 2 or 3 probes were designed for each of the target genera and species. The developed DNA array method correctly identified 9 genera (Alternaria, Aureobasidium, Cladosporium, Curvularia, Exophiala, Fusarium, Penicillium, Phoma, and Trichoderma) and 26 species belonging to 6 genera (Aspergillus, Neosartorya, Byssochlamys, Talaromyces, Paecilomyces, and Purpureocillium) in the strains isolated from the indoor environment. Identification results obtained by this DNA array method of fungi isolated from the manufacturing plant were consistent with those by the conventional method.

  4. Non-covalent interactions between ATP and RecA DNA-repairing proteins: DFT and semiempirical calculations

    NASA Astrophysics Data System (ADS)

    Rodriguez, Jorge

    2015-03-01

    The role of Bacterial RecA in the structural maintenance of genomes and the genetic information they carry has been established. In particular, the RecA DNA-repairing protein from D. Radiodurans, a radiation-resistant bacteria, is crucial for the repair of double strand breaks (DSBs). We have performed semi-empirical free-energy calculations and QM/MM calculations to study their non-covalent interactions with ATP and ADP. Such studies provide insight into the mechanisms of ATP/ADP --> RecA energy transfer and, therefore, about specific functional uses of incoming energy for DNA repairing mechanisms. We present a detailed analysis of the non-covalent interactions which minimize the interaction Gibbs free energies leading to the most stable non-covalent binding sites. Van der Waal, hydrogen bonding and electrostatic interactions has been quantified which provides a detailed insight into the mechanisms of ATP-RecA interaction. Further, possible chemical interactions and functional roles of RecA proteins are explored based on the previously mentioned studies. Acknowledgements: Funded, in part, by DTRA award 106339 (JHR). Dr. Mark C. Palenik and Mrs. Lora Beard are gratefully acknowledged Supported in part by DTRA Award 106339.

  5. Tumor-specific immunity and antiangiogenesis generated by a DNA vaccine encoding calreticulin linked to a tumor antigen.

    PubMed

    Cheng, W F; Hung, C F; Chai, C Y; Hsu, K F; He, L; Ling, M; Wu, T C

    2001-09-01

    Antigen-specific cancer immunotherapy and antiangiogenesis have emerged as two attractive strategies for cancer treatment. An innovative approach that combines both mechanisms will likely generate the most potent antitumor effect. We tested this approach using calreticulin (CRT), which has demonstrated the ability to enhance MHC class I presentation and exhibit an antiangiogenic effect. We explored the linkage of CRT to a model tumor antigen, human papilloma virus type-16 (HPV-16) E7, for the development of a DNA vaccine. We found that C57BL/6 mice vaccinated intradermally with CRT/E7 DNA exhibited a dramatic increase in E7-specific CD8(+) T cell precursors and an impressive antitumor effect against E7-expressing tumors compared with mice vaccinated with wild-type E7 DNA or CRT DNA. Vaccination of CD4/CD8 double-depleted C57BL/6 mice and immunocompromised (BALB/c nu/nu) mice with CRT/E7 DNA or CRT DNA generated significant reduction of lung tumor nodules compared with wild-type E7 DNA, suggesting that antiangiogenesis may have contributed to the antitumor effect. Examination of microvessel density in lung tumor nodules and an in vivo angiogenesis assay further confirmed the antiangiogenic effect generated by CRT/E7 and CRT. Thus, cancer therapy using CRT linked to a tumor antigen holds promise for treating tumors by combining antigen-specific immunotherapy and antiangiogenesis.

  6. Building a DNA barcode reference library for the true butterflies (Lepidoptera) of Peninsula Malaysia: what about the subspecies?

    PubMed

    Wilson, John-James; Sing, Kong-Wah; Sofian-Azirun, Mohd

    2013-01-01

    The objective of this study was to build a DNA barcode reference library for the true butterflies of Peninsula Malaysia and assess the value of attaching subspecies names to DNA barcode records. A new DNA barcode library was constructed with butterflies from the Museum of Zoology, University of Malaya collection. The library was analysed in conjunction with publicly available DNA barcodes from other Asia-Pacific localities to test the ability of the DNA barcodes to discriminate species and subspecies. Analyses confirmed the capacity of the new DNA barcode reference library to distinguish the vast majority of species (92%) and revealed that most subspecies possessed unique DNA barcodes (84%). In some cases conspecific subspecies exhibited genetic distances between their DNA barcodes that are typically seen between species, and these were often taxa that have previously been regarded as full species. Subspecies designations as shorthand for geographically and morphologically differentiated groups provide a useful heuristic for assessing how such groups correlate with clustering patterns of DNA barcodes, especially as the number of DNA barcodes per species in reference libraries increases. Our study demonstrates the value in attaching subspecies names to DNA barcode records as they can reveal a history of taxonomic concepts and expose important units of biodiversity.

  7. "Giant surfactants" created by the fast and efficient functionalization of a DNA tetrahedron with a temperature-responsive polymer.

    PubMed

    Wilks, Thomas R; Bath, Jonathan; de Vries, Jan Willem; Raymond, Jeffery E; Herrmann, Andreas; Turberfield, Andrew J; O'Reilly, Rachel K

    2013-10-22

    Copper catalyzed azide-alkyne cycloaddition (CuAAC) was employed to synthesize DNA block copolymers (DBCs) with a range of polymer blocks including temperature-responsive poly(N-isoproylacrylamide) (poly(NIPAM)) and highly hydrophobic poly(styrene). Exceptionally high yields were achieved at low DNA concentrations, in organic solvents, and in the absence of any solid support. The DNA segment of the DBC remained capable of sequence-specific hybridization: it was used to assemble a precisely defined nanostructure, a DNA tetrahedron, with pendant poly(NIPAM) segments. In the presence of an excess of poly(NIPAM) homopolymer, the tetrahedron-poly(NIPAM) conjugate nucleated the formation of large, well-defined nanoparticles at 40 °C, a temperature at which the homopolymer precipitated from solution. These composite nanoparticles were observed by dynamic light scattering and cryoTEM, and their hybrid nature was confirmed by AFM imaging. As a result of the large effective surface area of the tetrahedron, only very low concentrations of the conjugate were required in order for this surfactant-like behavior to be observed.

  8. Development of a DNA Microarray for Enterococcal Species, Virulence, and Antibiotic Resistance Gene Determinations among Isolates from Poultry▿

    PubMed Central

    Champagne, J.; Diarra, M. S.; Rempel, H.; Topp, E.; Greer, C. W.; Harel, J.; Masson, L.

    2011-01-01

    A DNA microarray (Enteroarray) was designed with probes targeting four species-specific taxonomic identifiers to discriminate among 18 different enterococcal species, while other probes were designed to identify 18 virulence factors and 174 antibiotic resistance genes. In total, 262 genes were utilized for rapid species identification of enterococcal isolates, while characterizing their virulence potential through the simultaneous identification of endogenous antibiotic resistance and virulence genes. Enterococcal isolates from broiler chicken farms were initially identified by using the API 20 Strep system, and the results were compared to those obtained with the taxonomic genes atpA, recA, pheS, and ddl represented on our microarray. Among the 171 isolates studied, five different enterococcal species were identified by using the API 20 Strep system: Enterococcus faecium, E. faecalis, E. durans, E. gallinarum, and E. avium. The Enteroarray detected the same species as API 20 Strep, as well as two more: E. casseliflavus and E. hirae. Species comparisons resulted in 15% (27 isolates) disagreement between the two methods among the five API 20 Strep identifiable species and 24% (42 isolates) disagreement when considering the seven Enteroarray identified species. The species specificity of key antibiotic and virulence genes identified by the Enteroarray were consistent with the literature adding further robustness to the redundant taxonomic probe data. Sequencing of the cpn60 gene further confirmed the complete accuracy of the microarray results. The new Enteroarray should prove to be a useful tool to accurately genotype strains of enterococci and assess their virulence potential. PMID:21335389

  9. Assessment of delivery parameters with the multi-electrode array for development of a DNA vaccine against Bacillus anthracis.

    PubMed

    Donate, Amy; Heller, Richard

    2013-12-01

    Gene electrotransfer (GET) enhances delivery of DNA vaccines by increasing both gene expression and immune responses. Our lab has developed the multi-electrode array (MEA) for DNA delivery to skin. The MEA was used at constant pulse duration (150 ms) and frequency (6.67 Hz). In this study, delivery parameters including applied voltage (5-45 V), amount of plasmid (100-300 μg), and number of treatments (2-3) were evaluated for delivery of a DNA vaccine. Mice were intradermally injected with plasmid expressing Bacillus anthracis protective antigen with or without GET and αPA serum titers measured. Within this experiment no significant differences were noted in antibody levels from varying dose or treatment number. However, significant differences were measured from applied voltages of 25 and 35 V. These voltages generated antibody levels between 20,000 and 25,000. Serum from animals vaccinated with these conditions also resulted in toxin neutralization in 40-60% of animals. Visual damage was noted at MEA conditions of 40 V. No damage was noted either visually or histologically from conditions of 35 V or below. These results reflect the importance of establishing appropriate electrical parameters and the potential for the MEA in non-invasive DNA vaccination against B. anthracis.

  10. Building a DNA Barcode Reference Library for the True Butterflies (Lepidoptera) of Peninsula Malaysia: What about the Subspecies?

    PubMed Central

    Wilson, John-James; Sing, Kong-Wah; Sofian-Azirun, Mohd

    2013-01-01

    The objective of this study was to build a DNA barcode reference library for the true butterflies of Peninsula Malaysia and assess the value of attaching subspecies names to DNA barcode records. A new DNA barcode library was constructed with butterflies from the Museum of Zoology, University of Malaya collection. The library was analysed in conjunction with publicly available DNA barcodes from other Asia-Pacific localities to test the ability of the DNA barcodes to discriminate species and subspecies. Analyses confirmed the capacity of the new DNA barcode reference library to distinguish the vast majority of species (92%) and revealed that most subspecies possessed unique DNA barcodes (84%). In some cases conspecific subspecies exhibited genetic distances between their DNA barcodes that are typically seen between species, and these were often taxa that have previously been regarded as full species. Subspecies designations as shorthand for geographically and morphologically differentiated groups provide a useful heuristic for assessing how such groups correlate with clustering patterns of DNA barcodes, especially as the number of DNA barcodes per species in reference libraries increases. Our study demonstrates the value in attaching subspecies names to DNA barcode records as they can reveal a history of taxonomic concepts and expose important units of biodiversity. PMID:24282514

  11. Nanogram quantities of a DNA vaccine protect rainbow trout fry against heterologous strains of infectious hematopoietic necrosis virus

    USGS Publications Warehouse

    Corbeil, S.; LaPatra, S.E.; Anderson, E.D.; Kurath, G.

    2000-01-01

    The efficacy of a DNA vaccine containing the glycoprotein gene of infectious hematopoietic necrosis virus (IHNV), a rhabdovirus affecting trout and salmon, was investigated. The minimal dose of vaccine required, the protection against heterologous strains, and the titers of neutralizing antibodies produced were used to evaluate the potential of the vaccine as a control pharmaceutical. Results indicated that a single dose of as little as 1–10 ng of vaccine protected rainbow trout fry against waterborne challenge by IHNV. An optimal dose of 100 ng per fish was selected to assure strong protection under various conditions. Neutralizing antibody titers were detected in fish vaccinated with concentrations of DNA ranging from 5 to 0.01 μg. Furthermore, the DNA vaccine protected fish against a broad range of viral strains from different geographic locations, including isolates from France and Japan, suggesting that the vaccine could be used worldwide. A single dose of this DNA vaccine induced protection in fish at a lower dose than is usually reported in mammalian DNA vaccine studies.

  12. Protective antibody responses against Clostridium difficile elicited by a DNA vaccine expressing the enzymatic domain of toxin B.

    PubMed

    Jin, Ke; Wang, Shixia; Zhang, Chunhua; Xiao, Yanling; Lu, Shan; Huang, Zuhu

    2013-01-01

    A DNA vaccination approach was used in the current study to screen for the immunogenicity of different fragments of toxin A and toxin B from Clostridium difficile. With this approach, protein antigens do not need to be produced in vitro and the immunogenicity of candidate C. difficile antigens can be identified directly in animals. Codon optimized toxin gene fragments were individually cloned into the DNA vaccine vector and tested in mice and rabbits for their ability to elicit C. difficile toxin-specific antibody responses. Only a subset of the C. difficile toxin fragments, including the C-terminal receptor binding domain of toxin A and a novel N-terminal enzymatic domain of toxin B, were able to elicit protective antibody responses as determined by protection of target cells in a cytotoxicity assay or by preventing death of mice in a passive antibody protection study. Significantly, antibodies elicited by the novel N-terminus of the toxin B DNA vaccine were able to increase the level of protection when used in combination with anti-toxin A antibodies in a toxin challenge model in mice.

  13. Coupling a DNA-Based Machine with Glucometer Readouts for Amplified Detection of Telomerase Activity in Cancer Cells.

    PubMed

    Wang, Wenjing; Huang, Shan; Li, Jingjing; Rui, Kai; Zhang, Jian-Rong; Zhu, Jun-Jie

    2016-03-24

    The strong correlation between cancer and telomerase activity has inspired the development of new strategies to evaluate telomerase activity. Here, a personal glucose meter (PGM) system that uses DNA-based machine amplification to detect telomerase in cancer cells is reported. In this assay, telomerase elongation products are amplified in the form of another type of product by a DNA-based machine. This process can only be activated by the hybridization of the extended telomerase substrate (TS) probe and the complementary primer in the presence of telomerase. The obtained products are then transformed to glucose-related signals via a three-component assay, which enables the simple use of a PGM to indirectly quantify the telomerase activity. The proposed method realizes sensitive telomerase activity detection down to 20 HeLa cells with a significantly enhanced dynamic range. Additionally, short telomerase elongation products, such as telomerase substrate probes with two repetitive sequences, that cannot be detected using the most widely used telomeric repeat amplification protocol assay were detected.

  14. Coupling a DNA-Based Machine with Glucometer Readouts for Amplified Detection of Telomerase Activity in Cancer Cells

    PubMed Central

    Wang, Wenjing; Huang, Shan; Li, Jingjing; Rui, Kai; Zhang, Jian-Rong; Zhu, Jun-Jie

    2016-01-01

    The strong correlation between cancer and telomerase activity has inspired the development of new strategies to evaluate telomerase activity. Here, a personal glucose meter (PGM) system that uses DNA-based machine amplification to detect telomerase in cancer cells is reported. In this assay, telomerase elongation products are amplified in the form of another type of product by a DNA-based machine. This process can only be activated by the hybridization of the extended telomerase substrate (TS) probe and the complementary primer in the presence of telomerase. The obtained products are then transformed to glucose-related signals via a three-component assay, which enables the simple use of a PGM to indirectly quantify the telomerase activity. The proposed method realizes sensitive telomerase activity detection down to 20 HeLa cells with a significantly enhanced dynamic range. Additionally, short telomerase elongation products, such as telomerase substrate probes with two repetitive sequences, that cannot be detected using the most widely used telomeric repeat amplification protocol assay were detected. PMID:27009555

  15. A DNA Vaccine Encoding for TcSSP4 Induces Protection against Acute and Chronic Infection in Experimental Chagas Disease

    PubMed Central

    Arce-Fonseca, Minerva; Ramos-Ligonio, Angel; López-Monteón, Aracely; Salgado-Jiménez, Berenice; Talamás-Rohana, Patricia; Rosales-Encina, José Luis

    2011-01-01

    Immunization of mice with plasmids containing genes of Trypanosoma cruzi induces protective immunity in the murine model of Chagas disease. A cDNA clone that codes for an amastigote-specific surface protein (TcSSP4) was used as a candidate to develop a DNA vaccine. Mice were immunized with the recombinant protein rTcSSP4 and with cDNA for TcSSP4, and challenged with bloodstream trypomastigotes. Immunization with rTcSSP4 protein makes mice more susceptible to trypomastigote infection, with high mortality rates, whereas mice immunized with a eukaryotic expression plasmid containing the TcSSP4 cDNA were able to control the acute phase of infection. Heart tissue of gene-vaccinated animals did not show myocarditis and tissue damage at 365 days following infection, as compared with control animals. INF-γ was detected in sera of DNA vaccinated mice shortly after immunization, suggesting the development of a Th1 response. The TcSSP4 gene is a promising candidate for the development of an anti-T. cruzi DNA vaccine. PMID:22110377

  16. Localised sequence regions possessing high melting temperatures prevent the amplification of a DNA mimic in competitive PCR.

    PubMed

    McDowell, D G; Burns, N A; Parkes, H C

    1998-07-15

    The polymerase chain reaction is an immensely powerful technique for identification and detection purposes. Increasingly, competitive PCR is being used as the basis for quantification. However, sequence length, melting temperature and primary sequence have all been shown to influence the efficiency of amplification in PCR systems and may therefore compromise the required equivalent co-amplification of target and mimic in competitive PCR. The work discussed here not only illustrates the need to balance length and melting temperature when designing a competitive PCR assay, but also emphasises the importance of careful examination of sequences for GC-rich domains and other sequences giving rise to stable secondary structures which could reduce the efficiency of amplification by serving as pause or termination sites. We present data confirming that under particular circumstances such localised sequence, high melting temperature regions can act as permanent termination sites, and offer an explanation for the severity of this effect which results in prevention of amplification of a DNA mimic in competitive PCR. It is also demonstrated that when Taq DNA polymerase is used in the presence of betaine or a proof reading enzyme, the effect may be reduced or eliminated.

  17. Localised sequence regions possessing high melting temperatures prevent the amplification of a DNA mimic in competitive PCR.

    PubMed Central

    McDowell, D G; Burns, N A; Parkes, H C

    1998-01-01

    The polymerase chain reaction is an immensely powerful technique for identification and detection purposes. Increasingly, competitive PCR is being used as the basis for quantification. However, sequence length, melting temperature and primary sequence have all been shown to influence the efficiency of amplification in PCR systems and may therefore compromise the required equivalent co-amplification of target and mimic in competitive PCR. The work discussed here not only illustrates the need to balance length and melting temperature when designing a competitive PCR assay, but also emphasises the importance of careful examination of sequences for GC-rich domains and other sequences giving rise to stable secondary structures which could reduce the efficiency of amplification by serving as pause or termination sites. We present data confirming that under particular circumstances such localised sequence, high melting temperature regions can act as permanent termination sites, and offer an explanation for the severity of this effect which results in prevention of amplification of a DNA mimic in competitive PCR. It is also demonstrated that when Taq DNA polymerase is used in the presence of betaine or a proof reading enzyme, the effect may be reduced or eliminated. PMID:9649616

  18. Characterization, validation and application of a DNA microarray for the detection of mandatory and other waterborne pathogens.

    PubMed

    Gomes, Maria; Vieira, Helena; Vale, Filipa F

    2015-11-01

    Culture methods for the detection of indicator bacteria are currently used for detection of waterborne bacteria. The need for an increased range of analyzed bacteria coupled with the obtainment of rapid and early results justify the development of a DNA microarray for the identification of waterborne pathogens. This DNA microarray has 16 implanted probes with a median size of 147 bases, targeting 12 different parameters, including all mandatory indicator microorganisms, such as Escherichia coli, Clostridium perfringens, Pseudomonas aeruginosa, Staphylococcus aureus, total and fecal coliforms and enterococci. The validation performed with DNA extracted from pure microbial cultures showed the suitability of the probes for detection of the target microorganism. To overcome the high dilution of water samples it was included either a prior culture step of bacterial contaminants retained after filtering 100 ml of water, or a 10-fold increase in the volume of filtered water, that resulted in the increase of the detected bacteria. The analysis of complex environmental water samples using culture methods and the DNA microarray revealed that the latter detected the same parameters plus other bacteria tested only in the DNA microarray. The results show that this DNA microarray may be a useful tool for water microbiological surveillance. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  19. Portal protein functions akin to a DNA-sensor that couples genome-packaging to icosahedral capsid maturation

    PubMed Central

    Lokareddy, Ravi K.; Sankhala, Rajeshwer S.; Roy, Ankoor; Afonine, Pavel V.; Motwani, Tina; Teschke, Carolyn M.; Parent, Kristin N.; Cingolani, Gino

    2017-01-01

    Tailed bacteriophages and herpesviruses assemble infectious particles via an empty precursor capsid (or ‘procapsid') built by multiple copies of coat and scaffolding protein and by one dodecameric portal protein. Genome packaging triggers rearrangement of the coat protein and release of scaffolding protein, resulting in dramatic procapsid lattice expansion. Here, we provide structural evidence that the portal protein of the bacteriophage P22 exists in two distinct dodecameric conformations: an asymmetric assembly in the procapsid (PC-portal) that is competent for high affinity binding to the large terminase packaging protein, and a symmetric ring in the mature virion (MV-portal) that has negligible affinity for the packaging motor. Modelling studies indicate the structure of PC-portal is incompatible with DNA coaxially spooled around the portal vertex, suggesting that newly packaged DNA triggers the switch from PC- to MV-conformation. Thus, we propose the signal for termination of ‘Headful Packaging' is a DNA-dependent symmetrization of portal protein. PMID:28134243

  20. Inhibition of BACE1 Activity by a DNA Aptamer in an Alzheimer’s Disease Cell Model

    PubMed Central

    Kou, Zhewen; Peng, Yonghua; Chen, Wenjun; Li, Xiaowen; Li, Shuji; Wang, Ying; Wang, Fang; Zhang, Xingmei

    2015-01-01

    An initial step in amyloid-β (Aβ) production includes amyloid precursor protein (APP) cleavage via β-Site amyloid precursor protein cleaving enzyme 1 (BACE1). Increased levels of brain Aβ have been implicated in the pathogenesis of Alzheimer’s disease (AD). Thus, β-secretase represents a primary target for inhibitor drug development in AD. In this study, aptamers were obtained from combinatorial oligonucleotide libraries using a technology referred to as systematic evolution of ligands by exponential enrichment (SELEX). A purified human BACE1 extracellular domain was used as a target to conduct an in vitro selection process using SELEX. Two DNA aptamers were capable of binding to BACE1 with high affinity and good specificity, with Kd values in the nanomolar range. We subsequently confirmed that one aptamer, A1, exhibited a distinct inhibitory effect on BACE1 activity in an AD cell model. We detected the effects of M17-APPsw cells that stably expressed Swedish mutant APP after aptamer A1 treatment. Aβ40 and Aβ42 concentrations secreted by M17-APPsw cells decreased intracellularly and in culture media. Furthermore, Western blot analysis indicated that sAPPβ expression significantly decreased in the A1 treated versus control groups. These findings support the preliminary feasibility of an aptamer evolved from a SELEX strategy to function as a potential BACE1 inhibitor. To our knowledge, this is the first study to acquire a DNA aptamer that exhibited binding specificity to BACE1 and inhibited its activity. PMID:26473367

  1. Chl1p, a DNA helicase-like protein in budding yeast, functions in sister-chromatid cohesion.

    PubMed Central

    Skibbens, Robert V

    2004-01-01

    From the time of DNA replication until anaphase onset, sister chromatids remain tightly paired along their length. Ctf7p/Eco1p is essential to establish sister-chromatid pairing during S-phase and associates with DNA replication components. DNA helicases precede the DNA replication fork and thus will first encounter chromatin sites destined for cohesion. In this study, I provide the first evidence that a DNA helicase is required for proper sister-chromatid cohesion. Characterizations of chl1 mutant cells reveal that CHL1 interacts genetically with both CTF7/ECO1 and CTF18/CHL12, two genes that function in sister-chromatid cohesion. Consistent with genetic interactions, Chl1p physically associates with Ctf7p/Eco1p both in vivo and in vitro. Finally, a functional assay reveals that Chl1p is critical for sister-chromatid cohesion. Within the budding yeast genome, Chl1p exhibits the highest degree of sequence similarity to human CHL1 isoforms and BACH1. Previous studies revealed that human CHLR1 exhibits DNA helicase-like activities and that BACH1 is a helicase-like protein that associates with the tumor suppressor BRCA1 to maintain genome integrity. Our findings document a novel role for Chl1p in sister-chromatid cohesion and provide new insights into the possible mechanisms through which DNA helicases may contribute to cancer progression when mutated. PMID:15020404

  2. Structure and Binding Energy of Double-Stranded A-DNA Mini-helices: Quantum-Chemical Study.

    PubMed

    Zubatiuk, Tetiana; Kukuev, Maxim A; Korolyova, Alexandra S; Gorb, Leonid; Nyporko, Alexey; Hovorun, Dmytro; Leszczynski, Jerzy

    2015-10-08

    A-DNA is thought to play a significant biological role in gene expression due to its specific conformation and binding features. In this study, double-stranded mini-helices (dA:dT)3 and (dG:dC)3 in A-like DNA conformation were investigated. M06-2X/6-31G(d,p) method has been utilized to identify the optimal geometries and predict physicochemical parameters of these systems. The results show the ability of the corresponding mini-helices to preserve their A-like conformation under the influences of solvent, charge, and Na(+) counterions. Presented structural and energetic data offer evidence that two steps of GG/CC or AA/TT are already enough to turn the DNA helix to generate different forms by favoring specific values of roll and slide at a local level. Our calculations support the experimentally known fact that AA/TT steps prefer the B-form over the A-ones, whereas GG/CC steps may be found in either the B- or A-form. The stability of mini-helices at the level of total energy analysis, ΔEtotal((A–B)), is discussed.

  3. Inactivation of a DNA Methylation Pathway in Maize Reproductive Organs Results in Apomixis-Like Phenotypes[C][W

    PubMed Central

    Garcia-Aguilar, Marcelina; Michaud, Caroline; Leblanc, Olivier; Grimanelli, Daniel

    2010-01-01

    Apomictic plants reproduce asexually through seeds by avoiding both meiosis and fertilization. Although apomixis is genetically regulated, its core genetic component(s) has not been determined yet. Using profiling experiments comparing sexual development in maize (Zea mays) to apomixis in maize-Tripsacum hybrids, we identified six loci that are specifically downregulated in ovules of apomictic plants. Four of them share strong homology with members of the RNA-directed DNA methylation pathway, which in Arabidopsis thaliana is involved in silencing via DNA methylation. Analyzing loss-of-function alleles for two maize DNA methyltransferase genes belonging to that subset, dmt102 and dmt103, which are downregulated in the ovules of apomictic plants and are homologous to the Arabidopsis CHROMOMETHYLASEs and DOMAINS REARRANGED METHYLTRANSFERASE families, revealed phenotypes reminiscent of apomictic development, including the production of unreduced gametes and formation of multiple embryo sacs in the ovule. Loss of DMT102 activity in ovules resulted in the establishment of a transcriptionally competent chromatin state in the archesporial tissue and in the egg cell that mimics the chromatin state found in apomicts. Interestingly, dmt102 and dmt103 expression in the ovule is found in a restricted domain in and around the germ cells, indicating that a DNA methylation pathway active during reproduction is essential for gametophyte development in maize and likely plays a critical role in the differentiation between apomictic and sexual reproduction. PMID:21037104

  4. Direct visualization of the reaction transformation and signal amplification in a DNA molecular machine with total internal reflection fluorescence microscopy

    NASA Astrophysics Data System (ADS)

    Ren, Rui; Wang, Haiyan; Liu, Rui; Zhang, Shusheng

    2013-10-01

    In this study, as a proof of concept, the signal amplification in an artificial DNA molecular machine was directly visualized via total internal reflection fluorescence microscopy (TIRFM). The molecular machine brought about obvious morphology change in DNA nanostructures as well as signal amplifications. On one hand, through a triggered and autonomically repeated RCA, a DNA nano-complex featuring a “locked” circular DNA template (serving as raw feed) was converted into a long periodically repeated strand, i.e. the RCA products. Furthermore, this RCA was repeated in three controllable reaction phases, bring about progressive signal amplification. It was testified that the RCA products (presented as long thread-like fluorescent objects) can be easily distinguished from the inputted DNA probes (presented as fluorescent dots), thus the transformation in reaction can be visualized. Also, by quantitive counting of the aforementioned fluorescence objects, the progress of the reaction through the phases, along with time, and over the lysozyme concentration can be demonstrated through TIRFM visualization. Overall, it was demonstrated that TIRFM is an efficient approach to quantitively visualize the biochemical processes at single-molecule level.

  5. Design and construction of a DNA origami drug delivery system based on MPT64 antibody aptamer for tuberculosis treatment

    PubMed Central

    Ranjbar, Reza; Hafezi-Moghadam, Mohammad Sadegh

    2016-01-01

    Introduction With all of the developments on infectious diseases, tuberculosis (TB) remains a cause of death among people. One of the most promising assembly techniques in nano-technology is “scaffolded DNA origami” to design and construct a nano-scale drug delivery system. Because of the global health problems of tuberculosis, the development of potent new anti-tuberculosis drug delivery system without cross-resistance with known anti-mycobacterial agents is urgently needed. The aim of this study was to design a nano-scale drug delivery system for TB treatment using the DNA origami method Methods In this study, we presented an experimental research on a DNA drug delivery system for treating Tuberculosis. TEM images were visualized with an FEI Tecnai T12 BioTWIN at 120 kV. The model was designed by caDNAno software and computational prediction of the 3D solution shape and its flexibility was calculated with a CanDo server. Results Synthesizing the product was imaged using transmission electron microscopy after negative-staining by uranyl formate. Conclusion We constructed a multilayer 3D DNA nanostructure system by designing square lattice geometry with the scaffolded-DNA-origami method. With changes in the lock and key sequences, we recommend that this system be used for other infectious diseases to target the pathogenic bacteria. PMID:27053991

  6. Laser-induced fluorescence resonance energy transfer for analysis of the quality of a DNA double helix

    NASA Astrophysics Data System (ADS)

    Bregadze, V. G.; Melikishvili, Z. G.; Giorgadze, T. G.; Khutsishvili, I. G.; Khuskivadze, T. B.; Jaliashvili, Z. V.; Sigua, K. I.

    2016-11-01

    The goal of this work is to use the method of the laser-induced fluorescence resonance energy transfer (FRET) of electronic excitation in a donor-acceptor pair of intercalators, (acridine orange (AO) as a donor and ethidium bromide (EB) as an acceptor), for the quantitative analysis of the quality of a DNA double helix. This approach obtains a visual picture of the defects of the genetic apparatus of tissue cells, particularly those of skin cells in real time and it can be used for the diagnosis of skin diseases and also in cosmetology. Transition metal (TM) ions such as Cu(II), Cu(I), Ag(I), silver nanoparticles (AgNPs), photo- and thermo effects were used to cause double helix defects in DNA. The concentration of DNA sites after exposure to Cu(II), Cu(I), Ag(I) ions, AgNPs impact, as well as laser irradiation (λ  =  457 nm) and temperature, which are applicable for intercalation, were estimated in relative units. The nanoscale FRET method enables the estimation of the concentration of double helix areas with high stability, applicable for intercalation in DNA after it was subjected to stress effect. It provides the opportunity to compare DNA-s of (1) different origin; (2) with various degrees of damage; (3) being in various functional states.

  7. ARG1 (altered response to gravity) encodes a DnaJ-like protein that potentially interacts with the cytoskeleton

    NASA Technical Reports Server (NTRS)

    Sedbrook, J. C.; Chen, R.; Masson, P. H.

    1999-01-01

    Gravitropism allows plant organs to direct their growth at a specific angle from the gravity vector, promoting upward growth for shoots and downward growth for roots. Little is known about the mechanisms underlying gravitropic signal transduction. We found that mutations in the ARG1 locus of Arabidopsis thaliana alter root and hypocotyl gravitropism without affecting phototropism, root growth responses to phytohormones or inhibitors of auxin transport, or starch accumulation. The positional cloning of ARG1 revealed a DnaJ-like protein containing a coiled-coil region homologous to coiled coils found in cytoskeleton-interacting proteins. These data suggest that ARG1 participates in a gravity-signaling process involving the cytoskeleton. A combination of Northern blot studies and analysis of ARG1-GUS fusion-reporter expression in transgenic plants demonstrated that ARG1 is expressed in all organs. Ubiquitous ARG1 expression in Arabidopsis and the identification of an ortholog in Caenorhabditis elegans suggest that ARG1 is involved in other essential processes.

  8. The Species and Origin of Shark Fins in Taiwan's Fishing Ports, Markets, and Customs Detention: A DNA Barcoding Analysis.

    PubMed

    Chuang, Po-Shun; Hung, Tzu-Chiao; Chang, Hung-An; Huang, Chien-Kang; Shiao, Jen-Chieh

    2016-01-01

    The increasing consumption of shark products, along with the shark's fishing vulnerabilities, has led to the decrease in certain shark populations. In this study we used a DNA barcoding method to identify the species of shark landings at fishing ports, shark fin products in retail stores, and shark fins detained by Taiwan customs. In total we identified 23, 24, and 14 species from 231 fishing landings, 316 fin products, and 113 detained shark fins, respectively. All the three sample sources were dominated by Prionace glauca, which accounted for more than 30% of the collected samples. Over 60% of the species identified in the fin products also appeared in the port landings, suggesting the domestic-dominance of shark fin products in Taiwan. However, international trade also contributes a certain proportion of the fin product markets, as four species identified from the shark fin products are not found in Taiwan's waters, and some domestic-available species were also found in the customs-detained sample. In addition to the species identification, we also found geographical differentiation in the cox1 gene of the common thresher sharks (Alopias vulpinus), the pelagic thresher shark (A. pelagicus), the smooth hammerhead shark (Sphyrna zygaena), and the scalloped hammerhead shark (S. lewini). This result might allow fishing authorities to more effectively trace the origins as well as enforce the management and conservation of these sharks.

  9. A new assay format for NF-kappaB based on a DNA triple helix and a fluorescence resonance energy transfer.

    PubMed

    Altevogt, Dominik; Hrenn, Andrea; Kern, Claudia; Clima, Lilia; Bannwarth, Willi; Merfort, Irmgard

    2009-10-07

    Herein we report a feasibility study for a new concept to detect DNA binding protein NF-kappaB based on a DNA triple helix formation in combination with a fluorescence resonance energy transfer (FRET). The new principle avoids expensive antibodies and radioactivity and might have implications for assays of other DNA binding proteins.

  10. Safety and preliminary evidence of biological efficacy of a mammaglobin-A DNA vaccine in patients with stable metastatic breast cancer

    PubMed Central

    Tiriveedhi, Venkataswarup; Tucker, Natalia; Herndon, John; Li, Lijin; Sturmoski, Mark; Ellis, Matthew; Ma, Cynthia; Naughton, Michael; Lockhart, A. Craig; Gao, Feng; Fleming, Timothy; Goedegebuure, Peter; Mohanakumar, Thalachallour; Gillanders, William E.

    2014-01-01

    Purpose Mammaglobin-A (MAM-A) is overexpressed in 40–80% of primary breast cancers. We initiated a phase 1 clinical trial of a MAM-A DNA vaccine to evaluate its safety and biological efficacy. Experimental Design Breast cancer patients with stable metastatic disease were eligible for enrollment. Safety was monitored with clinical and laboratory assessments. The CD8 T cell response was measured by ELISPOT, flow cytometry, and cytotoxicity assays. Progression-free survival was described using the Kaplan-Meier product limit estimator. Results Fourteen subjects have been treated with the MAM-A DNA vaccine and no significant adverse events have been observed. Eight of fourteen subjects were HLA-A2+, and the CD8 T cell response to vaccination was studied in detail. Flow cytometry demonstrated a significant increase in the frequency of MAM-A-specific CD8 T cells following vaccination (0.9 ± 0.5% vs. 3.8 ± 1.2%, p < 0.001), and ELISPOT analysis demonstrated an increase in the number of MAM-A-specific IFN-γ-secreting T cells (41 ± 32 vs. 215 ± 67 spm, p < 0.001). Although this study was not powered to evaluate progression-free survival, preliminary evidence suggests that subjects treated with the MAM-A DNA vaccine had improved progression-free survival compared to subjects who met all eligibility criteria, were enrolled in the trial, but were not vaccinated because of HLA phenotype. Conclusion The MAM-A DNA vaccine is safe, capable of eliciting MAM-A-specific CD8 T cell responses, and preliminary evidence suggests improved progression-free survival. Additional studies are required to define the potential of the MAM-A DNA vaccine for breast cancer prevention and/or therapy. PMID:25451106

  11. Aminoglycoside complexation with a DNA.RNA hybrid duplex: the thermodynamics of recognition and inhibition of RNA processing enzymes.

    PubMed

    Barbieri, Christopher M; Li, Tsai-Kun; Guo, Susan; Wang, Gang; Shallop, Anthony J; Pan, Weidong; Yang, Gengcheng; Gaffney, Barbara L; Jones, Roger A; Pilch, Daniel S

    2003-05-28

    Spectroscopic and calorimetric techniques were employed to characterize and contrast the binding of the aminoglycoside paromomycin to three octamer nucleic acid duplexes of identical sequence but different strand composition (a DNA.RNA hybrid duplex and the corresponding DNA.DNA and RNA.RNA duplexes). In addition, the impact of paromomycin binding on both RNase H- and RNase A-mediated cleavage of the RNA strand in the DNA.RNA duplex was also determined. Our results reveal the following significant features: (i) Paromomycin binding enhances the thermal stabilities of the RNA.RNA and DNA.RNA duplexes to similar extents, with this thermal enhancement being substantially greater in magnitude than that of the DNA.DNA duplex. (ii) Paromomycin binding to the DNA.RNA hybrid duplex induces CD changes consistent with a shift from an A-like to a more canonical A-conformation. (iii) Paromomycin binding to all three octamer duplexes is linked to the uptake of a similar number of protons, with the magnitude of this number being dependent on pH. (iv) The affinity of paromomycin for the three host duplexes follows the hierarchy, RNA.RNA > DNA.RNA > DNA.DNA. (v) The observed affinity of paromomycin for the RNA.RNA and DNA.RNA duplexes decreases with increasing pH. (vi) The binding of paromomycin to the DNA.RNA hybrid duplex inhibits both RNase H- and RNase A-mediated cleavage of the RNA strand. We discuss the implications of our combined results with regard to the specific targeting of DNA.RNA hybrid duplex domains and potential antiretroviral applications.

  12. Primary, nonsyndromic vesicoureteric reflux and nephropathy in sibling pairs: a United Kingdom cohort for a DNA bank.

    PubMed

    Lambert, Heather J; Stewart, Aisling; Gullett, Ambrose M; Cordell, Heather J; Malcolm, Sue; Feather, Sally A; Goodship, Judith A; Goodship, Timothy H J; Woolf, Adrian S

    2011-04-01

    Primary vesicoureteric reflux (VUR) can coexist with reflux nephropathy (RN) and impaired renal function. VUR appears to be an inherited condition and is reported in approximately one third of siblings of index cases. The objective was to establish a DNA collection and clinical database from U.K. families containing affected sibling pairs for future VUR genetics studies. The cohort's clinical characteristics have been described. Most patients were identified from tertiary pediatric nephrology centers; each family had an index case with cystography-proven primary, nonsyndromic VUR. Affected siblings had radiologically proven VUR and/or radiographically proven RN. One hundred eighty-nine index cases identified families with an additional 218 affected siblings. More than 90% were <20 years at the study's end. Blood was collected and leukocyte DNA extracted from all 407 patients and from 189 mothers and 183 fathers. Clinical presentation was established in 122; 92 had urinary tract infections and 16 had abnormal antenatal renal scans. RN was radiologically proven in 223 patients. Four patients had been transplanted; none were on dialysis. In 174 others aged >1 year, estimated GFR (eGFR) was calculated. Five had eGFR 15 to 59 and 48 had eGFR 60 to 89 ml/min per 1.73 m(2). Values were lower in bilateral RN patients than in those with either unilateral or absent RN. The large DNA collection from families with VUR and associated RN constitutes a resource for researchers exploring the most likely complex, genetic components predisposing to VUR and RN. © 2011 by the American Society of Nephrology

  13. Primary, Nonsyndromic Vesicoureteric Reflux and Nephropathy in Sibling Pairs: A United Kingdom Cohort for a DNA Bank

    PubMed Central

    Stewart, Aisling; Gullett, Ambrose M.; Cordell, Heather J.; Malcolm, Sue; Feather, Sally A.; Goodship, Judith A.; Goodship, Timothy H. J.; Woolf, Adrian S.

    2011-01-01

    Summary Background and objectives Primary vesicoureteric reflux (VUR) can coexist with reflux nephropathy (RN) and impaired renal function. VUR appears to be an inherited condition and is reported in approximately one third of siblings of index cases. The objective was to establish a DNA collection and clinical database from U.K. families containing affected sibling pairs for future VUR genetics studies. The cohort's clinical characteristics have been described. Design, setting, participants, & measurements Most patients were identified from tertiary pediatric nephrology centers; each family had an index case with cystography-proven primary, nonsyndromic VUR. Affected siblings had radiologically proven VUR and/or radiographically proven RN. Results One hundred eighty-nine index cases identified families with an additional 218 affected siblings. More than 90% were <20 years at the study's end. Blood was collected and leukocyte DNA extracted from all 407 patients and from 189 mothers and 183 fathers. Clinical presentation was established in 122; 92 had urinary tract infections and 16 had abnormal antenatal renal scans. RN was radiologically proven in 223 patients. Four patients had been transplanted; none were on dialysis. In 174 others aged >1 year, estimated GFR (eGFR) was calculated. Five had eGFR 15 to 59 and 48 had eGFR 60 to 89 ml/min per 1.73 m2. Values were lower in bilateral RN patients than in those with either unilateral or absent RN. Conclusions The large DNA collection from families with VUR and associated RN constitutes a resource for researchers exploring the most likely complex, genetic components predisposing to VUR and RN. PMID:21441121

  14. Clinical utility of a DNA probe to 17p11.2 in screening of patients with a peripheral neuropathy

    SciTech Connect

    Blancato, J.; Precht, K.; Meck, J.

    1994-09-01

    We assessed the usefulness of in situ hybridization with a DNA probe to the area of chromosome 17 at p11.2 as a diagnostic tool for screening for Charcot Marte Tooth 1A (CMT 1A). In situ hybridization with a probe to 17p11.2 was performed on fixed lymphocytes from the following groups of individuals: (1) normal controls; (2) patients evoking a strong clinical suspicion of CMT 1A; and (3) 3 families with an apparent autosomal dominant peripheral neuropathy of unknown diagnoses. Group 2 patients had evidence of demyelination as defined by nerve conduction of less that 50% of the normal mean or terminal latency greater than 50% of the normal mean in conduction studies. Analysis of interphase cells hybridized with a cosmid DNA probe to 17p11.2 requires inclusion of a normal control with each trial and masked observer. Due to the size of the target DNA and the nature of the centromeric heterochromatin, the scoring of this probe is more subjective than centromere probes. For example, if the two 17 chromosomes are decondensed as in interphase, two tandem signals may be visualized as one. Results from duplication positive patients demonstrate a large proportion of cells with two closely aligned, but separate, signals with an additional single signal. Normal results demonstrate a majority of cells with two separate signals representing both normal homologues. None of the 3 families with questionable diagnosis revealed a duplication at the region, reinforcing our belief that a clinical diagnosis is the most discriminating tool available for diagnosis of CMT 1A. We concur with Boylan that molecular analysis for CMT 1A is useful for establishing a diagnosis of CMT 1A, but is not a primary differential diagnostic test. The yield in screening patients without physiologic evidence of demyelination is likely to be low. We further find that the use of in situ hybridization is a simple method of performing the duplication analysis.

  15. Photophysics and photochemistry of a DNA-protein cross-linking model: a synergistic approach combining experiments and theory.

    PubMed

    Micciarelli, Marco; Valadan, Mohammadhassan; Della Ventura, Bartolomeo; Di Fabio, Giovanni; De Napoli, Lorenzo; Bonella, Sara; Röthlisberger, Ursula; Tavernelli, Ivano; Altucci, Carlo; Velotta, Raffaele

    2014-05-15

    The photophysical and photochemical properties of 5-benzyluracil and 5,6-benzyluracil, the latter produced by photocyclization of the former through irradiation with femtosecond UV laser pulses, are investigated both experimentally and theoretically. The absorption spectra of the two molecules are compared, and the principal electronic transitions involved are discussed, with particular emphasis on the perturbation induced on the two chromophore species (uracil and benzene) by their proximity. The photoproduct formation for different irradiation times was verified with high-performance liquid chromatography and nuclear magnetic resonance measurements. The steady-state fluorescence demonstrates that the fluorescence is a distinctive physical observable for detection and selective identification of 5- and 5,6-benzyluracil. The principal electronic decay paths of the two molecules, obtained through TDDFT calculations, explain the features observed in the emission spectra and the photoreactivity of 5-benzyluracil. The order of magnitude of the lifetime of the excited states is derived with steady-state fluorescence anisotropy measurements and rationalized with the help of the computational findings. Finally, the spectroscopic data collected are used to derive the photocyclization and fluorescence quantum yields. In obtaining a global picture of the photophysical and photochemical properties of the two molecules, our findings demonstrates that the use of 5-benzyluracil as a model system to study the proximity relations of a DNA base with a close-lying aromatic amino acid is valid at a local level since the main characteristics of the decay processes from the excited states of the uracil/thymine molecules remain almost unchanged in 5-benzyluracil, the main perturbation arising from the presence of the close-lying aromatic group.

  16. A yeast gene, MGS1, encoding a DNA-dependent AAA+ ATPase is required to maintain genome stability

    PubMed Central

    Hishida, Takashi; Iwasaki, Hiroshi; Ohno, Takayuki; Morishita, Takashi; Shinagawa, Hideo

    2001-01-01

    Changes in DNA superhelicity during DNA replication are mediated primarily by the activities of DNA helicases and topoisomerases. If these activities are defective, the progression of the replication fork can be hindered or blocked, which can lead to double-strand breaks, elevated recombination in regions of repeated DNA, and genome instability. Hereditary diseases like Werner's and Bloom's Syndromes are caused by defects in DNA helicases, and these diseases are associated with genome instability and carcinogenesis in humans. Here we report a Saccharomyces cerevisiae gene, MGS1 (Maintenance of Genome Stability 1), which encodes a protein belonging to the AAA+ class of ATPases, and whose central region is similar to Escherichia coli RuvB, a Holliday junction branch migration motor protein. The Mgs1 orthologues are highly conserved in prokaryotes and eukaryotes. The Mgs1 protein possesses DNA-dependent ATPase and single-strand DNA annealing activities. An mgs1 deletion mutant has an elevated rate of mitotic recombination, which causes genome instability. The mgs1 mutation is synergistic with a mutation in top3 (encoding topoisomerase III), and the double mutant exhibits severe growth defects and markedly increased genome instability. In contrast to the mgs1 mutation, a mutation in the sgs1 gene encoding a DNA helicase homologous to the Werner and Bloom helicases suppresses both the growth defect and the increased genome instability of the top3 mutant. Therefore, evolutionarily conserved Mgs1 may play a role together with RecQ family helicases and DNA topoisomerases in maintaining proper DNA topology, which is essential for genome stability. PMID:11459965

  17. Both hypomethylation and hypermethylation in a 0.2-kb region of a DNA repeat in cancer

    PubMed Central

    Nishiyama, Rie; Qi, Lixin; Lacey, Michelle; Ehrlich, Melanie

    2005-01-01

    NBL2 is a tandem 1.4-kb DNA repeat, whose hypomethylation in hepatocellular carcinomas was previously shown to be an independent predictor of disease progression. Here, we examined methylation of all cytosine residues in a 0.2-kb subregion of NBL2 in ovarian carcinomas, Wilms tumors, and diverse control tissues by hairpin-bisulfite PCR. This new genomic sequencing method detects 5-methylcytosine on covalently linked complementary strands of a DNA fragment. All DNA clones from normal somatic tissues displayed symmetrical methylation at seven CpG positions and no methylation or only hemimethylation at two others. Unexpectedly, 56% of cancer DNA clones had decreased methylation at some normally methylated CpG sites as well as increased methylation at one or both of the normally unmethylated sites. All 146 DNA clones from ten cancers could be distinguished from all 91somatic control clones by assessing methylation changes at three of these CpG sites. The special involvement of DNMT3B in NBL2 methylation was indicated by analysis of cells from ICF syndrome patients (immunodeficiency, centromeric region instability, facial anomalies), who have mutations in the gene encoding DNA methyltransferase 3B. Blot hybridization of 33 cancer DNAs digested with CpG methylation-sensitive enzymes confirmed that NBL2 arrays are unusually susceptible to cancer-linked hypermethylation and hypomethylation, consistent with our novel genomic sequencing findings. The combined Southern blot and genomic sequencing data indicate that some of the cancer-linked alterations in CpG methylation are occurring with considerable sequence specificity. NBL2 is an attractive candidate for an epigenetic cancer marker and for elucidating the nature of epigenetic changes in cancer. PMID:16317087

  18. Evaluation of the immunogenicity and the protective efficacy in mice of a DNA vaccine encoding SP41 from Brucella melitensis.

    PubMed

    Al-Mariri, Ayman; Abbady, Abdul Qader

    2013-04-17

    Brucella melitensis is a facultative intracellular Gram-negative bacterial pathogen that may enter the host via ingestion or inhalation, or through conjunctiva or skin abrasions. Some Brucella spp surface proteins (SPs) play an important role in bacterial adhesion and invasion and thus represent targets for the host immune system. Brucella spp surface protein with apparent molecular mass of 41 kDa interacts selectively with HeLa cells. To evaluate the role of SP41 (41 kDa) as a DNA vaccine against Brucella spp., pCISP41, a plasmid construct for protein expression in mammalian cells, was established. Exogenous SP41 was detected in pCISP41-transfected Vero cell line by immune blotting using specific polyclonal antibody. The protective role of pCISP41 against B. melitensis 16M in mice was evaluated by measuring B and T cell responses in comparison to those achieved with attenuated B. melitensis Rev. 1 vaccine. BALB/c mice injected with pCISP41 were able to develop SP41-specific serum immunoglobulin G (IgG) antibodies. In addition, splenocytes from DNA-SP41-vaccinated mice elicited a T-cell-proliferative response and also induced gamma interferon (IFN-γ) production, but not interleukin-5 (IL-5), suggesting the induction of a T-helper-1-dominated immune response. Vaccination with attenuated B. melitensis Rev.1 strain induced better protection levels than DNA vaccination with SP41 against B. melitensis 16M in mice. Such responses play an important role against intracellular infecting agents such as Brucella spp. Altogether, our data suggest that SP41 may represent a promising candidate for DNA vaccination against brucellosis, but more investigation to increase its protective efficacy should be done.

  19. Mate-Pair Sequencing as a Powerful Clinical Tool for the Characterization of Cancers with a DNA Viral Etiology

    PubMed Central

    Gao, Ge; Smith, David I.

    2015-01-01

    DNA viruses are known to be associated with a variety of different cancers. Human papillomaviruses (HPV) are a family of viruses and several of its sub-types are classified as high-risk HPVs as they are found to be associated with the development of a number of different cancers. Almost all cervical cancers appear to be driven by HPV infection and HPV is also found in most cancers of the anus and at least half the cancers of the vulva, penis and vagina, and increasingly found in one sub-type of head and neck cancers namely oropharyngeal squamous cell carcinoma. Our understanding of HPVs role in cancer development comes from extensive studies done on cervical cancer and it has just been assumed that HPV plays an identical role in the development of all other cancers arising in the presence of HPV sequences, although this has not been proven. Most invasive cervical cancers have the HPV genome integrated into one or more sites within the human genome. One powerful tool to examine all the sites of HPV integration in a cancer but that also provides a comprehensive view of genomic alterations in that cancer is the use of next generation sequencing of mate-pair libraries produced from the DNA isolated. We will describe how this powerful technology can provide important information about the genomic organization within an individual cancer genome, and how this has demonstrated that HPVs role in oropharyngeal squamous cell carcinoma is distinct from that in cervical cancer. We will also describe why the sequencing of mate-pair libraries could be a powerful clinical tool for the management of patients with a DNA viral etiology and how this could quickly transform the care of these patients. PMID:26262638

  20. DNA binding of Jun and Fos bZip domains: homodimers and heterodimers induce a DNA conformational change in solution.

    PubMed Central

    John, M; Leppik, R; Busch, S J; Granger-Schnarr, M; Schnarr, M

    1996-01-01

    We constructed plasmids encoding the sequences for the bZip modules of c-Jun and c-Fos which could then be expressed as soluble proteins in Escherichia coli. The purified bZip modules were tested for their binding capacities of synthetic oligonucleotides containing either TRE or CRE recognition sites in electrophoretic mobility shift assays and circular dichroism (CD). Electrophoretic mobility shift assays showed that bZip Jun homodimers and bZip Jun/Fos heterodimers bind a collagenase-like TRE (CTGACTCAT) with dissociation constants of respectively 1.4 x 10(-7) M and 5 x 10(-8) M. As reported earlier [Patel et al. (1990) Nature 347, 572-575], DNA binding induces a marked change of the protein structure. However, we found that the DNA also undergoes a conformational change. This is most clearly seen with small oligonucleotides of 13 or 14 bp harboring respectively a TRE (TGACTCA) or a CRE (TGACGTCA) sequence. In this case, the positive DNA CD signal at 280 nm increases almost two-fold with a concomitant blue-shift of 3-4 nm. Within experimental error the same spectral changes are observed for TRE and CRE containing DNA fragments. The spectral changes observed with a non-specific DNA fragment are weaker and the signal of free DNA is recovered upon addition of much smaller salt concentrations than required for a specific DNA fragment. Surprisingly the spectral changes induced by Jun/Jun homodimers are not identical to those induced by Jun/Fos heterodimers. However, in both cases the increase of the positive CD band and the concomitant blue shift would be compatible with a B to A-transition of part of the binding site or a DNA conformation intermediate between the canonical A and B structures. PMID:8948639

  1. Cooperative DNA Binding and Protein/DNA Fiber Formation Increases the Activity of the Dnmt3a DNA Methyltransferase*

    PubMed Central

    Emperle, Max; Rajavelu, Arumugam; Reinhardt, Richard; Jurkowska, Renata Z.; Jeltsch, Albert

    2014-01-01

    The Dnmt3a DNA methyltransferase has been shown to bind cooperatively to DNA and to form large multimeric protein/DNA fibers. However, it has also been reported to methylate DNA in a processive manner, a property that is incompatible with protein/DNA fiber formation. We show here that the DNA methylation rate of Dnmt3a increases more than linearly with increasing enzyme concentration on a long DNA substrate, but not on a short 30-mer oligonucleotide substrate. We also show that addition of a catalytically inactive Dnmt3a mutant, which carries an amino acid exchange in the catalytic center, increases the DNA methylation rate by wild type Dnmt3a on the long substrate but not on the short one. In agreement with this finding, preincubation experiments indicate that stable protein/DNA fibers are formed on the long, but not on the short substrate. In addition, methylation experiments with substrates containing one or two CpG sites did not provide evidence for a processive mechanism over a wide range of enzyme concentrations. These data clearly indicate that Dnmt3a binds to DNA in a cooperative reaction and that the formation of stable protein/DNA fibers increases the DNA methylation rate. Fiber formation occurs at low μm concentrations of Dnmt3a, which are in the range of Dnmt3a concentrations in the nucleus of embryonic stem cells. Understanding the mechanism of Dnmt3a is of vital importance because Dnmt3a is a hotspot of somatic cancer mutations one of which has been implicated in changing Dnmt3a processivity. PMID:25147181

  2. KISS1 can be used as a novel target for developing a DNA immunocastration vaccine in ram lambs.

    PubMed

    Han, Yanguo; Liu, Guiqiong; Jiang, Xunping; Ijaz, Nabeel; Tesema, Birhanu; Xie, Guangyue

    2015-02-04

    KISS1 gene-encoding kisspeptins are critical for the onset of puberty and control of adult fertility. This study investigated whether KISS1 can be used as a novel target for immunocastration. Human KISS1 was fused with the HBsAg-S gene for constructing an antibiotic-free recombinant plasmid pKS-asd that coded for 31.168 kDa target fusion protein. Six male Hu sheep lambs were divided into two equal groups, treatment and control. The vaccine (1mg/ram lamb) prepared in saline solution was injected into lambs at weeks 0, 3 and 6 of the experiment, respectively. Vaccine efficacy was evaluated in terms of KISS1-specific IgG antibody response, serum testosterone levels, scrotal circumference, testicular weight, length and breadth, extent of testicular tissue damage, and sexual behaviour changes. The specific anti-KISS1 antibody titre in vaccinated animals was significantly higher than that in controls (p<0.05). In addition, vaccinated animals showed lower serum testosterone level, testicular weight and length and smaller scrotal circumference than those in controls (p<0.05). Spermatogenesis of seminiferous tubules in vaccinated animals was suppressed; sexual behaviours in vaccinated animals were significantly lower (p<0.05) than those in controls. In conclusion, the immunization against KISS1 in this DNA vaccine induced a strong antibody response and resulted in the suppression of gonadal function and sexual behaviour in animals, demonstrating that KISS1 can be used as a novel target for developing a DNA immunocastration vaccine.

  3. Immune responses to a DNA/protein vaccination strategy against Staphylococcus aureus induced mastitis in dairy cows.

    PubMed

    Shkreta, Lulzim; Talbot, Brian G; Diarra, Moussa S; Lacasse, Pierre

    2004-11-15

    The fibronectin binding protein (FnBP) and clumping factor A (ClfA) of Staphylococcus aureus are important proteins involved in the pathogenesis of staphylococcal bovine mastitis. These antigens were the targets of a DNA and protein vaccination strategy against S. aureus induced mastitis in dairy cows. The DNA vaccine comprised the bicistronic plasmid (pCI-D(1)D(3)-IRES-ClfA) that encoded the fusion of two sequences, (D1(21-34); D3(20-33)) from the fibronectin-binding motifs of FnBP and a fragment from ClfA (aa 221-550) of S. aureus 8325-4 separated by an Internal Ribosomal Entry Site (IRES) sequence. In addition, the vaccine contained the plasmid encoding the bovine granulocyte-macrophage-colony stimulatory factor gene (pCI-bGM-CSF). Four, 7-month pregnant heifers were immunized twice with the DNA vaccine and boosted once with recombinant D(1)D(3) and ClfA proteins while four others were not immunized. The immunization induced lymphoproliferative responses and functional antibodies against D(1)D(3) and ClfA antigens. Three weeks after calving, three mammary quarters of each vaccinated and non-vaccinated cow were challenged with 900 CFU/each of S. aureus Newbould 305. The fourth quarter received saline only. Serum haptoglobin levels, cardiac rhythm and the body temperature of vaccinated cows during the 24-72 h post-challenge were lower than in non-vaccinated animals. At 21 days post-challenge, bacteria were present in 5 of the vaccinated and 11 of the control challenged quarters. The bacteria averaged 1.4 and 3.3 log(10) CFU/ml of milk from vaccinated and control cows respectively. In summary, DNA-protein vaccination against FnBP and ClfA of S. aureus caused both lymphoproliferative and humoral immune responses that provided partial protection of mammary gland from staphylococcal mastitis and better post-challenge conditions in vaccinated cows.

  4. An Independent Evaluation of the Validity of a DNA-Based Prognostic Test for Adolescent Idiopathic Scoliosis.

    PubMed

    Roye, Benjamin D; Wright, Margaret L; Matsumoto, Hiroko; Yorgova, Petya; McCalla, Daren; Hyman, Joshua E; Roye, David P; Shah, Suken A; Vitale, Michael G

    2015-12-16

    ScoliScore is a DNA-based prognostic test, designed and used to help to predict the risk of curve progression in patients with adolescent idiopathic scoliosis. The role of this test in clinical practice remains unclear as the published results of the ScoliScore have not been validated independently. The purpose of this study was to determine if the ScoliScore effectively predicted the risk of curve progression in patients with mild and moderate adolescent idiopathic scoliosis in two urban academic medical centers. One hundred and twenty-six patients with adolescent idiopathic scoliosis who met inclusion criteria at two centers were administered the ScoliScore test. Two groups were created: a progression group (those who had a Cobb angle of >40° or those who had undergone surgical fusion) and a non-progression group (those who had skeletal maturity without curve progression to 40°). ScoliScore values and risk levels were compared between the two groups. The negative predictive value was calculated for low-risk scores and the positive predictive value was calculated for high-risk scores. There was no significant difference (p = 0.706) in the mean ScoliScore (and standard deviation) between patients with curve progression (107 ± 55 points) and those without curve progression (102 ± 62 points). There was also no significant difference (p = 0.399) in curve progression between patients with high-risk scores (26.7%) and those with low-risk scores (12.9%). The positive predictive value of the test was 0.27 (95% confidence interval, 0.09 to 0.55), and the negative predictive value was 0.87 (95% confidence interval, 0.69 to 0.96). ScoliScores and rates of progression were not affected by brace-wear. ScoliScores did not differ between patients with and without curve progression, and the negative and positive predictive values were lower in our study than in the previously published validation study by the developers of the test. This may be due to differences in our test

  5. Effects of Regular Treadmill Exercise on a DNA Oxidative-Damage Marker and Total Antioxidant Capacity in Rat Hippocampal Tissue

    PubMed Central

    Mahjoub, Soleiman; Ghadi, Arezoo; Pourbagher, Roghayeh; Hajian-Tilaki, Karimollah

    2016-01-01

    Background and Purpose Regular exercise can result in changes in the levels of oxidative stress in the hippocampus; however, little attention has been paid to physical-activity-induced neuronal protection to exposure to lead compounds. This study investigated the effects of regular treadmill exercise on a DNA oxidative-damage marker [8-hydroxy-2'-deoxyguanosine (8-OHdG)] and the total antioxidant capacity (TAC) of hippocampal tissue in lead-acetate exposed rats. Methods This study investigated the effects of 8 weeks of regular treadmill exercise on 8-OHdG and the TAC of hippocampal tissue in lead-acetate-exposed rats. Wistar rats were randomly divided into four groups: baseline, sham (control), lead, and exercise+lead. The exercise program involved running on a treadmill with increasing intensity five times a week for 8 weeks. Animals in the lead and exercise+lead groups received lead acetate at 20 mg/kg body weight intraperitoneally three times weekly for 8 weeks. Animals in the sham group received solvent (ethyl oleate) at 30 mg/kg body weight three times weekly for 8 weeks. TAC and 8-OHdG were measured by spectrophotometric and ELISA techniques, respectively. Data were analyzed by ANOVA and Tukey's post-hoc test with a significance cutoff of p≤0.05. Results The level of 8-OHdG and the TAC were significantly higher and lower, respectively, in the lead group than in the baseline and sham groups (p<0.01). However, the 8-OHdG level and TAC value in hippocampal tissue were significantly decreased and increased, respectively, in the exercise+lead group relative to the lead group (p<0.05). Conclusions The TAC of hippocampal tissue may be directly associated with neural protection mechanisms of exercise following lead acetate injection, and the beneficial effects of regular exercise in preventing hippocampal neuronal damage could be due to decreased hippocampal oxidative stress such as reflected by a lower 8-OHdG level and increased TAC. PMID:27486937

  6. A DNA-binding surface of SPO11-1, an Arabidopsis SPO11 orthologue required for normal meiosis.

    PubMed

    Shingu, Yoshinori; Mikawa, Tsutomu; Onuma, Mariko; Hirayama, Takashi; Shibata, Takehiko

    2010-05-01

    Meiotic recombination is initiated by DNA double-stranded breaks introduced by the SPO11 protein. Despite a decade of research, the biochemical functions of SPO11 remain largely unknown, perhaps because of difficulties in studying the functionally active SPO11. Arabidopsis thaliana encodes three SPO11-related proteins, two of which (SPO11-1 and SPO11-2) are required for, and cooperate in, meiosis. We isolated soluble SPO11-1, fused with or free of a trigger factor-tag at its N terminus. The tag-free SPO11-1 needed to interact physically with soluble SPO11-1 to maintain its solubility, suggesting a multimeric active form including a solubilizing protein cofactor. An N-terminal fragment of PRD1, a SPO11-1-interacting protein required for normal meiosis, but not SPO11-2, forms a soluble complex with trigger factor-tagged SPO11-1, but the trigger factor-tag was required for the solubility. Formation of the complex is not sufficient to express endonuclease activity. Trigger factor-tagged SPO11-1 exhibited DNA-binding activities: Glu substitutions of the invariant Gly215 and Arg222 and of the nonconserved Arg223 and Arg226 in a conserved motif (G215E, R222E, R223E, R226E) reduced the DNA-binding ability in vitro, but substitutions of the conserved Arg130 and invariant Tyr103 (a residue in the putative endonuclease-active center) and of Arg residues outside conserved motifs by Glu or Phe (R130E, Y103F, R207E and R254E), did not. Tests for the ability of mutant spo11-1 proteins to complement the silique-defective phenotype of a spo11-1-homozygous mutant in vivo revealed that R222E and G215E induced serious deficiencies, while R130E caused a partial defect in silique formation. Thus, the Gly215, Arg222 and Arg223 residues of SPO11-1 form a DNA-binding surface that is functional in meiosis.

  7. Understanding B-DNA to A-DNA transition in the right-handed DNA helix: Perspective from a local to global transition.

    PubMed

    Kulkarni, Mandar; Mukherjee, Arnab

    2017-09-01

    The right-handed DNA helix exhibits two major conformations, A-DNA and B-DNA, depending on the environmental conditions. The B-DNA to A-DNA (B→A) transition is sequence specific, cooperative, and reversible. The reduced water activity due to the addition of solvents like ethanol or the presence of protein or drug molecules causes B→A transition. In several biological cases, B→A transition occurs at a local level where small fragments of a long DNA sequence undergoes B→A transition. In this review, we have discussed various aspects of B→A transition such as the role of water, sequence specificity, mechanism of B→A transition, etc. The review primarily focuses on the B→A mechanism involved at a local level, and finally its connection to the global transition in theoretical and experimental studies. Copyright © 2017. Published by Elsevier Ltd.

  8. Public involvement in pharmacogenomics research: a national survey on public attitudes towards pharmacogenomics research and the willingness to donate DNA samples to a DNA bank in Japan.

    PubMed

    Kobayashi, Eriko; Satoh, Nobunori

    2009-11-01

    To assess the attitudes of the Japanese general public towards pharmacogenomics research and a DNA bank for identifying genomic markers associated with ADRs and their willingness to donate DNA samples, we conducted a national survey for 1,103 Japanese adults from the general public, not a patient population. The response rate was 36.8%. The majority of the respondents showed a positive attitude towards pharmacogenomics research (81.0%) and a DNA bank (70.4%). Considering fictitious clinical situations such as taking medications and experiencing ADRs, the willingness to donate DNA samples when experiencing ADRs (61.7%) was higher than when taking medications (45.3%). Older generations were significantly associated with a decreased willingness to donate (OR = 0.45, CI 0.28-0.72 in 50s. OR = 0.49, CI: 0.31-0.77 in 60s). Positive attitudes towards pharmacogenomics research, a DNA bank, blood/bone marrow/organ donation were significantly associated with an increased willingness. However, the respondents had the following concerns regarding a DNA bank: the confidentiality of their personal information, the manner by which research results were utilized and simply the use of their own DNA for research. In order to attain public understanding to overcome these concerns, a process of public awareness should be put into place to emphasize the beneficial aspects of identifying genomic markers associated with ADRs and to address these concerns raised in our study. Further study is needed to assess the willingness of actual patients taking medications in real situations, since the respondents in our study were from the general public, not a patient population, and their willingness was assessed on the condition of assuming that they were patients taking medications.

  9. Microfluidic device using chemiluminescence and a DNA-arrayed thin film transistor photosensor for single nucleotide polymorphism genotyping of PCR amplicons from whole blood.

    PubMed

    Hatakeyama, Keiichi; Tanaka, Tsuyoshi; Sawaguchi, Masahiro; Iwadate, Akihito; Mizutani, Yasushi; Sasaki, Kazuhiro; Tateishi, Naofumi; Matsunaga, Tadashi

    2009-04-21

    This work describes a novel microfluidic device using a thin film transistor (TFT) photosensor integrating a microfluidic channel, a DNA chip platform, and a photodetector for the discrimination of single nucleotide polymorphisms (SNPs). A DNA-arrayed TFT photosensor was used as a DNA chip platform and photo detecting device. Chemiluminescence was used for DNA sensing because chemiluminescence provides higher sensitivity and requires simpler instrumentation than fluorescence methods. The SNP of biotinylated target DNA was detected based on chemiluminescence by using horse radish peroxidase-conjugated streptavidin. The lower detection limit for a model biotinylated oligonucleotide (63-mer) was 0.5 nM, much lower than expected DNA concentrations in a practical application of this device. Furthermore, SNP detection in the aldehyde dehydrogenase 2 gene was successfully achieved using DNA-arrayed TFT photosensor without DNA extraction and DNA purification using PCR products. The assay was completed in less than one hour. Our technology will be a promising approach to developing a miniaturized, disposable DNA chip with high sensitivity.

  10. Base composition at mtDNA boundaries suggests a DNA triple helix model for human mitochondrial DNA large-scale rearrangements.

    PubMed

    Rocher, Christophe; Letellier, Thierry; Copeland, William C; Lestienne, Patrick

    2002-06-01

    Different mechanisms have been proposed to account for mitochondrial DNA (mtDNA) instability based on the presence of short homologous sequences (direct repeats, DR) at the potential boundaries of mtDNA rearrangements. Among them, slippage-mispairing of the replication complex during the asymmetric replication cycle of the mammalian mitochondrial DNA has been proposed to account for the preferential localization of deletions. This mechanism involves a transfer of the replication complex from the first neo-synthesized heavy (H) strand of the DR1, to the DR2, thus bypassing the intervening sequence and producing a deleted molecule. Nevertheless, the nature of the bonds between the DNA strands remains unknown as the forward sequence of DR2, beyond the replication complex, stays double-stranded. Here, we have analyzed the base composition of the DR at the boundaries of mtDNA deletions and duplications and found a skewed pyrimidine content of about 75% in the light-strand DNA template. This suggests the possible building of a DNA triple helix between the G-rich neo-synthesized DR1 and the base-paired homologous G.C-rich DR2. In vitro experiments with the purified human DNA polymerase gamma subunits enabled us to show that the third DNA strand may be used as a primer for DNA replication, using a template with the direct repeat forming a hairpin, with which the primer could initiate DNA replication. These data suggest a novel molecular basis for mitochondrial DNA rearrangements through the distributive nature of the DNA polymerase gamma, at the level of the direct repeats. A general model accounting for large-scale mitochondrial DNA deletion and duplication is proposed. These experiments extend to a DNA polymerase from an eucaryote source the use of a DNA triple helix strand as a primer, like other DNA polymerases from phage and bacterial origins.

  11. Characterization of the protective and therapeutic efficiency of a DNA vaccine encoding the major birch pollen allergen Bet v 1a.

    PubMed

    Hartl, A; Hochreiter, R; Stepanoska, T; Ferreira, F; Thalhamer, J

    2004-01-01

    An estimated 100 million individuals suffer from birch pollen allergy. More than 95% of birch pollen-allergic subjects react with the major birch pollen allergen Bet v 1a, and almost 60% of them are sensitized exclusively to this allergen. DNA immunization using the Bet v 1a gene was evaluated with respect to its prophylactic and therapeutic efficacy. A DNA vaccine containing the entire Bet v 1a cDNA under the control of a CMV-promoter was constructed. In order to estimate the protective efficiency, animals received three injections of this vaccine prior to sensitization with recombinant Bet v 1a. Vice versa, in a therapeutic approach, sensitization was followed by treatment with the DNA vaccine. The Bet v 1a DNA vaccine induced strong Bet v 1-specific antibody responses with a Th1-biased response type. Animals which received the DNA vaccine were protected against a following allergic sensitization with Bet v 1a. The protective effect was characterized by suppression of Bet v 1-specific immunoglobulin (Ig)E production, lack of basophil activation and enhanced interferon (IFN)-gamma expression. In a therapeutic situation, treatment of sensitized animals with DNA vaccines decreased IgE production, IgE-mediated basophil release and drastically reduced anaphylactic activity as measured by passive cutaneous anaphylaxis assays. Concerning the cellular immune response, DNA immunization induced a sustaining and dominant shift from a Th2 type response towards a balanced Th1/Th2 type response as indicated by increased IFN-gamma but unchanged IL-5 levels in lymphoproliferation assays. The results demonstrate the allergen-specific protective and therapeutic efficacy of a DNA vaccine encoding the clinically highly relevant allergen Bet v 1a indicating the suitability of this concept for the treatment of allergic diseases.

  12. Effects of DDA, CpG-ODN, and plasmid-encoded chicken IFN-γ on protective immunity by a DNA vaccine against IBDV in chickens

    PubMed Central

    Roh, Ha Jung; Sung, Haan Woo

    2006-01-01

    This study examined the adjuvant effects of dimethyl dioctadecyl ammonium bromide (DDA), CpG oligodeoxynucleotides (CpG-ODN), and chicken interferon-γ (ChIFN-γ) on a DNA vaccine (pcDNA-VP243) against the infectious bursal disease virus (IBDV). A plasmid encoding chicken IFN-ã was constructed. Twice at 2-week intervals, two-week-old chickens were injected intramuscularly and intraperitoneally with either a DNA vaccine alone or a DNA vaccine together with the respective adjuvants. On week 2 after the second immunization, the chickens were orally challenged with the highly virulent IBDV. The groups that received the DNA vaccines plus either DDA or CpG-ODN showed significantly lower survival rates than the group that received the DNA vaccine alone. However, the survival rates for the DNA vaccine alone and for the DNA vaccine plus ChIFN-γ were similar. The chickens had no detectable antibodies to the IBDV before the challenge but all the surviving chickens in all groups except for the normal control group showed the induction of antibodies to the IBDV at day 10 after the challenge. As judged by the lymphocyte proliferation assays using the a WST-8 solution performed on the peripheral blood and splenic lymphocytes, the stimulation indices (SI) of the peripheral blood lymphocytes in all groups except for the normal control group were similar immediately before the challenge. At 10 days post-challenge, the SI for DNA vaccine plus either CpG-ODN or ChIFN-γ was similar to that of the DNA vaccine control group. For splenic lymphocytes, the SI in the DNA vaccine plus CpG-ODN and DNA vaccine plus ChIFN-γ groups were higher than for the DNA vaccine control. These results suggest that DDA actually compromises the protection against the IBDV by DNA vaccine, and CpG-ODN and IFN-γ had no significant effect. PMID:17106228

  13. Genetic analysis of an aphid endosymbiont DNA fragment homologous to the rnpA-rpmH-dnaA-dnaN-gyrB region of eubacteria.

    PubMed

    Lai, C Y; Baumann, P

    1992-04-15

    Buchnera aphidicola is a Gram- eubacterium with a DNA G+C content of 28-30 mol%. This organism is an obligate intracellular symbiont of aphids. To determine its similarity to or difference from other eubacteria, a 4.9-kb DNA fragment from B. aphidicola containing the gene homologous to Escherichia coli dnaA (a gene involved in the initiation of chromosome replication) was cloned into E. coli and sequenced. The order of genes on this fragment, 60K-10K-rnpA-rpmH-dnaA-dnaN-gyrB, was similar to that found in other eubacteria. The sole difference was the absence of recF between dnaN and gyrB. The deduced amino acid sequence of these proteins resembled those of E. coli by a 41 to 83% identity. Except for E. coli, in all the eubacteria so far examined, dnaA is preceded by multiple 9-nucleotide repeats known as a DnaA boxes. No DnaA boxes were detected in the endosymbiont DNA. The possibility that this observation is a consequence of the low G+C content of this DNA fragment (14 mol% G+C) is unlikely since in Mycoplasma capricolum this fragment (19 mol% G+C) has eight DnaA boxes (Fujita et al., 1992). The presence of the sequence, GATC, recognized by the Dam methyl-transferase system, only within six regions coding for proteins suggests that methylation is not a factor in the regulation of the initiation of endosymbiont chromosome replication.

  14. Autoregulation of the dnaA-dnaN operon and effects of DnaA protein levels on replication initiation in Bacillus subtilis.

    PubMed

    Ogura, Y; Imai, Y; Ogasawara, N; Moriya, S

    2001-07-01

    In Escherichia coli, the DnaA protein level appears to play a pivotal role in determining the timing of replication initiation. To examine the effects on replication initiation in B. subtilis, we constructed a strain in which a copy of the dnaA gene was integrated at the purA locus on the chromosome under the control of an isopropyl-beta-D-thiogalactopyranoside (IPTG)-inducible promoter. However, increasing the DnaA level resulted in cell elongation and inhibition of cell growth by induction of the SOS response. Transcription of the native dnaA-dnaN operon was greatly reduced at high DnaA levels, but it was increased in a dnaA-null mutant, indicating autoregulation of the operon by DnaA. When a copy of the dnaN gene was added downstream of the additional dnaA gene at purA, the cells grew at high DnaA levels, suggesting that depletion of DnaN (beta subunit of DNA polymerase III) within the cell by repression of the native dnaA-dnaN operon at high DnaA levels was the cause of the SOS induction. Flow cytometry of the cells revealed that the cell mass at initiation of replication increased at a lower DnaA level and decreased at DnaA levels higher than those of the wild type. Proper timing of replication initiation was observed at DnaA levels nearly comparable to the wild-type level. These results suggest that if the DnaA level increases with progression of the replication cycle, it could act as a rate-limiting factor of replication initiation in B. subtilis.

  15. Autoregulation of the dnaA-dnaN Operon and Effects of DnaA Protein Levels on Replication Initiation in Bacillus subtilis

    PubMed Central

    Ogura, Yoshitoshi; Imai, Yukiho; Ogasawara, Naotake; Moriya, Shigeki

    2001-01-01

    In Escherichia coli, the DnaA protein level appears to play a pivotal role in determining the timing of replication initiation. To examine the effects on replication initiation in B. subtilis, we constructed a strain in which a copy of the dnaA gene was integrated at the purA locus on the chromosome under the control of an isopropyl-β-d-thiogalactopyranoside (IPTG)-inducible promoter. However, increasing the DnaA level resulted in cell elongation and inhibition of cell growth by induction of the SOS response. Transcription of the native dnaA-dnaN operon was greatly reduced at high DnaA levels, but it was increased in a dnaA-null mutant, indicating autoregulation of the operon by DnaA. When a copy of the dnaN gene was added downstream of the additional dnaA gene at purA, the cells grew at high DnaA levels, suggesting that depletion of DnaN (β subunit of DNA polymerase III) within the cell by repression of the native dnaA-dnaN operon at high DnaA levels was the cause of the SOS induction. Flow cytometry of the cells revealed that the cell mass at initiation of replication increased at a lower DnaA level and decreased at DnaA levels higher than those of the wild type. Proper timing of replication initiation was observed at DnaA levels nearly comparable to the wild-type level. These results suggest that if the DnaA level increases with progression of the replication cycle, it could act as a rate-limiting factor of replication initiation in B. subtilis. PMID:11395445

  16. The Efficacy a DNA Vaccine Containing Inserted and Replicated Regions of the E7 Gene for Treatment of HPV 16 Induced Tumors

    PubMed Central

    Brinkman, Joeli A.; Xu, Xuemei; Kast, W. Martin

    2007-01-01

    A majority of cervical cancers are associated with HPV-16. A DNA vaccine (E7IR) was designed for prophylactic and therapeutic treatment of HPV-16+ tumors containing two repeats of the E7 gene to inactivate transformation and duplicate available epitopes. Mice were vaccinated then tumor challenged, or challenged and then immunized and monitored for tumor volume and survival. Splenocytes were utilized for in vivo CTL assays. The E7IR vaccine demonstrated decreased tumor volume and enhanced survival in prophylactic and therapeutic experiments and improved CTL mediated lysis. The E7IR vaccine shows promise in prevention of tumor formation and elimination of established tumors. PMID:17241713

  17. The efficacy of a DNA vaccine containing inserted and replicated regions of the E7 gene for treatment of HPV-16 induced tumors.

    PubMed

    Brinkman, Joeli A; Xu, Xuemei; Kast, W Martin

    2007-04-30

    A majority of cervical cancers are associated with Human Papillomavirus (HPV)-16. A DNA vaccine (E7IR) was designed for prophylactic and therapeutic treatment of HPV-16+ tumors containing two repeats of the E7 gene to inactivate transformation and duplicate available epitopes. Mice were vaccinated then tumor challenged, or challenged and then immunized and monitored for tumor volume and survival. Splenocytes were utilized for in vivo CTL assays. The E7IR vaccine demonstrated decreased tumor volume and enhanced survival in prophylactic and therapeutic experiments and improved CTL-mediated lysis. The E7IR vaccine shows promise in prevention of tumor formation and elimination of established tumors.

  18. Structure of the 2-Aminopurine-Cytosine Base Pair Formed in the Polymerase Active Site of the RB69 Y567A-DNA Polymerase

    SciTech Connect

    Reha-Krantz, Linda J.; Hariharan, Chithra; Subuddhi, Usharani; Xia, Shuangluo; Zhao, Chao; Beckman, Jeff; Christian, Thomas; Konigsberg, William

    2011-11-21

    The adenine base analogue 2-aminopurine (2AP) is a potent base substitution mutagen in prokaryotes because of its enhanceed ability to form a mutagenic base pair with an incoming dCTP. Despite more than 50 years of research, the structure of the 2AP-C base pair remains unclear. We report the structure of the 2AP-dCTP base pair formed within the polymerase active site of the RB69 Y567A-DNA polymerase. A modified wobble 2AP-C base pair was detected with one H-bond between N1 of 2AP and a proton from the C4 amino group of cytosine and an apparent bifurcated H-bond between a proton on the 2-amino group of 2-aminopurine and the ring N3 and O2 atoms of cytosine. Interestingly, a primer-terminal region rich in AT base pairs, compared to GC base pairs, facilitated dCTP binding opposite template 2AP. We propose that the increased flexibility of the nucleotide binding pocket formed in the Y567A-DNA polymerase and increased 'breathing' at the primer-terminal junction of A+T-rich DNA facilitate dCTP binding opposite template 2AP. Thus, interactions between DNA polymerase residues with a dynamic primer-terminal junction play a role in determining base selectivity within the polymerase active site of RB69 DNA polymerase.

  19. An unusual gene containing a dnaJ N-terminal box flanks the putative origin of replication of Mycoplasma genitalium.

    PubMed Central

    Bailey, C C; Bott, K F

    1994-01-01

    Origins of replication are known to be highly conserved among widely divergent microbial species, with the gene order in those regions being dnaA-dnaN-recF-gyrB. On the basis of sequence identities to entries in GenBank, the gene order of a 6-kb fragment of Mycoplasma genitalium DNA was determined to be dnaN-orf311-gyrB-gyrA-serS, which is structurally similar to the ancestral origin of replication. We have directly linked the dnaN gene to the M. genitalium dnaA gene by PCR amplification. However, we found a novel open reading frame, designated orf311, in place of an expected sequence encoding recF. Orf311 contains a DnaJ box motif at its N terminus, but it has no overall homology to any other protein or sequence in the database. We are unable to detect any recF homolog in M. genitalium by hybridization or during a random sequencing survey of the genome. PMID:8083173

  20. Applying the stochastic difference equation to DNA conformational transitions: a study of B-Z and B-A DNA transitions.

    PubMed

    Lim, Wilber; Feng, Yuan Ping

    2005-06-15

    Despite the existence of numerous models to account for the B-Z DNA transition, experimenters have not yet arrived at a conclusive answer to the structural and dynamical features of the B-Z transition. By applying the stochastic difference equation to simulate the B-Z DNA transition, we have shown that the stretched intermediate model of the B-Z transition is more probable than other B-Z transition models such as the Harvey model. This is accomplished by comparing potential energy profiles of various B-Z DNA transition models and calculating relative probabilities based on the stochastic difference equation with respect to length (SDEL) formalism. The results garnered in this article allow for new approaches in determining the structural transition of B-DNA to Z-DNA experimentally. We have also simulated the B-A DNA transition using the stochastic difference equation. Unlike the B-Z DNA transition, the mechanism for the B-A DNA transition is well established. The variation in the pseudorotation angle during the transition is in good agreement with experimental results. Qualitative features of the simulated B-A transition also agree well with experimental data. The SDEL approach is thus a suitable numerical technique to compute long-time molecular dynamics trajectory for DNA molecules.

  1. Protective efficacy of a DNA vaccine construct encoding the VP2 gene of infectious bursal disease and a truncated HSP70 of Mycobacterium tuberculosis in chickens.

    PubMed

    Maity, Hemanta Kumar; Dey, Sohini; Mohan, C Madhan; Khulape, Sagar A; Pathak, Dinesh C; Vakharia, Vikram N

    2015-02-18

    Infectious bursal disease (IBD) is an acute, infectious, immunosuppressive disease affecting young chicken worldwide. The etiological agent IBD virus (IBDV) is a double stranded RNA virus with outer capsid protein VP2 of IBDV is the major antigenic determinant capable of inducing neutralizing antibody. DNA vaccines encoding VP2 has been extensively studied achieving only partial protection. However, the efficacy of DNA vaccines against IBDV can be augmented by choosing a potential molecular adjuvant. The goal of the present study is to evaluate the immune response and protective efficacy of a DNA vaccine encoding the C-terminal domain of the heat shock protein 70 (cHSP70) of Mycobacterium tuberculosis gene genetically fused with the full length VP2 gene of IBDV (pCIVP2-cHSP70) in comparison to a 'DNA prime-protein boost' approach and a DNA vaccine encoding the VP2 gene (pCIVP2) alone. The results indicate that both pCIVP2-cHSP70 and 'DNA prime-protein boost' elicited humoral as well as cellular immune responses. Chickens in the pCIVP2-cHSP70 and 'DNA prime-protein boost' groups developed significantly higher levels of ELISA titer to IBDV antigen compared to the group immunized with pCIVP2 alone (p<0.01). However, significantly higher levels of lymphocyte proliferative response, IL-12 and IFN-γ production were found in the pCIVP2-cHSP70 group compared to 'DNA prime-protein boost' group. Additionally, chickens immunized with pCIVP2-cHSP70 and 'DNA prime-protein boost' vaccines were completely protected against the vvIBDV whereas pCIVP2 DNA vaccine alone was able to protect only 70%. These findings suggest that the truncated C-terminal HSP70 mediated DNA vaccine genetically fused with the VP2 gene construct stimulated both humoral and cell mediated immune responses and conferred complete protection against IBDV. This novel strategy is perhaps a seminal concept in utilizing HSP70 as an adjuvant molecule to elicit an immune response against IBD affecting chickens.

  2. Tyramine Hydrochloride Based Label-Free System for Operating Various DNA Logic Gates and a DNA Caliper for Base Number Measurements.

    PubMed

    Fan, Daoqing; Zhu, Xiaoqing; Dong, Shaojun; Wang, Erkang

    2017-07-05

    DNA is believed to be a promising candidate for molecular logic computation, and the fluorogenic/colorimetric substrates of G-quadruplex DNAzyme (G4zyme) are broadly used as label-free output reporters of DNA logic circuits. Herein, for the first time, tyramine-HCl (a fluorogenic substrate of G4zyme) is applied to DNA logic computation and a series of label-free DNA-input logic gates, including elementary AND, OR, and INHIBIT logic gates, as well as a two to one encoder, are constructed. Furthermore, a DNA caliper that can measure the base number of target DNA as low as three bases is also fabricated. This DNA caliper can also perform concatenated AND-AND logic computation to fulfil the requirements of sophisticated logic computing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Genetic mapping and biochemical characterization of suppressor mutations sukA and sukB for a dnaK7(Ts) mutation of Escherichia coli K-12.

    PubMed

    Itikawa, H; Mishina, Y; Wada, M; Fujita, H

    1992-02-01

    Temperature-resistant pseudorevertants were isolated from a dnaK7(Ts) mutant of Escherichia coli K-12. Two of these pseudorevertants were shown to carry suppressor mutations, sukA and sukB, respectively. Genetic mapping by conjugation and P1-transduction revealed that these suppressor mutations were located at two distinct sites between 76 and 77 min close to the suhA and rpoH genes. Labeled cellular proteins were extracted from suppressor mutants grown at various temperatures and subjected to SDS-gel electrophoresis. Autoradiograms of the gels indicated that these suppressor mutations each resulted in increased synthesis of the heat shock protein Lon (an ATP-dependent protease, La) at both permissive and nonpermissive temperatures.

  4. Telomere attrition induces a DNA double-strand break damage signal that reactivates p53 transcription in HTLV-I leukemic cells.

    PubMed

    Datta, A; Nicot, C

    2008-02-14

    Persistent inhibition of telomerase induces a severe telomere shortening in human T-cell leukemia virus type-1-infected cells which signals a DNA double-strand break damage response, formation of telomere dysfunction-induced foci and activates the ATM pathway. In turn, activation of ATM and its downstream effectors led to an increased phosphorylation and acetylation on specific residues of p53 known to be involved in transcriptional activation. Disruption of Mdm2-p53 complexes coupled with increased proteasomal degradation of MDMX further enhanced reactivation of p53 transcription, ultimately leading to senescence of tumor cells. Induction of senescence in these T-cells was associated with an increased expression of p21, p16 and activation of GSK3beta. Our results support the cancer-aging model and demonstrate that the halt of aging in cancer cells can be reversed through reactivation of p53.

  5. Measurement of changes in impedance of DNA nanowires due to radiation induced structural damage. A novel approach for a DNA-based radiosensitive device

    NASA Astrophysics Data System (ADS)

    Heimbach, Florian; Arndt, Alexander; Nettelbeck, Heidi; Langner, Frank; Giesen, Ulrich; Rabus, Hans; Sellner, Stefan; Toppari, Jussi; Shen, Boxuan; Baek, Woon Yong

    2017-08-01

    The ability of DNA to conduct electric current has been the topic of numerous investigations over the past few decades. Those investigations indicate that this ability is dependent on the molecular structure of the DNA. Radiation-induced damages, which lead to an alteration of the molecular structure, should therefore change the electrical impedance of a DNA molecule. In this paper, the damage due to ionising radiation is shown to have a direct effect on the electrical transport properties of DNA. Impedance measurements of DNA samples were carried out by an AC impedance spectrometer before, during and after irradiation. The samples comprised of DNA segments, which were immobilized between gold electrodes with a gap of 12 μm. The impedance of all DNA samples exhibited rising capacitive behaviour with increasing absorbed dose.

  6. Enzymatic Reaction with Unnatural Substrates: DNA Photolyase (Escherichia coli) Recognizes and Reverses Thymine [2+2] Dimers in the DNA Strand of a DNA/PNA Hybrid Duplex

    NASA Astrophysics Data System (ADS)

    Ramaiah, Danaboyina; Kan, Yongzhi; Koch, Troels; Orum, Henrik; Schuster, Gary B.

    1998-10-01

    Peptide nucleic acids (PNA) are mimics with normal bases connected to a pseudopeptide chain that obey Watson--Crick rules to form stable duplexes with itself and natural nucleic acids. This has focused attention on PNA as therapeutic or diagnostic reagents. Duplexes formed with PNA mirror some but not all properties of DNA. One fascinating aspect of PNA biochemistry is their reaction with enzymes. Here we show an enzyme reaction that operates effectively on a PNA/DNA hybrid duplex. A DNA oligonucleotide containing a cis, syn-thymine [2+2] dimer forms a stable duplex with PNA. The hybrid duplex is recognized by photolyase, and irradiation of the complex leads to the repair of the thymine dimer. This finding provides insight into the enzyme mechanism and provides a means for the selective repair of thymine photodimers.

  7. A combination of a DNA-chimera siRNA against PLK-1 and zoledronic acid suppresses the growth of malignant mesothelioma cells in vitro.

    PubMed

    Kawata, Eri; Ashihara, Eishi; Nakagawa, Yoko; Kiuchi, Takahiro; Ogura, Mai; Yao, Hisayuku; Sakai, Kazuki; Tanaka, Ruriko; Nagao, Rina; Yokota, Asumi; Takeuchi, Miki; Kimura, Shinya; Hirai, Hideyo; Maekawa, Taira

    2010-08-28

    Although novel agents effective against malignant mesothelioma (MM) have been developed, the prognosis of patients with MM is still poor. We generated a DNA-chimeric siRNA against polo-like kinase-1 (PLK-1), which was more stable in human serum than the non-chimeric siRNA. The chimeric PLK-1 siRNA inhibited MM cell proliferation through the induction of apoptosis. Next, we investigated the effects of zoledronic acid (ZOL) on MM cells, and found that ZOL also induced apoptosis in MM cells. Furthermore, ZOL augmented the inhibitory effects of the PLK-1 siRNA. In conclusion, combining a PLK-1 siRNA with ZOL treatment is an attractive strategy against MM. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  8. A new D-DNA form of poly(dA-dT).poly(dA-dT): an A-DNA type structure with reversed Hoogsteen pairing.

    PubMed

    Premilat, S; Albiser, G

    2001-10-01

    The D-DNA double helix model of poly(dA-dT).poly(dA-dT) proposed in the literature is not in accordance with some notable experimental facts and physicochemical conditions to which it is related. Thus, the fibre X-ray diffraction pattern of D-DNA obtained at a relative humidity lower than that giving the A-DNA form is singularly not taken into account when one assumes that there is only one D structure of B-DNA type. We rather suggest that there are actually two different forms of D-DNA, namely D(A) which partakes in the D-A-B transitions and D(B) associated with the D-B change of conformation. Although these two DNA structures have the same helical parameters (pitch and number of residues per turn), in agreement with X-ray data, their detailed conformations are considerably different. Whereas D(B) is indeed the structure generally defined as D-DNA, a critical analysis based on a comparison between different possible DNA double helices leads us to propose dihedral angles, a set of atomic coordinates and a stereo view of another new form of D-DNA, the D(A) structural model. It is a right-handed double helix with a dinucleotide as the repeat unit. The furanose rings are of the A-DNA type (C3' endo) and the bases are hydrogen bonded according to the reversed Hoogsteen pairing. Such a disposition renders the D(A) model unsuitable for poly(dI-dC).poly(dI-dC), the other alternating polynucleotide observed in the D(B) structure. The consistency of these two different D-DNA structures of poly(dA-dT).poly(dA-dT) with the general aspects of hydration and helix-helix transitions of DNA, as well as with the conformational variability of AT base sequences, is discussed.

  9. Immunogenicity of a DNA and Recombinant Protein Vaccine Combining LipL32 and Loa22 for Leptospirosis Using Chitosan as a Delivery System.

    PubMed

    Umthong, Supawadee; Buaklin, Arun; Jacquet, Alain; Sangjun, Noppadol; Kerdkaew, Ruthairat; Patarakul, Kanitha; Palaga, Tanapat

    2015-04-01

    Leptospirosis is a worldwide zoonotic disease caused by pathogenic Leptospira, a genus of which more than 250 serovars have been identified. Commercial bacterin vaccines are limited in that they lack both cross-protection against heterologous serovars and long-term protection. This study investigated in mice the immunogenicity of an anti-leptospirosis vaccine, using the outer membrane proteins LipL32 and Loa22 as antigens. The immunogenicity of this vaccine formulation was compared with those induced by vaccines based on LipL32 or Loa22 alone. A DNA-encapsulated chitosan nanoparticle was used for in vivo DNA delivery. Using a unique DNA plasmid expressing both lipL32 and loa22 for vaccination, higher antibody responses were induced than when combining plasmids harboring each gene separately. Therefore, this formulation was used to test the immunogenicity when administered by a heterologous prime (DNA)-boost (protein) immunization regimen. The specific antibody responses against LipL32 (total IgG and IgG1) and Loa22 (IgG1) were higher in mice receiving two antigens in combination than in those vaccinated with a single antigen alone. Although no significant difference in splenic CD4+ T cell proliferation was observed among all groups of vaccinated mice, splenocytes from mice vaccinated with two antigens exhibited higher interferon-γ and IL-2 production than when using single antigens alone upon in vitro restimulation. Taken together, the immunogenicity induced by LipL32 and Loa22 antigens in a heterologous primeboost immunization regimen using chitosan as a DNA delivery system induces higher immune response, and may be useful for developing a better vaccine for leptospirosis.

  10. THAP5 is a DNA-binding transcriptional repressor that is regulated in melanoma cells during DNA damage-induced cell death

    SciTech Connect

    Balakrishnan, Meenakshi P.; Cilenti, Lucia; Ambivero, Camilla; Goto, Yamafumi; Takata, Minoru; Turkson, James; Li, Xiaoman Shawn; Zervos, Antonis S.

    2011-01-07

    Research highlights: {yields} THAP5 is a DNA-binding protein and a transcriptional repressor. {yields} THAP5 is induced in melanoma cells upon exposure to UV or treatment with cisplatin. {yields} THAP5 induction correlates with the degree of apoptosis in melanoma cell population. {yields} THAP5 is a pro-apoptotic protein involved in melanoma cell death. -- Abstract: THAP5 was originally isolated as a specific interactor and substrate of the mitochondrial pro-apoptotic Omi/HtrA2 protease. It is a human zinc finger protein characterized by a restricted pattern of expression and the lack of orthologs in mouse and rat. The biological function of THAP5 is unknown but our previous studies suggest it could regulate G2/M transition in kidney cells and could be involved in human cardiomyocyte cell death associated with coronary artery disease (CAD). In this report, we expanded our studies on the properties and function of THAP5 in human melanoma cells. THAP5 was expressed in primary human melanocytes as well as in all melanoma cell lines that were tested. THAP5 protein level was significantly induced by UV irradiation or cisplatin treatment, conditions known to cause DNA damage. The induction of THAP5 correlated with a significant increase in apoptotic cell death. In addition, we show that THAP5 is a nuclear protein that could recognize and bind a specific DNA motif. THAP5 could also repress the transcription of a reporter gene in a heterologous system. Our work suggests that THAP5 is a DNA-binding protein and a transcriptional repressor. Furthermore, THAP5 has a pro-apoptotic function and it was induced in melanoma cells under conditions that promoted cell death.

  11. The COUP-TFII variant lacking a DNA-binding domain inhibits the activation of the Cyp7a1 promoter through physical interaction with COUP-TFII.

    PubMed

    Yamazaki, Tomoko; Suehiro, Jun-ichi; Miyazaki, Hideki; Minami, Takashi; Kodama, Tatsuhiki; Miyazono, Kohei; Watabe, Tetsuro

    2013-06-01

    The COUP-TFII (chicken ovalbumin upstream promoter-transcription factor II) nuclear receptor, which is composed of a DNA-binding domain and a ligand-binding domain, exerts pleiotropic effects on development and cell differentiation by regulating the transcription of its target genes, including Cyp7a1 (cytochrome P450, family 7, subfamily a, polypeptide 1), which plays important roles in catabolism of cholesterol in the liver. Although multiple variants of COUP-TFII exist, their roles in the regulation of Cyp7a1 expression have not been elucidated. In the present study, we investigated the roles of COUP-TFII-V2 (variant 2), which lacks a DNA-binding domain, in the regulation of the transcriptional control of the Cyp7a1 gene by COUP-TFII in hepatocellular carcinoma cells. We found that COUP-TFII-V2 was significantly expressed in Huh7 cells, in which Cyp7a1 was not expressed. Furthermore, knockdown of COUP-TFII-V2 enhanced endogenous Cyp7a1 expression in Huh7 cells. Although COUP-TFII activates the Cyp7a1 promoter through direct binding to DNA, this activation was affected by COUP-TFII-V2, which physically interacted with COUP-TFII and inhibited its DNA-binding ability. Chromatin immunoprecipitation assays showed that COUP-TFII-V2 inhibited the binding of endogenous COUP-TFII to the intact Cyp7a1 promoter. The results of the present study suggest that COUP-TFII-V2 negatively regulates the function of COUP-TFII by inhibiting its binding to DNA to decrease Cyp7a1 expression.

  12. Induction of antigen-positive cell death by the expression of perforin, but not DTa, from a DNA vaccine enhances the immune response.

    PubMed

    Gargett, Tessa; Grubor-Bauk, Branka; Garrod, Tamsin J; Yu, Wenbo; Miller, Darren; Major, Lee; Wesselingh, Steve; Suhrbier, Andreas; Gowans, Eric J

    2014-04-01

    The failure of traditional protein-based vaccines to prevent infection by viruses such as HIV or hepatitis C highlights the need for novel vaccine strategies. DNA vaccines have shown promise in small animal models, and are effective at generating anti-viral T cell-mediated immune responses; however, they have proved to be poorly immunogenic in clinical trials. We propose that the induction of necrosis will enhance the immune response to vaccine antigens encoded by DNA vaccines, as necrotic cells are known to release a range of intracellular factors that lead to dendritic cell (DC) activation and enhanced cross-presentation of antigen. Here we provide evidence that induction of cell death in DNA vaccine-targeted cells provides an adjuvant effect following intradermal vaccination of mice; however, this enhancement of the immune response is dependent on both the mechanism and timing of cell death after antigen expression. We report that a DNA vaccine encoding the cytolytic protein, perforin, resulted in DC activation, enhanced broad and multifunctional CD8 T-cell responses to the HIV-1 antigen GAG and reduced viral load following challenge with a chimeric virus, EcoHIV, compared with the canonical GAG DNA vaccine. This effect was not observed for a DNA vaccine encoding an apoptosis-inducing toxin, DTa, or when the level of perforin expression was increased to induce cell death sooner after vaccination. Thus, inducing lytic cell death following a threshold level of expression of a viral antigen can improve the immunogenicity of DNA vaccines, whereas apoptotic cell death has an inhibitory effect on the immune response.

  13. Loss of INPP4B causes a DNA repair defect through loss of BRCA1, ATM and ATR and can be targeted with PARP inhibitor treatment.

    PubMed

    Ip, Laura R H; Poulogiannis, George; Viciano, Felipe Cia; Sasaki, Junko; Kofuji, Satoshi; Spanswick, Victoria J; Hochhauser, Daniel; Hartley, John A; Sasaki, Takehiko; Gewinner, Christina A

    2015-04-30

    Treatment options for ovarian cancer patients remain limited and overall survival is less than 50% despite recent clinical advances. The lipid phosphatase inositol polyphosphate 4-phosphatase type II (INPP4B) has been described as a tumor suppressor in the PI3K/Akt pathway with loss of expression found most pronounced in breast, ovarian cancer and melanoma. Using microarray technology we identified a DNA repair defect in INPP4B-deficient cells, which we further characterized by comet assays and quantification of γH2AX, RAD51 and 53BP1 foci formation. INPP4B loss resulted in significantly increased sensitivity towards PARP inhibition, comparable to loss of BRCA1 in two- and three-dimensional in vitro models, as well as in in vivo xenograft models. Mechanistically, we discovered that INPP4B forms a protein complex with the key players of DNA repair, ATR and BRCA1, in GST pulldown and 293T overexpression assays, and INPP4B loss affects BRCA1, ATM and ATR protein stability resulting in the observed DNA repair defect. Given that INPP4B loss has been found in 40% of ovarian cancer patients, this study provides the rationale for establishing INPP4B as a biomarker of PARP inhibitor response, and consequently offers novel therapeutic options for a significant subset of patients. Loss of the tumor suppressor inositol polyphosphate 4-phosphatase type II (INPP4B) results in a DNA repair defect due to concomitant loss of BRCA1, ATR and ATM and can be therapeutically targeted with PARP inhibitors.

  14. Analysis of anamnestic immune responses in adult horses and priming in neonates induced by a DNA vaccine expressing the vapA gene of Rhodococcus equi.

    PubMed

    Lopez, A Marianela; Hines, Melissa T; Palmer, Guy H; Knowles, Donald P; Alperin, Debra C; Hines, Stephen A

    2003-09-08

    Rhodococcus equi remains one of the most important pathogens of early life in horses, yet conventional vaccines to prevent rhodococcal pneumonia have not been successful. DNA vaccination offers an alternative to conventional vaccines with specific advantages for immunization of neonates. We developed a DNA vaccine expressing the vapA gene (pVR1055vapA) that induced an anamnestic response characterized by virulence associated protein A (VapA)-specific IgG antibodies in sera and bronchoalveolar lavage fluid (BALF) as well as VapA-specific proliferation of pulmonary lymphocytes when tested in adult ponies. In contrast, none of the adults receiving the control plasmid responded. To determine if pVR1055vapA induced VapA-specific responses in the foal, the targeted age group for vaccination against R. equi, 10 naïve foals were randomly assigned at birth to two groups of five. At 8-15 days of age (day 1), foals were vaccinated by intranasal and intradermal (i.d.) routes with either pVR1055vapA or the negative control pVR1055vapA_rev. All foals were DNA boosted at day 14 and protein boosted at day 30 with either recombinant VapA or recombinant CAT (control group). Prior to the protein boost, neither group developed VapA-specific immune responses. However, at day 45, two of the VR1055vapA-vaccinated foals had increased titers of VapA-specific IgGb, IgM and IgGa in the sera, and IgG in the BALF. The induction of the opsonizing isotypes IgGa and IgGb has been previously shown to be associated with protection against R. equi. No VapA-specific immune responses were detected in the control group. This study indicates that the DNA vaccine effectively stimulates anamnestic systemic and pulmonary immune responses in adult horses. The results in foals suggest that the DNA vaccine also primed a subset of immunized neonates. These data support further development and modification to produce a DNA vaccine to more effectively prime neonatal foals.

  15. Dynamics of a DNA Gel

    NASA Astrophysics Data System (ADS)

    Adhikari, Ramesh; Bhattacharya, Aniket; Dogariu, Aristide

    We study in silico the properties of a gel consisting of DNA strands (modeled as semi-flexible chains) and linkers of varying flexibility, length, and topology. These linkers are envisioned and modeled as active components with additional attributes so as to mimic properties of a synthetic DNA gel containing motor proteins. We use Brownian dynamics to directly obtain frequency dependent complex shear moduli of the gel. We further carry out force spectroscopy on these computer generated gels and study the relaxation properties as a function of the important parameters of the model, e.g., densities and relative ratios of the DNAs and the linkers, the average life time of a link, etc. Our studies are relevant for designing synthetic bio-materials for both materials and medical applications.

  16. Developing a DNA variant database.

    PubMed

    Fung, David C Y

    2008-01-01

    Disease- and locus-specific variant databases have been a valuable resource to clinical and research geneticists. With the recent rapid developments in technologies, the number of DNA variants detected in a typical molecular genetics laboratory easily exceeds 1,000. To keep track of the growing inventory of DNA variants, many laboratories employ information technology to store the data as well as distributing the data and its associated information to clinicians and researchers via the Web. While it is a valuable resource, the hosting of a web-accessible database requires collaboration between bioinformaticians and biologists and careful planning to ensure its usability and availability. In this chapter, a series of tutorials on building a local DNA variant database out of a sample dataset will be provided. However, this tutorial will not include programming details on building a web interface and on constructing the web application necessary for web hosting. Instead, an introduction to the two commonly used methods for hosting web-accessible variant databases will be described. Apart from the tutorials, this chapter will also consider the resources and planning required for making a variant database project successful.

  17. A DNA-based method for identification of krill species and its application to analysing the diet of marine vertebrate predators.

    PubMed

    Jarman, S N; Gales, N J; Tierney, M; Gill, P C; Elliott, N G

    2002-12-01

    Accurate identification of species that are consumed by vertebrate predators is necessary for understanding marine food webs. Morphological methods for identifying prey components after consumption often fail to make accurate identifications of invertebrates because prey morphology becomes damaged during capture, ingestion and digestion. Another disadvantage of morphological methods for prey identification is that they often involve sampling procedures that are disruptive for the predator, such as stomach flushing or lethal collection. We have developed a DNA-based method for identifying species of krill (Crustacea: Malacostraca), an enormously abundant group of invertebrates that are directly consumed by many groups of marine vertebrates. The DNA-based approach allows identification of krill species present in samples of vertebrate stomach contents, vomit, and, more importantly, faeces. Utilizing samples of faeces from vertebrate predators minimizes the impact of dietary studies on the subject animals. We demonstrate our method first on samples of Adelie penguin (Pygoscelis adeliae) stomach contents, where DNA-based species identification can be confirmed by prey morphology. We then apply the method to faeces of Adelie penguins and to faeces of the endangered pygmy blue whale (Balaenoptera musculus brevicauda). In each of these cases, krill species consumed by the predators could be identified from their DNA present in faeces or stomach contents.

  18. In vitro clearance of doxorubicin with a DNA-based filtration device designed for intravascular use with intra-arterial chemotherapy.

    PubMed

    Aboian, Mariam S; Yu, Jay F; Gautam, Ayushi; Sze, Chia-Hung; Yang, Jeffrey K; Chan, Jonathan; Lillaney, Prasheel V; Jordan, Caroline D; Oh, Hee-Jeung; Wilson, David M; Patel, Anand S; Wilson, Mark W; Hetts, Steven W

    2016-12-01

    To report a novel method using immobilized DNA within mesh to sequester drugs that have intrinsic DNA binding characteristics directly from flowing blood. DNA binding experiments were carried out in vitro with doxorubicin in saline (PBS solution), porcine serum, and porcine blood. Genomic DNA was used to identify the concentration of DNA that shows optimum binding clearance of doxorubicin from solution. Doxorubicin binding kinetics by DNA enclosed within porous mesh bags was evaluated. Flow model simulating blood flow in the inferior vena cava was used to determine in vitro binding kinetics between doxorubicin and DNA. The kinetics of doxorubicin binding to free DNA is dose-dependent and rapid, with 82-96 % decrease in drug concentration from physiologic solutions within 1 min of reaction time. DNA demonstrates faster binding kinetics by doxorubicin as compared to polystyrene resins that use an ion exchange mechanism. DNA contained within mesh yields an approximately 70 % decrease in doxorubicin concentration from solution within 5 min. In the IVC flow model, there is a 70 % drop in doxorubicin concentration at 60 min. A DNA-containing ChemoFilter device can rapidly clear clinical doses of doxorubicin from a flow model in simple and complex physiological solutions, thereby suggesting a novel approach to reduce the toxicity of DNA-binding drugs.

  19. Characterization of the paclitaxel loaded chitosan graft Pluronic F127 copolymer micelles conjugate with a DNA aptamer targeting HER-2 overexpressing breast cancer cells

    NASA Astrophysics Data System (ADS)

    Thach Nguyen, Kim; Nguyen, Thu Ha; Do, Dinh Ho; Huan Le, Quang

    2017-03-01

    In this work we report the isolation of DNA aptamer that is specifically bound to a HER-2 overexpressing SK-BR-3 human breast cancer cell line, using SELEX strategy. Paclitaxel (PTX) loaded chitosan graft Pluronic F127 copolymer micelles conjugate with a DNA aptamer was synthesized and its structure was confirmed by TEM image. This binary mixed system consisting of DNA aptamer modified Pluronic F127 and chitosan could enhance PTX loading capacity and increase micelle stability. Morphology images confirmed the existence of PTX micelles, with an average size of approximately 86.22 ± 1.45 nm diameters. Drug release profile showed that the PTX conjugate maintained a sustained PTX release. From in vitro cell experiment it was shown that 89%–93%, 50%–58%, 55%–62%, 24%–28% and 2%–7% of the SK-BR-3, NS-VN-67, LH-VN-48, HT-VN-26 and NV-VN-31, respectively, were dead after 6–48 h. These results demonstrated a novel DNA aptamer-micelle assembly for efficient detection and a system for the delivery of PTX targeting specific HER-2 overexpressing. We have also successfully cultivated cancer tissues of explants from Vietnamese patients on a type I collagen substrate. The NS-VN-67, LH-VN-48, HT-VN-26 and NV-VN-31cell lines were used as cellular model sources for the study of chemotherapy drug in cancer.

  20. Lotus japonicus SUNERGOS1 encodes a predicted subunit A of a DNA topoisomerase VI that is required for nodule differentiation and accommodation of rhizobial infection

    PubMed Central

    Yoon, Hwi Joong; Hossain, Md Shakhawat; Held, Mark; Hou, Hongwei; Kehl, Marilyn; Tromas, Alexandre; Sato, Shusei; Tabata, Satoshi; Andersen, Stig Uggerhøj; Stougaard, Jens; Ross, Loretta; Szczyglowski, Krzysztof

    2014-01-01

    A symbiotic mutant of Lotus japonicus, called sunergos1-1 (suner1-1), originated from a har1-1 suppressor screen. suner1-1 supports epidermal infection by Mesorhizobium loti and initiates cell divisions for organogenesis of nodule primordia. However, these processes appear to be temporarily stalled early during symbiotic interaction, leading to a low nodule number phenotype. This defect is ephemeral and near wild-type nodule numbers are reached by suner1-1 at a later point after infection. Using an approach that combined map-based cloning and next-generation sequencing we have identified the causative mutation and show that the suner1-1 phenotype is determined by a weak recessive allele, with the corresponding wild-type SUNER1 locus encoding a predicted subunit A of a DNA topoisomerase VI. Our data suggest that at least one function of SUNER1 during symbiosis is to participate in endoreduplication, which is an essential step during normal differentiation of functional, nitrogen-fixing nodules. PMID:24661810

  1. Recovery of active beta-lactamases from Proteus vulgaris and RTEM-1 hybrid by random mutagenesis by using a dnaQ strain of Escherichia coli.

    PubMed

    Hosseini-Mazinani, S M; Nakajima, E; Ihara, Y; Kameyama, K Z; Sugimoto, K

    1996-09-01

    Proteus vulgaris and RTEM-1 beta-lactamases that belong to molecular class A with 37% amino acid similarity were examined to find the relationship between amino acid residues and activity of enzymes. MICs of ampicillin were > 2,000 micrograms/ml for Escherichia coli cells producing these enzymes. We have made 18 hybrid genes by substituting the coding region of the P. vulgaris beta-lactamase gene with the equivalent portions from the RTEM-1 gene. Most of these hybrids produced inactive proteins, but a few hybrid enzymes had partial or trace activity. From one of the hybrid genes (MIC of ampicillin, 100 micrograms/ml), we recovered three kinds of active mutants which provided ampicillin MICs of 1,000 micrograms/ml by the selection of spontaneous mutations in a dnaQ strain of E. coli. In these mutants, Leu-148, Met-182, and Tyr-274 were replaced with Val, Thr, and His, respectively. These amino acids have not been identified as residues with functional roles in substrate hydrolysis. Furthermore, from these hybrid mutants, we obtained a second set of mutants which conferred ampicillin MICs of 1,500 micrograms/ml. Interestingly, the second mutations were limited to these three amino acid substitutions. These amino acid residues which do not directly interact with substrates have an effect on enzyme activity. These mutant enzymes exhibited lower K(m) values for cephaloridine than both parental enzymes.

  2. RNA polymerase II stalled on a DNA template during transcription elongation is ubiquitinated and the ubiquitination facilitates displacement of the elongation complex.

    PubMed

    Yang, Li-Ying; Jiang, Hong; Rangel, Kelly M

    2003-03-01

    When mammalian cells are exposed to cisplatin or ultraviolet irradiation, the RNA polymerase II (RNAP II) large subunit becomes ubiquitinated and is subsequently degraded via the proteasomal pathway. Using a DNA template immobilized on magnetic beads in an in vitro transcription reaction, we showed that a pause of the elongating RNAP II complex caused by nucleotide starvation induced the ubiquitination of the stalled RNAP II. The ubiquitinated RNAP II dissociated from the ternary complex when transcription was allowed to resume. The dissociated (free) RNAP II remained ubiquitinated. The proteasome inhibitor MG132 increased the accumulation of ubiquitinated free RNAP II but did not affect the amount of ubiquitinated, template-bound RNAP II, indicating that the ubiquitinated RNAP II was displaced from the template and then degraded by the proteasomes. Our work shows that the elongation complex that was stalled at the template by nucleotide starvation is targeted by the ubiquitin-conjugating system and that ubiquitination facilitates displacement of the stalled RNAP II from the template. Our findings together with the findings by others that DNA damaging agents induced the ubiquitination in mammalian cells that are nucleotide excision repair competent, suggest that the RNAP II ubiquitination may have a role in the regulation of transcription-coupled DNA repair.

  3. A new fluorescence turn-on nanobiosensor for the detection of micro-RNA-21 based on a DNA-gold nanocluster

    NASA Astrophysics Data System (ADS)

    Hosseini, Morteza; Ahmadi, Elnaz; Borghei, Yasaman-Sadat; Ganjali, Mohammad Reza

    2017-03-01

    In this study, DNA/gold nanoclusters (AuNCs) were used to develop an AuNC-based turn-on fluorescence probe for the analysis of mi-RNA-21, which is a potential screening biomarker for cancer detection. AuNCs on a DNA scaffold were prepared through a one-pot wet-chemical route and evaluated by transmission electron microscopy and dynamic light scattering. Experiments revealed that the fluorescence intensity of the DNA-AuNCs showed a gradual increase with the addition of the target species in a concentration range from 1pM to 10 nM. The method had a detection limit of 0.7 pM and was able to discriminate the target species from mismatched mi-RNAs very efficiently. The method was used for the determination of mi-RNA spiked human plasma samples, and was evaluated as a promising nanobiosensor for application in the selective detection of mi-RNA in various biomedical and clinical tests.

  4. A new fluorescence turn-on nanobiosensor for the detection of micro-RNA-21 based on a DNA-gold nanocluster.

    PubMed

    Hosseini, Morteza; Ahmadi, Elnaz; Borghei, Yasaman-Sadat; Reza Ganjali, Mohammad

    2017-03-08

    In this study, DNA/gold nanoclusters (AuNCs) were used to develop an AuNC-based turn-on fluorescence probe for the analysis of mi-RNA-21, which is a potential screening biomarker for cancer detection. AuNCs on a DNA scaffold were prepared through a one-pot wet-chemical route and evaluated by transmission electron microscopy and dynamic light scattering. Experiments revealed that the fluorescence intensity of the DNA-AuNCs showed a gradual increase with the addition of the target species in a concentration range from 1pM to 10 nM. The method had a detection limit of 0.7 pM and was able to discriminate the target species from mismatched mi-RNAs very efficiently. The method was used for the determination of mi-RNA spiked human plasma samples, and was evaluated as a promising nanobiosensor for application in the selective detection of mi-RNA in various biomedical and clinical tests.

  5. A DNA vaccine encoding the E protein of West Nile virus is protective and can be boosted by recombinant domain DIII.

    PubMed

    Schneeweiss, Anne; Chabierski, Stefan; Salomo, Mathias; Delaroque, Nicolas; Al-Robaiy, Samiya; Grunwald, Thomas; Bürki, Kurt; Liebert, Uwe G; Ulbert, Sebastian

    2011-08-26

    West Nile Virus (WNV) is an emerging pathogenic flavivirus with increasing distribution worldwide. Birds are the natural host of the virus, but also mammals, including humans, can be infected. In some cases, a WNV infection can be associated with severe neurological symptoms. All currently available WNV vaccines are in the veterinary sector, and there is a need to develop safe and effective immunization technologies, which can also be used in humans. An alternative to current vaccination methods is DNA immunization. Most current DNA vaccine candidates against flaviviruses simultaneously express the viral envelope (E) and membrane (prM) proteins, which leads to the formation of virus-like particles. Here we generated a DNA plasmid, which expresses only the E-protein ectodomain. Vaccination of mice stimulated anti-WNV T-cell responses and neutralizing antibodies that were higher than those obtained after immunizing with a recombinant protein previously shown to be a protective WNV vaccine. A single dose of the plasmid was sufficient to protect animals from a lethal challenge with the virus. Moreover, immunogenicity could be boosted when DNA injection was followed by immunization with recombinant domain DIII of the E-protein. This resulted in significantly enhanced neutralizing antibody titers and a more prominent cellular immune response. The results suggest that the WNV E-protein is sufficient as a protective antigen in DNA vaccines and that protection can be significantly improved by adding a recombinant protein boost to the DNA prime.

  6. Recovery of active beta-lactamases from Proteus vulgaris and RTEM-1 hybrid by random mutagenesis by using a dnaQ strain of Escherichia coli.

    PubMed Central

    Hosseini-Mazinani, S M; Nakajima, E; Ihara, Y; Kameyama, K Z; Sugimoto, K

    1996-01-01

    Proteus vulgaris and RTEM-1 beta-lactamases that belong to molecular class A with 37% amino acid similarity were examined to find the relationship between amino acid residues and activity of enzymes. MICs of ampicillin were > 2,000 micrograms/ml for Escherichia coli cells producing these enzymes. We have made 18 hybrid genes by substituting the coding region of the P. vulgaris beta-lactamase gene with the equivalent portions from the RTEM-1 gene. Most of these hybrids produced inactive proteins, but a few hybrid enzymes had partial or trace activity. From one of the hybrid genes (MIC of ampicillin, 100 micrograms/ml), we recovered three kinds of active mutants which provided ampicillin MICs of 1,000 micrograms/ml by the selection of spontaneous mutations in a dnaQ strain of E. coli. In these mutants, Leu-148, Met-182, and Tyr-274 were replaced with Val, Thr, and His, respectively. These amino acids have not been identified as residues with functional roles in substrate hydrolysis. Furthermore, from these hybrid mutants, we obtained a second set of mutants which conferred ampicillin MICs of 1,500 micrograms/ml. Interestingly, the second mutations were limited to these three amino acid substitutions. These amino acid residues which do not directly interact with substrates have an effect on enzyme activity. These mutant enzymes exhibited lower K(m) values for cephaloridine than both parental enzymes. PMID:8878598

  7. The Synergistic Effect of Combined Immunization with a DNA Vaccine and Chimeric Yellow Fever/Dengue Virus Leads to Strong Protection against Dengue

    PubMed Central

    Azevedo, Adriana S.; Gonçalves, Antônio J. S.; Archer, Marcia; Freire, Marcos S.; Galler, Ricardo; Alves, Ada M. B.

    2013-01-01

    The dengue envelope glycoprotein (E) is the major component of virion surface and its ectodomain is composed of domains I, II and III. This protein is the main target for the development of a dengue vaccine with induction of neutralizing antibodies. In the present work, we tested two different vaccination strategies, with combined immunizations in a prime/booster regimen or simultaneous inoculation with a DNA vaccine (pE1D2) and a chimeric yellow fever/dengue 2 virus (YF17D-D2). The pE1D2 DNA vaccine encodes the ectodomain of the envelope DENV2 protein fused to t-PA signal peptide, while the YF17D-D2 was constructed by replacing the prM and E genes from the 17D yellow fever vaccine virus by those from DENV2. Balb/c mice were inoculated with these two vaccines by different prime/booster or simultaneous immunization protocols and most of them induced a synergistic effect on the elicited immune response, mainly in neutralizing antibody production. Furthermore, combined immunization remarkably increased protection against a lethal dose of DENV2, when compared to each vaccine administered alone. Results also revealed that immunization with the DNA vaccine, regardless of the combination with the chimeric virus, induced a robust cell immune response, with production of IFN-γ by CD8+ T lymphocytes. PMID:23472186

  8. A DNA-binding protein from Candida albicans that binds to the RPG box of Saccharomyces cerevisiae and the telomeric repeat sequence of C. albicans.

    PubMed

    Ishii, N; Yamamoto, M; Lahm, H W; Iizumi, S; Yoshihara, F; Nakayama, H; Arisawa, M; Aoki, Y

    1997-02-01

    Electromobility shift assays with a DNA probe containing the Saccharomyces cerevisiae ENO1 RPG box identified a specific DNA-binding protein in total protein extracts of Candida albicans. The protein, named Rbf1p (RPG-box-binding protein 1), bound to other S. cerevisiae RPG boxes, although the nucleotide recognition profile was not completely the same as that of S. cerevisiae Rap 1p (repressor-activator protein 1), an RPG-box-binding protein. The repetitive sequence of the C. albicans chromosomal telomere also competed with RPG-box binding to Rbf1p. For further analysis, we purified Rbf1p 57,600-fold from C. albicans total protein extracts, raised mAbs against the purified protein and immunologically cloned the gene, whose ORF specified a protein of 527 aa. The bacterially expressed protein showed RPG-box-binding activity with the same profile as that of the purified one. The Rbf1p, containing two glutamine-rich regions that are found in many transcription factors, showed transcriptional activation capability in S. cerevisiae and was predominantly observed in nuclei. These results suggest that Rbf1p is a transcription factor with telomere-binding activity in C. albicans.

  9. A DNA-stabilized silver nanoclusters/graphene oxide-based platform for the sensitive detection of DNA through hybridization chain reaction.

    PubMed

    Zhang, Siqi; Wang, Kun; Li, Kai-Bin; Shi, Wei; Jia, Wen-Ping; Chen, Xiaoying; Sun, Ting; Han, De-Man

    2017-05-15

    A silver nanoclusters (AgNCs)/graphene oxide (GO)-based fluorescence sensor was developed for label-free DNA detection through hybridization chain reaction (HCR). A DNA sequence associated with the human immunodeficiency virus (HIV) was selected as a model target. Two DNA probes, hairpin probe 1 (H1) and hairpin probe 2 (H2), were partially complementary. GO was used as an adsorption material to capture the hairpin probes and a selective fluorescence quencher was used to reduce the background signal. Upon addition of AgNO3 and NaBH4, the AgNCs were synthesized at the terminals of the H1 and H2 probes. In the absence of target DNA (THIV), hybridization chain reaction (HCR) could not be triggered due to the stability of H1 and H2 probes. The hairpin probe-protected AgNCs attached to the GO surface, efficiently quenching fluorescence of the AgNCs. Therefore, the system showed very low background. In presence of THIV, the target triggered the chain-like assembly of H1 and H2 through HCR, generating a long chain of H1 and H2 complexes. The HCR product (AgNCs nanowires) could not be adsorbed on the surface of GO; hence, it generated a strong fluorescent signal based on the concentration of the target. Under the optimized conditions, the detection limit of the fluorescence sensor was 1.18nM, and hence it can be applied to clinical samples.

  10. The Species and Origin of Shark Fins in Taiwan’s Fishing Ports, Markets, and Customs Detention: A DNA Barcoding Analysis

    PubMed Central

    Chuang, Po-Shun; Hung, Tzu-Chiao; Chang, Hung-An; Huang, Chien-Kang; Shiao, Jen-Chieh

    2016-01-01

    The increasing consumption of shark products, along with the shark’s fishing vulnerabilities, has led to the decrease in certain shark populations. In this study we used a DNA barcoding method to identify the species of shark landings at fishing ports, shark fin products in retail stores, and shark fins detained by Taiwan customs. In total we identified 23, 24, and 14 species from 231 fishing landings, 316 fin products, and 113 detained shark fins, respectively. All the three sample sources were dominated by Prionace glauca, which accounted for more than 30% of the collected samples. Over 60% of the species identified in the fin products also appeared in the port landings, suggesting the domestic-dominance of shark fin products in Taiwan. However, international trade also contributes a certain proportion of the fin product markets, as four species identified from the shark fin products are not found in Taiwan’s waters, and some domestic-available species were also found in the customs-detained sample. In addition to the species identification, we also found geographical differentiation in the cox1 gene of the common thresher sharks (Alopias vulpinus), the pelagic thresher shark (A. pelagicus), the smooth hammerhead shark (Sphyrna zygaena), and the scalloped hammerhead shark (S. lewini). This result might allow fishing authorities to more effectively trace the origins as well as enforce the management and conservation of these sharks. PMID:26799827

  11. Induction of immune response in mice with a DNA vaccine encoding outer membrane protein (omp31) of Brucella melitensis 16M.

    PubMed

    Gupta, V K; Rout, P K; Vihan, V S

    2007-06-01

    Brucellosis causes serious economic losses to goat farmers by way of reproductive losses in the form of abortions and stillbirths. Nucleic acid vaccines provide an exciting approach for antigen presentation to the immune system. In this study, we evaluated the ability of DNA vaccine encoding the omp31 protein of Brucella melitensis 16M to induce cellular and humoral immune responses in mice. We constructed eukaryotic expression vectors called pTargeTomp31, encoding outer membrane protein (omp31) of B. melitensis 16M. pTargeTomp31 was injected intramuscularly three times, at 3-week intervals in groups of mice 6 weeks of age. pTargeTomp31 induced good antibody response in ELISA . pTargeTomp31 elicited a T-cell-proliferative response and also induced a strong gamma interferon production upon restimulation with either the omp31 antigen or B. melitensis 16M extract. We also demonstrate that animals immunized with this plasmid elicited a strong and long-lived memory immune response. Furthermore, pTargeTomp31 elicited a typical T-helper 1-dominated immune response in mice, as determined by immunoglobulin G isotype analysis. This vaccine also provided the moderate degree of protection to the mice. This study for the first time focuses on DNA immunization of a gene from B. melitensis. These results may lead to the development of a DNA-based vaccine for the control of brucellosis in goats.

  12. Characterization of the Pathway-Specific Positive Transcriptional Regulator for Actinorhodin Biosynthesis in Streptomyces coelicolor A3(2) as a DNA-Binding Protein

    PubMed Central

    Arias, Paloma; Fernández-Moreno, Miguel A.; Malpartida, Francisco

    1999-01-01

    The ActII-ORF4 protein has been characterized as a DNA-binding protein that positively regulates the transcription of the actinorhodin biosynthetic genes. The target regions for the ActII-ORF4 protein were located within the act cluster. These regions, at high copy number, generate a nonproducer strain by in vivo titration of the regulator. The mutant phenotype could be made to revert with extra copies of the wild-type actII-ORF4 gene but not with the actII-ORF4-177 mutant. His-tagged recombinant wild-type ActII-ORF4 and mutant ActII-ORF4-177 proteins were purified from Escherichia coli cultures; both showed specific DNA-binding activity for the actVI-ORF1–ORFA and actIII-actI intergenic regions. DNase I footprinting assays clearly located the DNA-binding sites within the −35 regions of the corresponding promoters, showing the consensus sequence 5′-TCGAG-3′. Although both gene products (wild-type and mutant ActII-ORF4) showed DNA-binding activity, only the wild-type gene was capable of activating transcription of the act genes; thus, two basic functions can be differentiated within the regulatory protein: a specific DNA-binding activity and a transcriptional activation of the act biosynthetic genes. PMID:10559161

  13. Reduced nuclear binding of a DNA minor groove ligand (Hoechst 33342) and its impact on cytotoxicity in drug resistant murine cell lines.

    PubMed Central

    Morgan, S. A.; Watson, J. V.; Twentyman, P. R.; Smith, P. J.

    1990-01-01

    The reduced cellular uptake, and subsequent reduced nuclear availability, of cytotoxic agents is a factor in the resistance of mammalian cells to anti-cancer drugs that act by interaction with DNA. The whole cell uptake, nuclear binding and cytotoxicity of a DNA-specific ligand, Hoechst dye number 33342 (Ho342), has been studied in cytotoxic drug resistant variants of a murine tumour cell line. Cell lines showing various degrees of cross-resistance to adriamycin as a part of the phenotype of classical multi-drug resistance (MDR) demonstrated a reduction in intranuclear Ho342 content, up to a maximum of 35% of the level found in the parent as assessed by flow cytometry, despite similar levels of whole cell uptake determined using radiolabelled ligand. Ability to limit nuclear accessibility of Ho342 correlated closely with cellular resistance to Ho342 and to adriamycin. All drug resistant cell lines showed a significant increase in nuclear accessibility to Ho342 after verapamil treatment, including a methotrexate resistant cell line. The methotrexate resistant variant, not demonstrating MDR, showed reduced nuclear binding of Ho342 but increased cell kill associated with a propensity to develop a population of cells showing extra DNA replication in response to Ho342 exposure. Differences between cell lines in the relationship between Ho342-induced cell cycle perturbation and cell kill supported the conclusion that modulation of several pathways of response to cytotoxic agents had occurred in the development of drug resistance. PMID:2257227

  14. The cauliflower Or gene encodes a DnaJ cysteine-rich domain-containing protein that mediates high levels of beta-carotene accumulation.

    PubMed

    Lu, Shan; Van Eck, Joyce; Zhou, Xiangjun; Lopez, Alex B; O'Halloran, Diana M; Cosman, Kelly M; Conlin, Brian J; Paolillo, Dominick J; Garvin, David F; Vrebalov, Julia; Kochian, Leon V; Küpper, Hendrik; Earle, Elizabeth D; Cao, Jun; Li, Li

    2006-12-01

    Despite recent progress in our understanding of carotenogenesis in plants, the mechanisms that govern overall carotenoid accumulation remain largely unknown. The Orange (Or) gene mutation in cauliflower (Brassica oleracea var botrytis) confers the accumulation of high levels of beta-carotene in various tissues normally devoid of carotenoids. Using positional cloning, we isolated the gene representing Or and verified it by functional complementation in wild-type cauliflower. Or encodes a plastid-associated protein containing a DnaJ Cys-rich domain. The Or gene mutation is due to the insertion of a long terminal repeat retrotransposon in the Or allele. Or appears to be plant specific and is highly conserved among divergent plant species. Analyses of the gene, the gene product, and the cytological effects of the Or transgene suggest that the functional role of Or is associated with a cellular process that triggers the differentiation of proplastids or other noncolored plastids into chromoplasts for carotenoid accumulation. Moreover, we demonstrate that Or can be used as a novel genetic tool to induce carotenoid accumulation in a major staple food crop. We show here that controlling the formation of chromoplasts is an important mechanism by which carotenoid accumulation is regulated in plants.

  15. B-DNA to Zip-DNA: Simulating a DNA Transition to a Novel Structure with Enhanced Charge-Transport Characteristics

    PubMed Central

    Balaeff, Alexander; Craig, Stephen L.; Beratan, David N.

    2013-01-01

    The forced extension of a DNA segment is studied in a series of steered molecular dynamics simulations, employing a broad range of pulling forces. Throughout the entire force range, the formation of a zipper-like (zip-) DNA structure is observed. In that structure, first predicted by Lohikoski et al., the bases of the DNA strands interdigitate with each other and form a single-base aromatic stack. Similar motifs, albeit only a few base pairs in extent, have been observed in experimental crystal structures. Analysis of the dynamics of structural changes in pulled DNA shows that S-form DNA, thought to be adopted by DNA under applied force, serves as an intermediate between B-DNA and zip-DNA. Therefore, the phase transition plateau observed in force–extension curves of DNA is suggested to reflect the B-DNA to zip-DNA structural transition. Electronic structure analysis of purine bases in zip-DNA indicates a several-fold to order of magnitude increase in the π–π electronic coupling among nearest-neighbor nucleobases, compared to B-DNA. We further observe that zip-DNA does not require base pair complementarity between DNA strands, and we predict that the increased electronic coupling in zip-DNA will result in a much higher rate of charge transfer through an all-purine zip-DNA compared to B-DNA of equal length. PMID:21598926

  16. Gene Gun Bombardment with DNA-Coated Golden Particles Enhanced the Protective Effect of a DNA Vaccine Based on Thioredoxin Glutathione Reductase of Schistosoma japonicum

    PubMed Central

    Cao, Yan; Zhao, Bin; Han, Yanhui; Zhang, Juan; Li, Xuezhen; Qiu, Chunhui; Wu, Xiujuan; Hong, Yang; Ai, Dezhou; Lin, Jiaojiao; Fu, Zhiqiang

    2013-01-01

    Schistosomiasis, caused by infection with Schistosoma species, remains an important parasitic zoonosis. Thioredoxin glutathione reductase of Schistosoma japonicum (SjTGR) plays an important role in the development of the parasite and for its survival. Here we present a recombinant plasmid DNA vaccine, pVAX1/SjTGR, to estimate its protection against S. japonicum in BALB/c mice. The DNA vaccine administrated by particle bombardment induced higher protection than by intramuscular injection. All animals vaccinated with pVAX1/SjTGR developed significant specific anti-SjTGR antibodies than control groups. Moreover, animals immunized by gene gun exhibited a splenocyte proliferative response, with an increase in IFN-γ and IL-4. The recombinant plasmid administrated by gene gun achieved a medium protective efficacy of 27.83–38.83% (P < 0.01) of worm reduction and 40.38–44.51% (P < 0.01) of liver egg count reduction. It suggests that different modes of administering a DNA vaccine can influence the protective efficacy induced by the vaccine. Interestingly, from the enzymatic activity results, we found that worms obtained from pVAX1/SjTGR-vaccinated animals expressed lower enzymatic activity than the control group and the antibodies weakened the enzymatic activity of SjTGR in vitro, too. It implies that the high-level antibodies may contribute to the protective effects. PMID:23509820

  17. Interaction of a DNA-binding protein, the gene product of D5 of bacteriophage T5, with double-stranded DNA. Analysis by metrizamide gradient centrifugation.

    PubMed

    Fujimura, R K; Roop, B C

    1982-12-25

    Interactions of DNA and the gene product D5 (gpD5) of bacteriophage T5, a DNA-binding protein that binds preferentially and cooperatively to double-stranded DNA, were analyzed by metrizamide gradient centrifugation. Conditions were set so that DNA and DNA protein complex sedimented to apparent equilibrium positions. DNA has a buoyant density of 1.12 g/cm3, and DNA saturated with gpD5 has a buoyant density of 1.17 g/cm3. These values are independent of DNA size and base composition in the range studied. At gpD5 concentration below the saturation value in a low ionic strength buffer, DNA distribution is bimodal, indicating cooperative binding of gpD5 to DNA. However, in the presence of 10 mM MgCl2, the binding process becomes distributive, with the buoyant density increasing linearly with the amount of gpD5 added until the saturation. From these data, one molecule of gpD5 is calculated to cover 40 base pairs at saturation. The technique as described has general applicability to the study of any interaction between DNA and dNA-binding proteins that bind in sufficient amount to cause detectable changes in buoyant density.

  18. Characterization of a DNA-damage-recognition protein from F9 teratocarcinoma cells, which is inducible by retinoic acid and cyclic AMP.

    PubMed

    Chao, C C; Sun, N K; Lin-Chao, S

    1993-02-15

    A nuclear protein that recognizes u.v.-damaged DNA was detected in extracts from murine F9 embryonic stem cells using a DNA-binding assay. The nuclear-protein-binding activity was increased in cells after treatment with retinoic acid/dibutyryl cyclic AMP (dbcAMP), with optimum induction at 6 days. In vitro treatment of nuclear extracts with agents that affect protein conformation (such as urea, Nonidet P40 and Ca2+) slightly modulated the damage-recognition activity. Furthermore, treatment of nuclear extracts with phosphatase dramatically inhibited the binding activity. In addition, damaged-DNA recognition of the nuclear extracts was effectively inhibited by damaged double- and single-stranded DNA. The expression of the nuclear protein with similar characteristics was abundant in HeLa cells and was increased in drug- or u.v.-resistant cells. The findings suggest that the recognition of a u.v.-DNA adduct is modulated, at least in part, by an activity that is induced during retinoic acid/dbcAMP-induced differentiation. These results also imply that the identified damage-recognition protein may be important for the sensitivity or resistance of mammalian cells to DNA damage.

  19. The synergistic effect of combined immunization with a DNA vaccine and chimeric yellow fever/dengue virus leads to strong protection against dengue.

    PubMed

    Azevedo, Adriana S; Gonçalves, Antônio J S; Archer, Marcia; Freire, Marcos S; Galler, Ricardo; Alves, Ada M B

    2013-01-01

    The dengue envelope glycoprotein (E) is the major component of virion surface and its ectodomain is composed of domains I, II and III. This protein is the main target for the development of a dengue vaccine with induction of neutralizing antibodies. In the present work, we tested two different vaccination strategies, with combined immunizations in a prime/booster regimen or simultaneous inoculation with a DNA vaccine (pE1D2) and a chimeric yellow fever/dengue 2 virus (YF17D-D2). The pE1D2 DNA vaccine encodes the ectodomain of the envelope DENV2 protein fused to t-PA signal peptide, while the YF17D-D2 was constructed by replacing the prM and E genes from the 17D yellow fever vaccine virus by those from DENV2. Balb/c mice were inoculated with these two vaccines by different prime/booster or simultaneous immunization protocols and most of them induced a synergistic effect on the elicited immune response, mainly in neutralizing antibody production. Furthermore, combined immunization remarkably increased protection against a lethal dose of DENV2, when compared to each vaccine administered alone. Results also revealed that immunization with the DNA vaccine, regardless of the combination with the chimeric virus, induced a robust cell immune response, with production of IFN-γ by CD8+ T lymphocytes.

  20. Genotrim, a DNA-customized nutrigenomic product, targets genetic factors of obesity: hypothesizing a dopamine-glucose correlation demonstrating reward deficiency syndrome (RDS).

    PubMed

    Blum, Kenneth; Chen, Thomas J H; Meshkin, Brian; Downs, B William; Gordon, Cory A; Blum, Seth; Mangucci, Julie F; Braverman, Eric R; Arcuri, Vanessa; Deutsch, Roger; Pons, Manuel-Martinez-

    2007-01-01

    Obesity is the second largest cause of preventable death in the United States. Historically, obesity was considered a behavioral problem that could be simply addressed with behavioral modifications in diet and exercise. As scientific advancements have demonstrated in other neurological healthcare conditions such as alcoholism, there are important biological and genetic components that limit the efficacy of behavioral adjustments alone. In light of data suggesting frequent co-morbidities to obesity, including diabetes mellitus, atherosclerosis, osteoporosis, and potentially others, we hypothesize that the biologic and genetic factors, synergistically with behavioral modifications, must be addressed to adequately treat this disease. We hypothesize that one such genetic factor that influences behavior and thus obesity is a predisposition to glucose craving and the overall effect of dopaminergic activity in the reward center of the brain. This defect drives individuals to engage in activities of behavioral excess, which will increase brain dopamine function, for which we have created the term reward deficiency syndrome (RDS) to categorize such biological influences on behavior. Consuming large quantities of alcohol or carbohydrates (carbohydrate bingeing) stimulates the brain's production of and utilization of dopamine. So too does the intake of crack/cocaine and the abuse of nicotine. We are proposing that a novel approach to nutritional supplementation may be required to target the RDS role in obesity. In this regard, Genotrim, a DNA based customized nutraceutical has been designed and is currently under investigation in several clinical studies. This is the first hypothesis paper whereby this new paradigm shift in thinking about obesity is presented.

  1. Comparative analysis and molecular characterization of a gene BANF1 encoded a DNA-binding protein during mitosis from the Giant Panda and Black Bear.

    PubMed

    Zeng, Yichun; Hou, Yi-Ling; Ding, Xiang; Hou, Wan-Ru; Li, Jian

    2014-01-01

    Barrier to autointegration factor 1 (BANF1) is a DNA-binding protein found in the nucleus and cytoplasm of eukaryotic cells that functions to establish nuclear architecture during mitosis. The cDNA and the genomic sequence of BANF1 were cloned from the Giant Panda (Ailuropoda melanoleuca) and Black Bear (Ursus thibetanus mupinensis) using RT-PCR technology and Touchdown-PCR, respectively. The cDNA of the BANF1 cloned from Giant Panda and Black Bear is 297 bp in size, containing an open reading frame of 270 bp encoding 89 amino acids. The length of the genomic sequence from Giant Panda is 521 bp, from Black Bear is 536 bp, which were found both to possess 2 exons. Alignment analysis indicated that the nucleotide sequence and the deduced amino acid sequence are highly conserved to some mammalian species studied. Topology prediction showed there is one Protein kinase C phosphorylation site, one Casein kinase II phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Giant Panda, and there is one Protein kinase C phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Black Bear. The BANF1 gene can be readily expressed in E. coli. Results showed that the protein BANF1 fusion with the N-terminally His-tagged form gave rise to the accumulation of an expected 14 kD polypeptide that formed inclusion bodies. The expression products obtained could be used to purify the proteins and study their function further.

  2. RNA Interference by Single- and Double-stranded siRNA With a DNA Extension Containing a 3' Nuclease-resistant Mini-hairpin Structure.

    PubMed

    Allison, Simon J; Milner, Jo

    2014-01-07

    Selective gene silencing by RNA interference (RNAi) involves double-stranded small interfering RNA (ds siRNA) composed of single-stranded (ss) guide and passenger RNAs. siRNA is recognized and processed by Ago2 and C3PO, endonucleases of the RNA-induced silencing complex (RISC). RISC cleaves passenger RNA, exposing the guide RNA for base-pairing with its homologous mRNA target. Remarkably, the 3' end of passenger RNA can accommodate a DNA extension of 19-nucleotides without loss of RNAi function. This construct is termed passenger-3'-DNA/ds siRNA and includes a 3'-nuclease-resistant mini-hairpin structure. To test this novel modification further, we have now compared the following constructs: (I) guide-3'-DNA/ds siRNA, (II) passenger-3'-DNA/ds siRNA, (III) guide-3'-DNA/ss siRNA, and (IV) passenger-3'-DNA/ss siRNA. The RNAi target was SIRT1, a cancer-specific survival factor. Constructs I-III each induced selective knock-down of SIRT1 mRNA and protein in both noncancer and cancer cells, accompanied by apoptotic cell death in the cancer cells. Construct IV, which lacks the SIRT1 guide strand, had no effect. Importantly, the 3'-DNA mini-hairpin conferred nuclease resistance to constructs I and II. Resistance required the double-stranded RNA structure since single-stranded guide-3'-DNA/ss siRNA (construct III) was susceptible to serum nucleases with associated loss of RNAi activity. The potential applications of 3'-DNA/siRNA constructs are discussed.Molecular Therapy-Nucleic Acids (2014) 2, e141; doi:10.1038/mtna.2013.68; published online 7 January 2014.

  3. RNA Interference by Single- and Double-stranded siRNA With a DNA Extension Containing a 3' Nuclease-resistant Mini-hairpin Structure.

    PubMed

    Allison, Simon J; Milner, Jo

    2014-01-01

    Selective gene silencing by RNA interference (RNAi) involves double-stranded small interfering RNA (ds siRNA) composed of single-stranded (ss) guide and passenger RNAs. siRNA is recognized and processed by Ago2 and C3PO, endonucleases of the RNA-induced silencing complex (RISC). RISC cleaves passenger RNA, exposing the guide RNA for base-pairing with its homologous mRNA target. Remarkably, the 3' end of passenger RNA can accommodate a DNA extension of 19-nucleotides without loss of RNAi function. This construct is termed passenger-3'-DNA/ds siRNA and includes a 3'-nuclease-resistant mini-hairpin structure. To test this novel modification further, we have now compared the following constructs: (I) guide-3'-DNA/ds siRNA, (II) passenger-3'-DNA/ds siRNA, (III) guide-3'-DNA/ss siRNA, and (IV) passenger-3'-DNA/ss siRNA. The RNAi target was SIRT1, a cancer-specific survival factor. Constructs I-III each induced selective knock-down of SIRT1 mRNA and protein in both noncancer and cancer cells, accompanied by apoptotic cell death in the cancer cells. Construct IV, which lacks the SIRT1 guide strand, had no effect. Importantly, the 3'-DNA mini-hairpin conferred nuclease resistance to constructs I and II. Resistance required the double-stranded RNA structure since single-stranded guide-3'-DNA/ss siRNA (construct III) was susceptible to serum nucleases with associated loss of RNAi activity. The potential applications of 3'-DNA/siRNA constructs are discussed.

  4. A DNA barcoding method to discriminate between the model plant Brachypodium distachyon and its close relatives B. stacei and B. hybridum (Poaceae).

    PubMed

    López-Alvarez, Diana; López-Herranz, Maria Luisa; Betekhtin, Alexander; Catalán, Pilar

    2012-01-01

    Brachypodium distachyon s. l. has been widely investigated across the world as a model plant for temperate cereals and biofuel grasses. However, this annual plant shows three cytotypes that have been recently recognized as three independent species, the diploids B. distachyon (2n = 10) and B. stacei (2n = 20) and their derived allotetraploid B. hybridum (2n = 30). We propose a DNA barcoding approach that consists of a rapid, accurate and automatable species identification method using the standard DNA sequences of complementary plastid (trnLF) and nuclear (ITS, GI) loci. The highly homogenous but largely divergent B. distachyon and B. stacei diploids could be easily distinguished (100% identification success) using direct trnLF (2.4%), ITS (5.5%) or GI (3.8%) sequence divergence. By contrast, B. hybridum could only be unambiguously identified through the use of combined trnLF+ITS sequences (90% of identification success) or by cloned GI sequences (96.7%) that showed 5.4% (ITS) and 4% (GI) rate divergence between the two parental sequences found in the allopolyploid. Our data provide an unbiased and effective barcode to differentiate these three closely-related species from one another. This procedure overcomes the taxonomic uncertainty generated from methods based on morphology or flow cytometry identifications that have resulted in some misclassifications of the model plant and its allies. Our study also demonstrates that the allotetraploid B. hybridum has resulted from bi-directional crosses of B. distachyon and B. stacei plants acting either as maternal or paternal parents.

  5. Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach.

    PubMed

    Frimodt-Møller, Jakob; Charbon, Godefroid; Krogfelt, Karen A; Løbner-Olesen, Anders

    2017-09-11

    The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

  6. Molecular analysis of the Deinococcus radiodurans recA locus and identification of a mutation site in a DNA repair-deficient mutant, rec30.

    PubMed

    Narumi, I; Satoh, K; Kikuchi, M; Funayama, T; Kitayama, S; Yanagisawa, T; Watanabe, H; Yamamoto, K

    1999-12-07

    Deinococcus radiodurans strain rec30, which is a DNA damage repair-deficient mutant, has been estimated to be defective in the deinococcal recA gene. To identify the mutation site of strain rec30 and obtain information about the region flanking the gene, a 4.4-kb fragment carrying the wild-type recA gene was sequenced. It was revealed that the recA locus forms a polycistronic operon with the preceding cistrons (orf105a and orf105b). Predicted amino acid sequences of orf105a and orf105b showed substantial similarity to the competence-damage inducible protein (cinA gene product) from Streptococcus pneumoniae and the 2'-5' RNA ligase from Escherichia coli, respectively. By analyzing polymerase chain reaction (PCR) fragments derived from the genomic DNA of strain rec30, the mutation site in the strain was identified as a single G:C to A:T transition which causes an amino acid substitution at position 224 (Gly to Ser) of the deinococcal RecA protein. Furthermore, we succeeded in expressing both the wild-type and mutant recA genes of D. radiodurans in E. coli without any obvious toxicity or death. The gamma-ray resistance of an E. coli recA1 strain was fully restored by the expression of the wild-type recA gene of D. radiodurans that was cloned in an E. coli vector plasmid. This result is consistent with evidence that RecA proteins from many bacterial species can functionally complement E. coli recA mutants. In contrast with the wild-type gene, the mutant recA gene derived from strain rec30 did not complement E. coli recA1, suggesting that the mutant RecA protein lacks functional activity for recombinational repair.

  7. Base-pairing behavior of a carbocyclic Janus-AT nucleoside analogue capable of recognizing A and T within a DNA duplex.

    PubMed

    Largy, Eric; Liu, Wenbo; Hasan, Abid; Perrin, David M

    2013-11-04

    Janus-type nucleosides are heterocycles with two faces, each of which is designed to complement the H-bonding interactions of natural nucleosides comprising a canonical Watson-Crick base pair. By intercepting all of the hydrogen bonds contained within the base pair, oligomeric Janus nucleosides are expected to achieve sequence-specific DNA recognition through the formation of J-loops that will be more stable than D-loops, which simply replaces one base-pair with another. Herein, we report the synthesis of a novel Janus-AT nucleoside analogue, JAT , affixed on a carbocyclic analogue of deoxyribose that was converted to the corresponding phosphoramidite. A single JAT was successfully incorporated into a DNA strand by solid phase for targeting both A and T bases, and characterized through biophysical and computational methods. Experimental UV-melting and circular dichroism data demonstrated that within the context of a standard duplex, JAT associates preferentially with T over A, and much more poorly with C and G. Density functional theory calculations confirm that the JAT structure is well suited to associate only with A and T thereby highlighting the importance of the electronic structure in terms of H-bonding. Finally, molecular dynamics simulations validated the observation that JAT can substitute more effectively as an A-analogue than as a T-analogue without substantial distortion of the B-helix. Overall, this new Janus nucleotide is a promising tool for the targeting of A-T base pairs in DNA, and will lead to the development of oligo-Janus-nucleotide strands for sequence-specific DNA recognition.

  8. Islands of non-essential genes, including a DNA translocation operon, in the genome of bacteriophage 0305ϕ8-36

    PubMed Central

    Pathria, Saurav; Rolando, Mandy; Lieman, Karen; Hayes, Shirley; Hardies, Stephen; Serwer, Philip

    2012-01-01

    We investigate genes of lytic, Bacillus thuringiensis bacteriophage 0305ϕ8-36 that are non-essential for laboratory propagation, but might have a function in the wild. We isolate deletion mutants to identify these genes. The non-permutation of the genome (218.948 Kb, with a 6.479 Kb terminal repeat and 247 identified orfs) simplifies isolation of deletion mutants. We find two islands of non-essential genes. The first island (3.01% of the genomic DNA) has an informatically identified DNA translocation operon. Deletion causes no detectable growth defect during propagation in a dilute agarose overlay. Identification of the DNA translocation operon begins with a DNA relaxase and continues with a translocase and membrane-binding anchor proteins. The relaxase is in a family, first identified here, with homologs in other bacteriophages. The second deleted island (3.71% of the genome) has genes for two metallo-protein chaperonins and two tRNAs. Deletion causes a significant growth defect. In addition, (1) we find by “in situ” (in-plaque) single-particle fluorescence microscopy that adsorption to the host occurs at the tip of the 486 nm long tail, (2) we develop a procedure of 0305ϕ8-36 purification that does not cause tail contraction, and (3) we then find by electron microscopy that 0305ϕ8-36 undergoes tail tip-tail tip dimerization that potentially blocks adsorption to host cells, presumably with effectiveness that increases as the bacteriophage particle concentration increases. These observations provide an explanation of the previous observation that 0305ϕ8-36 does not lyse liquid cultures, even though 0305ϕ8-36 is genomically lytic. PMID:22666654

  9. Coadministration of the Three Antigenic Leishmania infantum Poly (A) Binding Proteins as a DNA Vaccine Induces Protection against Leishmania major Infection in BALB/c Mice.

    PubMed

    Soto, Manuel; Corvo, Laura; Garde, Esther; Ramírez, Laura; Iniesta, Virginia; Bonay, Pedro; Gómez-Nieto, Carlos; González, Víctor M; Martín, M Elena; Alonso, Carlos; Coelho, Eduardo A F; Barral, Aldina; Barral-Netto, Manoel; Iborra, Salvador

    2015-05-01

    Highly conserved intracellular proteins from Leishmania have been described as antigens in natural and experimental infected mammals. The present study aimed to evaluate the antigenicity and prophylactic properties of the Leishmania infantum Poly (A) binding proteins (LiPABPs). Three different members of the LiPABP family have been described. Recombinant tools based on these proteins were constructed: recombinant proteins and DNA vaccines. The three recombinant proteins were employed for coating ELISA plates. Sera from human and canine patients of visceral leishmaniasis and human patients of mucosal leishmaniasis recognized the three LiPABPs. In addition, the protective efficacy of a DNA vaccine based on the combination of the three Leishmania PABPs has been tested in a model of progressive murine leishmaniasis: BALB/c mice infected with Leishmania major. The induction of a Th1-like response against the LiPABP family by genetic vaccination was able to down-regulate the IL-10 predominant responses elicited by parasite LiPABPs after infection in this murine model. This modulation resulted in a partial protection against L. major infection. LiPABP vaccinated mice showed a reduction on the pathology that was accompanied by a decrease in parasite burdens, in antibody titers against Leishmania antigens and in the IL-4 and IL-10 parasite-specific mediated responses in comparison to control mice groups immunized with saline or with the non-recombinant plasmid. The results presented here demonstrate for the first time the prophylactic properties of a new family of Leishmania antigenic intracellular proteins, the LiPABPs. The redirection of the immune response elicited against the LiPABP family (from IL-10 towards IFN-γ mediated responses) by genetic vaccination was able to induce a partial protection against the development of the disease in a highly susceptible murine model of leishmaniasis.

  10. Human parvovirus B19 DNA replication induces a DNA damage response that is dispensable for cell cycle arrest at phase G2/M.

    PubMed

    Lou, Sai; Luo, Yong; Cheng, Fang; Huang, Qinfeng; Shen, Weiran; Kleiboeker, Steve; Tisdale, John F; Liu, Zhengwen; Qiu, Jianming

    2012-10-01

    Human parvovirus B19 (B19V) infection is highly restricted to human erythroid progenitor cells, in which it induces a DNA damage response (DDR). The DDR signaling is mainly mediated by the ATR (ataxia telangiectasia-mutated and Rad3-related) pathway, which promotes replication of the viral genome; however, the exact mechanisms employed by B19V to take advantage of the DDR for virus replication remain unclear. In this study, we focused on the initiators of the DDR and the role of the DDR in cell cycle arrest during B19V infection. We examined the role of individual viral proteins, which were delivered by lentiviruses, in triggering a DDR in ex vivo-expanded primary human erythroid progenitor cells and the role of DNA replication of the B19V double-stranded DNA (dsDNA) genome in a human megakaryoblastoid cell line, UT7/Epo-S1 (S1). All the cells were cultured under hypoxic conditions. The results showed that none of the viral proteins induced phosphorylation of H2AX or replication protein A32 (RPA32), both hallmarks of a DDR. However, replication of the B19V dsDNA genome was capable of inducing the DDR. Moreover, the DDR per se did not arrest the cell cycle at the G(2)/M phase in cells with replicating B19V dsDNA genomes. Instead, the B19V nonstructural 1 (NS1) protein was the key factor in disrupting the cell cycle via a putative transactivation domain operating through a p53-independent pathway. Taken together, the results suggest that the replication of the B19V genome is largely responsible for triggering a DDR, which does not perturb cell cycle progression at G(2)/M significantly, during B19V infection.

  11. Id3 upregulates BrdU incorporation associated with a DNA damage response, not replication, in human pancreatic β-cells

    PubMed Central

    Lee, Seung-Hee; Hao, Ergeng; Levine, Fred; Itkin-Ansari, Pamela

    2011-01-01

    Elucidating mechanisms of cell cycle control in normally quiescent human pancreatic β-cells has the potential to impact regeneration strategies for diabetes. Previously we demonstrated that Id3, a repressor of basic Helix-Loop-Helix (bHLH) proteins, was sufficient to induce cell cycle entry in pancreatic duct cells, which are closely related to β-cells developmentally. We hypothesized that Id3 might similarly induce cell cycle entry in primary human β-cells. To test this directly, adult human β-cells were transduced with adenovirus expressing Id3. Consistent with a replicative response, β-cells exhibited BrdU incorporation. Further, Id3 potently repressed expression of the cyclin dependent kinase inhibitor p57Kip2, a gene which is also silenced in a rare β-cell hyperproliferative disorder in infants. Surprisingly, however, BrdU positive β-cells did not express the proliferation markers Ki67 and pHH3. Instead, BrdU uptake reflected a DNA damage response, as manifested by hydroxyurea incorporation, γH2AX expression and 53BP1 subcellular relocalization. The uncoupling of BrdU uptake from replication raises a cautionary note about interpreting studies relying solely upon BrdU incorporation as evidence of β-cell proliferation. The data also establish that loss of p57Kip2 is not sufficient to induce cell cycle entry in adult β-cells. Moreover, the differential responses to Id3 between duct and β-cells reveal that β-cells possess intrinsic resistance to cell cycle entry not common to all quiescent epithelial cells in the adult human pancreas. The data provide a much needed comparative model for investigating the molecular basis for this resistance in order to develop a strategy for improving replication competence in β-cells. PMID:21964314

  12. Methyl Supplementation Attenuates Cocaine-Seeking Behaviors and Cocaine-Induced c-Fos Activation in a DNA Methylation-Dependent Manner

    PubMed Central

    Wright, Katherine N.; Hollis, Fiona; Duclot, Florian; Dossat, Amanda M.; Strong, Caroline E.; Francis, T. Chase; Mercer, Roger; Feng, Jian; Dietz, David M.; Lobo, Mary Kay; Nestler, Eric J.

    2015-01-01

    Epigenetic mechanisms, such as histone modifications, regulate responsiveness to drugs of abuse, such as cocaine, but relatively little is known about the regulation of addictive-like behaviors by DNA methylation. To investigate the influence of DNA methylation on the locomotor-activating effects of cocaine and on drug-seeking behavior, rats receiving methyl supplementation via chronic l-methionine (MET) underwent either a sensitization regimen of intermittent cocaine injections or intravenous self-administration of cocaine, followed by cue-induced and drug-primed reinstatement. MET blocked sensitization to the locomotor-activating effects of cocaine and attenuated drug-primed reinstatement, with no effect on cue-induced reinstatement or sucrose self-administration and reinstatement. Furthermore, upregulation of DNA methyltransferase 3a and 3b and global DNA hypomethylation were observed in the nucleus accumbens core (NAc), but not in the medial prefrontal cortex (mPFC), of cocaine-pretreated rats. Glutamatergic projections from the mPFC to the NAc are critically involved in the regulation of cocaine-primed reinstatement, and activation of both brain regions is seen in human addicts when reexposed to the drug. When compared with vehicle-pretreated rats, the immediate early gene c-Fos (a marker of neuronal activation) was upregulated in the NAc and mPFC of cocaine-pretreated rats after cocaine-primed reinstatement, and chronic MET treatment blocked its induction in both regions. Cocaine-induced c-Fos expression in the NAc was associated with reduced methylation at CpG dinucleotides in the c-Fos gene promoter, effects reversed by MET treatment. Overall, these data suggest that drug-seeking behaviors are, in part, attributable to a DNA methylation-dependent process, likely occurring at specific gene loci (e.g., c-Fos) in the reward pathway. PMID:26063926

  13. A quantum dot-aptamer beacon using a DNA intercalating dye as the FRET reporter: application to label-free thrombin detection.

    PubMed

    Chi, Chun-Wei; Lao, Yeh-Hsing; Li, Yi-Shan; Chen, Lin-Chi

    2011-03-15

    A new quantum dot (QD)-aptamer (apt) beacon that acts by folding-induced dissociation of a DNA intercalating dye, BOBO-3(B), is demonstrated with label-free thrombin detection. The beacon, denoted as QD-apt:B, is constructed by (1) coupling of a single-stranded thrombin aptamer to Qdot 565 via EDC/Sulfo-NHS chemistry and (2) staining the duplex regions of the aptamer on QD with excess BOBO-3 before thrombin binding. When mixing a thrombin sample with QD-apt:B, BOBO-3 is competed away from the beacon due to target-induced aptamer folding, which then causes a decrease in QD fluorescence resonance energy transfer (FRET)-mediated BOBO-3 emission and achieves thrombin quantitation. In this work, the effects of Mg(2+), coupling time, and aptamer type on the beacon's performances are investigated and discussed thoroughly with various methods, including transmission electron microscopy (TEM), dynamic light scattering (DLS), and two-color differential gel electrophoresis. Using the best aptamer beacon (HTQ37), we attain highly specific and wide-range detection (from nM to μM) of thrombin in buffer, and the beacon can sense nM-range thrombin in 15% diluted serum. Compared to the reported QD aptamer assays, our method is advantageous from the aspect of using a simple sensory unit design without losing the detection sensitivity. Therefore, we consider the QD-apt:B beacon a potential alternative to immuno-reagents and an effective tool to study nucleic acid folding on QD as well. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Co-administration of a DNA vaccine encoding the prostate specific membrane antigen and CpG oligodeoxynucleotides suppresses tumor growth.

    PubMed

    Ren, Jiaqiang; Zheng, Li; Chen, Qi; Li, Hua; Zhang, Lin; Zhu, Hongguang

    2004-09-09

    BACKGROUND: Prostate-specific membrane antigen (PSMA) is a well characterized prostate-specific tumor associated antigen. Its expression is elevated in prostate carcinoma, particularly in metastatic and recurrent lesions. These observations suggest that PSMA can be used as immune target to induce tumor cell-specific recognition by the host and, consequently tumor rejection. We utilized a DNA-based vaccine to specifically enhance PSMA expression. An immune modulator, such as CpG oligodeoxynucleotides which promote Th1-type immune responses was combined to increase the efficacy of tumor recognition and elimination. METHODS: A eukaryotic expression plasmid pCDNA3.1-PSMA encoding full-length PSMA was constructed. C57BL/6 mice were immunized with endotoxin-free pCDNA3.1-PSMA alone or in combination with CpG oligodeoxynucleotides by intramuscular injection. After 4 immunizations, PSMA specific antibodies and cytotoxic T lymphocyte reactivity were measured. Immunized C57BL/6 mice were also challenged subcutaneously with B16 cells transfected with PSMA to evaluate suppression of tumor growth. RESULTS: Vaccine-specific cytotoxic T lymphocytes reactive with B16 cells expressing PSMA could be induced with this treatment schedule. Immune protection was observed in vaccinated mice as indicated by increased tumor growth in the control group (100%) compared with the groups vaccinated with DNA alone (66.7%) or DNA plus CpG oligodeoxynucleotides (50%) respectively. Average tumor volume was smaller in vaccinated groups and tumor-free survival time was prolonged by the vaccination. CONCLUSION: The current findings suggest that specific anti-tumor immune response can be induced by DNA vaccines expressing PSMA. In addition, the suppression of in vivo growth of tumor cells expressing PSMA was augmented by CpG oligodeoxynucleotides. This strategy may provide a new venue for the treatment of carcinoma of prostate after failure of standard therapy.

  15. A DNA Barcoding Method to Discriminate between the Model Plant Brachypodium distachyon and Its Close Relatives B. stacei and B. hybridum (Poaceae)

    PubMed Central

    López-Alvarez, Diana; López-Herranz, Maria Luisa; Betekhtin, Alexander; Catalán, Pilar

    2012-01-01

    Background Brachypodium distachyon s. l. has been widely investigated across the world as a model plant for temperate cereals and biofuel grasses. However, this annual plant shows three cytotypes that have been recently recognized as three independent species, the diploids B. distachyon (2n = 10) and B. stacei (2n = 20) and their derived allotetraploid B. hybridum (2n = 30). Methodology/Principal Findings We propose a DNA barcoding approach that consists of a rapid, accurate and automatable species identification method using the standard DNA sequences of complementary plastid (trnLF) and nuclear (ITS, GI) loci. The highly homogenous but largely divergent B. distachyon and B. stacei diploids could be easily distinguished (100% identification success) using direct trnLF (2.4%), ITS (5.5%) or GI (3.8%) sequence divergence. By contrast, B. hybridum could only be unambiguously identified through the use of combined trnLF+ITS sequences (90% of identification success) or by cloned GI sequences (96.7%) that showed 5.4% (ITS) and 4% (GI) rate divergence between the two parental sequences found in the allopolyploid. Conclusion/Significance Our data provide an unbiased and effective barcode to differentiate these three closely-related species from one another. This procedure overcomes the taxonomic uncertainty generated from methods based on morphology or flow cytometry identifications that have resulted in some misclassifications of the model plant and its allies. Our study also demonstrates that the allotetraploid B. hybridum has resulted from bi-directional crosses of B. distachyon and B. stacei plants acting either as maternal or paternal parents. PMID:23240000

  16. Methyl supplementation attenuates cocaine-seeking behaviors and cocaine-induced c-Fos activation in a DNA methylation-dependent manner.

    PubMed

    Wright, Katherine N; Hollis, Fiona; Duclot, Florian; Dossat, Amanda M; Strong, Caroline E; Francis, T Chase; Mercer, Roger; Feng, Jian; Dietz, David M; Lobo, Mary Kay; Nestler, Eric J; Kabbaj, Mohamed

    2015-06-10

    Epigenetic mechanisms, such as histone modifications, regulate responsiveness to drugs of abuse, such as cocaine, but relatively little is known about the regulation of addictive-like behaviors by DNA methylation. To investigate the influence of DNA methylation on the locomotor-activating effects of cocaine and on drug-seeking behavior, rats receiving methyl supplementation via chronic l-methionine (MET) underwent either a sensitization regimen of intermittent cocaine injections or intravenous self-administration of cocaine, followed by cue-induced and drug-primed reinstatement. MET blocked sensitization to the locomotor-activating effects of cocaine and attenuated drug-primed reinstatement, with no effect on cue-induced reinstatement or sucrose self-administration and reinstatement. Furthermore, upregulation of DNA methyltransferase 3a and 3b and global DNA hypomethylation were observed in the nucleus accumbens core (NAc), but not in the medial prefrontal cortex (mPFC), of cocaine-pretreated rats. Glutamatergic projections from the mPFC to the NAc are critically involved in the regulation of cocaine-primed reinstatement, and activation of both brain regions is seen in human addicts when reexposed to the drug. When compared with vehicle-pretreated rats, the immediate early gene c-Fos (a marker of neuronal activation) was upregulated in the NAc and mPFC of cocaine-pretreated rats after cocaine-primed reinstatement, and chronic MET treatment blocked its induction in both regions. Cocaine-induced c-Fos expression in the NAc was associated with reduced methylation at CpG dinucleotides in the c-Fos gene promoter, effects reversed by MET treatment. Overall, these data suggest that drug-seeking behaviors are, in part, attributable to a DNA methylation-dependent process, likely occurring at specific gene loci (e.g., c-Fos) in the reward pathway.

  17. Moderate and high amounts of tamoxifen in αMHC-MerCreMer mice induce a DNA damage response, leading to heart failure and death

    PubMed Central

    Bersell, Kevin; Choudhury, Sangita; Mollova, Mariya; Polizzotti, Brian D.; Ganapathy, Balakrishnan; Walsh, Stuart; Wadugu, Brian; Arab, Shima; Kühn, Bernhard

    2013-01-01

    SUMMARY Numerous mouse models have utilized Cre-loxP technology to modify gene expression. Adverse effects of Cre recombinase activity have been reported, including in the heart. However, the mechanisms associated with cardiac Cre toxicity are largely unknown. Here, we show that expression of Cre in cardiomyocytes induces a DNA damage response, resulting in cardiomyocyte apoptosis, cardiac fibrosis and cardiac dysfunction. In an effort to increase the recombination efficiency of a widely used tamoxifen-sensitive Cre transgene under control of the α-myosin-heavy-chain promoter (αMHC-MerCreMer), we observed myocardial dysfunction and decreased survival, which were dependent on the dose of tamoxifen injected. After excluding a Cre-independent contribution by tamoxifen, we found that Cre induced myocardial fibrosis, activation of pro-fibrotic genes and cardiomyocyte apoptosis. Examination of the molecular mechanisms showed activation of DNA damage response signaling and p53 stabilization in the absence of loxP sites, suggesting that Cre induced illegitimate DNA breaks. Cardiomyocyte apoptosis was also induced by expressing Cre using adenoviral transduction, indicating that the effect was not dependent on genomic integration of the transgene. Cre-mediated homologous recombination at loxP sites was dose-dependent and had a ceiling effect at ∼80% of cardiomyocytes showing recombination. By titrating the amount of tamoxifen to maximize recombination while minimizing animal lethality, we determined that 30 μg tamoxifen/g body weight/day injected on three consecutive days is the optimal condition for the αMHC-MerCreMer system to induce recombination in the Rosa26-lacZ strain. Our results further highlight the importance of experimental design, including the use of appropriate genetic controls for Cre expression. PMID:23929941

  18. Aspects of T Cell-Mediated Immunity Induced in Mice by a DNA Vaccine Based on the Dengue-NS1 Antigen after Challenge by the Intracerebral Route

    PubMed Central

    Oliveira, Edson R. A.; Gonçalves, Antônio J. S.; Costa, Simone M.; Azevedo, Adriana S.; Mantuano-Barradas, Marcio; Nogueira, Ana Cristina M. A.

    2016-01-01

    Dengue disease has emerged as a major public health issue across tropical and subtropical countries. Infections caused by dengue virus (DENV) can evolve to life-threatening forms, resulting in about 20,000 deaths every year worldwide. Several animal models have been described concerning pre-clinical stages in vaccine development against dengue, each of them presenting limitations and advantages. Among these models, a traditional approach is the inoculation of a mouse-brain adapted DENV variant in immunocompetent animals by the intracerebral (i.c.) route. Despite the historical usage and relevance of this model for vaccine testing, little is known about the mechanisms by which the protection is developed upon vaccination. To cover this topic, a DNA vaccine based on the DENV non-structural protein 1 (pcTPANS1) was considered and investigations were focused on the induced T cell-mediated immunity against i.c.-DENV infection. Immunophenotyping assays by flow cytometry revealed that immunization with pcTPANS1 promotes a sustained T cell activation in spleen of i.c.-infected mice. Moreover, we found that the downregulation of CD45RB on T cells, as an indicator of cell activation, correlated with absence of morbidity upon virus challenge. Adoptive transfer procedures supported by CFSE-labeled cell tracking showed that NS1-specific T cells induced by vaccination, proliferate and migrate to peripheral organs of infected mice, such as the liver. Additionally, in late stages of infection (from the 7th day onwards), vaccinated mice also presented reduced levels of circulating IFN-γ and IL-12p70 in comparison to non-vaccinated animals. In conclusion, this work presented new aspects about the T cell-mediated immunity concerning DNA vaccination with pcTPANS1 and the i.c. infection model. These insights can be explored in further studies of anti-dengue vaccine efficacy. PMID:27631083

  19. Coadministration of the Three Antigenic Leishmania infantum Poly (A) Binding Proteins as a DNA Vaccine Induces Protection against Leishmania major Infection in BALB/c Mice

    PubMed Central

    Corvo, Laura; Garde, Esther; Ramírez, Laura; Iniesta, Virginia; Bonay, Pedro; Gómez-Nieto, Carlos; González, Víctor M.; Martín, M. Elena; Alonso, Carlos; Coelho, Eduardo A. F.; Barral, Aldina; Barral-Netto, Manoel

    2015-01-01

    Background Highly conserved intracellular proteins from Leishmania have been described as antigens in natural and experimental infected mammals. The present study aimed to evaluate the antigenicity and prophylactic properties of the Leishmania infantum Poly (A) binding proteins (LiPABPs). Methodology/Principal Findings Three different members of the LiPABP family have been described. Recombinant tools based on these proteins were constructed: recombinant proteins and DNA vaccines. The three recombinant proteins were employed for coating ELISA plates. Sera from human and canine patients of visceral leishmaniasis and human patients of mucosal leishmaniasis recognized the three LiPABPs. In addition, the protective efficacy of a DNA vaccine based on the combination of the three Leishmania PABPs has been tested in a model of progressive murine leishmaniasis: BALB/c mice infected with Leishmania major. The induction of a Th1-like response against the LiPABP family by genetic vaccination was able to down-regulate the IL-10 predominant responses elicited by parasite LiPABPs after infection in this murine model. This modulation resulted in a partial protection against L. major infection. LiPABP vaccinated mice showed a reduction on the pathology that was accompanied by a decrease in parasite burdens, in antibody titers against Leishmania antigens and in the IL-4 and IL-10 parasite-specific mediated responses in comparison to control mice groups immunized with saline or with the non-recombinant plasmid. Conclusion/Significance The results presented here demonstrate for the first time the prophylactic properties of a new family of Leishmania antigenic intracellular proteins, the LiPABPs. The redirection of the immune response elicited against the LiPABP family (from IL-10 towards IFN-γ mediated responses) by genetic vaccination was able to induce a partial protection against the development of the disease in a highly susceptible murine model of leishmaniasis. PMID:25955652

  20. Crystal structure of a DNA aptamer bound to PvLDH elucidates novel single-stranded DNA structural elements for folding and recognition

    PubMed Central

    Choi, Sung-Jin; Ban, Changill

    2016-01-01

    Structural elements are key elements for understanding single-stranded nucleic acid folding. Although various RNA structural elements have been documented, structural elements of single-stranded DNA (ssDNA) have rarely been reported. Herein, we determined a crystal structure of PvLDH in complex with a DNA aptamer called pL1. This aptamer folds into a hairpin-bulge contact by adopting three novel structural elements, viz, DNA T-loop-like motif, base–phosphate zipper, and DNA G·G metal ion zipper. Moreover, the pL1:PvLDH complex shows unique properties compared with other protein:nucleic acid complexes. Generally, extensive intermolecular hydrogen bonds occur between unpaired nucleotides and proteins for specific recognitions. Although most protein-interacting nucleotides of pL1 are unpaired nucleotides, pL1 recognizes PvLDH by predominant shape complementarity with many bridging water molecules owing to the combination of three novel structural elements making protein-binding unpaired nucleotides stable. Moreover, the additional set of Plasmodium LDH residues which were shown to form extensive hydrogen bonds with unpaired nucleotides of 2008s does not participate in the recognition of pL1. Superimposition of the pL1:PvLDH complex with hLDH reveals steric clashes between pL1 and hLDH in contrast with no steric clashes between 2008s and hLDH. Therefore, specific protein recognition mode of pL1 is totally different from that of 2008s. PMID:27725738

  1. Identification of single-nucleotide polymorphisms by the oligonucleotide ligation reaction: a DNA biosensor for simultaneous visual detection of both alleles.

    PubMed

    Toubanaki, Dimitra K; Christopoulos, Theodore K; Ioannou, Penelope C; Flordellis, Christodoulos S

    2009-01-01

    Although single nucleotide polymorphisms (SNPs) can be identified by direct hybridization with allele-specific oligonucleotide probes, enzyme-based genotyping methods offer much higher specificity and robustness. Among enzymatic methods, the oligonucleotide ligation reaction (OLR) offers the highest specificity for allele discrimination because two hybridization events are required for ligation. We report the development of a DNA biosensor that offers significant advantages over currently available methods for detection of OLR products: It allows simultaneous visual discrimination of both alleles using a single ligation reaction. Detection is complete within minutes without the need for any specialized instruments. It does not involve multiple cycles of incubation and washing. The dry-reagent format minimizes the pipetting steps. The need for qualified personnel is much lower than current methods. The principle of the assay is as follows: Following PCR amplification, a single OLR is performed using a biotinylated common probe and two allele-specific probes labeled with the haptens digoxigenin and fluorescein. Ligation products corresponding to the normal and mutant allele are double-labeled with biotin and either digoxigenin or fluorescein, respectively. The products are captured by antidigoxigenin or antifluorescein antibodies, or both, that are immobilized at the two test zones of the biosensor and react with antibiotin-functionalized gold nanoparticle reporters. The excess nanoparticles bind to biotinylated albumin that is immobilized at the control zone of the biosensor. The genotype is assigned by the characteristic red lines that appear at the two test zones. The proposed DNA biosensor constitutes a significant step toward point-of-care SNP genotyping.

  2. Characterization of a DNA damage-inducible membrane protein kinase from Deinococcus radiodurans and its role in bacterial radioresistance and DNA strand break repair.

    PubMed

    Rajpurohit, Yogendra S; Misra, Hari S

    2010-09-01

    Deinococcus radiodurans mutant lacking pyrroloquinoline-quinone (PQQ) synthesis shows sensitivity to γ-rays and impairment of DNA double strand break repair. The genome of this bacterium encodes five putative proteins having multiple PQQ binding motifs. The deletion mutants of corresponding genes were generated, and their response to DNA damage was monitored. Only the Δdr2518 mutant exhibited higher sensitivity to DNA damage. Survival of these cells decreased by 3-log cycle both at 6 kGy γ-rays and 1200 Jm(-2) UV (254 nm) radiation, and 2.5-log cycle upon 14 days desiccation at 5% humidity. The Δdr2518 mutant showed complete inhibition of DSB repair until 24 h PIR and disappearance of a few phosphoproteins. The Δdr2518pqqE:cat double mutant showed γ-ray sensitivity similar to Δdr2518 indicating functional interaction of these genes in D. radiodurans. DR2518 contains a eukaryotic type Ser/Thr kinase domain and structural topology suggesting stress responsive transmembrane protein. Its autokinase activity in solution was stimulated by nearly threefold with PQQ and twofold with linear DNA, but not with circular plasmid DNA. More than 15-fold increase in dr2518 transcription and several-fold enhanced in vivo phosphorylation of DR2518 were observed in response to γ irradiation. These results suggest that DR2518 as a DNA damage-responsive protein kinase plays an important role in radiation resistance and DNA strand break repair in D. radiodurans. © 2010 Blackwell Publishing Ltd.

  3. Preexisting Vaccinia Virus Immunity Decreases SIV-Specific Cellular Immunity but does not diminish Humoral Immunity and Efficacy of a DNA/MVA Vaccine

    PubMed Central

    Kannanganat, Sunil; Nigam, Pragati; Velu, Vijayakumar; Earl, Patricia L.; Lai, Lilin; Chennareddi, Lakshmi; Lawson, Benton; Wilson, Robert L.; Montefiori, David C.; Kozlowski, Pamela A.; Moss, Bernard; Robinson, Harriet L.; Amara, Rama Rao

    2012-01-01

    The influence of preexisting immunity to viral vectors is a major issue for the development of viral vectored vaccines. Here, we investigate the effect of preexisting vaccinia virus immunity on the immunogenicity and efficacy of a DNA/MVA SIV vaccine in rhesus macaques using a pathogenic intrarectal SIV251 challenge. Preexisting immunity decreased SIV-specific CD8 and CD4 T cell responses, but preserved the SIV-specific humoral immunity. In addition, preexisting immunity did not diminish the control of a SIV challenge mediated by the DNA/MVA vaccine. The peak and set point viremia was 150- and 17-fold lower, respectively in preimmune animals compared to control animals. The peak and set point viremia correlated directly with colorectal virus at 2 weeks post challenge suggesting that early control of virus replication at the site of viral challenge was critical for viral control. Factors that correlated with early colorectal viral control included (i) the presence of anti-SIV IgA in rectal secretions, (ii) high avidity binding antibody for the native form of Env and (iii) low magnitude of vaccine-elicited SIV-specific CD4 T cells displaying the CCR5 viral co-receptor. The frequency of SIV-specific CD8 T cells in blood and colorectal tissue at 2 weeks post challenge did not correlate with early colorectal viral control. These results suggest that preexisting vaccinia virus immunity may not limit the potential of recombinant MVA vaccines to elicit humoral immunity and highlight the importance of immunodeficiency virus vaccines achieving early control at the mucosal sites of challenge. PMID:21076059

  4. Vector optimization and needle-free intradermal application of a broadly protective polyvalent influenza A DNA vaccine for pigs and humans.

    PubMed

    Borggren, Marie; Nielsen, Jens; Bragstad, Karoline; Karlsson, Ingrid; Krog, Jesper S; Williams, James A; Fomsgaard, Anders

    2015-01-01

    The threat posed by the 2009 pandemic H1N1 virus emphasized the need for new influenza A virus vaccines inducing a broad cross-protective immune response for use in both humans and pigs. An effective and broad influenza vaccine for pigs would greatly benefit the pork industry and contribute to public health by diminishing the risk of emerging highly pathogenic reassortants. Current inactivated protein vaccines against swine influenza produce only short-lived immunity and have no efficacy against heterologous strains. DNA vaccines are a potential alternative with advantages such as the induction of cellular and humoral immunity, inherent safety and rapid production time. We have previously developed a DNA vaccine encoding selected influenza proteins of pandemic origin and demonstrated broad protective immune responses in ferrets and pigs. In this study, we evaluated our DNA vaccine expressed by next-generation vectors. These new vectors can improve gene expression, but they are also efficiently produced on large scales and comply with regulatory guidelines by avoiding antibiotic resistance genes. In addition, a new needle-free delivery of the vaccine, convenient for mass vaccinations, was compared with intradermal needle injection followed by electroporation. We report that when our DNA vaccine is expressed by the new vectors and delivered to the skin with the needle-free device in the rabbit model, it can elicit an antibody response with the same titers as a conventional vector with intradermal electroporation. The needle-free delivery is already in use for traditional protein vaccines in pigs but should be considered as a practical alternative for the mass administration of broadly protective influenza DNA vaccines.

  5. Contribution of TLR4 and MyD88 for adjuvant monophosphoryl lipid A (MPLA) activity in a DNA prime-protein boost HIV-1 vaccine.

    PubMed

    Pouliot, Kimberly; Buglione-Corbett, Rachel; Marty-Roix, Robyn; Montminy-Paquette, Sara; West, Kim; Wang, Shixia; Lu, Shan; Lien, Egil

    2014-09-03

    Recombinant protein vaccines are commonly formulated with an immune-stimulatory compound, or adjuvant, to boost immune responses to a particular antigen. Recent studies have shown that, through recognition of molecular motifs, receptors of the innate immune system are involved in the functions of adjuvants to generate and direct adaptive immune responses. However, it is not clear to which degree those receptors are also important when the adjuvant is used as part of a novel heterologous prime-boost immunization process in which the priming and boosting components are not the same type of vaccines. In the current study, we compared the immune responses elicited by a pentavalent HIV-1 DNA prime-protein boost vaccine in mice deficient in either Toll-like receptor 4 (TLR4) or myeloid differentiation primary response gene 88 (MyD88) to wildtype mice. HIV gp120 protein administered in the boost phase was formulated with either monophosphoryl lipid A (MPLA), QS-21, or Al(OH)3. Endpoint antibody titer, serum cytokine response and T-cell memory response were assessed. Neither TLR4 nor MyD88 deficiency had a significant effect on the immune response of mice given vaccine formulated with QS-21 or Al(OH)3. However, TLR4- and MyD88-deficiency decreased both the antibody and T-cell responses in mice administered HIV gp120 formulated with MPLA. These results further our understanding of the activation of TLR4 and MyD88 by MPLA in the context of a DNA prime/protein boost immunization strategy.

  6. Enhancement of immune response to a DNA vaccine against Mycobacterium tuberculosis Ag85B by incorporation of an autophagy inducing system.

    PubMed

    Meerak, Jomkhwan; Wanichwecharungruang, Supason P; Palaga, Tanapat

    2013-01-21

    DNA vaccines are a promising new generation of vaccines that can elicit an immune response using DNA encoding the antigen of interest. The efficacy of these vaccines, however, still needs to be improved. In this study, we investigated the effect of autophagy on increasing the efficacy of a candidate DNA vaccine against Mycobacterium tuberculosis (MTB), a causative agent of tuberculosis. Low molecular weight chitosan was used to encapsulate plasmid DNA containing a gene encoding MTB Antigen 85B (Ag85B), a secreted fibronectin-binding protein. To induce autophagy upon DNA vaccination, the kinase defective mTOR (mTOR-KD) was transfected into cells, and autophagy was detected based on the presence of LC3II. To investigate whether autophagy enhances an immune response upon DNA vaccination, we coencapsualted the Ag85B-containing plasmid with a plasmid encoding mTOR-KD. Plasmids encapsulated by chitosan particles were used for primary subcutaneous immunization and for intranasal boost in mice. After the boost vaccination, sera from the mice were measured for humoral immune response. The DNA vaccine with the autophagy-inducing construct elicited significantly higher Ag85B-specific antibody levels than the control group treated with the Ag85B plasmid alone or with the Ag85B plasmid plus the wild type mTOR construct. Upon in vitro stimulation of splenocytes from mice immunized with recombinant Ag85B, the highest levels of secreted IFN-γ and IL-2 were detected in mice immunized with the autophagy-inducing plasmid, while no differences in IL-4 levels were detected between the groups, suggesting that the DNA vaccine regimen with autophagy induction induced primarily a Th1 immune response. Furthermore, the enhanced proliferation of CD4+ T cells from mice receiving the autophagy-inducing vaccine was observed in vitro. Based on the evidence presented, we conclude that incorporating an autophagy-inducing element into a DNA vaccine may help to improve immune response.

  7. A DNA vaccine against tuberculosis based on the 65 kDa heat-shock protein differentially activates human macrophages and dendritic cells

    PubMed Central

    Franco, Luís H; Wowk, Pryscilla F; Silva, Célio L; Trombone, Ana PF; Coelho-Castelo, Arlete AM; Oliver, Constance; Jamur, Maria C; Moretto, Edson L; Bonato, Vânia LD

    2008-01-01

    Background A number of reports have demonstrated that rodents immunized with DNA vaccines can produce antibodies and cellular immune responses presenting a long-lasting protective immunity. These findings have attracted considerable interest in the field of DNA vaccination. We have previously described the prophylactic and therapeutic effects of a DNA vaccine encoding the Mycobacterium leprae 65 kDa heat shock protein (DNA-HSP65) in a murine model of tuberculosis. As DNA vaccines are often less effective in humans, we aimed to find out how the DNA-HSP65 stimulates human immune responses. Methods To address this question, we analysed the activation of both human macrophages and dendritic cells (DCs) cultured with DNA-HSP65. Then, these cells stimulated with the DNA vaccine were evaluated regarding the expression of surface markers, cytokine production and microbicidal activity. Results It was observed that DCs and macrophages presented different ability to uptake DNA vaccine. Under DNA stimulation, macrophages, characterized as CD11b+/CD86+/HLA-DR+, produced high levels of TNF-alpha, IL-6 (pro-inflammatory cytokines), and IL-10 (anti-inflammatory cytokine). Besides, they also presented a microbicidal activity higher than that observed in DCs after infection with M. tuberculosis. On the other hand, DCs, characterized as CD11c+/CD86+/CD123-/BDCA-4+/IFN-alpha-, produced high levels of IL-12 and low levels of TNF-alpha, IL-6 and IL-10. Finally, the DNA-HSP65 vaccine was able to induce proliferation of peripheral blood lymphocytes. Conclusion Our data suggest that the immune response is differently activated by the DNA-HSP65 vaccine in humans. These findings provide important clues to the design of new strategies for using DNA vaccines in human immunotherapy. PMID:18208592

  8. Direct Electrochemistry and Electrocatalysis of Horseradish Peroxidase Immobilized in a DNA/Chitosan-Fe₃O₄ Magnetic Nanoparticle Bio-Complex Film.

    PubMed

    Gu, Tingting; Wang, Jianli; Xia, Hongqi; Wang, Si; Yu, Xiaoting

    2014-02-11

    A DNA/chitosan-Fe₃O₄ magnetic nanoparticle bio-complex film was constructed for the immobilization of horseradish peroxidase (HRP) on a glassy carbon electrode. HRP was simply mixed with DNA, chitosan and Fe₃O₄ nanoparticles, and then applied to the electrode surface to form an enzyme-incorporated polyion complex film. Scanning electron microscopy (SEM) was used to study the surface features of DNA/chitosan/Fe₃O₄/HRP layer. The results of electrochemical impedance spectroscopy (EIS) show that Fe₃O₄ and enzyme were successfully immobilized on the electrode surface by the DNA/chitosan bio-polyion complex membrane. Direct electron transfer (DET) and bioelectrocatalysis of HRP in the DNA/chitosan/Fe₃O₄ film were investigated by cyclic voltammetry (CV) and constant potential amperometry. The HRP-immobilized electrode was found to undergo DET and exhibited a fast electron transfer rate constant of 3.7 s(-1). The CV results showed that the modified electrode gave rise to well-defined peaks in phosphate buffer, corresponding to the electrochemical redox reaction between HRP(Fe((III)())) and HRP(Fe((II))). The obtained electrode also displayed an electrocatalytic reduction behavior towards H₂O₂. The resulting DNA/chitosan/Fe₃O₄/HRP/glassy carbon electrode (GCE) shows a high sensitivity (20.8 A·cm(-2)·M(-1)) toward H₂O₂. A linear response to H₂O₂ measurement was obtained over the range from 2 µM to 100 µM (R² = 0.99) and an amperometric detection limit of 1 µM (S/N = 3). The apparent Michaelis-Menten constant of HRP immobilized on the electrode was 0.28 mM. Furthermore, the electrode exhibits both good operational stability and storage stability.

  9. Cooperation between CD4+ T Cells and Humoral Immunity Is Critical for Protection against Dengue Using a DNA Vaccine Based on the NS1 Antigen

    PubMed Central

    Gonçalves, Antônio J. S.; Oliveira, Edson R. A.; Costa, Simone M.; Paes, Marciano V.; Silva, Juliana F. A.; Azevedo, Adriana S.; Mantuano-Barradas, Marcio; Nogueira, Ana Cristina M. A.; Almeida, Cecília J.; Alves, Ada M. B.

    2015-01-01

    Dengue virus (DENV) is spread through most tropical and subtropical areas of the world and represents a serious public health problem. At present, the control of dengue disease is mainly hampered by the absence of antivirals or a vaccine, which results in an estimated half worldwide population at risk of infection. The immune response against DENV is not yet fully understood and a better knowledge of it is now recognized as one of the main challenge for vaccine development. In previous studies, we reported that a DNA vaccine containing the signal peptide sequence from the human tissue plasminogen activator (t-PA) fused to the DENV2 NS1 gene (pcTPANS1) induced protection against dengue in mice. In the present work, we aimed to elucidate the contribution of cellular and humoral responses elicited by this vaccine candidate for protective immunity. We observed that pcTPANS1 exerts a robust protection against dengue, inducing considerable levels of anti-NS1 antibodies and T cell responses. Passive immunization with anti-NS1 antibodies conferred partial protection in mice infected with low virus load (4 LD50), which was abrogated with the increase of viral dose (40 LD50). The pcTPANS1 also induced activation of CD4+ and CD8+ T cells. We detected production of IFN-γ and a cytotoxic activity by CD8+ T lymphocytes induced by this vaccine, although its contribution in the protection was not so evident when compared to CD4+ cells. Depletion of CD4+ cells in immunized mice completely abolished protection. Furthermore, transfer experiments revealed that animals receiving CD4+ T cells combined with anti-NS1 antiserum, both obtained from vaccinated mice, survived virus infection with survival rates not significantly different from pcTPANS1-immunized animals. Taken together, results showed that the protective immune response induced by the expression of NS1 antigen mediated by the pcTPANS1 requires a cooperation between CD4+ T cells and the humoral immunity. PMID:26650916

  10. Cooperation between CD4+ T Cells and Humoral Immunity Is Critical for Protection against Dengue Using a DNA Vaccine Based on the NS1 Antigen.

    PubMed

    Gonçalves, Antônio J S; Oliveira, Edson R A; Costa, Simone M; Paes, Marciano V; Silva, Juliana F A; Azevedo, Adriana S; Mantuano-Barradas, Marcio; Nogueira, Ana Cristina M A; Almeida, Cecília J; Alves, Ada M B

    2015-12-01

    Dengue virus (DENV) is spread through most tropical and subtropical areas of the world and represents a serious public health problem. At present, the control of dengue disease is mainly hampered by the absence of antivirals or a vaccine, which results in an estimated half worldwide population at risk of infection. The immune response against DENV is not yet fully understood and a better knowledge of it is now recognized as one of the main challenge for vaccine development. In previous studies, we reported that a DNA vaccine containing the signal peptide sequence from the human tissue plasminogen activator (t-PA) fused to the DENV2 NS1 gene (pcTPANS1) induced protection against dengue in mice. In the present work, we aimed to elucidate the contribution of cellular and humoral responses elicited by this vaccine candidate for protective immunity. We observed that pcTPANS1 exerts a robust protection against dengue, inducing considerable levels of anti-NS1 antibodies and T cell responses. Passive immunization with anti-NS1 antibodies conferred partial protection in mice infected with low virus load (4 LD50), which was abrogated with the increase of viral dose (40 LD50). The pcTPANS1 also induced activation of CD4+ and CD8+ T cells. We detected production of IFN-γ and a cytotoxic activity by CD8+ T lymphocytes induced by this vaccine, although its contribution in the protection was not so evident when compared to CD4+ cells. Depletion of CD4+ cells in immunized mice completely abolished protection. Furthermore, transfer experiments revealed that animals receiving CD4+ T cells combined with anti-NS1 antiserum, both obtained from vaccinated mice, survived virus infection with survival rates not significantly different from pcTPANS1-immunized animals. Taken together, results showed that the protective immune response induced by the expression of NS1 antigen mediated by the pcTPANS1 requires a cooperation between CD4+ T cells and the humoral immunity.

  11. Specificity of the TraA-DNA interaction in the regulation of the pPD1-encoded sex pheromone response in Enterococcus faecalis.

    PubMed

    Folli, Claudia; Mangiarotti, Laura; Folloni, Silvia; Alfieri, Beatrice; Gobbo, Marina; Berni, Rodolfo; Rivetti, Claudio

    2008-07-25

    The Enterococcus faecalis conjugative plasmid pPD1 encodes proteins responsible for the mating response to the sex pheromone cPD1 secreted by a recipient cell. This response involves the respectively negative and positive determinants traA and traE, the pheromone-inhibitor determinant ipd and structural genes participating in the conjugation process. TraA is capable of binding to key sites within the regulatory gene cluster. The binding of TraA to cognate sites is modulated by the pheromone (cPD1) and the pheromone-inhibitor (iPD1) peptides. Using atomic force microscopy and classic biochemical techniques, we mapped and characterized the TraA-DNA interactions within the pPD1 regulatory gene cluster and the role of TraA in the transcription regulation of the sex pheromone response. A previous report showed that TraA binds to three adjacent sites (tab1, tab2 and tab3) located upstream of the ipd promoter region. Here, we provide direct evidence for such interactions and show that TraA alone or in the presence of iPD1 inhibits ipd transcription by preferentially binding to tab1, whereas in the presence of saturating cPD1, the overall binding to the tab sites decreases, TraA preferentially binds to tab3 and the ipd repression is relieved. Moreover, TraA alone or in the presence of iPD1 binds to two non-adjacent sites within the ipd terminators T1 and T2, an interaction that is also relieved in the presence of cPD1. The binding of TraA to the termination region of ipd may play an important role in controlling traE and traF expression via a transcriptional read-through mechanism already postulated for the pAD1 plasmid. TraA may also regulate its own expression by binding to a site in the proximity of the traA promoter, which has been relocated 200 bp downstream of the ipd gene. A model for the TraA-mediated regulation of the pPD1-encoded sex pheromone response is presented.

  12. Questioning the paradigm of metal complex promoted phosphodiester hydrolysis: [Mo7O24](6-) polyoxometalate cluster as an unlikely catalyst for the hydrolysis of a DNA model substrate.

    PubMed

    Cartuyvels, Els; Absillis, Gregory; Parac-Vogt, Tatjana N

    2008-01-07

    The first example of a phosphodiester bond cleavage promoted by a highly negatively charged polyoxometalate cluster has been discovered: the hydrolysis of the phosphodiester bond in a DNA model substrate bis(p-nitrophenyl)phosphate (BNPP) is promoted by the heptamolybdate anion [Mo7O24](6-) with rates which represent an acceleration of nearly four orders of magnitude compared to the uncatalyzed cleavage.

  13. Mycobacterium smegmatis Lhr Is a DNA-dependent ATPase and a 3′-to-5′ DNA Translocase and Helicase That Prefers to Unwind 3′-Tailed RNA:DNA Hybrids*

    PubMed Central

    Ordonez, Heather; Shuman, Stewart

    2013-01-01

    We are interested in the distinctive roster of helicases of Mycobacterium, a genus of the phylum Actinobacteria that includes the human pathogen Mycobacterium tuberculosis and its avirulent relative Mycobacterium smegmatis. Here, we identify and characterize M. smegmatis Lhr as the exemplar of a novel clade of superfamily II helicases, by virtue of its biochemical specificities and signature domain organization. Lhr is a 1507-amino acid monomeric nucleic acid-dependent ATPase that uses the energy of ATP hydrolysis to drive unidirectional 3′-to-5′ translocation along single strand DNA and to unwind duplexes en route. The ATPase is more active in the presence of calcium than magnesium. ATP hydrolysis is triggered by either single strand DNA or single strand RNA, yet the apparent affinity for a DNA activator is 11-fold higher than for an RNA strand of identical size and nucleobase sequence. Lhr is 8-fold better at unwinding an RNA:DNA hybrid than it is at displacing a DNA:DNA duplex of identical nucleobase sequence. The truncated derivative Lhr-(1–856) is an autonomous ATPase, 3′-to-5′ translocase, and RNA:DNA helicase. Lhr-(1–856) is 100-fold better RNA:DNA helicase than DNA:DNA helicase. Lhr homologs are found in bacteria representing eight different phyla, being especially prevalent in Actinobacteria (including M. tuberculosis) and Proteobacteria (including Escherichia coli). PMID:23549043

  14. An improved vector system for constructing transcriptional lacZ fusions: analysis of regulation of the dnaA, dnaN, recF and gyrB genes of Escherichia coli.

    PubMed

    Macián, F; Pérez-Roger, I; Armengod, M E

    1994-07-22

    We describe a new vector system for the in vitro construction of transcriptional fusions to the lacZ gene, which is expressed from the translational start signals of galK. The galK ribosome-binding site (RBS) and its natural preceding region ensure a constant efficiency for lacZ translation and, thus, the beta-galactosidase (beta Gal) production of a given fusion is directly proportional to the in vivo transcriptional activity of the inserted DNA fragment. Single-copy lambda prophage versions of multicopy constructs can be made by in vivo recombination. We use this system to compare the transcriptional activities of the promoters present in the dnaA-dnaN-recF-gyrB cluster. The order of strength of these promoters is gyrB > dnaA > recF > dnaN. It is assumed that gyrB belongs to the dnaA-dnaN-recF operon, because the short recF-gyrB intercistronic region does not contain a terminator. By using this new vector system, we have detected strong termination signals within recF that are functional even when recF is translated at its normal rate. The low level of transcription coming to the end of recF, and the highest activity of the gyrB promoter, as well as results obtained with several gyrB::lacZ translational fusions, support the conclusion that gyrB is predominantly expressed from its own promoter under standard growth conditions. Finally, we have found that transcription from the dnaA promoters is constant at different growth rates. This supports the idea that autoregulation of the dnaA gene is responsible for the coupling of the DnaA protein synthesis to cell mass increase, and accumulation of DnaA protein governs the initiation of chromosome replication.

  15. The association between metabolic rate, immune parameters, and growth performance of rainbow trout, Oncorhynchus mykiss (Walbaum), following the injection of a DNA vaccine alone and concurrently with a polyvalent, oil-adjuvanted vaccine.

    PubMed

    Skinner, Lisa A; Schulte, P M; Balfry, S K; McKinley, R S; LaPatra, S E

    2010-02-01

    This research demonstrates a significant increase in routine metabolic rate (RMR) following injection of a DNA vaccine concurrently with a polyvalent, oil-adjuvanted vaccine. The increase in RMR was transient and associated with increased activity of both the non-specific and specific immune responses. Rainbow trout (Oncorhynchus mykiss) were injected with a DNA vaccine (DV), a commercially available polyvalent, oil-adjuvanted vaccine (AV), or the two vaccines in combination and sampled at 203, 305, and 406 days (dd) post-vaccine injection (pvi) for RMR and key immune parameters (serum lysozyme activity, serum neutralization antibody titres). The RMR of fish that received both the DV and the AV was significantly higher at 203 dd pvi, compared to fish from all other treatment groups which included the control, the AV, and the DV groups. The increased RMR corresponded to elevated levels of serum lysozyme activity and an earlier seroconversion of virus-specific neutralizing antibodies. To determine if growth performance was affected by the transient increase in RMR, specific growth rate (SGR), percent daily weight gain (WG), and feed conversion ratio (FCR) were determined at 798, 1204, and 1610 dd pvi. Although fish in all three vaccine groups showed significant increases in SGR and WG at 798 and 1610 dd pvi compared to the control group, the overall weight of the fish was not different at the end of the experiment. In summary, this study shows that concurrent injection of a DV and an AV transiently increases the RMR of rainbow trout and changes the manner in which the immune response occurs, but does not affect the overall growth performance of the fish.

  16. A DNA methylation biomarker of alcohol consumption.

    PubMed

    Liu, C; Marioni, R E; Hedman, Å K; Pfeiffer, L; Tsai, P-C; Reynolds, L M; Just, A C; Duan, Q; Boer, C G; Tanaka, T; Elks, C E; Aslibekyan, S; Brody, J A; Kühnel, B; Herder, C; Almli, L M; Zhi, D; Wang, Y; Huan, T; Yao, C; Mendelson, M M; Joehanes, R; Liang, L; Love, S-A; Guan, W; Shah, S; McRae, A F; Kretschmer, A; Prokisch, H; Strauch, K; Peters, A; Visscher, P M; Wray, N R; Guo, X; Wiggins, K L; Smith, A K; Binder, E B; Ressler, K J; Irvin, M R; Absher, D M; Hernandez, D; Ferrucci, L; Bandinelli, S; Lohman, K; Ding, J; Trevisi, L; Gustafsson, S; Sandling, J H; Stolk, L; Uitterlinden, A G; Yet, I; Castillo-Fernandez, J E; Spector, T D; Schwartz, J D; Vokonas, P; Lind, L; Li, Y; Fornage, M; Arnett, D K; Wareham, N J; Sotoodehnia, N; Ong, K K; van Meurs, J B J; Conneely, K N; Baccarelli, A A; Deary, I J; Bell, J T; North, K E; Liu, Y; Waldenberger, M; London, S J; Ingelsson, E; Levy, D

    2016-11-15

    The lack of reliable measures of alcohol intake is a major obstacle to the diagnosis and treatment of alcohol-related diseases. Epigenetic modifications such as DNA methylation may provide novel biomarkers of alcohol use. To examine this possibility, we performed an epigenome-wide association study of methylation of cytosine-phosphate-guanine dinucleotide (CpG) sites in relation to alcohol intake in 13 population-based cohorts (ntotal=13 317; 54% women; mean age across cohorts 42-76 years) using whole blood (9643 European and 2423 African ancestries) or monocyte-derived DNA (588 European, 263 African and 400 Hispanic ancestry) samples. We performed meta-analysis and variable selection in whole-blood samples of people of European ancestry (n=6926) and identified 144 CpGs that provided substantial discrimination (area under the curve=0.90-0.99) for current heavy alcohol intake (⩾42 g per day in men and ⩾28 g per day in women) in four replication cohorts. The ancestry-stratified meta-analysis in whole blood identified 328 (9643 European ancestry samples) and 165 (2423 African ancestry samples) alcohol-related CpGs at Bonferroni-adjusted P<1 × 10(-7). Analysis of the monocyte-derived DNA (n=1251) identified 62 alcohol-related CpGs at P<1 × 10(-7). In whole-blood samples of people of European ancestry, we detected differential methylation in two neurotransmitter receptor genes, the γ-Aminobutyric acid-A receptor delta and γ-aminobutyric acid B receptor subunit 1; their differential methylation was associated with expression levels of a number of genes involved in immune function. In conclusion, we have identified a robust alcohol-related DNA methylation signature and shown the potential utility of DNA methylation as a clinically useful diagnostic test to detect current heavy alcohol consumption.Molecular Psychiatry advance online publication, 15 November 2016; doi:10.1038/mp.2016.192.

  17. Thermal denaturation of A-DNA

    NASA Astrophysics Data System (ADS)

    Valle-Orero, J.; Wildes, A. R.; Theodorakopoulos, N.; Cuesta-López, S.; Garden, J.-L.; Danilkin, S.; Peyrard, M.

    2014-11-01

    The DNA molecule can take various conformational forms. Investigations focus mainly on the so-called ‘B-form’, schematically drawn in the famous paper by Watson and Crick [1]. This is the usual form of DNA in a biological environment and is the only form that is stable in an aqueous environment. Other forms, however, can teach us much about DNA. They have the same nucleotide base pairs for ‘building blocks’ as B-DNA, but with different relative positions, and studying these forms gives insight into the interactions between elements under conditions far from equilibrium in the B-form. Studying the thermal denaturation is particularly interesting because it provides a direct probe of those interactions which control the growth of the fluctuations when the ‘melting’ temperature is approached. Here we report such a study on the ‘A-form’ using calorimetry and neutron scattering. We show that it can be carried further than a similar study on B-DNA, requiring the improvement of thermodynamic models for DNA.

  18. Drama Drives a DNA Fingerprinting Lab Exercise.

    ERIC Educational Resources Information Center

    Rubenstein, Elaine C.; And Others

    1996-01-01

    Presents a laboratory exercise for an intermediate cell and molecular biology course that uses a murder-mystery play. Provokes students to think critically about important issues in scientific methodology in general and DNA analysis in particular. (JRH)

  19. Protein patterning by a DNA origami framework.

    PubMed

    Aslan, Hüsnü; Krissanaprasit, Abhichart; Besenbacher, Flemming; Gothelf, Kurt V; Dong, Mingdong

    2016-08-18

    A spatial arrangement of proteins provides structural and functional advantages in vast technological applications as well as fundamental research. Most protein patterning procedures employ complicated, time consuming and very costly nanofabrication techniques. As an alternative route, we developed a fully biomolecular self-assembly method using DNA Origami Frames (DOF) as a template for both small and large scale protein patterning. We employed a triangular DOF (tDOF) to arrange the Bovine Serum Albumin (BSA) protein. Our in situ protein patterning strategy provides a novel, fully organic platform using a fast and low-cost surface approach with possible utilization in fundamental science and technological applications.

  20. A DNA barcode for land plants

    PubMed Central

    Hollingsworth, Peter M.; Forrest, Laura L.; Spouge, John L.; Hajibabaei, Mehrdad; Ratnasingham, Sujeevan; van der Bank, Michelle; Chase, Mark W.; Cowan, Robyn S.; Erickson, David L.; Fazekas, Aron J.; Graham, Sean W.; James, Karen E.; Kim, Ki-Joong; Kress, W. John; Schneider, Harald; van AlphenStahl, Jonathan; Barrett, Spencer C.H.; van den Berg, Cassio; Bogarin, Diego; Burgess, Kevin S.; Cameron, Kenneth M.; Carine, Mark; Chacón, Juliana; Clark, Alexandra; Clarkson, James J.; Conrad, Ferozah; Devey, Dion S.; Ford, Caroline S.; Hedderson, Terry A.J.; Hollingsworth, Michelle L.; Husband, Brian C.; Kelly, Laura J.; Kesanakurti, Prasad R.; Kim, Jung Sung; Kim, Young-Dong; Lahaye, Renaud; Lee, Hae-Lim; Long, David G.; Madriñán, Santiago; Maurin, Olivier; Meusnier, Isabelle; Newmaster, Steven G.; Park, Chong-Wook; Percy, Diana M.; Petersen, Gitte; Richardson, James E.; Salazar, Gerardo A.; Savolainen, Vincent; Seberg, Ole; Wilkinson, Michael J.; Yi, Dong-Keun; Little, Damon P.

    2009-01-01

    DNA barcoding involves sequencing a standard region of DNA as a tool for species identification. However, there has been no agreement on which region(s) should be used for barcoding land plants. To provide a community recommendation on a standard plant barcode, we have compared the performance of 7 leading candidate plastid DNA regions (atpF–atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK–psbI spacer, and trnH–psbA spacer). Based on assessments of recoverability, sequence quality, and levels of species discrimination, we recommend the 2-locus combination of rbcL+matK as the plant barcode. This core 2-locus barcode will provide a universal framework for the routine use of DNA sequence data to identify specimens and contribute toward the discovery of overlooked species of land plants. PMID:19666622

  1. What is a "DNA-Compatible" Reaction?

    PubMed

    Malone, Marie L; Paegel, Brian M

    2016-04-11

    DNA-encoded synthesis can generate vastly diverse screening libraries of arbitrarily complex molecules as long as chemical reaction conditions do not compromise DNA's informational integrity, a fundamental constraint that "DNA-compatible" reaction development does not presently address. We devised DNA-encoded reaction rehearsal, an integrated analysis of reaction yield and impact on DNA, to acquire these key missing data. Magnetic DNA-functionalized sensor beads quantitatively report the % DNA template molecules remaining viable for PCR amplification after exposure to test reaction conditions. Analysis of solid-phase bond forming (e.g., Suzuki-Miyaura cross-coupling, reductive amination) and deprotection reactions (e.g., allyl esters, silyl ethers) guided the definition and optimization of DNA-compatible reaction conditions (>90% yield, >30% viable DNA molecules), most notably in cases that involved known (H(+), Pd) and more obscure (Δ, DMF) hazards to DNA integrity. The data provide an empirical yet mechanistically consistent and predictive framework for designing successful DNA-encoded reaction sequences for combinatorial library synthesis.

  2. Signal replication in a DNA nanostructure

    NASA Astrophysics Data System (ADS)

    Mendoza, Oscar; Houmadi, Said; Aimé, Jean-Pierre; Elezgaray, Juan

    2017-01-01

    Logic circuits based on DNA strand displacement reaction are the basic building blocks of future nanorobotic systems. The circuits tethered to DNA origami platforms present several advantages over solution-phase versions where couplings are always diffusion-limited. Here we consider a possible implementation of one of the basic operations needed in the design of these circuits, namely, signal replication. We show that with an appropriate preparation of the initial state, signal replication performs in a reproducible way. We also show the existence of side effects concomitant to the high effective concentrations in tethered circuits, such as slow leaky reactions and cross-activation.

  3. A DNA test to sex ratite birds.

    PubMed

    Huynen, Leon; Millar, Craig D; Lambert, David M

    2002-04-01

    DNA-based sex tests now exist for many avian species. However, none of these tests are widely applicable to ratites. We present DNA sequence data for a locus that is W chromosome-linked in the kiwi, ostrich, cassowary, rhea, and emu. At the amino acid level, this sequence has significant homology to X-linked genes in platyfish and Caenorhabditis elegans. Polymerase chain reaction (PCR) primers designed to this locus allow the assignment of sex in all species of living ratites.

  4. Drama Drives a DNA Fingerprinting Lab Exercise.

    ERIC Educational Resources Information Center

    Rubenstein, Elaine C.; And Others

    1996-01-01

    Presents a laboratory exercise for an intermediate cell and molecular biology course that uses a murder-mystery play. Provokes students to think critically about important issues in scientific methodology in general and DNA analysis in particular. (JRH)

  5. The promise of a DNA taxonomy.

    PubMed Central

    Blaxter, Mark L

    2004-01-01

    Not only is the number of described species a very small proportion of the estimated extant number of taxa, but it also appears that all concepts of the extent and boundaries of 'species' fail in many cases. Using conserved molecular sequences it is possible to define and diagnose molecular operational taxonomic units (MOTU) that have a similar extent to traditional 'species'. Use of a MOTU system not only allows the rapid and effective identification of most taxa, including those not encountered before, but also allows investigation of the evolution of patterns of diversity. A MOTU approach is not without problems, particularly in the area of deciding what level of molecular difference defines a biologically relevant taxon, but has many benefits. Molecular data are extremely well suited to re-analysis and meta-analysis, and data from multiple independent studies can be readily collated and investigated by using new parameters and assumptions. Previous molecular taxonomic efforts have focused narrowly. Advances in high-throughput sequencing methodologies, however, place the idea of a universal, multi-locus molecular barcoding system in the realm of the possible. PMID:15253352

  6. A DNA Fingerprint Simulation: Different, Simple, Effective.

    ERIC Educational Resources Information Center

    Reed, Eileen

    2001-01-01

    Discusses the impact of biotechnology (i.e., the use of DNA profiling in the courtroom) on today's society. Presents a hands-on activity for DNA profiling simulation that actively involves students. (YDS)

  7. Optimization of a DNA vaccine against SARS.

    PubMed

    Zakhartchouk, Alexander N; Viswanathan, Sathiyanarayanan; Moshynskyy, Igor; Petric, Martin; Babiuk, Lorne A

    2007-10-01

    Severe acute respiratory syndrome coronavirus (SARS-CoV) first appeared in Southern China in November 2002, and then quickly spread to 33 countries on five continents along international air travel routes. Although the SARS epidemic has been contained, there is a clear need for a safe and effective vaccine should an outbreak of a SARS-CoV infection reappear in human population. In this study, we tested four DNA-vaccine constructs: (1) pLL70, containing cDNA for the SARS-CoV spike (S) gene; (2) pcDNA-SS, containing codon-optimized S gene for SARS-CoV S protein (residues 12-1255) fused with a leader sequence derived from the human CD5 gene; (3) pcDNA-St, containing the gene encoding the N-portion of the codon-optimized S gene (residues 12-532) with the CD5 leader sequence; (4) pcDNA-St-VP22C, containing the gene encoding the N-portion of the codon-optimized S protein with the CD5 leader sequence fused with the C-terminal 138 amino acids of the bovine herpesvirus-1 (BHV-1) major tegument protein VP22. Each of these plasmids was intradermally administered to C57BL/6 mice in three separate immunizations. Analysis of humoral and cellular immune responses in immunized mice demonstrated that pcDNA-SS and pcDNA-St-VP22C are the most immunogenic SARS vaccine candidates.

  8. A DNA Fingerprint Simulation: Different, Simple, Effective.

    ERIC Educational Resources Information Center

    Reed, Eileen

    2001-01-01

    Discusses the impact of biotechnology (i.e., the use of DNA profiling in the courtroom) on today's society. Presents a hands-on activity for DNA profiling simulation that actively involves students. (YDS)

  9. Crystal structure of a DNA catalyst.

    PubMed

    Ponce-Salvatierra, Almudena; Wawrzyniak-Turek, Katarzyna; Steuerwald, Ulrich; Höbartner, Claudia; Pena, Vladimir

    2016-01-14

    Catalysis in biology is restricted to RNA (ribozymes) and protein enzymes, but synthetic biomolecular catalysts can also be made of DNA (deoxyribozymes) or synthetic genetic polymers. In vitro selection from synthetic random DNA libraries identified DNA catalysts for various chemical reactions beyond RNA backbone cleavage. DNA-catalysed reactions include RNA and DNA ligation in various topologies, hydrolytic cleavage and photorepair of DNA, as well as reactions of peptides and small molecules. In spite of comprehensive biochemical studies of DNA catalysts for two decades, fundamental mechanistic understanding of their function is lacking in the absence of three-dimensional models at atomic resolution. Early attempts to solve the crystal structure of an RNA-cleaving deoxyribozyme resulted in a catalytically irrelevant nucleic acid fold. Here we report the crystal structure of the RNA-ligating deoxyribozyme 9DB1 (ref. 14) at 2.8 Å resolution. The structure captures the ligation reaction in the post-catalytic state, revealing a compact folding unit stabilized by numerous tertiary interactions, and an unanticipated organization of the catalytic centre. Structure-guided mutagenesis provided insights into the basis for regioselectivity of the ligation reaction and allowed remarkable manipulation of substrate recognition and reaction rate. Moreover, the structure highlights how the specific properties of deoxyribose are reflected in the backbone conformation of the DNA catalyst, in support of its intricate three-dimensional organization. The structural principles underlying the catalytic ability of DNA elucidate differences and similarities in DNA versus RNA catalysts, which is relevant for comprehending the privileged position of folded RNA in the prebiotic world and in current organisms.

  10. The nuclear retention of transcription factor FOXO3a correlates with a DNA damage response and increased glutamine synthetase expression by astrocytes suggesting a neuroprotective role in the ageing brain.

    PubMed

    Fluteau, Adeline; Ince, Paul G; Minett, Thais; Matthews, Fiona E; Brayne, Carol; Garwood, Claire J; Ratcliffe, Laura E; Morgan, Sarah; Heath, Paul R; Shaw, Pamela J; Wharton, Stephen B; Simpson, Julie E

    2015-11-16

    The accumulation of reactive oxygen species leading to oxidative damage and cell death plays an important role in a number of neurodegenerative disorders. FOXO3a, the main isoform of FOXO transcription factors, mediates the cellular response to oxidative stress by regulating the expression of genes involved in DNA repair and glutamine metabolism, including glutamine synthetase (GS). Immunohistochemical investigation of the population-based neuropathology cohort of the Medical Research Council's Cognitive Function and Ageing Study (MRC CFAS) demonstrates that nuclear retention of FOXO3a significantly correlates with a DNA damage response and with GS expression by astrocytes. Furthermore, we show that GS expression correlates with increasing Alzheimer-type pathology in this ageing cohort. Our findings suggest that in response to oxidative stress, the nuclear retention of FOXO3a in astrocytes upregulates expression of GS as a neuroprotective mechanism. However, the activity of GS may be compromised by increasing levels of oxidative stress in the ageing brain resulting in dysfunctional enzyme activity, neuronal excitotoxic damage and cognitive impairment.

  11. The nuclear retention of transcription factor FOXO3a correlates with a DNA damage response and increased glutamine synthetase expression by astrocytes suggesting a neuroprotective role in the ageing brain

    PubMed Central

    Fluteau, Adeline; Ince, Paul G.; Minett, Thais; Matthews, Fiona E.; Brayne, Carol; Garwood, Claire J.; Ratcliffe, Laura E.; Morgan, Sarah; Heath, Paul R.; Shaw, Pamela J.; Wharton, Stephen B.; Simpson, Julie E.

    2015-01-01

    The accumulation of reactive oxygen species leading to oxidative damage and cell death plays an important role in a number of neurodegenerative disorders. FOXO3a, the main isoform of FOXO transcription factors, mediates the cellular response to oxidative stress by regulating the expression of genes involved in DNA repair and glutamine metabolism, including glutamine synthetase (GS). Immunohistochemical investigation of the population-based neuropathology cohort of the Medical Research Council’s Cognitive Function and Ageing Study (MRC CFAS) demonstrates that nuclear retention of FOXO3a significantly correlates with a DNA damage response and with GS expression by astrocytes. Furthermore, we show that GS expression correlates with increasing Alzheimer-type pathology in this ageing cohort. Our findings suggest that in response to oxidative stress, the nuclear retention of FOXO3a in astrocytes upregulates expression of GS as a neuroprotective mechanism. However, the activity of GS may be compromised by increasing levels of oxidative stress in the ageing brain resulting in dysfunctional enzyme activity, neuronal excitotoxic damage and cognitive impairment. PMID:26455863

  12. The caspase-independent algorithm of programmed cell death in Leishmania induced by baicalein: the role of LdEndoG, LdFEN-1 and LdTatD as a DNA 'degradesome'.

    PubMed

    BoseDasgupta, S; Das, B B; Sengupta, S; Ganguly, A; Roy, A; Dey, S; Tripathi, G; Dinda, B; Majumder, H K

    2008-10-01

    In the post-genomic perspective, the quest of programmed cell death (PCD) mechanisms in kinetoplastid parasites lies in the identification and characterization of cell death executer proteins. Here, we show that baicalein (BLN), a potent topoisomerase IB inhibitor, generates an oxidative stress in the parasites leading to altered physiological and morphological parameters, which are characteristic of PCD. For the first time we elucidate that, caspase-independent activation of a novel effector molecule, endonuclease G (LdEndoG), mediates BLN-induced cell death. Functional characterization of LdEndoG identifies Flap endonuclease-1 (LdFEN-1) and LdTatD-like nuclease as other effector molecules. BLN treatment translocates LdEndoG from mitochondria to nucleus, where it forms separate complexes with LdFEN-1 and LdTatD to constitute a DNA 'degradesome' unique to these parasites. Conditional antisense knockdown of LdEndoG provides protection against PCD. This knowledge paves the path toward a better understanding of the PCD pathway in simpler systems, which could be exploited in anti-leishmanial chemotherapy.

  13. Protective immunity against acute toxoplasmosis in BALB/c mice induced by a DNA vaccine encoding Toxoplasma gondii 10 kDa excretory-secretory antigen (TgESA10).

    PubMed

    Wang, Shuai; Wang, Yujian; Sun, Xiaoni; Zhang, Zhenchao; Liu, Tingqi; Gadahi, Javaid Ali; Xu, Lixin; Yan, Ruofeng; Song, Xiaokai; Li, Xiangrui

    2015-11-30

    Toxoplasma gondii 10 kDa excretory-secretory antigen (TgESA10) is involved in the early stages of host invasion. The aim of this study was to evaluate the immune protective efficacy of a DNA vaccine encoding TgESA10 gene against acute T. gondii infection in mice. The gene sequence encoding TgESA10 was inserted into the eukaryotic expression vector pVAX I, and the efficacy of intramuscular vaccination of BALB/c mice with pVAX-ESA10 was analyzed. Mice immunized with pVAX-ESA10 elicited high titers of total IgG, IgG1, IgG2a, IgA and IgM antibodies, while IgE showed no changes. Analysis of cytokine profiles revealed significant increases of IFN-γ, IL-4 and IL-17, while no significant changes were detected in TGF-β1. Additionally, we found that pVAX-ESA10 enhanced the activation of CD4(+) and CD8(+) T cells and the expression of MHC-I and MHC-II molecules in spleen in mice. Immunization with pVAX-ESA10 significantly prolonged survival time (14.3 ± 1.7 days) after challenge infection with the virulent T. gondii RH strain, compared with the control groups which died within 8 days. These results suggested that TgESA10 DNA vaccine could trigger strong humoral and cellular responses and induce partial protection against acute toxoplasmosis.

  14. Comparative assessment of a DNA and protein Leishmania donovani gamma glutamyl cysteine synthetase vaccine to cross-protect against murine cutaneous leishmaniasis caused by L. major or L. mexicana infection.

    PubMed

    Campbell, S A; Alawa, J; Doro, B; Henriquez, F L; Roberts, C W; Nok, A; Alawa, C B I; Alsaadi, M; Mullen, A B; Carter, K C

    2012-02-08

    Leishmaniasis is a major health problem and it is estimated that 12 million people are currently infected. A vaccine which could cross-protect people against different Leishmania spp. would facilitate control of this disease as more than one species of Leishmania may be present. In this study the ability of a DNA vaccine, using the full gene sequence for L. donovani gamma glutamyl cysteine synthetase (γGCS) incorporated in the pVAX vector (pVAXγGCS), and a protein vaccine, using the corresponding recombinant L. donovani γGCS protein (LdγGCS), to protect against L. major or L. mexicana infection was evaluated. DNA vaccination gave transient protection against L. major and no protection against L. mexicana despite significantly enhancing specific antibody titres in vaccinated infected mice compared to infected controls. Vaccination with the LdγGCS protected against both species but only if the protein was incorporated into non-ionic surfactant vesicles for L. mexicana. The results of this study indicate that a L. donovani γGCS vaccine could be used to vaccinate against more than one Leishmania species but only if the recombinant protein is used.

  15. A DNA vaccine encoding MPB83 from Mycobacterium bovis reduces M. bovis dissemination to the kidneys of mice and is expressed in primary cell cultures of the European badger (Meles meles).

    PubMed

    Chambers, M A; Stagg, D; Gavier-Widén, D; Lowrie, D; Newell, D; Hewinson, R G

    2001-10-01

    Nucleic acid (DNA) vaccination against tuberculosis in the European badger (Meles meles) is one approach to addressing the escalating problem of bovine tuberculosis in Great Britain. The aim of vaccination is to reduce the burden of tuberculosis within the badger population and the shedding of Mycobacterium bovis to levels that would break the transmission of infection to cattle. To this end, the vaccine would be required to limit the amount of disseminated tuberculosis in the badger, especially dissemination to the kidney from where M. bovis can be shed in the urine. A promising candidate DNA vaccine encoding a 26 kDa major antigen (MPB83) of M. bovis was evaluated in a mouse model of disseminated M. bovis infection. Using the DNA vaccine, protection against infection of the kidney was found to be greater than that achieved with the current live vaccine, Bacille Calmette-Guerin (BCG). Kidney tissue and skeletal muscle from the badger was used to derive primary cell cultures in which to examine the expression of MPB83 following transfection with the DNA vaccine. Kidney cortex gave rise to a monotypic culture of epithelial cells whilst the muscle gave rise to a mixed culture of fibroblasts and myoblasts. During culture the myoblasts differentiated into multinucleated myotubes, verified by immunofluorescent detection of mammalian desmin. Successful expression of MPB83 by transfected epithelial and myotube cells was confirmed by immunofluorescence using a monoclonal antibody specific to the protein. These observations fulfil the early requirements for the development of a DNA vaccine for badger tuberculosis.

  16. Use of S-[2,3-bispalmitoyiloxy-(2R)-propyl]-R-cysteinyl-amido-monomethoxy polyethylene glycol as an adjuvant improved protective immunity associated with a DNA vaccine encoding Cu,Zn superoxide dismutase of Brucella abortus in mice.

    PubMed

    Retamal-Díaz, Angello; Riquelme-Neira, Roberto; Sáez, Darwin; Rivera, Alejandra; Fernández, Pablo; Cabrera, Alex; Guzmán, Carlos A; Oñate, Angel

    2014-11-01

    This study was conducted to evaluate the immunogenicity and protective efficacy of a DNA vaccine encoding Brucella abortus Cu,Zn superoxide dismutase (SOD) using the Toll-like receptor 2/6 agonist S-[2,3-bispalmitoyiloxy-(2R)-propyl]-R-cysteinyl-amido-monomethoxy polyethylene glycol (BPPcysMPEG) as an adjuvant. Intranasal coadministration of BPPcysMPEG with a plasmid carrying the SOD-encoding gene (pcDNA-SOD) into BALB/c mice elicited antigen-specific humoral and cellular immune responses. Humoral responses were characterized by the stimulation of IgG2a and IgG1 and by the presence of SOD-specific secretory IgA in nasal and bronchoalveolar lavage fluids. Furthermore, T-cell proliferative responses and increased production of gamma interferon were also observed upon splenocyte restimulation with recombinant SOD. Cytotoxic responses were also stimulated, as demonstrated by the lysis of RB51-SOD-infected J774.A1 macrophages by cells recovered from immunized mice. The pcDNA-SOD/BPPcysMPEG formulation induced improved protection against challenge with the virulent strain B. abortus 2308 in BALB/c mice over that provided by pcDNA-SOD, suggesting the potential of this vaccination strategy against Brucella infection.

  17. Suppression of dexamethasone-stimulated DNA synthesis in an oncogene construct containing rat cell line by a DNA site-oriented ligand of poly-ADP-ribose polymerase: 6-amino-1,2-benzopyrone

    SciTech Connect

    Kirsten, E.; Bauer, P.I.; Kun, E. San Francisco State Univ., CA )

    1991-03-01

    The cellular inhibitory effects of 6-amino-1,2-benzopyrone (6-ABP), a DNA site-specific ligand of adenosine diphosphoribosyl transferase (ADPRT), were determined in a dexamethasone-sensitive EJ-ras gene construct containing cell line (14C cells). Dexamethansone in vitro transforms these cells to a tumorigenic phenotype and also stimulates cell replication. AT a nontoxic concentration 6-ABP treatment of intact cells for 4 days inhibits the dexamethasone-stimulated increment of cellular DNA content, depresses replicative DNA synthesis as assayed by thymidine incorporation to the level of cells that were not exposed to dexamethasone, and in permeabilized cells reduces the dexamethasone-stimulated increase of deoxyribonucleotide incorporation into DNA to the level of untreated cells. In situ pulse labeling of cells pretreated with 6-ABP indicated an inhibition of DNA synthesis at a stage prior to the formation of the 10-kb intermediate species. Neither dexamethasone nor the drug influenced the cellular quantity of ADPRT molecules, tested immunochemically.

  18. Nucleotide sequence of a Proteus mirabilis DNA fragment homologous to the 60K-rnpA-rpmH-dnaA-dnaN-recF-gyrB region of Escherichia coli.

    PubMed

    Skovgaard, O

    1990-09-01

    A 6.5-kb DNA fragment from Proteus mirabilis hybridized to the Escherichia coli dnaA gene. This DNA fragment was cloned and the nucleotide (nt) sequence determined. The fragment is homologous to a region of the E. coli chromosome containing a part of the gene encoding a 60-kDa membrane-associated protein (60K), the rnpA-rpmH-dnaA-dnaN-recF genes, and the N-terminal part of the gyrB gene. The degree of homology is variable: the amino-acid (aa) sequence of a part of the 60K protein and a part of the DnaA protein is only minimally conserved, whereas the C-terminal 148 aa of DnaA are identical in the two species. The conservation of the nt sequence between the rnpA gene and the gene encoding the 60K protein suggests that this region encodes a hitherto unrecognized protein. The ORF for this protein partially overlaps the 3' end of the rnpA structural gene, and the degree of conservation suggests that this gene is important for these bacteria.

  19. Protective effect of a DNA vaccine containing an open reading frame with homology to an ABC-type transporter present in the genomic island 3 of Brucella abortus in BALB/c mice.

    PubMed

    Riquelme-Neira, Roberto; Retamal-Díaz, Angello; Acuña, Francisca; Riquelme, Pablo; Rivera, Alejandra; Sáez, Darwin; Oñate, Angel

    2013-08-12

    The immunogenicity of a DNA vaccine containing an open reading frame (ORF) of genomic island 3 (GI-3), specific for Brucella abortus and Brucella melitensis, has been examined. Intramuscular injection of plasmid DNA carrying the open reading frame with homology to an ABC-type transporter (pV278a) into BALB/c mice elicited both humoral and cellular immune responses. Mice injected with pV278a had a dominant immunoglobulin G2a (IgG2a) response. This DNA vaccine elicited a T-cell-proliferative response and induced significant levels of interferon gamma (INF-γ) upon restimulation with recombinant 278a protein. Upon stimulation with an appropriate recombinant protein or crude Brucella protein, the vaccine did not induce IL-4, suggesting a typical T-helper (TH1) response. Furthermore, the vaccine induced protection in BALB/c mice when challenged with the virulent strain Brucella abortus 2308. Taken together, these data suggest that DNA vaccination offers an improved delivery of the homologous of an ABC-type transporter antigen, and provides the first evidence of a protective effect of this antigen in the construction of vaccines against B. abortus.

  20. Suppression of hLRH-1 mediated by a DNA vector-based RNA interference results in cell cycle arrest and induction of apoptosis in hepatocellular carcinoma cell BEL-7402

    SciTech Connect

    Wang Shuiliang; Lan Fenghua; Huang Lianghu; Dong Lihong; Zhu Zhongyong; Li Zonghai; Xie Youhua; Fu Jiliang . E-mail: fu825@mail.tongji.edu.cn

    2005-08-05

    RNA interference (RNAi) is the process by which double-stranded RNA directs sequence-specific degradation of mRNA. A DNA vector-based approach has been shown to be able to trigger RNA interference in mammalian cells successfully. LRH-1 is an orphan nuclear receptor predominantly expressed in tissues of endodermal origin, where it controls development and cholesterol homeostasis. In the present study, we demonstrated that the expression of hLRH-1 and cyclin E1 in BEL-7402 cells could be suppressed by up to {approx}80% via DNA vector-based RNA interference. The suppression of hLRH-1 resulted in cell cycle arrest mediated by the down-regulation of cyclin E1. Induction of apoptosis and down-regulation of Gadd45{beta} were also shown in hLRH-1 knock down BEL-7402 cells. These results, together with the findings that Gadd45{beta} remained unchanged in cyclin E1 RNAi cells, suggested that the induction of apoptosis by knock down of hLRH-1 was closely related to the down-regulation of Gadd45{beta}.

  1. Evaluation of a DNA vaccine candidate expressing prM-E-NS1 antigens of dengue virus serotype 1 with or without granulocyte-macrophage colony-stimulating factor (GM-CSF) in immunogenicity and protection.

    PubMed

    Zheng, Qun; Fan, Dongying; Gao, Na; Chen, Hui; Wang, Juan; Ming, Ying; Li, Jieqiong; An, Jing

    2011-01-17

    Dengue is one of the most important mosquito-borne viral diseases. In past years, although considerable effort has been put into the development of a vaccine, there is currently no licensed dengue vaccine. In this study, we constructed DNA vaccines that carried the prM-E-NS1 genes of dengue virus serotype 1 (DV1) with or without the granulocyte-macrophage colony-stimulating factor (GM-CSF) gene, an attractive DNA vaccine adjuvant. Immunization with the plasmid pCAG-DV1/E/NS1, which expresses viral prM-E-NS1, or the bicistronic plasmid pCAG-DV1-GM, which co-expresses viral prM-E-NS1 and GM-CSF, resulted in long-term IgG response, high levels of splenocyte-secreted interferon-γ and interleukin-2, strong cytotoxic T lymphocyte activity and sufficient protection in the DV1-challenged mice. This suggested that both humoral and cellular immune responses were induced by the immunizations and that they played important roles in protection against the DV1 challenge. Interestingly, the magnitude, quality and protective capacity of the immune responses induced by immunization with pCAG-DV1/E/NS1 or pCAG-DV1-GM seemed stronger than those induced by pCAG-DV1/E (expressing viral prM-E alone). Taken together, we demonstrated that prM/E plus NS1 would be a suitable solution for the development of a DNA vaccine against DV.

  2. Specific interactions with TBP and TFIIB in vitro suggest that 14-3-3 proteins may participate in the regulation of transcription when part of a DNA binding complex.

    PubMed

    Pan, S; Sehnke, P C; Ferl, R J; Gurley, W B

    1999-08-01

    The 14-3-3 family of multifunctional proteins is highly conserved among animals, plants, and yeast. Several studies have shown that these proteins are associated with a G-box DNA binding complex and are present in the nucleus in several plant and animal species. In this study, 14-3-3 proteins are shown to bind the TATA box binding protein (TBP), transcription factor IIB (TFIIB), and the human TBP-associated factor hTAF(II)32 in vitro but not hTAF(II)55. The interactions with TBP and TFIIB were highly specific, requiring amino acid residues in the box 1 domain of the 14-3-3 protein. These interactions do not require formation of the 14-3-3 dimer and are not dependent on known 14-3-3 recognition motifs containing phosphoserine. The 14-3-3-TFIIB interaction appears to occur within the same domain of TFIIB that binds the human herpes simplex virus transcriptional activator VP16, because VP16 and 14-3-3 were able to compete for interaction with TFIIB in vitro. In a plant transient expression system, 14-3-3 was able to activate GAL4-dependent beta-glucuronidase reporter gene expression at low levels when translationally fused with the GAL4 DNA binding domain. The in vitro binding with general transcription factors TBP and TFIIB together with its nuclear location provide evidence supporting a role for 14-3-3 proteins as transcriptional activators or coactivators when part of a DNA binding complex.

  3. A DNA Vaccine Encoding the Enterohemorragic Escherichia coli Shiga-Like Toxin 2 A2 and B Subunits Confers Protective Immunity to Shiga Toxin Challenge in the Murine Model▿

    PubMed Central

    Bentancor, Leticia V.; Bilen, Marcos; Brando, Romina J. Fernández; Ramos, María Victoria; Ferreira, Luis C. S.; Ghiringhelli, Pablo D.; Palermo, Marina S.

    2009-01-01

    Production of verocytotoxin or Shiga-like toxin (Stx), particularly Stx2, is the basis of hemolytic uremic syndrome, a frequently lethal outcome for subjects infected with Stx2-producing enterohemorrhagic Escherichia coli (EHEC) strains. The toxin is formed by a single A subunit, which promotes protein synthesis inhibition in eukaryotic cells, and five B subunits, which bind to globotriaosylceramide at the surface of host cells. Host enzymes cleave the A subunit into the A1 peptide, endowed with N-glycosidase activity to the 28S rRNA, and the A2 peptide, which confers stability to the B pentamer. We report the construction of a DNA vaccine (pStx2ΔAB) that expresses a nontoxic Stx2 mutated form consisting of the last 32 amino acids of the A2 sequence and the complete B subunit as two nonfused polypeptides. Immunization trials carried out with the DNA vaccine in BALB/c mice, alone or in combination with another DNA vaccine encoding granulocyte-macrophage colony-stimulating factor, resulted in systemic Stx-specific antibody responses targeting both A and B subunits of the native Stx2. Moreover, anti-Stx2 antibodies raised in mice immunized with pStx2ΔAB showed toxin neutralization activity in vitro and, more importantly, conferred partial protection to Stx2 challenge in vivo. The present vector represents the second DNA vaccine so far reported to induce protective immunity to Stx2 and may contribute, either alone or in combination with other procedures, to the development of prophylactic or therapeutic interventions aiming to ameliorate EHEC infection-associated sequelae. PMID:19176691

  4. A DNA vaccine encoding the viral hemorrhagic septicemia virus genotype IVb glycoprotein confers protection in muskellunge (Esox masquinongy), rainbow trout (Oncorhynchus mykiss), brown trout (Salmo trutta), and lake trout (Salvelinus namaycush).

    PubMed

    Standish, Isaac F; Millard, Elena V; Brenden, Travis O; Faisal, Mohamed

    2016-12-02

    The viral hemorrhagic septicemia virus (VHSV) is one of the most serious fish pathogens. In 2003, a novel sublineage (genotype IVb) of this deadly virus emerged in the Great Lakes basin causing serious fish kills. We have previously demonstrated that a DNA plasmid (pcDNA), containing a cytomegalovirus (CMV) promoter and the viral hemorrhagic septicemia virus (VHSV) genotype IVb glycoprotein (G) gene insert (designated pVHSivb-G) confers moderate protection in muskellunge (Esox masquinongy), a highly susceptible species upon challenge. In order to achieve optimal protection, we investigated a number of factors including the incubation time [i.e. the number of degree days (° days)] before challenge, and viral challenge dose and route. Additionally, we tested if pVHSivb-G provides protection against VHSV-IVb to less susceptible salmonids such as rainbow trout (Oncorhynchus mykiss), brown trout (Salmo trutta) and lake trout (Salvelinus namaycush). An increase in the period lapsed between vaccination and challenge to 1880° days resulted in 95% relative percent protection (RPS) in muskellunge following a single administration of the pVHSivb-G plasmid and viral challenge. An RPS of 100% for muskellunge was achieved with a longer incubation period (2400° days) and in conjunction with a booster dose of the plasmid. The pVHSivb-G vaccine also elicited significant protection in all three salmonid species, reaching 100% RPS in lake trout following an incubation period of 1001° days prior to viral challenge. Vaccination with pVHSivb-G was also associated with the development of significant levels of circulating VHSV-binding antibodies in muskellunge as measured by indirect ELISA, which reached peak levels 6-7 weeks post-vaccination. Viral shedding in vaccinated survivors was minimal and of transient nature. The study shows that the pVHSivb-G plasmid can elicit a protective response against the wild virus strain in a range of species important in recreational and commercial

  5. Preparation of a DNA-bound [Ru(bpy)2(mbpibH2)]2+ film and its two-mode luminescence tuning by copper(II) ions and EDTA

    NASA Astrophysics Data System (ADS)

    Gan, Gui-Lian; Chao, Hui; Ji, Shi-Bo; Chen, Lin-Lin; Li, Hong

    2012-11-01

    An imidazophenanthroline-containing ruthenium(II) complex [Ru(bpy)2(mbpibH2)]2+ (bpy = 2,2'-bipyridine, mbpibH2 = 1,3-bis([1,10]phenanthroline[5,6-d]imidazol-2-yl)benzene) can bind DNA through groove-binding and/or non-classical intercalation modes, revealed by spectrophotometric methods, viscosity measurements and variable ionic strength experiments. On the basis of binding interactions between cationic [Ru(bpy)2(mbpibH2)]2+ and anionic DNA at a molar ratio of 1:1, a yellow transparent cast film has been assembled on an indium-tin oxide (ITO) surface using a solution-based self-standing method. The prepared DNA-[Ru(bpy)2(mbpibH2)]2+ film shows a bi-exponential luminescence decay with τ1 = 62.1 ns (8.0%) and τ2 = 594.5 ns (92.0%), whose lifetimes become much shorter than those of DNA-bound [Ru(bpy)2(mbpibH2)]2+ in buffer solutions. The Ru(II) complex with a free bi-dentate coordination site in the DNA cast film shows tunable luminescence, quenched dynamically by Cu2+ and restored by using EDTA to eliminate two modes of Cu2+-binding. The results from this study provide a significant foundation for better understanding the fabrication and modulation of a DNA-based solid luminescence device using the Ru(II) complexes as DNA-concentrating and signal-sensing agents.

  6. Development of a DNA vaccine for chicken infectious anemia and its immunogenicity studies using high mobility group box 1 protein as a novel immunoadjuvant indicated induction of promising protective immune responses.

    PubMed

    Sawant, Pradeep Mahadev; Dhama, Kuldeep; Rawool, Deepak Bhiva; Wani, Mohd Yaqoob; Tiwari, Ruchi; Singh, Shambhu Dayal; Singh, Raj Kumar

    2015-01-03

    Chicken infectious anaemia (CIA) is an economically important and emerging poultry disease reported worldwide. Current CIA vaccines have limitations like, the inability of the virus to grow to high titres in embryos/cell cultures, possession of residual pathogenicity and a risk of reversion to virulence. In the present study, a DNA vaccine, encoding chicken infectious anaemia virus (CIAV) VP1 and VP2 genes, was developed and co-administered with truncated chicken high mobility group box 1 (HMGB1ΔC) protein in young chicks for the evaluation of vaccine immune response. CIAV VP1 and VP2 genes were cloned in pTARGET while HMGB1ΔC in PET32b vector. In vitro expression of these gene constructs was evaluated by Western blotting. Further, recombinant HMGB1ΔC was evaluated for its biological activity. The CIAV DNA vaccine administration in specific pathogen free chicks resulted in moderately protective ELISA antibody titres in the range of 4322.87 ± 359.72 to 8288.19 ± 136.38, increased CD8(+) cells, and a higher titre was observed by co-administration of novel adjuvant (HMGB1ΔC) and booster immunizations. The use of vaccine with adjuvant showed achieving antibody titres nearly 8500, titre considered as highly protective, which indicates that co-immunization of HMGB1ΔC may have a strong adjuvant activity on CIAV DNA vaccine induced immune responses. The able potential of HMGB1 protein holding strong adjuvant activity could be exploited further with trials with vaccines for other important pathogens for achieving the required protective immune responses.

  7. TRAV gene expression in PBMCs and TILs in patients with breast cancer analyzed by a DNA melting curve (FQ-PCR) technique for TCR α chain CDR3 spectratyping.

    PubMed

    He, X Y; Yang, W M; Tang, W T; Ma, R; Sun, Y P; Wang, P; Yao, X S

    2012-01-01

    To explore the expression of the TRAV gene in peripheral blood mononuclear cells (PBMCs) and in tumor-infiltrating lymphocytes (TILs) in the patients with breast cancer using a DNA melting curve (FQ-PCR) technique for T cell receptor (TCR) alpha chain CDR3 spectratyping. Peripheral blood samples and tissue samples were obtained from thirty breast cancer patients. Total RNA was extracted from PBMCs and tumor tissues and then reverse transcribed into cDNA. FQ-PCR was used to amplify the human TCR alpha chain CDR3 region with the primers to the TRAV and TRAC genes. TCR alpha chain CDR3 spectratyping and partial CDR3 sequencing were used to determine use of TRAV gene product in T cell responses. TCR alpha CDR3 spectratyping showed preferential usage of certain TRAV genes in the PBMCs and TILs of all patients with breast cancer. The frequencies of TRAV1.1, TRAV9, and TRAV29 exceeded 30% in PBMCs and the frequencies of TRAV1.1 and TRAV22 exceeded 30% in TILs. More than three quarters of the patients (23/30) overexpressed the same gene in both PBMCs and TILs; for example, patient-1 highly expressed TRAV9 in the PBMCs and TILs. Patients with positive or negative tumor markers of estrogen receptor (ER), progesterone receptor (PR), pS2, C-erbB-2, nm23, P53, and Ki-67 showed no significant common TRAV gene expression, but some TRAV gene preferential usage frequencies exceeded 20%. For example, five of seven patients positive for ER had high levels of expression of TRAV1.1 and TRAV3. Finally, the amino acid sequence of TCR CDR3 region showed some common motifs in some of the patients. TRAV gene expression was complex and diverse in the patients with breast cancer. The TRAV gene usage may be closely related to the diversity of breast tumor antigens and the differential immune responses observed in individual patients. Research into the immunological mechanism of T cells may provide guidance for individual T cell-directed therapy for breast cancer.

  8. Comparison of Immunogenicity in Rhesus Macaques of Transmitted-Founder, HIV-1 Group M Consensus, and Trivalent Mosaic Envelope Vaccines Formulated as a DNA Prime, NYVAC, and Envelope Protein Boost

    PubMed Central

    Hulot, Sandrine L.; Korber, Bette; Giorgi, Elena E.; Vandergrift, Nathan; Saunders, Kevin O.; Balachandran, Harikrishnan; Mach, Linh V.; Lifton, Michelle A.; Pantaleo, Giuseppe; Tartaglia, Jim; Phogat, Sanjay; Jacobs, Bertram; Kibler, Karen; Perdiguero, Beatriz; Gomez, Carmen E.; Esteban, Mariano; Rosati, Margherita; Felber, Barbara K.; Pavlakis, George N.; Parks, Robert; Lloyd, Krissey; Sutherland, Laura; Scearce, Richard; Letvin, Norman L.; Seaman, Michael S.; Alam, S. Munir; Montefiori, David; Liao, Hua-Xin; Haynes, Barton F.

    2015-01-01

    ABSTRACT An effective human immunodeficiency virus type 1 (HIV-1) vaccine must induce protective antibody responses, as well as CD4+ and CD8+ T cell responses, that can be effective despite extraordinary diversity of HIV-1. The consensus and mosaic immunogens are complete but artificial proteins, computationally designed to elicit immune responses with improved cross-reactive breadth, to attempt to overcome the challenge of global HIV diversity. In this study, we have compared the immunogenicity of a transmitted-founder (T/F) B clade Env (B.1059), a global group M consensus Env (Con-S), and a global trivalent mosaic Env protein in rhesus macaques. These antigens were delivered using a DNA prime-recombinant NYVAC (rNYVAC) vector and Env protein boost vaccination strategy. While Con-S Env was a single sequence, mosaic immunogens were a set of three Envs optimized to include the most common forms of potential T cell epitopes. Both Con-S and mosaic sequences retained common amino acids encompassed by both antibody and T cell epitopes and were central to globally circulating strains. Mosaics and Con-S Envs expressed as full-length proteins bound well to a number of neutralizing antibodies with discontinuous epitopes. Also, both consensus and mosaic immunogens induced significantly higher gamma interferon (IFN-γ) enzyme-linked immunosorbent spot assay (ELISpot) responses than B.1059 immunogen. Immunization with these proteins, particularly Con-S, also induced significantly higher neutralizing antibodies to viruses than B.1059 Env, primarily to tier 1 viruses. Both Con-S and mosaics stimulated more potent CD8-T cell responses against heterologous Envs than did B.1059. Both antibody and cellular data from this study strengthen the concept of using in silico-designed centralized immunogens for global HIV-1 vaccine development strategies. IMPORTANCE There is an increasing appreciation for the importance of vaccine-induced anti-Env antibody responses for preventing HIV-1

  9. Interferon gamma rapidly induces in human monocytes a DNA-binding factor that recognizes the gamma response region within the promoter of the gene for the high-affinity Fc gamma receptor.

    PubMed Central

    Wilson, K C; Finbloom, D S

    1992-01-01

    Interferon gamma (IFN-gamma) transcriptionally activates several early-response genes in monocytes that are important for the ultimate phenotype of the activated macrophage. One of these genes is the high-affinity Fc receptor for IgG (Fc gamma RI). Recently, Pearse et al. [Pearse, R.N., Feinman, R. & Ravetch, J. V. (1991) Proc. Natl. Acad. Sci. USA 88, 11305-11309] defined within the promoter region of the Fc gamma RI gene an element, the gamma response region, which was necessary for IFN-gamma-induced enhancement of Fc gamma RI. In this report we describe the induction by IFN-gamma of a DNA-binding factor, FcRF gamma (Fc gamma RI DNA-binding factor, IFN-gamma induced), that specifically recognizes the gamma response region element. Electrophoretic mobility shift assays (EMSAs) demonstrated the presence of FcRF gamma in human monocytes within 1 min after exposure to IFN-gamma. On EMSA, FcRF gamma consisted of two complexes termed FcRF gamma 1 and FcRF gamma 2. The nuclear concentration of FcRF gamma rapidly increased, peaked at 15 min, and then fell after 1-2 hr. Dose-response studies revealed (i) as little as 0.05 ng of IFN-gamma per ml induced FcRF gamma, (ii) maximum activation occurred at 1 ng/ml, and (iii) steady-state levels of Fc gamma RI mRNA closely paralleled that of FcRF gamma. Since FcRF gamma was activated in cells normally not expressing Fc gamma RI RNA, other regulatory mechanisms must control Fc gamma RI-restricted tissue expression. Activation of FcRF gamma by IFN-gamma was inhibited by pretreatment with 500 nM staurosporin and 25 microM phenyl arsine oxide. These data suggest that a kinase and possibly a phosphatase activity are required for IFN-gamma-induced signaling of FcRF gamma in monocytes. Images PMID:1334553

  10. Comparison of Immunogenicity in Rhesus Macaques of Transmitted-Founder, HIV-1 Group M Consensus, and Trivalent Mosaic Envelope Vaccines Formulated as a DNA Prime, NYVAC, and Envelope Protein Boost.

    PubMed

    Hulot, Sandrine L; Korber, Bette; Giorgi, Elena E; Vandergrift, Nathan; Saunders, Kevin O; Balachandran, Harikrishnan; Mach, Linh V; Lifton, Michelle A; Pantaleo, Giuseppe; Tartaglia, Jim; Phogat, Sanjay; Jacobs, Bertram; Kibler, Karen; Perdiguero, Beatriz; Gomez, Carmen E; Esteban, Mariano; Rosati, Margherita; Felber, Barbara K; Pavlakis, George N; Parks, Robert; Lloyd, Krissey; Sutherland, Laura; Scearce, Richard; Letvin, Norman L; Seaman, Michael S; Alam, S Munir; Montefiori, David; Liao, Hua-Xin; Haynes, Barton F; Santra, Sampa

    2015-06-01

    An effective human immunodeficiency virus type 1 (HIV-1) vaccine must induce protective antibody responses, as well as CD4(+) and CD8(+) T cell responses, that can be effective despite extraordinary diversity of HIV-1. The consensus and mosaic immunogens are complete but artificial proteins, computationally designed to elicit immune responses with improved cross-reactive breadth, to attempt to overcome the challenge of global HIV diversity. In this study, we have compared the immunogenicity of a transmitted-founder (T/F) B clade Env (B.1059), a global group M consensus Env (Con-S), and a global trivalent mosaic Env protein in rhesus macaques. These antigens were delivered using a DNA prime-recombinant NYVAC (rNYVAC) vector and Env protein boost vaccination strategy. While Con-S Env was a single sequence, mosaic immunogens were a set of three Envs optimized to include the most common forms of potential T cell epitopes. Both Con-S and mosaic sequences retained common amino acids encompassed by both antibody and T cell epitopes and were central to globally circulating strains. Mosaics and Con-S Envs expressed as full-length proteins bound well to a number of neutralizing antibodies with discontinuous epitopes. Also, both consensus and mosaic immunogens induced significantly higher gamma interferon (IFN-γ) enzyme-linked immunosorbent spot assay (ELISpot) responses than B.1059 immunogen. Immunization with these proteins, particularly Con-S, also induced significantly higher neutralizing antibodies to viruses than B.1059 Env, primarily to tier 1 viruses. Both Con-S and mosaics stimulated more potent CD8-T cell responses against heterologous Envs than did B.1059. Both antibody and cellular data from this study strengthen the concept of using in silico-designed centralized immunogens for global HIV-1 vaccine development strategies. There is an increasing appreciation for the importance of vaccine-induced anti-Env antibody responses for preventing HIV-1 acquisition. This

  11. A dnaN Plasmid Shuffle Strain for Rapid In Vivo Analysis of Mutant Escherichia coli β Clamps Provides Insight Into the Role of Clamp in umuDC-Mediated Cold Sensitivity

    PubMed Central

    Babu, Vignesh M. P.; Sutton, Mark D.

    2014-01-01

    The E. coli umuDC gene products participate in two temporally distinct roles: UmuD2C acts in a DNA damage checkpoint control, while UmuD'2C, also known as DNA polymerase V (Pol V), catalyzes replication past DNA lesions via a process termed translesion DNA synthesis. These different roles of the umuDC gene products are managed in part by the dnaN-encoded β sliding clamp protein. Co-overexpression of the β clamp and Pol V severely blocked E. coli growth at 30°C. We previously used a genetic assay that was independent of the ability of β clamp to support E. coli viability to isolate 8 mutant clamp proteins (βQ61K, βS107L, βD150N, βG157S, βV170M, βE202K, βM204K and βP363S) that failed to block growth at 30°C when co-overexpressed with Pol V. It was unknown whether these mutant clamps were capable of supporting E. coli viability and normal umuDC functions in vivo. The goals of this study were to answer these questions. To this end, we developed a novel dnaN plasmid shuffle assay. Using this assay, βD150N and βP363S were unable to support E. coli viability. The remaining 6 mutant clamps, each of which supported viability, were indistinguishable from β+ with respect to umuDC functions in vivo. In light of these findings, we analyzed phenotypes of strains overexpressing either β clamp or Pol V alone. The strain overexpressing β+, but not those expressing mutant β clamps, displayed slowed growth irrespective of the incubation temperature. Moreover, growth of the Pol V-expressing strain was modestly slowed at 30°, but not 42°C. Taken together, these results suggest the mutant clamps were identified due to their inability to slow growth rather than an inability to interact with Pol V. They further suggest that cold sensitivity is due, at least in part, to the combination of their individual effects on growth at 30°C. PMID:24896652

  12. A dnaN plasmid shuffle strain for rapid in vivo analysis of mutant Escherichia coli β clamps provides insight into the role of clamp in umuDC-mediated cold sensitivity.

    PubMed

    Babu, Vignesh M P; Sutton, Mark D

    2014-01-01

    The E. coli umuDC gene products participate in two temporally distinct roles: UmuD2C acts in a DNA damage checkpoint control, while UmuD'2C, also known as DNA polymerase V (Pol V), catalyzes replication past DNA lesions via a process termed translesion DNA synthesis. These different roles of the umuDC gene products are managed in part by the dnaN-encoded β sliding clamp protein. Co-overexpression of the β clamp and Pol V severely blocked E. coli growth at 30°C. We previously used a genetic assay that was independent of the ability of β clamp to support E. coli viability to isolate 8 mutant clamp proteins (βQ61K, βS107L, βD150N, βG157S, βV170M, βE202K, βM204K and βP363S) that failed to block growth at 30°C when co-overexpressed with Pol V. It was unknown whether these mutant clamps were capable of supporting E. coli viability and normal umuDC functions in vivo. The goals of this study were to answer these questions. To this end, we developed a novel dnaN plasmid shuffle assay. Using this assay, βD150N and βP363S were unable to support E. coli viability. The remaining 6 mutant clamps, each of which supported viability, were indistinguishable from β+ with respect to umuDC functions in vivo. In light of these findings, we analyzed phenotypes of strains overexpressing either β clamp or Pol V alone. The strain overexpressing β+, but not those expressing mutant β clamps, displayed slowed growth irrespective of the incubation temperature. Moreover, growth of the Pol V-expressing strain was modestly slowed at 30°, but not 42°C. Taken together, these results suggest the mutant clamps were identified due to their inability to slow growth rather than an inability to interact with Pol V. They further suggest that cold sensitivity is due, at least in part, to the combination of their individual effects on growth at 30°C.

  13. Prototyping nanorod control: A DNA double helix sheathed within a DNA six-helix bundle.

    PubMed

    Wang, Risheng; Liu, Wenyan; Seeman, Nadrian C

    2009-08-28

    The control of the structure of matter is a key goal of nanoscience. DNA is an exciting molecule for control because it forms programmable intermolecular interactions. Stiff DNA structures, such as the double crossover motif, the tensegrity triangle, and the six-helix bundle (6HB) have been used to produce periodic arrays of DNA components. The 6HB motif consists of six DNA double helices flanking an inner cavity whose diameter is similar to that of a double helix. This motif appears to be an excellent candidate to sheathe and control nanorods by inserting them into the cavity, and then to control the placement and orientation of the rod by controlling the DNA sheath. Here, we prototype this kind of control by using a seventh DNA double helix as the nanorod and fixing it inside the 6HB motif.

  14. A DNA vaccine encoding the 42 kDa C-terminus of merozoite surface protein 1 of Plasmodium falciparum induces antibody, interferon-gamma and cytotoxic T cell responses in rhesus monkeys: immuno-stimulatory effects of granulocyte macrophage-colony stimulating factor.

    PubMed

    Kumar, Sanjai; Villinger, Francois; Oakley, Miranda; Aguiar, Joao C; Jones, Trevor R; Hedstrom, Richard C; Gowda, Kalpana; Chute, John; Stowers, Anthony; Kaslow, David C; Thomas, Elaine K; Tine, John; Klinman, Dennis; Hoffman, Stephen L; Weiss, Walter W

    2002-04-01

    We have constructed a DNA plasmid vaccine encoding the C-terminal 42-kDa region of the merozoite surface protein 1 (pMSP1(42)) from the 3D7 strain of Plasmodium falciparum (Pf3D7). This plasmid expressed recombinant MSP1(42) after in vitro transfection in mouse VM92 cells. Rhesus monkeys immunized with pMSP1(42) produced antibodies reactive with Pf3D7 infected erythrocytes by IFAT, and by ELISA against yeast produced MSP1(19) (yMSP1(19)). Immunization also induced antigen specific T cell responses as measured by interferon-gamma production, and by classical CTL chromium release assays. In addition, immunization with pMSP1(42) primed animals for an enhanced antibody response to a subsequent boost with the recombinant yMSP1(19). We also evaluated Granulocyte-Macrophage Colony-Stimulating Factor (GM-CSF) as an adjuvant for pMSP1(42.) We tested both rhesus GM-CSF expressed from a DNA plasmid, and E. coli produced recombinant human GM-CSF. Plasmids encoding rhesus GM-CSF (prhGM-CSF) and human GM-CSF (phuGM-CSF) were constructed; these plasmids expressed bio-active recombinant GMCSF. Co-immunization with a mixture of prhGM-CSF and pMSP1(42) induced higher specific antibody responses after the first dose of plasmid, but after three doses of DNA monkeys immunized with or without prhGM-CSF had the same final antibody titers and T cell responses. In comparison, rhuGM-CSF protein did not lead to accelerated antibody production after the first DNA dose. However, antibody titers were maintained at a slightly higher level in monkeys receiving GM-CSF protein, and they had a higher response to boosting with recombinant MSP1(19). The GM-CSF plasmid or protein appears to be less potent as an adjuvant in rhesus monkeys than each is in mice, and more work is needed to determine if GM-CSF can be a useful adjuvant in DNA vaccination of primates.

  15. A DNA enzyme with Mg(2+)-Dependent RNA Phosphoesterase Activity

    NASA Technical Reports Server (NTRS)

    Breaker, Ronald R.; Joyce, Gerald F.

    1995-01-01

    Previously we demonstrated that DNA can act as an enzyme in the Pb(2+)-dependent cleavage of an RNA phosphoester. This is a facile reaction, with an uncatalyzed rate for a typical RNA phosphoester of approx. 10(exp -4)/ min in the presence of 1 mM Pb(OAc)2 at pH 7.0 and 23 C. The Mg(2+) - dependent reaction is more difficult, with an uncatalyzed rate of approx. 10(exp -7)/ min under comparable conditions. Mg(2+) - dependent cleavage has special relevance to biology because it is compatible with intracellular conditions. Using in vitro selection, we sought to develop a family of phosphoester-cleaving DNA enzymes that operate in the presence of various divalent metals, focusing particularly on the Mg(2+) - dependent reaction. Results: We generated a population of greater than 10(exp 13) DNAs containing 40 random nucleotides and carried out repeated rounds of selective amplification, enriching for molecules that cleave a target RNA phosphoester in the presence of 1 mM Mg(2+), Mn(2+), Zn(2+) or Pb(2+). Examination of individual clones from the Mg(2+) lineage after the sixth round revealed a catalytic motif comprised of a three-stem junction.This motif was partially randomized and subjected to seven additional rounds of selective amplification, yielding catalysts with a rate of 0.01/ min. The optimized DNA catalyst was divided into separate substrate and enzyme domains and shown to have a similar level of activity under multiple turnover conditions. Conclusions: We have generated a Mg(2+) - dependent DNA enzyme that cleaves a target RNA phosphoester with a catalytic rate approx. 10(exp 5) - fold greater than that of the uncatalyzed reaction. This activity is compatible with intracellular conditions, raising the possibility that DNA enzymes might be made to operate in vivo.

  16. A DNA-based method for detecting homologous blood doping.

    PubMed

    Manokhina, Irina; Rupert, James L

    2013-12-01

    Homologous (or allogeneic) blood doping, in which blood is transferred from a donor into a recipient athlete, is the easiest, cheapest, and fastest way to increase red cell mass (hematocrit) and therefore the oxygen-carrying capacity of the blood. Although thought to have been rendered obsolete as a doping strategy by the increased use of rhEPO to increased hematocrits, there is evidence that athletes are still using this potentially dangerous method to improve endurance performance. Current testing for homologous blood doping is based on identification of mixed populations of red blood cells by flow cytometry. This paper proposes that homologous blood doping could also be tested for by high-resolution qPCR-based genotyping and demonstrates that assays could be developed that would detect second populations of cells even if the "donor" blood was depleted of 99% of the DNA-containing leukocytes. Issues of test specificity and sensitivity are discussed as well as some of the ethical considerations that would have to be addressed if athletes' genotypes were to be used by the anti-doping authorities to prevent, or detect, the use of prohibited ergogenic practices.

  17. Local modes in a DNA polymer with hydrogen bond defect.

    PubMed Central

    Saxena, V K; Van Zandt, L L

    1994-01-01

    Vibrations of a homopolymer DNA with localized hydrogen bond defects have been examined using the recently developed decaying mode theory for long-chain polymers with local structural defects. For a poly(dA)-poly(dT) homopolymer having perturbed hydrogen bonds in one base pair, a localized mode at 63.2 cm-1 has been found. This mode has a very nearly pure H-bond stretch or "breathing" character, although the backbones do not separate. This agrees in frequency with a similar result found by other authors using a different approach. We search the full microwave frequency range for other local modes for several models of weakened H bonds. Besides the local mode with breathing characteristics, local modes with other characteristic motions were found, but only for asymmetrically perturbed bonds. We find in general that local modes are not very robust, requiring quite specific, narrow ranges in parameter space. They are also not abundant, there being only three in our most prolific model. PMID:7696483

  18. Dissolving Hydroxyolite: A DNA Molecule into Its Hydroxyapatite Mold.

    PubMed

    Bertran, Oscar; Revilla-López, Guillermo; Casanovas, Jordi; Del Valle, Luis J; Turon, Pau; Puiggalí, Jordi; Alemán, Carlos

    2016-05-04

    In spite of the clinical importance of hydroxyapatite (HAp), the mechanism that controls its dissolution in acidic environments remains unclear. Knowledge of such a process is highly desirable to provide better understanding of different pathologies, as for example osteoporosis, and of the HAp potential as vehicle for gene delivery to replace damaged DNA. In this work, the mechanism of dissolution in acid conditions of HAp nanoparticles encapsulating double-stranded DNA has been investigated at the atomistic level using computer simulations. For this purpose, four consecutive (multi-step) molecular dynamics simulations, involving different temperatures and proton transfer processes, have been carried out. Results are consistent with a polynuclear decalcification mechanism in which proton transfer processes, from the surface to the internal regions of the particle, play a crucial role. In addition, the DNA remains protected by the mineral mold and transferred proton from both temperature and chemicals. These results, which indicate that biomineralization imparts very effective protection to DNA, also have important implications in other biomedical fields, as for example in the design of artificial bones or in the fight against osteoporosis by promoting the fixation of Ca(2+) ions.

  19. A DNA-based assay for toxic chemicals in wastewater.

    PubMed

    Foreman, Amy L; Phillips, Leo; Kanellis, Vangelis G; Hammoudeh, Daoud; Naumann, Christoph; Wong, Henri; Chisari, Robert; Hibbert, D Brynn; Lee, Garry S H; Patra, Ronald; Julli, Moreno; Chapman, John; Cooke, A Roger; dos Remedios, Cristobal G

    2011-08-01

    Chemical toxicants, particularly metal ions, are a major contaminant in global waterways. Live-organism bioassays used to monitor chemical toxicants commonly involve measurements of activity or survival of a freshwater cladoceran (Ceriodaphnia dubia) or light emitted by the marine bacterium Vibrio fischeri, used in the commercial Microtox® bioassay. Here we describe a novel molecule-based assay system employing DNA as the chemical biosensor. Metals bind to DNA, causing structural changes that expel a bound (intercalated) fluorescent reporter dye. Analyses of test data using 48 wastewater samples potentially contaminated by metal ions show that the DNA-dye assay results correlate with those from C. dubia and Microtox bioassays. All three assays exhibit additive, antagonistic, and synergistic responses that cannot be predicted by knowing individual metal concentrations. Analyses of metals in these samples imply the presence of chemical toxicants other than metal ions. The DNA-dye assay is robust, has a 12-month shelf life, and is only slightly affected by sample pH in the range 4 to 9. The assay is completed in a matter of minutes, and its portability makes it well suited as a screening assay for use in the field. We conclude that the DNA-dye test is a surrogate bioassay suitable for screening chemical toxicity.

  20. Development and characterization of a DNA solar dosimeter.

    PubMed

    Ishigaki, Y; Takayama, A; Yamashita, S; Nikaido, O

    1999-06-01

    In this paper, we report the development and characterization of a solar ultraviolet (UV) dosimetry system that can be used as a film badge for radiation monitoring. DNA molecules are coated on a thin nylon membrane as a UV dosimeter. The membrane is sealed in a polyethylene filter envelope with silica gel to keep the humidity low. After exposure to UV or solar light, induced DNA damage is measured by an immunochemical reaction. The intensity of color developed during the immunological reaction can be correlated linearly with the irradiated UV dose delivered by an Oriel solar simulator within a limited dose range. We observe no effects of temperature on the level of damage induction. The membrane is proficient for measuring DNA damage for more than 21 days when stored at either 37 or 4 degrees C. The induced damage remains stable on the membrane for at least 22 days at both 37 and 4 degrees C. In addition to these indoor experiments, we report measurements of solar UV dose in outdoor experiments.

  1. A DNA sequence analysis program for the Apple Macintosh.

    PubMed Central

    Gross, R H

    1986-01-01

    This paper describes a new set of programs for analyzing DNA sequences using the Apple Macintosh computer, a computer ideally suited for this kind of analysis. Because of the Macintosh interface and the availability of high quality software-only speech synthesis, these programs are truly easy to use. Instead of typing in commands, the user directs the program by making selections with the mouse, thereby eliminating most typographical and syntax errors. Output options are selected by "pressing buttons" and then clicking "OK" with the mouse. DNA sequences are confirmed by having the program speak them. The high resolution graphics on the Macintosh not only allow for explanatory diagrams to be used to aid in deciding on input parameters, but can be used to produce slides for presentations and figures for papers. Because of the clipboard and the ability of the Macintosh to readily share data among different applications, data can be saved for use directly in word processing documents (e.g. manuscripts). PMID:3003685

  2. Spatial Organization of Enzyme Cascade on a DNA Origami Nanostructure.

    PubMed

    Fu, Jinglin; Li, Tianran

    2017-01-01

    Self-assembled DNA nanostructures hold great promise to organize multi-enzyme systems with the precise control of the geometric arrangements. Enzymes modified with single-stranded DNA anchors are assembled onto the DNA origami tiles by hybridizing with the corresponding complementary strands displayed on the surface of the DNA nanostructures. Here, we describe a protocol of assembling a two-enzyme cascade on a discrete, rectangular DNA origami tile, where the distance between enzymes is precisely controlled for investigating the distance-dependent cascade activities.

  3. DNA sequencing using electrical conductance measurements of a DNA polymerase

    NASA Astrophysics Data System (ADS)

    Chen, Yu-Shiun; Lee, Chia-Hui; Hung, Meng-Yen; Pan, Hsu-An; Chiou, Jin-Chern; Huang, G. Steven

    2013-06-01

    The development of personalized medicine--in which medical treatment is customized to an individual on the basis of genetic information--requires techniques that can sequence DNA quickly and cheaply. Single-molecule sequencing technologies, such as nanopores, can potentially be used to sequence long strands of DNA without labels or amplification, but a viable technique has yet to be established. Here, we show that single DNA molecules can be sequenced by monitoring the electrical conductance of a phi29 DNA polymerase as it incorporates unlabelled nucleotides into a template strand of DNA. The conductance of the polymerase is measured by attaching it to a protein transistor that consists of an antibody molecule (immunoglobulin G) bound to two gold nanoparticles, which are in turn connected to source and drain electrodes. The electrical conductance of the DNA polymerase exhibits well-separated plateaux that are ~3 pA in height. Each plateau corresponds to an individual base and is formed at a rate of ~22 nucleotides per second. Additional spikes appear on top of the plateaux and can be used to discriminate between the four different nucleotides. We also show that the sequencing platform works with a variety of DNA polymerases and can sequence difficult templates such as homopolymers.

  4. Detection of Toxoplasma gondii with a DNA molecular beacon probe

    NASA Astrophysics Data System (ADS)

    Zhou, Cun; Xu, Shichao; Yang, Juan; Zhang, Jimei; Dai, Zhao; Zheng, Guo; Sun, Bo; Sun, Shuqing; Feng, Teilin; Zi, Yan; Liang, Chu; Luo, Hao

    2009-07-01

    Toxoplasma gondii is a kind of microscopic parasite that may infect humans, and there are increasing concerns on the early detection of latent Toxoplasma gondii infection in recent years. This research highlights a new type of molecular beacon (MB) fluorescent probe for Toxoplasma DNA testing. We combined high-efficiency fluorescent inorganic core-shell quantum dots-CdTe/ZnS (as fluorescent energy donor) and BHQ-2 (energy acceptor) to the single-strand DNA of Toxoplasma gondii, and a molecular beacon sensing system based on fluorescence resonance energy transfer (FRET) was achieved. Core-shell quantum dots CdTe/ZnS was firstly prepared in aqueous solution, and the influencing factor of its fluorescent properties, including CdTe/Na2S/Zn(CH3COO)2 (v/v), dependence of reaction time, temperature, and pH, is investigated systematically. The synthesized quantum dots and molecular beacon were characterized by transmission electron microscopy (TEM), ultraviolet-visible spectrophotometer (UV-vis), fluorescent spectrophotometer (FS), respectively. The TEM results showed that CdTe/ZnS core-shell quantum dots is ~11nm in size, and the quantum dots is water-soluble well. The sensing ability of target DNA of assembled MB was investigated, and results showed that the target Toxoplasma gonddi DNA can be successfully detected by measuring the change of fluorescence intensity. The results showed that the current sensing probe will be a useful and convenient tool in Toxoplasma gondii early detection.

  5. A DNA marker to track Conotrachelus nenuphar (Coleoptera: Curculionidae) dispersal

    USDA-ARS?s Scientific Manuscript database

    Plum curculio, Conotrachelus nenuphar, is a pest of pome and stone fruits across the eastern U.S. In Georgia and South Carolina, plum curculio is the most destructive pest of peach fruit on which they feed and into which they oviposit. Peach infested with plum curculio may limit availability of mar...

  6. Structures of a DNA Polymerase Inserting Therapeutic Nucleotide Analogues.

    PubMed

    Schaich, Matthew A; Smith, Mallory R; Cloud, Ashley S; Holloran, Sean M; Freudenthal, Bret D

    2017-09-01

    Members of the nucleoside analogue class of cancer therapeutics compete with canonical nucleotides to disrupt numerous cellular processes, including nucleotide homeostasis, DNA and RNA synthesis, and nucleotide metabolism. Nucleoside analogues are triphosphorylated and subsequently inserted into genomic DNA, contributing to the efficacy of therapeutic nucleosides in multiple ways. In some cases, the altered base acts as a mutagen, altering the DNA sequence to promote cellular death; in others, insertion of the altered nucleotide triggers DNA repair pathways, which produce lethal levels of cytotoxic intermediates such as single and double stranded DNA breaks. As a prerequisite to many of these biological outcomes, the modified nucleotide must be accommodated in the DNA polymerase active site during nucleotide insertion. Currently, the molecular contacts that mediate DNA polymerase insertion of modified nucleotides remain unknown for multiple therapeutic compounds, despite decades of clinical use. To determine how modified bases are inserted into duplex DNA, we used mammalian DNA polymerase β (pol β) to visualize the structural conformations of four therapeutically relevant modified nucleotides, 6-thio-2'-deoxyguanosine-5'-triphosphate (6-TdGTP), 5-fluoro-2'-deoxyuridine-5'-triphosphate (5-FdUTP), 5-formyl-deoxycytosine-5'-triphosphate (5-FodCTP), and 5-formyl-deoxyuridine-5'-triphosphate (5-FodUTP). Together, the structures reveal a pattern in which the modified nucleotides utilize Watson-Crick base pairing interactions similar to that of unmodified nucleotides. The nucleotide modifications were consistently positioned in the major groove of duplex DNA, accommodated by an open cavity in pol β. These results provide novel information for the rational design of new therapeutic nucleoside analogues and a greater understanding of how modified nucleotides are tolerated by polymerases.

  7. Detection of toxoplasma gondii with a DNA molecular beacon probe

    NASA Astrophysics Data System (ADS)

    Xu, Shichao; Yao, Cuicui; Wei, Shuoming; Zhang, Jimei; Sun, Bo; Zheng, Guo; Han, Qing; Hu, Fei; Zhou, Hongming

    2008-12-01

    Toxoplasma gondii is a microscopic parasite that may infect humans, so there is an increasing concern on the early detection of latent Toxoplasma gondii infection in recent years. We currently report a rapid and sensitive method for Toxoplasma gondii based on molecular beacon (MB) probe. The probe based on fluorescence resonance energy transfer (FRET) with a stem-loop DNA oligonucleotide was labeled with CdTe/ZnS quantum dots (energy donor) at 5' end and BHQ-2 (energy acceptor) at 3' end, respectively. The probe was synthesized in PBS buffer at pH 8.2, room temperature for 24 h. Then target DNA was injected under the condition of 37°C, hybridization for 2 h, in Tris-HCl buffer. The data from fluorescence spectrum (FS) showed that ca 65% of emitted fluorescence was quenched, and about 50% recovery of fluorescence intensity was observed after adding target DNA, which indicated that the target DNA was successfully detected by MB probe. The detecting limitation was determined as ca 5 nM. Moreover, specificity of the probe was investigated by adding target DNA with one-base-pair mismatch, the low fluorescence recovery indicated the high specificity. The results showed that the current sensing probe will be a useful and convenient tool in Toxoplasma gondii early detection.

  8. A DNA Element Regulates Drug Tolerance and Withdrawal in Drosophila

    PubMed Central

    Li, Xiaolei; Ghezzi, Alfredo; Pohl, Jascha B.; Bohm, Arun Y.; Atkinson, Nigel S.

    2013-01-01

    Drug tolerance and withdrawal are insidious responses to drugs of abuse; the first increases drug consumption while the second punishes abstention. Drosophila generate functional tolerance to benzyl alcohol sedation by increasing neural expression of the slo BK-type Ca2+ activated K+ channel gene. After drug clearance this change produces a withdrawal phenotype—increased seizure susceptibility. The drug-induced histone modification profile identified the 6b element (60 nt) as a drug responsive element. Genomic deletion of 6b produces the allele, sloΔ6b, that reacts more strongly to the drug with increased induction, a massive increase in the duration of tolerance, and an increase in the withdrawal phenotype yet does not alter other slo-dependent behaviors. The 6b element is a homeostatic regulator of BK channel gene expression and is the first cis-acting DNA element shown to specifically affect the duration of a drug action. PMID:24086565

  9. Collective helicity switching of a DNA-coat assembly

    NASA Astrophysics Data System (ADS)

    Kim, Yongju; Li, Huichang; He, Ying; Chen, Xi; Ma, Xiaoteng; Lee, Myongsoo

    2017-07-01

    Hierarchical assemblies of biomolecular subunits can carry out versatile tasks at the cellular level with remarkable spatial and temporal precision. As an example, the collective motion and mutual cooperation between complex protein machines mediate essential functions for life, such as replication, synthesis, degradation, repair and transport. Nucleic acid molecules are far less dynamic than proteins and need to bind to specific proteins to form hierarchical structures. The simplest example of these nucleic acid-based structures is provided by a rod-shaped tobacco mosaic virus, which consists of genetic material surrounded by coat proteins. Inspired by the complexity and hierarchical assembly of viruses, a great deal of effort has been devoted to design similarly constructed artificial viruses. However, such a wrapping approach makes nucleic acid dynamics insensitive to environmental changes. This limitation generally restricts, for example, the amplification of the conformational dynamics between the right-handed B form to the left-handed Z form of double-stranded deoxyribonucleic acid (DNA). Here we report a virus-like hierarchical assembly in which the native DNA and a synthetic coat undergo repeated collective helicity switching triggered by pH change under physiological conditions. We also show that this collective helicity inversion occurs during translocation of the DNA-coat assembly into intracellular compartments. Translating DNA conformational dynamics into a higher level of hierarchical dynamics may provide an approach to create DNA-based nanomachines.

  10. Collective helicity switching of a DNA-coat assembly.

    PubMed

    Kim, Yongju; Li, Huichang; He, Ying; Chen, Xi; Ma, Xiaoteng; Lee, Myongsoo

    2017-07-01

    Hierarchical assemblies of biomolecular subunits can carry out versatile tasks at the cellular level with remarkable spatial and temporal precision. As an example, the collective motion and mutual cooperation between complex protein machines mediate essential functions for life, such as replication, synthesis, degradation, repair and transport. Nucleic acid molecules are far less dynamic than proteins and need to bind to specific proteins to form hierarchical structures. The simplest example of these nucleic acid-based structures is provided by a rod-shaped tobacco mosaic virus, which consists of genetic material surrounded by coat proteins. Inspired by the complexity and hierarchical assembly of viruses, a great deal of effort has been devoted to design similarly constructed artificial viruses. However, such a wrapping approach makes nucleic acid dynamics insensitive to environmental changes. This limitation generally restricts, for example, the amplification of the conformational dynamics between the right-handed B form to the left-handed Z form of double-stranded deoxyribonucleic acid (DNA). Here we report a virus-like hierarchical assembly in which the native DNA and a synthetic coat undergo repeated collective helicity switching triggered by pH change under physiological conditions. We also show that this collective helicity inversion occurs during translocation of the DNA-coat assembly into intracellular compartments. Translating DNA conformational dynamics into a higher level of hierarchical dynamics may provide an approach to create DNA-based nanomachines.

  11. A DNA Melting Exercise for a Large Laboratory Class

    ERIC Educational Resources Information Center

    Levine, Lauren A.; Junker, Matthew; Stark, Myranda; Greenleaf, Dustin

    2015-01-01

    A simple and economical experimental setup is described that enables multiple individuals or groups within a laboratory class to measure the thermal melting of double stranded DNA simultaneously. The setup utilizes a basic spectrophotometer capable of measuring absorbance at 260 nm, UV plastic cuvettes, and a stirring hot plate. Students measure…

  12. Escape of a knot from a DNA molecule in flow

    NASA Astrophysics Data System (ADS)

    Renner, Benjamin; Doyle, Patrick

    2014-03-01

    Macroscale knots are an everyday occurrence when trying to unravel an unorganized flexible string (e.g. an iPhone cord taken out of your pocket). In nature, knots are found in proteins and viral capsid DNA, and the properties imbued by their topologies are thought to have biological significance. Unlike their macroscale counterparts, thermal fluctuations greatly influence the dynamics of polymer knots. Here, we use Brownian Dynamics simulations to study knot diffusion along a linear polymer chain. The model is parameterized to dsDNA, a model polymer used in previous simulation and experimental studies of knot dynamics. We have used this model to study the process of knot escape and transport along a dsDNA strand extended by an elongational flow. For a range of knot topologies and flow strengths, we show scalings that result in collapse of the data onto a master curve. We show a topologically mediated mode of transport coincides with observed differences in rates of knot transport, and we provide a simple mechanistic explanation for its effect. We anticipate these results will build on the growing body of fundamental studies of knotted polymers and inform future experimental study. This work is supported by the Singapore-MIT Alliance for Research and Technology (SMART) and National Science Foundation (NSF) grant CBET-0852235.

  13. Scaffolded DNA origami of a DNA tetrahedron molecular container.

    PubMed

    Ke, Yonggang; Sharma, Jaswinder; Liu, Minghui; Jahn, Kasper; Liu, Yan; Yan, Hao

    2009-06-01

    We describe a strategy of scaffolded DNA origami to design and construct 3D molecular cages of tetrahedron geometry with inside volume closed by triangular faces. Each edge of the triangular face is approximately 54 nm in dimension. The estimated total external volume and the internal cavity of the triangular pyramid are about 1.8 x 10(-23) and 1.5 x 10(-23) m(3), respectively. Correct formation of the tetrahedron DNA cage was verified by gel electrophoresis, atomic force microscopy, transmission electron microscopy, and dynamic light scattering techniques.

  14. Identification of Streptococcus pneumoniae with a DNA probe.

    PubMed Central

    Denys, G A; Carey, R B

    1992-01-01

    The Accuprobe Streptococcus pneumoniae Culture Identification Test (Gen-Probe, Inc.) was evaluated with 172 isolates of S. pneumoniae and 204 nonpneumococcal isolates. The sensitivity and specificity of the Accuprobe test were 100%. Optimum results were obtained when four or more discrete colonies were selected for testing. The Accuprobe test was determined to be an accurate and rapid method for identification of S. pneumoniae. PMID:1400974

  15. Conformation dependent electronic transport in a DNA double-helix

    SciTech Connect

    Kundu, Sourav Karmakar, S. N.

    2015-10-15

    We present a tight-binding study of conformation dependent electronic transport properties of DNA double-helix including its helical symmetry. We have studied the changes in the localization properties of DNA as we alter the number of stacked bases within every pitch of the double-helix keeping fixed the total number of nitrogen bases within the DNA molecule. We take three DNA sequences, two of them are periodic and one is random and observe that in all the cases localization length increases as we increase the radius of DNA double-helix i.e., number of nucleobases within a pitch. We have also investigated the effect of backbone energetic on the I-V response of the system and found that in presence of helical symmetry, depending on the interplay of conformal variation and disorder, DNA can be found in either metallic, semiconducting and insulating phases, as observed experimentally.

  16. A DNA Melting Exercise for a Large Laboratory Class

    ERIC Educational Resources Information Center

    Levine, Lauren A.; Junker, Matthew; Stark, Myranda; Greenleaf, Dustin

    2015-01-01

    A simple and economical experimental setup is described that enables multiple individuals or groups within a laboratory class to measure the thermal melting of double stranded DNA simultaneously. The setup utilizes a basic spectrophotometer capable of measuring absorbance at 260 nm, UV plastic cuvettes, and a stirring hot plate. Students measure…

  17. Rapid development of a DNA vaccine for Zika virus.

    PubMed

    Dowd, Kimberly A; Ko, Sung-Youl; Morabito, Kaitlyn M; Yang, Eun Sung; Pelc, Rebecca S; DeMaso, Christina R; Castilho, Leda R; Abbink, Peter; Boyd, Michael; Nityanandam, Ramya; Gordon, David N; Gallagher, John Robert; Chen, Xuejun; Todd, John-Paul; Tsybovsky, Yaroslav; Harris, Audray; Huang, Yan-Jang S; Higgs, Stephen; Vanlandingham, Dana L; Andersen, Hanne; Lewis, Mark G; De La Barrera, Rafael; Eckels, Kenneth H; Jarman, Richard G; Nason, Martha C; Barouch, Dan H; Roederer, Mario; Kong, Wing-Pui; Mascola, John R; Pierson, Theodore C; Graham, Barney S

    2016-10-14

    Zika virus (ZIKV) was identified as a cause of congenital disease during the explosive outbreak in the Americas and Caribbean that began in 2015. Because of the ongoing fetal risk from endemic disease and travel-related exposures, a vaccine to prevent viremia in women of childbearing age and their partners is imperative. We found that vaccination with DNA expressing the premembrane and envelope proteins of ZIKV was immunogenic in mice and nonhuman primates, and protection against viremia after ZIKV challenge correlated with serum neutralizing activity. These data not only indicate that DNA vaccination could be a successful approach to protect against ZIKV infection, but also suggest a protective threshold of vaccine-induced neutralizing activity that prevents viremia after acute infection. Copyright © 2016, American Association for the Advancement of Science.

  18. A mechanical metamaterial made from a DNA hydrogel

    NASA Astrophysics Data System (ADS)

    Lee, Jong Bum; Peng, Songming; Yang, Dayong; Roh, Young Hoon; Funabashi, Hisakage; Park, Nokyoung; Rice, Edward J.; Chen, Liwei; Long, Rong; Wu, Mingming; Luo, Dan

    2012-12-01

    Metamaterials are artificial substances that are structurally engineered to have properties not typically found in nature. To date, almost all metamaterials have been made from inorganic materials such as silicon and copper, which have unusual electromagnetic or acoustic properties that allow them to be used, for example, as invisible cloaks, superlenses or super absorbers for sound. Here, we show that metamaterials with unusual mechanical properties can be prepared using DNA as a building block. We used a polymerase enzyme to elongate DNA chains and weave them non-covalently into a hydrogel. The resulting material, which we term a meta-hydrogel, has liquid-like properties when taken out of water and solid-like properties when in water. Moreover, upon the addition of water, and after complete deformation, the hydrogel can be made to return to its original shape. The meta-hydrogel has a hierarchical internal structure and, as an example of its potential applications, we use it to create an electric circuit that uses water as a switch.

  19. A mechanical metamaterial made from a DNA hydrogel.

    PubMed

    Lee, Jong Bum; Peng, Songming; Yang, Dayong; Roh, Young Hoon; Funabashi, Hisakage; Park, Nokyoung; Rice, Edward J; Chen, Liwei; Long, Rong; Wu, Mingming; Luo, Dan

    2012-12-01

    Metamaterials are artificial substances that are structurally engineered to have properties not typically found in nature. To date, almost all metamaterials have been made from inorganic materials such as silicon and copper, which have unusual electromagnetic or acoustic properties that allow them to be used, for example, as invisible cloaks, superlenses or super absorbers for sound. Here, we show that metamaterials with unusual mechanical properties can be prepared using DNA as a building block. We used a polymerase enzyme to elongate DNA chains and weave them non-covalently into a hydrogel. The resulting material, which we term a meta-hydrogel, has liquid-like properties when taken out of water and solid-like properties when in water. Moreover, upon the addition of water, and after complete deformation, the hydrogel can be made to return to its original shape. The meta-hydrogel has a hierarchical internal structure and, as an example of its potential applications, we use it to create an electric circuit that uses water as a switch.

  20. Encapsulation of Gold Nanoparticles in a DNA Origami Cage

    SciTech Connect

    Zhao, Zhao; Jacovetty, Erica L.; Liu, Yan; Yan, Hao

    2011-01-21

    A critical challenge in nanoparticle (NP) surface functionalization is to label the NP surface with a single copy of a functional group or to display multiple, unique molecules on the NP surface with control of the orientation and intermolecular distance. This challenge was addressed with the construction of a spatially addressable, self-assembling DNA origami nanocage that encapsulates gold nanoparticles and interrupts its surface symmetry

  1. A DNA-based assay identifies Batrachochytrium dendrobatidis in amphibians.

    PubMed

    Annis, Seanna L; Dastoor, Farahad P; Ziel, Heather; Daszak, Peter; Longcore, Joyce E

    2004-07-01

    Chytridiomycosis caused by Batrachochytrium dendrobatidis (Chytridiomycota) has been implicated in declines of amphibian populations on four continents. We have developed a sensitive and specific polymerase chain reaction-based assay to detect this pathogen. We isolated B. dendrobatidis from captive and wild amphibians collected across North America and sequenced the internal transcribed spacer regions of the rDNA cassette of multiple isolates. We identified two primers (Bd1a and Bd2a) that are specific to B. dendrobatidis under amplification conditions described in this study. DNA amplification with Bd1a/Bd2a primers produced a fragment of approximately 300 bp from B. dendrobatidis DNA but not from DNA of other species of chytrids or common soil fungi. The assay detected 10 zoospores or 10 pg of DNA from B. dendrobatidis and detected infections in skin samples from a tiger salamander (Ambystoma tigrinum), boreal toads (Bufo boreas), Wyoming toads (Bufo baxteri), and smooth-sided toads (Bufo guttatus). This assay required only small samples of skin and can be used to process a large number of samples.

  2. ATM kinase: Much more than a DNA damage responsive protein.

    PubMed

    Guleria, Ayushi; Chandna, Sudhir

    2016-03-01

    ATM, mutation of which causes Ataxia telangiectasia, has emerged as a cardinal multifunctional protein kinase during past two decades as evidenced by various studies from around the globe. Further to its well established and predominant role in DNA damage response, ATM has also been understood to help in maintaining overall functional integrity of cells; since its mutation, inactivation or deficiency results in a variety of pathological manifestations besides DNA damage. These include oxidative stress, metabolic syndrome, mitochondrial dysfunction as well as neurodegeneration. Recently, high throughput screening using proteomics, metabolomics and transcriptomic studies revealed several proteins which might be acting as substrates of ATM. Studies that can help in identifying effective regulatory controls within the ATM-mediated pathways/mechanisms can help in developing better therapeutics. In fact, more in-depth understanding of ATM-dependent cellular signals could also help in the treatment of variety of other disease conditions since these pathways seem to control many critical cellular functions. In this review, we have attempted to put together a detailed yet lucid picture of the present-day understanding of ATM's role in various pathophysiological conditions involving DNA damage and beyond. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Divergent Requirement for a DNA Repair Enzyme during Enterovirus Infections.

    PubMed

    Maciejewski, Sonia; Nguyen, Joseph H C; Gómez-Herreros, Fernando; Cortés-Ledesma, Felipe; Caldecott, Keith W; Semler, Bert L

    2015-12-29

    Viruses of the Enterovirus genus of picornaviruses, including poliovirus, coxsackievirus B3 (CVB3), and human rhinovirus, commandeer the functions of host cell proteins to aid in the replication of their small viral genomic RNAs during infection. One of these host proteins is a cellular DNA repair enzyme known as 5' tyrosyl-DNA phosphodiesterase 2 (TDP2). TDP2 was previously demonstrated to mediate the cleavage of a unique covalent linkage between a viral protein (VPg) and the 5' end of picornavirus RNAs. Although VPg is absent from actively translating poliovirus mRNAs, the removal of VPg is not required for the in vitro translation and replication of the RNA. However, TDP2 appears to be excluded from replication and encapsidation sites during peak times of poliovirus infection of HeLa cells, suggesting a role for TDP2 during the viral replication cycle. Using a mouse embryonic fibroblast cell line lacking TDP2, we found that TDP2 is differentially required among enteroviruses. Our single-cycle viral growth analysis shows that CVB3 replication has a greater dependency on TDP2 than does poliovirus or human rhinovirus replication. During infection, CVB3 protein accumulation is undetectable (by Western blot analysis) in the absence of TDP2, whereas poliovirus protein accumulation is reduced but still detectable. Using an infectious CVB3 RNA with a reporter, CVB3 RNA could still be replicated in the absence of TDP2 following transfection, albeit at reduced levels. Overall, these results indicate that TDP2 potentiates viral replication during enterovirus infections of cultured cells, making TDP2 a potential target for antiviral development for picornavirus infections. Picornaviruses are one of the most prevalent groups of viruses that infect humans and livestock worldwide. These viruses include the human pathogens belonging to the Enterovirus genus, such as poliovirus, coxsackievirus B3 (CVB3), and human rhinovirus. Diseases caused by enteroviruses pose a major problem for public health and have significant economic impact. Poliovirus can cause paralytic poliomyelitis. CVB3 can cause hand, foot, and mouth disease and myocarditis. Human rhinovirus is the causative agent of the common cold, which has a severe economic impact due to lost productivity and severe health consequences in individuals with respiratory dysfunction, such as asthma. By gaining a better understanding of the enterovirus replication cycle, antiviral drugs against enteroviruses may be developed. Here, we report that the absence of the cellular enzyme TDP2 can significantly decrease viral yields of poliovirus, CVB3, and human rhinovirus, making TDP2 a potential target for an antiviral against enterovirus infections. Copyright © 2016 Maciejewski et al.

  4. Hydrodynamics of a DNA molecule in a flow field

    NASA Astrophysics Data System (ADS)

    Larson, R. G.; Perkins, T. T.; Smith, D. E.; Chu, S.

    1997-02-01

    The hydrodynamics of a single, fluorescing, DNA molecule held at one end by 'optical tweezers' and subjected to a uniform flow are compared with Monte Carlo simulations that account for the molecule's entropic elasticity, Brownian motion, and hydrodynamic drag. Using self-diffusion data and analytic expressions to obtain the drag in the limits of the undeformed coil and of the fully stretched thread, the predicted chain stretching and mass distribution are in quantitative agreement with measurements. The results explain the success of the nonlinear elastic 'dumbbell' model in predicting the rheological properties of dilute polymer solutions.

  5. Forensic analysis of hallucinogenic fungi: a DNA-based approach.

    PubMed

    Nugent, Kimberly G; Saville, Barry J

    2004-03-10

    Hallucinogenic fungi synthesize two controlled substances, psilocin and psilocybin. Possession of the fungal species that contain these compounds is a criminal offence in North America. Some related species that are morphologically similar, do not contain the controlled substances. Therefore, unambiguous identification of fungi to the species level is critical in determining if a mushroom is illegal. We investigate a phylogenetic approach for the identification of species that contain the psychoactive compounds. We analyzed 35 North American specimens representing seven different genera of hallucinogenic and non-hallucinogenic mushrooms. We amplified and sequenced the internal transcribed spacer region of the rDNA (ITS-1) and a 5' portion of the nuclear large ribosomal subunit of rRNA (nLSU rRNA or 28S). ITS-1 locus sequence data was highly variable and produced a phylogenetic resolution that was not consistent with morphological identifications. In contrast, the nLSU rRNA data clustered isolates from the same species and separated hallucinogen containing and non-hallucinogen containing isolates into distinct clades. With this information, we propose an approach that combines the specificity of PCR detection and the resolving power of phylogenetic analysis to efficiently and unambiguously identify hallucinogenic fungal specimens for legal purposes.

  6. A DNA ring acting as a thermal ratchet.

    PubMed

    Kulić, Igor M; Thaokar, Rochish; Schiessel, Helmut

    2005-11-30

    Several DNA nanomotors have been recently constructed in laboratories worldwide. These machines are, however, relatively slow and do not perform continuous rotations. We have recently proposed a rotary DNA nanomachine that shows a continuous rotation with a frequency of 10(2)-10(4) Hz. This motor is a closed DNA ring whose elastic features are tuned such that it can be externally driven via e.g. periodic temperature changes. As a result, the twirling ring propels itself through the fluid with a speed of tens of nanometres up to a few microns per second. The current paper gives a more detailed presentation of this motor and provides a derivation of the low- and high-frequency asymptotic behaviour of thermal ratchets in general.

  7. Cooperative dynamics of a DNA polymerase replicating complex.

    PubMed

    Moors, Samuel L C; Herdewijn, Piet; Robben, Johan; Ceulemans, Arnout

    2013-12-01

    Engineered DNA polymerases continue to be the workhorses of many applications in biotechnology, medicine and nanotechnology. However, the dynamic interplay between the enzyme and the DNA remains unclear. In this study, we performed an extensive replica exchange with flexible tempering (REFT) molecular dynamics simulation of the ternary replicating complex of the archaeal family B DNA polymerase from the thermophile Thermococcus gorgonarius, right before the chemical step. The convoluted dynamics of the enzyme are reducible to rigid-body motions of six subdomains. Upon binding to the enzyme, the DNA double helix conformation changes from a twisted state to a partially untwisted state. The twisted state displays strong bending motion, whereby the DNA oscillates between a straight and a bent conformation. The dynamics of double-stranded DNA are strongly correlated with rotations of the thumb toward the palm, which suggests an assisting role of the enzyme during DNA translocation. In the complex, the primer-template duplex displays increased preference for the B-DNA conformation at the n-2 and n-3 dinucleotide steps. Interactions at the primer 3' end indicate that Thr541 and Asp540 are the acceptors of the first proton transfer in the chemical step, whereas in the translocation step both residues hold the primer 3' terminus in the vicinity of the priming site, which is crucial for high processivity.

  8. A DNA mini-barcode for land plants.

    PubMed

    Little, Damon P

    2014-05-01

    Small portions of the barcode region - mini-barcodes - may be used in place of full-length barcodes to overcome DNA degradation for samples with poor DNA preservation. 591,491,286 rbcL mini-barcode primer combinations were electronically evaluated for PCR universality, and two novel highly universal sets of priming sites were identified. Novel and published rbcL mini-barcode primers were evaluated for PCR amplification [determined with a validated electronic simulation (n = 2765) and empirically (n = 188)], Sanger sequence quality [determined empirically (n = 188)], and taxonomic discrimination [determined empirically (n = 30,472)]. PCR amplification for all mini-barcodes, as estimated by validated electronic simulation, was successful for 90.2-99.8% of species. Overall Sanger sequence quality for mini-barcodes was very low - the best mini-barcode tested produced sequences of adequate quality (B20 ≥ 0.5) for 74.5% of samples. The majority of mini-barcodes provide correct identifications of families in excess of 70.1% of the time. Discriminatory power noticeably decreased at lower taxonomic levels. At the species level, the discriminatory power of the best mini-barcode was less than 38.2%. For samples believed to contain DNA from only one species, an investigator should attempt to sequence, in decreasing order of utility and probability of success, mini-barcodes F (rbcL1/rbcLB), D (F52/R193) and K (F517/R604). For samples believed to contain DNA from more than one species, an investigator should amplify and sequence mini-barcode D (F52/R193).

  9. ATOMIC AND MOLECULAR PHYSICS: Modelling of a DNA packaging motor

    NASA Astrophysics Data System (ADS)

    Qian, Jun; Xie, Ping; Xue, Xiao-Guang; Wang, Peng-Ye

    2009-11-01

    During the assembly of many viruses, a powerful molecular motor packages the genome into a preassembled capsid. The Bacillus subtilis phage phi29 is an excellent model system to investigate the DNA packaging mechanism because of its highly efficient in vitro DNA packaging activity and the development of a single-molecule packaging assay. Here we make use of structural and biochemical experimental data to build a physical model of DNA packaging by the phi29 DNA packaging motor. Based on the model, various dynamic behaviours such as the packaging rate, pause frequency and slip frequency under different ATP concentrations, ADP concentrations, external loads as well as capsid fillings are studied by using Monte Carlo simulation. Good agreement is obtained between the simulated and available experimental results. Moreover, we make testable predictions that should guide future experiments related to motor function.

  10. Analysis of a DNA simulation model through hairpin melting experiments

    PubMed Central

    Linak, Margaret C.; Dorfman, Kevin D.

    2010-01-01

    We compare the predictions of a two-bead Brownian dynamics simulation model to melting experiments of DNA hairpins with complementary AT or GC stems and noninteracting loops in buffer A. This system emphasizes the role of stacking and hydrogen bonding energies, which are characteristics of DNA, rather than backbone bending, stiffness, and excluded volume interactions, which are generic characteristics of semiflexible polymers. By comparing high throughput data on the open-close transition of various DNA hairpins to the corresponding simulation data, we (1) establish a suitable metric to compare the simulations to experiments, (2) find a conversion between the simulation and experimental temperatures, and (3) point out several limitations of the model, including the lack of G-quartets and cross stacking effects. Our approach and experimental data can be used to validate similar coarse-grained simulation models. PMID:20886965

  11. 3D-DART: a DNA structure modelling server

    PubMed Central

    van Dijk, Marc; Bonvin, Alexandre M. J. J.

    2009-01-01

    There is a growing interest in structural studies of DNA by both experimental and computational approaches. Often, 3D-structural models of DNA are required, for instance, to serve as templates for homology modeling, as starting structures for macro-molecular docking or as scaffold for NMR structure calculations. The conformational adaptability of DNA when binding to a protein is often an important factor and at the same time a limitation in such studies. As a response to the demand for 3D-structural models reflecting the intrinsic plasticity of DNA we present the 3D-DART server (3DNA-Driven DNA Analysis and Rebuilding Tool). The server provides an easy interface to a powerful collection of tools for the generation of DNA-structural models in custom conformations. The computational engine beyond the server makes use of the 3DNA software suite together with a collection of home-written python scripts. The server is freely available at http://haddock.chem.uu.nl/dna without any login requirement. PMID:19417072

  12. A DNA topoisomerase VI-like complex initiates meiotic recombination.

    PubMed

    Vrielynck, Nathalie; Chambon, Aurélie; Vezon, Daniel; Pereira, Lucie; Chelysheva, Liudmila; De Muyt, Arnaud; Mézard, Christine; Mayer, Claudine; Grelon, Mathilde

    2016-02-26

    The SPO11 protein catalyzes the formation of meiotic DNA double strand breaks (DSBs) and is homologous to the A subunit of an archaeal topoisomerase (topo VI). Topo VI are heterotetrameric enzymes comprising two A and two B subunits; however, no topo VIB involved in meiotic recombination had been identified. We characterized a structural homolog of the archaeal topo VIB subunit [meiotic topoisomerase VIB-like (MTOPVIB)], which is essential for meiotic DSB formation. It forms a complex with the two Arabidopsis thaliana SPO11 orthologs required for meiotic DSB formation (SPO11-1 and SPO11-2) and is absolutely required for the formation of the SPO11-1/SPO11-2 heterodimer. These findings suggest that the catalytic core complex responsible for meiotic DSB formation in eukaryotes adopts a topo VI-like structure.

  13. A DNA Vaccine against Yellow Fever Virus: Development and Evaluation

    PubMed Central

    Maciel, Milton; Cruz, Fábia da Silva Pereira; Cordeiro, Marli Tenório; da Motta, Márcia Archer; Cassemiro, Klécia Marília Soares de Melo; Maia, Rita de Cássia Carvalho; de Figueiredo, Regina Célia Bressan Queiroz; Galler, Ricardo; Freire, Marcos da Silva; August, Joseph Thomas; Marques, Ernesto T. A.; Dhalia, Rafael

    2015-01-01

    Attenuated yellow fever (YF) virus 17D/17DD vaccines are the only available protection from YF infection, which remains a significant source of morbidity and mortality in the tropical areas of the world. The attenuated YF virus vaccine, which is used worldwide, generates both long-lasting neutralizing antibodies and strong T-cell responses. However, on rare occasions, this vaccine has toxic side effects that can be fatal. This study presents the design of two non-viral DNA-based antigen formulations and the characterization of their expression and immunological properties. The two antigen formulations consist of DNA encoding the full-length envelope protein (p/YFE) or the full-length envelope protein fused to the lysosomal-associated membrane protein signal, LAMP-1 (pL/YFE), aimed at diverting antigen processing/presentation through the major histocompatibility complex II precursor compartments. The immune responses triggered by these formulations were evaluated in H2b and H2d backgrounds, corresponding to the C57Bl/6 and BALB/c mice strains, respectively. Both DNA constructs were able to induce very strong T-cell responses of similar magnitude against almost all epitopes that are also generated by the YF 17DD vaccine. The pL/YFE formulation performed best overall. In addition to the T-cell response, it was also able to stimulate high titers of anti-YF neutralizing antibodies comparable to the levels elicited by the 17DD vaccine. More importantly, the pL/YFE vaccine conferred 100% protection against the YF virus in intracerebrally challenged mice. These results indicate that pL/YFE DNA is an excellent vaccine candidate and should be considered for further developmental studies. PMID:25875109

  14. A DNA vaccine against yellow fever virus: development and evaluation.

    PubMed

    Maciel, Milton; Cruz, Fábia da Silva Pereira; Cordeiro, Marli Tenório; da Motta, Márcia Archer; Cassemiro, Klécia Marília Soares de Melo; Maia, Rita de Cássia Carvalho; de Figueiredo, Regina Célia Bressan Queiroz; Galler, Ricardo; Freire, Marcos da Silva; August, Joseph Thomas; Marques, Ernesto T A; Dhalia, Rafael

    2015-04-01

    Attenuated yellow fever (YF) virus 17D/17DD vaccines are the only available protection from YF infection, which remains a significant source of morbidity and mortality in the tropical areas of the world. The attenuated YF virus vaccine, which is used worldwide, generates both long-lasting neutralizing antibodies and strong T-cell responses. However, on rare occasions, this vaccine has toxic side effects that can be fatal. This study presents the design of two non-viral DNA-based antigen formulations and the characterization of their expression and immunological properties. The two antigen formulations consist of DNA encoding the full-length envelope protein (p/YFE) or the full-length envelope protein fused to the lysosomal-associated membrane protein signal, LAMP-1 (pL/YFE), aimed at diverting antigen processing/presentation through the major histocompatibility complex II precursor compartments. The immune responses triggered by these formulations were evaluated in H2b and H2d backgrounds, corresponding to the C57Bl/6 and BALB/c mice strains, respectively. Both DNA constructs were able to induce very strong T-cell responses of similar magnitude against almost all epitopes that are also generated by the YF 17DD vaccine. The pL/YFE formulation performed best overall. In addition to the T-cell response, it was also able to stimulate high titers of anti-YF neutralizing antibodies comparable to the levels elicited by the 17DD vaccine. More importantly, the pL/YFE vaccine conferred 100% protection against the YF virus in intracerebrally challenged mice. These results indicate that pL/YFE DNA is an excellent vaccine candidate and should be considered for further developmental studies.

  15. Identifying single bases in a DNA oligomer with electron tunnelling

    NASA Astrophysics Data System (ADS)

    Huang, Shuo; He, Jin; Chang, Shuai; Zhang, Peiming; Liang, Feng; Li, Shengqin; Tuchband, Michael; Fuhrmann, Alexander; Ros, Robert; Lindsay, Stuart

    2010-12-01

    It has been proposed that single molecules of DNA could be sequenced by measuring the physical properties of the bases as they pass through a nanopore. Theoretical calculations suggest that electron tunnelling can identify bases in single-stranded DNA without enzymatic processing, and it was recently experimentally shown that tunnelling can sense individual nucleotides and nucleosides. Here, we report that tunnelling electrodes functionalized with recognition reagents can identify a single base flanked by other bases in short DNA oligomers. The residence time of a single base in a recognition junction is on the order of a second, but pulling the DNA through the junction with a force of tens of piconewtons would yield reading speeds of tens of bases per second.

  16. The use of cycleave PCR for the differentiation of the rejuvenating herb species Pueraria candollei (White Kwao Khruea), Butea superba (Red Kwao Khruea), and Mucuna macrocarpa (Black Kwao Khruea), and the simultaneous detection of multiple DNA targets in a DNA admixture.

    PubMed

    Wiriyakarun, Suchaya; Zhu, Shu; Komatsu, Katsuko; Sukrong, Suchada

    2014-01-01

    Kwao Khruea, the tuberous roots of Pueraria candollei Graham ex Benth. (White Kwao Khruea), Butea superba Roxb. (Red Kwao Khruea), and Mucuna macrocarpa Wall. (Black Kwao Khruea), are used as rejuvenating herbs in traditional medicine in many tropical countries. Although Kwao Khruea has attracted strong interest because of its rejuvenation properties, each species is used for specific purposes and effects. P. candollei shows estrogenic effects in females. In contrast, B. superba and M. macrocarpa show androgenic effects in males. The potential misidentification of dried tuberous roots of various Kwao Khruea species might cause problems in the drug market, especially when they are reduced into powders. A cycleave PCR, which is based on the sequence of chloroplast matK gene, was developed to differentiate P. candollei, B. superba, and M. macrocarpa. The results showed that cycleave PCR is able to identify specific Kwao Khruea species. A multiplex cycleave PCR was optimized for the simultaneous detection of two different DNA targets in a DNA admixture. The specificity of this technique was confirmed by its ability to distinguish M. macrocarpa from five related Mucuna species. Cycleave PCR can be a specific, sensitive, and rapid method for the identification of medicinal plants and crude plant samples.

  17. Structure determination of a DNA octamer in solution by NMR spectroscopy. Effect of fast local motions

    SciTech Connect

    Koning, T.M.G.; Boelens, R.; Kaptein, R. ); van der Marel, G.A.; van Boom, J.H. )

    1991-04-16

    NMR structures of biomolecules are primarily based on nuclear Overhauser effects (NOEs) between protons. For the interpretation of NOEs in terms of distances, usually the assumption of a single rotational correlation time corresponding to a rigid molecule approximation is made. Here the authors investigate the effect of fast internal motions of the interproton vectors in the context of the relaxation matrix approach for structure determination of biomolecules. From molecular dynamics simulations generalized order parameters were calculated for the DNA octamer d(GCGTTCGC){center dot}d(CGCAACGC), and these were used in the calculation of NOE intensities. The magnitudes of the order parameters showed some variation for the different types of interproton vectors. The interproton distances changed only slightly, with a maximum of 10%; nevertheless, the changes were significant and resulted in constraints that were better satisfied. The structure of the DNA octamer was determined by using restrained molecular dynamics simulations with H{sub 2}O as a solvent, with and without the inclusion of local internal motions. Starting from A- or B-DNA, the structures showed a high local convergence, while the global convergence for the octamer was ca. 2.6 {angstrom}.

  18. A DNA extraction protocol for improved DNA yield from individual mosquitoes

    PubMed Central

    Nieman, Catelyn C.; Yamasaki, Youki; Collier, Travis C.; Lee, Yoosook

    2015-01-01

    Typical DNA extraction protocols from commercially available kits provide an adequate amount of DNA from a single individual mosquito sufficient for PCR-based assays. However, next-generation sequencing applications and high-throughput SNP genotyping assays exposed the limitation of DNA quantity one usually gets from a single individual mosquito. Whole genome amplification could alleviate the issue but it also creates bias in genome representation. While trying to find alternative DNA extraction protocols for improved DNA yield, we found that a combination of the tissue lysis protocol from Life Technologies and the DNA extraction protocol from Qiagen yielded a higher DNA amount than the protocol using the Qiagen or Life Technologies kit only. We have not rigorously tested all the possible combinations of extraction protocols; we also only tested this on mosquito samples. Therefore, our finding should be noted as a suggestion for improving people’s own DNA extraction protocols and not as an advertisement of a commercially available product. PMID:26937269

  19. Molecular architecture of the HerA-NurA DNA double-strand break resection complex.

    PubMed

    Byrne, Robert Thomas; Schuller, Jan Michael; Unverdorben, Pia; Förster, Friedrich; Hopfner, Karl-Peter

    2014-12-20

    DNA double-strand breaks can be repaired by homologous recombination, during which the DNA ends are long-range resected by helicase-nuclease systems to generate 3' single strand tails. In archaea, this requires the Mre11-Rad50 complex and the ATP-dependent helicase-nuclease complex HerA-NurA. We report the cryo-EM structure of Sulfolobus solfataricus HerA-NurA at 7.4Å resolution and present the pseudo-atomic model of the complex. HerA forms an ASCE hexamer that tightly interacts with a NurA dimer, with each NurA protomer binding three adjacent HerA HAS domains. Entry to NurA's nuclease active sites requires dsDNA to pass through a 23Å wide channel in the HerA hexamer. The structure suggests that HerA is a dsDNA translocase that feeds DNA into the NurA nuclease sites.

  20. LKB1 is a DNA damage response protein that regulates cellular sensitivity to PARP inhibitors

    PubMed Central

    Wang, Huibo; Wang, Shuai; Hang, Wei; Zeng, Qinghua; Quan, Cheng-Shi; Zhai, Ying-Xian; Wang, Jian-Wei; Shen, Xiang-Feng; Jian, Yong-Ping; Zhao, Rui-Xun; Werle, Kaitlin D.; Cui, Rutao; Liang, Jiyong; Li, Yu-Lin; Xu, Zhi-Xiang

    2016-01-01

    Liver kinase B1 (LKB1) functions as a tumor suppressor encoded by STK11, a gene that mutated in Peutz-Jeghers syndrome and in sporadic cancers. Previous studies showed that LKB1 participates in IR- and ROS-induced DNA damage response (DDR). However, the impact of LKB1 mutations on targeted cancer therapy remains unknown. Herein, we demonstrated that LKB1 formed DNA damage-induced nuclear foci and co-localized with ataxia telangiectasia mutated kinase (ATM), γ-H2AX, and breast cancer susceptibility 1 (BRCA1). ATM mediated LKB1 phosphorylation at Thr 363 following the exposure of cells to ionizing radiation (IR). LKB1 interacted with BRCA1, a downstream effector in DDR that is recruited to sites of DNA damage and functions directly in homologous recombination (HR) DNA repair. LKB1 deficient cells exhibited delayed DNA repair due to insufficient HR. Notably, LKB1 deficiency sensitized cells to poly (ADP-ribose) polymerase (PARP) inhibitors. Thus, we have demonstrated a novel function of LKB1 in DNA damage response. Cancer cells lacking LKB1 are more susceptible to DNA damage-based therapy and, in particular, to drugs that further impair DNA repair, such as PARP inhibitors. PMID:27705915

  1. DEVELOPMENT OF A DNA ARCHIVE FOR GENETIC MONITORING OF FISH POPULATIONS

    EPA Science Inventory

    Analysis of intraspecific genetic diversity provides a potentially powerful tool to estimate the impacts of environmental stressors on populations. Genetic responses of populations to novel stressors include dramatic shifts in genotype frequencies at loci under selection (i.e. ad...

  2. Magnetic and gold-coated magnetic nanoparticles as a DNA sensor.

    PubMed

    Kouassi, Gilles K; Irudayaraj, Joseph

    2006-05-15

    In this study, we report the chemical synthesis and functionalization of magnetic and gold-coated magnetic nanoparticles and the immobilization of single-stranded biotinylated oligonucleotides onto these particles. Selected sequences specific to the BRCA1 gene were used as a test platform. The binding of oligonucleotides to these particles was achieved through a streptavidin-biotin bridge via a carbodiimide activation protocol. Particle size and oligonucleotide attachment were confirmed by transmission electron microscopy; oligonucleotide binding was characterized by Fourier transform infrared spectroscopy and hybridization confirmed by fluorescence emission from the fluorophore attached to the target oligonucleotide strand. The rate of hybridization was measured using a spectrofluorometer and a microarray scanner. The rate of hybridization of oligonucleotides bound to the synthesized particles depends on the inorganic support material and its surface chemistry. The rate of hybridization increased concomitantly with the concentration of the probe and the target in the reaction medium. Furthermore, exposure of probe and target oligonucleotide to a combination of target and noncomplementary DNA strand reduced the rate of hybridization, possibly because of steric crowding in the reaction medium and cross-linking between reacting oligonucleotides and the noncomplementary strands. The study undertaken opens several possibilities in bioconjugate attachment to functionalized iron and iron nanocomposite structures for controlled manipulation and handling using magnetic fields.

  3. Use of a dual-labelled oligonucleotide as a DNA dosemeter for radiological exposure detection.

    PubMed

    Wood, T; Lewis, B J; McDermott, K; Bennett, L G I; Avarmaa, K; Corcoran, E C; Wilkinson, D; Jones, A; Jones, T; Kennedy, E; Prud'homme-Lalonde, L; Boudreau, D; Gravel, J-F; Drolet, C; Kerr, A; Schreiner, L J; Pierre, J R M; Blagoeva, R; Veres, T

    2012-01-01

    A reporter molecule consisting of a synthetic oligonucleotide is being characterised for a novel damage detection scenario for its potential use as a field-deployable, personal deoxyribonucleic acid (DNA) dosemeter for radiation detection. This dosemeter is devoid of any biological properties other than being naked DNA and therefore has no DNA repair capabilities. It supports biodosimetry techniques, which require lengthy analysis of cells from irradiated individuals, and improves upon inorganic dosimetry, thereby providing for a more relevant means of measuring the accumulated dose from a potentially mixed-radiation field. Radiation-induced single strand breaks (SSBs) within the DNA result in a quantifiable fluorescent signal. Proof of concept has been achieved over 250 mGy-10 Gy dose range in radiation fields from ⁶⁰Co, with similar results seen using a linear accelerator X-ray source. Further refinements to both the molecule and the exposure/detection platform are expected to lead to enhanced levels of detection for mixed-field radiological events.

  4. Subunit Conformations and Assembly States of a DNA Translocating Motor: The Terminase of Bacteriophage P22

    PubMed Central

    Němeček, Daniel; Gilcrease, Eddie B.; Kang, Sebyung; Prevelige, Peter E.; Casjens, Sherwood; Thomas, George J.

    2007-01-01

    Bacteriophage P22, a podovirus infecting strains of Salmonella typhimurium, packages a 42 kbp genome using a headful mechanism. DNA translocation is accomplished by the phage terminase, a powerful molecular motor consisting of large and small subunits. Although many of the structural proteins of the P22 virion have been well characterized, little is known about the terminase subunits and their molecular mechanism of DNA translocation. We report here structural and assembly properties of ectopically expressed and highly purified terminase large and small subunits. The large subunit (gp2), which contains the nuclease and ATPase activities of terminase, exists as a stable monomer with an α/β fold. The small subunit (gp3), which recognizes DNA for packaging and may regulate gp2 activity, exhibits a highly α-helical secondary structure and self-associates to form a stable oligomeric ring in solution. For wildtype gp3, the ring contains nine subunits, as demonstrated by hydrodynamic measurements, electron microscopy and native mass spectrometry. We have also characterized a gp3 mutant (Ala 112 → Thr) that forms a ten subunit ring, despite a subunit fold indistinguishable from wildtype. Both the nonameric and decameric gp3 rings exhibit nonspecific DNA binding activity, and gp2 is able to bind strongly to the DNA/gp3 complex but not to DNA alone. We propose a scheme for the roles of P22 terminase large and small subunits in the recruitment and packaging of viral DNA and discuss the model in relation to proposals for terminase-driven DNA translocation in other phages. PMID:17945256

  5. Development of a DNA Microarray for Molecular Identification of All 46 Salmonella O Serogroups

    PubMed Central

    Guo, Dan; Liu, Bin; Liu, Fenxia; Cao, Boyang; Chen, Min; Hao, Xiyan; Feng, Lu

    2013-01-01

    Salmonella is a major cause of food-borne disease in many countries. Serotype determination of Salmonella is important for disease assessment, infection control, and epidemiological surveillance. In this study, a microarray system that targets the O antigen-specific genes was developed for simultaneously detecting and identifying all 46 Salmonella O serogroups. Of these, 40 serogroups can be confidently identified, and the remaining 6, in three pairs (serogroups O67 and B, E1 and E4, and A and D1), need to be further distinguished from each other using PCR methods or conventional serotyping methods. The microarray was shown to be highly specific when evaluated against 293 Salmonella strains, 186 Shigella strains, representative Escherichia coli strains, and 10 strains of other bacterial species. The assay correctly identified 288 (98%) of the Salmonella strains. The detection sensitivity was determined to be 50 ng genomic DNA per sample. By testing simulated samples in a tomato background, 2 to 8 CFU per gram inoculated could be detected after enrichment. This newly developed microarray assay is the first molecular protocol that can be used for the comprehensive detection and identification of all 46 Salmonella O serogroups. Compared to the traditional serogrouping method, the microarray provides a reliable, high-throughput, and sensitive approach that can be used for rapid identification of multiple Salmonella O serogroups simultaneously. PMID:23524674

  6. A DNA polymerase from maize axes: its purification and possible role.

    PubMed

    Coello, P; Rodríquez, R; García, E; Vázquez-Ramos, J M

    1992-12-01

    Three different DNA polymerase activities can be resolved by passing a protein extract from 24 h imbibed maize axes through DEAE-cellulose. These activities have been numbered 1, 2 and 3, according to their elution order. One of them, DNA polymerase 2, elutes at 100-120 mM phosphates. This enzyme was further purified by passing it through Heparin-Sepharose, Sephacryl S-300 and DNA cellulose. Purification was nearly 5000-fold. The enzyme needs Mg2+, is stimulated by K+, has an optimum pH of 7.0 and its optimum temperature is 30-37 degrees C. Specific inhibitors for different types of polymerases, such as aphidicolin, dideoxythymidine triphosphate and N-ethyl maleimide, gave intermediate values of inhibition, making impossible the definition of the type of enzyme purified by its inhibitory pattern. SDS-PAGE indicated the presence of several bands of molecular masses of 28-40, 56 and 15 kDa. Most of these bands could be visualized when proteins from crude extracts were analyzed by western blot, using an antibody against calf thymus DNA polymerase alpha. A high molecular mass (around 500 kDa) was calculated by western blot of native gels using the same antibody. Finally, specific activity of this enzyme increased 100-fold during maize germination whereas polymerase 3 virtually did not increase. Furthermore, immunoprecipitation experiments with the antipolymerase alpha-antibody showed a decrease in DNA polymerase activity by 70%. The possibility that polymerase 2 is a replicative enzyme is discussed.

  7. A DNA break– and phosphorylation-dependent positive feedback loop promotes immunoglobulin class-switch recombination

    PubMed Central

    Vuong, Bao Q; Ucher, Anna J; Donghia, Nina M; Gu, Xiwen; Nicolas, Laura; Nowak, Urszula; Rahman, Numa; Strout, Matthew P; Mills, Kevin D; Stavnezer, Janet; Chaudhuri, Jayanta

    2014-01-01

    The ability of activation-induced cytidine deaminase (AID) to efficiently mediate class-switch recombination (CSR) is dependent on its phosphorylation at Ser38; however, the trigger that induces AID phosphorylation and the mechanism by which phosphorylated AID drives CSR have not been elucidated. Here we found that phosphorylation of AID at Ser38 was induced by DNA breaks. Conversely, in the absence of AID phosphorylation, DNA breaks were not efficiently generated at switch (S) regions in the immunoglobulin heavy-chain locus (Igh), consistent with a failure of AID to interact with the endonuclease APE1. Additionally, deficiency in the DNA-damage sensor ATM impaired the phosphorylation of AID at Ser38 and the interaction of AID with APE1. Our results identify a positive feedback loop for the amplification of DNA breaks at S regions through the phosphorylation- and ATM-dependent interaction of AID with APE1. PMID:24097111

  8. Integration of clinical point-of-care requirements in a DNA microarray genotyping test.

    PubMed

    Van Dorst, Bieke; Cremers, Amelieke; Jans, Karolien; Van Domburg, Trees; Steegen, Kim; Huang, Chengjun; Dorrer, Christian; Lagae, Liesbet; Ferwerda, Gerben; Stuyver, Lieven J

    2014-11-15

    Various proof-of-concept studies have shown the potential of biosensors with a high multiplex detection capability for the readout of DNA microarrays in a lab-on-a-chip. This is particularly interesting for the development of point-of-care genotyping tests, to screen for multiple pathogens and/or antibiotic resistance patterns. In this paper, an assay workflow is presented, suited for the development of novel lab-on-a-chips with an integrated DNA microarray. Besides the description of the different assay steps (DNA purification, amplification and detection), a control strategy is presented according to recommendations of the US Food and Drug Administration (FDA). To use a lab-on-a-chip for diagnostic applications, the optimization and evaluation of the assay performance with clinical samples is very important. Therefore, appropriate quantification methods are described, which allow optimization and evaluation of the separate assay steps, as well as total assay performance. In order to demonstrate and evaluate the total workflow, blood samples spiked with Streptococcus pneumoniae were tested. All blood samples with ≥ 10(3)CFU S. pneumoniae per ml of human blood were successfully detected by this genotyping assay.

  9. Algebraic Statistics of Poincaré Recurrences in a DNA Molecule.

    PubMed

    Mazur, Alexey K; Shepelyansky, D L

    2015-10-30

    The statistics of Poincaré recurrences is studied for the base-pair breathing dynamics of an all-atom DNA molecule in a realistic aqueous environment with thousands of degrees of freedom. It is found that at least over five decades in time the decay of recurrences is described by an algebraic law with the Poincaré exponent close to β=1.2. This value is directly related to the correlation decay exponent ν=β-1, which is close to ν≈0.15 observed in the time resolved Stokes shift experiments. By applying the virial theorem we analyze the chaotic dynamics in polynomial potentials and demonstrate analytically that an exponent β=1.2 is obtained assuming the dominance of dipole-dipole interactions in the relevant DNA dynamics. Molecular dynamics simulations also reveal the presence of strong low frequency noise with the exponent η=1.6. We trace parallels with the chaotic dynamics of symplectic maps with a few degrees of freedom characterized by the Poincaré exponent β~1.5.

  10. Evidence for a DNA-relay mechanism in ParABS-mediated chromosome segregation.

    PubMed

    Lim, Hoong Chuin; Surovtsev, Ivan Vladimirovich; Beltran, Bruno Gabriel; Huang, Fang; Bewersdorf, Jörg; Jacobs-Wagner, Christine

    2014-05-23

    The widely conserved ParABS system plays a major role in bacterial chromosome segregation. How the components of this system work together to generate translocation force and directional motion remains uncertain. Here, we combine biochemical approaches, quantitative imaging and mathematical modeling to examine the mechanism by which ParA drives the translocation of the ParB/parS partition complex in Caulobacter crescentus. Our experiments, together with simulations grounded on experimentally-determined biochemical and cellular parameters, suggest a novel 'DNA-relay' mechanism in which the chromosome plays a mechanical function. In this model, DNA-bound ParA-ATP dimers serve as transient tethers that harness the elastic dynamics of the chromosome to relay the partition complex from one DNA region to another across a ParA-ATP dimer gradient. Since ParA-like proteins are implicated in the partitioning of various cytoplasmic cargos, the conservation of their DNA-binding activity suggests that the DNA-relay mechanism may be a general form of intracellular transport in bacteria.DOI: http://dx.doi.org/10.7554/eLife.02758.001.

  11. Solvent and solvent isotope effects on the vibrational cooling dynamics of a DNA base derivative.

    PubMed

    Middleton, Chris T; Cohen, Boiko; Kohler, Bern

    2007-10-25

    Vibrational cooling by 9-methyladenine was studied in a series of solvents by femtosecond transient absorption spectroscopy. Signals at UV and near-UV probe wavelengths were assigned to hot ground state population created by ultrafast internal conversion following electronic excitation by a 267 nm pump pulse. A characteristic time for vibrational cooling was determined from bleach recovery signals at 250 nm. This time increases progressively in H2O (2.4 ps), D2O (4.2 ps), methanol (4.5 ps), and acetonitrile (13.1 ps), revealing a pronounced solvent effect on the dissipation of excess vibrational energy. The trend also indicates that the rate of cooling is enhanced in solvents with a dense network of hydrogen bonds. The faster rate of cooling seen in H2O vs D2O is noteworthy in view of the similar hydrogen bonding and macroscopic thermal properties of both liquids. We propose that the solvent isotope effect arises from differences in the rates of solute-solvent vibrational energy transfer. Given the similarities of the vibrational friction spectra of H2O and D2O at low frequencies, the solvent isotope effect may indicate that a considerable portion of the excess energy decays by exciting relatively high frequency (>/=700 cm-1) solvent modes.

  12. Regulation at a distance of biomolecular interactions using a DNA origami nanoactuator

    PubMed Central

    Ke, Yonggang; Meyer, Travis; Shih, William M.; Bellot, Gaetan

    2016-01-01

    The creation of nanometre-sized structures that exhibit controllable motions and functions is a critical step towards building nanomachines. Recent developments in the field of DNA nanotechnology have begun to address these goals, demonstrating complex static or dynamic nanostructures made of DNA. Here we have designed and constructed a rhombus-shaped DNA origami ‘nanoactuator' that uses mechanical linkages to copy distance changes induced on one half (‘the driver') to be propagated to the other half (‘the mirror'). By combining this nanoactuator with split enhanced green fluorescent protein (eGFP), we have constructed a DNA–protein hybrid nanostructure that demonstrates tunable fluorescent behaviours via long-range allosteric regulation. In addition, the nanoactuator can be used as a sensor that responds to specific stimuli, including changes in buffer composition and the presence of restriction enzymes or specific nucleic acids. PMID:26988942

  13. Disruption of a DNA topoisomerase I gene affects morphogenesis in Arabidopsis.

    PubMed

    Takahashi, Taku; Matsuhara, Shio; Abe, Mitsutomo; Komeda, Yoshibumi

    2002-09-01

    The genesis of phyllotaxis, which often is associated with the Fibonacci series of numbers, is an old unsolved puzzle in plant morphogenesis. Here, we show that disruption of an Arabidopsis topoisomerase (topo) I gene named TOP1alpha affects phyllotaxis and plant architecture. The divergence angles and internode lengths between two successive flowers were more random in the top1alpha mutant than in the wild type. The top1alpha plants sporadically produced multiple flowers from one node, and the number of floral organ primordia often was different. The mutation also caused the twisting of inflorescences and individual flowers and the serration of leaf margins. These morphological abnormalities indicate that TOP1alpha may play a critical role in the maintenance of a regular pattern of organ initiation. The top1alpha mutant transformed with the RNA interference construct for TOP1beta, another topo I gene arrayed tandemly with TOP1alpha, was found to be lethal at young seedling stages, suggesting that topo I activity is essential in plants.

  14. Establishing a DNA identification system for pigs (Sus scrofa) using a multiplex STR amplification.

    PubMed

    Lin, Yu-Chih; Hsieh, Hsing-Mei; Lee, James Chun-I; Hsiao, Chung-Ting; Lin, Der-Yuh; Linacre, Adrian; Tsai, Li-Chin

    2014-03-01

    In this study we establish a novel STR multiplex using 13 tetra-nucleotide STRs and the amelogenin marker for the forensic identification of pigs. The genotypes and allele frequency were generated based on 341 samples from 11 pig breeds in Taiwan. Genetic variation was tested including Na, Ne, Ho, He, F-statistics, PIC, Pm and PE for each STR locus and for each breed. Based upon the 341 samples in this study, the CPm and CPEtrio of the 13 STR loci were 1.31 E-11 and 0.9996 respectively. The CPItrio based on ten family sets ranged from 4.012 E+4 to 4.332 E+6 for paternity test. Validation of the multiplex included: determining the sensitivity of the test, where reproducible full DNA profiles were obtained using an initial template of between 0.25 and 1 ng; a comprehensive range of tissue types generated the same genotype; and the specificity was confirmed as no DNA full profile was generated for any species other than Sus scrofa. Based on the phylogenetic analysis, the European domestic breeds clustered separately from the Asian breeds, as expected, and their hybrids formed unique clades respectively between the clades of Asian and European breeds. Eleven test samples, acting as unknown samples, matched all expected breeds. We demonstrate that this novel 14-plex PCR system is valuable in pig individualization, parentage testing, breed assessment, phylogenetic study and forensic applications.

  15. Identification of a DNA methylation signature in blood cells from persons with Down Syndrome

    PubMed Central

    Bacalini, Maria Giulia; Gentilini, Davide; Boattini, Alessio; Giampieri, Enrico; Pirazzini, Chiara; Giuliani, Cristina; Fontanesi, Elisa; Scurti, Maria; Remondini, Daniel; Capri, Miriam; Cocchi, Guido; Ghezzo, Alessandro; Del Rio, Alberto; Luiselli, Donata; Vitale, Giovanni; Mari, Daniela; Castellani, Gastone; Fraga, Mario; Di Blasio, Anna Maria; Salvioli, Stefano; Franceschi, Claudio; Garagnani, Paolo

    2015-01-01

    Down Syndrome (DS) is characterized by a wide spectrum of clinical signs, which include segmental premature aging of central nervous and immune systems. Although it is well established that the causative defect of DS is the trisomy of chromosome 21, the molecular bases of its phenotype are still largely unknown. We used the Infinium HumanMethylation450 BeadChip to investigate DNA methylation patterns in whole blood from 29 DS persons, using their relatives (mothers and unaffected siblings) as controls. This family-based model allowed us to monitor possible confounding effects on DNA methylation patterns deriving from genetic and environmental factors. Although differentially methylated regions (DMRs) displayed a genome-wide distribution, they were enriched on chromosome 21. DMRs mapped in genes involved in developmental functions, including embryonic development (HOXA family) and haematological (RUNX1 and EBF4) and neuronal (NCAM1) development. Moreover, genes involved in the regulation of chromatin structure (PRMD8, KDM2B, TET1) showed altered methylation. The data also showed that several pathways are affected in DS, including PI3K-Akt signaling. In conclusion, we identified an epigenetic signature of DS that sustains a link between developmental defects and disease phenotype, including segmental premature aging. PMID:25701644

  16. Protein domains and conformational changes in the activation of RepA, a DNA replication initiator.

    PubMed Central

    Giraldo, R; Andreu, J M; Díaz-Orejas, R

    1998-01-01

    RepA is the DNA replication initiator protein of the Pseudomonas plasmid pPS10. RepA has a dual function: as a dimer, it binds to an inversely-repeated sequence acting as a repressor of its own synthesis; as a monomer, RepA binds to four directly-repeated sequences to constitute a specialized nucleoprotein complex responsible for the initiation of DNA replication. We have previously shown that a Leucine Zipper-like motif (LZ) at the N-terminus of RepA is responsible for protein dimerization. In this paper we characterize the existence in RepA of two protein globular domains C-terminal to the LZ. We propose that dissociation of RepA dimers into monomers results in a conformational change from a compact arrangement of both domains, competent for binding to the operator, to an extended species that is suited for iteron binding. This model establishes the structural basis for the activation of DNA replication initiators in plasmids from Gram-negative bacteria. PMID:9687517

  17. Temperate Myxococcus xanthus phage Mx8 encodes a DNA adenine methylase, Mox.

    PubMed

    Magrini, V; Salmi, D; Thomas, D; Herbert, S K; Hartzell, P L; Youderian, P

    1997-07-01

    Temperate bacteriophage Mx8 of Myxococcus xanthus encapsidates terminally repetitious DNA, packaged as circular permutations of its 49-kbp genome. During both lytic and lysogenic development, Mx8 expresses a nonessential DNA methylase, Mox, which modifies adenine residues in occurrences of XhoI and PstI recognition sites, CTCGAG and CTGCAG, respectively, on both phage DNA and the host chromosome. The mox gene is necessary for methylase activity in vivo, because an amber mutation in the mox gene abolishes activity. The mox gene is the only phage gene required for methylase activity in vivo, because ectopic expression of mox as part of the M. xanthus mglBA operon results in partial methylation of the host chromosome. The predicted amino acid sequence of Mox is related most closely to that of the methylase involved in the cell cycle control of Caulobacter crescentus. We speculate that Mox acts to protect Mx8 phage DNA against restriction upon infection of a subset of natural M. xanthus hosts. One natural isolate of M. xanthus, the lysogenic source of related phage Mx81, produces a restriction endonuclease with the cleavage specificity of endonuclease BstBI.

  18. A DNA/HDAC dual-targeting drug CY190602 with significantly enhanced anticancer potency.

    PubMed

    Liu, Chuan; Ding, Hongyu; Li, Xiaoxi; Pallasch, Christian P; Hong, Liya; Guo, Dianwu; Chen, Yi; Wang, Difei; Wang, Wei; Wang, Yajie; Hemann, Michael T; Jiang, Hai

    2015-03-09

    Genotoxic drugs constitute a major treatment modality for human cancers; however, cancer cells' intrinsic DNA repair capability often increases the threshold of lethality and renders these drugs ineffective. The emerging roles of HDACs in DNA repair provide new opportunities for improving traditional genotoxic drugs. Here, we report the development and characterization of CY190602, a novel bendamustine-derived drug with significantly enhanced anticancer potency. We show that CY190602's enhanced potency can be attributed to its newly gained ability to inhibit HDACs. Using this novel DNA/HDAC dual-targeting drug as a tool, we further explored HDAC's role in DNA repair. We found that HDAC activities are essential for the expression of several genes involved in DNA synthesis and repair, including TYMS, Tip60, CBP, EP300, and MSL1. Importantly, CY190602, the first-in-class example of such DNA/HDAC dual-targeting drugs, exhibited significantly enhanced anticancer activity in vitro and in vivo. These findings provide rationales for incorporating HDAC inhibitory moieties into genotoxic drugs, so as to overcome the repair capacity of cancer cells. Systematic development of similar DNA/HDAC dual-targeting drugs may represent a novel opportunity for improving cancer therapy.

  19. Tuning the stereoselectivity of a DNA-catalyzed michael addition through covalent modification.

    PubMed

    Dey, Surjendu; Jäschke, Andres

    2015-09-14

    Complexes of G-quadruplex DNA and Cu(II) ions have previously been applied as catalysts in asymmetric reactions, but the largely unspecific and noncovalent nature of the interaction has impeded understanding of the structural basis of catalysis. To better control the formation of a catalytically competent species, DNA quadruplexes were derivatized with linker-bpy-Cu(II) complexes in a site-specific manner and applied in asymmetric aqueous Michael additions. These modified quadruplexes exhibited high rate acceleration and stereoselectivity. Different factors were found to be important for the catalytic performance of the modified G-quadruplexes, among them, the position of modification, the topology of the quadruplex, the nature of the ligand, and the length of the linker between the ligand and DNA. Moving the same ligand by just two nucleotides inverted the stereochemical outcome: quadruplexes modified at position 10 formed the (-)-enantiomer with up to 92 % ee, while DNA derivatized at position 12 formed the (+)-enantiomer with up to 75 % ee. This stereopreference was maintained when applied to structurally different Michael acceptors. This work demonstrates a new and simple way to tune the stereoselectivity in DNA-based asymmetric catalysis.

  20. The degree of apoptosis as an immunostimulant for a DNA vaccine against HIV-1 infection.

    PubMed

    Kojima, Yoshitsugu; Jounai, Nao; Takeshita, Fumihiko; Nakazawa, Masatoshi; Okuda, Kentaro; Watabe, Setsuko; Xin, Ke-Qin; Okuda, Kenji

    2007-01-05

    To regulate the expression of the apoptotic gene, we constructed bicistronic DNA vaccines that encode for HIV env and caspase-3 mutant (casp 3m) that are expressed via the encephalomyocarditis virus internal ribosomal entry site (IRES) or cytomegalovirus (CMV) promoter-dependent translations. While IRES-casp 3m induced weak apoptosis and caused little reduction in antigen expression, CMV-casp 3m elicited strong apoptosis and led to a marked decrease in the antigen expression. Therefore, IRES-casp 3m augmented HIV-specific immune responses, and IRES-casp 3m induced significant protection against the vaccinia-HIV chimeric virus. These results suggest that the appropriate level of apoptosis is important for DNA vaccine development.

  1. Transcription-driven twin supercoiling of a DNA loop: A Brownian dynamics study

    NASA Astrophysics Data System (ADS)

    Mielke, Steven P.; Fink, William H.; Krishnan, V. V.; Grønbech-Jensen, Niels; Benham, Craig J.

    2004-10-01

    The torque generated by RNA polymerase as it tracks along double-stranded DNA can potentially induce long-range structural deformations integral to mechanisms of biological significance in both prokaryotes and eukaryotes. In this paper, we introduce a dynamic computer model for investigating this phenomenon. Duplex DNA is represented as a chain of hydrodynamic beads interacting through potentials of linearly elastic stretching, bending, and twisting, as well as excluded volume. The chain, linear when relaxed, is looped to form two open but topologically constrained subdomains. This permits the dynamic introduction of torsional stress via a centrally applied torque. We simulate by Brownian dynamics the 100 μs response of a 477-base pair B-DNA template to the localized torque generated by the prokaryotic transcription ensemble. Following a sharp rise at early times, the distributed twist assumes a nearly constant value in both subdomains, and a succession of supercoiling deformations occurs as superhelical stress is increasingly partitioned to writhe. The magnitude of writhe surpasses that of twist before also leveling off when the structure reaches mechanical equilibrium with the torsional load. Superhelicity is simultaneously right handed in one subdomain and left handed in the other, as predicted by the "transcription-induced twin-supercoiled-domain" model [L. F. Liu and J. C. Wang, Proc. Natl. Acad. Sci. U.S.A. 84, 7024 (1987)]. The properties of the chain at the onset of writhing agree well with predictions from theory, and the generated stress is ample for driving secondary structural transitions in physiological DNA.

  2. Electrochemical control of a DNA Holliday Junction nanoswitch by Mg2+ ions.

    PubMed

    Ferapontova, E E; Mountford, C P; Crain, J; Buck, A H; Dickinson, P; Beattie, J S; Ghazal, P; Terry, J G; Walton, A J; Mount, A R

    2008-11-15

    The molecular conformation of a synthetic branched, 4-way DNA Holliday junction (HJ) was electrochemically switched between the open and closed (stacked) conformers. Switching was achieved by electrochemically induced quantitative release of Mg(2+) ions from the oxidised poly(N-methylpyrrole) film (PPy), which contained polyacrylate as an immobile counter anion and Mg(2+) ions as charge compensating mobile cations. This increase in the Mg(2+) concentration screened the electrostatic repulsion between the widely separated arms in the open HJ configuration, inducing switching to the closed conformation. Upon electrochemical reduction of PPy, entrapment of Mg(2+) ions back into the PPy film induced the reverse HJ switching from the closed to open state. The conformational transition was monitored using fluorescence resonance energy transfer (FRET) between donor and acceptor dyes each located at the terminus of one of the arms. The demonstrated electrochemical control of the conformation of the used probe-target HJ complex, previously reported as a highly sequence specific nanodevice for detecting of unlabelled target [Buck, A.H., Campbell, C.J., Dickinson, P., Mountford, C.P., Stoquert, H.C., Terry, J.G., Evans, S.A.G., Keane, L., Su, T.J., Mount, A.R., Walton, A.J., Beattie, J.S., Crain, J., Ghazal, P., 2007. Anal. Chem., 79, 4724-4728], allows the development of electronically addressable DNA nanodevices and label-free gene detection assays.

  3. A DNA methylation classifier of cervical precancer based on human papillomavirus and human genes.

    PubMed

    Brentnall, Adam R; Vasiljević, Nataša; Scibior-Bentkowska, Dorota; Cadman, Louise; Austin, Janet; Szarewski, Anne; Cuzick, Jack; Lorincz, Attila T

    2014-09-15

    Testing for high-risk (hr) types of human papillomavirus (HPV) is highly sensitive as a screening test of high-grade cervical intraepithelial neoplastic (CIN2/3) disease, the precursor of cervical cancer. However, it has a relatively low specificity. Our objective was to develop a prediction rule with a higher specificity, using combinations of human and HPV DNA methylation. Exfoliated cervical specimens from colposcopy-referral cohorts in London were analyzed for DNA methylation levels by pyrosequencing in the L1 and L2 regions of HPV16, HPV18, HPV31 and human genes EPB41L3, DPYS and MAL. Samples from 1,493 hrHPV-positive women were assessed and of these 556 were found to have CIN2/3 at biopsy; 556 tested positive for HPV16 (323 CIN2/3), 201 for HPV18 (73 CIN2/3) and 202 for HPV31 (98 CIN2/3). The prediction rule included EPB41L3 and HPV and had area under curve 0.80 (95% CI 0.78-0.82). For 90% sensitivity, specificity was 36% (33-40) and positive predictive value (PPV) was 46% (43-48). By HPV type, 90% sensitivity corresponded to the following specificities and PPV, respectively: HPV16, 38% (32-45) and 67% (63-71); HPV18, 53% (45-62) and 52% (45-59); HPV31, 39% (31-49) and 58% (51-65); HPV16, 18 or 31, 44% (40-49) and 62% (59-65) and other hrHPV 17% (14-21) and 21% (18-24). We conclude that a methylation assay in hrHPV-positive women might improve PPV with minimal sensitivity loss. © 2014 The Authors. UICC.

  4. Positive association between a DNA sequence variant in the serotonin 2A receptor gene and schizophrenia

    SciTech Connect

    Inayama, Y.; Yoneda, H.; Sakai, T.

    1996-02-16

    Sixty-two patients with schizophrenia and 96 normal controls were investigated for genetic association with restriction fragment length polymorphisms (RFLPs) in the serotonin receptor genes. A positive association between the serotonin 2A receptor gene (HTR2A) and schizophrenia was found, but not between schizophrenia and the serotonin 1A receptor gene. The positive association we report here would suggest that the DNA region with susceptibility to schizophrenia lies in the HTR2A on the long arm of chromosome 13. 15 refs., 2 tabs.

  5. Molecular Cloning and Analysis of a DNA Repetitive Element from the Mouse Genome

    ERIC Educational Resources Information Center

    Geisinger, Adriana; Cossio, Gabriela; Wettstein, Rodolfo

    2006-01-01

    We report the development of a 3-week laboratory activity for an undergraduate molecular biology course. This activity introduces students to the practice of basic molecular techniques such as restriction enzyme digestion, agarose gel electrophoresis, cloning, plasmid DNA purification, Southern blotting, and sequencing. Students learn how to carry…

  6. Quantification of Fewer than Ten Copies of a DNA Biomarker without Amplification or Labeling.

    PubMed

    Lee, Yoonhee; Kim, Youngkyu; Lee, Donggyu; Roy, Dhruvajyoti; Park, Joon Won

    2016-06-08

    Polymerase chain reaction (PCR) is a highly sensitive diagnosis technique for detection of nucleic acids and for monitoring residual disease; however, PCR can be unreliable for samples containing very few target molecules. Here, we describe a quantification method, using force-distance (FD) curve based atomic force microscopy (AFM) to detect a target DNA bound to small (1.4-1.9 μm diameter) probe DNA spots, allowing mapping of entire spots to nanometer resolution. Using a synthetic BCR-ABL fusion gene sequence target, we examined samples containing between one and 10 target copies. A high degree of correlation (r(2) = 0.994) between numbers of target copies and detected probe clusters was observed, and the approach could detect the BCR-ABL biomarker when only a single copy was present, although multiple screens were required. Our results clearly demonstrate that FD curve-based imaging is suitable for quantitative analysis of fewer than 10 copies of DNA biomarkers without amplification, modification, or labeling.

  7. Use of a DNA microarray for detection and identification of bacterial pathogens associated with fishery products.

    PubMed

    Cao, Boyang; Li, Rongrong; Xiong, Songjin; Yao, Fangfang; Liu, Xiangqian; Wang, Min; Feng, Lu; Wang, Lei

    2011-12-01

    We established a microarray for the simultaneous detection and identification of diverse putative pathogens often associated with fishery products by targeting specific genes of Listeria monocytogenes, Salmonella, Shigella, Staphylococcus aureus, Streptococcus pyogenes, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, and Yersinia enterocolitica and the 16S-23S rRNA gene internal transcribed spacer (ITS) region of Proteus mirabilis and Proteus vulgaris. The microarray contained 26 specific probes and was tested against a total of 123 target bacterial strains that included 55 representative strains, 68 clinical isolates, and 45 strains of other bacterial species that belonged to 8 genera and 34 species, and it was shown to be specific and reproducible. A detection sensitivity of 10 ng DNA or 10 CFU/ml for pure cultures of each target organism demonstrated that the assay was highly sensitive and reproducible. Mock and real fishery product samples were tested by the microarray, and the accuracy was 100%. The DNA microarray method described in this communication is specific, sensitive, and reliable and has several advantages over traditional methods of bacterial culture and antiserum agglutination assays.

  8. The fork and the kinase: a DNA replication tale from a CHK1 perspective.

    PubMed

    González Besteiro, Marina A; Gottifredi, Vanesa

    2015-01-01

    Replication fork progression is being continuously hampered by exogenously introduced and naturally occurring DNA lesions and other physical obstacles. Checkpoint kinase 1 (Chk1) is activated at replication forks that encounter damaged DNA. Subsequently, Chk1 inhibits the initiation of new replication factories and stimulates the firing of dormant origins (those in the vicinity of stalled forks). Chk1 also avoids fork collapse into DSBs (double strand breaks) and promotes fork elongation. At the molecular level, the current model considers stalled forks as the site of Chk1 activation and the nucleoplasm as the location where Chk1 phosphorylates target proteins. This model certainly serves to explain how Chk1 modulates origin firing, but how Chk1 controls the fate of stalled forks is less clear. Interestingly, recent reports demonstrating that Chk1 phosphorylates chromatin-bound proteins and even holds kinase-independent functions might shed light on how Chk1 contributes to the elongation of damaged DNA. Indeed, such findings have unveiled a puzzling connection between Chk1 and DNA lesion bypass, which might be central to promoting fork elongation and checkpoint attenuation. In summary, Chk1 is a multifaceted and versatile signaling factor that acts at ongoing forks and replication origins to determine the extent and quality of the cellular response to replication stress.

  9. Catalytic enantioselective syn hydration of enones in water using a DNA-based catalyst.

    PubMed

    Boersma, Arnold J; Coquière, David; Geerdink, Danny; Rosati, Fiora; Feringa, Ben L; Roelfes, Gerard

    2010-11-01

    The enantioselective addition of water to olefins in an aqueous environment is a common transformation in biological systems, but was beyond the ability of synthetic chemists. Here, we present the first examples of a non-enzymatic catalytic enantioselective hydration of enones, for which we used a catalyst that comprises a copper complex, based on an achiral ligand, non-covalently bound to (deoxy)ribonucleic acid, which is the only source of chirality present under the reaction conditions. The chiral β-hydroxy ketone product was obtained in up to 82% enantiomeric excess. Deuterium-labelling studies demonstrated that the reaction is diastereospecific, with only the syn hydration product formed. So far, this diastereospecific and enantioselective reaction had no equivalent in conventional homogeneous catalysis.

  10. A DNA Barcode Library for Korean Chironomidae (Insecta: Diptera) and Indexes for Defining Barcode Gap

    PubMed Central

    Kim, Sungmin; Song, Kyo-Hong; Ree, Han-Il; Kim, Won

    2012-01-01

    Non-biting midges (Diptera: Chironomidae) are a diverse population that commonly causes respiratory allergies in humans. Chironomid larvae can be used to indicate freshwater pollution, but accurate identification on the basis of morphological characteristics is difficult. In this study, we constructed a mitochondrial cytochrome c oxidase subunit I (COI)-based DNA barcode library for Korean chironomids. This library consists of 211 specimens from 49 species, including adults and unidentified larvae. The interspecies and intraspecies COI sequence variations were analyzed. Sophisticated indexes were developed in order to properly evaluate indistinct barcode gaps that are created by insufficient sampling on both the interspecies and intraspecies levels and by variable mutation rates across taxa. In a variety of insect datasets, these indexes were useful for re-evaluating large barcode datasets and for defining COI barcode gaps. The COI-based DNA barcode library will provide a rapid and reliable tool for the molecular identification of Korean chironomid species. Furthermore, this reverse-taxonomic approach will be improved by the continuous addition of other speceis’ sequences to the library. PMID:22138764

  11. Development of a DNA Sensor Based on Nanoporous Pt-Rich Electrodes

    NASA Astrophysics Data System (ADS)

    Van Hao, Pham; Thanh, Pham Duc; Xuan, Chu Thi; Hai, Nguyen Hoang; Tuan, Mai Anh

    2017-02-01

    Nanoporous Pt-rich electrodes with 72 at.% Pt composition were fabricated by sputtering a Pt-Ag alloy, followed by an electrochemical dealloying process to selectively etch away Ag atoms. The surface properties of nanoporous membranes were investigated by energy-dispersive x-ray spectroscopy (EDS), scanning electron microscopy (SEM), atomic force microscopy (AFM), a documentation system, and a gel image system (Gel Doc Imager). A single strand of probe deoxyribonucleic acid (DNA) was immobilized onto the electrode surface by physical adsorption. The DNA probe and target hybridization were measured using a lock-in amplifier and an electrochemical impedance spectroscope (EIS). The nanoporous Pt-rich electrode-based DNA sensor offers a fast response time of 3.7 s, with a limit of detection (LOD) of 4.35 × 10-10 M of DNA target.

  12. Identification of the vascular plants of Churchill, Manitoba, using a DNA barcode library

    PubMed Central

    2012-01-01

    Background Because arctic plant communities are highly vulnerable to climate change, shifts in their composition require rapid, accurate identifications, often for specimens that lack diagnostic floral characters. The present study examines the role that DNA barcoding can play in aiding floristic evaluations in the arctic by testing the effectiveness of the core plant barcode regions (rbcL, matK) and a supplemental ribosomal DNA (ITS2) marker for a well-studied flora near Churchill, Manitoba. Results This investigation examined 900 specimens representing 312 of the 354 species of vascular plants known from Churchill. Sequencing success was high for rbcL: 95% for fresh specimens and 85% for herbarium samples (mean age 20 years). ITS2 worked equally well for the fresh and herbarium material (89% and 88%). However, sequencing success was lower for matK, despite two rounds of PCR amplification, which reflected less effective primer binding and sensitivity to the DNA degradation (76% of fresh, 45% of herbaria samples). A species was considered as taxonomically resolved if its members showed at least one diagnostic difference from any other taxon in the study and formed a monophyletic clade. The highest species resolution (69%) was obtained by combining information from all three genes. The joint sequence information for rbcL and matK distinguished 54% of 286 species, while rbcL and ITS2 distinguished 63% of 285 species. Discrimination of species within Salix, which constituted 8% of the flora, was particularly problematic. Despite incomplete resolution, the barcode results revealed 22 misidentified herbarium specimens, and enabled the identification of field specimens which were otherwise too immature to identify. Although seven cases of ITS2 paralogy were noted in the families Cyperaceae, Juncaceae and Juncaginaceae, this intergenic spacer played an important role in resolving congeneric plant species at Churchill. Conclusions Our results provided fast and cost-effective solution to create a comprehensive, effective DNA barcode reference library for a local flora. PMID:23190419

  13. Colloidal Au-enhanced surface plasmon resonance imaging: application in a DNA hybridization process

    NASA Astrophysics Data System (ADS)

    Manera, M. G.; Spadavecchia, J.; Taurino, A.; Rella, R.

    2010-03-01

    The detection of the DNA hybridization mechanism using monodispersed gold nanoparticles as labels is an interesting alternative to increase the sensitivity of the SPR imaging technique. DNA-modified Au nanoparticles (DNA-Au NPs) containing single-stranded (ss) portions of DNA were prepared by monitoring their monolayer formation by UV-vis spectroscopy. The hybridization process between specific thio-oligonucleotides immobilized on the DNA-Au NPs and the corresponding complementary strands is reported and compared with the traditional hybridization process on properly self-assembled thin gold films deposited on glass substrates. A remarkable signal amplification is observed, following the incorporation of colloidal Au into a SPR biosensing experiment, resulting in an increased SPR response to DNA-DNA interactions. In particular Fusarium thiolated DNA (5'HS poly(T)15ATC CCT CAA AAA CTG CCG CT-3) and trichothecenes complementary DNA (5'-AGC GGC AGT TTT TGA GGG AT-3') sequences have been explored due to their possible application to agro-industry for the control of food quality.

  14. Epigenetic control of viral life-cycle by a DNA-methylation dependent transcription factor.

    PubMed

    Flower, Kirsty; Thomas, David; Heather, James; Ramasubramanyan, Sharada; Jones, Susan; Sinclair, Alison J

    2011-01-01

    Epstein-Barr virus (EBV) encoded transcription factor Zta (BZLF1, ZEBRA, EB1) is the prototype of a class of transcription factor (including C/EBPalpha) that interact with CpG-containing DNA response elements in a methylation-dependent manner. The EBV genome undergoes a biphasic methylation cycle; it is extensively methylated during viral latency but is reset to an unmethylated state following viral lytic replication. Zta is expressed transiently following infection and again during the switch between latency and lytic replication. The requirement for CpG-methylation at critical Zta response elements (ZREs) has been proposed to regulate EBV replication, specifically it could aid the activation of viral lytic gene expression from silenced promoters on the methylated genome during latency in addition to preventing full lytic reactivation from the non-methylated EBV genome immediately following infection. We developed a computational approach to predict the location of ZREs which we experimentally assessed using in vitro and in vivo DNA association assays. A remarkably different binding motif is apparent for the CpG and non-CpG ZREs. Computational prediction of the location of these binding motifs in EBV revealed that the majority of lytic cycle genes have at least one and many have multiple copies of methylation-dependent CpG ZREs within their promoters. This suggests that the abundance of Zta protein coupled with the methylation status of the EBV genome act together to co-ordinate the expression of lytic cycle genes at the majority of EBV promoters.

  15. The Relationship between Phenotype and Genotype: A DNA Transformation and DNA Isolation Laboratory Exercise.

    ERIC Educational Resources Information Center

    Guilfoile, Patrick; Plum, Stephen

    2000-01-01

    Provides laboratory exercises that demonstrate two genetic concepts: the difference between a genetic selection and a genetic screening experiment, and the relationship between phenotype and genotype. (SAH)

  16. Development of a DNA Sensor Based on Nanoporous Pt-Rich Electrodes

    NASA Astrophysics Data System (ADS)

    Van Hao, Pham; Thanh, Pham Duc; Xuan, Chu Thi; Hai, Nguyen Hoang; Tuan, Mai Anh

    2017-06-01

    Nanoporous Pt-rich electrodes with 72 at.% Pt composition were fabricated by sputtering a Pt-Ag alloy, followed by an electrochemical dealloying process to selectively etch away Ag atoms. The surface properties of nanoporous membranes were investigated by energy-dispersive x-ray spectroscopy (EDS), scanning electron microscopy (SEM), atomic force microscopy (AFM), a documentation system, and a gel image system (Gel Doc Imager). A single strand of probe deoxyribonucleic acid (DNA) was immobilized onto the electrode surface by physical adsorption. The DNA probe and target hybridization were measured using a lock-in amplifier and an electrochemical impedance spectroscope (EIS). The nanoporous Pt-rich electrode-based DNA sensor offers a fast response time of 3.7 s, with a limit of detection (LOD) of 4.35 × 10-10 M of DNA target.

  17. A DNA-Assembled Fe3O4@Ag Nanorod in Silica Matrix for Cholesterol Biosensing

    NASA Astrophysics Data System (ADS)

    Satvekar, R. K.; Tiwari, A. P.; Rohiwal, S. S.; Tiwale, B. M.; Pawar, S. H.

    2015-12-01

    A novel nanocomposite having DNA-assembled Fe3O4@Ag nanorods in silica matrix has been proposed for fabrication of bienzymatic cholesterol nanobiosensor. Cholesterol oxidase and horseradish peroxidase have been co-encapsulated in Silica/Fe3O4@Ag-DNA nanocomposite deposited on the indium tin oxide electrode. Cyclic voltammetry was employed for the electrochemical behavior of proposed biosensor and used to estimate cholesterol with a linear range of 5-195 mg/dL.

  18. Use of a DNA Microarray for Simultaneous Detection of Antibiotic Resistance Genes among Staphylococcal Clinical Isolates▿

    PubMed Central

    Zhu, Ling-Xiang; Zhang, Zhi-Wei; Wang, Can; Yang, Hua-Wei; Jiang, Di; Zhang, Qiong; Mitchelson, Keith; Cheng, Jing

    2007-01-01

    We developed a multiplex asymmetric PCR (MAPCR)-based DNA microarray assay for characterization of the clinically relevant antibiotic resistance genes leading to penicillin, methicillin, aminoglycoside, macrolide, lincosamide, and streptogramin B (MLSB) resistance in staphylococci. The DNA-based assay involves detection of specific conserved regions of the mecA, blaZ (methicillin and penicillin resistance), aac(6′)-Ie-aph(2‴) (aminoglycoside resistance), ermA and ermC genes (MLSB resistance), and the msrA gene (macrolide and streptogramin B resistance). The microarray uses a variable sequence region of the 16S rRNA gene to broadly differentiate between Staphylococcus aureus and other coagulase-negative staphylococci (CoNS). The performance of the microarray was validated with a total of 178 clinically important S. aureus and 237 CoNS isolates, with correlations of 100% for S. aureus to CoNS discrimination and more than 90% for antibiotic resistance between the genotypic analysis determined by the microarray and the phenotype determined by standard methods of species identification and susceptibility testing. The major discrepant results were 17 mecA-positive CoNS and 60 aac(6′)-Ie-aph(2‴)-positive CoNS isolates measured by microarray that were susceptible to the corresponding antibiotics based on disk diffusion assay. Overall, this microarray-based assay offers a simultaneous, fast (≤5 h), and accurate identification of antibiotic resistance genes from a single colony, as well as species classification. Our extensive validation of the microarray suggests that it may be a useful tool to complement phenotypic susceptibility testing in clinical laboratories and to survey the spread of antibiotic resistance determinants in epidemiological studies. PMID:17728472

  19. RecBCD enzyme is a DNA helicase with fast and slow motors of opposite polarity.

    PubMed

    Taylor, Andrew F; Smith, Gerald R

    2003-06-19

    Helicases are molecular motors that move along and unwind double-stranded nucleic acids. RecBCD enzyme is a complex helicase and nuclease, essential for the major pathway of homologous recombination and DNA repair in Escherichia coli. It has sets of helicase motifs in both RecB and RecD, two of its three subunits. This rapid, highly processive enzyme unwinds DNA in an unusual manner: the 5'-ended strand forms a long single-stranded tail, whereas the 3'-ended strand forms an ever-growing single-stranded loop and short single-stranded tail. Here we show by electron microscopy of individual molecules that RecD is a fast helicase acting on the 5'-ended strand and RecB is a slow helicase acting on the 3'-ended strand on which the single-stranded loop accumulates. Mutational inactivation of the helicase domain in RecB or in RecD, or removal of the RecD subunit, altered the rates of unwinding or the types of structure produced, or both. This dual-helicase mechanism explains how the looped recombination intermediates are generated and may serve as a general model for highly processive travelling machines with two active motors, such as other helicases and kinesins.

  20. Purification and Characterization of a DNA-Binding Recombinant PREP1:PBX1 Complex

    PubMed Central

    Mathiasen, Lisa; Bruckmann, Chiara; Pasqualato, Sebastiano; Blasi, Francesco

    2015-01-01

    Human PREP1 and PBX1 are homeodomain transcriptional factors, whose biochemical and structural characterization has not yet been fully described. Expression of full-length recombinant PREP1 (47.6 kDa) and PBX1 (46.6 kDa) in E. coli is difficult because of poor yield, high instability and insufficient purity, in particular for structural studies. We cloned the cDNA of both proteins into a dicistronic vector containing an N-terminal glutathione S-transferase (GST) tag and co-expressed and co-purified a stable PBX1:PREP1 complex. For structural studies, we produced two C-terminally truncated complexes that retain their ability to bind DNA and are more stable than the full-length proteins through various purification steps. Here we report the production of large amounts of soluble and pure recombinant human PBX1:PREP1 complex in an active form capable of binding DNA. PMID:25856340

  1. Design of a DNA chip for detection of unknown genetically modified organisms (GMOs).

    PubMed

    Nesvold, Håvard; Kristoffersen, Anja Bråthen; Holst-Jensen, Arne; Berdal, Knut G

    2005-05-01

    Unknown genetically modified organisms (GMOs) have not undergone a risk evaluation, and hence might pose a danger to health and environment. There are, today, no methods for detecting unknown GMOs. In this paper we propose a novel method intended as a first step in an approach for detecting unknown genetically modified (GM) material in a single plant. A model is designed where biological and combinatorial reduction rules are applied to a set of DNA chip probes containing all possible sequences of uniform length n, creating probes capable of detecting unknown GMOs. The model is theoretically tested for Arabidopsis thaliana Columbia, and the probabilities for detecting inserts and receiving false positives are assessed for various parameters for this organism. From a theoretical standpoint, the model looks very promising but should be tested further in the laboratory. The model and algorithms will be available upon request to the corresponding author.

  2. Immunization of the Female Genital Tract with a DNA-Based Vaccine

    PubMed Central

    Livingston, Julie B.; Lu, Shan; Robinson, Harriet; Anderson, Deborah J.

    1998-01-01

    Vaccines are being sought for contraception and the prevention of sexually transmitted diseases. However, progress is slow in this area largely because of lack of information on induction of protective immune responses in genital tract mucosa. In this study, we investigated whether in vivo transfection with a model DNA-based antigen delivered by gene gun technology would induce an antibody response detectable in vaginal secretions. Female rats were immunized with plasmids encoding human growth hormone (HGH) under the control of a cytomegalovirus promoter (pCMV/HGH) via vaginal mucosa (V), Peyer’s patch (PP), and/or abdominal skin (S) routes. Localization of HGH in the target tissues demonstrated that all three sites can be transfected in vivo with pCMV/HGH. Vaginal tissues expressed roughly the same level of plasmid as skin. Antibodies to HGH were detectable in serum and vaginal secretions in rats immunized with pCMV/HGH. In the rats primed and boosted vaginally, vaginal immunoglobulin A (IgA) and IgG antibody titers to HGH were sustained for at least 14 weeks, whereas rats immunized via other routes and protocols (S/V, S/S, PP/PP, or PP/V) did not consistently sustain significant vaginal antibody titers beyond week 6. DNA-based immunizations administered by the gene gun may be an effective method of inducing local immunity in the female genital tract. PMID:9423874

  3. A DNA-based semantic fusion model for remote sensing data.

    PubMed

    Sun, Heng; Weng, Jian; Yu, Guangchuang; Massawe, Richard H

    2013-01-01

    Semantic technology plays a key role in various domains, from conversation understanding to algorithm analysis. As the most efficient semantic tool, ontology can represent, process and manage the widespread knowledge. Nowadays, many researchers use ontology to collect and organize data's semantic information in order to maximize research productivity. In this paper, we firstly describe our work on the development of a remote sensing data ontology, with a primary focus on semantic fusion-driven research for big data. Our ontology is made up of 1,264 concepts and 2,030 semantic relationships. However, the growth of big data is straining the capacities of current semantic fusion and reasoning practices. Considering the massive parallelism of DNA strands, we propose a novel DNA-based semantic fusion model. In this model, a parallel strategy is developed to encode the semantic information in DNA for a large volume of remote sensing data. The semantic information is read in a parallel and bit-wise manner and an individual bit is converted to a base. By doing so, a considerable amount of conversion time can be saved, i.e., the cluster-based multi-processes program can reduce the conversion time from 81,536 seconds to 4,937 seconds for 4.34 GB source data files. Moreover, the size of result file recording DNA sequences is 54.51 GB for parallel C program compared with 57.89 GB for sequential Perl. This shows that our parallel method can also reduce the DNA synthesis cost. In addition, data types are encoded in our model, which is a basis for building type system in our future DNA computer. Finally, we describe theoretically an algorithm for DNA-based semantic fusion. This algorithm enables the process of integration of the knowledge from disparate remote sensing data sources into a consistent, accurate, and complete representation. This process depends solely on ligation reaction and screening operations instead of the ontology.

  4. An Organometallic Compound which Exhibits a DNA Topology-Dependent One-Stranded Intercalation Mode.

    PubMed

    Ma, Zhujun; Palermo, Giulia; Adhireksan, Zenita; Murray, Benjamin S; von Erlach, Thibaud; Dyson, Paul J; Rothlisberger, Ursula; Davey, Curt A

    2016-06-20

    Understanding how small molecules interact with DNA is essential since it underlies a multitude of pathological conditions and therapeutic interventions. Many different intercalator compounds have been studied because of their activity as mutagens or drugs, but little is known regarding their interaction with nucleosomes, the protein-packaged form of DNA in cells. Here, using crystallographic methods and molecular dynamics simulations, we discovered that adducts formed by [(η(6) -THA)Ru(ethylenediamine)Cl][PF6 ] (THA=5,8,9,10-tetrahydroanthracene; RAED-THA-Cl[PF6 ]) in the nucleosome comprise a novel one-stranded intercalation and DNA distortion mode. Conversely, the THA group in fact remains solvent exposed and does not disrupt base stacking in RAED-THA adducts on B-form DNA. This newly observed DNA binding mode and topology dependence may actually be prevalent and should be considered when studying covalently binding intercalating compounds. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Blocking Blood Supply to Breast Carcinoma With a DNA Vaccine Encoding VEGF Receptor-2

    DTIC Science & Technology

    2006-03-01

    from D121 mouse Lewis lung carcinoma cells and activated mouse splenocytes, respectively. Total RNA was extracted with the RNeasy Mini kit (Qiagen...CCL21 along with a PBS control group. All mice used in the prophylactic experiments were challenged by i.v. injections of 1 105 D121 murine Lewis ...lung carcinoma cells 1 week after the last immunization. In therapeutic settings, mice were first injected i.v. with 1 105 D121 murine Lewis lung

  6. A checklist of the bats of Peninsular Malaysia and progress towards a DNA barcode reference library

    PubMed Central

    Ramli, Rosli; Bhassu, Subha

    2017-01-01

    Several published checklists of bat species have covered Peninsular Malaysia as part of a broader region and/or in combination with other mammal groups. Other researchers have produced comprehensive checklists for specific localities within the peninsula. To our knowledge, a comprehensive checklist of bats specifically for the entire geopolitical region of Peninsular Malaysia has never been published, yet knowing which species are present in Peninsular Malaysia and their distributions across the region are crucial in developing suitable conservation plans. Our literature search revealed that 110 bat species have been documented in Peninsular Malaysia; 105 species have precise locality records while five species lack recent and/or precise locality records. We retrieved 18 species from records dated before the year 2000 and seven species have only ever been recorded once. Our search of Barcode of Life Datasystems (BOLD) found that 86 (of the 110) species have public records of which 48 species have public DNA barcodes available from bats sampled in Peninsular Malaysia. Based on Neighbour-Joining tree analyses and the allocation of DNA barcodes to Barcode Index Number system (BINs) by BOLD, several DNA barcodes recorded under the same species name are likely to represent distinct taxa. We discuss these cases in detail and highlight the importance of further surveys to determine the occurences and resolve the taxonomy of particular bat species in Peninsular Malaysia, with implications for conservation priorities. PMID:28742835

  7. Early development and characterization of a DNA-based radiation dosimeter

    NASA Astrophysics Data System (ADS)

    Avarmaa, Kirsten A.

    It is the priority of first responders to minimize damage to persons and infrastructure in the case of a nuclear emergency due to an accident or deliberate terrorist attack -- if this emergency includes a radioactive hazard, first responders require a simple-to-use, accurate and complete dosimeter for radiation protection purposes in order to minimize the health risk to these individuals and the general population at large. This work consists of the early evaluation of the design and performance of a biologically relevant dosimeter which uses DNA material that can respond to the radiation of any particle type. The construct consists of fluorescently tagged strands of DNA. The signalling components of this dosimeter are also investigated for their sensitivity to radiation damage and light exposure. The dual-labelled dosimeter that is evaluated in this work gave a measurable response to gamma radiation at dose levels of 10 Gy for the given detector design and experimental setup. Further testing outside of this work confirmed this finding and indicated a working range of 100 mGy to 10 Gy using a custom-built fluorimeter as part of a larger CRTI initiative. Characterization of the chromatic components of the dosimeter showed that photobleaching is not expected to have an effect on dosimeter performance, but that radiation can damage the non-DNA signalling components at higher dose levels, although this damage is minimal at lower doses over the expected operating ranges. This work therefore describes the early steps in the quantification of the behaviour of the DNA dosimeter as a potential biologically-based device to measure radiation dose.

  8. Feasibility of a DNA-Based Combinatorial Array Recognition Surface (CARS) in a Polyacrylamide Gel Matrix

    DTIC Science & Technology

    2007-12-12

    Air Force Research Laboratory Human Effectiveness Directorate Biosciences and Protection Division I C I Branch I ,. : ~’ :"" V"’"~ Air Force...Materiel Command ~ AN~ City-Base, TX 78235 ::’FRURHPC Air Force Research Laboratory Human Effectiveness Directorate n Biosciences and Protection...recognition, in effect making it a universal biosensor surface. Data are presented for differential binding pattcrns of various analytcs to one

  9. Association of Childhood Chronic Physical Aggression with a DNA Methylation Signature in Adult Human T Cells

    PubMed Central

    Guillemin, Claire; Vitaro, Frank; Côté, Sylvana M.; Hallett, Michael; Tremblay, Richard E.; Szyf, Moshe

    2014-01-01

    Background Chronic physical aggression (CPA) is characterized by frequent use of physical aggression from early childhood to adolescence. Observed in approximately 5% of males, CPA is associated with early childhood adverse environments and long-term negative consequences. Alterations in DNA methylation, a covalent modification of DNA that regulates genome function, have been associated with early childhood adversity. Aims To test the hypothesis that a trajectory of chronic physical aggression during childhood is associated with a distinct DNA methylation profile during adulthood. Methods We analyzed genome-wide promoter DNA methylation profiles of T cells from two groups of adult males assessed annually for frequency of physical aggression between 6 and 15 years of age: a group with CPA and a control group. Methylation profiles covering the promoter regions of 20 000 genes and 400 microRNAs were generated using MeDIP followed by hybridization to microarrays. Results In total, 448 distinct gene promoters were differentially methylated in CPA. Functionally, many of these genes have previously been shown to play a role in aggression and were enriched in biological pathways affected by behavior. Their locations in the genome tended to form clusters spanning millions of bases in the genome. Conclusions This study provides evidence of clustered and genome-wide variation in promoter DNA methylation in young adults that associates with a history of chronic physical aggression from 6 to 15 years of age. However, longitudinal studies of methylation during early childhood will be necessary to determine if and how this methylation variation in T cells DNA plays a role in early development of chronic physical aggression. PMID:24691403

  10. Molecular Cloning and Analysis of a DNA Repetitive Element from the Mouse Genome

    ERIC Educational Resources Information Center

    Geisinger, Adriana; Cossio, Gabriela; Wettstein, Rodolfo

    2006-01-01

    We report the development of a 3-week laboratory activity for an undergraduate molecular biology course. This activity introduces students to the practice of basic molecular techniques such as restriction enzyme digestion, agarose gel electrophoresis, cloning, plasmid DNA purification, Southern blotting, and sequencing. Students learn how to carry…

  11. A contamination assessment of the CI carbonaceous meteorite Orgueil using a DNA-directed approach

    NASA Astrophysics Data System (ADS)

    Aerts, J. W.; Elsaesser, A.; RöLing, W. F. M.; Ehrenfreund, P.

    2016-05-01

    The Orgueil meteorite has become one of the most well-studied carbonaceous meteorites, after it fell in France 150 yr ago. Extraterrestrial organic compounds such as amino acids and nucleobases in the parts per billion ranges were identified in Orgueil samples with supporting isotopic analyses. However, speculations of terrestrial contamination such as organic inclusions in the form of microbes and seeds accompanied the analyses of the Orgueil meteorite ever since its fall. By using molecular analysis, we performed DNA extractions and spiking experiments combined with 16S and 18S rRNA gene targeted PCR amplification to quantify the level of terrestrial biocontamination. Our results indicate that terrestrial contamination with DNA was insignificant in the investigated meteorite fraction. We also remeasured and confirmed concentrations of amino acids found in previous studies and conclude that their rather high concentrations and distribution cannot be explained by terrestrial contamination with microorganisms alone. These results represent the first analysis using DNA-directed tools in the analysis of the Orgueil meteorite to determine trace levels of biomarkers.

  12. SEQAID: a DNA sequence assembling program based on a mathematical model.

    PubMed Central

    Peltola, H; Söderlund, H; Ukkonen, E

    1984-01-01

    A program package, called SEQAID, to support DNA sequencing is presented. The program automatically assembles long DNA sequences from short fragments with minimal user interaction. Various tools for controlling the assembling process are also available. The main novel features of the system are that SEQAID implements several new well-behaved algorithms based on a mathematical model of the problem. It also utilizes available information on restriction fragments to detect illegitimate overlaps and to find relationships between separately assembled sequence blocks. Experiences with the system are reported including an extremely pathological real sequence which offers an interesting benchmark for this kind of programs. PMID:6320092

  13. Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer.

    PubMed

    Song, Kyung-Mi; Cho, Minseon; Jo, Hunho; Min, Kyoungin; Jeon, Sung Ho; Kim, Taisun; Han, Min Su; Ku, Ja Kang; Ban, Changill

    2011-08-15

    A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

  14. Single molecule FRET analysis of the 11 discrete steps of a DNA actuator.

    PubMed

    Hildebrandt, Lasse L; Preus, Søren; Zhang, Zhao; Voigt, Niels V; Gothelf, Kurt V; Birkedal, Victoria

    2014-06-25

    DNA hybridization allows the design and assembly of dynamic DNA-based molecular devices. Such structures usually accomplish their function by the addition of fuel strands that drive the structure from one conformation to a new one or by internal changes in DNA hybridization. We report here on the performance and robustness of one of these devices by the detailed study of a dynamic DNA actuator. The DNA actuator was chosen as a model system, as it is the device with most discrete states to date. It is able to reversibly slide between 11 different states and can in principle function both autonomously and nonautonomously. The 11 states of the actuator were investigated by single molecule Förster Resonance Energy Transfer (smFRET) microscopy to obtain information on the static and dynamic heterogeneities of the device. Our results show that the DNA actuator can be effectively locked in several conformations with the help of well-designed DNA lock strands. However, the device also shows pronounced static and dynamic heterogeneities both in the unlocked and locked modes, and we suggest possible structural models. Our study allows for the direct visualization of the conformational diversity and movement of the dynamic DNA-based device and shows that complex DNA-based devices are inherently heterogeneous. Our results also demonstrate that single molecule techniques are a powerful tool for structural dynamics studies and provide a stringent test for the performance of molecular devices made out of DNA.

  15. Probability assessment of conformational ensembles: sugar repuckering in a DNA duplex in solution.

    PubMed Central

    Ulyanov, N B; Schmitz, U; Kumar, A; James, T L

    1995-01-01

    Conformational flexibility of molecules in solution implies that different conformers contribute to the NMR signal. This may lead to internal inconsistencies in the 2D NOE-derived interproton distance restraints and to conflict with scalar coupling-based torsion angle restraints. Such inconsistencies have been revealed and analyzed for the DNA octamer GTATAATG.CATATTAC, containing the Pribnow box consensus sequence. A number of subsets of distance restraints were constructed and used in the restrained Monte Carlo refinement of different double-helical conformers. The probabilities of conformers were then calculated by a quadratic programming algorithm, minimizing a relaxation rate-base residual index. The calculated distribution of conformers agrees with the experimental NOE data as an ensemble better than any single structure. A comparison with the results of this procedure, which we term PARSE (Probability Assessment via Relaxation rates of a Structural Ensemble), to an alternative method to generate solution ensembles showed, however, that the detailed multi-conformational description of solution DNA structure remains ambiguous at this stage. Nevertheless, some ensemble properties can be deduced with confidence, the most prominent being a distribution of sugar puckers with minor populations in the N-region and major populations in the S-region. Importantly, such a distribution is in accord with the analysis of independent experimental data--deoxyribose proton-proton scalar coupling constants. Images FIGURE 1 FIGURE 3 FIGURE 4 PMID:7711233

  16. THE FORK AND THE KINASE: A DNA REPLICATION TALE FROM A CHK1 PERSPECTIVE

    PubMed Central

    González Besteiro, Marina A.; Gottifredi, Vanesa

    2014-01-01

    Replication fork progression is being continuously hampered by exogenously introduced and naturally occurring DNA lesions and other physical obstacles. The checkpoint kinase 1 (Chk1) is activated at replication forks that encounter damaged-DNA. Chk1 inhibits the initiation of new replication factories and stimulates the firing of dormant origins (those in the vicinity of stalled forks). Chk1 also avoids fork collapse into DSBs (double strand breaks) and promotes fork elongation. At the molecular level, the current model considers stalled forks as the site of Chk1 activation and the nucleoplasm as the location where Chk1 phosphorylates target proteins. This model certainly serves to explain how Chk1 modulates origin firing, but how Chk1 controls the fate of stalled forks is less clear. Interestingly, recent reports demonstrating that Chk1 phosphorylates chromatin-bound proteins and even holds kinase-independent functions might shed light on how Chk1 contributes to the elongation of damaged DNA. Such findings unveil a puzzling connection between Chk1 and DNA-lesion bypass, which might be central to promoting fork elongation and checkpoint attenuation. In summary, the multifaceted and versatile functions of Chk1 at ongoing forks and replication origins determine the extent and quality of the cellular response to replication stress. PMID:25795119

  17. Self-assembly of two-dimensional binary quasicrystals: a possible route to a DNA quasicrystal.

    PubMed

    Reinhardt, Aleks; Schreck, John S; Romano, Flavio; Doye, Jonathan P K

    2017-01-11

    We use Monte Carlo simulations and free-energy techniques to show that binary solutions of penta- and hexavalent two-dimensional patchy particles can form thermodynamically stable quasicrystals even at very narrow patch widths, provided their patch interactions are chosen in an appropriate way. Such patchy particles can be thought of as a coarse-grained representation of DNA multi-arm 'star' motifs, which can be chosen to bond with one another very specifically by tuning the DNA sequences of the protruding arms. We explore several possible design strategies and conclude that DNA star tiles that are designed to interact with one another in a specific but not overly constrained way could potentially be used to construct soft quasicrystals in experiment. We verify that such star tiles can form stable dodecagonal motifs using oxDNA, a realistic coarse-grained model of DNA.

  18. Endogenous APOBEC3A DNA cytosine deaminase is cytoplasmic and nongenotoxic.

    PubMed

    Land, Allison M; Law, Emily K; Carpenter, Michael A; Lackey, Lela; Brown, William L; Harris, Reuben S

    2013-06-14

    APOBEC3A (A3A) is a myeloid lineage-specific DNA cytosine deaminase with a role in innate immunity to foreign DNA. Previous studies have shown that heterologously expressed A3A is genotoxic, suggesting that monocytes may have a mechanism to regulate this enzyme. Indeed, we observed no significant cytotoxicity when interferon was used to induce the expression of endogenous A3A in CD14(+)-enriched primary cells or the monocytic cell line THP-1. In contrast, doxycycline-induced A3A in HEK293 cells caused major cytotoxicity at protein levels lower than those observed when CD14(+) cells were stimulated with interferon. Immunofluorescent microscopy of interferon-stimulated CD14(+) and THP-1 cells revealed that endogenous A3A is cytoplasmic, in stark contrast to stably or transiently transfected A3A, which has a cell-wide localization. A3A constructs engineered to be cytoplasmic are also nontoxic in HEK293 cells. These data combine to suggest that monocytic cells use a cytoplasmic retention mechanism to control A3A and avert genotoxicity during innate immune responses.

  19. The Relationship between Phenotype and Genotype: A DNA Transformation and DNA Isolation Laboratory Exercise.

    ERIC Educational Resources Information Center

    Guilfoile, Patrick; Plum, Stephen

    2000-01-01

    Provides laboratory exercises that demonstrate two genetic concepts: the difference between a genetic selection and a genetic screening experiment, and the relationship between phenotype and genotype. (SAH)

  20. Fingerprinting Diazotroph Communities in the Chesapeake Bay by Using a DNA Macroarray

    PubMed Central

    Jenkins, Bethany D.; Steward, Grieg F.; Short, Steven M.; Ward, Bess B.; Zehr, Jonathan P.

    2004-01-01

    Investigations of the distribution and diversity of nitrogen-fixing microorganisms in natural environments have often relied on PCR amplification and sequence analysis of a portion of one of the key enzymes in nitrogen fixation, dinitrogenase reductase, encoded by nifH. Recent work has suggested that DNA macroarrays provide semiquantitative fingerprints of diversity within mixtures of nifH amplicons (G. F. Steward, B. D. Jenkins, B. B. Ward, and J. P. Zehr, Appl. Environ. Microbiol. 70:1455-1465, 2004). Here we report the application of macroarrays for a study in the Chesapeake Bay. Samples from different locations in the bay yielded distinct fingerprints. Analysis of replicates and samples from different locations by cluster analysis showed that replicates clustered together, whereas different samples formed distinct clusters. There was a correspondence between the hybridization pattern observed and that predicted from the distribution of sequence types in a corresponding clone library. Some discrepancies between the methods were observed which are likely a result of the high nifH sequence diversity in the Chesapeake Bay and the limited number of sequences represented on this version of the array. Analyses of sequences in the clone library indicate that the Chesapeake Bay harbors unique, phylogenetically diverse diazotrophs. The macroarray hybridization patterns suggest that there are spatially variable communities of diazotrophs, which have been confirmed by quantitative PCR methods (S. M. Short, B. D. Jenkins, and J. P. Zehr, Appl. Environ. Microbiol., in press). The results show that DNA macroarrays have great potential for mapping the spatial and temporal variability of functional gene diversity in the environment. PMID:15006803

  1. A DNA bipedal nanowalker with a piston-like expulsion stroke.

    PubMed

    Yeo, Q Y; Loh, I Y; Tee, S R; Chiang, Y H; Cheng, J; Liu, M H; Wang, Z S

    2017-08-24

    Artificial molecular walkers beyond burn-bridge designs are important for nanotechnology, but their systematic development remains difficult. Herein, we have reported a new rationally designed DNA walker-track system and experimentally verified a previously proposed general expulsion regime for implementing non-burn-bridge nanowalkers. The DNA walker has an optically powered engine motif that reversibly extends and contracts the walker via a quadruplex-duplex conformational change. The walker's extension is an energy-absorbing and force-generating process, which drives the walker's leg dissociation off-track in a piston-like expulsion stroke. The unzipping-shearing asymmetry provides the expulsion stroke a bias, which decides the direction of the walker. Moreover, three candidate walkers of different sizes were fabricated. Fluorescence motility experiments indicated two of them as successful walkers and revealed a distinctive size dependence that was expected for these expulsive walkers, but was not observed in previously reported walkers. This study identifies unique technical requirements for expulsive nanowalkers. The present DNA design is readily adapted for making similar walkers from other molecules since the unzipping-shearing asymmetry is common.

  2. Postlarval muscle growth in fish: a DNA flow cytometric and morphometric analysis.

    PubMed

    Alfei, L; Maggi, F; Parvopassu, F; Bertoncello, G; De Vita, R

    1989-01-01

    The mechanism of postlarval fish myotomal growth was investigated in trout (Salmo gairdneri) by means of morphometric and cytofluorometric analysis. The mechanism by which new fibres are added during postlarval growth (hyperplasia) is not fully understood. In histological cross sections these new fibres have a small diameter which give the muscle a "mosaic" appearance. One hypothesis suggested that they could be derived from the proliferative activity of satellite cells. DNA cytofluorometric analysis of nuclei suspensions obtained from trout white myotomal muscle during different developmental stages (eleutherembyronic; alevin; yearling and adult) showed a consistently low S-cytometric phase during all stage in which myofibres of small diameters were present. The percentage of such small fibres, determined by morphometric analysis, suggested that satellite cells are the proliferative population. In fact, their percentages, as determined by morphometric analysis in histological section, bear a linear relationship with the S-cytometric phase percent nuclei (R = 0.927). Only in adults (67 cm in size) there was a significant decrease in the S-cytometric phase. At this stage, in histological sections, the myotomal muscle no longer had a "mosaic" appearance because of the disappearance of the small fibres. It may, therefore, be supposed that in the cm 67 adult specimens, the proliferative population is entering the G0 phase. It is known, in fact, that muscle growth proceeds only by fibre hypertrophy in trout longer than 70 cm in length (Stickland, 1983).

  3. Speeding up the self-assembly of a DNA nanodevice using a variety of polar solvents

    NASA Astrophysics Data System (ADS)

    Kang, Di; Duan, Ruixue; Tan, Yerpeng; Hong, Fan; Wang, Boya; Chen, Zhifei; Xu, Shaofang; Lou, Xiaoding; Wei, Wei; Yurke, Bernard; Xia, Fan

    2014-11-01

    The specific recognition and programmable assembly properties make DNA a potential material for nanodevices. However, the more intelligent the nanodevice is, the more complicated the structure of the nanodevice is, which limits the speed of DNA assembly. Herein, to address this problem, we investigate the performance of DNA Strand Displacement Reaction (DSDR) in a mixture of polar organic solvents and aqueous buffer and demonstrate that the organic polar solvent can speed up DNA self-assembly efficiently. Taking DSDR in 20% ethanol as an example, first we have demonstrated that the DSDR is highly accelerated in the beginning of the reaction and it can complete 60% of replacement reactions (160% enhancement compared with aqueous buffer) in the first 300 seconds. Secondly, we calculated that the ΔΔG of the DSDR in 20% ethanol (-18.2 kcal mol-1) is lower than that in pure aqueous buffer (-32.6 kcal mol-1), while the activation energy is lowered by introducing ethanol. Finally, we proved that the DSDR on the electrode surface can also be accelerated using this simple strategy. More importantly, to test the efficacy of this approach in nanodevices with a complicated and slow DNA self-assembly process, we apply this strategy in the hybridization chain reaction (HCR) and prove the acceleration is fairly obvious in 20% ethanol, which demonstrates the feasibility of the proposed strategy in DNA nanotechnology and DNA-based biosensors.The specific recognition and programmable assembly properties make DNA a potential material for nanodevices. However, the more intelligent the nanodevice is, the more complicated the structure of the nanodevice is, which limits the speed of DNA assembly. Herein, to address this problem, we investigate the performance of DNA Strand Displacement Reaction (DSDR) in a mixture of polar organic solvents and aqueous buffer and demonstrate that the organic polar solvent can speed up DNA self-assembly efficiently. Taking DSDR in 20% ethanol as an example, first we have demonstrated that the DSDR is highly accelerated in the beginning of the reaction and it can complete 60% of replacement reactions (160% enhancement compared with aqueous buffer) in the first 300 seconds. Secondly, we calculated that the ΔΔG of the DSDR in 20% ethanol (-18.2 kcal mol-1) is lower than that in pure aqueous buffer (-32.6 kcal mol-1), while the activation energy is lowered by introducing ethanol. Finally, we proved that the DSDR on the electrode surface can also be accelerated using this simple strategy. More importantly, to test the efficacy of this approach in nanodevices with a complicated and slow DNA self-assembly process, we apply this strategy in the hybridization chain reaction (HCR) and prove the acceleration is fairly obvious in 20% ethanol, which demonstrates the feasibility of the proposed strategy in DNA nanotechnology and DNA-based biosensors. Electronic supplementary information (ESI) available: Experimental procedures and analytical data are provided. See DOI: 10.1039/c4nr02257b

  4. Molecular genetic and biochemical analyses of a DNA repair gene from Serratia marcescens

    SciTech Connect

    Murphy, K.E.

    1989-01-01

    In Escherichia coli, the SOS response and two 3-methyladenine DNA glycosylases (TagI and TagII) are required for repair of DNA damaged by alkylating agents such as methyl methanesulfonate (MMS). Mutations of the recA gene eliminate the SOS response. TagI and TagII are encoded by the tag and alkA genes, respectively. A gene (rpr) encoding 3-methyladenine DNA glycosylase activity was isolated from the Gram-negative bacterium Serratia marcescens. The gene, localized to a 1.5-kilobase pair SmaI-HindIII restriction fragment, was cloned into plasmid pUC18. The clone complemented E. coli tag alkA and recA mutations for MMS resistance. The rpr gene did not, however, complement recA mutations for resistance to ultraviolet light or the ability to perform homologous recombination reactions, nor did it complement E. coli ada or alkB mutations. Two proteins of molecular weights 42,000 and 16,000 were produced from the rpr locus. Analysis of deletion and insertion mutants of rpr suggested that the 42kD molecule is the active protein. The 16kD protein may either be a breakdown product of the 42kD species or may be encoded by another gene overlapping the reading frame of the rpr gene. Biochemical assays showed that the rpr gene product (Rpr) possesses 3-methyladenine DNA glycosylase activity.

  5. A DNA Hypomethylation Signature Predicts Antitumor Activity of LSD1 Inhibitors in SCLC.

    PubMed

    Mohammad, Helai P; Smitheman, Kimberly N; Kamat, Chandrashekhar D; Soong, David; Federowicz, Kelly E; Van Aller, Glenn S; Schneck, Jess L; Carson, Jeffrey D; Liu, Yan; Butticello, Michael; Bonnette, William G; Gorman, Shelby A; Degenhardt, Yan; Bai, Yuchen; McCabe, Michael T; Pappalardi, Melissa B; Kasparec, Jiri; Tian, Xinrong; McNulty, Kenneth C; Rouse, Meagan; McDevitt, Patrick; Ho, Thau; Crouthamel, Michelle; Hart, Timothy K; Concha, Nestor O; McHugh, Charles F; Miller, William H; Dhanak, Dashyant; Tummino, Peter J; Carpenter, Christopher L; Johnson, Neil W; Hann, Christine L; Kruger, Ryan G

    2015-07-13

    Epigenetic dysregulation has emerged as an important mechanism in cancer. Alterations in epigenetic machinery have become a major focus for targeted therapies. The current report describes the discovery and biological activity of a cyclopropylamine containing inhibitor of Lysine Demethylase 1 (LSD1), GSK2879552. This small molecule is a potent, selective, orally bioavailable, mechanism-based irreversible inactivator of LSD1. A proliferation screen of cell lines representing a number of tumor types indicated that small cell lung carcinoma (SCLC) is sensitive to LSD1 inhibition. The subset of SCLC lines and primary samples that undergo growth inhibition in response to GSK2879552 exhibit DNA hypomethylation of a signature set of probes, suggesting this may be used as a predictive biomarker of activity.

  6. Allosteric “beta-blocker” isolated from a DNA-encoded small molecule library

    PubMed Central

    Ahn, Seungkirl; Kahsai, Alem W.; Pani, Biswaranjan; Wang, Qin-Ting; Zhao, Shuai; Wall, Alissa L.; Strachan, Ryan T.; Staus, Dean P.; Wingler, Laura M.; Sun, Lillian D.; Sinnaeve, Justine; Choi, Minjung; Cho, Ted; Xu, Thomas T.; Hansen, Gwenn M.; Burnett, Michael B.; Lamerdin, Jane E.; Bassoni, Daniel L.; Gavino, Bryant J.; Husemoen, Gitte; Olsen, Eva K.; Franch, Thomas; Costanzi, Stefano; Chen, Xin; Lefkowitz, Robert J.

    2017-01-01

    The β2-adrenergic receptor (β2AR) has been a model system for understanding regulatory mechanisms of G-protein–coupled receptor (GPCR) actions and plays a significant role in cardiovascular and pulmonary diseases. Because all known β-adrenergic receptor drugs target the orthosteric binding site of the receptor, we set out to isolate allosteric ligands for this receptor by panning DNA-encoded small-molecule libraries comprising 190 million distinct compounds against purified human β2AR. Here, we report the discovery of a small-molecule negative allosteric modulator (antagonist), compound 15 [([4-((2S)-3-(((S)-3-(3-bromophenyl)-1-(methylamino)-1-oxopropan-2-yl)amino)-2-(2-cyclohexyl-2-phenylacetamido)-3-oxopropyl)benzamide], exhibiting a unique chemotype and low micromolar affinity for the β2AR. Binding of 15 to the receptor cooperatively enhances orthosteric inverse agonist binding while negatively modulating binding of orthosteric agonists. Studies with a specific antibody that binds to an intracellular region of the β2AR suggest that 15 binds in proximity to the G-protein binding site on the cytosolic surface of the β2AR. In cell-signaling studies, 15 inhibits cAMP production through the β2AR, but not that mediated by other Gs-coupled receptors. Compound 15 also similarly inhibits β-arrestin recruitment to the activated β2AR. This study presents an allosteric small-molecule ligand for the β2AR and introduces a broadly applicable method for screening DNA-encoded small-molecule libraries against purified GPCR targets. Importantly, such an approach could facilitate the discovery of GPCR drugs with tailored allosteric effects. PMID:28130548

  7. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi

    2013-01-01

    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815