Science.gov

Sample records for a-rich rna sequences

  1. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    EPA Science Inventory

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  2. antaRNA: ant colony-based RNA sequence design.

    PubMed

    Kleinkauf, Robert; Mann, Martin; Backofen, Rolf

    2015-10-01

    RNA sequence design is studied at least as long as the classical folding problem. Although for the latter the functional fold of an RNA molecule is to be found ,: inverse folding tries to identify RNA sequences that fold into a function-specific target structure. In combination with RNA-based biotechnology and synthetic biology ,: reliable RNA sequence design becomes a crucial step to generate novel biochemical components. In this article ,: the computational tool antaRNA is presented. It is capable of compiling RNA sequences for a given structure that comply in addition with an adjustable full range objective GC-content distribution ,: specific sequence constraints and additional fuzzy structure constraints. antaRNA applies ant colony optimization meta-heuristics and its superior performance is shown on a biological datasets. http://www.bioinf.uni-freiburg.de/Software/antaRNA CONTACT: backofen@informatik.uni-freiburg.de Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  3. Experimental investigation of an RNA sequence space

    NASA Technical Reports Server (NTRS)

    Lee, Youn-Hyung; Dsouza, Lisa; Fox, George E.

    1993-01-01

    Modern rRNAs are the historic consequence of an ongoing evolutionary exploration of a sequence space. These extant sequences belong to a special subset of the sequence space that is comprised only of those primary sequences that can validly perform the biological function(s) required of the particular RNA. If it were possible to readily identify all such valid sequences, stochastic predictions could be made about the relative likelihood of various evolutionary pathways available to an RNA. Herein an experimental system which can assess whether a particular sequence is likely to have validity as a eubacterial 5S rRNA is described. A total of ten naturally occurring, and hence known to be valid, sequences and two point mutants of unknown validity were used to test the usefulness of the approach. Nine of the ten valid sequences tested positive whereas both mutants tested as clearly defective. The tenth valid sequence gave results that would be interpreted as reflecting a borderline status were the answer not known. These results demonstrate that it is possible to experimentally determine which sequences in local regions of the sequence space are potentially valid 5S rRNAs.

  4. Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

    PubMed

    Tan, M K

    1991-08-01

    A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

  5. Introduction to Single-Cell RNA Sequencing.

    PubMed

    Olsen, Thale Kristin; Baryawno, Ninib

    2018-04-01

    During the last decade, high-throughput sequencing methods have revolutionized the entire field of biology. The opportunity to study entire transcriptomes in great detail using RNA sequencing (RNA-seq) has fueled many important discoveries and is now a routine method in biomedical research. However, RNA-seq is typically performed in "bulk," and the data represent an average of gene expression patterns across thousands to millions of cells; this might obscure biologically relevant differences between cells. Single-cell RNA-seq (scRNA-seq) represents an approach to overcome this problem. By isolating single cells, capturing their transcripts, and generating sequencing libraries in which the transcripts are mapped to individual cells, scRNA-seq allows assessment of fundamental biological properties of cell populations and biological systems at unprecedented resolution. Here, we present the most common scRNA-seq protocols in use today and the basics of data analysis and discuss factors that are important to consider before planning and designing an scRNA-seq project. © 2018 by John Wiley & Sons, Inc. Copyright © 2018 John Wiley & Sons, Inc.

  6. Highly multiplexed subcellular RNA sequencing in situ

    PubMed Central

    Lee, Je Hyuk; Daugharthy, Evan R.; Scheiman, Jonathan; Kalhor, Reza; Ferrante, Thomas C.; Yang, Joyce L.; Terry, Richard; Jeanty, Sauveur S. F.; Li, Chao; Amamoto, Ryoji; Peters, Derek T.; Turczyk, Brian M.; Marblestone, Adam H.; Inverso, Samuel A.; Bernard, Amy; Mali, Prashant; Rios, Xavier; Aach, John; Church, George M.

    2014-01-01

    Understanding the spatial organization of gene expression with single nucleotide resolution requires localizing the sequences of expressed RNA transcripts within a cell in situ. Here we describe fluorescent in situ RNA sequencing (FISSEQ), in which stably cross-linked cDNA amplicons are sequenced within a biological sample. Using 30-base reads from 8,742 genes in situ, we examined RNA expression and localization in human primary fibroblasts using a simulated wound healing assay. FISSEQ is compatible with tissue sections and whole mount embryos, and reduces the limitations of optical resolution and noisy signals on single molecule detection. Our platform enables massively parallel detection of genetic elements, including gene transcripts and molecular barcodes, and can be used to investigate cellular phenotype, gene regulation, and environment in situ. PMID:24578530

  7. Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes

    NASA Technical Reports Server (NTRS)

    Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.

    1987-01-01

    A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

  8. Polyadenylation of RNA transcribed from mammalian SINEs by RNA polymerase III: Complex requirements for nucleotide sequences.

    PubMed

    Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A

    2016-02-01

    It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. YM500: a small RNA sequencing (smRNA-seq) database for microRNA research

    PubMed Central

    Cheng, Wei-Chung; Chung, I-Fang; Huang, Tse-Shun; Chang, Shih-Ting; Sun, Hsing-Jen; Tsai, Cheng-Fong; Liang, Muh-Lii; Wong, Tai-Tong; Wang, Hsei-Wei

    2013-01-01

    MicroRNAs (miRNAs) are small RNAs ∼22 nt in length that are involved in the regulation of a variety of physiological and pathological processes. Advances in high-throughput small RNA sequencing (smRNA-seq), one of the next-generation sequencing applications, have reshaped the miRNA research landscape. In this study, we established an integrative database, the YM500 (http://ngs.ym.edu.tw/ym500/), containing analysis pipelines and analysis results for 609 human and mice smRNA-seq results, including public data from the Gene Expression Omnibus (GEO) and some private sources. YM500 collects analysis results for miRNA quantification, for isomiR identification (incl. RNA editing), for arm switching discovery, and, more importantly, for novel miRNA predictions. Wetlab validation on >100 miRNAs confirmed high correlation between miRNA profiling and RT-qPCR results (R = 0.84). This database allows researchers to search these four different types of analysis results via our interactive web interface. YM500 allows researchers to define the criteria of isomiRs, and also integrates the information of dbSNP to help researchers distinguish isomiRs from SNPs. A user-friendly interface is provided to integrate miRNA-related information and existing evidence from hundreds of sequencing datasets. The identified novel miRNAs and isomiRs hold the potential for both basic research and biotech applications. PMID:23203880

  10. PRADA: pipeline for RNA sequencing data analysis.

    PubMed

    Torres-García, Wandaliz; Zheng, Siyuan; Sivachenko, Andrey; Vegesna, Rahulsimham; Wang, Qianghu; Yao, Rong; Berger, Michael F; Weinstein, John N; Getz, Gad; Verhaak, Roel G W

    2014-08-01

    Technological advances in high-throughput sequencing necessitate improved computational tools for processing and analyzing large-scale datasets in a systematic automated manner. For that purpose, we have developed PRADA (Pipeline for RNA-Sequencing Data Analysis), a flexible, modular and highly scalable software platform that provides many different types of information available by multifaceted analysis starting from raw paired-end RNA-seq data: gene expression levels, quality metrics, detection of unsupervised and supervised fusion transcripts, detection of intragenic fusion variants, homology scores and fusion frame classification. PRADA uses a dual-mapping strategy that increases sensitivity and refines the analytical endpoints. PRADA has been used extensively and successfully in the glioblastoma and renal clear cell projects of The Cancer Genome Atlas program.  http://sourceforge.net/projects/prada/  gadgetz@broadinstitute.org or rverhaak@mdanderson.org  Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  11. Short RNA indicator sequences are not completely degraded by autoclaving

    PubMed Central

    Unnithan, Veena V.; Unc, Adrian; Joe, Valerisa; Smith, Geoffrey B.

    2014-01-01

    Short indicator RNA sequences (<100 bp) persist after autoclaving and are recovered intact by molecular amplification. Primers targeting longer sequences are most likely to produce false positives due to amplification errors easily verified by melting curves analyses. If short indicator RNA sequences are used for virus identification and quantification then post autoclave RNA degradation methodology should be employed, which may include further autoclaving. PMID:24518856

  12. Computational Prediction of the Immunomodulatory Potential of RNA Sequences.

    PubMed

    Nagpal, Gandharva; Chaudhary, Kumardeep; Dhanda, Sandeep Kumar; Raghava, Gajendra Pal Singh

    2017-01-01

    Advances in the knowledge of various roles played by non-coding RNAs have stimulated the application of RNA molecules as therapeutics. Among these molecules, miRNA, siRNA, and CRISPR-Cas9 associated gRNA have been identified as the most potent RNA molecule classes with diverse therapeutic applications. One of the major limitations of RNA-based therapeutics is immunotoxicity of RNA molecules as it may induce the innate immune system. In contrast, RNA molecules that are potent immunostimulators are strong candidates for use in vaccine adjuvants. Thus, it is important to understand the immunotoxic or immunostimulatory potential of these RNA molecules. The experimental techniques for determining immunostimulatory potential of siRNAs are time- and resource-consuming. To overcome this limitation, recently our group has developed a web-based server "imRNA" for predicting the immunomodulatory potential of RNA sequences. This server integrates a number of modules that allow users to perform various tasks including (1) generation of RNA analogs with reduced immunotoxicity, (2) identification of highly immunostimulatory regions in RNA sequence, and (3) virtual screening. This server may also assist users in the identification of minimum mutations required in a given RNA sequence to minimize its immunomodulatory potential that is required for designing RNA-based therapeutics. Besides, the server can be used for designing RNA-based vaccine adjuvants as it may assist users in the identification of mutations required for increasing immunomodulatory potential of a given RNA sequence. In summary, this chapter describes major applications of the "imRNA" server in designing RNA-based therapeutics and vaccine adjuvants (http://www.imtech.res.in/raghava/imrna/).

  13. Size, Shape, and Sequence-Dependent Immunogenicity of RNA Nanoparticles.

    PubMed

    Guo, Sijin; Li, Hui; Ma, Mengshi; Fu, Jian; Dong, Yizhou; Guo, Peixuan

    2017-12-15

    RNA molecules have emerged as promising therapeutics. Like all other drugs, the safety profile and immune response are important criteria for drug evaluation. However, the literature on RNA immunogenicity has been controversial. Here, we used the approach of RNA nanotechnology to demonstrate that the immune response of RNA nanoparticles is size, shape, and sequence dependent. RNA triangle, square, pentagon, and tetrahedron with same shape but different sizes, or same size but different shapes were used as models to investigate the immune response. The levels of pro-inflammatory cytokines induced by these RNA nanoarchitectures were assessed in macrophage-like cells and animals. It was found that RNA polygons without extension at the vertexes were immune inert. However, when single-stranded RNA with a specific sequence was extended from the vertexes of RNA polygons, strong immune responses were detected. These immunostimulations are sequence specific, because some other extended sequences induced little or no immune response. Additionally, larger-size RNA square induced stronger cytokine secretion. 3D RNA tetrahedron showed stronger immunostimulation than planar RNA triangle. These results suggest that the immunogenicity of RNA nanoparticles is tunable to produce either a minimal immune response that can serve as safe therapeutic vectors, or a strong immune response for cancer immunotherapy or vaccine adjuvants. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  14. RNAcentral: A comprehensive database of non-coding RNA sequences

    SciTech Connect

    Williams, Kelly Porter; Lau, Britney Yan

    RNAcentral is a database of non-coding RNA (ncRNA) sequences that aggregates data from specialised ncRNA resources and provides a single entry point for accessing ncRNA sequences of all ncRNA types from all organisms. Since its launch in 2014, RNAcentral has integrated twelve new resources, taking the total number of collaborating database to 22, and began importing new types of data, such as modified nucleotides from MODOMICS and PDB. We created new species-specific identifiers that refer to unique RNA sequences within a context of single species. Furthermore, the website has been subject to continuous improvements focusing on text and sequence similaritymore » searches as well as genome browsing functionality.« less

  15. RNAcentral: A comprehensive database of non-coding RNA sequences

    DOE PAGES

    Williams, Kelly Porter; Lau, Britney Yan

    2016-10-28

    RNAcentral is a database of non-coding RNA (ncRNA) sequences that aggregates data from specialised ncRNA resources and provides a single entry point for accessing ncRNA sequences of all ncRNA types from all organisms. Since its launch in 2014, RNAcentral has integrated twelve new resources, taking the total number of collaborating database to 22, and began importing new types of data, such as modified nucleotides from MODOMICS and PDB. We created new species-specific identifiers that refer to unique RNA sequences within a context of single species. Furthermore, the website has been subject to continuous improvements focusing on text and sequence similaritymore » searches as well as genome browsing functionality.« less

  16. Novel Approach to Analyzing MFE of Noncoding RNA Sequences

    PubMed Central

    George, Tina P.; Thomas, Tessamma

    2016-01-01

    Genomic studies have become noncoding RNA (ncRNA) centric after the study of different genomes provided enormous information on ncRNA over the past decades. The function of ncRNA is decided by its secondary structure, and across organisms, the secondary structure is more conserved than the sequence itself. In this study, the optimal secondary structure or the minimum free energy (MFE) structure of ncRNA was found based on the thermodynamic nearest neighbor model. MFE of over 2600 ncRNA sequences was analyzed in view of its signal properties. Mathematical models linking MFE to the signal properties were found for each of the four classes of ncRNA analyzed. MFE values computed with the proposed models were in concordance with those obtained with the standard web servers. A total of 95% of the sequences analyzed had deviation of MFE values within ±15% relative to those obtained from standard web servers. PMID:27695341

  17. Novel Approach to Analyzing MFE of Noncoding RNA Sequences.

    PubMed

    George, Tina P; Thomas, Tessamma

    2016-01-01

    Genomic studies have become noncoding RNA (ncRNA) centric after the study of different genomes provided enormous information on ncRNA over the past decades. The function of ncRNA is decided by its secondary structure, and across organisms, the secondary structure is more conserved than the sequence itself. In this study, the optimal secondary structure or the minimum free energy (MFE) structure of ncRNA was found based on the thermodynamic nearest neighbor model. MFE of over 2600 ncRNA sequences was analyzed in view of its signal properties. Mathematical models linking MFE to the signal properties were found for each of the four classes of ncRNA analyzed. MFE values computed with the proposed models were in concordance with those obtained with the standard web servers. A total of 95% of the sequences analyzed had deviation of MFE values within ±15% relative to those obtained from standard web servers.

  18. Structural insights into the recognition of the internal A-rich linker from OxyS sRNA by Escherichia coli Hfq

    PubMed Central

    Wang, Lijun; Wang, Weiwei; Li, Fudong; Zhang, Jiahai; Wu, Jihui; Gong, Qingguo; Shi, Yunyu

    2015-01-01

    Small RNA OxyS is induced during oxidative stress in Escherichia coli and it is an Hfq-dependent negative regulator of mRNA translation. OxyS represses the translation of fhlA and rpoS mRNA, which encode the transcriptional activator and σs subunit of RNA polymerase, respectively. However, little is known regarding how Hfq, an RNA chaperone, interacts with OxyS at the atomic level. Here, using fluorescence polarization and tryptophan fluorescence quenching assays, we verified that the A-rich linker region of OxyS sRNA binds Hfq at its distal side. We also report two crystal structures of Hfq in complex with A-rich RNA fragments from this linker region. Both of these RNA fragments bind to the distal side of Hfq and adopt a different conformation compared with those previously reported for the (A-R-N)n tripartite recognition motif. Furthermore, using fluorescence polarization, electrophoresis mobility shift assays and in vivo translation assays, we found that an Hfq mutant, N48A, increases the binding affinity of OxyS for Hfq in vitro but is defective in the negative regulation of fhlA translation in vivo, suggesting that the normal function of OxyS depends on the details of the interaction with Hfq that may be related to the rapid recycling of Hfq in the cell. PMID:25670676

  19. RNase H-assisted RNA-primed rolling circle amplification for targeted RNA sequence detection.

    PubMed

    Takahashi, Hirokazu; Ohkawachi, Masahiko; Horio, Kyohei; Kobori, Toshiro; Aki, Tsunehiro; Matsumura, Yukihiko; Nakashimada, Yutaka; Okamura, Yoshiko

    2018-05-17

    RNA-primed rolling circle amplification (RPRCA) is a useful laboratory method for RNA detection; however, the detection of RNA is limited by the lack of information on 3'-terminal sequences. We uncovered that conventional RPRCA using pre-circularized probes could potentially detect the internal sequence of target RNA molecules in combination with RNase H. However, the specificity for mRNA detection was low, presumably due to non-specific hybridization of non-target RNA with the circular probe. To overcome this technical problem, we developed a method for detecting a sequence of interest in target RNA molecules via RNase H-assisted RPRCA using padlocked probes. When padlock probes are hybridized to the target RNA molecule, they are converted to the circular form by SplintR ligase. Subsequently, RNase H creates nick sites only in the hybridized RNA sequence, and single-stranded DNA is finally synthesized from the nick site by phi29 DNA polymerase. This method could specifically detect at least 10 fmol of the target RNA molecule without reverse transcription. Moreover, this method detected GFP mRNA present in 10 ng of total RNA isolated from Escherichia coli without background DNA amplification. Therefore, this method can potentially detect almost all types of RNA molecules without reverse transcription and reveal full-length sequence information.

  20. Sequence analysis of RNase MRP RNA reveals its origination from eukaryotic RNase P RNA

    PubMed Central

    Zhu, Yanglong; Stribinskis, Vilius; Ramos, Kenneth S.; Li, Yong

    2006-01-01

    RNase MRP is a eukaryote-specific endoribonuclease that generates RNA primers for mitochondrial DNA replication and processes precursor rRNA. RNase P is a ubiquitous endoribonuclease that cleaves precursor tRNA transcripts to produce their mature 5′ termini. We found extensive sequence homology of catalytic domains and specificity domains between their RNA subunits in many organisms. In Candida glabrata, the internal loop of helix P3 is 100% conserved between MRP and P RNAs. The helix P8 of MRP RNA from microsporidia Encephalitozoon cuniculi is identical to that of P RNA. Sequence homology can be widely spread over the whole molecule of MRP RNA and P RNA, such as those from Dictyostelium discoideum. These conserved nucleotides between the MRP and P RNAs strongly support the hypothesis that the MRP RNA is derived from the P RNA molecule in early eukaryote evolution. PMID:16540690

  1. DSAP: deep-sequencing small RNA analysis pipeline.

    PubMed

    Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

    2010-07-01

    DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

  2. Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

    PubMed

    Wickersheim, Michelle L; Blumenstiel, Justin P

    2013-11-01

    A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

  3. Accurate multiple sequence-structure alignment of RNA sequences using combinatorial optimization.

    PubMed

    Bauer, Markus; Klau, Gunnar W; Reinert, Knut

    2007-07-27

    The discovery of functional non-coding RNA sequences has led to an increasing interest in algorithms related to RNA analysis. Traditional sequence alignment algorithms, however, fail at computing reliable alignments of low-homology RNA sequences. The spatial conformation of RNA sequences largely determines their function, and therefore RNA alignment algorithms have to take structural information into account. We present a graph-based representation for sequence-structure alignments, which we model as an integer linear program (ILP). We sketch how we compute an optimal or near-optimal solution to the ILP using methods from combinatorial optimization, and present results on a recently published benchmark set for RNA alignments. The implementation of our algorithm yields better alignments in terms of two published scores than the other programs that we tested: This is especially the case with an increasing number of input sequences. Our program LARA is freely available for academic purposes from http://www.planet-lisa.net.

  4. How Messenger RNA and Nascent Chain Sequences Regulate Translation Elongation.

    PubMed

    Choi, Junhong; Grosely, Rosslyn; Prabhakar, Arjun; Lapointe, Christopher P; Wang, Jinfan; Puglisi, Joseph D

    2018-06-20

    Translation elongation is a highly coordinated, multistep, multifactor process that ensures accurate and efficient addition of amino acids to a growing nascent-peptide chain encoded in the sequence of translated messenger RNA (mRNA). Although translation elongation is heavily regulated by external factors, there is clear evidence that mRNA and nascent-peptide sequences control elongation dynamics, determining both the sequence and structure of synthesized proteins. Advances in methods have driven experiments that revealed the basic mechanisms of elongation as well as the mechanisms of regulation by mRNA and nascent-peptide sequences. In this review, we highlight how mRNA and nascent-peptide elements manipulate the translation machinery to alter the dynamics and pathway of elongation.

  5. Simulations Using Random-Generated DNA and RNA Sequences

    ERIC Educational Resources Information Center

    Bryce, C. F. A.

    1977-01-01

    Using a very simple computer program written in BASIC, a very large number of random-generated DNA or RNA sequences are obtained. Students use these sequences to predict complementary sequences and translational products, evaluate base compositions, determine frequencies of particular triplet codons, and suggest possible secondary structures.…

  6. RNAcentral: an international database of ncRNA sequences

    DOE PAGES

    Williams, Kelly Porter

    2014-10-28

    The field of non-coding RNA biology has been hampered by the lack of availability of a comprehensive, up-to-date collection of accessioned RNA sequences. Here we present the first release of RNAcentral, a database that collates and integrates information from an international consortium of established RNA sequence databases. The initial release contains over 8.1 million sequences, including representatives of all major functional classes. A web portal (http://rnacentral.org) provides free access to data, search functionality, cross-references, source code and an integrated genome browser for selected species.

  7. RNA processing in Neurospora crassa mitochondria: use of transfer RNA sequences as signals.

    PubMed Central

    Breitenberger, C A; Browning, K S; Alzner-DeWeerd, B; RajBhandary, U L

    1985-01-01

    We have used RNA gel transfer hybridization, S1 nuclease mapping and primer extension to analyze transcripts derived from several genes in Neurospora crassa mitochondria. The transcripts studied include those for cytochrome oxidase subunit III, 17S rRNA and an unidentified open reading frame. In all three cases, initial transcripts are long, include tRNA sequences, and are subsequently processed to generate the mature RNAs. We find that endpoints of the most abundant transcripts generally coincide with those of tRNA sequences. We therefore conclude that tRNA sequences in long transcripts act as primary signals for RNA processing in N. crassa mitochondria. The situation is somewhat analogous to that observed in mammalian mitochondrial systems. The difference, however, is that in mammalian mitochondria, noncoding spacers between tRNA, rRNA and protein genes are very short and in many cases non-existent, allowing no room for intergenic RNA processing signals whereas, in N. crassa mtDNA, intergenic non-coding sequences are usually several hundred nucleotides long and contain highly conserved GC-rich palindromic sequences. Since these GC-rich palindromic sequences are retained in the processed mature RNAs, we conclude that they do not serve as signals for RNA processing. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:2990893

  8. Primer-independent RNA sequencing with bacteriophage phi6 RNA polymerase and chain terminators.

    PubMed

    Makeyev, E V; Bamford, D H

    2001-05-01

    Here we propose a new general method for directly determining RNA sequence based on the use of the RNA-dependent RNA polymerase from bacteriophage phi6 and the chain terminators (RdRP sequencing). The following properties of the polymerase render it appropriate for this application: (1) the phi6 polymerase can replicate a number of single-stranded RNA templates in vitro. (2) In contrast to the primer-dependent DNA polymerases utilized in the sequencing procedure by Sanger et al. (Proc Natl Acad Sci USA, 1977, 74:5463-5467), it initiates nascent strand synthesis without a primer, starting the polymerization on the very 3'-terminus of the template. (3) The polymerase can incorporate chain-terminating nucleotide analogs into the nascent RNA chain to produce a set of base-specific termination products. Consequently, 3' proximal or even complete sequence of many target RNA molecules can be rapidly deduced without prior sequence information. The new technique proved useful for sequencing several synthetic ssRNA templates. Furthermore, using genomic segments of the bluetongue virus we show that RdRP sequencing can also be applied to naturally occurring dsRNA templates. This suggests possible uses of the method in the RNA virus research and diagnostics.

  9. INFO-RNA--a server for fast inverse RNA folding satisfying sequence constraints.

    PubMed

    Busch, Anke; Backofen, Rolf

    2007-07-01

    INFO-RNA is a new web server for designing RNA sequences that fold into a user given secondary structure. Furthermore, constraints on the sequence can be specified, e.g. one can restrict sequence positions to a fixed nucleotide or to a set of nucleotides. Moreover, the user can allow violations of the constraints at some positions, which can be advantageous in complicated cases. The INFO-RNA web server allows biologists to design RNA sequences in an automatic manner. It is clearly and intuitively arranged and easy to use. The procedure is fast, as most applications are completed within seconds and it proceeds better and faster than other existing tools. The INFO-RNA web server is freely available at http://www.bioinf.uni-freiburg.de/Software/INFO-RNA/

  10. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

    PubMed

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-02-04

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  11. RISE: a database of RNA interactome from sequencing experiments

    PubMed Central

    Gong, Jing; Shao, Di; Xu, Kui

    2018-01-01

    Abstract We present RISE (http://rise.zhanglab.net), a database of RNA Interactome from Sequencing Experiments. RNA-RNA interactions (RRIs) are essential for RNA regulation and function. RISE provides a comprehensive collection of RRIs that mainly come from recent transcriptome-wide sequencing-based experiments like PARIS, SPLASH, LIGR-seq, and MARIO, as well as targeted studies like RIA-seq, RAP-RNA and CLASH. It also includes interactions aggregated from other primary databases and publications. The RISE database currently contains 328,811 RNA-RNA interactions mainly in human, mouse and yeast. While most existing RNA databases mainly contain interactions of miRNA targeting, notably, more than half of the RRIs in RISE are among mRNA and long non-coding RNAs. We compared different RRI datasets in RISE and found limited overlaps in interactions resolved by different techniques and in different cell lines. It may suggest technology preference and also dynamic natures of RRIs. We also analyzed the basic features of the human and mouse RRI networks and found that they tend to be scale-free, small-world, hierarchical and modular. The analysis may nominate important RNAs or RRIs for further investigation. Finally, RISE provides a Circos plot and several table views for integrative visualization, with extensive molecular and functional annotations to facilitate exploration of biological functions for any RRI of interest. PMID:29040625

  12. The chemical structure of DNA sequence signals for RNA transcription

    NASA Technical Reports Server (NTRS)

    George, D. G.; Dayhoff, M. O.

    1982-01-01

    The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.

  13. Computational Analysis of Mouse piRNA Sequence and Biogenesis

    PubMed Central

    Betel, Doron; Sheridan, Robert; Marks, Debora S; Sander, Chris

    2007-01-01

    The recent discovery of a new class of 30-nucleotide long RNAs in mammalian testes, called PIWI-interacting RNA (piRNA), with similarities to microRNAs and repeat-associated small interfering RNAs (rasiRNAs), has raised puzzling questions regarding their biogenesis and function. We report a comparative analysis of currently available piRNA sequence data from the pachytene stage of mouse spermatogenesis that sheds light on their sequence diversity and mechanism of biogenesis. We conclude that (i) there are at least four times as many piRNAs in mouse testes than currently known; (ii) piRNAs, which originate from long precursor transcripts, are generated by quasi-random enzymatic processing that is guided by a weak sequence signature at the piRNA 5′ends resulting in a large number of distinct sequences; and (iii) many of the piRNA clusters contain inverted repeats segments capable of forming double-strand RNA fold-back segments that may initiate piRNA processing analogous to transposon silencing. PMID:17997596

  14. Spliced synthetic genes as internal controls in RNA sequencing experiments.

    PubMed

    Hardwick, Simon A; Chen, Wendy Y; Wong, Ted; Deveson, Ira W; Blackburn, James; Andersen, Stacey B; Nielsen, Lars K; Mattick, John S; Mercer, Tim R

    2016-09-01

    RNA sequencing (RNA-seq) can be used to assemble spliced isoforms, quantify expressed genes and provide a global profile of the transcriptome. However, the size and diversity of the transcriptome, the wide dynamic range in gene expression and inherent technical biases confound RNA-seq analysis. We have developed a set of spike-in RNA standards, termed 'sequins' (sequencing spike-ins), that represent full-length spliced mRNA isoforms. Sequins have an entirely artificial sequence with no homology to natural reference genomes, but they align to gene loci encoded on an artificial in silico chromosome. The combination of multiple sequins across a range of concentrations emulates alternative splicing and differential gene expression, and it provides scaling factors for normalization between samples. We demonstrate the use of sequins in RNA-seq experiments to measure sample-specific biases and determine the limits of reliable transcript assembly and quantification in accompanying human RNA samples. In addition, we have designed a complementary set of sequins that represent fusion genes arising from rearrangements of the in silico chromosome to aid in cancer diagnosis. RNA sequins provide a qualitative and quantitative reference with which to navigate the complexity of the human transcriptome.

  15. Small molecule alteration of RNA sequence in cells and animals.

    PubMed

    Guan, Lirui; Luo, Yiling; Ja, William W; Disney, Matthew D

    2017-10-18

    RNA regulation and maintenance are critical for proper cell function. Small molecules that specifically alter RNA sequence would be exceptionally useful as probes of RNA structure and function or as potential therapeutics. Here, we demonstrate a photochemical approach for altering the trinucleotide expanded repeat causative of myotonic muscular dystrophy type 1 (DM1), r(CUG) exp . The small molecule, 2H-4-Ru, binds to r(CUG) exp and converts guanosine residues to 8-oxo-7,8-dihydroguanosine upon photochemical irradiation. We demonstrate targeted modification upon irradiation in cell culture and in Drosophila larvae provided a diet containing 2H-4-Ru. Our results highlight a general chemical biology approach for altering RNA sequence in vivo by using small molecules and photochemistry. Furthermore, these studies show that addition of 8-oxo-G lesions into RNA 3' untranslated regions does not affect its steady state levels. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Identifying novel sequence variants of RNA 3D motifs

    PubMed Central

    Zirbel, Craig L.; Roll, James; Sweeney, Blake A.; Petrov, Anton I.; Pirrung, Meg; Leontis, Neocles B.

    2015-01-01

    Predicting RNA 3D structure from sequence is a major challenge in biophysics. An important sub-goal is accurately identifying recurrent 3D motifs from RNA internal and hairpin loop sequences extracted from secondary structure (2D) diagrams. We have developed and validated new probabilistic models for 3D motif sequences based on hybrid Stochastic Context-Free Grammars and Markov Random Fields (SCFG/MRF). The SCFG/MRF models are constructed using atomic-resolution RNA 3D structures. To parameterize each model, we use all instances of each motif found in the RNA 3D Motif Atlas and annotations of pairwise nucleotide interactions generated by the FR3D software. Isostericity relations between non-Watson–Crick basepairs are used in scoring sequence variants. SCFG techniques model nested pairs and insertions, while MRF ideas handle crossing interactions and base triples. We use test sets of randomly-generated sequences to set acceptance and rejection thresholds for each motif group and thus control the false positive rate. Validation was carried out by comparing results for four motif groups to RMDetect. The software developed for sequence scoring (JAR3D) is structured to automatically incorporate new motifs as they accumulate in the RNA 3D Motif Atlas when new structures are solved and is available free for download. PMID:26130723

  17. Comparison of ribosomal RNA removal methods for transcriptome sequencing workflows in teleost fish

    USDA-ARS?s Scientific Manuscript database

    RNA sequencing (RNA-Seq) is becoming the standard for transcriptome analysis. Removal of contaminating ribosomal RNA (rRNA) is a priority in the preparation of libraries suitable for sequencing. rRNAs are commonly removed from total RNA via either mRNA selection or rRNA depletion. These methods have...

  18. Sequence to Structure (S2S): display, manipulate and interconnect RNA data from sequence to structure.

    PubMed

    Jossinet, Fabrice; Westhof, Eric

    2005-08-01

    Efficient RNA sequence manipulations (such as multiple alignments) need to be constrained by rules of RNA structure folding. The structural knowledge has increased dramatically in the last years with the accumulation of several large RNA structures similar to those of the bacterial ribosome subunits. However, no tool in the RNA community provides an easy way to link and integrate progress made at the sequence level using the available three-dimensional information. Sequence to Structure (S2S) proposes a framework in which an user can easily display, manipulate and interconnect heterogeneous RNA data, such as multiple sequence alignments, secondary and tertiary structures. S2S has been implemented using the Java language and has been developed and tested under UNIX systems, such as Linux and MacOSX. S2S is available at http://bioinformatics.org/S2S/.

  19. RNA sequencing: current and prospective uses in metabolic research.

    PubMed

    Vikman, Petter; Fadista, Joao; Oskolkov, Nikolay

    2014-10-01

    Previous global RNA analysis was restricted to known transcripts in species with a defined transcriptome. Next generation sequencing has transformed transcriptomics by making it possible to analyse expressed genes with an exon level resolution from any tissue in any species without any a priori knowledge of which genes that are being expressed, splice patterns or their nucleotide sequence. In addition, RNA sequencing is a more sensitive technique compared with microarrays with a larger dynamic range, and it also allows for investigation of imprinting and allele-specific expression. This can be done for a cost that is able to compete with that of a microarray, making RNA sequencing a technique available to most researchers. Therefore RNA sequencing has recently become the state of the art with regards to large-scale RNA investigations and has to a large extent replaced microarrays. The only drawback is the large data amounts produced, which together with the complexity of the data can make a researcher spend far more time on analysis than performing the actual experiment. © 2014 Society for Endocrinology.

  20. Deep sequencing of cardiac microRNA-mRNA interactomes in clinical and experimental cardiomyopathy

    PubMed Central

    Matkovich, Scot J.; Dorn, Gerald W.

    2018-01-01

    Summary MicroRNAs are a family of short (~21 nucleotide) noncoding RNAs that serve key roles in cellular growth and differentiation and the response of the heart to stress stimuli. As the sequence-specific recognition element of RNA-induced silencing complexes (RISCs), microRNAs bind mRNAs and prevent their translation via mechanisms that may include transcript degradation and/or prevention of ribosome binding. Short microRNA sequences and the ability of microRNAs to bind to mRNA sites having only partial/imperfect sequence complementarity complicates purely computational analyses of microRNA-mRNA interactomes. Furthermore, computational microRNA target prediction programs typically ignore biological context, and therefore the principal determinants of microRNA-mRNA binding: the presence and quantity of each. To address these deficiencies we describe an empirical method, developed via studies of stressed and failing hearts, to determine disease-induced changes in microRNAs, mRNAs, and the mRNAs targeted to the RISC, without cross-linking mRNAs to RISC proteins. Deep sequencing methods are used to determine RNA abundances, delivering unbiased, quantitative RNA data limited only by their annotation in the genome of interest. We describe the laboratory bench steps required to perform these experiments, experimental design strategies to achieve an appropriate number of sequencing reads per biological replicate, and computer-based processing tools and procedures to convert large raw sequencing data files into gene expression measures useful for differential expression analyses. PMID:25836573

  1. Deep sequencing of cardiac microRNA-mRNA interactomes in clinical and experimental cardiomyopathy.

    PubMed

    Matkovich, Scot J; Dorn, Gerald W

    2015-01-01

    MicroRNAs are a family of short (~21 nucleotide) noncoding RNAs that serve key roles in cellular growth and differentiation and the response of the heart to stress stimuli. As the sequence-specific recognition element of RNA-induced silencing complexes (RISCs), microRNAs bind mRNAs and prevent their translation via mechanisms that may include transcript degradation and/or prevention of ribosome binding. Short microRNA sequences and the ability of microRNAs to bind to mRNA sites having only partial/imperfect sequence complementarity complicate purely computational analyses of microRNA-mRNA interactomes. Furthermore, computational microRNA target prediction programs typically ignore biological context, and therefore the principal determinants of microRNA-mRNA binding: the presence and quantity of each. To address these deficiencies we describe an empirical method, developed via studies of stressed and failing hearts, to determine disease-induced changes in microRNAs, mRNAs, and the mRNAs targeted to the RISC, without cross-linking mRNAs to RISC proteins. Deep sequencing methods are used to determine RNA abundances, delivering unbiased, quantitative RNA data limited only by their annotation in the genome of interest. We describe the laboratory bench steps required to perform these experiments, experimental design strategies to achieve an appropriate number of sequencing reads per biological replicate, and computer-based processing tools and procedures to convert large raw sequencing data files into gene expression measures useful for differential expression analyses.

  2. RNAcentral: A vision for an international database of RNA sequences

    PubMed Central

    Bateman, Alex; Agrawal, Shipra; Birney, Ewan; Bruford, Elspeth A.; Bujnicki, Janusz M.; Cochrane, Guy; Cole, James R.; Dinger, Marcel E.; Enright, Anton J.; Gardner, Paul P.; Gautheret, Daniel; Griffiths-Jones, Sam; Harrow, Jen; Herrero, Javier; Holmes, Ian H.; Huang, Hsien-Da; Kelly, Krystyna A.; Kersey, Paul; Kozomara, Ana; Lowe, Todd M.; Marz, Manja; Moxon, Simon; Pruitt, Kim D.; Samuelsson, Tore; Stadler, Peter F.; Vilella, Albert J.; Vogel, Jan-Hinnerk; Williams, Kelly P.; Wright, Mathew W.; Zwieb, Christian

    2011-01-01

    During the last decade there has been a great increase in the number of noncoding RNA genes identified, including new classes such as microRNAs and piRNAs. There is also a large growth in the amount of experimental characterization of these RNA components. Despite this growth in information, it is still difficult for researchers to access RNA data, because key data resources for noncoding RNAs have not yet been created. The most pressing omission is the lack of a comprehensive RNA sequence database, much like UniProt, which provides a comprehensive set of protein knowledge. In this article we propose the creation of a new open public resource that we term RNAcentral, which will contain a comprehensive collection of RNA sequences and fill an important gap in the provision of biomedical databases. We envision RNA researchers from all over the world joining a federated RNAcentral network, contributing specialized knowledge and databases. RNAcentral would centralize key data that are currently held across a variety of databases, allowing researchers instant access to a single, unified resource. This resource would facilitate the next generation of RNA research and help drive further discoveries, including those that improve food production and human and animal health. We encourage additional RNA database resources and research groups to join this effort. We aim to obtain international network funding to further this endeavor. PMID:21940779

  3. repRNA: a web server for generating various feature vectors of RNA sequences.

    PubMed

    Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen

    2016-02-01

    With the rapid growth of RNA sequences generated in the postgenomic age, it is highly desired to develop a flexible method that can generate various kinds of vectors to represent these sequences by focusing on their different features. This is because nearly all the existing machine-learning methods, such as SVM (support vector machine) and KNN (k-nearest neighbor), can only handle vectors but not sequences. To meet the increasing demands and speed up the genome analyses, we have developed a new web server, called "representations of RNA sequences" (repRNA). Compared with the existing methods, repRNA is much more comprehensive, flexible and powerful, as reflected by the following facts: (1) it can generate 11 different modes of feature vectors for users to choose according to their investigation purposes; (2) it allows users to select the features from 22 built-in physicochemical properties and even those defined by users' own; (3) the resultant feature vectors and the secondary structures of the corresponding RNA sequences can be visualized. The repRNA web server is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repRNA/ .

  4. HYBRIDIZATION PROPERTIES OF DNA SEQUENCES DIRECTING THE SYNTHESIS OF MESSENGER RNA AND HETEROGENEOUS NUCLEAR RNA

    PubMed Central

    Greenberg, Jay R.; Perry, Robert P.

    1971-01-01

    The relationship of the DNA sequences from which polyribosomal messenger RNA (mRNA) and heterogeneous nuclear RNA (NRNA) of mouse L cells are transcribed was investigated by means of hybridization kinetics and thermal denaturation of the hybrids. Hybridization was performed in formamide solutions at DNA excess. Under these conditions most of the hybridizing mRNA and NRNA react at values of Dot (DNA concentration multiplied by time) expected for RNA transcribed from the nonrepeated or rarely repeated fraction of the genome. However, a fraction of both mRNA and NRNA hybridize at values of Dot about 10,000 times lower, and therefore must be transcribed from highly redundant DNA sequences. The fraction of NRNA hybridizing to highly repeated sequences is about 1.7 times greater than the corresponding fraction of mRNA. The hybrids formed by the rapidly reacting fractions of both NRNA and mRNA melt over a narrow temperature range with a midpoint about 11°C below that of native L cell DNA. This indicates that these hybrids consist of partially complementary sequences with approximately 11% mismatching of bases. Hybrids formed by the slowly reacting fraction of NRNA melt within 4°–6°C of native DNA, indicating very little, if any, mismatching of bases. Hybrids of the slowly reacting components of mRNA, formed under conditions of sufficiently low RNA input, have a high thermal stability, similar to that observed for hybrids of the slowly reacting NRNA component. However, when higher inputs of mRNA are used, hybrids are formed which have a strikingly lower thermal stability. This observation can be explained by assuming that there is sufficient similarity among the relatively rare DNA sequences coding for mRNA so that under hybridization conditions, in which these DNA sequences are not truly in excess, reversible hybrids exhibiting a considerable amount of mispairing are formed. The fact that a comparable phenomenon has not been observed for NRNA may mean that there is

  5. Method for rapid base sequencing in DNA and RNA

    DOEpatents

    Jett, J.H.; Keller, R.A.; Martin, J.C.; Moyzis, R.K.; Ratliff, R.L.; Shera, E.B.; Stewart, C.C.

    1987-10-07

    A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed. 2 figs.

  6. Method for rapid base sequencing in DNA and RNA

    DOEpatents

    Jett, J.H.; Keller, R.A.; Martin, J.C.; Moyzis, R.K.; Ratliff, R.L.; Shera, E.B.; Stewart, C.C.

    1990-10-09

    A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed. 2 figs.

  7. Method for rapid base sequencing in DNA and RNA

    DOEpatents

    Jett, James H.; Keller, Richard A.; Martin, John C.; Moyzis, Robert K.; Ratliff, Robert L.; Shera, E. Brooks; Stewart, Carleton C.

    1990-01-01

    A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed.

  8. Transcriptome and Small RNA Deep Sequencing Reveals Deregulation of miRNA Biogenesis in Human Glioma

    PubMed Central

    Moore, Lynette M.; Kivinen, Virpi; Liu, Yuexin; Annala, Matti; Cogdell, David; Liu, Xiuping; Liu, Chang-Gong; Sawaya, Raymond; Yli-Harja, Olli; Shmulevich, Ilya; Fuller, Gregory N.; Zhang, Wei; Nykter, Matti

    2013-01-01

    Altered expression of oncogenic and tumor-suppressing microRNAs (miRNAs) is widely associated with tumorigenesis. However, the regulatory mechanisms underlying these alterations are poorly understood. We sought to shed light on the deregulation of miRNA biogenesis promoting the aberrant miRNA expression profiles identified in these tumors. Using sequencing technology to perform both whole-transcriptome and small RNA sequencing of glioma patient samples, we examined precursor and mature miRNAs to directly evaluate the miRNA maturation process, and interrogated expression profiles for genes involved in the major steps of miRNA biogenesis. We found that ratios of mature to precursor forms of a large number of miRNAs increased with the progression from normal brain to low-grade and then to high-grade gliomas. The expression levels of genes involved in each of the three major steps of miRNA biogenesis (nuclear processing, nucleo-cytoplasmic transport, and cytoplasmic processing) were systematically altered in glioma tissues. Survival analysis of an independent data set demonstrated that the alteration of genes involved in miRNA maturation correlates with survival in glioma patients. Direct quantification of miRNA maturation with deep sequencing demonstrated that deregulation of the miRNA biogenesis pathway is a hallmark for glioma genesis and progression. PMID:23007860

  9. Single-Cell RNA-Sequencing in Glioma.

    PubMed

    Johnson, Eli; Dickerson, Katherine L; Connolly, Ian D; Hayden Gephart, Melanie

    2018-04-10

    In this review, we seek to summarize the literature concerning the use of single-cell RNA-sequencing for CNS gliomas. Single-cell analysis has revealed complex tumor heterogeneity, subpopulations of proliferating stem-like cells and expanded our view of tumor microenvironment influence in the disease process. Although bulk RNA-sequencing has guided our initial understanding of glioma genetics, this method does not accurately define the heterogeneous subpopulations found within these tumors. Single-cell techniques have appealing applications in cancer research, as diverse cell types and the tumor microenvironment have important implications in therapy. High cost and difficult protocols prevent widespread use of single-cell RNA-sequencing; however, continued innovation will improve accessibility and expand our of knowledge gliomas.

  10. Sequence determinants of improved CRISPR sgRNA design.

    PubMed

    Xu, Han; Xiao, Tengfei; Chen, Chen-Hao; Li, Wei; Meyer, Clifford A; Wu, Qiu; Wu, Di; Cong, Le; Zhang, Feng; Liu, Jun S; Brown, Myles; Liu, X Shirley

    2015-08-01

    The CRISPR/Cas9 system has revolutionized mammalian somatic cell genetics. Genome-wide functional screens using CRISPR/Cas9-mediated knockout or dCas9 fusion-mediated inhibition/activation (CRISPRi/a) are powerful techniques for discovering phenotype-associated gene function. We systematically assessed the DNA sequence features that contribute to single guide RNA (sgRNA) efficiency in CRISPR-based screens. Leveraging the information from multiple designs, we derived a new sequence model for predicting sgRNA efficiency in CRISPR/Cas9 knockout experiments. Our model confirmed known features and suggested new features including a preference for cytosine at the cleavage site. The model was experimentally validated for sgRNA-mediated mutation rate and protein knockout efficiency. Tested on independent data sets, the model achieved significant results in both positive and negative selection conditions and outperformed existing models. We also found that the sequence preference for CRISPRi/a is substantially different from that for CRISPR/Cas9 knockout and propose a new model for predicting sgRNA efficiency in CRISPRi/a experiments. These results facilitate the genome-wide design of improved sgRNA for both knockout and CRISPRi/a studies. © 2015 Xu et al.; Published by Cold Spring Harbor Laboratory Press.

  11. Comparative Analysis of Single-Cell RNA Sequencing Methods.

    PubMed

    Ziegenhain, Christoph; Vieth, Beate; Parekh, Swati; Reinius, Björn; Guillaumet-Adkins, Amy; Smets, Martha; Leonhardt, Heinrich; Heyn, Holger; Hellmann, Ines; Enard, Wolfgang

    2017-02-16

    Single-cell RNA sequencing (scRNA-seq) offers new possibilities to address biological and medical questions. However, systematic comparisons of the performance of diverse scRNA-seq protocols are lacking. We generated data from 583 mouse embryonic stem cells to evaluate six prominent scRNA-seq methods: CEL-seq2, Drop-seq, MARS-seq, SCRB-seq, Smart-seq, and Smart-seq2. While Smart-seq2 detected the most genes per cell and across cells, CEL-seq2, Drop-seq, MARS-seq, and SCRB-seq quantified mRNA levels with less amplification noise due to the use of unique molecular identifiers (UMIs). Power simulations at different sequencing depths showed that Drop-seq is more cost-efficient for transcriptome quantification of large numbers of cells, while MARS-seq, SCRB-seq, and Smart-seq2 are more efficient when analyzing fewer cells. Our quantitative comparison offers the basis for an informed choice among six prominent scRNA-seq methods, and it provides a framework for benchmarking further improvements of scRNA-seq protocols. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Sequence, Structure, and Context Preferences of Human RNA Binding Proteins.

    PubMed

    Dominguez, Daniel; Freese, Peter; Alexis, Maria S; Su, Amanda; Hochman, Myles; Palden, Tsultrim; Bazile, Cassandra; Lambert, Nicole J; Van Nostrand, Eric L; Pratt, Gabriel A; Yeo, Gene W; Graveley, Brenton R; Burge, Christopher B

    2018-06-07

    RNA binding proteins (RBPs) orchestrate the production, processing, and function of mRNAs. Here, we present the affinity landscapes of 78 human RBPs using an unbiased assay that determines the sequence, structure, and context preferences of these proteins in vitro by deep sequencing of bound RNAs. These data enable construction of "RNA maps" of RBP activity without requiring crosslinking-based assays. We found an unexpectedly low diversity of RNA motifs, implying frequent convergence of binding specificity toward a relatively small set of RNA motifs, many with low compositional complexity. Offsetting this trend, however, we observed extensive preferences for contextual features distinct from short linear RNA motifs, including spaced "bipartite" motifs, biased flanking nucleotide composition, and bias away from or toward RNA structure. Our results emphasize the importance of contextual features in RNA recognition, which likely enable targeting of distinct subsets of transcripts by different RBPs that recognize the same linear motif. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Impact of sequencing depth and read length on single cell RNA sequencing data of T cells.

    PubMed

    Rizzetto, Simone; Eltahla, Auda A; Lin, Peijie; Bull, Rowena; Lloyd, Andrew R; Ho, Joshua W K; Venturi, Vanessa; Luciani, Fabio

    2017-10-06

    Single cell RNA sequencing (scRNA-seq) provides great potential in measuring the gene expression profiles of heterogeneous cell populations. In immunology, scRNA-seq allowed the characterisation of transcript sequence diversity of functionally relevant T cell subsets, and the identification of the full length T cell receptor (TCRαβ), which defines the specificity against cognate antigens. Several factors, e.g. RNA library capture, cell quality, and sequencing output affect the quality of scRNA-seq data. We studied the effects of read length and sequencing depth on the quality of gene expression profiles, cell type identification, and TCRαβ reconstruction, utilising 1,305 single cells from 8 publically available scRNA-seq datasets, and simulation-based analyses. Gene expression was characterised by an increased number of unique genes identified with short read lengths (<50 bp), but these featured higher technical variability compared to profiles from longer reads. Successful TCRαβ reconstruction was achieved for 6 datasets (81% - 100%) with at least 0.25 millions (PE) reads of length >50 bp, while it failed for datasets with <30 bp reads. Sufficient read length and sequencing depth can control technical noise to enable accurate identification of TCRαβ and gene expression profiles from scRNA-seq data of T cells.

  14. RNA circularization reveals terminal sequence heterogeneity in a double-stranded RNA virus.

    PubMed

    Widmer, G

    1993-03-01

    Double-stranded RNA viruses (dsRNA), termed LRV1, have been found in several strains of the protozoan parasite Leishmania. With the aim of constructing a full-length cDNA copy of the viral genome, including its terminal sequences, a protocol based on PCR amplification across the 3'-5' junction of circularized RNA was developed. This method proved to be applicable to dsRNA. It provided a relatively simple alternative to one-sided PCR, without loss of specificity inherent in the use of generic primers. LRV1 terminal nucleotide sequences obtained by this method showed a considerable variation in length, particularly at the 5' end of the positive strand, as well as the potential for forming 3' overhangs. The opposite genomic end terminates in 0, 1, or 2 TCA trinucleotide repeats. These results are compared with terminal sequences derived from one-sided PCR experiments.

  15. Gene expression distribution deconvolution in single-cell RNA sequencing.

    PubMed

    Wang, Jingshu; Huang, Mo; Torre, Eduardo; Dueck, Hannah; Shaffer, Sydney; Murray, John; Raj, Arjun; Li, Mingyao; Zhang, Nancy R

    2018-06-26

    Single-cell RNA sequencing (scRNA-seq) enables the quantification of each gene's expression distribution across cells, thus allowing the assessment of the dispersion, nonzero fraction, and other aspects of its distribution beyond the mean. These statistical characterizations of the gene expression distribution are critical for understanding expression variation and for selecting marker genes for population heterogeneity. However, scRNA-seq data are noisy, with each cell typically sequenced at low coverage, thus making it difficult to infer properties of the gene expression distribution from raw counts. Based on a reexamination of nine public datasets, we propose a simple technical noise model for scRNA-seq data with unique molecular identifiers (UMI). We develop deconvolution of single-cell expression distribution (DESCEND), a method that deconvolves the true cross-cell gene expression distribution from observed scRNA-seq counts, leading to improved estimates of properties of the distribution such as dispersion and nonzero fraction. DESCEND can adjust for cell-level covariates such as cell size, cell cycle, and batch effects. DESCEND's noise model and estimation accuracy are further evaluated through comparisons to RNA FISH data, through data splitting and simulations and through its effectiveness in removing known batch effects. We demonstrate how DESCEND can clarify and improve downstream analyses such as finding differentially expressed genes, identifying cell types, and selecting differentiation markers. Copyright © 2018 the Author(s). Published by PNAS.

  16. Methods for processing high-throughput RNA sequencing data.

    PubMed

    Ares, Manuel

    2014-11-03

    High-throughput sequencing (HTS) methods for analyzing RNA populations (RNA-Seq) are gaining rapid application to many experimental situations. The steps in an RNA-Seq experiment require thought and planning, especially because the expense in time and materials is currently higher and the protocols are far less routine than those used for other high-throughput methods, such as microarrays. As always, good experimental design will make analysis and interpretation easier. Having a clear biological question, an idea about the best way to do the experiment, and an understanding of the number of replicates needed will make the entire process more satisfying. Whether the goal is capturing transcriptome complexity from a tissue or identifying small fragments of RNA cross-linked to a protein of interest, conversion of the RNA to cDNA followed by direct sequencing using the latest methods is a developing practice, with new technical modifications and applications appearing every day. Even more rapid are the development and improvement of methods for analysis of the very large amounts of data that arrive at the end of an RNA-Seq experiment, making considerations regarding reproducibility, validation, visualization, and interpretation increasingly important. This introduction is designed to review and emphasize a pathway of analysis from experimental design through data presentation that is likely to be successful, with the recognition that better methods are right around the corner. © 2014 Cold Spring Harbor Laboratory Press.

  17. Direct Sequence Detection of Structured H5 Influenza Viral RNA

    PubMed Central

    Kerby, Matthew B.; Freeman, Sarah; Prachanronarong, Kristina; Artenstein, Andrew W.; Opal, Steven M.; Tripathi, Anubhav

    2008-01-01

    We describe the development of sequence-specific molecular beacons (dual-labeled DNA probes) for identification of the H5 influenza subtype, cleavage motif, and receptor specificity when hybridized directly with in vitro transcribed viral RNA (vRNA). The cloned hemagglutinin segment from a highly pathogenic H5N1 strain, A/Hanoi/30408/2005(H5N1), isolated from humans was used as template for in vitro transcription of sense-strand vRNA. The hybridization behavior of vRNA and a conserved subtype probe was characterized experimentally by varying conditions of time, temperature, and Mg2+ to optimize detection. Comparison of the hybridization rates of probe to DNA and RNA targets indicates that conformational switching of influenza RNA structure is a rate-limiting step and that the secondary structure of vRNA dominates the binding kinetics. The sensitivity and specificity of probe recognition of other H5 strains was calculated from sequence matches to the National Center for Biotechnology Information influenza database. The hybridization specificity of the subtype probes was experimentally verified with point mutations within the probe loop at five locations corresponding to the other human H5 strains. The abundance frequencies of the hemagglutinin cleavage motif and sialic acid recognition sequences were experimentally tested for H5 in all host viral species. Although the detection assay must be coupled with isothermal amplification on the chip, the new probes form the basis of a portable point-of-care diagnostic device for influenza subtyping. PMID:18403607

  18. Properties of a U1 RNA enhancer-like sequence.

    PubMed Central

    Ciliberto, G; Palla, F; Tebb, G; Mattaj, I W; Philipson, L

    1987-01-01

    The properties of a X.laevis U1B snRNA gene enhancer have been studied by microinjection in Xenopus oocytes. The enhancer-like sequence, defined as a short DNA stretch that is able to activate transcription in an orientation independent manner, is interchangeable between different U snRNA genes. The enhancer sequence alone does not, however, efficiently activate transcription from an SV40 pol II promoter but regains its activity when combined with the U-gene specific proximal sequence element. DNase I protection experiments show that the X.laevis U1B enhancer can interact specifically with a nuclear factor present in mammalian cells. Images PMID:3031597

  19. Quantitative assessment of RNA-protein interactions with high-throughput sequencing-RNA affinity profiling.

    PubMed

    Ozer, Abdullah; Tome, Jacob M; Friedman, Robin C; Gheba, Dan; Schroth, Gary P; Lis, John T

    2015-08-01

    Because RNA-protein interactions have a central role in a wide array of biological processes, methods that enable a quantitative assessment of these interactions in a high-throughput manner are in great demand. Recently, we developed the high-throughput sequencing-RNA affinity profiling (HiTS-RAP) assay that couples sequencing on an Illumina GAIIx genome analyzer with the quantitative assessment of protein-RNA interactions. This assay is able to analyze interactions between one or possibly several proteins with millions of different RNAs in a single experiment. We have successfully used HiTS-RAP to analyze interactions of the EGFP and negative elongation factor subunit E (NELF-E) proteins with their corresponding canonical and mutant RNA aptamers. Here we provide a detailed protocol for HiTS-RAP that can be completed in about a month (8 d hands-on time). This includes the preparation and testing of recombinant proteins and DNA templates, clustering DNA templates on a flowcell, HiTS and protein binding with a GAIIx instrument, and finally data analysis. We also highlight aspects of HiTS-RAP that can be further improved and points of comparison between HiTS-RAP and two other recently developed methods, quantitative analysis of RNA on a massively parallel array (RNA-MaP) and RNA Bind-n-Seq (RBNS), for quantitative analysis of RNA-protein interactions.

  20. Exploring Connectivity in Sequence Space of Functional RNA

    NASA Technical Reports Server (NTRS)

    Wei, Chenyu; Pohorille, Andrzej; Popovic, Milena; Ditzler, Mark

    2017-01-01

    Emergence of replicable genetic molecules was one of the marking points in the origin of life, evolution of which can be conceptualized as a walk through the space of all possible sequences. A theoretical concept of fitness landscape helps to understand evolutionary processes through assigning a value of fitness to each genotype. Then, evolution of a phenotype is viewed as a series of consecutive, single-point mutations. Natural selection biases evolution toward peaks of high fitness and away from valleys of low fitness. whereas neutral drift occurs in the sequence space without direction as mutations are introduced at random. Large networks of neutral or near-neutral mutations on a fitness landscape, especially for sufficiently long genomes, are possible or even inevitable. Their detection in experiments, however, has been elusive. Although a few near-neutral evolutionary pathways have been found, recent experimental evidence indicates landscapes consist of largely isolated islands. The generality of these results, however, is not clear, as the genome length or the fraction of functional molecules in the genotypic space might have been insufficient for the emergence of large, neutral networks. Thorough investigation on the structure of the fitness landscape is essential to understand the mechanisms of evolution of early genomes. RNA molecules are commonly assumed to play the pivotal role in the origin of genetic systems. They are widely believed to be early, if not the earliest, genetic and catalytic molecules, with abundant biochemical activities as aptamers and ribozymes, i.e. RNA molecules capable, respectively, to bind small molecules or catalyze chemical reactions. Here, we present results of our recent studies on the structure of the sequence space of RNA ligase ribozymes selected through in vitro evolution. Several hundred thousands of sequences active to a different degree were obtained by way of deep sequencing. Analysis of these sequences revealed

  1. Structurally complex and highly active RNA ligases derived from random RNA sequences

    NASA Technical Reports Server (NTRS)

    Ekland, E. H.; Szostak, J. W.; Bartel, D. P.

    1995-01-01

    Seven families of RNA ligases, previously isolated from random RNA sequences, fall into three classes on the basis of secondary structure and regiospecificity of ligation. Two of the three classes of ribozymes have been engineered to act as true enzymes, catalyzing the multiple-turnover transformation of substrates into products. The most complex of these ribozymes has a minimal catalytic domain of 93 nucleotides. An optimized version of this ribozyme has a kcat exceeding one per second, a value far greater than that of most natural RNA catalysts and approaching that of comparable protein enzymes. The fact that such a large and complex ligase emerged from a very limited sampling of sequence space implies the existence of a large number of distinct RNA structures of equivalent complexity and activity.

  2. Comprehensive analysis of RNA-protein interactions by high-throughput sequencing-RNA affinity profiling.

    PubMed

    Tome, Jacob M; Ozer, Abdullah; Pagano, John M; Gheba, Dan; Schroth, Gary P; Lis, John T

    2014-06-01

    RNA-protein interactions play critical roles in gene regulation, but methods to quantitatively analyze these interactions at a large scale are lacking. We have developed a high-throughput sequencing-RNA affinity profiling (HiTS-RAP) assay by adapting a high-throughput DNA sequencer to quantify the binding of fluorescently labeled protein to millions of RNAs anchored to sequenced cDNA templates. Using HiTS-RAP, we measured the affinity of mutagenized libraries of GFP-binding and NELF-E-binding aptamers to their respective targets and identified critical regions of interaction. Mutations additively affected the affinity of the NELF-E-binding aptamer, whose interaction depended mainly on a single-stranded RNA motif, but not that of the GFP aptamer, whose interaction depended primarily on secondary structure.

  3. Short intronic repeat sequences facilitate circular RNA production.

    PubMed

    Liang, Dongming; Wilusz, Jeremy E

    2014-10-15

    Recent deep sequencing studies have revealed thousands of circular noncoding RNAs generated from protein-coding genes. These RNAs are produced when the precursor messenger RNA (pre-mRNA) splicing machinery "backsplices" and covalently joins, for example, the two ends of a single exon. However, the mechanism by which the spliceosome selects only certain exons to circularize is largely unknown. Using extensive mutagenesis of expression plasmids, we show that miniature introns containing the splice sites along with short (∼ 30- to 40-nucleotide) inverted repeats, such as Alu elements, are sufficient to allow the intervening exons to circularize in cells. The intronic repeats must base-pair to one another, thereby bringing the splice sites into close proximity to each other. More than simple thermodynamics is clearly at play, however, as not all repeats support circularization, and increasing the stability of the hairpin between the repeats can sometimes inhibit circular RNA biogenesis. The intronic repeats and exonic sequences must collaborate with one another, and a functional 3' end processing signal is required, suggesting that circularization may occur post-transcriptionally. These results suggest detailed and generalizable models that explain how the splicing machinery determines whether to produce a circular noncoding RNA or a linear mRNA. © 2014 Liang and Wilusz; Published by Cold Spring Harbor Laboratory Press.

  4. Short intronic repeat sequences facilitate circular RNA production

    PubMed Central

    Liang, Dongming

    2014-01-01

    Recent deep sequencing studies have revealed thousands of circular noncoding RNAs generated from protein-coding genes. These RNAs are produced when the precursor messenger RNA (pre-mRNA) splicing machinery “backsplices” and covalently joins, for example, the two ends of a single exon. However, the mechanism by which the spliceosome selects only certain exons to circularize is largely unknown. Using extensive mutagenesis of expression plasmids, we show that miniature introns containing the splice sites along with short (∼30- to 40-nucleotide) inverted repeats, such as Alu elements, are sufficient to allow the intervening exons to circularize in cells. The intronic repeats must base-pair to one another, thereby bringing the splice sites into close proximity to each other. More than simple thermodynamics is clearly at play, however, as not all repeats support circularization, and increasing the stability of the hairpin between the repeats can sometimes inhibit circular RNA biogenesis. The intronic repeats and exonic sequences must collaborate with one another, and a functional 3′ end processing signal is required, suggesting that circularization may occur post-transcriptionally. These results suggest detailed and generalizable models that explain how the splicing machinery determines whether to produce a circular noncoding RNA or a linear mRNA. PMID:25281217

  5. Integrating RNA sequencing into neuro-oncology practice.

    PubMed

    Rogawski, David S; Vitanza, Nicholas A; Gauthier, Angela C; Ramaswamy, Vijay; Koschmann, Carl

    2017-11-01

    Malignant tumors of the central nervous system (CNS) cause substantial morbidity and mortality, yet efforts to optimize chemo- and radiotherapy have largely failed to improve dismal prognoses. Over the past decade, RNA sequencing (RNA-seq) has emerged as a powerful tool to comprehensively characterize the transcriptome of CNS tumor cells in one high-throughput step, leading to improved understanding of CNS tumor biology and suggesting new routes for targeted therapies. RNA-seq has been instrumental in improving the diagnostic classification of brain tumors, characterizing oncogenic fusion genes, and shedding light on intratumor heterogeneity. Currently, RNA-seq is beginning to be incorporated into regular neuro-oncology practice in the form of precision neuro-oncology programs, which use information from tumor sequencing to guide implementation of personalized targeted therapies. These programs show great promise in improving patient outcomes for tumors where single agent trials have been ineffective. As RNA-seq is a relatively new technique, many further applications yielding new advances in CNS tumor research and management are expected in the coming years. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Computational Prediction of miRNA Genes from Small RNA Sequencing Data

    PubMed Central

    Kang, Wenjing; Friedländer, Marc R.

    2015-01-01

    Next-generation sequencing now for the first time allows researchers to gage the depth and variation of entire transcriptomes. However, now as rare transcripts can be detected that are present in cells at single copies, more advanced computational tools are needed to accurately annotate and profile them. microRNAs (miRNAs) are 22 nucleotide small RNAs (sRNAs) that post-transcriptionally reduce the output of protein coding genes. They have established roles in numerous biological processes, including cancers and other diseases. During miRNA biogenesis, the sRNAs are sequentially cleaved from precursor molecules that have a characteristic hairpin RNA structure. The vast majority of new miRNA genes that are discovered are mined from small RNA sequencing (sRNA-seq), which can detect more than a billion RNAs in a single run. However, given that many of the detected RNAs are degradation products from all types of transcripts, the accurate identification of miRNAs remain a non-trivial computational problem. Here, we review the tools available to predict animal miRNAs from sRNA sequencing data. We present tools for generalist and specialist use cases, including prediction from massively pooled data or in species without reference genome. We also present wet-lab methods used to validate predicted miRNAs, and approaches to computationally benchmark prediction accuracy. For each tool, we reference validation experiments and benchmarking efforts. Last, we discuss the future of the field. PMID:25674563

  7. Single-cell RNA sequencing identifies diverse roles of epithelial cells in idiopathic pulmonary fibrosis

    PubMed Central

    Mizuno, Takako; Sridharan, Anusha; Du, Yina; Guo, Minzhe; Wikenheiser-Brokamp, Kathryn A.; Perl, Anne-Karina T.; Funari, Vincent A.; Gokey, Jason J.; Stripp, Barry R.; Whitsett, Jeffrey A.

    2016-01-01

    Idiopathic pulmonary fibrosis (IPF) is a lethal interstitial lung disease characterized by airway remodeling, inflammation, alveolar destruction, and fibrosis. We utilized single-cell RNA sequencing (scRNA-seq) to identify epithelial cell types and associated biological processes involved in the pathogenesis of IPF. Transcriptomic analysis of normal human lung epithelial cells defined gene expression patterns associated with highly differentiated alveolar type 2 (AT2) cells, indicated by enrichment of RNAs critical for surfactant homeostasis. In contrast, scRNA-seq of IPF cells identified 3 distinct subsets of epithelial cell types with characteristics of conducting airway basal and goblet cells and an additional atypical transitional cell that contributes to pathological processes in IPF. Individual IPF cells frequently coexpressed alveolar type 1 (AT1), AT2, and conducting airway selective markers, demonstrating “indeterminate” states of differentiation not seen in normal lung development. Pathway analysis predicted aberrant activation of canonical signaling via TGF-β, HIPPO/YAP, P53, WNT, and AKT/PI3K. Immunofluorescence confocal microscopy identified the disruption of alveolar structure and loss of the normal proximal-peripheral differentiation of pulmonary epithelial cells. scRNA-seq analyses identified loss of normal epithelial cell identities and unique contributions of epithelial cells to the pathogenesis of IPF. The present study provides a rich data source to further explore lung health and disease. PMID:27942595

  8. Design of the hairpin ribozyme for targeting specific RNA sequences.

    PubMed

    Hampel, A; DeYoung, M B; Galasinski, S; Siwkowski, A

    1997-01-01

    The following steps should be taken when designing the hairpin ribozyme to cleave a specific target sequence: 1. Select a target sequence containing BN*GUC where B is C, G, or U. 2. Select the target sequence in areas least likely to have extensive interfering structure. 3. Design the conventional hairpin ribozyme as shown in Fig. 1, such that it can form a 4 bp helix 2 and helix 1 lengths up to 10 bp. 4. Synthesize this ribozyme from single-stranded DNA templates with a double-stranded T7 promoter. 5. Prepare a series of short substrates capable of forming a range of helix 1 lengths of 5-10 bp. 6. Identify these by direct RNA sequencing. 7. Assay the extent of cleavage of each substrate to identify the optimal length of helix 1. 8. Prepare the hairpin tetraloop ribozyme to determine if catalytic efficiency can be improved.

  9. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    PubMed

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-11

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

  10. The technology and biology of single-cell RNA sequencing.

    PubMed

    Kolodziejczyk, Aleksandra A; Kim, Jong Kyoung; Svensson, Valentine; Marioni, John C; Teichmann, Sarah A

    2015-05-21

    The differences between individual cells can have profound functional consequences, in both unicellular and multicellular organisms. Recently developed single-cell mRNA-sequencing methods enable unbiased, high-throughput, and high-resolution transcriptomic analysis of individual cells. This provides an additional dimension to transcriptomic information relative to traditional methods that profile bulk populations of cells. Already, single-cell RNA-sequencing methods have revealed new biology in terms of the composition of tissues, the dynamics of transcription, and the regulatory relationships between genes. Rapid technological developments at the level of cell capture, phenotyping, molecular biology, and bioinformatics promise an exciting future with numerous biological and medical applications. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. RnaSeqSampleSize: real data based sample size estimation for RNA sequencing.

    PubMed

    Zhao, Shilin; Li, Chung-I; Guo, Yan; Sheng, Quanhu; Shyr, Yu

    2018-05-30

    One of the most important and often neglected components of a successful RNA sequencing (RNA-Seq) experiment is sample size estimation. A few negative binomial model-based methods have been developed to estimate sample size based on the parameters of a single gene. However, thousands of genes are quantified and tested for differential expression simultaneously in RNA-Seq experiments. Thus, additional issues should be carefully addressed, including the false discovery rate for multiple statistic tests, widely distributed read counts and dispersions for different genes. To solve these issues, we developed a sample size and power estimation method named RnaSeqSampleSize, based on the distributions of gene average read counts and dispersions estimated from real RNA-seq data. Datasets from previous, similar experiments such as the Cancer Genome Atlas (TCGA) can be used as a point of reference. Read counts and their dispersions were estimated from the reference's distribution; using that information, we estimated and summarized the power and sample size. RnaSeqSampleSize is implemented in R language and can be installed from Bioconductor website. A user friendly web graphic interface is provided at http://cqs.mc.vanderbilt.edu/shiny/RnaSeqSampleSize/ . RnaSeqSampleSize provides a convenient and powerful way for power and sample size estimation for an RNAseq experiment. It is also equipped with several unique features, including estimation for interested genes or pathway, power curve visualization, and parameter optimization.

  12. Toward Rare Blood Cell Preservation for RNA Sequencing.

    PubMed

    Vickovic, Sanja; Ahmadian, Afshin; Lewensohn, Rolf; Lundeberg, Joakim

    2015-07-01

    Cancer is driven by various events leading to cell differentiation and disease progression. Molecular tools are powerful approaches for describing how and why these events occur. With the growing field of next-generation DNA sequencing, there is an increasing need for high-quality nucleic acids derived from human cells and tissues-a prerequisite for successful cell profiling. Although advances in RNA preservation have been made, some of the largest biobanks still do not employ RNA blood preservation as standard because of limitations in low blood-input volume and RNA stability over the whole gene body. Therefore, we have developed a robust protocol for blood preservation and long-term storage while maintaining RNA integrity. Furthermore, we explored the possibility of using the protocol for preserving rare cell samples, such as circulating tumor cells. The results of our study confirmed that gene expression was not impacted by the preservation procedure (r(2) > 0.88) or by long-term storage (r(2) = 0.95), with RNA integrity number values averaging over 8. Similarly, cell surface antigens were still available for antibody selection (r(2) = 0.95). Lastly, data mining for fusion events showed that it was possible to detect rare tumor cells among a background of other cells present in blood irrespective of fixation. Thus, the developed protocol would be suitable for rare blood cell preservation followed by RNA sequencing analysis. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  13. Using small RNA (sRNA) deep sequencing to understand global virus distribution in plants

    USDA-ARS?s Scientific Manuscript database

    Small RNAs (sRNAs), a class of regulatory RNAs, have been used to serve as the specificity determinants of suppressing gene expression in plants and animals. Next generation sequencing (NGS) uncovered the sRNA landscape in most organisms including their associated microbes. In the current study, w...

  14. RISC RNA sequencing for context-specific identification of in vivo microRNA targets.

    PubMed

    Matkovich, Scot J; Van Booven, Derek J; Eschenbacher, William H; Dorn, Gerald W

    2011-01-07

    MicroRNAs (miRs) are expanding our understanding of cardiac disease and have the potential to transform cardiovascular therapeutics. One miR can target hundreds of individual mRNAs, but existing methodologies are not sufficient to accurately and comprehensively identify these mRNA targets in vivo. To develop methods permitting identification of in vivo miR targets in an unbiased manner, using massively parallel sequencing of mouse cardiac transcriptomes in combination with sequencing of mRNA associated with mouse cardiac RNA-induced silencing complexes (RISCs). We optimized techniques for expression profiling small amounts of RNA without introducing amplification bias and applied this to anti-Argonaute 2 immunoprecipitated RISCs (RISC-Seq) from mouse hearts. By comparing RNA-sequencing results of cardiac RISC and transcriptome from the same individual hearts, we defined 1645 mRNAs consistently targeted to mouse cardiac RISCs. We used this approach in hearts overexpressing miRs from Myh6 promoter-driven precursors (programmed RISC-Seq) to identify 209 in vivo targets of miR-133a and 81 in vivo targets of miR-499. Consistent with the fact that miR-133a and miR-499 have widely differing "seed" sequences and belong to different miR families, only 6 targets were common to miR-133a- and miR-499-programmed hearts. RISC-sequencing is a highly sensitive method for general RISC profiling and individual miR target identification in biological context and is applicable to any tissue and any disease state.

  15. Adenylylation of small RNA sequencing adapters using the TS2126 RNA ligase I.

    PubMed

    Lama, Lodoe; Ryan, Kevin

    2016-01-01

    Many high-throughput small RNA next-generation sequencing protocols use 5' preadenylylated DNA oligonucleotide adapters during cDNA library preparation. Preadenylylation of the DNA adapter's 5' end frees from ATP-dependence the ligation of the adapter to RNA collections, thereby avoiding ATP-dependent side reactions. However, preadenylylation of the DNA adapters can be costly and difficult. The currently available method for chemical adenylylation of DNA adapters is inefficient and uses techniques not typically practiced in laboratories profiling cellular RNA expression. An alternative enzymatic method using a commercial RNA ligase was recently introduced, but this enzyme works best as a stoichiometric adenylylating reagent rather than a catalyst and can therefore prove costly when several variant adapters are needed or during scale-up or high-throughput adenylylation procedures. Here, we describe a simple, scalable, and highly efficient method for the 5' adenylylation of DNA oligonucleotides using the thermostable RNA ligase 1 from bacteriophage TS2126. Adapters with 3' blocking groups are adenylylated at >95% yield at catalytic enzyme-to-adapter ratios and need not be gel purified before ligation to RNA acceptors. Experimental conditions are also reported that enable DNA adapters with free 3' ends to be 5' adenylylated at >90% efficiency. © 2015 Lama and Ryan; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  16. Deciphering mRNA Sequence Determinants of Protein Production Rate

    NASA Astrophysics Data System (ADS)

    Szavits-Nossan, Juraj; Ciandrini, Luca; Romano, M. Carmen

    2018-03-01

    One of the greatest challenges in biophysical models of translation is to identify coding sequence features that affect the rate of translation and therefore the overall protein production in the cell. We propose an analytic method to solve a translation model based on the inhomogeneous totally asymmetric simple exclusion process, which allows us to unveil simple design principles of nucleotide sequences determining protein production rates. Our solution shows an excellent agreement when compared to numerical genome-wide simulations of S. cerevisiae transcript sequences and predicts that the first 10 codons, which is the ribosome footprint length on the mRNA, together with the value of the initiation rate, are the main determinants of protein production rate under physiological conditions. Finally, we interpret the obtained analytic results based on the evolutionary role of the codons' choice for regulating translation rates and ribosome densities.

  17. Fingerprints of Modified RNA Bases from Deep Sequencing Profiles.

    PubMed

    Kietrys, Anna M; Velema, Willem A; Kool, Eric T

    2017-11-29

    Posttranscriptional modifications of RNA bases are not only found in many noncoding RNAs but have also recently been identified in coding (messenger) RNAs as well. They require complex and laborious methods to locate, and many still lack methods for localized detection. Here we test the ability of next-generation sequencing (NGS) to detect and distinguish between ten modified bases in synthetic RNAs. We compare ultradeep sequencing patterns of modified bases, including miscoding, insertions and deletions (indels), and truncations, to unmodified bases in the same contexts. The data show widely varied responses to modification, ranging from no response, to high levels of mutations, insertions, deletions, and truncations. The patterns are distinct for several of the modifications, and suggest the future use of ultradeep sequencing as a fingerprinting strategy for locating and identifying modifications in cellular RNAs.

  18. Single-Cell RNA Sequencing of Glioblastoma Cells.

    PubMed

    Sen, Rajeev; Dolgalev, Igor; Bayin, N Sumru; Heguy, Adriana; Tsirigos, Aris; Placantonakis, Dimitris G

    2018-01-01

    Single-cell RNA sequencing (sc-RNASeq) is a recently developed technique used to evaluate the transcriptome of individual cells. As opposed to conventional RNASeq in which entire populations are sequenced in bulk, sc-RNASeq can be beneficial when trying to better understand gene expression patterns in markedly heterogeneous populations of cells or when trying to identify transcriptional signatures of rare cells that may be underrepresented when using conventional bulk RNASeq. In this method, we describe the generation and analysis of cDNA libraries from single patient-derived glioblastoma cells using the C1 Fluidigm system. The protocol details the use of the C1 integrated fluidics circuit (IFC) for capturing, imaging and lysing cells; performing reverse transcription; and generating cDNA libraries that are ready for sequencing and analysis.

  19. Unifying cancer and normal RNA sequencing data from different sources

    PubMed Central

    Wang, Qingguo; Armenia, Joshua; Zhang, Chao; Penson, Alexander V.; Reznik, Ed; Zhang, Liguo; Minet, Thais; Ochoa, Angelica; Gross, Benjamin E.; Iacobuzio-Donahue, Christine A.; Betel, Doron; Taylor, Barry S.; Gao, Jianjiong; Schultz, Nikolaus

    2018-01-01

    Driven by the recent advances of next generation sequencing (NGS) technologies and an urgent need to decode complex human diseases, a multitude of large-scale studies were conducted recently that have resulted in an unprecedented volume of whole transcriptome sequencing (RNA-seq) data, such as the Genotype Tissue Expression project (GTEx) and The Cancer Genome Atlas (TCGA). While these data offer new opportunities to identify the mechanisms underlying disease, the comparison of data from different sources remains challenging, due to differences in sample and data processing. Here, we developed a pipeline that processes and unifies RNA-seq data from different studies, which includes uniform realignment, gene expression quantification, and batch effect removal. We find that uniform alignment and quantification is not sufficient when combining RNA-seq data from different sources and that the removal of other batch effects is essential to facilitate data comparison. We have processed data from GTEx and TCGA and successfully corrected for study-specific biases, enabling comparative analysis between TCGA and GTEx. The normalized datasets are available for download on figshare. PMID:29664468

  20. Preparation of highly multiplexed small RNA sequencing libraries.

    PubMed

    Persson, Helena; Søkilde, Rolf; Pirona, Anna Chiara; Rovira, Carlos

    2017-08-01

    MicroRNAs (miRNAs) are ~22-nucleotide-long small non-coding RNAs that regulate the expression of protein-coding genes by base pairing to partially complementary target sites, preferentially located in the 3´ untranslated region (UTR) of target mRNAs. The expression and function of miRNAs have been extensively studied in human disease, as well as the possibility of using these molecules as biomarkers for prognostication and treatment guidance. To identify and validate miRNAs as biomarkers, their expression must be screened in large collections of patient samples. Here, we develop a scalable protocol for the rapid and economical preparation of a large number of small RNA sequencing libraries using dual indexing for multiplexing. Combined with the use of off-the-shelf reagents, more samples can be sequenced simultaneously on large-scale sequencing platforms at a considerably lower cost per sample. Sample preparation is simplified by pooling libraries prior to gel purification, which allows for the selection of a narrow size range while minimizing sample variation. A comparison with publicly available data from benchmarking of miRNA analysis platforms showed that this method captures absolute and differential expression as effectively as commercially available alternatives.

  1. Next-generation sequencing library preparation method for identification of RNA viruses on the Ion Torrent Sequencing Platform.

    PubMed

    Chen, Guiqian; Qiu, Yuan; Zhuang, Qingye; Wang, Suchun; Wang, Tong; Chen, Jiming; Wang, Kaicheng

    2018-05-09

    Next generation sequencing (NGS) is a powerful tool for the characterization, discovery, and molecular identification of RNA viruses. There were multiple NGS library preparation methods published for strand-specific RNA-seq, but some methods are not suitable for identifying and characterizing RNA viruses. In this study, we report a NGS library preparation method to identify RNA viruses using the Ion Torrent PGM platform. The NGS sequencing adapters were directly inserted into the sequencing library through reverse transcription and polymerase chain reaction, without fragmentation and ligation of nucleic acids. The results show that this method is simple to perform, able to identify multiple species of RNA viruses in clinical samples.

  2. Deep sequencing of foot-and-mouth disease virus reveals RNA sequences involved in genome packaging.

    PubMed

    Logan, Grace; Newman, Joseph; Wright, Caroline F; Lasecka-Dykes, Lidia; Haydon, Daniel T; Cottam, Eleanor M; Tuthill, Tobias J

    2017-10-18

    Non-enveloped viruses protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. Packaging and capsid assembly in RNA viruses can involve interactions between capsid proteins and secondary structures in the viral genome as exemplified by the RNA bacteriophage MS2 and as proposed for other RNA viruses of plants, animals and human. In the picornavirus family of non-enveloped RNA viruses, the requirements for genome packaging remain poorly understood. Here we show a novel and simple approach to identify predicted RNA secondary structures involved in genome packaging in the picornavirus foot-and-mouth disease virus (FMDV). By interrogating deep sequencing data generated from both packaged and unpackaged populations of RNA we have determined multiple regions of the genome with constrained variation in the packaged population. Predicted secondary structures of these regions revealed stem loops with conservation of structure and a common motif at the loop. Disruption of these features resulted in attenuation of virus growth in cell culture due to a reduction in assembly of mature virions. This study provides evidence for the involvement of predicted RNA structures in picornavirus packaging and offers a readily transferable methodology for identifying packaging requirements in many other viruses. Importance In order to transmit their genetic material to a new host, non-enveloped viruses must protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. For many non-enveloped RNA viruses the requirements for this critical part of the viral life cycle remain poorly understood. We have identified RNA sequences involved in genome packaging of the picornavirus foot-and-mouth disease virus. This virus causes an economically devastating disease of livestock affecting both the developed and developing world. The experimental methods developed to carry out this work are novel, simple and transferable to the

  3. The Landscape of Circular RNA Expression Profiles in Papillary Thyroid Carcinoma Based on RNA Sequencing.

    PubMed

    Lan, Xiabin; Xu, Jiajie; Chen, Chao; Zheng, Chuanming; Wang, Jiafeng; Cao, Jun; Zhu, Xuhang; Ge, Minghua

    2018-05-25

    Papillary thyroid carcinoma (PTC) is the most common type of thyroid cancer. However, the molecular mechanisms responsible for its tumorigenesis and progression remain largely unknown. Circular RNA (circRNA) is a novel type of noncoding RNA that can serve as an ideal biomarker due to its stability. Recent evidence suggests that circRNAs play important roles in tumorigenesis. This study aims to investigate circRNA expression profiles and their potential biological functions in PTC. High-throughput RNA sequencing was used to assess circRNA expression profiles in PTC, and quantitative real-time polymerase chain reaction (qRT-PCR) was used to validate dysregulated circRNAs. Receiver operating characteristic (ROC) curves were generated to evaluate the diagnostic value of circRNAs for PTC. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were employed to determine the biological functions of differentially expressed circRNAs. Bioinformatic analyses were applied to predict interactions between circRNAs and microRNAs (miRNAs), and a circRNA-miRNA-mRNA network was constructed using Cytoscape software. We identified a number of differentially expressed circRNAs in PTC tissues compared with paired normal thyroid tissues, with chr5: 160757890-160763776-, chr12: 40696591-40697936+, chr7: 22330794-22357656-, and chr21: 16386665-16415895- being upregulated, and chr7: 91924203-91957214+, chr2: 179514891-179516047-, chr9: 16435553-16437522-, and chr22: 36006931-36007153- being downregulated. These findings were confirmed by qRT-PCR, and ROC curves indicated that they can serve as potential biomarkers for PTC. GO and KEGG pathway analyses showed that some of these circRNAs are related to cancers. Additionally, bioinformatic analyses revealed a potential competing-endogenous-RNA-regulating network among circRNAs, miRNAs, and mRNAs. Our study results depict the landscape of circRNA expression profiles in PTC and also provide potential

  4. Long Non-Coding RNA and Alternative Splicing Modulations in Parkinson's Leukocytes Identified by RNA Sequencing

    PubMed Central

    Soreq, Lilach; Guffanti, Alessandro; Salomonis, Nathan; Simchovitz, Alon; Israel, Zvi; Bergman, Hagai; Soreq, Hermona

    2014-01-01

    The continuously prolonged human lifespan is accompanied by increase in neurodegenerative diseases incidence, calling for the development of inexpensive blood-based diagnostics. Analyzing blood cell transcripts by RNA-Seq is a robust means to identify novel biomarkers that rapidly becomes a commonplace. However, there is lack of tools to discover novel exons, junctions and splicing events and to precisely and sensitively assess differential splicing through RNA-Seq data analysis and across RNA-Seq platforms. Here, we present a new and comprehensive computational workflow for whole-transcriptome RNA-Seq analysis, using an updated version of the software AltAnalyze, to identify both known and novel high-confidence alternative splicing events, and to integrate them with both protein-domains and microRNA binding annotations. We applied the novel workflow on RNA-Seq data from Parkinson's disease (PD) patients' leukocytes pre- and post- Deep Brain Stimulation (DBS) treatment and compared to healthy controls. Disease-mediated changes included decreased usage of alternative promoters and N-termini, 5′-end variations and mutually-exclusive exons. The PD regulated FUS and HNRNP A/B included prion-like domains regulated regions. We also present here a workflow to identify and analyze long non-coding RNAs (lncRNAs) via RNA-Seq data. We identified reduced lncRNA expression and selective PD-induced changes in 13 of over 6,000 detected leukocyte lncRNAs, four of which were inversely altered post-DBS. These included the U1 spliceosomal lncRNA and RP11-462G22.1, each entailing sequence complementarity to numerous microRNAs. Analysis of RNA-Seq from PD and unaffected controls brains revealed over 7,000 brain-expressed lncRNAs, of which 3,495 were co-expressed in the leukocytes including U1, which showed both leukocyte and brain increases. Furthermore, qRT-PCR validations confirmed these co-increases in PD leukocytes and two brain regions, the amygdala and substantia

  5. Analysis of sequencing data for probing RNA secondary structures and protein-RNA binding in studying posttranscriptional regulations.

    PubMed

    Hu, Xihao; Wu, Yang; Lu, Zhi John; Yip, Kevin Y

    2016-11-01

    High-throughput sequencing has been used to study posttranscriptional regulations, where the identification of protein-RNA binding is a major and fast-developing sub-area, which is in turn benefited by the sequencing methods for whole-transcriptome probing of RNA secondary structures. In the study of RNA secondary structures using high-throughput sequencing, bases are modified or cleaved according to their structural features, which alter the resulting composition of sequencing reads. In the study of protein-RNA binding, methods have been proposed to immuno-precipitate (IP) protein-bound RNA transcripts in vitro or in vivo By sequencing these transcripts, the protein-RNA interactions and the binding locations can be identified. For both types of data, read counts are affected by a combination of confounding factors, including expression levels of transcripts, sequence biases, mapping errors and the probing or IP efficiency of the experimental protocols. Careful processing of the sequencing data and proper extraction of important features are fundamentally important to a successful analysis. Here we review and compare different experimental methods for probing RNA secondary structures and binding sites of RNA-binding proteins (RBPs), and the computational methods proposed for analyzing the corresponding sequencing data. We suggest how these two types of data should be integrated to study the structural properties of RBP binding sites as a systematic way to better understand posttranscriptional regulations. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  6. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    PubMed

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  7. SEXCMD: Development and validation of sex marker sequences for whole-exome/genome and RNA sequencing.

    PubMed

    Jeong, Seongmun; Kim, Jiwoong; Park, Won; Jeon, Hongmin; Kim, Namshin

    2017-01-01

    Over the last decade, a large number of nucleotide sequences have been generated by next-generation sequencing technologies and deposited to public databases. However, most of these datasets do not specify the sex of individuals sampled because researchers typically ignore or hide this information. Male and female genomes in many species have distinctive sex chromosomes, XX/XY and ZW/ZZ, and expression levels of many sex-related genes differ between the sexes. Herein, we describe how to develop sex marker sequences from syntenic regions of sex chromosomes and use them to quickly identify the sex of individuals being analyzed. Array-based technologies routinely use either known sex markers or the B-allele frequency of X or Z chromosomes to deduce the sex of an individual. The same strategy has been used with whole-exome/genome sequence data; however, all reads must be aligned onto a reference genome to determine the B-allele frequency of the X or Z chromosomes. SEXCMD is a pipeline that can extract sex marker sequences from reference sex chromosomes and rapidly identify the sex of individuals from whole-exome/genome and RNA sequencing after training with a known dataset through a simple machine learning approach. The pipeline counts total numbers of hits from sex-specific marker sequences and identifies the sex of the individuals sampled based on the fact that XX/ZZ samples do not have Y or W chromosome hits. We have successfully validated our pipeline with mammalian (Homo sapiens; XY) and avian (Gallus gallus; ZW) genomes. Typical calculation time when applying SEXCMD to human whole-exome or RNA sequencing datasets is a few minutes, and analyzing human whole-genome datasets takes about 10 minutes. Another important application of SEXCMD is as a quality control measure to avoid mixing samples before bioinformatics analysis. SEXCMD comprises simple Python and R scripts and is freely available at https://github.com/lovemun/SEXCMD.

  8. Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

    PubMed

    Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

    2018-03-19

    To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

  9. SPAR: small RNA-seq portal for analysis of sequencing experiments.

    PubMed

    Kuksa, Pavel P; Amlie-Wolf, Alexandre; Katanic, Živadin; Valladares, Otto; Wang, Li-San; Leung, Yuk Yee

    2018-05-04

    The introduction of new high-throughput small RNA sequencing protocols that generate large-scale genomics datasets along with increasing evidence of the significant regulatory roles of small non-coding RNAs (sncRNAs) have highlighted the urgent need for tools to analyze and interpret large amounts of small RNA sequencing data. However, it remains challenging to systematically and comprehensively discover and characterize sncRNA genes and specifically-processed sncRNA products from these datasets. To fill this gap, we present Small RNA-seq Portal for Analysis of sequencing expeRiments (SPAR), a user-friendly web server for interactive processing, analysis, annotation and visualization of small RNA sequencing data. SPAR supports sequencing data generated from various experimental protocols, including smRNA-seq, short total RNA sequencing, microRNA-seq, and single-cell small RNA-seq. Additionally, SPAR includes publicly available reference sncRNA datasets from our DASHR database and from ENCODE across 185 human tissues and cell types to produce highly informative small RNA annotations across all major small RNA types and other features such as co-localization with various genomic features, precursor transcript cleavage patterns, and conservation. SPAR allows the user to compare the input experiment against reference ENCODE/DASHR datasets. SPAR currently supports analyses of human (hg19, hg38) and mouse (mm10) sequencing data. SPAR is freely available at https://www.lisanwanglab.org/SPAR.

  10. Effects of RNA integrity on transcript quantification by total RNA sequencing of clinically collected human placental samples.

    PubMed

    Reiman, Mario; Laan, Maris; Rull, Kristiina; Sõber, Siim

    2017-08-01

    RNA degradation is a ubiquitous process that occurs in living and dead cells, as well as during handling and storage of extracted RNA. Reduced RNA quality caused by degradation is an established source of uncertainty for all RNA-based gene expression quantification techniques. RNA sequencing is an increasingly preferred method for transcriptome analyses, and dependence of its results on input RNA integrity is of significant practical importance. This study aimed to characterize the effects of varying input RNA integrity [estimated as RNA integrity number (RIN)] on transcript level estimates and delineate the characteristic differences between transcripts that differ in degradation rate. The study used ribodepleted total RNA sequencing data from a real-life clinically collected set ( n = 32) of human solid tissue (placenta) samples. RIN-dependent alterations in gene expression profiles were quantified by using DESeq2 software. Our results indicate that small differences in RNA integrity affect gene expression quantification by introducing a moderate and pervasive bias in expression level estimates that significantly affected 8.1% of studied genes. The rapidly degrading transcript pool was enriched in pseudogenes, short noncoding RNAs, and transcripts with extended 3' untranslated regions. Typical slowly degrading transcripts (median length, 2389 nt) represented protein coding genes with 4-10 exons and high guanine-cytosine content.-Reiman, M., Laan, M., Rull, K., Sõber, S. Effects of RNA integrity on transcript quantification by total RNA sequencing of clinically collected human placental samples. © FASEB.

  11. Comparative RNA sequencing reveals substantial genetic variation in endangered primates

    PubMed Central

    Perry, George H.; Melsted, Páll; Marioni, John C.; Wang, Ying; Bainer, Russell; Pickrell, Joseph K.; Michelini, Katelyn; Zehr, Sarah; Yoder, Anne D.; Stephens, Matthew; Pritchard, Jonathan K.; Gilad, Yoav

    2012-01-01

    Comparative genomic studies in primates have yielded important insights into the evolutionary forces that shape genetic diversity and revealed the likely genetic basis for certain species-specific adaptations. To date, however, these studies have focused on only a small number of species. For the majority of nonhuman primates, including some of the most critically endangered, genome-level data are not yet available. In this study, we have taken the first steps toward addressing this gap by sequencing RNA from the livers of multiple individuals from each of 16 mammalian species, including humans and 11 nonhuman primates. Of the nonhuman primate species, five are lemurs and two are lorisoids, for which little or no genomic data were previously available. To analyze these data, we developed a method for de novo assembly and alignment of orthologous gene sequences across species. We assembled an average of 5721 gene sequences per species and characterized diversity and divergence of both gene sequences and gene expression levels. We identified patterns of variation that are consistent with the action of positive or directional selection, including an 18-fold enrichment of peroxisomal genes among genes whose regulation likely evolved under directional selection in the ancestral primate lineage. Importantly, we found no relationship between genetic diversity and endangered status, with the two most endangered species in our study, the black and white ruffed lemur and the Coquerel's sifaka, having the highest genetic diversity among all primates. Our observations imply that many endangered lemur populations still harbor considerable genetic variation. Timely efforts to conserve these species alongside their habitats have, therefore, strong potential to achieve long-term success. PMID:22207615

  12. Small RNA sequencing and functional characterization reveals microRNA-143 tumor suppressor activity in liposarcoma

    PubMed Central

    Ugras, Stacy; Brill, Elliott; Jacobsen, Anders; Hafner, Markus; Socci, Nicholas D.; DeCarolis, Penelope L.; Khanin, Raya; O'Connor, Rachael; Mihailovic, Aleksandra; Taylor, Barry S.; Sheridan, Robert; Gimble, Jeffrey M.; Viale, Agnes; Crago, Aimee; Antonescu, Cristina R.; Sander, Chris; Tuschl, Thomas; Singer, Samuel

    2011-01-01

    Liposarcoma remains the most common mesenchymal cancer, with a mortality rate of 60% among patients with this disease. To address the present lack of therapeutic options, we embarked upon a study of microRNA (miRNA) expression alterations associated with liposarcomagenesis with the goal of exploiting differentially expressed miRNAs and the gene products they regulate as potential therapeutic targets. MicroRNA expression was profiled in samples of normal adipose tissue, well-differentiated liposarcoma, and dedifferentiated liposarcoma by both deep sequencing of small RNA libraries and hybridization-based Agilent microarrays. The expression profiles discriminated liposarcoma from normal adipose tissue and well-differentiated from dedifferentiated disease. We defined over 40 miRNAs that were dysregulated in dedifferentiated liposarcomas in both the sequencing and the microarray analysis. The upregulated miRNAs included two cancer-associated species (miR-21, miR-26a), and the downregulated miRNAs included two species that were highly abundant in adipose tissue (miR-143, miR-145). Restoring miR-143 expression in dedifferentiated liposarcoma cells inhibited proliferation, induced apoptosis, and decreased expression of BCL2, TOP2A, PRC1, and PLK1. The downregulation of PRC1 and its docking partner PLK1 suggests that miR-143 inhibits cytokinesis in these cells. In support of this idea, treatment with a PLK1 inhibitor potently induced G2/M growth arrest and apoptosis in liposarcoma cells. Taken together, our findings suggest that miR-143 re-expression vectors or selective agents directed at miR-143 or its targets may have therapeutic value in dedifferentiated liposarcoma. PMID:21693658

  13. Modulations of RNA sequences by cytokinin in pumpkin cotyledons

    SciTech Connect

    Chang, C.; Ertl, J.; Chen, C.

    1987-04-01

    Polyadenylated mRNAs from excised pumpkin cotyledons treated with or without 10/sup -4/ M benzyladenine (BA) for various time periods in suspension culture were assayed by in vitro translation in the presence of (/sup 35/S) methionine. The radioactive polypeptides were analyzed by one- and two-dimensional polyacrylamide gel electrophoresis. Specific sequences of mRNAs were enhanced, reduced, induced, or suppressed by the hormone within 60 min of the application of BA to the cotyledons. Four independent cDNA clones of cytokinin-modulated mRNAs have been selected and characterized. RNA blot hybridization using the four cDNA probes also indicates that the levels of specific mRNAs aremore » modulated upward or downward by the hormone.« less

  14. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    PubMed Central

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein. PMID:2798128

  15. High-throughput illumina strand-specific RNA sequencing library preparation

    USDA-ARS?s Scientific Manuscript database

    Conventional Illumina RNA-Seq does not have the resolution to decode the complex eukaryote transcriptome due to the lack of RNA polarity information. Strand-specific RNA sequencing (ssRNA-Seq) can overcome these limitations and as such is better suited for genome annotation, de novo transcriptome as...

  16. PASTA: splice junction identification from RNA-Sequencing data

    PubMed Central

    2013-01-01

    Background Next generation transcriptome sequencing (RNA-Seq) is emerging as a powerful experimental tool for the study of alternative splicing and its regulation, but requires ad-hoc analysis methods and tools. PASTA (Patterned Alignments for Splicing and Transcriptome Analysis) is a splice junction detection algorithm specifically designed for RNA-Seq data, relying on a highly accurate alignment strategy and on a combination of heuristic and statistical methods to identify exon-intron junctions with high accuracy. Results Comparisons against TopHat and other splice junction prediction software on real and simulated datasets show that PASTA exhibits high specificity and sensitivity, especially at lower coverage levels. Moreover, PASTA is highly configurable and flexible, and can therefore be applied in a wide range of analysis scenarios: it is able to handle both single-end and paired-end reads, it does not rely on the presence of canonical splicing signals, and it uses organism-specific regression models to accurately identify junctions. Conclusions PASTA is a highly efficient and sensitive tool to identify splicing junctions from RNA-Seq data. Compared to similar programs, it has the ability to identify a higher number of real splicing junctions, and provides highly annotated output files containing detailed information about their location and characteristics. Accurate junction data in turn facilitates the reconstruction of the splicing isoforms and the analysis of their expression levels, which will be performed by the remaining modules of the PASTA pipeline, still under development. Use of PASTA can therefore enable the large-scale investigation of transcription and alternative splicing. PMID:23557086

  17. RNA Sequencing Identifies Novel Translational Biomarkers of Kidney Fibrosis

    PubMed Central

    Craciun, Florin L.; Bijol, Vanesa; Ajay, Amrendra K.; Rao, Poornima; Kumar, Ramya K.; Hutchinson, John; Hofmann, Oliver; Joshi, Nikita; Luyendyk, James P.; Kusebauch, Ulrike; Moss, Christopher L.; Srivastava, Anand; Himmelfarb, Jonathan; Waikar, Sushrut S.; Moritz, Robert L.

    2016-01-01

    CKD is the gradual, asymptomatic loss of kidney function, but current tests only identify CKD when significant loss has already happened. Several potential biomarkers of CKD have been reported, but none have been approved for preclinical or clinical use. Using RNA sequencing in a mouse model of folic acid-induced nephropathy, we identified ten genes that track kidney fibrosis development, the common pathologic finding in patients with CKD. The gene expression of all ten candidates was confirmed to be significantly higher (approximately ten- to 150-fold) in three well established, mechanistically distinct mouse models of kidney fibrosis than in models of nonfibrotic AKI. Protein expression of these genes was also high in the folic acid model and in patients with biopsy-proven kidney fibrosis. mRNA expression of the ten genes increased with increasing severity of kidney fibrosis, decreased in response to therapeutic intervention, and increased only modestly (approximately two- to five-fold) with liver fibrosis in mice and humans, demonstrating specificity for kidney fibrosis. Using targeted selected reaction monitoring mass spectrometry, we detected three of the ten candidates in human urine: cadherin 11 (CDH11), macrophage mannose receptor C1 (MRC1), and phospholipid transfer protein (PLTP). Furthermore, urinary levels of each of these three proteins distinguished patients with CKD (n=53) from healthy individuals (n=53; P<0.05). In summary, we report the identification of urinary CDH11, MRC1, and PLTP as novel noninvasive biomarkers of CKD. PMID:26449608

  18. Chromatin-associated RNA sequencing (ChAR-seq) maps genome-wide RNA-to-DNA contacts

    PubMed Central

    Jukam, David; Teran, Nicole A; Risca, Viviana I; Smith, Owen K; Johnson, Whitney L; Skotheim, Jan M; Greenleaf, William James

    2018-01-01

    RNA is a critical component of chromatin in eukaryotes, both as a product of transcription, and as an essential constituent of ribonucleoprotein complexes that regulate both local and global chromatin states. Here, we present a proximity ligation and sequencing method called Chromatin-Associated RNA sequencing (ChAR-seq) that maps all RNA-to-DNA contacts across the genome. Using Drosophila cells, we show that ChAR-seq provides unbiased, de novo identification of targets of chromatin-bound RNAs including nascent transcripts, chromosome-specific dosage compensation ncRNAs, and genome-wide trans-associated RNAs involved in co-transcriptional RNA processing. PMID:29648534

  19. Characterization of Human Salivary Extracellular RNA by Next-generation Sequencing.

    PubMed

    Li, Feng; Kaczor-Urbanowicz, Karolina Elżbieta; Sun, Jie; Majem, Blanca; Lo, Hsien-Chun; Kim, Yong; Koyano, Kikuye; Liu Rao, Shannon; Young Kang, So; Mi Kim, Su; Kim, Kyoung-Mee; Kim, Sung; Chia, David; Elashoff, David; Grogan, Tristan R; Xiao, Xinshu; Wong, David T W

    2018-04-23

    It was recently discovered that abundant and stable extracellular RNA (exRNA) species exist in bodily fluids. Saliva is an emerging biofluid for biomarker development for noninvasive detection and screening of local and systemic diseases. Use of RNA-Sequencing (RNA-Seq) to profile exRNA is rapidly growing; however, no single preparation and analysis protocol can be used for all biofluids. Specifically, RNA-Seq of saliva is particularly challenging owing to high abundance of bacterial contents and low abundance of salivary exRNA. Given the laborious procedures needed for RNA-Seq library construction, sequencing, data storage, and data analysis, saliva-specific and optimized protocols are essential. We compared different RNA isolation methods and library construction kits for long and small RNA sequencing. The role of ribosomal RNA (rRNA) depletion also was evaluated. The miRNeasy Micro Kit (Qiagen) showed the highest total RNA yield (70.8 ng/mL cell-free saliva) and best small RNA recovery, and the NEBNext library preparation kits resulted in the highest number of detected human genes [5649-6813 at 1 reads per kilobase RNA per million mapped (RPKM)] and small RNAs [482-696 microRNAs (miRNAs) and 190-214 other small RNAs]. The proportion of human RNA-Seq reads was much higher in rRNA-depleted saliva samples (41%) than in samples without rRNA depletion (14%). In addition, the transfer RNA (tRNA)-derived RNA fragments (tRFs), a novel class of small RNAs, were highly abundant in human saliva, specifically tRF-4 (4%) and tRF-5 (15.25%). Our results may help in selection of the best adapted methods of RNA isolation and small and long RNA library constructions for salivary exRNA studies. © 2018 American Association for Clinical Chemistry.

  20. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    PubMed Central

    Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

    2015-01-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  1. Use of 16S Ribosomal RNA Sequences to Infer Relationships among Archaebacteria.

    DTIC Science & Technology

    1987-04-16

    the rRNAs of one or both other kingdoms , and among the archaebacteria there are also substantial variations) (1), echinoderms (5, 11), major...Security Classification) Ln Use of 16S Ribosomal RNA Sequences to infer Relationships among Archaebacteria : Annual Report (U) q 12 PERSONAL AUTHOR(S...FIELD GROUP SUB-GROUP Archaebacteria ; Eubacteria; Eukaryotes; 16S Ribosomal RNA; 08 I Phylogeny; rRNA; RNA Sequencing; Molecular Clock; Urkingdoms; r

  2. Single-Cell RNA Sequencing of the Bronchial Epithelium in Smokers With Lung Cancer

    DTIC Science & Technology

    2015-07-01

    AWARD NUMBER: W81XWH-14-1-0234 TITLE: Single-Cell RNA Sequencing of the Bronchial Epithelium in Smokers With Lung Cancer PRINCIPAL INVESTIGATOR...TITLE AND SUBTITLE Single-Cell RNA Sequencing of the Bronchial Epithelium in Smokers With Lung Cancer 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH...single cell RNA sequencing on airway epithelial cells obtained from smokers with and without lung cancer to identify cell-type dependent gene expression

  3. Digital RNA sequencing minimizes sequence-dependent bias and amplification noise with optimized single-molecule barcodes

    PubMed Central

    Shiroguchi, Katsuyuki; Jia, Tony Z.; Sims, Peter A.; Xie, X. Sunney

    2012-01-01

    RNA sequencing (RNA-Seq) is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification. We developed a simple strategy for mitigating these complications, allowing truly digital RNA-Seq. Following reverse transcription, a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends. After PCR, we applied paired-end deep sequencing to read the two barcodes and cDNA sequences. Rather than counting the number of reads, RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence. We optimized the barcodes to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome. We demonstrated transcriptome profiling of Escherichia coli with more accurate and reproducible quantification than conventional RNA-Seq. PMID:22232676

  4. Sequence-structure relationships in RNA loops: establishing the basis for loop homology modeling.

    PubMed

    Schudoma, Christian; May, Patrick; Nikiforova, Viktoria; Walther, Dirk

    2010-01-01

    The specific function of RNA molecules frequently resides in their seemingly unstructured loop regions. We performed a systematic analysis of RNA loops extracted from experimentally determined three-dimensional structures of RNA molecules. A comprehensive loop-structure data set was created and organized into distinct clusters based on structural and sequence similarity. We detected clear evidence of the hallmark of homology present in the sequence-structure relationships in loops. Loops differing by <25% in sequence identity fold into very similar structures. Thus, our results support the application of homology modeling for RNA loop model building. We established a threshold that may guide the sequence divergence-based selection of template structures for RNA loop homology modeling. Of all possible sequences that are, under the assumption of isosteric relationships, theoretically compatible with actual sequences observed in RNA structures, only a small fraction is contained in the Rfam database of RNA sequences and classes implying that the actual RNA loop space may consist of a limited number of unique loop structures and conserved sequences. The loop-structure data sets are made available via an online database, RLooM. RLooM also offers functionalities for the modeling of RNA loop structures in support of RNA engineering and design efforts.

  5. Long-read sequencing of nascent RNA reveals coupling among RNA processing events.

    PubMed

    Herzel, Lydia; Straube, Korinna; Neugebauer, Karla M

    2018-06-14

    Pre-mRNA splicing is accomplished by the spliceosome, a megadalton complex that assembles de novo on each intron. Because spliceosome assembly and catalysis occur cotranscriptionally, we hypothesized that introns are removed in the order of their transcription in genomes dominated by constitutive splicing. Remarkably little is known about splicing order and the regulatory potential of nascent transcript remodeling by splicing, due to the limitations of existing methods that focus on analysis of mature splicing products (mRNAs) rather than substrates and intermediates. Here, we overcome this obstacle through long-read RNA sequencing of nascent, multi-intron transcripts in the fission yeast Schizosaccharomyces pombe Most multi-intron transcripts were fully spliced, consistent with rapid cotranscriptional splicing. However, an unexpectedly high proportion of transcripts were either fully spliced or fully unspliced, suggesting that splicing of any given intron is dependent on the splicing status of other introns in the transcript. Supporting this, mild inhibition of splicing by a temperature-sensitive mutation in prp2 , the homolog of vertebrate U2AF65, increased the frequency of fully unspliced transcripts. Importantly, fully unspliced transcripts displayed transcriptional read-through at the polyA site and were degraded cotranscriptionally by the nuclear exosome. Finally, we show that cellular mRNA levels were reduced in genes with a high number of unspliced nascent transcripts during caffeine treatment, showing regulatory significance of cotranscriptional splicing. Therefore, overall splicing of individual nascent transcripts, 3' end formation, and mRNA half-life depend on the splicing status of neighboring introns, suggesting crosstalk among spliceosomes and the polyA cleavage machinery during transcription elongation. © 2018 Herzel et al.; Published by Cold Spring Harbor Laboratory Press.

  6. Molecular characterization of physis tissue by RNA sequencing.

    PubMed

    Paradise, Christopher R; Galeano-Garces, Catalina; Galeano-Garces, Daniela; Dudakovic, Amel; Milbrandt, Todd A; Saris, Daniel B F; Krych, Aaron J; Karperien, Marcel; Ferguson, Gabriel B; Evseenko, Denis; Riester, Scott M; van Wijnen, Andre J; Noelle Larson, A

    2018-08-20

    The physis is a well-established and anatomically distinct cartilaginous structure that is crucial for normal long-bone development and growth. Abnormalities in physis function are linked to growth plate disorders and other pediatric musculoskeletal diseases. Understanding the molecular pathways operative in the physis may permit development of regenerative therapies to complement surgically-based procedures that are the current standard of care for growth plate disorders. Here, we performed next generation RNA sequencing on mRNA isolated from human physis and other skeletal tissues (e.g., articular cartilage and bone; n = 7 for each tissue). We observed statistically significant enrichment of gene sets in the physis when compared to the other musculoskeletal tissues. Further analysis of these upregulated genes identified physis-specific networks of extracellular matrix proteins including collagens (COL2A1, COL6A1, COL9A1, COL14A1, COL16A1) and matrilins (MATN1, MATN2, MATN3), and signaling proteins in the WNT pathway (WNT10B, FZD1, FZD10, DKK2) or the FGF pathway (FGF10, FGFR4). Our results provide further insight into the gene expression networks that contribute to the physis' unique structural composition and regulatory signaling networks. Physis-specific expression profiles may guide ongoing initiatives in tissue engineering and cell-based therapies for treatment of growth plate disorders and growth modulation therapies. Furthermore, our findings provide new leads for therapeutic drug discovery that would permit future intervention through pharmacological rather than surgical strategies. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.

    PubMed

    Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A

    2018-05-01

    Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.

  8. Equally parsimonious pathways through an RNA sequence space are not equally likely

    NASA Technical Reports Server (NTRS)

    Lee, Y. H.; DSouza, L. M.; Fox, G. E.

    1997-01-01

    An experimental system for determining the potential ability of sequences resembling 5S ribosomal RNA (rRNA) to perform as functional 5S rRNAs in vivo in the Escherichia coli cellular environment was devised previously. Presumably, the only 5S rRNA sequences that would have been fixed by ancestral populations are ones that were functionally valid, and hence the actual historical paths taken through RNA sequence space during 5S rRNA evolution would have most likely utilized valid sequences. Herein, we examine the potential validity of all sequence intermediates along alternative equally parsimonious trajectories through RNA sequence space which connect two pairs of sequences that had previously been shown to behave as valid 5S rRNAs in E. coli. The first trajectory requires a total of four changes. The 14 sequence intermediates provide 24 apparently equally parsimonious paths by which the transition could occur. The second trajectory involves three changes, six intermediate sequences, and six potentially equally parsimonious paths. In total, only eight of the 20 sequence intermediates were found to be clearly invalid. As a consequence of the position of these invalid intermediates in the sequence space, seven of the 30 possible paths consisted of exclusively valid sequences. In several cases, the apparent validity/invalidity of the intermediate sequences could not be anticipated on the basis of current knowledge of the 5S rRNA structure. This suggests that the interdependencies in RNA sequence space may be more complex than currently appreciated. If ancestral sequences predicted by parsimony are to be regarded as actual historical sequences, then the present results would suggest that they should also satisfy a validity requirement and that, in at least limited cases, this conjecture can be tested experimentally.

  9. Annealing to sequences within the primer binding site loop promotes an HIV-1 RNA conformation favoring RNA dimerization and packaging

    PubMed Central

    Seif, Elias; Niu, Meijuan; Kleiman, Lawrence

    2013-01-01

    The 5′ untranslated region (5′ UTR) of HIV-1 genomic RNA (gRNA) includes structural elements that regulate reverse transcription, transcription, translation, tRNALys3 annealing to the gRNA, and gRNA dimerization and packaging into viruses. It has been reported that gRNA dimerization and packaging are regulated by changes in the conformation of the 5′-UTR RNA. In this study, we show that annealing of tRNALys3 or a DNA oligomer complementary to sequences within the primer binding site (PBS) loop of the 5′ UTR enhances its dimerization in vitro. Structural analysis of the 5′-UTR RNA using selective 2′-hydroxyl acylation analyzed by primer extension (SHAPE) shows that the annealing promotes a conformational change of the 5′ UTR that has been previously reported to favor gRNA dimerization and packaging into virus. The model predicted by SHAPE analysis is supported by antisense experiments designed to test which annealed sequences will promote or inhibit gRNA dimerization. Based on reports showing that the gRNA dimerization favors its incorporation into viruses, we tested the ability of a mutant gRNA unable to anneal to tRNALys3 to be incorporated into virions. We found a ∼60% decrease in mutant gRNA packaging compared with wild-type gRNA. Together, these data further support a model for viral assembly in which the initial annealing of tRNALys3 to gRNA is cytoplasmic, which in turn aids in the promotion of gRNA dimerization and its incorporation into virions. PMID:23960173

  10. Single-Cell RNA Sequencing of Human T Cells.

    PubMed

    Villani, Alexandra-Chloé; Shekhar, Karthik

    2017-01-01

    Understanding how populations of human T cells leverage cellular heterogeneity, plasticity, and diversity to achieve a wide range of functional flexibility, particularly during dynamic processes such as development, differentiation, and antigenic response, is a core challenge that is well suited for single-cell analysis. Hypothesis-free evaluation of cellular states and subpopulations by transcriptional profiling of single T cells can identify relationships that may be obscured by targeted approaches such as FACS sorting on cell-surface antigens, or bulk expression analysis. While this approach is relevant to all cell types, it is of particular interest in the study of T cells for which classical phenotypic criteria are now viewed as insufficient for distinguishing different T cell subtypes and transitional states, and defining the changes associated with dysfunctional T cell states in autoimmunity and tumor-related exhaustion. This unit describes a protocol to generate single-cell transcriptomic libraries of human blood CD4 + and CD8 + T cells, and also introduces the basic bioinformatic steps to process the resulting sequence data for further computational analysis. We show how cellular subpopulations can be identified from transcriptional data, and derive characteristic gene expression signatures that distinguish these states. We believe single-cell RNA-seq is a powerful technique to study the cellular heterogeneity in complex tissues, a paradigm that will be of great value for the immune system.

  11. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed Central

    Hori, H; Osawa, S; Iwabuchi, M

    1980-01-01

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

  12. Genomic Sequence of the WHO International Standard for Hepatitis A Virus RNA.

    PubMed

    Jenkins, Adrian; Minhas, Rehan; Morris, Clare; Berry, Neil

    2018-05-10

    The World Health Organization (WHO) international standard for hepatitis A virus (HAV) RNA nucleic acid assays was characterized by complete genome sequencing. The entire coding sequence and noncoding regions were assigned HAV genotype IB. This information will aid the design, development, and evaluation of HAV RNA amplification assays. Copyright © 2018 Jenkins et al.

  13. Transcription profile of boar spermatozoa as revealed by RNA-sequencing

    USDA-ARS?s Scientific Manuscript database

    High-throughput RNA sequencing (RNA-Seq) overcomes the limitations of the current hybridization-based techniques to detect the actual pool of RNA transcripts in spermatozoa. The application of this technology in livestock can speed the discovery of potential predictors of male fertility. As a first ...

  14. Evaluating Quality of Aged Archival Formalin-Fixed Paraffin-Embedded Samples for RNA-Sequencing

    EPA Science Inventory

    Archival formalin-fixed paraffin-embedded (FFPE) samples offer a vast, untapped source of genomic data for biomarker discovery. However, the quality of FFPE samples is often highly variable, and conventional methods to assess RNA quality for RNA-sequencing (RNA-seq) are not infor...

  15. Optimized approach for Ion Proton RNA sequencing reveals details of RNA splicing and editing features of the transcriptome.

    PubMed

    Brown, Roger B; Madrid, Nathaniel J; Suzuki, Hideaki; Ness, Scott A

    2017-01-01

    RNA-sequencing (RNA-seq) has become the standard method for unbiased analysis of gene expression but also provides access to more complex transcriptome features, including alternative RNA splicing, RNA editing, and even detection of fusion transcripts formed through chromosomal translocations. However, differences in library methods can adversely affect the ability to recover these different types of transcriptome data. For example, some methods have bias for one end of transcripts or rely on low-efficiency steps that limit the complexity of the resulting library, making detection of rare transcripts less likely. We tested several commonly used methods of RNA-seq library preparation and found vast differences in the detection of advanced transcriptome features, such as alternatively spliced isoforms and RNA editing sites. By comparing several different protocols available for the Ion Proton sequencer and by utilizing detailed bioinformatics analysis tools, we were able to develop an optimized random primer based RNA-seq technique that is reliable at uncovering rare transcript isoforms and RNA editing features, as well as fusion reads from oncogenic chromosome rearrangements. The combination of optimized libraries and rapid Ion Proton sequencing provides a powerful platform for the transcriptome analysis of research and clinical samples.

  16. INFO-RNA—a server for fast inverse RNA folding satisfying sequence constraints

    PubMed Central

    Busch, Anke; Backofen, Rolf

    2007-01-01

    INFO-RNA is a new web server for designing RNA sequences that fold into a user given secondary structure. Furthermore, constraints on the sequence can be specified, e.g. one can restrict sequence positions to a fixed nucleotide or to a set of nucleotides. Moreover, the user can allow violations of the constraints at some positions, which can be advantageous in complicated cases. The INFO-RNA web server allows biologists to design RNA sequences in an automatic manner. It is clearly and intuitively arranged and easy to use. The procedure is fast, as most applications are completed within seconds and it proceeds better and faster than other existing tools. The INFO-RNA web server is freely available at http://www.bioinf.uni-freiburg.de/Software/INFO-RNA/ PMID:17452349

  17. Variant discovery in the sheep milk transcriptome using RNA sequencing.

    PubMed

    Suárez-Vega, Aroa; Gutiérrez-Gil, Beatriz; Klopp, Christophe; Tosser-Klopp, Gwenola; Arranz, Juan José

    2017-02-15

    The identification of genetic variation underlying desired phenotypes is one of the main challenges of current livestock genetic research. High-throughput transcriptome sequencing (RNA-Seq) offers new opportunities for the detection of transcriptome variants (SNPs and short indels) in different tissues and species. In this study, we used RNA-Seq on Milk Sheep Somatic Cells (MSCs) with the goal of characterizing the genetic variation within the coding regions of the milk transcriptome in Churra and Assaf sheep, two common dairy sheep breeds farmed in Spain. A total of 216,637 variants were detected in the MSCs transcriptome of the eight ewes analyzed. Among them, a total of 57,795 variants were detected in the regions harboring Quantitative Trait Loci (QTL) for milk yield, protein percentage and fat percentage, of which 21.44% were novel variants. Among the total variants detected, 561 (2.52%) and 1,649 (7.42%) were predicted to produce high or moderate impact changes in the corresponding transcriptional unit, respectively. In the functional enrichment analysis of the genes positioned within selected QTL regions harboring novel relevant functional variants (high and moderate impact), the KEGG pathway with the highest enrichment was "protein processing in endoplasmic reticulum". Additionally, a total of 504 and 1,063 variants were identified in the genes encoding principal milk proteins and molecules involved in the lipid metabolism, respectively. Of these variants, 20 mutations were found to have putative relevant effects on the encoded proteins. We present herein the first transcriptomic approach aimed at identifying genetic variants of the genes expressed in the lactating mammary gland of sheep. Through the transcriptome analysis of variability within regions harboring QTL for milk yield, protein percentage and fat percentage, we have found several pathways and genes that harbor mutations that could affect dairy production traits. Moreover, remarkable variants

  18. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing.

    PubMed

    Chan, Chia Sing; Chan, Kok-Gan; Tay, Yea-Ling; Chua, Yi-Heng; Goh, Kian Mau

    2015-01-01

    The Sungai Klah (SK) hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-m-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0-9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3-V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream) and geochemical parameters (broad temperature and pH range). It is speculated that symbiotic relationships occur between the members of the community.

  19. BioVLAB-MMIA-NGS: microRNA-mRNA integrated analysis using high-throughput sequencing data.

    PubMed

    Chae, Heejoon; Rhee, Sungmin; Nephew, Kenneth P; Kim, Sun

    2015-01-15

    It is now well established that microRNAs (miRNAs) play a critical role in regulating gene expression in a sequence-specific manner, and genome-wide efforts are underway to predict known and novel miRNA targets. However, the integrated miRNA-mRNA analysis remains a major computational challenge, requiring powerful informatics systems and bioinformatics expertise. The objective of this study was to modify our widely recognized Web server for the integrated mRNA-miRNA analysis (MMIA) and its subsequent deployment on the Amazon cloud (BioVLAB-MMIA) to be compatible with high-throughput platforms, including next-generation sequencing (NGS) data (e.g. RNA-seq). We developed a new version called the BioVLAB-MMIA-NGS, deployed on both Amazon cloud and on a high-performance publicly available server called MAHA. By using NGS data and integrating various bioinformatics tools and databases, BioVLAB-MMIA-NGS offers several advantages. First, sequencing data is more accurate than array-based methods for determining miRNA expression levels. Second, potential novel miRNAs can be detected by using various computational methods for characterizing miRNAs. Third, because miRNA-mediated gene regulation is due to hybridization of an miRNA to its target mRNA, sequencing data can be used to identify many-to-many relationship between miRNAs and target genes with high accuracy. http://epigenomics.snu.ac.kr/biovlab_mmia_ngs/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. RNA Sequencing of the Exercise Transcriptome in Equine Athletes

    PubMed Central

    Verini-Supplizi, Andrea; Barcaccia, Gianni; Albiero, Alessandro; D'Angelo, Michela; Campagna, Davide; Valle, Giorgio; Felicetti, Michela; Silvestrelli, Maurizio; Cappelli, Katia

    2013-01-01

    The horse is an optimal model organism for studying the genomic response to exercise-induced stress, due to its natural aptitude for athletic performance and the relative homogeneity of its genetic and environmental backgrounds. Here, we applied RNA-sequencing analysis through the use of SOLiD technology in an experimental framework centered on exercise-induced stress during endurance races in equine athletes. We monitored the transcriptional landscape by comparing gene expression levels between animals at rest and after competition. Overall, we observed a shift from coding to non-coding regions, suggesting that the stress response involves the differential expression of not annotated regions. Notably, we observed significant post-race increases of reads that correspond to repeats, especially the intergenic and intronic L1 and L2 transposable elements. We also observed increased expression of the antisense strands compared to the sense strands in intronic and regulatory regions (1 kb up- and downstream) of the genes, suggesting that antisense transcription could be one of the main mechanisms for transposon regulation in the horse under stress conditions. We identified a large number of transcripts corresponding to intergenic and intronic regions putatively associated with new transcriptional elements. Gene expression and pathway analysis allowed us to identify several biological processes and molecular functions that may be involved with exercise-induced stress. Ontology clustering reflected mechanisms that are already known to be stress activated (e.g., chemokine-type cytokines, Toll-like receptors, and kinases), as well as “nucleic acid binding” and “signal transduction activity” functions. There was also a general and transient decrease in the global rates of protein synthesis, which would be expected after strenuous global stress. In sum, our network analysis points toward the involvement of specific gene clusters in equine exercise-induced stress

  1. Maternal Plasma DNA and RNA Sequencing for Prenatal Testing.

    PubMed

    Tamminga, Saskia; van Maarle, Merel; Henneman, Lidewij; Oudejans, Cees B M; Cornel, Martina C; Sistermans, Erik A

    2016-01-01

    Cell-free DNA (cfDNA) testing has recently become indispensable in diagnostic testing and screening. In the prenatal setting, this type of testing is often called noninvasive prenatal testing (NIPT). With a number of techniques, using either next-generation sequencing or single nucleotide polymorphism-based approaches, fetal cfDNA in maternal plasma can be analyzed to screen for rhesus D genotype, common chromosomal aneuploidies, and increasingly for testing other conditions, including monogenic disorders. With regard to screening for common aneuploidies, challenges arise when implementing NIPT in current prenatal settings. Depending on the method used (targeted or nontargeted), chromosomal anomalies other than trisomy 21, 18, or 13 can be detected, either of fetal or maternal origin, also referred to as unsolicited or incidental findings. For various biological reasons, there is a small chance of having either a false-positive or false-negative NIPT result, or no result, also referred to as a "no-call." Both pre- and posttest counseling for NIPT should include discussing potential discrepancies. Since NIPT remains a screening test, a positive NIPT result should be confirmed by invasive diagnostic testing (either by chorionic villus biopsy or by amniocentesis). As the scope of NIPT is widening, professional guidelines need to discuss the ethics of what to offer and how to offer. In this review, we discuss the current biochemical, clinical, and ethical challenges of cfDNA testing in the prenatal setting and its future perspectives including novel applications that target RNA instead of DNA. © 2016 Elsevier Inc. All rights reserved.

  2. Quantifying the relationship between sequence and three-dimensional structure conservation in RNA

    PubMed Central

    2010-01-01

    Background In recent years, the number of available RNA structures has rapidly grown reflecting the increased interest on RNA biology. Similarly to the studies carried out two decades ago for proteins, which gave the fundamental grounds for developing comparative protein structure prediction methods, we are now able to quantify the relationship between sequence and structure conservation in RNA. Results Here we introduce an all-against-all sequence- and three-dimensional (3D) structure-based comparison of a representative set of RNA structures, which have allowed us to quantitatively confirm that: (i) there is a measurable relationship between sequence and structure conservation that weakens for alignments resulting in below 60% sequence identity, (ii) evolution tends to conserve more RNA structure than sequence, and (iii) there is a twilight zone for RNA homology detection. Discussion The computational analysis here presented quantitatively describes the relationship between sequence and structure for RNA molecules and defines a twilight zone region for detecting RNA homology. Our work could represent the theoretical basis and limitations for future developments in comparative RNA 3D structure prediction. PMID:20550657

  3. Discriminative Prediction of A-To-I RNA Editing Events from DNA Sequence

    PubMed Central

    Sun, Jiangming; Singh, Pratibha; Bagge, Annika; Valtat, Bérengère; Vikman, Petter; Spégel, Peter; Mulder, Hindrik

    2016-01-01

    RNA editing is a post-transcriptional alteration of RNA sequences that, via insertions, deletions or base substitutions, can affect protein structure as well as RNA and protein expression. Recently, it has been suggested that RNA editing may be more frequent than previously thought. A great impediment, however, to a deeper understanding of this process is the paramount sequencing effort that needs to be undertaken to identify RNA editing events. Here, we describe an in silico approach, based on machine learning, that ameliorates this problem. Using 41 nucleotide long DNA sequences, we show that novel A-to-I RNA editing events can be predicted from known A-to-I RNA editing events intra- and interspecies. The validity of the proposed method was verified in an independent experimental dataset. Using our approach, 203 202 putative A-to-I RNA editing events were predicted in the whole human genome. Out of these, 9% were previously reported. The remaining sites require further validation, e.g., by targeted deep sequencing. In conclusion, the approach described here is a useful tool to identify potential A-to-I RNA editing events without the requirement of extensive RNA sequencing. PMID:27764195

  4. Integrated sequencing of exome and mRNA of large-sized single cells.

    PubMed

    Wang, Lily Yan; Guo, Jiajie; Cao, Wei; Zhang, Meng; He, Jiankui; Li, Zhoufang

    2018-01-10

    Current approaches of single cell DNA-RNA integrated sequencing are difficult to call SNPs, because a large amount of DNA and RNA is lost during DNA-RNA separation. Here, we performed simultaneous single-cell exome and transcriptome sequencing on individual mouse oocytes. Using microinjection, we kept the nuclei intact to avoid DNA loss, while retaining the cytoplasm inside the cell membrane, to maximize the amount of DNA and RNA captured from the single cell. We then conducted exome-sequencing on the isolated nuclei and mRNA-sequencing on the enucleated cytoplasm. For single oocytes, exome-seq can cover up to 92% of exome region with an average sequencing depth of 10+, while mRNA-sequencing reveals more than 10,000 expressed genes in enucleated cytoplasm, with similar performance for intact oocytes. This approach provides unprecedented opportunities to study DNA-RNA regulation, such as RNA editing at single nucleotide level in oocytes. In future, this method can also be applied to other large cells, including neurons, large dendritic cells and large tumour cells for integrated exome and transcriptome sequencing.

  5. Deep sequencing and in silico analysis of small RNA library reveals novel miRNA from leaf Persicaria minor transcriptome.

    PubMed

    Samad, Abdul Fatah A; Nazaruddin, Nazaruddin; Murad, Abdul Munir Abdul; Jani, Jaeyres; Zainal, Zamri; Ismail, Ismanizan

    2018-03-01

    In current era, majority of microRNA (miRNA) are being discovered through computational approaches which are more confined towards model plants. Here, for the first time, we have described the identification and characterization of novel miRNA in a non-model plant, Persicaria minor ( P . minor ) using computational approach. Unannotated sequences from deep sequencing were analyzed based on previous well-established parameters. Around 24 putative novel miRNAs were identified from 6,417,780 reads of the unannotated sequence which represented 11 unique putative miRNA sequences. PsRobot target prediction tool was deployed to identify the target transcripts of putative novel miRNAs. Most of the predicted target transcripts (mRNAs) were known to be involved in plant development and stress responses. Gene ontology showed that majority of the putative novel miRNA targets involved in cellular component (69.07%), followed by molecular function (30.08%) and biological process (0.85%). Out of 11 unique putative miRNAs, 7 miRNAs were validated through semi-quantitative PCR. These novel miRNAs discoveries in P . minor may develop and update the current public miRNA database.

  6. Sequence-Specific Affinity Chromatography of Bacterial Small Regulatory RNA-Binding Proteins from Bacterial Cells.

    PubMed

    Gans, Jonathan; Osborne, Jonathan; Cheng, Juliet; Djapgne, Louise; Oglesby-Sherrouse, Amanda G

    2018-01-01

    Bacterial small RNA molecules (sRNAs) are increasingly recognized as central regulators of bacterial stress responses and pathogenesis. In many cases, RNA-binding proteins are critical for the stability and function of sRNAs. Previous studies have adopted strategies to genetically tag an sRNA of interest, allowing isolation of RNA-protein complexes from cells. Here we present a sequence-specific affinity purification protocol that requires no prior genetic manipulation of bacterial cells, allowing isolation of RNA-binding proteins bound to native RNA molecules.

  7. High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

    PubMed Central

    Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.

    2016-01-01

    Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from <1 ng of plasma RNA in <5 h. TGIRT-seq of RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

  8. Messenger RNA biomarker signatures for forensic body fluid identification revealed by targeted RNA sequencing.

    PubMed

    Hanson, E; Ingold, S; Haas, C; Ballantyne, J

    2018-05-01

    The recovery of a DNA profile from the perpetrator or victim in criminal investigations can provide valuable 'source level' information for investigators. However, a DNA profile does not reveal the circumstances by which biological material was transferred. Some contextual information can be obtained by a determination of the tissue or fluid source of origin of the biological material as it is potentially indicative of some behavioral activity on behalf of the individual that resulted in its transfer from the body. Here, we sought to improve upon established RNA based methods for body fluid identification by developing a targeted multiplexed next generation mRNA sequencing assay comprising a panel of approximately equal sized gene amplicons. The multiplexed biomarker panel includes several highly specific gene targets with the necessary specificity to definitively identify most forensically relevant biological fluids and tissues (blood, semen, saliva, vaginal secretions, menstrual blood and skin). In developing the biomarker panel we evaluated 66 gene targets, with a progressive iteration of testing target combinations that exhibited optimal sensitivity and specificity using a training set of forensically relevant body fluid samples. The current assay comprises 33 targets: 6 blood, 6 semen, 6 saliva, 4 vaginal secretions, 5 menstrual blood and 6 skin markers. We demonstrate the sensitivity and specificity of the assay and the ability to identify body fluids in single source and admixed stains. A 16 sample blind test was carried out by one lab with samples provided by the other participating lab. The blinded lab correctly identified the body fluids present in 15 of the samples with the major component identified in the 16th. Various classification methods are being investigated to permit inference of the body fluid/tissue in dried physiological stains. These include the percentage of reads in a sample that are due to each of the 6 tissues/body fluids tested and

  9. [Influence of antisense RNA and sequences of viral transactivators traps on RNA synthesis of HTLV-1 virus].

    PubMed

    Borisenko, A S; Kotus, E V; Kaloshin, A A

    2008-01-01

    Significant number of scientific publications devoted to inhibition of viral replication by antisense RNA (asRNA) genes shows that this approach is useful for gene therapy of viral infections. To investigate the possibility of suppression of HTLV-1 virus reproduction by asRNA we constructed recombinant plasmids containing asRNA genes against U3 long terminal repeats region and X gene under the control of promoter of myeloproliferative sarcoma virus (MPSV) or without such promoter. Using stable calcium-phosphate transfection method with subsequent selection in the presence of G-418, RaHOS line-based cell clones carrying both asRNA genes and sequences able to bind HTLV-1 transactivator proteins (i.e. "traps" of viral transactivators, TVT) were obtained. Data from dot-hybridization analysis of viral RNA extracted from RaHOS cell clones showed that TVT sequences are able to suppress the viral RNA synthesis on 90% and asRNA against X gene synthesis--on 50%.

  10. RStrucFam: a web server to associate structure and cognate RNA for RNA-binding proteins from sequence information.

    PubMed

    Ghosh, Pritha; Mathew, Oommen K; Sowdhamini, Ramanathan

    2016-10-07

    RNA-binding proteins (RBPs) interact with their cognate RNA(s) to form large biomolecular assemblies. They are versatile in their functionality and are involved in a myriad of processes inside the cell. RBPs with similar structural features and common biological functions are grouped together into families and superfamilies. It will be useful to obtain an early understanding and association of RNA-binding property of sequences of gene products. Here, we report a web server, RStrucFam, to predict the structure, type of cognate RNA(s) and function(s) of proteins, where possible, from mere sequence information. The web server employs Hidden Markov Model scan (hmmscan) to enable association to a back-end database of structural and sequence families. The database (HMMRBP) comprises of 437 HMMs of RBP families of known structure that have been generated using structure-based sequence alignments and 746 sequence-centric RBP family HMMs. The input protein sequence is associated with structural or sequence domain families, if structure or sequence signatures exist. In case of association of the protein with a family of known structures, output features like, multiple structure-based sequence alignment (MSSA) of the query with all others members of that family is provided. Further, cognate RNA partner(s) for that protein, Gene Ontology (GO) annotations, if any and a homology model of the protein can be obtained. The users can also browse through the database for details pertaining to each family, protein or RNA and their related information based on keyword search or RNA motif search. RStrucFam is a web server that exploits structurally conserved features of RBPs, derived from known family members and imprinted in mathematical profiles, to predict putative RBPs from sequence information. Proteins that fail to associate with such structure-centric families are further queried against the sequence-centric RBP family HMMs in the HMMRBP database. Further, all other essential

  11. Comprehensive comparative analysis of 5'-end RNA-sequencing methods.

    PubMed

    Adiconis, Xian; Haber, Adam L; Simmons, Sean K; Levy Moonshine, Ami; Ji, Zhe; Busby, Michele A; Shi, Xi; Jacques, Justin; Lancaster, Madeline A; Pan, Jen Q; Regev, Aviv; Levin, Joshua Z

    2018-06-04

    Specialized RNA-seq methods are required to identify the 5' ends of transcripts, which are critical for studies of gene regulation, but these methods have not been systematically benchmarked. We directly compared six such methods, including the performance of five methods on a single human cellular RNA sample and a new spike-in RNA assay that helps circumvent challenges resulting from uncertainties in annotation and RNA processing. We found that the 'cap analysis of gene expression' (CAGE) method performed best for mRNA and that most of its unannotated peaks were supported by evidence from other genomic methods. We applied CAGE to eight brain-related samples and determined sample-specific transcription start site (TSS) usage, as well as a transcriptome-wide shift in TSS usage between fetal and adult brain.

  12. Deep Sequencing of RNA from Ancient Maize Kernels

    PubMed Central

    Rasmussen, Morten; Cappellini, Enrico; Romero-Navarro, J. Alberto; Wales, Nathan; Alquezar-Planas, David E.; Penfield, Steven; Brown, Terence A.; Vielle-Calzada, Jean-Philippe; Montiel, Rafael; Jørgensen, Tina; Odegaard, Nancy; Jacobs, Michael; Arriaza, Bernardo; Higham, Thomas F. G.; Ramsey, Christopher Bronk; Willerslev, Eske; Gilbert, M. Thomas P.

    2013-01-01

    The characterization of biomolecules from ancient samples can shed otherwise unobtainable insights into the past. Despite the fundamental role of transcriptomal change in evolution, the potential of ancient RNA remains unexploited – perhaps due to dogma associated with the fragility of RNA. We hypothesize that seeds offer a plausible refuge for long-term RNA survival, due to the fundamental role of RNA during seed germination. Using RNA-Seq on cDNA synthesized from nucleic acid extracts, we validate this hypothesis through demonstration of partial transcriptomal recovery from two sources of ancient maize kernels. The results suggest that ancient seed transcriptomics may offer a powerful new tool with which to study plant domestication. PMID:23326310

  13. Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations.

    PubMed

    Reid-Bayliss, Kate S; Loeb, Lawrence A

    2017-08-29

    Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

  14. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  15. a Simple Symmetric Algorithm Using a Likeness with Introns Behavior in RNA Sequences

    NASA Astrophysics Data System (ADS)

    Regoli, Massimo

    2009-02-01

    The RNA-Crypto System (shortly RCS) is a symmetric key algorithm to cipher data. The idea for this new algorithm starts from the observation of nature. In particular from the observation of RNA behavior and some of its properties. The RNA sequences has some sections called Introns. Introns, derived from the term "intragenic regions", are non-coding sections of precursor mRNA (pre-mRNA) or other RNAs, that are removed (spliced out of the RNA) before the mature RNA is formed. Once the introns have been spliced out of a pre-mRNA, the resulting mRNA sequence is ready to be translated into a protein. The corresponding parts of a gene are known as introns as well. The nature and the role of Introns in the pre-mRNA is not clear and it is under ponderous researches by Biologists but, in our case, we will use the presence of Introns in the RNA-Crypto System output as a strong method to add chaotic non coding information and an unnecessary behaviour in the access to the secret key to code the messages. In the RNA-Crypto System algoritnm the introns are sections of the ciphered message with non-coding information as well as in the precursor mRNA.

  16. A short autocomplementary sequence plays an essential role in avian sarcoma-leukosis virus RNA dimerization.

    PubMed

    Fossé, P; Motté, N; Roumier, A; Gabus, C; Muriaux, D; Darlix, J L; Paoletti, J

    1996-12-24

    Retroviral genomes consist of two identical RNA molecules joined noncovalently near their 5'-ends. Recently, two models have been proposed for RNA dimer formation on the basis of results obtained in vitro with human immunodeficiency virus type 1 RNA and Moloney murine leukemia virus RNA. It was first proposed that viral RNA dimerizes by forming an interstrand quadruple helix with purine tetrads. The second model postulates that RNA dimerization is initiated by a loop-loop interaction between the two RNA molecules. In order to better characterize the dimerization process of retroviral genomic RNA, we analyzed the in vitro dimerization of avian sarcoma-leukosis virus (ASLV) RNA using different transcripts. We determined the requirements for heterodimer formation, the thermal dissociation of RNA dimers, and the influence of antisense DNA oligonucleotides on dimer formation. Our results strongly suggest that purine tetrads are not involved in dimer formation. Data show that an autocomplementary sequence located upstream from the splice donor site and within a major packaging signal plays a crucial role in ASLV RNA dimer formation in vitro. This sequence is able to form a stem-loop structure, and phylogenetic analysis reveals that it is conserved in 28 different avian sarcoma and leukosis viruses. These results suggest that dimerization of ASLV RNA is initiated by a loop-loop interaction between two RNA molecules and provide an additional argument for the ubiquity of the dimerization process via loop-loop interaction.

  17. Single Cell Total RNA Sequencing through Isothermal Amplification in Picoliter-Droplet Emulsion.

    PubMed

    Fu, Yusi; Chen, He; Liu, Lu; Huang, Yanyi

    2016-11-15

    Prevalent single cell RNA amplification and sequencing chemistries mainly focus on polyadenylated RNAs in eukaryotic cells by using oligo(dT) primers for reverse transcription. We develop a new RNA amplification method, "easier-seq", to reverse transcribe and amplify the total RNAs, both with and without polyadenylate tails, from a single cell for transcriptome sequencing with high efficiency, reproducibility, and accuracy. By distributing the reverse transcribed cDNA molecules into 1.5 × 10 5 aqueous droplets in oil, the cDNAs are isothermally amplified using random primers in each of these 65-pL reactors separately. This new method greatly improves the ease of single-cell RNA sequencing by reducing the experimental steps. Meanwhile, with less chance to induce errors, this method can easily maintain the quality of single-cell sequencing. In addition, this polyadenylate-tail-independent method can be seamlessly applied to prokaryotic cell RNA sequencing.

  18. Mapping the miRNA interactome by crosslinking ligation and sequencing of hybrids (CLASH)

    PubMed Central

    Helwak, Aleksandra; Tollervey, David

    2014-01-01

    RNA-RNA interactions play critical roles in many cellular processes but studying them is difficult and laborious. Here, we describe an experimental procedure, termed crosslinking ligation and sequencing of hybrids (CLASH), which allows high-throughput identification of sites of RNA-RNA interaction. During CLASH, a tagged bait protein is UV crosslinked in vivo to stabilise RNA interactions and purified under denaturing conditions. RNAs associated with the bait protein are partially truncated, and the ends of RNA-duplexes are ligated together. Following linker addition, cDNA library preparation and high-throughput sequencing, the ligated duplexes give rise to chimeric cDNAs, which unambiguously identify RNA-RNA interaction sites independent of bioinformatic predictions. This protocol is optimized for studying miRNA targets bound by Argonaute proteins, but should be easily adapted for other RNA-binding proteins and classes of RNA. The protocol requires around 5 days to complete, excluding the time required for high-throughput sequencing and bioinformatic analyses. PMID:24577361

  19. The conserved CAAGAAAGA spacer sequence is an essential element for the formation of 3' termini of the sea urchin H3 histone mRNA by RNA processing.

    PubMed Central

    Georgiev, O; Birnstiel, M L

    1985-01-01

    Analysis of cDNA sequences obtained from the small nuclear RNA U7 has previously suggested specific contacts, by base pairing, between the conserved stem-loop structure and CAAGAAAGA sequence of the histone pre-mRNA and the 5'-terminal sequence of the U7 RNA during RNA processing. In order to test some aspects of the model we have created a series of linker scan, deletion and insertion mutants of the 3' terminus of a sea urchin H3 histone gene and have injected mutant DNAs or in vitro synthesized precursors into frog oocyte nuclei for interpretation. We find that, in addition to the stem-loop structure of the mRNA, the CAAGAAAGA spacer transcript within the histone pre-mRNA is required absolutely for RNA processing, as predicted from our model. Spacer sequences immediately downstream of the CAAGAAAGA motif are not complementary to U7 RNA. Nevertheless, they are necessary for obtaining a maximal rate of RNA processing, as is the ACCA sequence coding for the 3' terminus of the mature mRNA. An increase of distance between the mRNA palindrome and the CAAGAAAGA by as little as six nucleotides abolishes all processing. It may, therefore, be useful to regard both these sequence motifs as part of one and the same RNA processing signal with narrowly defined topologies. Interestingly, U7 RNA-dependent 3' processing of histone pre-mRNA can occur in RNA injection experiments only when the in vitro synthesized pre-mRNA contains sequence extensions well beyond the region of sequence complementarities to the U7 RNA. In addition to directing 3' processing the terminal mRNA sequences may have a role in histone mRNA stabilization in the cytoplasmic compartment. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:2410259

  20. Using small RNA deep sequencing data to detect siRNA duplexes induced by plant viruses

    USDA-ARS?s Scientific Manuscript database

    Small interfering RNA (siRNA) duplexes are produced in plants during virus infection, which are short (usually 21 to 24-base pair) double-stranded RNAs (dsRNAs) with several overhanging nucleotides on the 5' end and 3' end. The investigation of the siRNA duplexes is useful to better understand the R...

  1. miRBase: integrating microRNA annotation and deep-sequencing data.

    PubMed

    Kozomara, Ana; Griffiths-Jones, Sam

    2011-01-01

    miRBase is the primary online repository for all microRNA sequences and annotation. The current release (miRBase 16) contains over 15,000 microRNA gene loci in over 140 species, and over 17,000 distinct mature microRNA sequences. Deep-sequencing technologies have delivered a sharp rise in the rate of novel microRNA discovery. We have mapped reads from short RNA deep-sequencing experiments to microRNAs in miRBase and developed web interfaces to view these mappings. The user can view all read data associated with a given microRNA annotation, filter reads by experiment and count, and search for microRNAs by tissue- and stage-specific expression. These data can be used as a proxy for relative expression levels of microRNA sequences, provide detailed evidence for microRNA annotations and alternative isoforms of mature microRNAs, and allow us to revisit previous annotations. miRBase is available online at: http://www.mirbase.org/.

  2. 3' terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing.

    PubMed

    Goldfarb, Katherine C; Cech, Thomas R

    2013-09-21

    Post-transcriptional 3' end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3' RACE coupled with high-throughput sequencing to characterize the 3' terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. The 3' terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3' terminus of an in vitro transcribed MRP RNA control and the differing 3' terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). 3' RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3' terminal sequences of noncoding RNAs.

  3. 3′ terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing

    PubMed Central

    2013-01-01

    Background Post-transcriptional 3′ end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3′ RACE coupled with high-throughput sequencing to characterize the 3′ terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. Results The 3′ terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3′ terminus of an in vitro transcribed MRP RNA control and the differing 3′ terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). Conclusions 3′ RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3′ terminal sequences of noncoding RNAs. PMID:24053768

  4. Advances in single-cell RNA sequencing and its applications in cancer research.

    PubMed

    Zhu, Sibo; Qing, Tao; Zheng, Yuanting; Jin, Li; Shi, Leming

    2017-08-08

    Unlike population-level approaches, single-cell RNA sequencing enables transcriptomic analysis of an individual cell. Through the combination of high-throughput sequencing and bioinformatic tools, single-cell RNA-seq can detect more than 10,000 transcripts in one cell to distinguish cell subsets and dynamic cellular changes. After several years' development, single-cell RNA-seq can now achieve massively parallel, full-length mRNA sequencing as well as in situ sequencing and even has potential for multi-omic detection. One appealing area of single-cell RNA-seq is cancer research, and it is regarded as a promising way to enhance prognosis and provide more precise target therapy by identifying druggable subclones. Indeed, progresses have been made regarding solid tumor analysis to reveal intratumoral heterogeneity, correlations between signaling pathways, stemness, drug resistance, and tumor architecture shaping the microenvironment. Furthermore, through investigation into circulating tumor cells, many genes have been shown to promote a propensity toward stemness and the epithelial-mesenchymal transition, to enhance anchoring and adhesion, and to be involved in mechanisms of anoikis resistance and drug resistance. This review focuses on advances and progresses of single-cell RNA-seq with regard to the following aspects: 1. Methodologies of single-cell RNA-seq 2. Single-cell isolation techniques 3. Single-cell RNA-seq in solid tumor research 4. Single-cell RNA-seq in circulating tumor cell research 5.

  5. Advances in single-cell RNA sequencing and its applications in cancer research

    PubMed Central

    Zhu, Sibo; Qing, Tao; Zheng, Yuanting; Jin, Li; Shi, Leming

    2017-01-01

    Unlike population-level approaches, single-cell RNA sequencing enables transcriptomic analysis of an individual cell. Through the combination of high-throughput sequencing and bioinformatic tools, single-cell RNA-seq can detect more than 10,000 transcripts in one cell to distinguish cell subsets and dynamic cellular changes. After several years’ development, single-cell RNA-seq can now achieve massively parallel, full-length mRNA sequencing as well as in situ sequencing and even has potential for multi-omic detection. One appealing area of single-cell RNA-seq is cancer research, and it is regarded as a promising way to enhance prognosis and provide more precise target therapy by identifying druggable subclones. Indeed, progresses have been made regarding solid tumor analysis to reveal intratumoral heterogeneity, correlations between signaling pathways, stemness, drug resistance, and tumor architecture shaping the microenvironment. Furthermore, through investigation into circulating tumor cells, many genes have been shown to promote a propensity toward stemness and the epithelial-mesenchymal transition, to enhance anchoring and adhesion, and to be involved in mechanisms of anoikis resistance and drug resistance. This review focuses on advances and progresses of single-cell RNA-seq with regard to the following aspects: 1. Methodologies of single-cell RNA-seq 2. Single-cell isolation techniques 3. Single-cell RNA-seq in solid tumor research 4. Single-cell RNA-seq in circulating tumor cell research 5. Perspectives PMID:28881849

  6. Sequence variation between 462 human individuals fine-tunes functional sites of RNA processing

    NASA Astrophysics Data System (ADS)

    Ferreira, Pedro G.; Oti, Martin; Barann, Matthias; Wieland, Thomas; Ezquina, Suzana; Friedländer, Marc R.; Rivas, Manuel A.; Esteve-Codina, Anna; Estivill, Xavier; Guigó, Roderic; Dermitzakis, Emmanouil; Antonarakis, Stylianos; Meitinger, Thomas; Strom, Tim M.; Palotie, Aarno; François Deleuze, Jean; Sudbrak, Ralf; Lerach, Hans; Gut, Ivo; Syvänen, Ann-Christine; Gyllensten, Ulf; Schreiber, Stefan; Rosenstiel, Philip; Brunner, Han; Veltman, Joris; Hoen, Peter A. C. T.; Jan van Ommen, Gert; Carracedo, Angel; Brazma, Alvis; Flicek, Paul; Cambon-Thomsen, Anne; Mangion, Jonathan; Bentley, David; Hamosh, Ada; Rosenstiel, Philip; Strom, Tim M.; Lappalainen, Tuuli; Guigó, Roderic; Sammeth, Michael

    2016-09-01

    Recent advances in the cost-efficiency of sequencing technologies enabled the combined DNA- and RNA-sequencing of human individuals at the population-scale, making genome-wide investigations of the inter-individual genetic impact on gene expression viable. Employing mRNA-sequencing data from the Geuvadis Project and genome sequencing data from the 1000 Genomes Project we show that the computational analysis of DNA sequences around splice sites and poly-A signals is able to explain several observations in the phenotype data. In contrast to widespread assessments of statistically significant associations between DNA polymorphisms and quantitative traits, we developed a computational tool to pinpoint the molecular mechanisms by which genetic markers drive variation in RNA-processing, cataloguing and classifying alleles that change the affinity of core RNA elements to their recognizing factors. The in silico models we employ further suggest RNA editing can moonlight as a splicing-modulator, albeit less frequently than genomic sequence diversity. Beyond existing annotations, we demonstrate that the ultra-high resolution of RNA-Seq combined from 462 individuals also provides evidence for thousands of bona fide novel elements of RNA processing—alternative splice sites, introns, and cleavage sites—which are often rare and lowly expressed but in other characteristics similar to their annotated counterparts.

  7. Embedding siRNA sequences targeting Apolipoprotein B100 in shRNA and miRNA scaffolds results in differential processing and in vivo efficacy

    PubMed Central

    Maczuga, Piotr; Lubelski, Jacek; van Logtenstein, Richard; Borel, Florie; Blits, Bas; Fakkert, Erwin; Costessi, Adalberto; Butler, Derek; van Deventer, Sander; Petry, Harald; Koornneef, Annemart; Konstantinova, Pavlina

    2013-01-01

    Overexpression of short hairpin RNA (shRNA) often causes cytotoxicity and using microRNA (miRNA) scaffolds can circumvent this problem. In this study, identically predicted small interfering RNA (siRNA) sequences targeting apolipoprotein B100 (siApoB) were embedded in shRNA (shApoB) or miRNA (miApoB) scaffolds and a direct comparison of the processing and long-term in vivo efficacy was performed. Next generation sequencing of small RNAs originating from shApoB- or miApoB-transfected cells revealed substantial differences in processing, resulting in different siApoB length, 5′ and 3′ cleavage sites and abundance of the guide or passenger strands. Murine liver transduction with adeno-associated virus (AAV) vectors expressing shApoB or miApoB resulted in high levels of siApoB expression associated with strong decrease of plasma ApoB protein and cholesterol. Expression of miApoB from the liver-specific LP1 promoter was restricted to the liver, while the H1 promoter-expressed shApoB was ectopically present. Delivery of 1 × 1011 genome copies AAV-shApoB or AAV-miApoB led to a gradual loss of ApoB and plasma cholesterol inhibition, which was circumvented by delivering a 20-fold lower vector dose. In conclusion, incorporating identical siRNA sequences in shRNA or miRNA scaffolds results in differential processing patterns and in vivo efficacy that may have serious consequences for future RNAi-based therapeutics. PMID:23089734

  8. MicroRNA Expression Profile in Penile Cancer Revealed by Next-Generation Small RNA Sequencing

    PubMed Central

    Zhang, Yuanwei; Xu, Bo; Zhou, Jun; Fan, Song; Hao, Zongyao; Shi, Haoqiang; Zhang, Xiansheng; Kong, Rui; Xu, Lingfan; Gao, Jingjing; Zou, Duohong; Liang, Chaozhao

    2015-01-01

    Penile cancer (PeCa) is a relatively rare tumor entity but possesses higher morbidity and mortality rates especially in developing countries. To date, the concrete pathogenic signaling pathways and core machineries involved in tumorigenesis and progression of PeCa remain to be elucidated. Several studies suggested miRNAs, which modulate gene expression at posttranscriptional level, were frequently mis-regulated and aberrantly expressed in human cancers. However, the miRNA profile in human PeCa has not been reported before. In this present study, the miRNA profile was obtained from 10 fresh penile cancerous tissues and matched adjacent non-cancerous tissues via next-generation sequencing. As a result, a total of 751 and 806 annotated miRNAs were identified in normal and cancerous penile tissues, respectively. Among which, 56 miRNAs with significantly different expression levels between paired tissues were identified. Subsequently, several annotated miRNAs were selected randomly and validated using quantitative real-time PCR. Compared with the previous publications regarding to the altered miRNAs expression in various cancers and especially genitourinary (prostate, bladder, kidney, testis) cancers, the most majority of deregulated miRNAs showed the similar expression pattern in penile cancer. Moreover, the bioinformatics analyses suggested that the putative target genes of differentially expressed miRNAs between cancerous and matched normal penile tissues were tightly associated with cell junction, proliferation, growth as well as genomic instability and so on, by modulating Wnt, MAPK, p53, PI3K-Akt, Notch and TGF-β signaling pathways, which were all well-established to participate in cancer initiation and progression. Our work presents a global view of the differentially expressed miRNAs and potentially regulatory networks of their target genes for clarifying the pathogenic transformation of normal penis to PeCa, which research resource also provides new insights

  9. Informatics for RNA Sequencing: A Web Resource for Analysis on the Cloud

    PubMed Central

    Griffith, Malachi; Walker, Jason R.; Spies, Nicholas C.; Ainscough, Benjamin J.; Griffith, Obi L.

    2015-01-01

    Massively parallel RNA sequencing (RNA-seq) has rapidly become the assay of choice for interrogating RNA transcript abundance and diversity. This article provides a detailed introduction to fundamental RNA-seq molecular biology and informatics concepts. We make available open-access RNA-seq tutorials that cover cloud computing, tool installation, relevant file formats, reference genomes, transcriptome annotations, quality-control strategies, expression, differential expression, and alternative splicing analysis methods. These tutorials and additional training resources are accompanied by complete analysis pipelines and test datasets made available without encumbrance at www.rnaseq.wiki. PMID:26248053

  10. SSMART: Sequence-structure motif identification for RNA-binding proteins.

    PubMed

    Munteanu, Alina; Mukherjee, Neelanjan; Ohler, Uwe

    2018-06-11

    RNA-binding proteins (RBPs) regulate every aspect of RNA metabolism and function. There are hundreds of RBPs encoded in the eukaryotic genomes, and each recognize its RNA targets through a specific mixture of RNA sequence and structure properties. For most RBPs, however, only a primary sequence motif has been determined, while the structure of the binding sites is uncharacterized. We developed SSMART, an RNA motif finder that simultaneously models the primary sequence and the structural properties of the RNA targets sites. The sequence-structure motifs are represented as consensus strings over a degenerate alphabet, extending the IUPAC codes for nucleotides to account for secondary structure preferences. Evaluation on synthetic data showed that SSMART is able to recover both sequence and structure motifs implanted into 3'UTR-like sequences, for various degrees of structured/unstructured binding sites. In addition, we successfully used SSMART on high-throughput in vivo and in vitro data, showing that we not only recover the known sequence motif, but also gain insight into the structural preferences of the RBP. Availability: SSMART is freely available at https://ohlerlab.mdc-berlin.de/software/SSMART_137/. Supplementary data are available at Bioinformatics online.

  11. Artificial small RNA for sequence specific cleavage of target RNA through RNase III endonuclease Dicer

    PubMed Central

    Liu, Yali; Liu, Li; Zhan, Yonghao; Zhuang, Chengle; Lin, Junhao; Chen, Mingwei; Li, Jianfa; Cai, Zhiming; Huang, Weiren; Zhang, Yong

    2016-01-01

    CRISPR-Cas9 system uses a guide RNA which functions in conjunction with Cas9 proteins to target a DNA and cleaves double-strand DNA. This phenomenon raises a question whether an artificial small RNA (asRNA), composed of a Dicer–binding RNA element and an antisense RNA, could also be used to induce Dicer to process and degrade a specific RNA. If so, we could develop a new method which is named DICERi for gene silencing or RNA editing. To prove the feasibility of asRNA, we selected MALAT-1 as target and used Hela and MDA-MB-231 cells as experimental models. The results of qRT-PCR showed that the introduction of asRNA decreased the relative expression level of target gene significantly. Next, we analyzed cell proliferation using CCK-8 and EdU staining assays, and then cell migration using wound scratch and Transwell invasion assays. We found that cell proliferation and cell migration were both suppressed remarkably after asRNA was expressed in Hela and MDA-MB-231 cells. Cell apoptosis was also detected through Hoechst staining and ELISA assays and the data indicated that he numbers of apoptotic cell in experimental groups significantly increased compared with negative controls. In order to prove that the gene silencing effects were caused by Dicer, we co-transfected shRNA silencing Dicer and asRNA. The relative expression levels of Dicer and MALAT-1 were both detected and the results indicated that when the cleavage role of Dicer was silenced, the relative expression level of MALAT-1 was not affected after the introduction of asRNA. All the above results demonstrated that these devices directed by Dicer effectively excised target RNA and repressed the target genes, thus causing phenotypic changes. Our works adds a new dimension to gene regulating technologies and may have broad applications in construction of gene circuits. PMID:27231846

  12. Artificial small RNA for sequence specific cleavage of target RNA through RNase III endonuclease Dicer.

    PubMed

    Xu, Wen; Liu, Yuchen; Liu, Yali; Liu, Li; Zhan, Yonghao; Zhuang, Chengle; Lin, Junhao; Chen, Mingwei; Li, Jianfa; Cai, Zhiming; Huang, Weiren; Zhang, Yong

    2016-08-23

    CRISPR-Cas9 system uses a guide RNA which functions in conjunction with Cas9 proteins to target a DNA and cleaves double-strand DNA. This phenomenon raises a question whether an artificial small RNA (asRNA), composed of a Dicer-binding RNA element and an antisense RNA, could also be used to induce Dicer to process and degrade a specific RNA. If so, we could develop a new method which is named DICERi for gene silencing or RNA editing. To prove the feasibility of asRNA, we selected MALAT-1 as target and used Hela and MDA-MB-231 cells as experimental models. The results of qRT-PCR showed that the introduction of asRNA decreased the relative expression level of target gene significantly. Next, we analyzed cell proliferation using CCK-8 and EdU staining assays, and then cell migration using wound scratch and Transwell invasion assays. We found that cell proliferation and cell migration were both suppressed remarkably after asRNA was expressed in Hela and MDA-MB-231 cells. Cell apoptosis was also detected through Hoechst staining and ELISA assays and the data indicated that he numbers of apoptotic cell in experimental groups significantly increased compared with negative controls. In order to prove that the gene silencing effects were caused by Dicer, we co-transfected shRNA silencing Dicer and asRNA. The relative expression levels of Dicer and MALAT-1 were both detected and the results indicated that when the cleavage role of Dicer was silenced, the relative expression level of MALAT-1 was not affected after the introduction of asRNA. All the above results demonstrated that these devices directed by Dicer effectively excised target RNA and repressed the target genes, thus causing phenotypic changes. Our works adds a new dimension to gene regulating technologies and may have broad applications in construction of gene circuits.

  13. Biclustering as a method for RNA local multiple sequence alignment.

    PubMed

    Wang, Shu; Gutell, Robin R; Miranker, Daniel P

    2007-12-15

    Biclustering is a clustering method that simultaneously clusters both the domain and range of a relation. A challenge in multiple sequence alignment (MSA) is that the alignment of sequences is often intended to reveal groups of conserved functional subsequences. Simultaneously, the grouping of the sequences can impact the alignment; precisely the kind of dual situation biclustering is intended to address. We define a representation of the MSA problem enabling the application of biclustering algorithms. We develop a computer program for local MSA, BlockMSA, that combines biclustering with divide-and-conquer. BlockMSA simultaneously finds groups of similar sequences and locally aligns subsequences within them. Further alignment is accomplished by dividing both the set of sequences and their contents. The net result is both a multiple sequence alignment and a hierarchical clustering of the sequences. BlockMSA was tested on the subsets of the BRAliBase 2.1 benchmark suite that display high variability and on an extension to that suite to larger problem sizes. Also, alignments were evaluated of two large datasets of current biological interest, T box sequences and Group IC1 Introns. The results were compared with alignments computed by ClustalW, MAFFT, MUCLE and PROBCONS alignment programs using Sum of Pairs (SPS) and Consensus Count. Results for the benchmark suite are sensitive to problem size. On problems of 15 or greater sequences, BlockMSA is consistently the best. On none of the problems in the test suite are there appreciable differences in scores among BlockMSA, MAFFT and PROBCONS. On the T box sequences, BlockMSA does the most faithful job of reproducing known annotations. MAFFT and PROBCONS do not. On the Intron sequences, BlockMSA, MAFFT and MUSCLE are comparable at identifying conserved regions. BlockMSA is implemented in Java. Source code and supplementary datasets are available at http://aug.csres.utexas.edu/msa/

  14. Fluorescent in situ sequencing (FISSEQ) of RNA for gene expression profiling in intact cells and tissues

    PubMed Central

    Lee, Je Hyuk; Daugharthy, Evan R.; Scheiman, Jonathan; Kalhor, Reza; Ferrante, Thomas C.; Terry, Richard; Turczyk, Brian M.; Yang, Joyce L.; Lee, Ho Suk; Aach, John; Zhang, Kun; Church, George M.

    2014-01-01

    RNA sequencing measures the quantitative change in gene expression over the whole transcriptome, but it lacks spatial context. On the other hand, in situ hybridization provides the location of gene expression, but only for a small number of genes. Here we detail a protocol for genome-wide profiling of gene expression in situ in fixed cells and tissues, in which RNA is converted into cross-linked cDNA amplicons and sequenced manually on a confocal microscope. Unlike traditional RNA-seq our method enriches for context-specific transcripts over house-keeping and/or structural RNA, and it preserves the tissue architecture for RNA localization studies. Our protocol is written for researchers experienced in cell microscopy with minimal computing skills. Library construction and sequencing can be completed within 14 d, with image analysis requiring an additional 2 d. PMID:25675209

  15. Empirical analysis of RNA robustness and evolution using high-throughput sequencing of ribozyme reactions.

    PubMed

    Hayden, Eric J

    2016-08-15

    RNA molecules provide a realistic but tractable model of a genotype to phenotype relationship. This relationship has been extensively investigated computationally using secondary structure prediction algorithms. Enzymatic RNA molecules, or ribozymes, offer access to genotypic and phenotypic information in the laboratory. Advancements in high-throughput sequencing technologies have enabled the analysis of sequences in the lab that now rivals what can be accomplished computationally. This has motivated a resurgence of in vitro selection experiments and opened new doors for the analysis of the distribution of RNA functions in genotype space. A body of computational experiments has investigated the persistence of specific RNA structures despite changes in the primary sequence, and how this mutational robustness can promote adaptations. This article summarizes recent approaches that were designed to investigate the role of mutational robustness during the evolution of RNA molecules in the laboratory, and presents theoretical motivations, experimental methods and approaches to data analysis. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Structural Requirement in Clostridium perfringens Collagenase mRNA 5′ Leader Sequence for Translational Induction through Small RNA-mRNA Base Pairing

    PubMed Central

    Nomura, Nobuhiko; Nakamura, Kouji

    2013-01-01

    The Gram-positive anaerobic bacterium Clostridium perfringens is pathogenic to humans and animals, and the production of its toxins is strictly regulated during the exponential phase. We recently found that the 5′ leader sequence of the colA transcript encoding collagenase, which is a major toxin of this organism, is processed and stabilized in the presence of the small RNA VR-RNA. The primary colA 5′-untranslated region (5′UTR) forms a long stem-loop structure containing an internal bulge and masks its own ribosomal binding site. Here we found that VR-RNA directly regulates colA expression through base pairing with colA mRNA in vivo. However, when the internal bulge structure was closed by point mutations in colA mRNA, translation ceased despite the presence of VR-RNA. In addition, a mutation disrupting the colA stem-loop structure induced mRNA processing and ColA-FLAG translational activation in the absence of VR-RNA, indicating that the stem-loop and internal bulge structure of the colA 5′ leader sequence is important for regulation by VR-RNA. On the other hand, processing was required for maximal ColA expression but was not essential for VR-RNA-dependent colA regulation. Finally, colA processing and translational activation were induced at a high temperature without VR-RNA. These results suggest that inhibition of the colA 5′ leader structure through base pairing is the primary role of VR-RNA in colA regulation and that the colA 5′ leader structure is a possible thermosensor. PMID:23585542

  17. Molecular-Sized DNA or RNA Sequencing Machine | NCI Technology Transfer Center | TTC

    Cancer.gov

    The National Cancer Institute's Gene Regulation and Chromosome Biology Laboratory is seeking statements of capability or interest from parties interested in collaborative research to co-develop a molecular-sized DNA or RNA sequencing machine.

  18. RNA Sequencing Identifies New RNase III Cleavage Sites in Escherichia coli and Reveals Increased Regulation of mRNA

    DOE PAGES

    Gordon, Gina C.; Cameron, Jeffrey C.; Pfleger, Brian F.

    2017-03-28

    Ribonucleases facilitate rapid turnover of RNA, providing cells with another mechanism to adjust transcript and protein levels in response to environmental conditions. While many examples have been documented, a comprehensive list of RNase targets is not available. To address this knowledge gap, we compared levels of RNA sequencing coverage of Escherichia coli and a corresponding RNase III mutant to expand the list of known RNase III targets. RNase III is a widespread endoribonuclease that binds and cleaves double-stranded RNA in many critical transcripts. RNase III cleavage at novel sites found in aceEF, proP, tnaC, dctA, pheM, sdhC, yhhQ, glpT, aceK,more » and gluQ accelerated RNA decay, consistent with previously described targets wherein RNase III cleavage initiates rapid degradation of secondary messages by other RNases. In contrast, cleavage at three novel sites in the ahpF, pflB, and yajQ transcripts led to stabilized secondary transcripts. Two other novel sites in hisL and pheM overlapped with transcriptional attenuators that likely serve to ensure turnover of these highly structured RNAs. Many of the new RNase III target sites are located on transcripts encoding metabolic enzymes. For instance, two novel RNase III sites are located within transcripts encoding enzymes near a key metabolic node connecting glycolysis and the tricarboxylic acid (TCA) cycle. Pyruvate dehydrogenase activity was increased in an rnc deletion mutant compared to the wild-type (WT) strain in early stationary phase, confirming the novel link between RNA turnover and regulation of pathway activity. Identification of these novel sites suggests that mRNA turnover may be an underappreciated mode of regulating metabolism. IMPORTANCE: The concerted action and overlapping functions of endoribonucleases, exoribonucleases, and RNA processing enzymes complicate the study of global RNA turnover and recycling of specific transcripts. More information about RNase specificity and activity is

  19. RNA Sequencing Identifies New RNase III Cleavage Sites in Escherichia coli and Reveals Increased Regulation of mRNA

    SciTech Connect

    Gordon, Gina C.; Cameron, Jeffrey C.; Pfleger, Brian F.

    Ribonucleases facilitate rapid turnover of RNA, providing cells with another mechanism to adjust transcript and protein levels in response to environmental conditions. While many examples have been documented, a comprehensive list of RNase targets is not available. To address this knowledge gap, we compared levels of RNA sequencing coverage of Escherichia coli and a corresponding RNase III mutant to expand the list of known RNase III targets. RNase III is a widespread endoribonuclease that binds and cleaves double-stranded RNA in many critical transcripts. RNase III cleavage at novel sites found in aceEF, proP, tnaC, dctA, pheM, sdhC, yhhQ, glpT, aceK,more » and gluQ accelerated RNA decay, consistent with previously described targets wherein RNase III cleavage initiates rapid degradation of secondary messages by other RNases. In contrast, cleavage at three novel sites in the ahpF, pflB, and yajQ transcripts led to stabilized secondary transcripts. Two other novel sites in hisL and pheM overlapped with transcriptional attenuators that likely serve to ensure turnover of these highly structured RNAs. Many of the new RNase III target sites are located on transcripts encoding metabolic enzymes. For instance, two novel RNase III sites are located within transcripts encoding enzymes near a key metabolic node connecting glycolysis and the tricarboxylic acid (TCA) cycle. Pyruvate dehydrogenase activity was increased in an rnc deletion mutant compared to the wild-type (WT) strain in early stationary phase, confirming the novel link between RNA turnover and regulation of pathway activity. Identification of these novel sites suggests that mRNA turnover may be an underappreciated mode of regulating metabolism. IMPORTANCE: The concerted action and overlapping functions of endoribonucleases, exoribonucleases, and RNA processing enzymes complicate the study of global RNA turnover and recycling of specific transcripts. More information about RNase specificity and activity is

  20. Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer

    DTIC Science & Technology

    2016-09-01

    AWARD NUMBER: W81XWH-14-1-0080 TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer. PRINCIPAL INVESTIGATOR...PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland 21702-5012 DISTRIBUTION STATEMENT: Approved for Public Release...SUBTITLE Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer. 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-14-1-0080 GRANT11489

  1. Method for rapid base sequencing in DNA and RNA with two base labeling

    DOEpatents

    Jett, J.H.; Keller, R.A.; Martin, J.C.; Posner, R.G.; Marrone, B.L.; Hammond, M.L.; Simpson, D.J.

    1995-04-11

    A method is described for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand. 4 figures.

  2. Method for rapid base sequencing in DNA and RNA with two base labeling

    DOEpatents

    Jett, James H.; Keller, Richard A.; Martin, John C.; Posner, Richard G.; Marrone, Babetta L.; Hammond, Mark L.; Simpson, Daniel J.

    1995-01-01

    Method for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand.

  3. Quantitative Assessment of RNA-Protein Interactions with High Throughput Sequencing - RNA Affinity Profiling (HiTS-RAP)

    PubMed Central

    Ozer, Abdullah; Tome, Jacob M.; Friedman, Robin C.; Gheba, Dan; Schroth, Gary P.; Lis, John T.

    2016-01-01

    Because RNA-protein interactions play a central role in a wide-array of biological processes, methods that enable a quantitative assessment of these interactions in a high-throughput manner are in great demand. Recently, we developed the High Throughput Sequencing-RNA Affinity Profiling (HiTS-RAP) assay, which couples sequencing on an Illumina GAIIx with the quantitative assessment of one or several proteins’ interactions with millions of different RNAs in a single experiment. We have successfully used HiTS-RAP to analyze interactions of EGFP and NELF-E proteins with their corresponding canonical and mutant RNA aptamers. Here, we provide a detailed protocol for HiTS-RAP, which can be completed in about a month (8 days hands-on time) including the preparation and testing of recombinant proteins and DNA templates, clustering DNA templates on a flowcell, high-throughput sequencing and protein binding with GAIIx, and finally data analysis. We also highlight aspects of HiTS-RAP that can be further improved and points of comparison between HiTS-RAP and two other recently developed methods, RNA-MaP and RBNS. A successful HiTS-RAP experiment provides the sequence and binding curves for approximately 200 million RNAs in a single experiment. PMID:26182240

  4. Genome wide assessment of mRNA in astrocyte protrusions by direct RNA sequencing reveals mRNA localization for the intermediate filament protein nestin.

    PubMed

    Thomsen, Rune; Pallesen, Jonatan; Daugaard, Tina F; Børglum, Anders D; Nielsen, Anders L

    2013-11-01

    Subcellular RNA localization plays an important role in development, cell differentiation, and cell migration. For a comprehensive description of the population of protrusion localized mRNAs in astrocytes we separated protrusions from cell bodies in a Boyden chamber and performed high-throughput direct RNA sequencing. The mRNAs with localization in astrocyte protrusions encode proteins belonging to a variety of functional groups indicating involvement of RNA localization for a palette of cellular functions. The mRNA encoding the intermediate filament protein Nestin was among the identified mRNAs. By RT-qPCR and RNA FISH analysis we confirmed Nestin mRNA localization in cell protrusions and also protrusion localization of Nestin protein. Nestin mRNA localization was dependent of Fragile X mental retardation syndrome proteins Fmrp and Fxr1, and the Nestin 3'-UTR was sufficient to mediate protrusion mRNA localization. The mRNAs for two other intermediate filament proteins in astrocytes, Gfap and Vimentin, have moderate and no protrusion localization, respectively, showing that individual intermediate filament components have different localization mechanisms. The correlated localization of Nestin mRNA with Nestin protein in cell protrusions indicates the presence of a regulatory mechanism at the mRNA localization level for the Nestin intermediate filament protein with potential importance for astrocyte functions during brain development and maintenance. Copyright © 2013 Wiley Periodicals, Inc.

  5. Sequence-Based Prediction of RNA-Binding Residues in Proteins.

    PubMed

    Walia, Rasna R; El-Manzalawy, Yasser; Honavar, Vasant G; Dobbs, Drena

    2017-01-01

    Identifying individual residues in the interfaces of protein-RNA complexes is important for understanding the molecular determinants of protein-RNA recognition and has many potential applications. Recent technical advances have led to several high-throughput experimental methods for identifying partners in protein-RNA complexes, but determining RNA-binding residues in proteins is still expensive and time-consuming. This chapter focuses on available computational methods for identifying which amino acids in an RNA-binding protein participate directly in contacting RNA. Step-by-step protocols for using three different web-based servers to predict RNA-binding residues are described. In addition, currently available web servers and software tools for predicting RNA-binding sites, as well as databases that contain valuable information about known protein-RNA complexes, RNA-binding motifs in proteins, and protein-binding recognition sites in RNA are provided. We emphasize sequence-based methods that can reliably identify interfacial residues without the requirement for structural information regarding either the RNA-binding protein or its RNA partner.

  6. Sequence-Based Prediction of RNA-Binding Residues in Proteins

    PubMed Central

    Walia, Rasna R.; EL-Manzalawy, Yasser; Honavar, Vasant G.; Dobbs, Drena

    2017-01-01

    Identifying individual residues in the interfaces of protein–RNA complexes is important for understanding the molecular determinants of protein–RNA recognition and has many potential applications. Recent technical advances have led to several high-throughput experimental methods for identifying partners in protein–RNA complexes, but determining RNA-binding residues in proteins is still expensive and time-consuming. This chapter focuses on available computational methods for identifying which amino acids in an RNA-binding protein participate directly in contacting RNA. Step-by-step protocols for using three different web-based servers to predict RNA-binding residues are described. In addition, currently available web servers and software tools for predicting RNA-binding sites, as well as databases that contain valuable information about known protein–RNA complexes, RNA-binding motifs in proteins, and protein-binding recognition sites in RNA are provided. We emphasize sequence-based methods that can reliably identify interfacial residues without the requirement for structural information regarding either the RNA-binding protein or its RNA partner. PMID:27787829

  7. Phylogenetic Analysis of Marine Picoplankton Using Tau RNA Sequences.

    DTIC Science & Technology

    1991-02-01

    Pacific Ocean (Aloha Station). DNA prepared from both populations was analyzed by hybridization using kingdom -specific probes complementary to 16S rRNA...euba:-teria. Few eukaryotes, no archaebacteria detected (at low resolution). "* Fluorescendly labeled phylogenetir group-specific oligon ucleotfides

  8. Oasis: online analysis of small RNA deep sequencing data.

    PubMed

    Capece, Vincenzo; Garcia Vizcaino, Julio C; Vidal, Ramon; Rahman, Raza-Ur; Pena Centeno, Tonatiuh; Shomroni, Orr; Suberviola, Irantzu; Fischer, Andre; Bonn, Stefan

    2015-07-01

    Oasis is a web application that allows for the fast and flexible online analysis of small-RNA-seq (sRNA-seq) data. It was designed for the end user in the lab, providing an easy-to-use web frontend including video tutorials, demo data and best practice step-by-step guidelines on how to analyze sRNA-seq data. Oasis' exclusive selling points are a differential expression module that allows for the multivariate analysis of samples, a classification module for robust biomarker detection and an advanced programming interface that supports the batch submission of jobs. Both modules include the analysis of novel miRNAs, miRNA targets and functional analyses including GO and pathway enrichment. Oasis generates downloadable interactive web reports for easy visualization, exploration and analysis of data on a local system. Finally, Oasis' modular workflow enables for the rapid (re-) analysis of data. Oasis is implemented in Python, R, Java, PHP, C++ and JavaScript. It is freely available at http://oasis.dzne.de. stefan.bonn@dzne.de Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  9. Accurate identification of RNA editing sites from primitive sequence with deep neural networks.

    PubMed

    Ouyang, Zhangyi; Liu, Feng; Zhao, Chenghui; Ren, Chao; An, Gaole; Mei, Chuan; Bo, Xiaochen; Shu, Wenjie

    2018-04-16

    RNA editing is a post-transcriptional RNA sequence alteration. Current methods have identified editing sites and facilitated research but require sufficient genomic annotations and prior-knowledge-based filtering steps, resulting in a cumbersome, time-consuming identification process. Moreover, these methods have limited generalizability and applicability in species with insufficient genomic annotations or in conditions of limited prior knowledge. We developed DeepRed, a deep learning-based method that identifies RNA editing from primitive RNA sequences without prior-knowledge-based filtering steps or genomic annotations. DeepRed achieved 98.1% and 97.9% area under the curve (AUC) in training and test sets, respectively. We further validated DeepRed using experimentally verified U87 cell RNA-seq data, achieving 97.9% positive predictive value (PPV). We demonstrated that DeepRed offers better prediction accuracy and computational efficiency than current methods with large-scale, mass RNA-seq data. We used DeepRed to assess the impact of multiple factors on editing identification with RNA-seq data from the Association of Biomolecular Resource Facilities and Sequencing Quality Control projects. We explored developmental RNA editing pattern changes during human early embryogenesis and evolutionary patterns in Drosophila species and the primate lineage using DeepRed. Our work illustrates DeepRed's state-of-the-art performance; it may decipher the hidden principles behind RNA editing, making editing detection convenient and effective.

  10. A tale of two sequences: microRNA-target chimeric reads.

    PubMed

    Broughton, James P; Pasquinelli, Amy E

    2016-04-04

    In animals, a functional interaction between a microRNA (miRNA) and its target RNA requires only partial base pairing. The limited number of base pair interactions required for miRNA targeting provides miRNAs with broad regulatory potential and also makes target prediction challenging. Computational approaches to target prediction have focused on identifying miRNA target sites based on known sequence features that are important for canonical targeting and may miss non-canonical targets. Current state-of-the-art experimental approaches, such as CLIP-seq (cross-linking immunoprecipitation with sequencing), PAR-CLIP (photoactivatable-ribonucleoside-enhanced CLIP), and iCLIP (individual-nucleotide resolution CLIP), require inference of which miRNA is bound at each site. Recently, the development of methods to ligate miRNAs to their target RNAs during the preparation of sequencing libraries has provided a new tool for the identification of miRNA target sites. The chimeric, or hybrid, miRNA-target reads that are produced by these methods unambiguously identify the miRNA bound at a specific target site. The information provided by these chimeric reads has revealed extensive non-canonical interactions between miRNAs and their target mRNAs, and identified many novel interactions between miRNAs and noncoding RNAs.

  11. Development and Verification of an RNA Sequencing (RNA-Seq) Assay for the Detection of Gene Fusions in Tumors.

    PubMed

    Winters, Jennifer L; Davila, Jaime I; McDonald, Amber M; Nair, Asha A; Fadra, Numrah; Wehrs, Rebecca N; Thomas, Brittany C; Balcom, Jessica R; Jin, Long; Wu, Xianglin; Voss, Jesse S; Klee, Eric W; Oliver, Gavin R; Graham, Rondell P; Neff, Jadee L; Rumilla, Kandelaria M; Aypar, Umut; Kipp, Benjamin R; Jenkins, Robert B; Jen, Jin; Halling, Kevin C

    2018-06-13

    We assessed the performance characteristics of an RNA sequencing (RNA-Seq) assay designed to detect gene fusions in 571 genes to help manage patients with cancer. Polyadenylated RNA was converted to cDNA, which was then used to prepare next-generation sequencing libraries that were sequenced on an Illumina HiSeq 2500 instrument and analyzed with an in-house developed bioinformatic pipeline. The assay identified 38 of 41 gene fusions detected by another method, such as fluorescence in situ hybridization or RT-PCR, for a sensitivity of 93%. No false-positive gene fusions were identified in 15 normal tissue specimens and 10 tumor specimens that were negative for fusions by RNA sequencing or Mate Pair NGS (100% specificity). The assay also identified 22 fusions in 17 tumor specimens that had not been detected by other methods. Eighteen of the 22 fusions had not previously been described. Good intra-assay and interassay reproducibility was observed with complete concordance for the presence or absence of gene fusions in replicates. The analytical sensitivity of the assay was tested by diluting RNA isolated from gene fusion-positive cases with fusion-negative RNA. Gene fusions were generally detectable down to 12.5% dilutions for most fusions and as little as 3% for some fusions. This assay can help identify fusions in patients with cancer; these patients may in turn benefit from both US Food and Drug Administration-approved and investigational targeted therapies. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  12. High-Throughput Mapping of Single-Neuron Projections by Sequencing of Barcoded RNA.

    PubMed

    Kebschull, Justus M; Garcia da Silva, Pedro; Reid, Ashlan P; Peikon, Ian D; Albeanu, Dinu F; Zador, Anthony M

    2016-09-07

    Neurons transmit information to distant brain regions via long-range axonal projections. In the mouse, area-to-area connections have only been systematically mapped using bulk labeling techniques, which obscure the diverse projections of intermingled single neurons. Here we describe MAPseq (Multiplexed Analysis of Projections by Sequencing), a technique that can map the projections of thousands or even millions of single neurons by labeling large sets of neurons with random RNA sequences ("barcodes"). Axons are filled with barcode mRNA, each putative projection area is dissected, and the barcode mRNA is extracted and sequenced. Applying MAPseq to the locus coeruleus (LC), we find that individual LC neurons have preferred cortical targets. By recasting neuroanatomy, which is traditionally viewed as a problem of microscopy, as a problem of sequencing, MAPseq harnesses advances in sequencing technology to permit high-throughput interrogation of brain circuits. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Sequence specificity of the human mRNA N6-adenosine methylase in vitro.

    PubMed Central

    Harper, J E; Miceli, S M; Roberts, R J; Manley, J L

    1990-01-01

    N6-adenosine methylation is a frequent modification of mRNAs and their precursors, but little is known about the mechanism of the reaction or the function of the modification. To explore these questions, we developed conditions to examine N6-adenosine methylase activity in HeLa cell nuclear extracts. Transfer of the methyl group from S-[3H methyl]-adenosylmethionine to unlabeled random copolymer RNA substrates of varying ribonucleotide composition revealed a substrate specificity consistent with a previously deduced consensus sequence, Pu[G greater than A]AC[A/C/U]. 32-P labeled RNA substrates of defined sequence were used to examine the minimum sequence requirements for methylation. Each RNA was 20 nucleotides long, and contained either the core consensus sequence GGACU, or some variation of this sequence. RNAs containing GGACU, either in single or multiple copies, were good substrates for methylation, whereas RNAs containing single base substitutions within the GGACU sequence gave dramatically reduced methylation. These results demonstrate that the N6-adenosine methylase has a strict sequence specificity, and that there is no requirement for extended sequences or secondary structures for methylation. Recognition of this sequence does not require an RNA component, as micrococcal nuclease pretreatment of nuclear extracts actually increased methylation efficiency. Images PMID:2216767

  14. Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

    PubMed Central

    Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

    1996-01-01

    Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

  15. Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado

    PubMed Central

    Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.

    2012-01-01

    A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV). PMID:22205720

  16. Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

    PubMed Central

    Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

    1974-01-01

    Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

  17. Genome Sequence of Saccharomyces cerevisiae Double-Stranded RNA Virus L-A-28.

    PubMed

    Konovalovas, Aleksandras; Serviené, Elena; Serva, Saulius

    2016-06-16

    We cloned and sequenced the complete genome of the L-A-28 virus from the Saccharomyces cerevisiae K28 killer strain. This sequence completes the set of currently identified L-A helper viruses required for expression of double-stranded RNA-originated killer phenotypes in baking yeast. Copyright © 2016 Konovalovas et al.

  18. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    PubMed Central

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  19. The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus.

    PubMed Central

    Gustafson, G; Armour, S L

    1986-01-01

    The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus (BSMV) has been determined. The sequence is 3289 nucleotides in length and contains four open reading frames (ORFs) which code for proteins of Mr 22,147 (ORF1), Mr 58,098 (ORF2), Mr 17,378 (ORF3), and Mr 14,119 (ORF4). The predicted N-terminal amino acid sequence of the polypeptide encoded by the ORF nearest the 5'-end of the RNA (ORF1) is identical (after the initiator methionine) to the published N-terminal amino acid sequence of BSMV coat protein for 29 of the first 30 amino acids. ORF2 occupies the central portion of the coding region of RNA beta and ORF3 is located at the 3'-end. The ORF4 sequence overlaps the 3'-region of ORF2 and the 5'-region of ORF3 and differs in codon usage from the other three RNA beta ORFs. The coding region of RNA beta is followed by a poly(A) tract and a 238 nucleotide tRNA-like structure which are common to all three BSMV genomic RNAs. Images PMID:3754962

  20. How to design a single-cell RNA-sequencing experiment: pitfalls, challenges and perspectives.

    PubMed

    Dal Molin, Alessandra; Di Camillo, Barbara

    2018-01-31

    The sequencing of the transcriptome of single cells, or single-cell RNA-sequencing, has now become the dominant technology for the identification of novel cell types in heterogeneous cell populations or for the study of stochastic gene expression. In recent years, various experimental methods and computational tools for analysing single-cell RNA-sequencing data have been proposed. However, most of them are tailored to different experimental designs or biological questions, and in many cases, their performance has not been benchmarked yet, thus increasing the difficulty for a researcher to choose the optimal single-cell transcriptome sequencing (scRNA-seq) experiment and analysis workflow. In this review, we aim to provide an overview of the current available experimental and computational methods developed to handle single-cell RNA-sequencing data and, based on their peculiarities, we suggest possible analysis frameworks depending on specific experimental designs. Together, we propose an evaluation of challenges and open questions and future perspectives in the field. In particular, we go through the different steps of scRNA-seq experimental protocols such as cell isolation, messenger RNA capture, reverse transcription, amplification and use of quantitative standards such as spike-ins and Unique Molecular Identifiers (UMIs). We then analyse the current methodological challenges related to preprocessing, alignment, quantification, normalization, batch effect correction and methods to control for confounding effects. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

    PubMed Central

    Schnare, M N; Gray, M W

    1982-01-01

    In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

  2. Rare Cell Detection by Single-Cell RNA Sequencing as Guided by Single-Molecule RNA FISH.

    PubMed

    Torre, Eduardo; Dueck, Hannah; Shaffer, Sydney; Gospocic, Janko; Gupte, Rohit; Bonasio, Roberto; Kim, Junhyong; Murray, John; Raj, Arjun

    2018-02-28

    Although single-cell RNA sequencing can reliably detect large-scale transcriptional programs, it is unclear whether it accurately captures the behavior of individual genes, especially those that express only in rare cells. Here, we use single-molecule RNA fluorescence in situ hybridization as a gold standard to assess trade-offs in single-cell RNA-sequencing data for detecting rare cell expression variability. We quantified the gene expression distribution for 26 genes that range from ubiquitous to rarely expressed and found that the correspondence between estimates across platforms improved with both transcriptome coverage and increased number of cells analyzed. Further, by characterizing the trade-off between transcriptome coverage and number of cells analyzed, we show that when the number of genes required to answer a given biological question is small, then greater transcriptome coverage is more important than analyzing large numbers of cells. More generally, our report provides guidelines for selecting quality thresholds for single-cell RNA-sequencing experiments aimed at rare cell analyses. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Self-Assembly of Measles Virus Nucleocapsid-like Particles: Kinetics and RNA Sequence Dependence.

    PubMed

    Milles, Sigrid; Jensen, Malene Ringkjøbing; Communie, Guillaume; Maurin, Damien; Schoehn, Guy; Ruigrok, Rob W H; Blackledge, Martin

    2016-08-01

    Measles virus RNA genomes are packaged into helical nucleocapsids (NCs), comprising thousands of nucleo-proteins (N) that bind the entire genome. N-RNA provides the template for replication and transcription by the viral polymerase and is a promising target for viral inhibition. Elucidation of mechanisms regulating this process has been severely hampered by the inability to controllably assemble NCs. Here, we demonstrate self-organization of N into NC-like particles in vitro upon addition of RNA, providing a simple and versatile tool for investigating assembly. Real-time NMR and fluorescence spectroscopy reveals biphasic assembly kinetics. Remarkably, assembly depends strongly on the RNA-sequence, with the genomic 5' end and poly-Adenine sequences assembling efficiently, while sequences such as poly-Uracil are incompetent for NC formation. This observation has important consequences for understanding the assembly process. © 2016 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  4. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  5. Small RNA Deep Sequencing and the Effects of microRNA408 on Root Gravitropic Bending in Arabidopsis

    NASA Astrophysics Data System (ADS)

    Li, Huasheng; Lu, Jinying; Sun, Qiao; Chen, Yu; He, Dacheng; Liu, Min

    2015-11-01

    MicroRNA (miRNA) is a non-coding small RNA composed of 20 to 24 nucleotides that influences plant root development. This study analyzed the miRNA expression in Arabidopsis root tip cells using Illumina sequencing and real-time PCR before (sample 0) and 15 min after (sample 15) a 3-D clinostat rotational treatment was administered. After stimulation was performed, the expression levels of seven miRNA genes, including Arabidopsis miR160, miR161, miR394, miR402, miR403, miR408, and miR823, were significantly upregulated. Illumina sequencing results also revealed two novel miRNAsthat have not been previously reported, The target genes of these miRNAs included pentatricopeptide repeat-containing protein and diadenosine tetraphosphate hydrolase. An overexpression vector of Arabidopsis miR408 was constructed and transferred to Arabidopsis plant. The roots of plants over expressing miR408 exhibited a slower reorientation upon gravistimulation in comparison with those of wild-type. This result indicate that miR408 could play a role in root gravitropic response.

  6. Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).

    PubMed

    Watters, Kyle E; Lucks, Julius B

    2016-01-01

    Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.

  7. StarScan: a web server for scanning small RNA targets from degradome sequencing data.

    PubMed

    Liu, Shun; Li, Jun-Hao; Wu, Jie; Zhou, Ke-Ren; Zhou, Hui; Yang, Jian-Hua; Qu, Liang-Hu

    2015-07-01

    Endogenous small non-coding RNAs (sRNAs), including microRNAs, PIWI-interacting RNAs and small interfering RNAs, play important gene regulatory roles in animals and plants by pairing to the protein-coding and non-coding transcripts. However, computationally assigning these various sRNAs to their regulatory target genes remains technically challenging. Recently, a high-throughput degradome sequencing method was applied to identify biologically relevant sRNA cleavage sites. In this study, an integrated web-based tool, StarScan (sRNA target Scan), was developed for scanning sRNA targets using degradome sequencing data from 20 species. Given a sRNA sequence from plants or animals, our web server performs an ultrafast and exhaustive search for potential sRNA-target interactions in annotated and unannotated genomic regions. The interactions between small RNAs and target transcripts were further evaluated using a novel tool, alignScore. A novel tool, degradomeBinomTest, was developed to quantify the abundance of degradome fragments located at the 9-11th nucleotide from the sRNA 5' end. This is the first web server for discovering potential sRNA-mediated RNA cleavage events in plants and animals, which affords mechanistic insights into the regulatory roles of sRNAs. The StarScan web server is available at http://mirlab.sysu.edu.cn/starscan/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Exploration of RNA Sequence Space in the Absence of a Replicase.

    PubMed

    Tirumalai, Madhan R; Tran, Quyen; Paci, Maxim; Chavan, Dimple; Marathe, Anuradha; Fox, George E

    2018-05-11

    It is generally considered that if an RNA World ever existed that it would be driven by an RNA capable of RNA replication. Whether such a catalytic RNA could emerge in an RNA World or not, there would need to be prior routes to increasing complexity in order to produce it. It is hypothesized here that increasing sequence variety, if not complexity, can in fact readily emerge in response to a dynamic equilibrium between synthesis and degradation. A model system in which T4 RNA ligase catalyzes synthesis and Benzonase catalyzes degradation was constructed. An initial 20-mer served as a seed and was subjected to 180 min of simultaneous ligation and degradation. The seed RNA rapidly disappeared and was replaced by an increasing number and variety of both larger and smaller variants. Variants of 40-80 residues were consistently seen, typically representing 2-4% of the unique sequences. In a second experiment with four individual 9-mers, numerous variants were again produced. These included variants of the individual 9-mers as well as sequences that contained sequence segments from two or more 9-mers. In both cases, the RNA products lack large numbers of point mutations but instead incorporate additions and subtractions of fragments of the original RNAs. The system demonstrates that if such equilibrium were established in a prebiotic world it would result in significant exploration of RNA sequence space and likely increased complexity. It remains to be seen if the variety of products produced is affected by the presence of small peptide oligomers.

  9. Single-Cell RNA-Sequencing: Assessment of Differential Expression Analysis Methods.

    PubMed

    Dal Molin, Alessandra; Baruzzo, Giacomo; Di Camillo, Barbara

    2017-01-01

    The sequencing of the transcriptomes of single-cells, or single-cell RNA-sequencing, has now become the dominant technology for the identification of novel cell types and for the study of stochastic gene expression. In recent years, various tools for analyzing single-cell RNA-sequencing data have been proposed, many of them with the purpose of performing differentially expression analysis. In this work, we compare four different tools for single-cell RNA-sequencing differential expression, together with two popular methods originally developed for the analysis of bulk RNA-sequencing data, but largely applied to single-cell data. We discuss results obtained on two real and one synthetic dataset, along with considerations about the perspectives of single-cell differential expression analysis. In particular, we explore the methods performance in four different scenarios, mimicking different unimodal or bimodal distributions of the data, as characteristic of single-cell transcriptomics. We observed marked differences between the selected methods in terms of precision and recall, the number of detected differentially expressed genes and the overall performance. Globally, the results obtained in our study suggest that is difficult to identify a best performing tool and that efforts are needed to improve the methodologies for single-cell RNA-sequencing data analysis and gain better accuracy of results.

  10. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing

    PubMed Central

    Chan, Chia Sing; Chan, Kok-Gan; Tay, Yea-Ling; Chua, Yi-Heng; Goh, Kian Mau

    2015-01-01

    The Sungai Klah (SK) hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-m-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0–9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3-V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream) and geochemical parameters (broad temperature and pH range). It is speculated that symbiotic relationships occur between the members of the community. PMID:25798135

  11. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    PubMed

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  12. Computational sequence analysis of predicted long dsRNA transcriptomes of major crops reveals sequence complementarity with human genes.

    PubMed

    Jensen, Peter D; Zhang, Yuanji; Wiggins, B Elizabeth; Petrick, Jay S; Zhu, Jin; Kerstetter, Randall A; Heck, Gregory R; Ivashuta, Sergey I

    2013-01-01

    Long double-stranded RNAs (long dsRNAs) are precursors for the effector molecules of sequence-specific RNA-based gene silencing in eukaryotes. Plant cells can contain numerous endogenous long dsRNAs. This study demonstrates that such endogenous long dsRNAs in plants have sequence complementarity to human genes. Many of these complementary long dsRNAs have perfect sequence complementarity of at least 21 nucleotides to human genes; enough complementarity to potentially trigger gene silencing in targeted human cells if delivered in functional form. However, the number and diversity of long dsRNA molecules in plant tissue from crops such as lettuce, tomato, corn, soy and rice with complementarity to human genes that have a long history of safe consumption supports a conclusion that long dsRNAs do not present a significant dietary risk.

  13. Identification of characteristic oligonucleotides in the bacterial 16S ribosomal RNA sequence dataset

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; Willson, Richard C.; Fox, George E.

    2002-01-01

    MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.

  14. A practical guide to single-cell RNA-sequencing for biomedical research and clinical applications.

    PubMed

    Haque, Ashraful; Engel, Jessica; Teichmann, Sarah A; Lönnberg, Tapio

    2017-08-18

    RNA sequencing (RNA-seq) is a genomic approach for the detection and quantitative analysis of messenger RNA molecules in a biological sample and is useful for studying cellular responses. RNA-seq has fueled much discovery and innovation in medicine over recent years. For practical reasons, the technique is usually conducted on samples comprising thousands to millions of cells. However, this has hindered direct assessment of the fundamental unit of biology-the cell. Since the first single-cell RNA-sequencing (scRNA-seq) study was published in 2009, many more have been conducted, mostly by specialist laboratories with unique skills in wet-lab single-cell genomics, bioinformatics, and computation. However, with the increasing commercial availability of scRNA-seq platforms, and the rapid ongoing maturation of bioinformatics approaches, a point has been reached where any biomedical researcher or clinician can use scRNA-seq to make exciting discoveries. In this review, we present a practical guide to help researchers design their first scRNA-seq studies, including introductory information on experimental hardware, protocol choice, quality control, data analysis and biological interpretation.

  15. RNA Sequencing of the Human Milk Fat Layer Transcriptome Reveals Distinct Gene Expression Profiles at Three Stages of Lactation

    PubMed Central

    Lemay, Danielle G.; Ballard, Olivia A.; Hughes, Maria A.; Morrow, Ardythe L.; Horseman, Nelson D.; Nommsen-Rivers, Laurie A.

    2013-01-01

    Aware of the important benefits of human milk, most U.S. women initiate breastfeeding but difficulties with milk supply lead some to quit earlier than intended. Yet, the contribution of maternal physiology to lactation difficulties remains poorly understood. Human milk fat globules, by enveloping cell contents during their secretion into milk, are a rich source of mammary cell RNA. Here, we pair this non-invasive mRNA source with RNA-sequencing to probe the milk fat layer transcriptome during three stages of lactation: colostral, transitional, and mature milk production. The resulting transcriptomes paint an exquisite portrait of human lactation. The resulting transcriptional profiles cluster not by postpartum day, but by milk Na:K ratio, indicating that women sampled during similar postpartum time frames could be at markedly different stages of gene expression. Each stage of lactation is characterized by a dynamic range (105-fold) in transcript abundances not previously observed with microarray technology. We discovered that transcripts for isoferritins and cathepsins are strikingly abundant during colostrum production, highlighting the potential importance of these proteins for neonatal health. Two transcripts, encoding β-casein (CSN2) and α-lactalbumin (LALBA), make up 45% of the total pool of mRNA in mature lactation. Genes significantly expressed across all stages of lactation are associated with making, modifying, transporting, and packaging milk proteins. Stage-specific transcripts are associated with immune defense during the colostral stage, up-regulation of the machinery needed for milk protein synthesis during the transitional stage, and the production of lipids during mature lactation. We observed strong modulation of key genes involved in lactose synthesis and insulin signaling. In particular, protein tyrosine phosphatase, receptor type, F (PTPRF) may serve as a biomarker linking insulin resistance with insufficient milk supply. This study provides

  16. Integrative analyses of RNA editing, alternative splicing, and expression of young genes in human brain transcriptome by deep RNA sequencing.

    PubMed

    Wu, Dong-Dong; Ye, Ling-Qun; Li, Yan; Sun, Yan-Bo; Shao, Yi; Chen, Chunyan; Zhu, Zhu; Zhong, Li; Wang, Lu; Irwin, David M; Zhang, Yong E; Zhang, Ya-Ping

    2015-08-01

    Next-generation RNA sequencing has been successfully used for identification of transcript assembly, evaluation of gene expression levels, and detection of post-transcriptional modifications. Despite these large-scale studies, additional comprehensive RNA-seq data from different subregions of the human brain are required to fully evaluate the evolutionary patterns experienced by the human brain transcriptome. Here, we provide a total of 6.5 billion RNA-seq reads from different subregions of the human brain. A significant correlation was observed between the levels of alternative splicing and RNA editing, which might be explained by a competition between the molecular machineries responsible for the splicing and editing of RNA. Young human protein-coding genes demonstrate biased expression to the neocortical and non-neocortical regions during evolution on the lineage leading to humans. We also found that a significantly greater number of young human protein-coding genes are expressed in the putamen, a tissue that was also observed to have the highest level of RNA-editing activity. The putamen, which previously received little attention, plays an important role in cognitive ability, and our data suggest a potential contribution of the putamen to human evolution. © The Author (2015). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS. All rights reserved.

  17. SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.

    PubMed

    Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver

    2012-07-15

    In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.

  18. RNA Editing Modulates Human Hepatic Aryl Hydrocarbon Receptor Expression by Creating MicroRNA Recognition Sequence.

    PubMed

    Nakano, Masataka; Fukami, Tatsuki; Gotoh, Saki; Takamiya, Masataka; Aoki, Yasuhiro; Nakajima, Miki

    2016-01-08

    Adenosine to inosine (A-to-I) RNA editing is the most frequent type of post-transcriptional nucleotide conversion in humans, and it is catalyzed by adenosine deaminase acting on RNA (ADAR) enzymes. In this study we investigated the effect of RNA editing on human aryl hydrocarbon receptor (AhR) expression because the AhR transcript potentially forms double-stranded structures, which are targets of ADAR enzymes. In human hepatocellular carcinoma-derived Huh-7 cells, the ADAR1 knockdown reduced the RNA editing levels in the 3'-untranslated region (3'-UTR) of the AhR transcript and increased the AhR protein levels. The ADAR1 knockdown enhanced the ligand-mediated induction of CYP1A1, a gene downstream of AhR. We investigated the possibility that A-to-I RNA editing creates miRNA targeting sites in the AhR mRNA and found that the miR-378-dependent down-regulation of AhR was abolished by ADAR1 knockdown. These results indicated that the ADAR1-mediated down-regulation of AhR could be attributed to the creation of a miR-378 recognition site in the AhR 3'-UTR. The interindividual differences in the RNA editing levels within the AhR 3'-UTR in a panel of 32 human liver samples were relatively small, whereas the differences in ADAR1 expression were large (220-fold). In the human liver samples a significant inverse association was observed between the miR-378 and AhR protein levels, suggesting that the RNA-editing-dependent down-regulation of AhR by miR-378 contributes to the variability in the constitutive hepatic expression of AhR. In conclusion, this study uncovered for the first time that A-to-I RNA editing modulates the potency of xenobiotic metabolism in the human liver. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Classification of G-protein coupled receptors based on a rich generation of convolutional neural network, N-gram transformation and multiple sequence alignments.

    PubMed

    Li, Man; Ling, Cheng; Xu, Qi; Gao, Jingyang

    2018-02-01

    Sequence classification is crucial in predicting the function of newly discovered sequences. In recent years, the prediction of the incremental large-scale and diversity of sequences has heavily relied on the involvement of machine-learning algorithms. To improve prediction accuracy, these algorithms must confront the key challenge of extracting valuable features. In this work, we propose a feature-enhanced protein classification approach, considering the rich generation of multiple sequence alignment algorithms, N-gram probabilistic language model and the deep learning technique. The essence behind the proposed method is that if each group of sequences can be represented by one feature sequence, composed of homologous sites, there should be less loss when the sequence is rebuilt, when a more relevant sequence is added to the group. On the basis of this consideration, the prediction becomes whether a query sequence belonging to a group of sequences can be transferred to calculate the probability that the new feature sequence evolves from the original one. The proposed work focuses on the hierarchical classification of G-protein Coupled Receptors (GPCRs), which begins by extracting the feature sequences from the multiple sequence alignment results of the GPCRs sub-subfamilies. The N-gram model is then applied to construct the input vectors. Finally, these vectors are imported into a convolutional neural network to make a prediction. The experimental results elucidate that the proposed method provides significant performance improvements. The classification error rate of the proposed method is reduced by at least 4.67% (family level I) and 5.75% (family Level II), in comparison with the current state-of-the-art methods. The implementation program of the proposed work is freely available at: https://github.com/alanFchina/CNN .

  20. Customized workflow development and data modularization concepts for RNA-Sequencing and metatranscriptome experiments.

    PubMed

    Lott, Steffen C; Wolfien, Markus; Riege, Konstantin; Bagnacani, Andrea; Wolkenhauer, Olaf; Hoffmann, Steve; Hess, Wolfgang R

    2017-11-10

    RNA-Sequencing (RNA-Seq) has become a widely used approach to study quantitative and qualitative aspects of transcriptome data. The variety of RNA-Seq protocols, experimental study designs and the characteristic properties of the organisms under investigation greatly affect downstream and comparative analyses. In this review, we aim to explain the impact of structured pre-selection, classification and integration of best-performing tools within modularized data analysis workflows and ready-to-use computing infrastructures towards experimental data analyses. We highlight examples for workflows and use cases that are presented for pro-, eukaryotic and mixed dual RNA-Seq (meta-transcriptomics) experiments. In addition, we are summarizing the expertise of the laboratories participating in the project consortium "Structured Analysis and Integration of RNA-Seq experiments" (de.STAIR) and its integration with the Galaxy-workbench of the RNA Bioinformatics Center (RBC). Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  1. An Optimized Transient Dual Luciferase Assay for Quantifying MicroRNA Directed Repression of Targeted Sequences

    PubMed Central

    Moyle, Richard L.; Carvalhais, Lilia C.; Pretorius, Lara-Simone; Nowak, Ekaterina; Subramaniam, Gayathery; Dalton-Morgan, Jessica; Schenk, Peer M.

    2017-01-01

    Studies investigating the action of small RNAs on computationally predicted target genes require some form of experimental validation. Classical molecular methods of validating microRNA action on target genes are laborious, while approaches that tag predicted target sequences to qualitative reporter genes encounter technical limitations. The aim of this study was to address the challenge of experimentally validating large numbers of computationally predicted microRNA-target transcript interactions using an optimized, quantitative, cost-effective, and scalable approach. The presented method combines transient expression via agroinfiltration of Nicotiana benthamiana leaves with a quantitative dual luciferase reporter system, where firefly luciferase is used to report the microRNA-target sequence interaction and Renilla luciferase is used as an internal standard to normalize expression between replicates. We report the appropriate concentration of N. benthamiana leaf extracts and dilution factor to apply in order to avoid inhibition of firefly LUC activity. Furthermore, the optimal ratio of microRNA precursor expression construct to reporter construct and duration of the incubation period post-agroinfiltration were determined. The optimized dual luciferase assay provides an efficient, repeatable and scalable method to validate and quantify microRNA action on predicted target sequences. The optimized assay was used to validate five predicted targets of rice microRNA miR529b, with as few as six technical replicates. The assay can be extended to assess other small RNA-target sequence interactions, including assessing the functionality of an artificial miRNA or an RNAi construct on a targeted sequence. PMID:28979287

  2. Uncultivated Microbial Eukaryotic Diversity: A Method to Link ssu rRNA Gene Sequences with Morphology

    PubMed Central

    Hirst, Marissa B.; Kita, Kelley N.; Dawson, Scott C.

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA “phylotypes” from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  3. Profiling of drought-responsive microRNA and mRNA in tomato using high-throughput sequencing.

    PubMed

    Liu, Minmin; Yu, Huiyang; Zhao, Gangjun; Huang, Qiufeng; Lu, Yongen; Ouyang, Bo

    2017-06-26

    Abiotic stresses cause severe loss of crop production. Among them, drought is one of the most frequent environmental stresses, which limits crop growth, development and productivity. Plant drought tolerance is fine-tuned by a complex gene regulatory network. Understanding the molecular regulation of this polygenic trait is crucial for the eventual success to improve plant yield and quality. Recent studies have demonstrated that microRNAs play critical roles in plant drought tolerance. However, little is known about the microRNA in drought response of the model plant tomato. Here, we described the profiling of drought-responsive microRNA and mRNA in tomato using high-throughput next-generation sequencing. Drought stress was applied on the seedlings of M82, a drought-sensitive cultivated tomato genotype, and IL9-1, a drought-tolerant introgression line derived from the stress-resistant wild species Solanum pennellii LA0716 and M82. Under drought, IL9-1 performed superior than M82 regarding survival rate, H 2 O 2 elimination and leaf turgor maintenance. A total of four small RNA and eight mRNA libraries were constructed and sequenced using Illumina sequencing technology. 105 conserved and 179 novel microRNAs were identified, among them, 54 and 98 were differentially expressed upon drought stress, respectively. The majority of the differentially-expressed conserved microRNAs was up-regulated in IL9-1 whereas down-regulated in M82. Under drought stress, 2714 and 1161 genes were found to be differentially expressed in M82 and IL9-1, respectively, and many of their homologues are involved in plant stress, such as genes encoding transcription factor and protein kinase. Various pathways involved in abiotic stress were revealed by Gene Ontology and pathway analysis. The mRNA sequencing results indicated that most of the target genes were regulated by their corresponding microRNAs, which suggested that microRNAs may play essential roles in the drought tolerance of tomato. In

  4. R3D-2-MSA: the RNA 3D structure-to-multiple sequence alignment server

    PubMed Central

    Cannone, Jamie J.; Sweeney, Blake A.; Petrov, Anton I.; Gutell, Robin R.; Zirbel, Craig L.; Leontis, Neocles

    2015-01-01

    The RNA 3D Structure-to-Multiple Sequence Alignment Server (R3D-2-MSA) is a new web service that seamlessly links RNA three-dimensional (3D) structures to high-quality RNA multiple sequence alignments (MSAs) from diverse biological sources. In this first release, R3D-2-MSA provides manual and programmatic access to curated, representative ribosomal RNA sequence alignments from bacterial, archaeal, eukaryal and organellar ribosomes, using nucleotide numbers from representative atomic-resolution 3D structures. A web-based front end is available for manual entry and an Application Program Interface for programmatic access. Users can specify up to five ranges of nucleotides and 50 nucleotide positions per range. The R3D-2-MSA server maps these ranges to the appropriate columns of the corresponding MSA and returns the contents of the columns, either for display in a web browser or in JSON format for subsequent programmatic use. The browser output page provides a 3D interactive display of the query, a full list of sequence variants with taxonomic information and a statistical summary of distinct sequence variants found. The output can be filtered and sorted in the browser. Previous user queries can be viewed at any time by resubmitting the output URL, which encodes the search and re-generates the results. The service is freely available with no login requirement at http://rna.bgsu.edu/r3d-2-msa. PMID:26048960

  5. Small RNA sequencing for secondary metabolite analysis in Persicaria minor.

    PubMed

    Samad, Abdul Fatah A; Nazaruddin, Nazaruddin; Sajad, Muhammad; Jani, Jaeyres; Murad, Abdul Munir Abdul; Zainal, Zamri; Ismail, Ismanizan

    2017-09-01

    Persicaria minor (kesum) is an important medicinal plant and commonly found in southeast countries; Malaysia, Thailand, Indonesia, and Vietnam. This plant is enriched with a variety of secondary metabolites (SMs), and among these SMs, terpenoids are in high abundance. Terpenoids are comprised of many valuable biomolecules which have well-established role in agriculture and pharmaceutical industry. In P. minor , for the first time, we have generated small RNAs data sets, which can be used as tool in deciphering their roles in terpenoid biosynthesis pathways. Fungal pathogen, Fusarium oxysporum was used as elicitor to trigger SMs biosynthesis in P. minor. Raw reads and small RNA analysis data have already been deposited at GenBank under the accessions; SRX2645684 ( Fusarium -treated), SRX2645685 ( Fusarium -treated), SRX2645686 (mock-infected), and SRX2645687 (mock-infected).

  6. Discovery of DNA viruses in wild-caught mosquitoes using small RNA high throughput sequencing.

    PubMed

    Ma, Maijuan; Huang, Yong; Gong, Zhengda; Zhuang, Lu; Li, Cun; Yang, Hong; Tong, Yigang; Liu, Wei; Cao, Wuchun

    2011-01-01

    Mosquito-borne infectious diseases pose a severe threat to public health in many areas of the world. Current methods for pathogen detection and surveillance are usually dependent on prior knowledge of the etiologic agents involved. Hence, efficient approaches are required for screening wild mosquito populations to detect known and unknown pathogens. In this study, we explored the use of Next Generation Sequencing to identify viral agents in wild-caught mosquitoes. We extracted total RNA from different mosquito species from South China. Small 18-30 bp length RNA molecules were purified, reverse-transcribed into cDNA and sequenced using Illumina GAIIx instrumentation. Bioinformatic analyses to identify putative viral agents were conducted and the results confirmed by PCR. We identified a non-enveloped single-stranded DNA densovirus in the wild-caught Culex pipiens molestus mosquitoes. The majority of the viral transcripts (.>80% of the region) were covered by the small viral RNAs, with a few peaks of very high coverage obtained. The +/- strand sequence ratio of the small RNAs was approximately 7∶1, indicating that the molecules were mainly derived from the viral RNA transcripts. The small viral RNAs overlapped, enabling contig assembly of the viral genome sequence. We identified some small RNAs in the reverse repeat regions of the viral 5'- and 3' -untranslated regions where no transcripts were expected. Our results demonstrate for the first time that high throughput sequencing of small RNA is feasible for identifying viral agents in wild-caught mosquitoes. Our results show that it is possible to detect DNA viruses by sequencing the small RNAs obtained from insects, although the underlying mechanism of small viral RNA biogenesis is unclear. Our data and those of other researchers show that high throughput small RNA sequencing can be used for pathogen surveillance in wild mosquito vectors.

  7. The zinc fingers of YY1 bind single-stranded RNA with low sequence specificity.

    PubMed

    Wai, Dorothy C C; Shihab, Manar; Low, Jason K K; Mackay, Joel P

    2016-11-02

    Classical zinc fingers (ZFs) are traditionally considered to act as sequence-specific DNA-binding domains. More recently, classical ZFs have been recognised as potential RNA-binding modules, raising the intriguing possibility that classical-ZF transcription factors are involved in post-transcriptional gene regulation via direct RNA binding. To date, however, only one classical ZF-RNA complex, that involving TFIIIA, has been structurally characterised. Yin Yang-1 (YY1) is a multi-functional transcription factor involved in many regulatory processes, and binds DNA via four classical ZFs. Recent evidence suggests that YY1 also interacts with RNA, but the molecular nature of the interaction remains unknown. In the present work, we directly assess the ability of YY1 to bind RNA using in vitro assays. Systematic Evolution of Ligands by EXponential enrichment (SELEX) was used to identify preferred RNA sequences bound by the YY1 ZFs from a randomised library over multiple rounds of selection. However, a strong motif was not consistently recovered, suggesting that the RNA sequence selectivity of these domains is modest. YY1 ZF residues involved in binding to single-stranded RNA were identified by NMR spectroscopy and found to be largely distinct from the set of residues involved in DNA binding, suggesting that interactions between YY1 and ssRNA constitute a separate mode of nucleic acid binding. Our data are consistent with recent reports that YY1 can bind to RNA in a low-specificity, yet physiologically relevant manner. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Study design requirements for RNA sequencing-based breast cancer diagnostics.

    PubMed

    Mer, Arvind Singh; Klevebring, Daniel; Grönberg, Henrik; Rantalainen, Mattias

    2016-02-01

    Sequencing-based molecular characterization of tumors provides information required for individualized cancer treatment. There are well-defined molecular subtypes of breast cancer that provide improved prognostication compared to routine biomarkers. However, molecular subtyping is not yet implemented in routine breast cancer care. Clinical translation is dependent on subtype prediction models providing high sensitivity and specificity. In this study we evaluate sample size and RNA-sequencing read requirements for breast cancer subtyping to facilitate rational design of translational studies. We applied subsampling to ascertain the effect of training sample size and the number of RNA sequencing reads on classification accuracy of molecular subtype and routine biomarker prediction models (unsupervised and supervised). Subtype classification accuracy improved with increasing sample size up to N = 750 (accuracy = 0.93), although with a modest improvement beyond N = 350 (accuracy = 0.92). Prediction of routine biomarkers achieved accuracy of 0.94 (ER) and 0.92 (Her2) at N = 200. Subtype classification improved with RNA-sequencing library size up to 5 million reads. Development of molecular subtyping models for cancer diagnostics requires well-designed studies. Sample size and the number of RNA sequencing reads directly influence accuracy of molecular subtyping. Results in this study provide key information for rational design of translational studies aiming to bring sequencing-based diagnostics to the clinic.

  9. A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer.

    PubMed

    Álvarez-Martos, Isabel; Ferapontova, Elena E

    2017-08-05

    A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. RNA Sequencing and Bioinformatics Analysis Implicate the Regulatory Role of a Long Noncoding RNA-mRNA Network in Hepatic Stellate Cell Activation.

    PubMed

    Guo, Can-Jie; Xiao, Xiao; Sheng, Li; Chen, Lili; Zhong, Wei; Li, Hai; Hua, Jing; Ma, Xiong

    2017-01-01

    To analyze the long noncoding (lncRNA)-mRNA expression network and potential roles in rat hepatic stellate cells (HSCs) during activation. LncRNA expression was analyzed in quiescent and culture-activated HSCs by RNA sequencing, and differentially expressed lncRNAs verified by quantitative reverse transcription polymerase chain reaction (qRT-PCR) were subjected to bioinformatics analysis. In vivo analyses of differential lncRNA-mRNA expression were performed on a rat model of liver fibrosis. We identified upregulation of 12 lncRNAs and 155 mRNAs and downregulation of 12 lncRNAs and 374 mRNAs in activated HSCs. Additionally, we identified the differential expression of upregulated lncRNAs (NONRATT012636.2, NONRATT016788.2, and NONRATT021402.2) and downregulated lncRNAs (NONRATT007863.2, NONRATT019720.2, and NONRATT024061.2) in activated HSCs relative to levels observed in quiescent HSCs, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses showed that changes in lncRNAs associated with HSC activation revealed 11 significantly enriched pathways according to their predicted targets. Moreover, based on the predicted co-expression network, the relative dynamic levels of NONRATT013819.2 and lysyl oxidase (Lox) were compared during HSC activation both in vitro and in vivo. Our results confirmed the upregulation of lncRNA NONRATT013819.2 and Lox mRNA associated with the extracellular matrix (ECM)-related signaling pathway in HSCs and fibrotic livers. Our results detailing a dysregulated lncRNA-mRNA network might provide new treatment strategies for hepatic fibrosis based on findings indicating potentially critical roles for NONRATT013819.2 and Lox in ECM remodeling during HSC activation. © 2017 The Author(s). Published by S. Karger AG, Basel.

  11. Structator: fast index-based search for RNA sequence-structure patterns

    PubMed Central

    2011-01-01

    Background The secondary structure of RNA molecules is intimately related to their function and often more conserved than the sequence. Hence, the important task of searching databases for RNAs requires to match sequence-structure patterns. Unfortunately, current tools for this task have, in the best case, a running time that is only linear in the size of sequence databases. Furthermore, established index data structures for fast sequence matching, like suffix trees or arrays, cannot benefit from the complementarity constraints introduced by the secondary structure of RNAs. Results We present a novel method and readily applicable software for time efficient matching of RNA sequence-structure patterns in sequence databases. Our approach is based on affix arrays, a recently introduced index data structure, preprocessed from the target database. Affix arrays support bidirectional pattern search, which is required for efficiently handling the structural constraints of the pattern. Structural patterns like stem-loops can be matched inside out, such that the loop region is matched first and then the pairing bases on the boundaries are matched consecutively. This allows to exploit base pairing information for search space reduction and leads to an expected running time that is sublinear in the size of the sequence database. The incorporation of a new chaining approach in the search of RNA sequence-structure patterns enables the description of molecules folding into complex secondary structures with multiple ordered patterns. The chaining approach removes spurious matches from the set of intermediate results, in particular of patterns with little specificity. In benchmark experiments on the Rfam database, our method runs up to two orders of magnitude faster than previous methods. Conclusions The presented method's sublinear expected running time makes it well suited for RNA sequence-structure pattern matching in large sequence databases. RNA molecules containing several

  12. Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences

    PubMed Central

    Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

    2018-01-01

    RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992

  13. Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences.

    PubMed

    Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

    2018-01-01

    RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.

  14. YM500v2: a small RNA sequencing (smRNA-seq) database for human cancer miRNome research

    PubMed Central

    Cheng, Wei-Chung; Chung, I-Fang; Tsai, Cheng-Fong; Huang, Tse-Shun; Chen, Chen-Yang; Wang, Shao-Chuan; Chang, Ting-Yu; Sun, Hsing-Jen; Chao, Jeffrey Yung-Chuan; Cheng, Cheng-Chung; Wu, Cheng-Wen; Wang, Hsei-Wei

    2015-01-01

    We previously presented YM500, which is an integrated database for miRNA quantification, isomiR identification, arm switching discovery and novel miRNA prediction from 468 human smRNA-seq datasets. Here in this updated YM500v2 database (http://ngs.ym.edu.tw/ym500/), we focus on the cancer miRNome to make the database more disease-orientated. New miRNA-related algorithms developed after YM500 were included in YM500v2, and, more significantly, more than 8000 cancer-related smRNA-seq datasets (including those of primary tumors, paired normal tissues, PBMC, recurrent tumors, and metastatic tumors) were incorporated into YM500v2. Novel miRNAs (miRNAs not included in the miRBase R21) were not only predicted by three independent algorithms but also cleaned by a new in silico filtration strategy and validated by wetlab data such as Cross-Linked ImmunoPrecipitation sequencing (CLIP-seq) to reduce the false-positive rate. A new function ‘Meta-analysis’ is additionally provided for allowing users to identify real-time differentially expressed miRNAs and arm-switching events according to customer-defined sample groups and dozens of clinical criteria tidying up by proficient clinicians. Cancer miRNAs identified hold the potential for both basic research and biotech applications. PMID:25398902

  15. YM500v2: a small RNA sequencing (smRNA-seq) database for human cancer miRNome research.

    PubMed

    Cheng, Wei-Chung; Chung, I-Fang; Tsai, Cheng-Fong; Huang, Tse-Shun; Chen, Chen-Yang; Wang, Shao-Chuan; Chang, Ting-Yu; Sun, Hsing-Jen; Chao, Jeffrey Yung-Chuan; Cheng, Cheng-Chung; Wu, Cheng-Wen; Wang, Hsei-Wei

    2015-01-01

    We previously presented YM500, which is an integrated database for miRNA quantification, isomiR identification, arm switching discovery and novel miRNA prediction from 468 human smRNA-seq datasets. Here in this updated YM500v2 database (http://ngs.ym.edu.tw/ym500/), we focus on the cancer miRNome to make the database more disease-orientated. New miRNA-related algorithms developed after YM500 were included in YM500v2, and, more significantly, more than 8000 cancer-related smRNA-seq datasets (including those of primary tumors, paired normal tissues, PBMC, recurrent tumors, and metastatic tumors) were incorporated into YM500v2. Novel miRNAs (miRNAs not included in the miRBase R21) were not only predicted by three independent algorithms but also cleaned by a new in silico filtration strategy and validated by wetlab data such as Cross-Linked ImmunoPrecipitation sequencing (CLIP-seq) to reduce the false-positive rate. A new function 'Meta-analysis' is additionally provided for allowing users to identify real-time differentially expressed miRNAs and arm-switching events according to customer-defined sample groups and dozens of clinical criteria tidying up by proficient clinicians. Cancer miRNAs identified hold the potential for both basic research and biotech applications. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Prediction of effective RNA interference targets and pathway-related genes in lepidopteran insects by RNA sequencing analysis.

    PubMed

    Guan, Ruo-Bing; Li, Hai-Chao; Miao, Xue-Xia

    2018-06-01

    When using RNA interference (RNAi) to study gene functions in Lepidoptera insects, we discovered that some genes could not be suppressed; instead, their expression levels could be up-regulated by double-stranded RNA (dsRNA). To predict which genes could be easily silenced, we treated the Asian corn borer (Ostrinia furnacalis) with dsGFP (green fluorescent protein) and dsMLP (muscle lim protein). A transcriptome sequence analysis was conducted using the cDNAs 6 h after treatment with dsRNA. The results indicated that 160 genes were up-regulated and 44 genes were down-regulated by the two dsRNAs. Then, 50 co-up-regulated, 25 co-down-regulated and 43 unaffected genes were selected to determine their RNAi responses. All the 25 down-regulated genes were knocked down by their corresponding dsRNA. However, several of the up-regulated and unaffected genes were up-regulated when treated with their corresponding dsRNAs instead of being knocked down. The genes up-regulated by the dsGFP treatment may be involved in insect immune responses or the RNAi pathway. When the immune-related genes were excluded, only seven genes were induced by dsGFP, including ago-2 and dicer-2. These results not only provide a reference for efficient RNAi target predications, but also provide some potential RNAi pathway-related genes for further study. © 2017 Institute of Zoology, Chinese Academy of Sciences.

  17. Sequencing and Characterisation of an Extensive Atlantic Salmon (Salmo salar L.) MicroRNA Repertoire

    PubMed Central

    Bekaert, Michaël; Lowe, Natalie R.; Bishop, Stephen C.; Bron, James E.; Taggart, John B.; Houston, Ross D.

    2013-01-01

    Atlantic salmon (Salmo salar L.), a member of the family Salmonidae, is a totemic species of ecological and cultural significance that is also economically important in terms of both sports fisheries and aquaculture. These factors have promoted the continuous development of genomic resources for this species, furthering both fundamental and applied research. MicroRNAs (miRNA) are small endogenous non-coding RNA molecules that control spatial and temporal expression of targeted genes through post-transcriptional regulation. While miRNA have been characterised in detail for many other species, this is not yet the case for Atlantic salmon. To identify miRNAs from Atlantic salmon, we constructed whole fish miRNA libraries for 18 individual juveniles (fry, four months post hatch) and characterised them by Illumina high-throughput sequencing (total of 354,505,167 paired-ended reads). We report an extensive and partly novel repertoire of miRNA sequences, comprising 888 miRNA genes (547 unique mature miRNA sequences), quantify their expression levels in basal conditions, examine their homology to miRNAs from other species and identify their predicted target genes. We also identify the location and putative copy number of the miRNA genes in the draft Atlantic salmon reference genome sequence. The Atlantic salmon miRNAs experimentally identified in this study provide a robust large-scale resource for functional genome research in salmonids. There is an opportunity to explore the evolution of salmonid miRNAs following the relatively recent whole genome duplication event in salmonid species and to investigate the role of miRNAs in the regulation of gene expression in particular their contribution to variation in economically and ecologically important traits. PMID:23922936

  18. Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

    PubMed

    Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz

    2013-01-01

    Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

  19. Sequence-specific inhibition of Dicer measured with a force-based microarray for RNA ligands.

    PubMed

    Limmer, Katja; Aschenbrenner, Daniela; Gaub, Hermann E

    2013-04-01

    Malfunction of protein translation causes many severe diseases, and suitable correction strategies may become the basis of effective therapies. One major regulatory element of protein translation is the nuclease Dicer that cuts double-stranded RNA independently of the sequence into pieces of 19-22 base pairs starting the RNA interference pathway and activating miRNAs. Inhibiting Dicer is not desirable owing to its multifunctional influence on the cell's gene regulation. Blocking specific RNA sequences by small-molecule binding, however, is a promising approach to affect the cell's condition in a controlled manner. A label-free assay for the screening of site-specific interference of small molecules with Dicer activity is thus needed. We used the Molecular Force Assay (MFA), recently developed in our lab, to measure the activity of Dicer. As a model system, we used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. We show that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.

  20. Phenotype classification of single cells using SRS microscopy, RNA sequencing, and microfluidics (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Streets, Aaron M.; Cao, Chen; Zhang, Xiannian; Huang, Yanyi

    2016-03-01

    Phenotype classification of single cells reveals biological variation that is masked in ensemble measurement. This heterogeneity is found in gene and protein expression as well as in cell morphology. Many techniques are available to probe phenotypic heterogeneity at the single cell level, for example quantitative imaging and single-cell RNA sequencing, but it is difficult to perform multiple assays on the same single cell. In order to directly track correlation between morphology and gene expression at the single cell level, we developed a microfluidic platform for quantitative coherent Raman imaging and immediate RNA sequencing (RNA-Seq) of single cells. With this device we actively sort and trap cells for analysis with stimulated Raman scattering microscopy (SRS). The cells are then processed in parallel pipelines for lysis, and preparation of cDNA for high-throughput transcriptome sequencing. SRS microscopy offers three-dimensional imaging with chemical specificity for quantitative analysis of protein and lipid distribution in single cells. Meanwhile, the microfluidic platform facilitates single-cell manipulation, minimizes contamination, and furthermore, provides improved RNA-Seq detection sensitivity and measurement precision, which is necessary for differentiating biological variability from technical noise. By combining coherent Raman microscopy with RNA sequencing, we can better understand the relationship between cellular morphology and gene expression at the single-cell level.

  1. mESAdb: microRNA Expression and Sequence Analysis Database

    PubMed Central

    Kaya, Koray D.; Karakülah, Gökhan; Yakıcıer, Cengiz M.; Acar, Aybar C.; Konu, Özlen

    2011-01-01

    microRNA expression and sequence analysis database (http://konulab.fen.bilkent.edu.tr/mirna/) (mESAdb) is a regularly updated database for the multivariate analysis of sequences and expression of microRNAs from multiple taxa. mESAdb is modular and has a user interface implemented in PHP and JavaScript and coupled with statistical analysis and visualization packages written for the R language. The database primarily comprises mature microRNA sequences and their target data, along with selected human, mouse and zebrafish expression data sets. mESAdb analysis modules allow (i) mining of microRNA expression data sets for subsets of microRNAs selected manually or by motif; (ii) pair-wise multivariate analysis of expression data sets within and between taxa; and (iii) association of microRNA subsets with annotation databases, HUGE Navigator, KEGG and GO. The use of existing and customized R packages facilitates future addition of data sets and analysis tools. Furthermore, the ability to upload and analyze user-specified data sets makes mESAdb an interactive and expandable analysis tool for microRNA sequence and expression data. PMID:21177657

  2. mESAdb: microRNA expression and sequence analysis database.

    PubMed

    Kaya, Koray D; Karakülah, Gökhan; Yakicier, Cengiz M; Acar, Aybar C; Konu, Ozlen

    2011-01-01

    microRNA expression and sequence analysis database (http://konulab.fen.bilkent.edu.tr/mirna/) (mESAdb) is a regularly updated database for the multivariate analysis of sequences and expression of microRNAs from multiple taxa. mESAdb is modular and has a user interface implemented in PHP and JavaScript and coupled with statistical analysis and visualization packages written for the R language. The database primarily comprises mature microRNA sequences and their target data, along with selected human, mouse and zebrafish expression data sets. mESAdb analysis modules allow (i) mining of microRNA expression data sets for subsets of microRNAs selected manually or by motif; (ii) pair-wise multivariate analysis of expression data sets within and between taxa; and (iii) association of microRNA subsets with annotation databases, HUGE Navigator, KEGG and GO. The use of existing and customized R packages facilitates future addition of data sets and analysis tools. Furthermore, the ability to upload and analyze user-specified data sets makes mESAdb an interactive and expandable analysis tool for microRNA sequence and expression data.

  3. incaRNAfbinv: a web server for the fragment-based design of RNA sequences

    PubMed Central

    Drory Retwitzer, Matan; Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme; Barash, Danny

    2016-01-01

    Abstract In recent years, new methods for computational RNA design have been developed and applied to various problems in synthetic biology and nanotechnology. Lately, there is considerable interest in incorporating essential biological information when solving the inverse RNA folding problem. Correspondingly, RNAfbinv aims at including biologically meaningful constraints and is the only program to-date that performs a fragment-based design of RNA sequences. In doing so it allows the design of sequences that do not necessarily exactly fold into the target, as long as the overall coarse-grained tree graph shape is preserved. Augmented by the weighted sampling algorithm of incaRNAtion, our web server called incaRNAfbinv implements the method devised in RNAfbinv and offers an interactive environment for the inverse folding of RNA using a fragment-based design approach. It takes as input: a target RNA secondary structure; optional sequence and motif constraints; optional target minimum free energy, neutrality and GC content. In addition to the design of synthetic regulatory sequences, it can be used as a pre-processing step for the detection of novel natural occurring RNAs. The two complementary methodologies RNAfbinv and incaRNAtion are merged together and fully implemented in our web server incaRNAfbinv, available at http://www.cs.bgu.ac.il/incaRNAfbinv. PMID:27185893

  4. Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

    USDA-ARS?s Scientific Manuscript database

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

  5. AT-rich sequence elements promote nascent transcript cleavage leading to RNA polymerase II termination

    PubMed Central

    White, Eleanor; Kamieniarz-Gdula, Kinga; Dye, Michael J.; Proudfoot, Nick J.

    2013-01-01

    RNA Polymerase II (Pol II) termination is dependent on RNA processing signals as well as specific terminator elements located downstream of the poly(A) site. One of the two major terminator classes described so far is the Co-Transcriptional Cleavage (CoTC) element. We show that homopolymer A/T tracts within the human β-globin CoTC-mediated terminator element play a critical role in Pol II termination. These short A/T tracts, dispersed within seemingly random sequences, are strong terminator elements, and bioinformatics analysis confirms the presence of such sequences in 70% of the putative terminator regions (PTRs) genome-wide. PMID:23258704

  6. PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3' UTRs and coding sequences.

    PubMed

    Šulc, Miroslav; Marín, Ray M; Robins, Harlan S; Vaníček, Jiří

    2015-07-01

    The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3' untranslated regions (3' UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3' UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA-mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA-mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. High-throughput sequencing reveals circular substrates for an archaeal RNA ligase

    PubMed Central

    Becker, Hubert F.; Héliou, Alice; Djaout, Kamel; Lestini, Roxane; Regnier, Mireille; Myllykallio, Hannu

    2017-01-01

    ABSTRACT It is only recently that the abundant presence of circular RNAs (circRNAs) in all kingdoms of Life, including the hyperthermophilic archaeon Pyrococcus abyssi, has emerged. This led us to investigate the physiologic significance of a previously observed weak intramolecular ligation activity of Pab1020 RNA ligase. Here we demonstrate that this enzyme, despite sharing significant sequence similarity with DNA ligases, is indeed an RNA-specific polynucleotide ligase efficiently acting on physiologically significant substrates. Using a combination of RNA immunoprecipitation assays and RNA-seq, our genome-wide studies revealed 133 individual circRNA loci in P. abyssi. The large majority of these loci interacted with Pab1020 in cells and circularization of selected C/D Box and 5S rRNA transcripts was confirmed biochemically. Altogether these studies revealed that Pab1020 is required for RNA circularization. Our results further suggest the functional speciation of an ancestral NTase domain and/or DNA ligase toward RNA ligase activity and prompt for further characterization of the widespread functions of circular RNAs in prokaryotes. Detailed insight into the cellular substrates of Pab1020 may facilitate the development of new biotechnological applications e.g. in ligation of preadenylated adaptors to RNA molecules. PMID:28277897

  8. Identification of extracellular miRNA in archived serum samples by next-generation sequencing from RNA extracted using multiple methods.

    PubMed

    Gautam, Aarti; Kumar, Raina; Dimitrov, George; Hoke, Allison; Hammamieh, Rasha; Jett, Marti

    2016-10-01

    miRNAs act as important regulators of gene expression by promoting mRNA degradation or by attenuating protein translation. Since miRNAs are stably expressed in bodily fluids, there is growing interest in profiling these miRNAs, as it is minimally invasive and cost-effective as a diagnostic matrix. A technical hurdle in studying miRNA dynamics is the ability to reliably extract miRNA as small sample volumes and low RNA abundance create challenges for extraction and downstream applications. The purpose of this study was to develop a pipeline for the recovery of miRNA using small volumes of archived serum samples. The RNA was extracted employing several widely utilized RNA isolation kits/methods with and without addition of a carrier. The small RNA library preparation was carried out using Illumina TruSeq small RNA kit and sequencing was carried out using Illumina platform. A fraction of five microliters of total RNA was used for library preparation as quantification is below the detection limit. We were able to profile miRNA levels in serum from all the methods tested. We found out that addition of nucleic acid based carrier molecules had higher numbers of processed reads but it did not enhance the mapping of any miRBase annotated sequences. However, some of the extraction procedures offer certain advantages: RNA extracted by TRIzol seemed to align to the miRBase best; extractions using TRIzol with carrier yielded higher miRNA-to-small RNA ratios. Nuclease free glycogen can be carrier of choice for miRNA sequencing. Our findings illustrate that miRNA extraction and quantification is influenced by the choice of methodologies. Addition of nucleic acid- based carrier molecules during extraction procedure is not a good choice when assaying miRNA using sequencing. The careful selection of an extraction method permits the archived serum samples to become valuable resources for high-throughput applications.

  9. RNA-Sequencing of Primary Retinoblastoma Tumors Provides New Insights and Challenges Into Tumor Development.

    PubMed

    Elchuri, Sailaja V; Rajasekaran, Swetha; Miles, Wayne O

    2018-01-01

    Retinoblastoma is rare tumor of the retina caused by the homozygous loss of the Retinoblastoma 1 tumor suppressor gene (RB1). Loss of the RB1 protein, pRB, results in de-regulated activity of the E2F transcription factors, chromatin changes and developmental defects leading to tumor development. Extensive microarray profiles of these tumors have enabled the identification of genes sensitive to pRB disruption, however, this technology has a number of limitations in the RNA profiles that they generate. The advent of RNA-sequencing has enabled the global profiling of all of the RNA within the cell including both coding and non-coding features and the detection of aberrant RNA processing events. In this perspective, we focus on discussing how RNA-sequencing of rare Retinoblastoma tumors will build on existing data and open up new area's to improve our understanding of the biology of these tumors. In particular, we discuss how the RB-research field may be to use this data to determine how RB1 loss results in the expression of; non-coding RNAs, causes aberrant RNA processing events and how a deeper analysis of metabolic RNA changes can be utilized to model tumor specific shifts in metabolism. Each section discusses new opportunities and challenges associated with these types of analyses and aims to provide an honest assessment of how understanding these different processes may contribute to the treatment of Retinoblastoma.

  10. An improved and validated RNA HLA class I SBT approach for obtaining full length coding sequences.

    PubMed

    Gerritsen, K E H; Olieslagers, T I; Groeneweg, M; Voorter, C E M; Tilanus, M G J

    2014-11-01

    The functional relevance of human leukocyte antigen (HLA) class I allele polymorphism beyond exons 2 and 3 is difficult to address because more than 70% of the HLA class I alleles are defined by exons 2 and 3 sequences only. For routine application on clinical samples we improved and validated the HLA sequence-based typing (SBT) approach based on RNA templates, using either a single locus-specific or two overlapping group-specific polymerase chain reaction (PCR) amplifications, with three forward and three reverse sequencing reactions for full length sequencing. Locus-specific HLA typing with RNA SBT of a reference panel, representing the major antigen groups, showed identical results compared to DNA SBT typing. Alleles encountered with unknown exons in the IMGT/HLA database and three samples, two with Null and one with a Low expressed allele, have been addressed by the group-specific RNA SBT approach to obtain full length coding sequences. This RNA SBT approach has proven its value in our routine full length definition of alleles. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. CapZyme-Seq Comprehensively Defines Promoter-Sequence Determinants for RNA 5' Capping with NAD.

    PubMed

    Vvedenskaya, Irina O; Bird, Jeremy G; Zhang, Yuanchao; Zhang, Yu; Jiao, Xinfu; Barvík, Ivan; Krásný, Libor; Kiledjian, Megerditch; Taylor, Deanne M; Ebright, Richard H; Nickels, Bryce E

    2018-05-03

    Nucleoside-containing metabolites such as NAD + can be incorporated as 5' caps on RNA by serving as non-canonical initiating nucleotides (NCINs) for transcription initiation by RNA polymerase (RNAP). Here, we report CapZyme-seq, a high-throughput-sequencing method that employs NCIN-decapping enzymes NudC and Rai1 to detect and quantify NCIN-capped RNA. By combining CapZyme-seq with multiplexed transcriptomics, we determine efficiencies of NAD + capping by Escherichia coli RNAP for ∼16,000 promoter sequences. The results define preferred transcription start site (TSS) positions for NAD + capping and define a consensus promoter sequence for NAD + capping: HRRASWW (TSS underlined). By applying CapZyme-seq to E. coli total cellular RNA, we establish that sequence determinants for NCIN capping in vivo match the NAD + -capping consensus defined in vitro, and we identify and quantify NCIN-capped small RNAs (sRNAs). Our findings define the promoter-sequence determinants for NCIN capping with NAD + and provide a general method for analysis of NCIN capping in vitro and in vivo. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

    PubMed

    Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

    2003-01-01

    Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

  13. Modeling bias and variation in the stochastic processes of small RNA sequencing

    PubMed Central

    Etheridge, Alton; Sakhanenko, Nikita; Galas, David

    2017-01-01

    Abstract The use of RNA-seq as the preferred method for the discovery and validation of small RNA biomarkers has been hindered by high quantitative variability and biased sequence counts. In this paper we develop a statistical model for sequence counts that accounts for ligase bias and stochastic variation in sequence counts. This model implies a linear quadratic relation between the mean and variance of sequence counts. Using a large number of sequencing datasets, we demonstrate how one can use the generalized additive models for location, scale and shape (GAMLSS) distributional regression framework to calculate and apply empirical correction factors for ligase bias. Bias correction could remove more than 40% of the bias for miRNAs. Empirical bias correction factors appear to be nearly constant over at least one and up to four orders of magnitude of total RNA input and independent of sample composition. Using synthetic mixes of known composition, we show that the GAMLSS approach can analyze differential expression with greater accuracy, higher sensitivity and specificity than six existing algorithms (DESeq2, edgeR, EBSeq, limma, DSS, voom) for the analysis of small RNA-seq data. PMID:28369495

  14. High-Throughput Sequencing of RNA Silencing-Associated Small RNAs in Olive (Olea europaea L.)

    PubMed Central

    Donaire, Livia; Pedrola, Laia; de la Rosa, Raúl; Llave, César

    2011-01-01

    Small RNAs (sRNAs) of 20 to 25 nucleotides (nt) in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.). sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA) regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive. PMID:22140484

  15. Fast online and index-based algorithms for approximate search of RNA sequence-structure patterns

    PubMed Central

    2013-01-01

    Background It is well known that the search for homologous RNAs is more effective if both sequence and structure information is incorporated into the search. However, current tools for searching with RNA sequence-structure patterns cannot fully handle mutations occurring on both these levels or are simply not fast enough for searching large sequence databases because of the high computational costs of the underlying sequence-structure alignment problem. Results We present new fast index-based and online algorithms for approximate matching of RNA sequence-structure patterns supporting a full set of edit operations on single bases and base pairs. Our methods efficiently compute semi-global alignments of structural RNA patterns and substrings of the target sequence whose costs satisfy a user-defined sequence-structure edit distance threshold. For this purpose, we introduce a new computing scheme to optimally reuse the entries of the required dynamic programming matrices for all substrings and combine it with a technique for avoiding the alignment computation of non-matching substrings. Our new index-based methods exploit suffix arrays preprocessed from the target database and achieve running times that are sublinear in the size of the searched sequences. To support the description of RNA molecules that fold into complex secondary structures with multiple ordered sequence-structure patterns, we use fast algorithms for the local or global chaining of approximate sequence-structure pattern matches. The chaining step removes spurious matches from the set of intermediate results, in particular of patterns with little specificity. In benchmark experiments on the Rfam database, our improved online algorithm is faster than the best previous method by up to factor 45. Our best new index-based algorithm achieves a speedup of factor 560. Conclusions The presented methods achieve considerable speedups compared to the best previous method. This, together with the expected

  16. Targeted RNA-Sequencing with Competitive Multiplex-PCR Amplicon Libraries

    PubMed Central

    Blomquist, Thomas M.; Crawford, Erin L.; Lovett, Jennie L.; Yeo, Jiyoun; Stanoszek, Lauren M.; Levin, Albert; Li, Jia; Lu, Mei; Shi, Leming; Muldrew, Kenneth; Willey, James C.

    2013-01-01

    Whole transcriptome RNA-sequencing is a powerful tool, but is costly and yields complex data sets that limit its utility in molecular diagnostic testing. A targeted quantitative RNA-sequencing method that is reproducible and reduces the number of sequencing reads required to measure transcripts over the full range of expression would be better suited to diagnostic testing. Toward this goal, we developed a competitive multiplex PCR-based amplicon sequencing library preparation method that a) targets only the sequences of interest and b) controls for inter-target variation in PCR amplification during library preparation by measuring each transcript native template relative to a known number of synthetic competitive template internal standard copies. To determine the utility of this method, we intentionally selected PCR conditions that would cause transcript amplification products (amplicons) to converge toward equimolar concentrations (normalization) during library preparation. We then tested whether this approach would enable accurate and reproducible quantification of each transcript across multiple library preparations, and at the same time reduce (through normalization) total sequencing reads required for quantification of transcript targets across a large range of expression. We demonstrate excellent reproducibility (R2 = 0.997) with 97% accuracy to detect 2-fold change using External RNA Controls Consortium (ERCC) reference materials; high inter-day, inter-site and inter-library concordance (R2 = 0.97–0.99) using FDA Sequencing Quality Control (SEQC) reference materials; and cross-platform concordance with both TaqMan qPCR (R2 = 0.96) and whole transcriptome RNA-sequencing following “traditional” library preparation using Illumina NGS kits (R2 = 0.94). Using this method, sequencing reads required to accurately quantify more than 100 targeted transcripts expressed over a 107-fold range was reduced more than 10,000-fold, from 2.3×109 to 1

  17. RNA Deep Sequencing Reveals Differential MicroRNA Expression during Development of Sea Urchin and Sea Star

    PubMed Central

    Kadri, Sabah; Hinman, Veronica F.; Benos, Panayiotis V.

    2011-01-01

    microRNAs (miRNAs) are small (20–23 nt), non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin) and Patiria miniata (sea star) are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc.) to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads). Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common). We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html. PMID:22216218

  18. Next-generation sequencing identifies the natural killer cell microRNA transcriptome

    PubMed Central

    Fehniger, Todd A.; Wylie, Todd; Germino, Elizabeth; Leong, Jeffrey W.; Magrini, Vincent J.; Koul, Sunita; Keppel, Catherine R.; Schneider, Stephanie E.; Koboldt, Daniel C.; Sullivan, Ryan P.; Heinz, Michael E.; Crosby, Seth D.; Nagarajan, Rakesh; Ramsingh, Giridharan; Link, Daniel C.; Ley, Timothy J.; Mardis, Elaine R.

    2010-01-01

    Natural killer (NK) cells are innate lymphocytes important for early host defense against infectious pathogens and surveillance against malignant transformation. Resting murine NK cells regulate the translation of effector molecule mRNAs (e.g., granzyme B, GzmB) through unclear molecular mechanisms. MicroRNAs (miRNAs) are small noncoding RNAs that post-transcriptionally regulate the translation of their mRNA targets, and are therefore candidates for mediating this control process. While the expression and importance of miRNAs in T and B lymphocytes have been established, little is known about miRNAs in NK cells. Here, we used two next-generation sequencing (NGS) platforms to define the miRNA transcriptomes of resting and cytokine-activated primary murine NK cells, with confirmation by quantitative real-time PCR (qRT-PCR) and microarrays. We delineate a bioinformatics analysis pipeline that identified 302 known and 21 novel mature miRNAs from sequences obtained from NK cell small RNA libraries. These miRNAs are expressed over a broad range and exhibit isomiR complexity, and a subset is differentially expressed following cytokine activation. Using these miRNA NGS data, miR-223 was identified as a mature miRNA present in resting NK cells with decreased expression following cytokine activation. Furthermore, we demonstrate that miR-223 specifically targets the 3′ untranslated region of murine GzmB in vitro, indicating that this miRNA may contribute to control of GzmB translation in resting NK cells. Thus, the sequenced NK cell miRNA transcriptome provides a valuable framework for further elucidation of miRNA expression and function in NK cell biology. PMID:20935160

  19. RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences.

    PubMed

    Brule, C E; Dean, K M; Grayhack, E J

    2016-01-01

    The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.

  20. Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

    PubMed Central

    2018-01-01

    Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA) is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%), all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal. PMID:29682424

  1. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    NASA Technical Reports Server (NTRS)

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  2. Influence of gag and RRE Sequences on HIV-1 RNA Packaging Signal Structure and Function.

    PubMed

    Kharytonchyk, Siarhei; Brown, Joshua D; Stilger, Krista; Yasin, Saif; Iyer, Aishwarya S; Collins, John; Summers, Michael F; Telesnitsky, Alice

    2018-07-06

    The packaging signal (Ψ) and Rev-responsive element (RRE) enable unspliced HIV-1 RNAs' export from the nucleus and packaging into virions. For some retroviruses, engrafting Ψ onto a heterologous RNA is sufficient to direct encapsidation. In contrast, HIV-1 RNA packaging requires 5' leader Ψ elements plus poorly defined additional features. We previously defined minimal 5' leader sequences competitive with intact Ψ for HIV-1 packaging, and here examined the potential roles of additional downstream elements. The findings confirmed that together, HIV-1 5' leader Ψ sequences plus a nuclear export element are sufficient to specify packaging. However, RNAs trafficked using a heterologous export element did not compete well with RNAs using HIV-1's RRE. Furthermore, some RNA additions to well-packaged minimal vectors rendered them packaging-defective. These defects were rescued by extending gag sequences in their native context. To understand these packaging defects' causes, in vitro dimerization properties of RNAs containing minimal packaging elements were compared to RNAs with sequence extensions that were or were not compatible with packaging. In vitro dimerization was found to correlate with packaging phenotypes, suggesting that HIV-1 evolved to prevent 5' leader residues' base pairing with downstream residues and misfolding of the packaging signal. Our findings explain why gag sequences have been implicated in packaging and show that RRE's packaging contributions appear more specific than nuclear export alone. Paired with recent work showing that sequences upstream of Ψ can dictate RNA folds, the current work explains how genetic context of minimal packaging elements contributes to HIV-1 RNA fate determination. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. The impact of CRISPR repeat sequence on structures of a Cas6 protein-RNA complex

    SciTech Connect

    Wang, Ruiying; Zheng, Han; Preamplume, Gan

    The repeat-associated mysterious proteins (RAMPs) comprise the most abundant family of proteins involved in prokaryotic immunity against invading genetic elements conferred by the clustered regularly interspaced short palindromic repeat (CRISPR) system. Cas6 is one of the first characterized RAMP proteins and is a key enzyme required for CRISPR RNA maturation. Despite a strong structural homology with other RAMP proteins that bind hairpin RNA, Cas6 distinctly recognizes single-stranded RNA. Previous structural and biochemical studies show that Cas6 captures the 5' end while cleaving the 3' end of the CRISPR RNA. Here, we describe three structures and complementary biochemical analysis of amore » noncatalytic Cas6 homolog from Pyrococcus horikoshii bound to CRISPR repeat RNA of different sequences. Our study confirms the specificity of the Cas6 protein for single-stranded RNA and further reveals the importance of the bases at Positions 5-7 in Cas6-RNA interactions. Substitutions of these bases result in structural changes in the protein-RNA complex including its oligomerization state.« less

  4. RISC RNA sequencing for context-specific identification of in vivo miR targets

    PubMed Central

    Matkovich, Scot J; Van Booven, Derek J; Eschenbacher, William H; Dorn, Gerald W

    2010-01-01

    Rationale MicroRNAs (miRs) are expanding our understanding of cardiac disease and have the potential to transform cardiovascular therapeutics. One miR can target hundreds of individual mRNAs, but existing methodologies are not sufficient to accurately and comprehensively identify these mRNA targets in vivo. Objective To develop methods permitting identification of in vivo miR targets in an unbiased manner, using massively parallel sequencing of mouse cardiac transcriptomes in combination with sequencing of mRNA associated with mouse cardiac RNA-induced silencing complexes (RISCs). Methods and Results We optimized techniques for expression profiling small amounts of RNA without introducing amplification bias, and applied this to anti-Argonaute 2 immunoprecipitated RISCs (RISC-Seq) from mouse hearts. By comparing RNA-sequencing results of cardiac RISC and transcriptome from the same individual hearts, we defined 1,645 mRNAs consistently targeted to mouse cardiac RISCs. We employed this approach in hearts overexpressing miRs from Myh6 promoter-driven precursors (programmed RISC-Seq) to identify 209 in vivo targets of miR-133a and 81 in vivo targets of miR-499. Consistent with the fact that miR-133a and miR-499 have widely differing ‘seed’ sequences and belong to different miR families, only 6 targets were common to miR-133a- and miR-499-programmed hearts. Conclusions RISC-sequencing is a highly sensitive method for general RISC profiling and individual miR target identification in biological context, and is applicable to any tissue and any disease state. Summary MicroRNAs (miRs) are key regulators of mRNA translation in health and disease. While bioinformatic predictions suggest that a single miR may target hundreds of mRNAs, the number of experimentally verified targets of miRs is low. To enable comprehensive, unbiased examination of miR targets, we have performed deep RNA sequencing of cardiac transcriptomes in parallel with cardiac RNA-induced silencing complex

  5. Sequence-specific bias correction for RNA-seq data using recurrent neural networks.

    PubMed

    Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru

    2017-01-25

    The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.

  6. Bioinformatics analysis of plant orthologous introns: identification of an intronic tRNA-like sequence.

    PubMed

    Akkuratov, Evgeny E; Walters, Lorraine; Saha-Mandal, Arnab; Khandekar, Sushant; Crawford, Erin; Zirbel, Craig L; Leisner, Scott; Prakash, Ashwin; Fedorova, Larisa; Fedorov, Alexei

    2014-09-10

    Orthologous introns have identical positions relative to the coding sequence in orthologous genes of different species. By analyzing the complete genomes of five plants we generated a database of 40,512 orthologous intron groups of dicotyledonous plants, 28,519 orthologous intron groups of angiosperms, and 15,726 of land plants (moss and angiosperms). Multiple sequence alignments of each orthologous intron group were obtained using the Mafft algorithm. The number of conserved regions in plant introns appeared to be hundreds of times fewer than that in mammals or vertebrates. Approximately three quarters of conserved intronic regions among angiosperms and dicots, in particular, correspond to alternatively-spliced exonic sequences. We registered only a handful of conserved intronic ncRNAs of flowering plants. However, the most evolutionarily conserved intronic region, which is ubiquitous for all plants examined in this study, including moss, possessed multiple structural features of tRNAs, which caused us to classify it as a putative tRNA-like ncRNA. Intronic sequences encoding tRNA-like structures are not unique to plants. Bioinformatics examination of the presence of tRNA inside introns revealed an unusually long-term association of four glycine tRNAs inside the Vac14 gene of fish, amniotes, and mammals. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Ultra Deep Sequencing of Listeria monocytogenes sRNA Transcriptome Revealed New Antisense RNAs

    PubMed Central

    Behrens, Sebastian; Widder, Stefanie; Mannala, Gopala Krishna; Qing, Xiaoxing; Madhugiri, Ramakanth; Kefer, Nathalie; Mraheil, Mobarak Abu; Rattei, Thomas; Hain, Torsten

    2014-01-01

    Listeria monocytogenes, a gram-positive pathogen, and causative agent of listeriosis, has become a widely used model organism for intracellular infections. Recent studies have identified small non-coding RNAs (sRNAs) as important factors for regulating gene expression and pathogenicity of L. monocytogenes. Increased speed and reduced costs of high throughput sequencing (HTS) techniques have made RNA sequencing (RNA-Seq) the state-of-the-art method to study bacterial transcriptomes. We created a large transcriptome dataset of L. monocytogenes containing a total of 21 million reads, using the SOLiD sequencing technology. The dataset contained cDNA sequences generated from L. monocytogenes RNA collected under intracellular and extracellular condition and additionally was size fractioned into three different size ranges from <40 nt, 40–150 nt and >150 nt. We report here, the identification of nine new sRNAs candidates of L. monocytogenes and a reevaluation of known sRNAs of L. monocytogenes EGD-e. Automatic comparison to known sRNAs revealed a high recovery rate of 55%, which was increased to 90% by manual revision of the data. Moreover, thorough classification of known sRNAs shed further light on their possible biological functions. Interestingly among the newly identified sRNA candidates are antisense RNAs (asRNAs) associated to the housekeeping genes purA, fumC and pgi and potentially their regulation, emphasizing the significance of sRNAs for metabolic adaptation in L. monocytogenes. PMID:24498259

  8. Secondary Structure Predictions for Long RNA Sequences Based on Inversion Excursions and MapReduce.

    PubMed

    Yehdego, Daniel T; Zhang, Boyu; Kodimala, Vikram K R; Johnson, Kyle L; Taufer, Michela; Leung, Ming-Ying

    2013-05-01

    Secondary structures of ribonucleic acid (RNA) molecules play important roles in many biological processes including gene expression and regulation. Experimental observations and computing limitations suggest that we can approach the secondary structure prediction problem for long RNA sequences by segmenting them into shorter chunks, predicting the secondary structures of each chunk individually using existing prediction programs, and then assembling the results to give the structure of the original sequence. The selection of cutting points is a crucial component of the segmenting step. Noting that stem-loops and pseudoknots always contain an inversion, i.e., a stretch of nucleotides followed closely by its inverse complementary sequence, we developed two cutting methods for segmenting long RNA sequences based on inversion excursions: the centered and optimized method. Each step of searching for inversions, chunking, and predictions can be performed in parallel. In this paper we use a MapReduce framework, i.e., Hadoop, to extensively explore meaningful inversion stem lengths and gap sizes for the segmentation and identify correlations between chunking methods and prediction accuracy. We show that for a set of long RNA sequences in the RFAM database, whose secondary structures are known to contain pseudoknots, our approach predicts secondary structures more accurately than methods that do not segment the sequence, when the latter predictions are possible computationally. We also show that, as sequences exceed certain lengths, some programs cannot computationally predict pseudoknots while our chunking methods can. Overall, our predicted structures still retain the accuracy level of the original prediction programs when compared with known experimental secondary structure.

  9. Identifying 5-methylcytosine sites in RNA sequence using composite encoding feature into Chou's PseKNC.

    PubMed

    Sabooh, M Fazli; Iqbal, Nadeem; Khan, Mukhtaj; Khan, Muslim; Maqbool, H F

    2018-05-01

    This study examines accurate and efficient computational method for identification of 5-methylcytosine sites in RNA modification. The occurrence of 5-methylcytosine (m 5 C) plays a vital role in a number of biological processes. For better comprehension of the biological functions and mechanism it is necessary to recognize m 5 C sites in RNA precisely. The laboratory techniques and procedures are available to identify m 5 C sites in RNA, but these procedures require a lot of time and resources. This study develops a new computational method for extracting the features of RNA sequence. In this method, first the RNA sequence is encoded via composite feature vector, then, for the selection of discriminate features, the minimum-redundancy-maximum-relevance algorithm was used. Secondly, the classification method used has been based on a support vector machine by using jackknife cross validation test. The suggested method efficiently identifies m 5 C sites from non- m 5 C sites and the outcome of the suggested algorithm is 93.33% with sensitivity of 90.0 and specificity of 96.66 on bench mark datasets. The result exhibits that proposed algorithm shown significant identification performance compared to the existing computational techniques. This study extends the knowledge about the occurrence sites of RNA modification which paves the way for better comprehension of the biological uses and mechanism. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. RNA sequencing uncovers antisense RNAs and novel small RNAs in Streptococcus pyogenes

    PubMed Central

    Le Rhun, Anaïs; Beer, Yan Yan; Reimegård, Johan; Chylinski, Krzysztof; Charpentier, Emmanuelle

    2016-01-01

    ABSTRACT Streptococcus pyogenes is a human pathogen responsible for a wide spectrum of diseases ranging from mild to life-threatening infections. During the infectious process, the temporal and spatial expression of pathogenicity factors is tightly controlled by a complex network of protein and RNA regulators acting in response to various environmental signals. Here, we focus on the class of small RNA regulators (sRNAs) and present the first complete analysis of sRNA sequencing data in S. pyogenes. In the SF370 clinical isolate (M1 serotype), we identified 197 and 428 putative regulatory RNAs by visual inspection and bioinformatics screening of the sequencing data, respectively. Only 35 from the 197 candidates identified by visual screening were assigned a predicted function (T-boxes, ribosomal protein leaders, characterized riboswitches or sRNAs), indicating how little is known about sRNA regulation in S. pyogenes. By comparing our list of predicted sRNAs with previous S. pyogenes sRNA screens using bioinformatics or microarrays, 92 novel sRNAs were revealed, including antisense RNAs that are for the first time shown to be expressed in this pathogen. We experimentally validated the expression of 30 novel sRNAs and antisense RNAs. We show that the expression profile of 9 sRNAs including 2 predicted regulatory elements is affected by the endoribonucleases RNase III and/or RNase Y, highlighting the critical role of these enzymes in sRNA regulation. PMID:26580233

  11. Identifying mRNA sequence elements for target recognition by human Argonaute proteins

    PubMed Central

    Li, Jingjing; Kim, TaeHyung; Nutiu, Razvan; Ray, Debashish; Hughes, Timothy R.; Zhang, Zhaolei

    2014-01-01

    It is commonly known that mammalian microRNAs (miRNAs) guide the RNA-induced silencing complex (RISC) to target mRNAs through the seed-pairing rule. However, recent experiments that coimmunoprecipitate the Argonaute proteins (AGOs), the central catalytic component of RISC, have consistently revealed extensive AGO-associated mRNAs that lack seed complementarity with miRNAs. We herein test the hypothesis that AGO has its own binding preference within target mRNAs, independent of guide miRNAs. By systematically analyzing the data from in vivo cross-linking experiments with human AGOs, we have identified a structurally accessible and evolutionarily conserved region (∼10 nucleotides in length) that alone can accurately predict AGO–mRNA associations, independent of the presence of miRNA binding sites. Within this region, we further identified an enriched motif that was replicable on independent AGO-immunoprecipitation data sets. We used RNAcompete to enumerate the RNA-binding preference of human AGO2 to all possible 7-mer RNA sequences and validated the AGO motif in vitro. These findings reveal a novel function of AGOs as sequence-specific RNA-binding proteins, which may aid miRNAs in recognizing their targets with high specificity. PMID:24663241

  12. JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

    PubMed Central

    Dong, Min; Graham, Mitchell; Yadav, Nehul

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

  13. RNAfbinv: an interactive Java application for fragment-based design of RNA sequences.

    PubMed

    Weinbrand, Lina; Avihoo, Assaf; Barash, Danny

    2013-11-15

    In RNA design problems, it is plausible to assume that the user would be interested in preserving a particular RNA secondary structure motif, or fragment, for biological reasons. The preservation could be in structure or sequence, or both. Thus, the inverse RNA folding problem could benefit from considering fragment constraints. We have developed a new interactive Java application called RNA fragment-based inverse that allows users to insert an RNA secondary structure in dot-bracket notation. It then performs sequence design that conforms to the shape of the input secondary structure, the specified thermodynamic stability, the specified mutational robustness and the user-selected fragment after shape decomposition. In this shape-based design approach, specific RNA structural motifs with known biological functions are strictly enforced, while others can possess more flexibility in their structure in favor of preserving physical attributes and additional constraints. RNAfbinv is freely available for download on the web at http://www.cs.bgu.ac.il/~RNAexinv/RNAfbinv. The site contains a help file with an explanation regarding the exact use.

  14. RNA sequencing uncovers antisense RNAs and novel small RNAs in Streptococcus pyogenes.

    PubMed

    Le Rhun, Anaïs; Beer, Yan Yan; Reimegård, Johan; Chylinski, Krzysztof; Charpentier, Emmanuelle

    2016-01-01

    Streptococcus pyogenes is a human pathogen responsible for a wide spectrum of diseases ranging from mild to life-threatening infections. During the infectious process, the temporal and spatial expression of pathogenicity factors is tightly controlled by a complex network of protein and RNA regulators acting in response to various environmental signals. Here, we focus on the class of small RNA regulators (sRNAs) and present the first complete analysis of sRNA sequencing data in S. pyogenes. In the SF370 clinical isolate (M1 serotype), we identified 197 and 428 putative regulatory RNAs by visual inspection and bioinformatics screening of the sequencing data, respectively. Only 35 from the 197 candidates identified by visual screening were assigned a predicted function (T-boxes, ribosomal protein leaders, characterized riboswitches or sRNAs), indicating how little is known about sRNA regulation in S. pyogenes. By comparing our list of predicted sRNAs with previous S. pyogenes sRNA screens using bioinformatics or microarrays, 92 novel sRNAs were revealed, including antisense RNAs that are for the first time shown to be expressed in this pathogen. We experimentally validated the expression of 30 novel sRNAs and antisense RNAs. We show that the expression profile of 9 sRNAs including 2 predicted regulatory elements is affected by the endoribonucleases RNase III and/or RNase Y, highlighting the critical role of these enzymes in sRNA regulation.

  15. The maize stripe virus major noncapsid protein messenger RNA transcripts contain heterogeneous leader sequences at their 5' termini.

    PubMed

    Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W

    1993-12-01

    Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.

  16. eRNA: a graphic user interface-based tool optimized for large data analysis from high-throughput RNA sequencing.

    PubMed

    Yuan, Tiezheng; Huang, Xiaoyi; Dittmar, Rachel L; Du, Meijun; Kohli, Manish; Boardman, Lisa; Thibodeau, Stephen N; Wang, Liang

    2014-03-05

    RNA sequencing (RNA-seq) is emerging as a critical approach in biological research. However, its high-throughput advantage is significantly limited by the capacity of bioinformatics tools. The research community urgently needs user-friendly tools to efficiently analyze the complicated data generated by high throughput sequencers. We developed a standalone tool with graphic user interface (GUI)-based analytic modules, known as eRNA. The capacity of performing parallel processing and sample management facilitates large data analyses by maximizing hardware usage and freeing users from tediously handling sequencing data. The module miRNA identification" includes GUIs for raw data reading, adapter removal, sequence alignment, and read counting. The module "mRNA identification" includes GUIs for reference sequences, genome mapping, transcript assembling, and differential expression. The module "Target screening" provides expression profiling analyses and graphic visualization. The module "Self-testing" offers the directory setups, sample management, and a check for third-party package dependency. Integration of other GUIs including Bowtie, miRDeep2, and miRspring extend the program's functionality. eRNA focuses on the common tools required for the mapping and quantification analysis of miRNA-seq and mRNA-seq data. The software package provides an additional choice for scientists who require a user-friendly computing environment and high-throughput capacity for large data analysis. eRNA is available for free download at https://sourceforge.net/projects/erna/?source=directory.

  17. Ensemble-based classification approach for micro-RNA mining applied on diverse metagenomic sequences.

    PubMed

    ElGokhy, Sherin M; ElHefnawi, Mahmoud; Shoukry, Amin

    2014-05-06

    MicroRNAs (miRNAs) are endogenous ∼22 nt RNAs that are identified in many species as powerful regulators of gene expressions. Experimental identification of miRNAs is still slow since miRNAs are difficult to isolate by cloning due to their low expression, low stability, tissue specificity and the high cost of the cloning procedure. Thus, computational identification of miRNAs from genomic sequences provide a valuable complement to cloning. Different approaches for identification of miRNAs have been proposed based on homology, thermodynamic parameters, and cross-species comparisons. The present paper focuses on the integration of miRNA classifiers in a meta-classifier and the identification of miRNAs from metagenomic sequences collected from different environments. An ensemble of classifiers is proposed for miRNA hairpin prediction based on four well-known classifiers (Triplet SVM, Mipred, Virgo and EumiR), with non-identical features, and which have been trained on different data. Their decisions are combined using a single hidden layer neural network to increase the accuracy of the predictions. Our ensemble classifier achieved 89.3% accuracy, 82.2% f-measure, 74% sensitivity, 97% specificity, 92.5% precision and 88.2% negative predictive value when tested on real miRNA and pseudo sequence data. The area under the receiver operating characteristic curve of our classifier is 0.9 which represents a high performance index.The proposed classifier yields a significant performance improvement relative to Triplet-SVM, Virgo and EumiR and a minor refinement over MiPred.The developed ensemble classifier is used for miRNA prediction in mine drainage, groundwater and marine metagenomic sequences downloaded from the NCBI sequence reed archive. By consulting the miRBase repository, 179 miRNAs have been identified as highly probable miRNAs. Our new approach could thus be used for mining metagenomic sequences and finding new and homologous miRNAs. The paper investigates a

  18. Missing data and technical variability in single-cell RNA-sequencing experiments.

    PubMed

    Hicks, Stephanie C; Townes, F William; Teng, Mingxiang; Irizarry, Rafael A

    2017-11-06

    Until recently, high-throughput gene expression technology, such as RNA-Sequencing (RNA-seq) required hundreds of thousands of cells to produce reliable measurements. Recent technical advances permit genome-wide gene expression measurement at the single-cell level. Single-cell RNA-Seq (scRNA-seq) is the most widely used and numerous publications are based on data produced with this technology. However, RNA-seq and scRNA-seq data are markedly different. In particular, unlike RNA-seq, the majority of reported expression levels in scRNA-seq are zeros, which could be either biologically-driven, genes not expressing RNA at the time of measurement, or technically-driven, genes expressing RNA, but not at a sufficient level to be detected by sequencing technology. Another difference is that the proportion of genes reporting the expression level to be zero varies substantially across single cells compared to RNA-seq samples. However, it remains unclear to what extent this cell-to-cell variation is being driven by technical rather than biological variation. Furthermore, while systematic errors, including batch effects, have been widely reported as a major challenge in high-throughput technologies, these issues have received minimal attention in published studies based on scRNA-seq technology. Here, we use an assessment experiment to examine data from published studies and demonstrate that systematic errors can explain a substantial percentage of observed cell-to-cell expression variability. Specifically, we present evidence that some of these reported zeros are driven by technical variation by demonstrating that scRNA-seq produces more zeros than expected and that this bias is greater for lower expressed genes. In addition, this missing data problem is exacerbated by the fact that this technical variation varies cell-to-cell. Then, we show how this technical cell-to-cell variability can be confused with novel biological results. Finally, we demonstrate and discuss how batch

  19. Understanding the Sequence Preference of Recurrent RNA Building Blocks using Quantum Chemistry: The Intrastrand RNA Dinucleotide Platform.

    PubMed

    Mládek, Arnošt; Sponer, Judit E; Kulhánek, Petr; Lu, Xiang-Jun; Olson, Wilma K; Sponer, Jiřĺ

    2012-01-10

    Folded RNA molecules are shaped by an astonishing variety of highly conserved noncanonical molecular interactions and backbone topologies. The dinucleotide platform is a widespread recurrent RNA modular building submotif formed by the side-by-side pairing of bases from two consecutive nucleotides within a single strand, with highly specific sequence preferences. This unique arrangement of bases is cemented by an intricate network of noncanonical hydrogen bonds and facilitated by a distinctive backbone topology. The present study investigates the gas-phase intrinsic stabilities of the three most common RNA dinucleotide platforms - 5'-GpU-3', ApA, and UpC - via state-of-the-art quantum-chemical (QM) techniques. The mean stability of base-base interactions decreases with sequence in the order GpU > ApA > UpC. Bader's atoms-in-molecules analysis reveals that the N2(G)…O4(U) hydrogen bond of the GpU platform is stronger than the corresponding hydrogen bonds in the other two platforms. The mixed-pucker sugar-phosphate backbone conformation found in most GpU platforms, in which the 5'-ribose sugar (G) is in the C2'-endo form and the 3'-sugar (U) in the C3'-endo form, is intrinsically more stable than the standard A-RNA backbone arrangement, partially as a result of a favorable O2'…O2P intra-platform interaction. Our results thus validate the hypothesis of Lu et al. (Lu Xiang-Jun, et al. Nucleic Acids Res. 2010, 38, 4868-4876), that the superior stability of GpU platforms is partially mediated by the strong O2'…O2P hydrogen bond. In contrast, ApA and especially UpC platform-compatible backbone conformations are rather diverse and do not display any characteristic structural features. The average stabilities of ApA and UpC derived backbone conformers are also lower than those of GpU platforms. Thus, the observed structural and evolutionary patterns of the dinucleotide platforms can be accounted for, to a large extent, by their intrinsic properties as described by

  20. R3D-2-MSA: the RNA 3D structure-to-multiple sequence alignment server.

    PubMed

    Cannone, Jamie J; Sweeney, Blake A; Petrov, Anton I; Gutell, Robin R; Zirbel, Craig L; Leontis, Neocles

    2015-07-01

    The RNA 3D Structure-to-Multiple Sequence Alignment Server (R3D-2-MSA) is a new web service that seamlessly links RNA three-dimensional (3D) structures to high-quality RNA multiple sequence alignments (MSAs) from diverse biological sources. In this first release, R3D-2-MSA provides manual and programmatic access to curated, representative ribosomal RNA sequence alignments from bacterial, archaeal, eukaryal and organellar ribosomes, using nucleotide numbers from representative atomic-resolution 3D structures. A web-based front end is available for manual entry and an Application Program Interface for programmatic access. Users can specify up to five ranges of nucleotides and 50 nucleotide positions per range. The R3D-2-MSA server maps these ranges to the appropriate columns of the corresponding MSA and returns the contents of the columns, either for display in a web browser or in JSON format for subsequent programmatic use. The browser output page provides a 3D interactive display of the query, a full list of sequence variants with taxonomic information and a statistical summary of distinct sequence variants found. The output can be filtered and sorted in the browser. Previous user queries can be viewed at any time by resubmitting the output URL, which encodes the search and re-generates the results. The service is freely available with no login requirement at http://rna.bgsu.edu/r3d-2-msa. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. RNA sequencing confirms similarities between PPI-responsive oesophageal eosinophilia and eosinophilic oesophagitis.

    PubMed

    Peterson, K A; Yoshigi, M; Hazel, M W; Delker, D A; Lin, E; Krishnamurthy, C; Consiglio, N; Robson, J; Yandell, M; Clayton, F

    2018-06-04

    Although current American guidelines distinguish proton pump inhibitor-responsive oesophageal eosinophilia (PPI-REE) from eosinophilic oesophagitis (EoE), these entities are broadly similar. While two microarray studies showed that they have similar transcriptomes, more extensive RNA sequencing studies have not been done previously. To determine whether RNA sequencing identifies genetic markers distinguishing PPI-REE from EoE. We retrospectively examined 13 PPI-REE and 14 EoE biopsies, matched for tissue eosinophil content, and 14 normal controls. Patients and controls were not PPI-treated at the time of biopsy. We did RNA sequencing on formalin-fixed, paraffin-embedded tissue, with differential expression confirmation by quantitative polymerase chain reaction (PCR). We validated the use of formalin-fixed, paraffin-embedded vs RNAlater-preserved tissue, and compared our formalin-fixed, paraffin-embedded EoE results to a prior EoE study. By RNA sequencing, no genes were differentially expressed between the EoE and PPI-REE groups at the false discovery rate (FDR) ≤0.01 level. Compared to normal controls, 1996 genes were differentially expressed in the PPI-REE group and 1306 genes in the EoE group. By less stringent criteria, only MAPK8IP2 was differentially expressed between PPI-REE and EoE (FDR = 0.029, 2.2-fold less in EoE than in PPI-REE), with similar results by PCR. KCNJ2, which was differentially expressed in a prior study, was similar in the EoE and PPI-REE groups by both RNA sequencing and real-time PCR. Eosinophilic oesophagitis and PPI-REE have comparable transcriptomes, confirming that they are part of the same disease continuum. © 2018 John Wiley & Sons Ltd.

  2. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

    PubMed

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

    1990-01-01

    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  3. Reanalysis of RNA-Sequencing Data Reveals Several Additional Fusion Genes with Multiple Isoforms

    PubMed Central

    Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

    2012-01-01

    RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts. PMID:23119097

  4. Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

    PubMed

    Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

    2012-01-01

    RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

  5. Retrospective MicroRNA Sequencing: Complementary DNA Library Preparation Protocol Using Formalin-fixed Paraffin-embedded RNA Specimens.

    PubMed

    Loudig, Olivier; Liu, Christina; Rohan, Thomas; Ben-Dov, Iddo Z

    2018-05-05

    -Archived, clinically classified formalin-fixed paraffin-embedded (FFPE) tissues can provide nucleic acids for retrospective molecular studies of cancer development. By using non-invasive or pre-malignant lesions from patients who later develop invasive disease, gene expression analyses may help identify early molecular alterations that predispose to cancer risk. It has been well described that nucleic acids recovered from FFPE tissues have undergone severe physical damage and chemical modifications, which make their analysis difficult and generally requires adapted assays. MicroRNAs (miRNAs), however, which represent a small class of RNA molecules spanning only up to ~18-24 nucleotides, have been shown to withstand long-term storage and have been successfully analyzed in FFPE samples. Here we present a 3' barcoded complementary DNA (cDNA) library preparation protocol specifically optimized for the analysis of small RNAs extracted from archived tissues, which was recently demonstrated to be robust and highly reproducible when using archived clinical specimens stored for up to 35 years. This library preparation is well adapted to the multiplex analysis of compromised/degraded material where RNA samples (up to 18) are ligated with individual 3' barcoded adapters and then pooled together for subsequent enzymatic and biochemical preparations prior to analysis. All purifications are performed by polyacrylamide gel electrophoresis (PAGE), which allows size-specific selections and enrichments of barcoded small RNA species. This cDNA library preparation is well adapted to minute RNA inputs, as a pilot polymerase chain reaction (PCR) allows determination of a specific amplification cycle to produce optimal amounts of material for next-generation sequencing (NGS). This approach was optimized for the use of degraded FFPE RNA from specimens archived for up to 35 years and provides highly reproducible NGS data.

  6. Efficient experimental design and analysis strategies for the detection of differential expression using RNA-Sequencing

    PubMed Central

    2012-01-01

    Background RNA sequencing (RNA-Seq) has emerged as a powerful approach for the detection of differential gene expression with both high-throughput and high resolution capabilities possible depending upon the experimental design chosen. Multiplex experimental designs are now readily available, these can be utilised to increase the numbers of samples or replicates profiled at the cost of decreased sequencing depth generated per sample. These strategies impact on the power of the approach to accurately identify differential expression. This study presents a detailed analysis of the power to detect differential expression in a range of scenarios including simulated null and differential expression distributions with varying numbers of biological or technical replicates, sequencing depths and analysis methods. Results Differential and non-differential expression datasets were simulated using a combination of negative binomial and exponential distributions derived from real RNA-Seq data. These datasets were used to evaluate the performance of three commonly used differential expression analysis algorithms and to quantify the changes in power with respect to true and false positive rates when simulating variations in sequencing depth, biological replication and multiplex experimental design choices. Conclusions This work quantitatively explores comparisons between contemporary analysis tools and experimental design choices for the detection of differential expression using RNA-Seq. We found that the DESeq algorithm performs more conservatively than edgeR and NBPSeq. With regard to testing of various experimental designs, this work strongly suggests that greater power is gained through the use of biological replicates relative to library (technical) replicates and sequencing depth. Strikingly, sequencing depth could be reduced as low as 15% without substantial impacts on false positive or true positive rates. PMID:22985019

  7. Efficient experimental design and analysis strategies for the detection of differential expression using RNA-Sequencing.

    PubMed

    Robles, José A; Qureshi, Sumaira E; Stephen, Stuart J; Wilson, Susan R; Burden, Conrad J; Taylor, Jennifer M

    2012-09-17

    RNA sequencing (RNA-Seq) has emerged as a powerful approach for the detection of differential gene expression with both high-throughput and high resolution capabilities possible depending upon the experimental design chosen. Multiplex experimental designs are now readily available, these can be utilised to increase the numbers of samples or replicates profiled at the cost of decreased sequencing depth generated per sample. These strategies impact on the power of the approach to accurately identify differential expression. This study presents a detailed analysis of the power to detect differential expression in a range of scenarios including simulated null and differential expression distributions with varying numbers of biological or technical replicates, sequencing depths and analysis methods. Differential and non-differential expression datasets were simulated using a combination of negative binomial and exponential distributions derived from real RNA-Seq data. These datasets were used to evaluate the performance of three commonly used differential expression analysis algorithms and to quantify the changes in power with respect to true and false positive rates when simulating variations in sequencing depth, biological replication and multiplex experimental design choices. This work quantitatively explores comparisons between contemporary analysis tools and experimental design choices for the detection of differential expression using RNA-Seq. We found that the DESeq algorithm performs more conservatively than edgeR and NBPSeq. With regard to testing of various experimental designs, this work strongly suggests that greater power is gained through the use of biological replicates relative to library (technical) replicates and sequencing depth. Strikingly, sequencing depth could be reduced as low as 15% without substantial impacts on false positive or true positive rates.

  8. Accounting for technical noise in differential expression analysis of single-cell RNA sequencing data.

    PubMed

    Jia, Cheng; Hu, Yu; Kelly, Derek; Kim, Junhyong; Li, Mingyao; Zhang, Nancy R

    2017-11-02

    Recent technological breakthroughs have made it possible to measure RNA expression at the single-cell level, thus paving the way for exploring expression heterogeneity among individual cells. Current single-cell RNA sequencing (scRNA-seq) protocols are complex and introduce technical biases that vary across cells, which can bias downstream analysis without proper adjustment. To account for cell-to-cell technical differences, we propose a statistical framework, TASC (Toolkit for Analysis of Single Cell RNA-seq), an empirical Bayes approach to reliably model the cell-specific dropout rates and amplification bias by use of external RNA spike-ins. TASC incorporates the technical parameters, which reflect cell-to-cell batch effects, into a hierarchical mixture model to estimate the biological variance of a gene and detect differentially expressed genes. More importantly, TASC is able to adjust for covariates to further eliminate confounding that may originate from cell size and cell cycle differences. In simulation and real scRNA-seq data, TASC achieves accurate Type I error control and displays competitive sensitivity and improved robustness to batch effects in differential expression analysis, compared to existing methods. TASC is programmed to be computationally efficient, taking advantage of multi-threaded parallelization. We believe that TASC will provide a robust platform for researchers to leverage the power of scRNA-seq. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Accounting for technical noise in differential expression analysis of single-cell RNA sequencing data

    PubMed Central

    Jia, Cheng; Hu, Yu; Kelly, Derek; Kim, Junhyong

    2017-01-01

    Abstract Recent technological breakthroughs have made it possible to measure RNA expression at the single-cell level, thus paving the way for exploring expression heterogeneity among individual cells. Current single-cell RNA sequencing (scRNA-seq) protocols are complex and introduce technical biases that vary across cells, which can bias downstream analysis without proper adjustment. To account for cell-to-cell technical differences, we propose a statistical framework, TASC (Toolkit for Analysis of Single Cell RNA-seq), an empirical Bayes approach to reliably model the cell-specific dropout rates and amplification bias by use of external RNA spike-ins. TASC incorporates the technical parameters, which reflect cell-to-cell batch effects, into a hierarchical mixture model to estimate the biological variance of a gene and detect differentially expressed genes. More importantly, TASC is able to adjust for covariates to further eliminate confounding that may originate from cell size and cell cycle differences. In simulation and real scRNA-seq data, TASC achieves accurate Type I error control and displays competitive sensitivity and improved robustness to batch effects in differential expression analysis, compared to existing methods. TASC is programmed to be computationally efficient, taking advantage of multi-threaded parallelization. We believe that TASC will provide a robust platform for researchers to leverage the power of scRNA-seq. PMID:29036714

  10. Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming.

    PubMed

    Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben

    2015-07-14

    The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1-3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN).

  11. Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming

    PubMed Central

    Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben

    2015-01-01

    The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1–3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN). PMID:26172504

  12. PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3′ UTRs and coding sequences

    PubMed Central

    Šulc, Miroslav; Marín, Ray M.; Robins, Harlan S.; Vaníček, Jiří

    2015-01-01

    The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3′ untranslated regions (3′ UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3′ UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA–mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA–mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. PMID:25948580

  13. Novel approaches for bioinformatic analysis of salivary RNA sequencing data for development.

    PubMed

    Kaczor-Urbanowicz, Karolina Elzbieta; Kim, Yong; Li, Feng; Galeev, Timur; Kitchen, Rob R; Gerstein, Mark; Koyano, Kikuye; Jeong, Sung-Hee; Wang, Xiaoyan; Elashoff, David; Kang, So Young; Kim, Su Mi; Kim, Kyoung; Kim, Sung; Chia, David; Xiao, Xinshu; Rozowsky, Joel; Wong, David T W

    2018-01-01

    Analysis of RNA sequencing (RNA-Seq) data in human saliva is challenging. Lack of standardization and unification of the bioinformatic procedures undermines saliva's diagnostic potential. Thus, it motivated us to perform this study. We applied principal pipelines for bioinformatic analysis of small RNA-Seq data of saliva of 98 healthy Korean volunteers including either direct or indirect mapping of the reads to the human genome using Bowtie1. Analysis of alignments to exogenous genomes by another pipeline revealed that almost all of the reads map to bacterial genomes. Thus, salivary exRNA has fundamental properties that warrant the design of unique additional steps while performing the bioinformatic analysis. Our pipelines can serve as potential guidelines for processing of RNA-Seq data of human saliva. Processing and analysis results of the experimental data generated by the exceRpt (v4.6.3) small RNA-seq pipeline (github.gersteinlab.org/exceRpt) are available from exRNA atlas (exrna-atlas.org). Alignment to exogenous genomes and their quantification results were used in this paper for the analyses of small RNAs of exogenous origin. dtww@ucla.edu. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  14. Global transcriptional start site mapping using differential RNA sequencing reveals novel antisense RNAs in Escherichia coli.

    PubMed

    Thomason, Maureen K; Bischler, Thorsten; Eisenbart, Sara K; Förstner, Konrad U; Zhang, Aixia; Herbig, Alexander; Nieselt, Kay; Sharma, Cynthia M; Storz, Gisela

    2015-01-01

    While the model organism Escherichia coli has been the subject of intense study for decades, the full complement of its RNAs is only now being examined. Here we describe a survey of the E. coli transcriptome carried out using a differential RNA sequencing (dRNA-seq) approach, which can distinguish between primary and processed transcripts, and an automated prediction algorithm for transcriptional start sites (TSS). With the criterion of expression under at least one of three growth conditions examined, we predicted 14,868 TSS candidates, including 5,574 internal to annotated genes (iTSS) and 5,495 TSS corresponding to potential antisense RNAs (asRNAs). We examined expression of 14 candidate asRNAs by Northern analysis using RNA from wild-type E. coli and from strains defective for RNases III and E, two RNases reported to be involved in asRNA processing. Interestingly, nine asRNAs detected as distinct bands by Northern analysis were differentially affected by the rnc and rne mutations. We also compared our asRNA candidates with previously published asRNA annotations from RNA-seq data and discuss the challenges associated with these cross-comparisons. Our global transcriptional start site map represents a valuable resource for identification of transcription start sites, promoters, and novel transcripts in E. coli and is easily accessible, together with the cDNA coverage plots, in an online genome browser. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. Global Transcriptional Start Site Mapping Using Differential RNA Sequencing Reveals Novel Antisense RNAs in Escherichia coli

    PubMed Central

    Thomason, Maureen K.; Bischler, Thorsten; Eisenbart, Sara K.; Förstner, Konrad U.; Zhang, Aixia; Herbig, Alexander; Nieselt, Kay

    2014-01-01

    While the model organism Escherichia coli has been the subject of intense study for decades, the full complement of its RNAs is only now being examined. Here we describe a survey of the E. coli transcriptome carried out using a differential RNA sequencing (dRNA-seq) approach, which can distinguish between primary and processed transcripts, and an automated prediction algorithm for transcriptional start sites (TSS). With the criterion of expression under at least one of three growth conditions examined, we predicted 14,868 TSS candidates, including 5,574 internal to annotated genes (iTSS) and 5,495 TSS corresponding to potential antisense RNAs (asRNAs). We examined expression of 14 candidate asRNAs by Northern analysis using RNA from wild-type E. coli and from strains defective for RNases III and E, two RNases reported to be involved in asRNA processing. Interestingly, nine asRNAs detected as distinct bands by Northern analysis were differentially affected by the rnc and rne mutations. We also compared our asRNA candidates with previously published asRNA annotations from RNA-seq data and discuss the challenges associated with these cross-comparisons. Our global transcriptional start site map represents a valuable resource for identification of transcription start sites, promoters, and novel transcripts in E. coli and is easily accessible, together with the cDNA coverage plots, in an online genome browser. PMID:25266388

  16. Evaluation of commercial DNA and RNA extraction methods for high-throughput sequencing of FFPE samples.

    PubMed

    Kresse, Stine H; Namløs, Heidi M; Lorenz, Susanne; Berner, Jeanne-Marie; Myklebost, Ola; Bjerkehagen, Bodil; Meza-Zepeda, Leonardo A

    2018-01-01

    Nucleic acid material of adequate quality is crucial for successful high-throughput sequencing (HTS) analysis. DNA and RNA isolated from archival FFPE material are frequently degraded and not readily amplifiable due to chemical damage introduced during fixation. To identify optimal nucleic acid extraction kits, DNA and RNA quantity, quality and performance in HTS applications were evaluated. DNA and RNA were isolated from five sarcoma archival FFPE blocks, using eight extraction protocols from seven kits from three different commercial vendors. For DNA extraction, the truXTRAC FFPE DNA kit from Covaris gave higher yields and better amplifiable DNA, but all protocols gave comparable HTS library yields using Agilent SureSelect XT and performed well in downstream variant calling. For RNA extraction, all protocols gave comparable yields and amplifiable RNA. However, for fusion gene detection using the Archer FusionPlex Sarcoma Assay, the truXTRAC FFPE RNA kit from Covaris and Agencourt FormaPure kit from Beckman Coulter showed the highest percentage of unique read-pairs, providing higher complexity of HTS data and more frequent detection of recurrent fusion genes. truXTRAC simultaneous DNA and RNA extraction gave similar outputs as individual protocols. These findings show that although successful HTS libraries could be generated in most cases, the different protocols gave variable quantity and quality for FFPE nucleic acid extraction. Selecting the optimal procedure is highly valuable and may generate results in borderline quality specimens.

  17. LncRNA Expression Profile of Human Thoracic Aortic Dissection by High-Throughput Sequencing.

    PubMed

    Sun, Jie; Chen, Guojun; Jing, Yuanwen; He, Xiang; Dong, Jianting; Zheng, Junmeng; Zou, Meisheng; Li, Hairui; Wang, Shifei; Sun, Yili; Liao, Wangjun; Liao, Yulin; Feng, Li; Bin, Jianping

    2018-01-01

    In this study, the long non-coding RNA (lncRNA) expression profile in human thoracic aortic dissection (TAD), a highly lethal cardiovascular disease, was investigated. Human TAD (n=3) and normal aortic tissues (NA) (n=3) were examined by high-throughput sequencing. Bioinformatics analyses were performed to predict the roles of aberrantly expressed lncRNAs. Quantitative real-time polymerase chain reaction (qRT-PCR) was applied to validate the results. A total of 269 lncRNAs (159 up-regulated and 110 down-regulated) and 2, 255 mRNAs (1 294 up-regulated and 961 down-regulated) were aberrantly expressed in human TAD (fold-change> 1.5, P< 0.05). QRT-PCR results of five dysregulated genes were consistent with HTS data. A lncRNA-mRNA coexpression analysis showed positive correlations between the up-regulated lncRNA (ENSG00000269936) and its adjacent up-regulated mRNA (MAP2K6, R=0.940, P< 0.01), and between the down-regulated lncRNA_1421 and its down-regulated mRNAs (FBLN5, R=0.950, P< 0.01; ACTA2, R=0.96, P< 0.01; TIMP3, R=0.96, P< 0.05). The lncRNA-miRNA-mRNA network indicated that the up-regulated lncRNA XIST and p21 had similar sequences targeted by has-miR-17-5p. The results of luciferase assay and fluorescence immuno-cytochemistry were consistent with that. And qRT-PCR results showed that lncRNA XIST and p21 were expressed at a higher level and has-miR-17-5p was expressed at a lower level in TAD than in NA. The predicted binding motifs of three up-regulated lncRNAs (ENSG00000248508, ENSG00000226530, and EG00000259719) were correlated with up-regulated RUNX1 (R=0.982, P< 0.001; R=0.967, P< 0.01; R=0.960, P< 0.01, respectively). Our study revealed a set of dysregulated lncRNAs and predicted their multiple potential functions in human TAD. These findings suggest that lncRNAs are novel potential therapeutic targets for human TAD. © 2018 The Author(s). Published by S. Karger AG, Basel.

  18. How to Tackle the Challenge of siRNA Delivery with Sequence-Defined Oligoamino Amides.

    PubMed

    Reinhard, Sören; Wagner, Ernst

    2017-01-01

    RNA interference (RNAi) as a mechanism of gene regulation provides exciting opportunities for medical applications. Synthetic small interfering RNA (siRNA) triggers the knockdown of complementary mRNA sequences in a catalytic fashion and has to be delivered into the cytosol of the targeted cells. The design of adequate carrier systems to overcome multiple extracellular and intracellular roadblocks within the delivery process has utmost importance. Cationic polymers form polyplexes through electrostatic interaction with negatively charged nucleic acids and present a promising class of carriers. Issues of polycations regarding toxicity, heterogeneity, and polydispersity can be overcome by solid-phase-assisted synthesis of sequence-defined cationic oligomers. These medium-sized highly versatile nucleic acid carriers display low cytotoxicity and can be modified and tailored in multiple ways to meet specific requirements of nucleic acid binding, polyplex size, shielding, targeting, and intracellular release of the cargo. In this way, sequence-defined cationic oligomers can mimic the dynamic and bioresponsive behavior of viruses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Structural Analysis of Single-Point Mutations Given an RNA Sequence: A Case Study with RNAMute

    NASA Astrophysics Data System (ADS)

    Churkin, Alexander; Barash, Danny

    2006-12-01

    We introduce here for the first time the RNAMute package, a pattern-recognition-based utility to perform mutational analysis and detect vulnerable spots within an RNA sequence that affect structure. Mutations in these spots may lead to a structural change that directly relates to a change in functionality. Previously, the concept was tried on RNA genetic control elements called "riboswitches" and other known RNA switches, without an organized utility that analyzes all single-point mutations and can be further expanded. The RNAMute package allows a comprehensive categorization, given an RNA sequence that has functional relevance, by exploring the patterns of all single-point mutants. For illustration, we apply the RNAMute package on an RNA transcript for which individual point mutations were shown experimentally to inactivate spectinomycin resistance in Escherichia coli. Functional analysis of mutations on this case study was performed experimentally by creating a library of point mutations using PCR and screening to locate those mutations. With the availability of RNAMute, preanalysis can be performed computationally before conducting an experiment.

  20. SHAPE Selection (SHAPES) enrich for RNA structure signal in SHAPE sequencing-based probing data

    PubMed Central

    Poulsen, Line Dahl; Kielpinski, Lukasz Jan; Salama, Sofie R.; Krogh, Anders; Vinther, Jeppe

    2015-01-01

    Selective 2′ Hydroxyl Acylation analyzed by Primer Extension (SHAPE) is an accurate method for probing of RNA secondary structure. In existing SHAPE methods, the SHAPE probing signal is normalized to a no-reagent control to correct for the background caused by premature termination of the reverse transcriptase. Here, we introduce a SHAPE Selection (SHAPES) reagent, N-propanone isatoic anhydride (NPIA), which retains the ability of SHAPE reagents to accurately probe RNA structure, but also allows covalent coupling between the SHAPES reagent and a biotin molecule. We demonstrate that SHAPES-based selection of cDNA–RNA hybrids on streptavidin beads effectively removes the large majority of background signal present in SHAPE probing data and that sequencing-based SHAPES data contain the same amount of RNA structure data as regular sequencing-based SHAPE data obtained through normalization to a no-reagent control. Moreover, the selection efficiently enriches for probed RNAs, suggesting that the SHAPES strategy will be useful for applications with high-background and low-probing signal such as in vivo RNA structure probing. PMID:25805860

  1. Single-cell mRNA cytometry via sequence-specific nanoparticle clustering and trapping

    NASA Astrophysics Data System (ADS)

    Labib, Mahmoud; Mohamadi, Reza M.; Poudineh, Mahla; Ahmed, Sharif U.; Ivanov, Ivaylo; Huang, Ching-Lung; Moosavi, Maral; Sargent, Edward H.; Kelley, Shana O.

    2018-05-01

    Cell-to-cell variation in gene expression creates a need for techniques that can characterize expression at the level of individual cells. This is particularly true for rare circulating tumour cells, in which subtyping and drug resistance are of intense interest. Here we describe a method for cell analysis—single-cell mRNA cytometry—that enables the isolation of rare cells from whole blood as a function of target mRNA sequences. This approach uses two classes of magnetic particles that are labelled to selectively hybridize with different regions of the target mRNA. Hybridization leads to the formation of large magnetic clusters that remain localized within the cells of interest, thereby enabling the cells to be magnetically separated. Targeting specific intracellular mRNAs enablescirculating tumour cells to be distinguished from normal haematopoietic cells. No polymerase chain reaction amplification is required to determine RNA expression levels and genotype at the single-cell level, and minimal cell manipulation is required. To demonstrate this approach we use single-cell mRNA cytometry to detect clinically important sequences in prostate cancer specimens.

  2. Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer.

    PubMed

    Wojcik, Sylwia E; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z; Rai, Kanti R; Kipps, Thomas J; Keating, Michael J; Croce, Carlo M; Calin, George A

    2010-02-01

    Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas.

  3. Three Cases of Anaerobiospirillum succiniciproducens Bacteremia Confirmed by 16S rRNA Gene Sequencing

    PubMed Central

    Tee, Wee; Korman, Tony M.; Waters, Mary Jo; Macphee, Andrew; Jenney, Adam; Joyce, Linda; Dyall-Smith, Michael L.

    1998-01-01

    We describe three cases of Anaerobiospirillum succiniciproducens bacteremia from Australia. We believe one of these cases represents the first report of A. succiniciproducens bacteremia in a human immunodeficiency virus (HIV)-infected individual. The other two patients had an underlying disorder (one patient had bleeding esophageal varices complicating alcohol liver disease and one patient had non-Hodgkin’s lymphoma). A motile, gram-negative, spiral anaerobe was isolated by culturing blood from all patients. Electron microscopy showed a curved bacterium with bipolar tufts of flagella resembling Anaerobiospirillum spp. Sequencing of the 16S rRNA genes of the isolates revealed no close relatives (organisms likely to be in the same genus) in the sequence databases, nor were any sequence data available for A. succiniciproducens. This report presents for the first time the 16S rRNA gene sequence of the type strain of A. succiniciproducens, strain ATCC 29305. Two of the three clinical isolates have sequences identical to that of the type strain, while the sequence of the other strain differs from that of the type strain at 4 nucleotides. PMID:9574678

  4. zUMIs - A fast and flexible pipeline to process RNA sequencing data with UMIs.

    PubMed

    Parekh, Swati; Ziegenhain, Christoph; Vieth, Beate; Enard, Wolfgang; Hellmann, Ines

    2018-06-01

    Single-cell RNA-sequencing (scRNA-seq) experiments typically analyze hundreds or thousands of cells after amplification of the cDNA. The high throughput is made possible by the early introduction of sample-specific bar codes (BCs), and the amplification bias is alleviated by unique molecular identifiers (UMIs). Thus, the ideal analysis pipeline for scRNA-seq data needs to efficiently tabulate reads according to both BC and UMI. zUMIs is a pipeline that can handle both known and random BCs and also efficiently collapse UMIs, either just for exon mapping reads or for both exon and intron mapping reads. If BC annotation is missing, zUMIs can accurately detect intact cells from the distribution of sequencing reads. Another unique feature of zUMIs is the adaptive downsampling function that facilitates dealing with hugely varying library sizes but also allows the user to evaluate whether the library has been sequenced to saturation. To illustrate the utility of zUMIs, we analyzed a single-nucleus RNA-seq dataset and show that more than 35% of all reads map to introns. Also, we show that these intronic reads are informative about expression levels, significantly increasing the number of detected genes and improving the cluster resolution. zUMIs flexibility makes if possible to accommodate data generated with any of the major scRNA-seq protocols that use BCs and UMIs and is the most feature-rich, fast, and user-friendly pipeline to process such scRNA-seq data.

  5. High throughput 16SrRNA gene sequencing reveals the correlation between Propionibacterium acnes and sarcoidosis.

    PubMed

    Zhao, Meng-Meng; Du, Shan-Shan; Li, Qiu-Hong; Chen, Tao; Qiu, Hui; Wu, Qin; Chen, Shan-Shan; Zhou, Ying; Zhang, Yuan; Hu, Yang; Su, Yi-Liang; Shen, Li; Zhang, Fen; Weng, Dong; Li, Hui-Ping

    2017-02-01

    This study aims to use high throughput 16SrRNA gene sequencing to examine the bacterial profile of lymph node biopsy samples of patients with sarcoidosis and to further verify the association between Propionibacterium acnes (P. acnes) and sarcoidosis. A total of 36 mediastinal lymph node biopsy specimens were collected from 17 cases of sarcoidosis, 8 tuberculosis (TB group), and 11 non-infectious lung diseases (control group). The V4 region of the bacterial 16SrRNA gene in the specimens was amplified and sequenced using the high throughput sequencing platform MiSeq, and bacterial profile was established. The data analysis software QIIME and Metastats were used to compare bacterial relative abundance in the three patient groups. Overall, 545 genera were identified; 38 showed significantly lower and 29 had significantly higher relative abundance in the sarcoidosis group than in the TB and control groups (P < 0.01). P. acnes 16SrRNA was exclusively found in all the 17 samples of the sarcoidosis group, whereas was not detected in the TB and control groups. The relative abundance of P. acnes in the sarcoidosis group (0.16% ± 0. 11%) was significantly higher than that in the TB (Metastats analysis: P = 0.0010, q = 0.0044) and control groups (Metastats analysis: P = 0.0010, q = 0.0038). The relative abundance of P. granulosum was only 0.0022% ± 0. 0044% in the sarcoidosis group. P. granulosum 16SrRNA was not detected in the other two groups. High throughput 16SrRNA gene sequencing appears to be a useful tool to investigate the bacterial profile of sarcoidosis specimens. The results suggest that P. acnes may be involved in sarcoidosis development.

  6. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    PubMed

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  7. Gene expression and splicing alterations analyzed by high throughput RNA sequencing of chronic lymphocytic leukemia specimens.

    PubMed

    Liao, Wei; Jordaan, Gwen; Nham, Phillipp; Phan, Ryan T; Pelegrini, Matteo; Sharma, Sanjai

    2015-10-16

    To determine differentially expressed and spliced RNA transcripts in chronic lymphocytic leukemia specimens a high throughput RNA-sequencing (HTS RNA-seq) analysis was performed. Ten CLL specimens and five normal peripheral blood CD19+ B cells were analyzed by HTS RNA-seq. The library preparation was performed with Illumina TrueSeq RNA kit and analyzed by Illumina HiSeq 2000 sequencing system. An average of 48.5 million reads for B cells, and 50.6 million reads for CLL specimens were obtained with 10396 and 10448 assembled transcripts for normal B cells and primary CLL specimens respectively. With the Cuffdiff analysis, 2091 differentially expressed genes (DEG) between B cells and CLL specimens based on FPKM (fragments per kilobase of transcript per million reads and false discovery rate, FDR q < 0.05, fold change >2) were identified. Expression of selected DEGs (n = 32) with up regulated and down regulated expression in CLL from RNA-seq data were also analyzed by qRT-PCR in a test cohort of CLL specimens. Even though there was a variation in fold expression of DEG genes between RNA-seq and qRT-PCR; more than 90 % of analyzed genes were validated by qRT-PCR analysis. Analysis of RNA-seq data for splicing alterations in CLL and B cells was performed by Multivariate Analysis of Transcript Splicing (MATS analysis). Skipped exon was the most frequent splicing alteration in CLL specimens with 128 significant events (P-value <0.05, minimum inclusion level difference >0.1). The RNA-seq analysis of CLL specimens identifies novel DEG and alternatively spliced genes that are potential prognostic markers and therapeutic targets. High level of validation by qRT-PCR for a number of DEG genes supports the accuracy of this analysis. Global comparison of transcriptomes of B cells, IGVH non-mutated CLL (U-CLL) and mutated CLL specimens (M-CLL) with multidimensional scaling analysis was able to segregate CLL and B cell transcriptomes but the M-CLL and U-CLL transcriptomes

  8. RNA regulators responding to ribosomal protein S15 are frequent in sequence space

    PubMed Central

    Slinger, Betty L.; Meyer, Michelle M.

    2016-01-01

    There are several natural examples of distinct RNA structures that interact with the same ligand to regulate the expression of homologous genes in different organisms. One essential question regarding this phenomenon is whether such RNA regulators are the result of convergent or divergent evolution. Are the RNAs derived from some common ancestor and diverged to the point where we cannot identify the similarity, or have multiple solutions to the same biological problem arisen independently? A key variable in assessing these alternatives is how frequently such regulators arise within sequence space. Ribosomal protein S15 is autogenously regulated via an RNA regulator in many bacterial species; four apparently distinct regulators have been functionally validated in different bacterial phyla. Here, we explore how frequently such regulators arise within a partially randomized sequence population. We find many RNAs that interact specifically with ribosomal protein S15 from Geobacillus kaustophilus with biologically relevant dissociation constants. Furthermore, of the six sequences we characterize, four show regulatory activity in an Escherichia coli reporter assay. Subsequent footprinting and mutagenesis analysis indicates that protein binding proximal to regulatory features such as the Shine–Dalgarno sequence is sufficient to enable regulation, suggesting that regulation in response to S15 is relatively easily acquired. PMID:27580716

  9. tRNADB-CE: tRNA gene database well-timed in the era of big sequence data.

    PubMed

    Abe, Takashi; Inokuchi, Hachiro; Yamada, Yuko; Muto, Akira; Iwasaki, Yuki; Ikemura, Toshimichi

    2014-01-01

    The tRNA gene data base curated by experts "tRNADB-CE" (http://trna.ie.niigata-u.ac.jp) was constructed by analyzing 1,966 complete and 5,272 draft genomes of prokaryotes, 171 viruses', 121 chloroplasts', and 12 eukaryotes' genomes plus fragment sequences obtained by metagenome studies of environmental samples. 595,115 tRNA genes in total, and thus two times of genes compiled previously, have been registered, for which sequence, clover-leaf structure, and results of sequence-similarity and oligonucleotide-pattern searches can be browsed. To provide collective knowledge with help from experts in tRNA researches, we added a column for enregistering comments to each tRNA. By grouping bacterial tRNAs with an identical sequence, we have found high phylogenetic preservation of tRNA sequences, especially at the phylum level. Since many species-unknown tRNAs from metagenomic sequences have sequences identical to those found in species-known prokaryotes, the identical sequence group (ISG) can provide phylogenetic markers to investigate the microbial community in an environmental ecosystem. This strategy can be applied to a huge amount of short sequences obtained from next-generation sequencers, as showing that tRNADB-CE is a well-timed database in the era of big sequence data. It is also discussed that batch-learning self-organizing-map with oligonucleotide composition is useful for efficient knowledge discovery from big sequence data.

  10. Sequence-based heuristics for faster annotation of non-coding RNA families.

    PubMed

    Weinberg, Zasha; Ruzzo, Walter L

    2006-01-01

    Non-coding RNAs (ncRNAs) are functional RNA molecules that do not code for proteins. Covariance Models (CMs) are a useful statistical tool to find new members of an ncRNA gene family in a large genome database, using both sequence and, importantly, RNA secondary structure information. Unfortunately, CM searches are extremely slow. Previously, we created rigorous filters, which provably sacrifice none of a CM's accuracy, while making searches significantly faster for virtually all ncRNA families. However, these rigorous filters make searches slower than heuristics could be. In this paper we introduce profile HMM-based heuristic filters. We show that their accuracy is usually superior to heuristics based on BLAST. Moreover, we compared our heuristics with those used in tRNAscan-SE, whose heuristics incorporate a significant amount of work specific to tRNAs, where our heuristics are generic to any ncRNA. Performance was roughly comparable, so we expect that our heuristics provide a high-quality solution that--unlike family-specific solutions--can scale to hundreds of ncRNA families. The source code is available under GNU Public License at the supplementary web site.

  11. visnormsc: A Graphical User Interface to Normalize Single-cell RNA Sequencing Data.

    PubMed

    Tang, Lijun; Zhou, Nan

    2017-12-26

    Single-cell RNA sequencing (RNA-seq) allows the analysis of gene expression with high resolution. The intrinsic defects of this promising technology imports technical noise into the single-cell RNA-seq data, increasing the difficulty of accurate downstream inference. Normalization is a crucial step in single-cell RNA-seq data pre-processing. SCnorm is an accurate and efficient method that can be used for this purpose. An R implementation of this method is currently available. On one hand, the R package possesses many excellent features from R. On the other hand, R programming ability is required, which prevents the biologists who lack the skills from learning to use it quickly. To make this method more user-friendly, we developed a graphical user interface, visnormsc, for normalization of single-cell RNA-seq data. It is implemented in Python and is freely available at https://github.com/solo7773/visnormsc . Although visnormsc is based on the existing method, it contributes to this field by offering a user-friendly alternative. The out-of-the-box and cross-platform features make visnormsc easy to learn and to use. It is expected to serve biologists by simplifying single-cell RNA-seq normalization.

  12. Conserved Non-Coding Sequences are Associated with Rates of mRNA Decay in Arabidopsis.

    PubMed

    Spangler, Jacob B; Feltus, Frank Alex

    2013-01-01

    Steady-state mRNA levels are tightly regulated through a combination of transcriptional and post-transcriptional control mechanisms. The discovery of cis-acting DNA elements that encode these control mechanisms is of high importance. We have investigated the influence of conserved non-coding sequences (CNSs), DNA patterns retained after an ancient whole genome duplication event, on the breadth of gene expression and the rates of mRNA decay in Arabidopsis thaliana. The absence of CNSs near α duplicate genes was associated with a decrease in breadth of gene expression and slower mRNA decay rates while the presence CNSs near α duplicates was associated with an increase in breadth of gene expression and faster mRNA decay rates. The observed difference in mRNA decay rate was fastest in genes with CNSs in both non-transcribed and transcribed regions, albeit through an unknown mechanism. This study supports the notion that some Arabidopsis CNSs regulate the steady-state mRNA levels through post-transcriptional control mechanisms and that CNSs also play a role in controlling the breadth of gene expression.

  13. Conserved Non-Coding Sequences are Associated with Rates of mRNA Decay in Arabidopsis

    PubMed Central

    Spangler, Jacob B.; Feltus, Frank Alex

    2013-01-01

    Steady-state mRNA levels are tightly regulated through a combination of transcriptional and post-transcriptional control mechanisms. The discovery of cis-acting DNA elements that encode these control mechanisms is of high importance. We have investigated the influence of conserved non-coding sequences (CNSs), DNA patterns retained after an ancient whole genome duplication event, on the breadth of gene expression and the rates of mRNA decay in Arabidopsis thaliana. The absence of CNSs near α duplicate genes was associated with a decrease in breadth of gene expression and slower mRNA decay rates while the presence CNSs near α duplicates was associated with an increase in breadth of gene expression and faster mRNA decay rates. The observed difference in mRNA decay rate was fastest in genes with CNSs in both non-transcribed and transcribed regions, albeit through an unknown mechanism. This study supports the notion that some Arabidopsis CNSs regulate the steady-state mRNA levels through post-transcriptional control mechanisms and that CNSs also play a role in controlling the breadth of gene expression. PMID:23675377

  14. DrImpute: imputing dropout events in single cell RNA sequencing data.

    PubMed

    Gong, Wuming; Kwak, Il-Youp; Pota, Pruthvi; Koyano-Nakagawa, Naoko; Garry, Daniel J

    2018-06-08

    The single cell RNA sequencing (scRNA-seq) technique begin a new era by allowing the observation of gene expression at the single cell level. However, there is also a large amount of technical and biological noise. Because of the low number of RNA transcriptomes and the stochastic nature of the gene expression pattern, there is a high chance of missing nonzero entries as zero, which are called dropout events. We develop DrImpute to impute dropout events in scRNA-seq data. We show that DrImpute has significantly better performance on the separation of the dropout zeros from true zeros than existing imputation algorithms. We also demonstrate that DrImpute can significantly improve the performance of existing tools for clustering, visualization and lineage reconstruction of nine published scRNA-seq datasets. DrImpute can serve as a very useful addition to the currently existing statistical tools for single cell RNA-seq analysis. DrImpute is implemented in R and is available at https://github.com/gongx030/DrImpute .

  15. Small tandemly repeated DNA sequences of higher plants likely originate from a tRNA gene ancestor.

    PubMed Central

    Benslimane, A A; Dron, M; Hartmann, C; Rode, A

    1986-01-01

    Several monomers (177 bp) of a tandemly arranged repetitive nuclear DNA sequence of Brassica oleracea have been cloned and sequenced. They share up to 95% homology between one another and up to 80% with other satellite DNA sequences of Cruciferae, suggesting a common ancestor. Both strands of these monomers show more than 50% homology with many tRNA genes; the best homologies have been obtained with Lys and His yeast mitochondrial tRNA genes (respectively 64% and 60%). These results suggest that small tandemly repeated DNA sequences of plants may have evolved from a tRNA gene ancestor. These tandem repeats have probably arisen via a process involving reverse transcription of polymerase III RNA intermediates, as is the case for interspersed DNA sequences of mammalians. A model is proposed to explain the formation of such small tandemly repeated DNA sequences. Images PMID:3774553

  16. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  17. Two distinct extracellular RNA signatures released by a single cell type identified by microarray and next-generation sequencing

    PubMed Central

    Lässer, Cecilia; Shelke, Ganesh Vilas; Yeri, Ashish; Kim, Dae-Kyum; Crescitelli, Rossella; Raimondo, Stefania; Sjöstrand, Margareta; Gho, Yong Song; Van Keuren Jensen, Kendall; Lötvall, Jan

    2017-01-01

    ABSTRACT Cells secrete extracellular RNA (exRNA) to their surrounding environment and exRNA has been found in many body fluids such as blood, breast milk and cerebrospinal fluid. However, there are conflicting results regarding the nature of exRNA. Here, we have separated 2 distinct exRNA profiles released by mast cells, here termed high-density (HD) and low-density (LD) exRNA. The exRNA in both fractions was characterized by microarray and next-generation sequencing. Both exRNA fractions contained mRNA and miRNA, and the mRNAs in the LD exRNA correlated closely with the cellular mRNA, whereas the HD mRNA did not. Furthermore, the HD exRNA was enriched in lincRNA, antisense RNA, vault RNA, snoRNA, and snRNA with little or no evidence of full-length 18S and 28S rRNA. The LD exRNA was enriched in mitochondrial rRNA, mitochondrial tRNA, tRNA, piRNA, Y RNA, and full-length 18S and 28S rRNA. The proteomes of the HD and LD exRNA-containing fractions were determined with LC-MS/MS and analyzed with Gene Ontology term finder, which showed that both proteomes were associated with the term extracellular vesicles and electron microscopy suggests that at least a part of the exRNA is associated with exosome-like extracellular vesicles. Additionally, the proteins in the HD fractions tended to be associated with the nucleus and ribosomes, whereas the LD fraction proteome tended to be associated with the mitochondrion. We show that the 2 exRNA signatures released by a single cell type can be separated by floatation on a density gradient. These results show that cells can release multiple types of exRNA with substantial differences in RNA species content. This is important for any future studies determining the nature and function of exRNA released from different cells under different conditions. PMID:27791479

  18. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  19. An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5′ UTRs and its implications for eukaryotic gene translation regulation

    PubMed Central

    Pánek, Josef; Kolář, Michal; Vohradský, Jiří; Shivaya Valášek, Leoš

    2013-01-01

    There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA–rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5′ untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5′ UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5′ UTRs of mRNAs. PMID:23804757

  20. Determining RNA quality for NextGen sequencing: some exceptions to the gold standard rule of 23S to 16S rRNA ratio

    USDA-ARS?s Scientific Manuscript database

    Using next-generation-sequencing technology to assess entire transcriptomes requires high quality starting RNA. Currently, RNA quality is routinely judged using automated microfluidic gel electrophoresis platforms and associated algorithms. Here we report that such automated methods generate false-n...

  1. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

    PubMed

    Hammond, R W; Crosslin, J M

    1995-04-01

    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  2. The nucleotide sequence of a major glycine transfer RNA from the posterior silk gland of Bombyx mori L.

    PubMed Central

    Zúñiga, M C; Steitz, J A

    1977-01-01

    The nucleotide sequence of tRNA1Gly isolated from the posterior silk gland of Bombyx mori has been determined. This transfer RNA is present in high amounts in the posterior silk gland during the fifth larval instar. It has a GCC anticodon, capable of decoding a major glycine codon in the fibroin messenger RNA, GGU. Structural features of Bombyx tRNA1Gly and its homology to other eukaryotic glycine tRNAs are discussed. Images PMID:414206

  3. ssHMM: extracting intuitive sequence-structure motifs from high-throughput RNA-binding protein data

    PubMed Central

    Krestel, Ralf; Ohler, Uwe; Vingron, Martin; Marsico, Annalisa

    2017-01-01

    Abstract RNA-binding proteins (RBPs) play an important role in RNA post-transcriptional regulation and recognize target RNAs via sequence-structure motifs. The extent to which RNA structure influences protein binding in the presence or absence of a sequence motif is still poorly understood. Existing RNA motif finders either take the structure of the RNA only partially into account, or employ models which are not directly interpretable as sequence-structure motifs. We developed ssHMM, an RNA motif finder based on a hidden Markov model (HMM) and Gibbs sampling which fully captures the relationship between RNA sequence and secondary structure preference of a given RBP. Compared to previous methods which output separate logos for sequence and structure, it directly produces a combined sequence-structure motif when trained on a large set of sequences. ssHMM’s model is visualized intuitively as a graph and facilitates biological interpretation. ssHMM can be used to find novel bona fide sequence-structure motifs of uncharacterized RBPs, such as the one presented here for the YY1 protein. ssHMM reaches a high motif recovery rate on synthetic data, it recovers known RBP motifs from CLIP-Seq data, and scales linearly on the input size, being considerably faster than MEMERIS and RNAcontext on large datasets while being on par with GraphProt. It is freely available on Github and as a Docker image. PMID:28977546

  4. Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

    SciTech Connect

    Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie

    2009-11-20

    RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR)more » shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.« less

  5. Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

    NASA Technical Reports Server (NTRS)

    Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1991-01-01

    Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

  6. JingleBells: A Repository of Immune-Related Single-Cell RNA-Sequencing Datasets.

    PubMed

    Ner-Gaon, Hadas; Melchior, Ariel; Golan, Nili; Ben-Haim, Yael; Shay, Tal

    2017-05-01

    Recent advances in single-cell RNA-sequencing (scRNA-seq) technology increase the understanding of immune differentiation and activation processes, as well as the heterogeneity of immune cell types. Although the number of available immune-related scRNA-seq datasets increases rapidly, their large size and various formats render them hard for the wider immunology community to use, and read-level data are practically inaccessible to the non-computational immunologist. To facilitate datasets reuse, we created the JingleBells repository for immune-related scRNA-seq datasets ready for analysis and visualization of reads at the single-cell level (http://jinglebells.bgu.ac.il/). To this end, we collected the raw data of publicly available immune-related scRNA-seq datasets, aligned the reads to the relevant genome, and saved aligned reads in a uniform format, annotated for cell of origin. We also added scripts and a step-by-step tutorial for visualizing each dataset at the single-cell level, through the commonly used Integrated Genome Viewer (www.broadinstitute.org/igv/). The uniform scRNA-seq format used in JingleBells can facilitate reuse of scRNA-seq data by computational biologists. It also enables immunologists who are interested in a specific gene to visualize the reads aligned to this gene to estimate cell-specific preferences for splicing, mutation load, or alleles. Thus JingleBells is a resource that will extend the usefulness of scRNA-seq datasets outside the programming aficionado realm. Copyright © 2017 by The American Association of Immunologists, Inc.

  7. Mapping specificity landscapes of RNA-protein interactions by high throughput sequencing.

    PubMed

    Jankowsky, Eckhard; Harris, Michael E

    2017-04-15

    To function in a biological setting, RNA binding proteins (RBPs) have to discriminate between alternative binding sites in RNAs. This discrimination can occur in the ground state of an RNA-protein binding reaction, in its transition state, or in both. The extent by which RBPs discriminate at these reaction states defines RBP specificity landscapes. Here, we describe the HiTS-Kin and HiTS-EQ techniques, which combine kinetic and equilibrium binding experiments with high throughput sequencing to quantitatively assess substrate discrimination for large numbers of substrate variants at ground and transition states of RNA-protein binding reactions. We discuss experimental design, practical considerations and data analysis and outline how a combination of HiTS-Kin and HiTS-EQ allows the mapping of RBP specificity landscapes. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. SIDR: simultaneous isolation and parallel sequencing of genomic DNA and total RNA from single cells.

    PubMed

    Han, Kyung Yeon; Kim, Kyu-Tae; Joung, Je-Gun; Son, Dae-Soon; Kim, Yeon Jeong; Jo, Areum; Jeon, Hyo-Jeong; Moon, Hui-Sung; Yoo, Chang Eun; Chung, Woosung; Eum, Hye Hyeon; Kim, Sangmin; Kim, Hong Kwan; Lee, Jeong Eon; Ahn, Myung-Ju; Lee, Hae-Ock; Park, Donghyun; Park, Woong-Yang

    2018-01-01

    Simultaneous sequencing of the genome and transcriptome at the single-cell level is a powerful tool for characterizing genomic and transcriptomic variation and revealing correlative relationships. However, it remains technically challenging to analyze both the genome and transcriptome in the same cell. Here, we report a novel method for simultaneous isolation of genomic DNA and total RNA (SIDR) from single cells, achieving high recovery rates with minimal cross-contamination, as is crucial for accurate description and integration of the single-cell genome and transcriptome. For reliable and efficient separation of genomic DNA and total RNA from single cells, the method uses hypotonic lysis to preserve nuclear lamina integrity and subsequently captures the cell lysate using antibody-conjugated magnetic microbeads. Evaluating the performance of this method using real-time PCR demonstrated that it efficiently recovered genomic DNA and total RNA. Thorough data quality assessments showed that DNA and RNA simultaneously fractionated by the SIDR method were suitable for genome and transcriptome sequencing analysis at the single-cell level. The integration of single-cell genome and transcriptome sequencing by SIDR (SIDR-seq) showed that genetic alterations, such as copy-number and single-nucleotide variations, were more accurately captured by single-cell SIDR-seq compared with conventional single-cell RNA-seq, although copy-number variations positively correlated with the corresponding gene expression levels. These results suggest that SIDR-seq is potentially a powerful tool to reveal genetic heterogeneity and phenotypic information inferred from gene expression patterns at the single-cell level. © 2018 Han et al.; Published by Cold Spring Harbor Laboratory Press.

  9. SIDR: simultaneous isolation and parallel sequencing of genomic DNA and total RNA from single cells

    PubMed Central

    Han, Kyung Yeon; Kim, Kyu-Tae; Joung, Je-Gun; Son, Dae-Soon; Kim, Yeon Jeong; Jo, Areum; Jeon, Hyo-Jeong; Moon, Hui-Sung; Yoo, Chang Eun; Chung, Woosung; Eum, Hye Hyeon; Kim, Sangmin; Kim, Hong Kwan; Lee, Jeong Eon; Ahn, Myung-Ju; Lee, Hae-Ock; Park, Donghyun; Park, Woong-Yang

    2018-01-01

    Simultaneous sequencing of the genome and transcriptome at the single-cell level is a powerful tool for characterizing genomic and transcriptomic variation and revealing correlative relationships. However, it remains technically challenging to analyze both the genome and transcriptome in the same cell. Here, we report a novel method for simultaneous isolation of genomic DNA and total RNA (SIDR) from single cells, achieving high recovery rates with minimal cross-contamination, as is crucial for accurate description and integration of the single-cell genome and transcriptome. For reliable and efficient separation of genomic DNA and total RNA from single cells, the method uses hypotonic lysis to preserve nuclear lamina integrity and subsequently captures the cell lysate using antibody-conjugated magnetic microbeads. Evaluating the performance of this method using real-time PCR demonstrated that it efficiently recovered genomic DNA and total RNA. Thorough data quality assessments showed that DNA and RNA simultaneously fractionated by the SIDR method were suitable for genome and transcriptome sequencing analysis at the single-cell level. The integration of single-cell genome and transcriptome sequencing by SIDR (SIDR-seq) showed that genetic alterations, such as copy-number and single-nucleotide variations, were more accurately captured by single-cell SIDR-seq compared with conventional single-cell RNA-seq, although copy-number variations positively correlated with the corresponding gene expression levels. These results suggest that SIDR-seq is potentially a powerful tool to reveal genetic heterogeneity and phenotypic information inferred from gene expression patterns at the single-cell level. PMID:29208629

  10. Suitability of partial 16S ribosomal RNA gene sequence analysis for the identification of dangerous bacterial pathogens.

    PubMed

    Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F

    2007-03-01

    In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.

  11. Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing

    PubMed Central

    Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

    2010-01-01

    Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome. PMID:20392818

  12. Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing.

    PubMed

    Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

    2010-08-01

    Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome.

  13. RNA-Mediated Gene Duplication and Retroposons: Retrogenes, LINEs, SINEs, and Sequence Specificity

    PubMed Central

    2013-01-01

    A substantial number of “retrogenes” that are derived from the mRNA of various intron-containing genes have been reported. A class of mammalian retroposons, long interspersed element-1 (LINE1, L1), has been shown to be involved in the reverse transcription of retrogenes (or processed pseudogenes) and non-autonomous short interspersed elements (SINEs). The 3′-end sequences of various SINEs originated from a corresponding LINE. As the 3′-untranslated regions of several LINEs are essential for retroposition, these LINEs presumably require “stringent” recognition of the 3′-end sequence of the RNA template. However, the 3′-ends of mammalian L1s do not exhibit any similarity to SINEs, except for the presence of 3′-poly(A) repeats. Since the 3′-poly(A) repeats of L1 and Alu SINE are critical for their retroposition, L1 probably recognizes the poly(A) repeats, thereby mobilizing not only Alu SINE but also cytosolic mRNA. Many flowering plants only harbor L1-clade LINEs and a significant number of SINEs with poly(A) repeats, but no homology to the LINEs. Moreover, processed pseudogenes have also been found in flowering plants. I propose that the ancestral L1-clade LINE in the common ancestor of green plants may have recognized a specific RNA template, with stringent recognition then becoming relaxed during the course of plant evolution. PMID:23984183

  14. Exploration of sequence space as the basis of viral RNA genome segmentation.

    PubMed

    Moreno, Elena; Ojosnegros, Samuel; García-Arriaza, Juan; Escarmís, Cristina; Domingo, Esteban; Perales, Celia

    2014-05-06

    The mechanisms of viral RNA genome segmentation are unknown. On extensive passage of foot-and-mouth disease virus in baby hamster kidney-21 cells, the virus accumulated multiple point mutations and underwent a transition akin to genome segmentation. The standard single RNA genome molecule was replaced by genomes harboring internal in-frame deletions affecting the L- or capsid-coding region. These genomes were infectious and killed cells by complementation. Here we show that the point mutations in the nonstructural protein-coding region (P2, P3) that accumulated in the standard genome before segmentation increased the relative fitness of the segmented version relative to the standard genome. Fitness increase was documented by intracellular expression of virus-coded proteins and infectious progeny production by RNAs with the internal deletions placed in the sequence context of the parental and evolved genome. The complementation activity involved several viral proteins, one of them being the leader proteinase L. Thus, a history of genetic drift with accumulation of point mutations was needed to allow a major variation in the structure of a viral genome. Thus, exploration of sequence space by a viral genome (in this case an unsegmented RNA) can reach a point of the space in which a totally different genome structure (in this case, a segmented RNA) is favored over the form that performed the exploration.

  15. High-Throughput Single-Cell RNA Sequencing and Data Analysis.

    PubMed

    Sagar; Herman, Josip Stefan; Pospisilik, John Andrew; Grün, Dominic

    2018-01-01

    Understanding biological systems at a single cell resolution may reveal several novel insights which remain masked by the conventional population-based techniques providing an average readout of the behavior of cells. Single-cell transcriptome sequencing holds the potential to identify novel cell types and characterize the cellular composition of any organ or tissue in health and disease. Here, we describe a customized high-throughput protocol for single-cell RNA-sequencing (scRNA-seq) combining flow cytometry and a nanoliter-scale robotic system. Since scRNA-seq requires amplification of a low amount of endogenous cellular RNA, leading to substantial technical noise in the dataset, downstream data filtering and analysis require special care. Therefore, we also briefly describe in-house state-of-the-art data analysis algorithms developed to identify cellular subpopulations including rare cell types as well as to derive lineage trees by ordering the identified subpopulations of cells along the inferred differentiation trajectories.

  16. Nucleotide sequence and phylogenetic analysis of Cucurbit yellow stunting disorder virus RNA 2.

    PubMed

    Livieratos, Ioannis C; Coutts, Robert H A

    2002-06-01

    The complete nucleotide sequence of Cucurbit yellow stunting disorder virus (CYSDV) RNA 2, a whitefly (Bemisia tabaci)-transmitted closterovirus with a bi-partite genome, is reported. CYSDV RNA 2 is 7,281 nucleotides long and contains the closterovirus hallmark gene array with a similar arrangement to the prototype member of the genus Crinivirus, Lettuce infectious yellows virus (LIYV). CYSDV RNA 2 contains open reading frames (ORFs) potentially encoding in a 5' to 3' direction for proteins of 5 kDa (ORF 1; hydrophobic protein), 62 kDa (ORF 2; heat shock protein 70 homolog, HSP70h), 59 kDa (ORF 3; protein of unknown function), 9 kDa (ORF 4; protein of unknown function), 28.5 kDa (ORF 5; coat protein, CP), 53 kDa (ORF 6; coat protein minor, CPm), and 26.5 kDa (ORF 7; protein of unknown function). Pairwise comparisons of CYSDV RNA 2-encoded proteins (HSP70h, p59 and CPm) among the closteroviruses showed that CYSDV is closely related to LIYV. Phylogenetic analysis based on the amino acid sequence of the HSP70h, indicated that CYSDV clusters with other members of the genus Crinivirus, and it is related to Little cherry virus-1 (LChV-1), but is distinct from the aphid- or mealybug-transmitted closteroviruses.

  17. Rtools: a web server for various secondary structural analyses on single RNA sequences.

    PubMed

    Hamada, Michiaki; Ono, Yukiteru; Kiryu, Hisanori; Sato, Kengo; Kato, Yuki; Fukunaga, Tsukasa; Mori, Ryota; Asai, Kiyoshi

    2016-07-08

    The secondary structures, as well as the nucleotide sequences, are the important features of RNA molecules to characterize their functions. According to the thermodynamic model, however, the probability of any secondary structure is very small. As a consequence, any tool to predict the secondary structures of RNAs has limited accuracy. On the other hand, there are a few tools to compensate the imperfect predictions by calculating and visualizing the secondary structural information from RNA sequences. It is desirable to obtain the rich information from those tools through a friendly interface. We implemented a web server of the tools to predict secondary structures and to calculate various structural features based on the energy models of secondary structures. By just giving an RNA sequence to the web server, the user can get the different types of solutions of the secondary structures, the marginal probabilities such as base-paring probabilities, loop probabilities and accessibilities of the local bases, the energy changes by arbitrary base mutations as well as the measures for validations of the predicted secondary structures. The web server is available at http://rtools.cbrc.jp, which integrates software tools, CentroidFold, CentroidHomfold, IPKnot, CapR, Raccess, Rchange and RintD. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Primer and platform effects on 16S rRNA tag sequencing

    SciTech Connect

    Tremblay, Julien; Singh, Kanwar; Fern, Alison

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  19. Primer and platform effects on 16S rRNA tag sequencing

    DOE PAGES

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  20. The siRNA Non-seed Region and Its Target Sequences Are Auxiliary Determinants of Off-Target Effects.

    PubMed

    Kamola, Piotr J; Nakano, Yuko; Takahashi, Tomoko; Wilson, Paul A; Ui-Tei, Kumiko

    2015-12-01

    RNA interference (RNAi) is a powerful tool for post-transcriptional gene silencing. However, the siRNA guide strand may bind unintended off-target transcripts via partial sequence complementarity by a mechanism closely mirroring micro RNA (miRNA) silencing. To better understand these off-target effects, we investigated the correlation between sequence features within various subsections of siRNA guide strands, and its corresponding target sequences, with off-target activities. Our results confirm previous reports that strength of base-pairing in the siRNA seed region is the primary factor determining the efficiency of off-target silencing. However, the degree of downregulation of off-target transcripts with shared seed sequence is not necessarily similar, suggesting that there are additional auxiliary factors that influence the silencing potential. Here, we demonstrate that both the melting temperature (Tm) in a subsection of siRNA non-seed region, and the GC contents of its corresponding target sequences, are negatively correlated with the efficiency of off-target effect. Analysis of experimentally validated miRNA targets demonstrated a similar trend, indicating a putative conserved mechanistic feature of seed region-dependent targeting mechanism. These observations may prove useful as parameters for off-target prediction algorithms and improve siRNA 'specificity' design rules.

  1. Utility of next-generation RNA-sequencing in identifying chimeric transcription involving human endogenous retroviruses.

    PubMed

    Sokol, Martin; Jessen, Karen Margrethe; Pedersen, Finn Skou

    2016-01-01

    Several studies have shown that human endogenous retroviruses and endogenous retrovirus-like repeats (here collectively HERVs) impose direct regulation on human genes through enhancer and promoter motifs present in their long terminal repeats (LTRs). Although chimeric transcription in which novel gene isoforms containing retroviral and human sequence are transcribed from viral promoters are commonly associated with disease, regulation by HERVs is beneficial in other settings; for example, in human testis chimeric isoforms of TP63 induced by an ERV9 LTR protect the male germ line upon DNA damage by inducing apoptosis, whereas in the human globin locus the γ- and β-globin switch during normal hematopoiesis is mediated by complex interactions of an ERV9 LTR and surrounding human sequence. The advent of deep sequencing or next-generation sequencing (NGS) has revolutionized the way researchers solve important scientific questions and develop novel hypotheses in relation to human genome regulation. We recently applied next-generation paired-end RNA-sequencing (RNA-seq) together with chromatin immunoprecipitation with sequencing (ChIP-seq) to examine ERV9 chimeric transcription in human reference cell lines from Encyclopedia of DNA Elements (ENCODE). This led to the discovery of advanced regulation mechanisms by ERV9s and other HERVs across numerous human loci including transcription of large gene-unannotated genomic regions, as well as cooperative regulation by multiple HERVs and non-LTR repeats such as Alu elements. In this article, well-established examples of human gene regulation by HERVs are reviewed followed by a description of paired-end RNA-seq, and its application in identifying chimeric transcription genome-widely. Based on integrative analyses of RNA-seq and ChIP-seq, data we then present novel examples of regulation by ERV9s of tumor suppressor genes CADM2 and SEMA3A, as well as transcription of an unannotated region. Taken together, this article highlights

  2. Identification and analysis of pig chimeric mRNAs using RNA sequencing data

    PubMed Central

    2012-01-01

    Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561

  3. SMARTIV: combined sequence and structure de-novo motif discovery for in-vivo RNA binding data.

    PubMed

    Polishchuk, Maya; Paz, Inbal; Yakhini, Zohar; Mandel-Gutfreund, Yael

    2018-05-25

    Gene expression regulation is highly dependent on binding of RNA-binding proteins (RBPs) to their RNA targets. Growing evidence supports the notion that both RNA primary sequence and its local secondary structure play a role in specific Protein-RNA recognition and binding. Despite the great advance in high-throughput experimental methods for identifying sequence targets of RBPs, predicting the specific sequence and structure binding preferences of RBPs remains a major challenge. We present a novel webserver, SMARTIV, designed for discovering and visualizing combined RNA sequence and structure motifs from high-throughput RNA-binding data, generated from in-vivo experiments. The uniqueness of SMARTIV is that it predicts motifs from enriched k-mers that combine information from ranked RNA sequences and their predicted secondary structure, obtained using various folding methods. Consequently, SMARTIV generates Position Weight Matrices (PWMs) in a combined sequence and structure alphabet with assigned P-values. SMARTIV concisely represents the sequence and structure motif content as a single graphical logo, which is informative and easy for visual perception. SMARTIV was examined extensively on a variety of high-throughput binding experiments for RBPs from different families, generated from different technologies, showing consistent and accurate results. Finally, SMARTIV is a user-friendly webserver, highly efficient in run-time and freely accessible via http://smartiv.technion.ac.il/.

  4. Combining micro-RNA and protein sequencing to detect robust biomarkers for Graves' disease and orbitopathy.

    PubMed

    Zhang, Lei; Masetti, Giulia; Colucci, Giuseppe; Salvi, Mario; Covelli, Danila; Eckstein, Anja; Kaiser, Ulrike; Draman, Mohd Shazli; Muller, Ilaria; Ludgate, Marian; Lucini, Luigi; Biscarini, Filippo

    2018-05-30

    Graves' Disease (GD) is an autoimmune condition in which thyroid-stimulating antibodies (TRAB) mimic thyroid-stimulating hormone function causing hyperthyroidism. 5% of GD patients develop inflammatory Graves' orbitopathy (GO) characterized by proptosis and attendant sight problems. A major challenge is to identify which GD patients are most likely to develop GO and has relied on TRAB measurement. We screened sera/plasma from 14 GD, 19 GO and 13 healthy controls using high-throughput proteomics and miRNA sequencing (Illumina's HiSeq2000 and Agilent-6550 Funnel quadrupole-time-of-flight mass spectrometry) to identify potential biomarkers for diagnosis or prognosis evaluation. Euclidean distances and differential expression (DE) based on miRNA and protein quantification were analysed by multidimensional scaling (MDS) and multinomial regression respectively. We detected 3025 miRNAs and 1886 proteins and MDS revealed good separation of the 3 groups. Biomarkers were identified by combined DE and Lasso-penalized predictive models; accuracy of predictions was 0.86 (±0:18), and 5 miRNA and 20 proteins were found including Zonulin, Alpha-2 macroglobulin, Beta-2 glycoprotein 1 and Fibronectin. Functional analysis identified relevant metabolic pathways, including hippo signaling, bacterial invasion of epithelial cells and mRNA surveillance. Proteomic and miRNA analyses, combined with robust bioinformatics, identified circulating biomarkers applicable to diagnose GD, predict GO disease status and optimize patient management.

  5. A highly efficient method for extracting next-generation sequencing quality RNA from adipose tissue of recalcitrant animal species.

    PubMed

    Sharma, Davinder; Golla, Naresh; Singh, Dheer; Onteru, Suneel K

    2018-03-01

    The next-generation sequencing (NGS) based RNA sequencing (RNA-Seq) and transcriptome profiling offers an opportunity to unveil complex biological processes. Successful RNA-Seq and transcriptome profiling requires a large amount of high-quality RNA. However, NGS-quality RNA isolation is extremely difficult from recalcitrant adipose tissue (AT) with high lipid content and low cell numbers. Further, the amount and biochemical composition of AT lipid varies depending upon the animal species which can pose different degree of resistance to RNA extraction. Currently available approaches may work effectively in one species but can be almost unproductive in another species. Herein, we report a two step protocol for the extraction of NGS quality RNA from AT across a broad range of animal species. © 2017 Wiley Periodicals, Inc.

  6. DNA and RNA sequencing by nanoscale reading through programmable electrophoresis and nanoelectrode-gated tunneling and dielectric detection

    DOEpatents

    Lee, James W.; Thundat, Thomas G.

    2005-06-14

    An apparatus and method for performing nucleic acid (DNA and/or RNA) sequencing on a single molecule. The genetic sequence information is obtained by probing through a DNA or RNA molecule base by base at nanometer scale as though looking through a strip of movie film. This DNA sequencing nanotechnology has the theoretical capability of performing DNA sequencing at a maximal rate of about 1,000,000 bases per second. This enhanced performance is made possible by a series of innovations including: novel applications of a fine-tuned nanometer gap for passage of a single DNA or RNA molecule; thin layer microfluidics for sample loading and delivery; and programmable electric fields for precise control of DNA or RNA movement. Detection methods include nanoelectrode-gated tunneling current measurements, dielectric molecular characterization, and atomic force microscopy/electrostatic force microscopy (AFM/EFM) probing for nanoscale reading of the nucleic acid sequences.

  7. Complete nucleotide sequences and genome characterization of a novel double-stranded RNA virus infecting Rosa multiflora.

    PubMed

    Salem, Nidá M; Golino, Deborah A; Falk, Bryce W; Rowhani, Adib

    2008-01-01

    The three double-stranded (ds) RNAs were detected in Rosa multiflora plants showing rose spring dwarf (RSD) symptoms. Northern blot analysis revealed three dsRNAs in preparations of both dsRNA and total RNA from R. multiflora plants. The complete sequences of the dsRNAs (referred to as dsRNA 1, dsRNA 2 and dsRNA 3) were determined based on a combination of shotgun cloning of dsRNA cDNAs and reverse transcription-polymerase chain reaction (RT-PCR). The largest dsRNA (dsRNA 1) was 1,762 bp long with a single open reading frame (ORF) that encoded a putative polypeptide containing 479 amino acid residues with a molecular mass of 55.9 kDa. This polypeptide contains amino acid sequence motifs conserved in the RNA-dependent RNA polymerases (RdRp) of members of the family Partitiviridae. Both dsRNA 2 (1,475 bp) and dsRNA 3 (1,384 bp) contained single ORFs, encoding putative proteins of unknown function. The 5' untranslated regions (UTR) of all three segments shared regions of high sequence homology. Phylogenetic analysis using the RdRp sequences of the various partitiviruses revealed that the new sequences would constitute the genome of a virus in family Partitiviridae. This virus would cluster with Fragaria chiloensis cryptic virus and Raphanus sativus cryptic virus 2. We suggest that the three dsRNA segments constitute the genome of a novel cryptic virus infecting roses; we propose the name Rosa multiflora cryptic virus (RMCV). Detection primers were developed and used for RT-PCR detection of RMCV in rose plants.

  8. The RNase P RNA from cyanobacteria: short tandemly repeated repetitive (STRR) sequences are present within the RNase P RNA gene in heterocyst-forming cyanobacteria.

    PubMed Central

    Vioque, A

    1997-01-01

    The RNase P RNA gene (rnpB) from 10 cyanobacteria has been characterized. These new RNAs, together with the previously available ones, provide a comprehensive data set of RNase P RNA from diverse cyanobacterial lineages. All heterocystous cyanobacteria, but none of the non-heterocystous strains analyzed, contain short tandemly repeated repetitive (STRR) sequences that increase the length of helix P12. Site-directed mutagenesis experiments indicate that the STRR sequences are not required for catalytic activity in vitro. STRR sequences seem to have recently and independently invaded the RNase P RNA genes in heterocyst-forming cyanobacteria because closely related strains contain unrelated STRR sequences. Most cyanobacteria RNase P RNAs lack the sequence GGU in the loop connecting helices P15 and P16 that has been established to interact with the 3'-end CCA in precursor tRNA substrates in other bacteria. This character is shared with plastid RNase P RNA. Helix P6 is longer than usual in most cyanobacteria as well as in plastid RNase P RNA. PMID:9254706

  9. Diversity, Distribution, and Evolution of Tomato Viruses in China Uncovered by Small RNA Sequencing.

    PubMed

    Xu, Chenxi; Sun, Xuepeng; Taylor, Angela; Jiao, Chen; Xu, Yimin; Cai, Xiaofeng; Wang, Xiaoli; Ge, Chenhui; Pan, Guanghui; Wang, Quanxi; Fei, Zhangjun; Wang, Quanhua

    2017-06-01

    Tomato is a major vegetable crop that has tremendous popularity. However, viral disease is still a major factor limiting tomato production. Here, we report the tomato virome identified through sequencing small RNAs of 170 field-grown samples collected in China. A total of 22 viruses were identified, including both well-documented and newly detected viruses. The tomato viral community is dominated by a few species, and they exhibit polymorphisms and recombination in the genomes with cold spots and hot spots. Most samples were coinfected by multiple viruses, and the majority of identified viruses are positive-sense single-stranded RNA viruses. Evolutionary analysis of one of the most dominant tomato viruses, Tomato yellow leaf curl virus (TYLCV), predicts its origin and the time back to its most recent common ancestor. The broadly sampled data have enabled us to identify several unreported viruses in tomato, including a completely new virus, which has a genome of ∼13.4 kb and groups with aphid-transmitted viruses in the genus Cytorhabdovirus Although both DNA and RNA viruses can trigger the biogenesis of virus-derived small interfering RNAs (vsiRNAs), we show that features such as length distribution, paired distance, and base selection bias of vsiRNA sequences reflect different plant Dicer-like proteins and Argonautes involved in vsiRNA biogenesis. Collectively, this study offers insights into host-virus interaction in tomato and provides valuable information to facilitate the management of viral diseases. IMPORTANCE Tomato is an important source of micronutrients in the human diet and is extensively consumed around the world. Virus is among the major constraints on tomato production. Categorizing virus species that are capable of infecting tomato and understanding their diversity and evolution are challenging due to difficulties in detecting such fast-evolving biological entities. Here, we report the landscape of the tomato virome in China, the leading country in

  10. Diversity, Distribution, and Evolution of Tomato Viruses in China Uncovered by Small RNA Sequencing

    PubMed Central

    Xu, Chenxi; Taylor, Angela; Jiao, Chen; Xu, Yimin; Cai, Xiaofeng; Wang, Xiaoli; Ge, Chenhui; Pan, Guanghui; Wang, Quanxi

    2017-01-01

    ABSTRACT Tomato is a major vegetable crop that has tremendous popularity. However, viral disease is still a major factor limiting tomato production. Here, we report the tomato virome identified through sequencing small RNAs of 170 field-grown samples collected in China. A total of 22 viruses were identified, including both well-documented and newly detected viruses. The tomato viral community is dominated by a few species, and they exhibit polymorphisms and recombination in the genomes with cold spots and hot spots. Most samples were coinfected by multiple viruses, and the majority of identified viruses are positive-sense single-stranded RNA viruses. Evolutionary analysis of one of the most dominant tomato viruses, Tomato yellow leaf curl virus (TYLCV), predicts its origin and the time back to its most recent common ancestor. The broadly sampled data have enabled us to identify several unreported viruses in tomato, including a completely new virus, which has a genome of ∼13.4 kb and groups with aphid-transmitted viruses in the genus Cytorhabdovirus. Although both DNA and RNA viruses can trigger the biogenesis of virus-derived small interfering RNAs (vsiRNAs), we show that features such as length distribution, paired distance, and base selection bias of vsiRNA sequences reflect different plant Dicer-like proteins and Argonautes involved in vsiRNA biogenesis. Collectively, this study offers insights into host-virus interaction in tomato and provides valuable information to facilitate the management of viral diseases. IMPORTANCE Tomato is an important source of micronutrients in the human diet and is extensively consumed around the world. Virus is among the major constraints on tomato production. Categorizing virus species that are capable of infecting tomato and understanding their diversity and evolution are challenging due to difficulties in detecting such fast-evolving biological entities. Here, we report the landscape of the tomato virome in China, the leading

  11. Application of small RNA sequencing to identify microRNAs in acute kidney injury and fibrosis

    SciTech Connect

    Pellegrini, Kathryn L.

    Establishing a microRNA (miRNA) expression profile in affected tissues provides an important foundation for the discovery of miRNAs involved in the development or progression of pathologic conditions. We conducted small RNA sequencing to generate a temporal profile of miRNA expression in the kidneys using a mouse model of folic acid-induced (250 mg/kg i.p.) kidney injury and fibrosis. From the 103 miRNAs that were differentially expressed over the time course (> 2-fold, p < 0.05), we chose to further investigate miR-18a-5p, which is expressed during the acute stage of the injury; miR-132-3p, which is upregulated during transition between acute and fibroticmore » injury; and miR-146b-5p, which is highly expressed at the peak of fibrosis. Using qRT-PCR, we confirmed the increased expression of these candidate miRNAs in the folic acid model as well as in other established mouse models of acute injury (ischemia/reperfusion injury) and fibrosis (unilateral ureteral obstruction). In situ hybridization confirmed high expression of miR-18a-5p, miR-132-3p and miR-146b-5p throughout the kidney cortex in mice and humans with severe kidney injury or fibrosis. When primary human proximal tubular epithelial cells were treated with model nephrotoxicants such as cadmium chloride (CdCl{sub 2}), arsenic trioxide, aristolochic acid (AA), potassium dichromate (K{sub 2}Cr{sub 2}O{sub 7}) and cisplatin, miRNA-132-3p was upregulated 4.3-fold after AA treatment and 1.5-fold after K{sub 2}Cr{sub 2}O{sub 7} and CdCl{sub 2} treatment. These results demonstrate the application of temporal small RNA sequencing to identify miR-18a, miR-132 and miR-146b as differentially expressed miRNAs during distinct phases of kidney injury and fibrosis progression. - Highlights: • We used small RNA sequencing to identify differentially expressed miRNAs in kidney. • Distinct patterns were found for acute injury and fibrotic stages in the kidney. • Upregulation of miR-18a, -132 and -146b was confirmed

  12. Indel detection from DNA and RNA sequencing data with transIndel.

    PubMed

    Yang, Rendong; Van Etten, Jamie L; Dehm, Scott M

    2018-04-19

    Insertions and deletions (indels) are a major class of genomic variation associated with human disease. Indels are primarily detected from DNA sequencing (DNA-seq) data but their transcriptional consequences remain unexplored due to challenges in discriminating medium-sized and large indels from splicing events in RNA-seq data. Here, we developed transIndel, a splice-aware algorithm that parses the chimeric alignments predicted by a short read aligner and reconstructs the mid-sized insertions and large deletions based on the linear alignments of split reads from DNA-seq or RNA-seq data. TransIndel exhibits competitive or superior performance over eight state-of-the-art indel detection tools on benchmarks using both synthetic and real DNA-seq data. Additionally, we applied transIndel to DNA-seq and RNA-seq datasets from 333 primary prostate cancer patients from The Cancer Genome Atlas (TCGA) and 59 metastatic prostate cancer patients from AACR-PCF Stand-Up- To-Cancer (SU2C) studies. TransIndel enhanced the taxonomy of DNA- and RNA-level alterations in prostate cancer by identifying recurrent FOXA1 indels as well as exitron splicing in genes implicated in disease progression. Our study demonstrates that transIndel is a robust tool for elucidation of medium- and large-sized indels from DNA-seq and RNA-seq data. Including RNA-seq in indel discovery efforts leads to significant improvements in sensitivity for identification of med-sized and large indels missed by DNA-seq, and reveals non-canonical RNA-splicing events in genes associated with disease pathology.

  13. RNA sequencing enables systematic identification of platelet transcriptomic alterations in NSCLC patients.

    PubMed

    Zhang, Qun; Hu, Huan; Liu, Hongda; Jin, Jiajia; Zhu, Peiyuan; Wang, Shujun; Shen, Kaikai; Hu, Yangbo; Li, Zhou; Zhan, Ping; Zhu, Suhua; Fan, Hang; Zhang, Jianya; Lv, Tangfeng; Song, Yong

    2018-05-29

    Platelets are implicated as key players in the metastatic dissemination of tumor cells. Previous evidence demonstrated platelets retained cytoplasmic RNAs with physiologically activity, splicing pre-mRNA to mRNA and translating into functional proteins in response to external stimulation. Recently, platelets gene profile of healthy or diseased individuals were characterized with the help of RNA sequencing (RNA-Seq) in some studies, leading to new insights into the mechanisms underlying disease pathogenesis. In this study, we performed RNA-seq in platelets from 7 healthy individuals and 15 non-small cell lung cancer (NSCLC) patients. Our data revealed a subset of near universal differently expressed gene (DEG) profiles in platelets of metastatic NSCLC compared to healthy individuals, including 626 up-regulated RNAs (mRNAs and ncRNAs) and 1497 down-regulated genes. The significant over-expressed genes showed enrichment in focal adhesion, platelets activation, gap junction and adherens junction pathways. The DEGs also included previously reported tumor-related genes such as PDGFR, VEGF, EGF, etc., verifying the consistence and significance of platelet RNA-Seq in oncology study. We also validated several up-regulated DEGs involved in tumor cell-induced platelet aggregation (TCIPA) and tumorigenesis. Additionally, transcriptomic comparison analyses of NSCLC subgroups were conducted. Between non-metastatic and metastatic NSCLC patients, 526 platelet DEGs were identified with the most altered expression. The outcomes from subgroup analysis between lung adenocarcinoma and lung squamous cell carcinoma demonstrated the diagnostic potential of platelet RNA-Seq on distinguishing tumor histological types. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  14. DNA/RNA transverse current sequencing: intrinsic structural noise from neighboring bases

    PubMed Central

    Alvarez, Jose R.; Skachkov, Dmitry; Massey, Steven E.; Kalitsov, Alan; Velev, Julian P.

    2015-01-01

    Nanopore DNA sequencing via transverse current has emerged as a promising candidate for third-generation sequencing technology. It produces long read lengths which could alleviate problems with assembly errors inherent in current technologies. However, the high error rates of nanopore sequencing have to be addressed. A very important source of the error is the intrinsic noise in the current arising from carrier dispersion along the chain of the molecule, i.e., from the influence of neighboring bases. In this work we perform calculations of the transverse current within an effective multi-orbital tight-binding model derived from first-principles calculations of the DNA/RNA molecules, to study the effect of this structural noise on the error rates in DNA/RNA sequencing via transverse current in nanopores. We demonstrate that a statistical technique, utilizing not only the currents through the nucleotides but also the correlations in the currents, can in principle reduce the error rate below any desired precision. PMID:26150827

  15. Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

    PubMed Central

    Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

    1981-01-01

    The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

  16. eRNA: a graphic user interface-based tool optimized for large data analysis from high-throughput RNA sequencing

    PubMed Central

    2014-01-01

    Background RNA sequencing (RNA-seq) is emerging as a critical approach in biological research. However, its high-throughput advantage is significantly limited by the capacity of bioinformatics tools. The research community urgently needs user-friendly tools to efficiently analyze the complicated data generated by high throughput sequencers. Results We developed a standalone tool with graphic user interface (GUI)-based analytic modules, known as eRNA. The capacity of performing parallel processing and sample management facilitates large data analyses by maximizing hardware usage and freeing users from tediously handling sequencing data. The module miRNA identification” includes GUIs for raw data reading, adapter removal, sequence alignment, and read counting. The module “mRNA identification” includes GUIs for reference sequences, genome mapping, transcript assembling, and differential expression. The module “Target screening” provides expression profiling analyses and graphic visualization. The module “Self-testing” offers the directory setups, sample management, and a check for third-party package dependency. Integration of other GUIs including Bowtie, miRDeep2, and miRspring extend the program’s functionality. Conclusions eRNA focuses on the common tools required for the mapping and quantification analysis of miRNA-seq and mRNA-seq data. The software package provides an additional choice for scientists who require a user-friendly computing environment and high-throughput capacity for large data analysis. eRNA is available for free download at https://sourceforge.net/projects/erna/?source=directory. PMID:24593312

  17. The Rhinovirus Subviral A-Particle Exposes 3′-Terminal Sequences of Its Genomic RNA

    PubMed Central

    Harutyunyan, Shushan; Kowalski, Heinrich

    2014-01-01

    ABSTRACT Enteroviruses, which represent a large genus within the family Picornaviridae, undergo important conformational modifications during infection of the host cell. Once internalized by receptor-mediated endocytosis, receptor binding and/or the acidic endosomal environment triggers the native virion to expand and convert into the subviral (altered) A-particle. The A-particle is lacking the internal capsid protein VP4 and exposes N-terminal amphipathic sequences of VP1, allowing for its direct interaction with a lipid bilayer. The genomic single-stranded (+)RNA then exits through a hole close to a 2-fold axis of icosahedral symmetry and passes through a pore in the endosomal membrane into the cytosol, leaving behind the empty shell. We demonstrate that in vitro acidification of a prototype of the minor receptor group of common cold viruses, human rhinovirus A2 (HRV-A2), also results in egress of the poly(A) tail of the RNA from the A-particle, along with adjacent nucleotides totaling ∼700 bases. However, even after hours of incubation at pH 5.2, 5′-proximal sequences remain inside the capsid. In contrast, the entire RNA genome is released within minutes of exposure to the acidic endosomal environment in vivo. This finding suggests that the exposed 3′-poly(A) tail facilitates the positioning of the RNA exit site onto the putative channel in the lipid bilayer, thereby preventing the egress of viral RNA into the endosomal lumen, where it may be degraded. IMPORTANCE For host cell infection, a virus transfers its genome from within the protective capsid into the cytosol; this requires modifications of the viral shell. In common cold viruses, exit of the RNA genome is prepared by the acidic environment in endosomes converting the native virion into the subviral A-particle. We demonstrate that acidification in vitro results in RNA exit starting from the 3′-terminal poly(A). However, the process halts as soon as about 700 bases have left the viral shell

  18. Mapping a nucleolar targeting sequence of an RNA binding nucleolar protein, Nop25

    SciTech Connect

    Fujiwara, Takashi; Suzuki, Shunji; Kanno, Motoko

    2006-06-10

    Nop25 is a putative RNA binding nucleolar protein associated with rRNA transcription. The present study was undertaken to determine the mechanism of Nop25 localization in the nucleolus. Deletion experiments of Nop25 amino acid sequence showed Nop25 to contain a nuclear targeting sequence in the N-terminal and a nucleolar targeting sequence in the C-terminal. By expressing derivative peptides from the C-terminal as GFP-fusion proteins in the cells, a lysine and arginine residue-enriched peptide (KRKHPRRAQDSTKKPPSATRTSKTQRRRR) allowed a GFP-fusion protein to be transported and fully retained in the nucleolus. When the peptide was fused with cMyc epitope and expressed in the cells, amore » cMyc epitope was then detected in the nucleolus. Nop25 did not localize in the nucleolus by deletion of the peptide from Nop25. Furthermore, deletion of a subdomain (KRKHPRRAQ) in the peptide or amino acid substitution of lysine and arginine residues in the subdomain resulted in the loss of Nop25 nucleolar localization. These results suggest that the lysine and arginine residue-enriched peptide is the most prominent nucleolar targeting sequence of Nop25 and that the long stretch of basic residues might play an important role in the nucleolar localization of Nop25. Although Nop25 contained putative SUMOylation, phosphorylation and glycosylation sites, the amino acid substitution in these sites had no effect on the nucleolar localization, thus suggesting that these post-translational modifications did not contribute to the localization of Nop25 in the nucleolus. The treatment of the cells, which expressed a GFP-fusion protein with a nucleolar targeting sequence of Nop25, with RNase A resulted in a complete dislocation of the protein from the nucleolus. These data suggested that the nucleolar targeting sequence might therefore play an important role in the binding of Nop25 to RNA molecules and that the RNA binding of Nop25 might be essential for the nucleolar localization of Nop25.« less

  19. Using deep RNA sequencing for the structural annotation of the laccaria bicolor mycorrhizal transcriptome.

    SciTech Connect

    Larsen, P. E.; Trivedi, G.; Sreedasyam, A.

    2010-07-06

    Accurate structural annotation is important for prediction of function and required for in vitro approaches to characterize or validate the gene expression products. Despite significant efforts in the field, determination of the gene structure from genomic data alone is a challenging and inaccurate process. The ease of acquisition of transcriptomic sequence provides a direct route to identify expressed sequences and determine the correct gene structure. We developed methods to utilize RNA-seq data to correct errors in the structural annotation and extend the boundaries of current gene models using assembly approaches. The methods were validated with a transcriptomic data set derivedmore » from the fungus Laccaria bicolor, which develops a mycorrhizal symbiotic association with the roots of many tree species. Our analysis focused on the subset of 1501 gene models that are differentially expressed in the free living vs. mycorrhizal transcriptome and are expected to be important elements related to carbon metabolism, membrane permeability and transport, and intracellular signaling. Of the set of 1501 gene models, 1439 (96%) successfully generated modified gene models in which all error flags were successfully resolved and the sequences aligned to the genomic sequence. The remaining 4% (62 gene models) either had deviations from transcriptomic data that could not be spanned or generated sequence that did not align to genomic sequence. The outcome of this process is a set of high confidence gene models that can be reliably used for experimental characterization of protein function. 69% of expressed mycorrhizal JGI 'best' gene models deviated from the transcript sequence derived by this method. The transcriptomic sequence enabled correction of a majority of the structural inconsistencies and resulted in a set of validated models for 96% of the mycorrhizal genes. The method described here can be applied to improve gene structural annotation in other species, provided

  20. Small RNA and transcriptome deep sequencing proffers insight into floral gene regulation in Rosa cultivars.

    PubMed

    Kim, Jungeun; Park, June Hyun; Lim, Chan Ju; Lim, Jae Yun; Ryu, Jee-Youn; Lee, Bong-Woo; Choi, Jae-Pil; Kim, Woong Bom; Lee, Ha Yeon; Choi, Yourim; Kim, Donghyun; Hur, Cheol-Goo; Kim, Sukweon; Noh, Yoo-Sun; Shin, Chanseok; Kwon, Suk-Yoon

    2012-11-21

    Roses (Rosa sp.), which belong to the family Rosaceae, are the most economically important ornamental plants--making up 30% of the floriculture market. However, given high demand for roses, rose breeding programs are limited in molecular resources which can greatly enhance and speed breeding efforts. A better understanding of important genes that contribute to important floral development and desired phenotypes will lead to improved rose cultivars. For this study, we analyzed rose miRNAs and the rose flower transcriptome in order to generate a database to expound upon current knowledge regarding regulation of important floral characteristics. A rose genetic database will enable comprehensive analysis of gene expression and regulation via miRNA among different Rosa cultivars. We produced more than 0.5 million reads from expressed sequences, totalling more than 110 million bp. From these, we generated 35,657, 31,434, 34,725, and 39,722 flower unigenes from Rosa hybrid: 'Vital', 'Maroussia', and 'Sympathy' and Rosa rugosa Thunb., respectively. The unigenes were assigned functional annotations, domains, metabolic pathways, Gene Ontology (GO) terms, Plant Ontology (PO) terms, and MIPS Functional Catalogue (FunCat) terms. Rose flower transcripts were compared with genes from whole genome sequences of Rosaceae members (apple, strawberry, and peach) and grape. We also produced approximately 40 million small RNA reads from flower tissue for Rosa, representing 267 unique miRNA tags. Among identified miRNAs, 25 of them were novel and 242 of them were conserved miRNAs. Statistical analyses of miRNA profiles revealed both shared and species-specific miRNAs, which presumably effect flower development and phenotypes. In this study, we constructed a Rose miRNA and transcriptome database, and we analyzed the miRNAs and transcriptome generated from the flower tissues of four Rosa cultivars. The database provides a comprehensive genetic resource which can be used to better understand

  1. mRNA deep sequencing reveals 75 new genes and a complex transcriptional landscape in Mimivirus.

    PubMed

    Legendre, Matthieu; Audic, Stéphane; Poirot, Olivier; Hingamp, Pascal; Seltzer, Virginie; Byrne, Deborah; Lartigue, Audrey; Lescot, Magali; Bernadac, Alain; Poulain, Julie; Abergel, Chantal; Claverie, Jean-Michel

    2010-05-01

    Mimivirus, a virus infecting Acanthamoeba, is the prototype of the Mimiviridae, the latest addition to the nucleocytoplasmic large DNA viruses. The Mimivirus genome encodes close to 1000 proteins, many of them never before encountered in a virus, such as four amino-acyl tRNA synthetases. To explore the physiology of this exceptional virus and identify the genes involved in the building of its characteristic intracytoplasmic "virion factory," we coupled electron microscopy observations with the massively parallel pyrosequencing of the polyadenylated RNA fractions of Acanthamoeba castellanii cells at various time post-infection. We generated 633,346 reads, of which 322,904 correspond to Mimivirus transcripts. This first application of deep mRNA sequencing (454 Life Sciences [Roche] FLX) to a large DNA virus allowed the precise delineation of the 5' and 3' extremities of Mimivirus mRNAs and revealed 75 new transcripts including several noncoding RNAs. Mimivirus genes are expressed across a wide dynamic range, in a finely regulated manner broadly described by three main temporal classes: early, intermediate, and late. This RNA-seq study confirmed the AAAATTGA sequence as an early promoter element, as well as the presence of palindromes at most of the polyadenylation sites. It also revealed a new promoter element correlating with late gene expression, which is also prominent in Sputnik, the recently described Mimivirus "virophage." These results-validated genome-wide by the hybridization of total RNA extracted from infected Acanthamoeba cells on a tiling array (Agilent)--will constitute the foundation on which to build subsequent functional studies of the Mimivirus/Acanthamoeba system.

  2. mRNA deep sequencing reveals 75 new genes and a complex transcriptional landscape in Mimivirus

    PubMed Central

    Legendre, Matthieu; Audic, Stéphane; Poirot, Olivier; Hingamp, Pascal; Seltzer, Virginie; Byrne, Deborah; Lartigue, Audrey; Lescot, Magali; Bernadac, Alain; Poulain, Julie; Abergel, Chantal; Claverie, Jean-Michel

    2010-01-01

    Mimivirus, a virus infecting Acanthamoeba, is the prototype of the Mimiviridae, the latest addition to the nucleocytoplasmic large DNA viruses. The Mimivirus genome encodes close to 1000 proteins, many of them never before encountered in a virus, such as four amino-acyl tRNA synthetases. To explore the physiology of this exceptional virus and identify the genes involved in the building of its characteristic intracytoplasmic “virion factory,” we coupled electron microscopy observations with the massively parallel pyrosequencing of the polyadenylated RNA fractions of Acanthamoeba castellanii cells at various time post-infection. We generated 633,346 reads, of which 322,904 correspond to Mimivirus transcripts. This first application of deep mRNA sequencing (454 Life Sciences [Roche] FLX) to a large DNA virus allowed the precise delineation of the 5′ and 3′ extremities of Mimivirus mRNAs and revealed 75 new transcripts including several noncoding RNAs. Mimivirus genes are expressed across a wide dynamic range, in a finely regulated manner broadly described by three main temporal classes: early, intermediate, and late. This RNA-seq study confirmed the AAAATTGA sequence as an early promoter element, as well as the presence of palindromes at most of the polyadenylation sites. It also revealed a new promoter element correlating with late gene expression, which is also prominent in Sputnik, the recently described Mimivirus “virophage.” These results—validated genome-wide by the hybridization of total RNA extracted from infected Acanthamoeba cells on a tiling array (Agilent)—will constitute the foundation on which to build subsequent functional studies of the Mimivirus/Acanthamoeba system. PMID:20360389

  3. Conserved small mRNA with an unique, extended Shine-Dalgarno sequence

    PubMed Central

    Hahn, Julia; Migur, Anzhela; von Boeselager, Raphael Freiherr; Kubatova, Nina; Kubareva, Elena; Schwalbe, Harald

    2017-01-01

    ABSTRACT Up to now, very small protein-coding genes have remained unrecognized in sequenced genomes. We identified an mRNA of 165 nucleotides (nt), which is conserved in Bradyrhizobiaceae and encodes a polypeptide with 14 amino acid residues (aa). The small mRNA harboring a unique Shine-Dalgarno sequence (SD) with a length of 17 nt was localized predominantly in the ribosome-containing P100 fraction of Bradyrhizobium japonicum USDA 110. Strong interaction between the mRNA and 30S ribosomal subunits was demonstrated by their co-sedimentation in sucrose density gradient. Using translational fusions with egfp, we detected weak translation and found that it is impeded by both the extended SD and the GTG start codon (instead of ATG). Biophysical characterization (CD- and NMR-spectroscopy) showed that synthesized polypeptide remained unstructured in physiological puffer. Replacement of the start codon by a stop codon increased the stability of the transcript, strongly suggesting additional posttranscriptional regulation at the ribosome. Therefore, the small gene was named rreB (ribosome-regulated expression in Bradyrhizobiaceae). Assuming that the unique ribosome binding site (RBS) is a hallmark of rreB homologs or similarly regulated genes, we looked for similar putative RBS in bacterial genomes and detected regions with at least 16 nt complementarity to the 3′-end of 16S rRNA upstream of sORFs in Caulobacterales, Rhizobiales, Rhodobacterales and Rhodospirillales. In the Rhodobacter/Roseobacter lineage of α-proteobacteria the corresponding gene (rreR) is conserved and encodes an 18 aa protein. This shows how specific RBS features can be used to identify new genes with presumably similar control of expression at the RNA level. PMID:27834614

  4. RNA sequencing reveals significant miRNAs in Atypical endometrial hyperplasia.

    PubMed

    Tang, Shiqian; Dai, Yinmei

    2018-06-01

    In this paper, we aimed to investigate the miRNAs that played a regulatory role in the development of atypical endometrial hyperplasia (AEH). RNA sequencing was performed for endometrial tissues from 3 AEH patients and 3 endometrial normal hyperplasia patients. RNA sequencing data were processed and differentially expressed (DE) miRNAs were identified between AEH and controls. The target genes for DE miRNAs were identified and mapped to the protein-protein interaction (PPI) network. The miRNA related functions were predicted and miRNA-disease gene network was constructed. Total 18 DE miRNAs were overlapped in three sample groups, among which hsa-miR-577, hsa-miR-182-5p and hsa-miR-183-5p were top three miRNAs that targeting largest number of genes. Function analysis showed that the 18 overlapped miRNAs mainly related with cancer and signaling transduction related pathways. PPI network showed that total 12 genes were among top 20 genes based on three network topological features including BCL2, UMPS, MAPK13, PRKCB, CREB1, IGF1, SP1, SMAD3, IGF1R, NOTCH2, WNT5A, TK2. Top 10 miRNAs in miRNA-disease gene network were identified such as hsa-miR-577 (degree = 17), hsa-miR-182-5p (degree = 16) and hsa-miR-3609 (degree = 13). hsa-miR-577 and hsa-miR-182-5p may play regulatory role in AEH through AMPK signal pathway and Wnt signaling pathway. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Detecting cooperative sequences in the binding of RNA Polymerase-II

    NASA Astrophysics Data System (ADS)

    Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

    2008-03-01

    Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

  6. An optimized protocol for generation and analysis of Ion Proton sequencing reads for RNA-Seq.

    PubMed

    Yuan, Yongxian; Xu, Huaiqian; Leung, Ross Ka-Kit

    2016-05-26

    Previous studies compared running cost, time and other performance measures of popular sequencing platforms. However, comprehensive assessment of library construction and analysis protocols for Proton sequencing platform remains unexplored. Unlike Illumina sequencing platforms, Proton reads are heterogeneous in length and quality. When sequencing data from different platforms are combined, this can result in reads with various read length. Whether the performance of the commonly used software for handling such kind of data is satisfactory is unknown. By using universal human reference RNA as the initial material, RNaseIII and chemical fragmentation methods in library construction showed similar result in gene and junction discovery number and expression level estimated accuracy. In contrast, sequencing quality, read length and the choice of software affected mapping rate to a much larger extent. Unspliced aligner TMAP attained the highest mapping rate (97.27 % to genome, 86.46 % to transcriptome), though 47.83 % of mapped reads were clipped. Long reads could paradoxically reduce mapping in junctions. With reference annotation guide, the mapping rate of TopHat2 significantly increased from 75.79 to 92.09 %, especially for long (>150 bp) reads. Sailfish, a k-mer based gene expression quantifier attained highly consistent results with that of TaqMan array and highest sensitivity. We provided for the first time, the reference statistics of library preparation methods, gene detection and quantification and junction discovery for RNA-Seq by the Ion Proton platform. Chemical fragmentation performed equally well with the enzyme-based one. The optimal Ion Proton sequencing options and analysis software have been evaluated.

  7. Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer

    PubMed Central

    Wojcik, Sylwia E.; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S.; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z.; Rai, Kanti R.; Kipps, Thomas J.; Keating, Michael J.

    2010-01-01

    Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas. PMID:19926640

  8. Deep sequencing of Salmonella RNA associated with heterologous Hfq proteins in vivo reveals small RNAs as a major target class and identifies RNA processing phenotypes.

    PubMed

    Sittka, Alexandra; Sharma, Cynthia M; Rolle, Katarzyna; Vogel, Jörg

    2009-01-01

    The bacterial Sm-like protein, Hfq, is a key factor for the stability and function of small non-coding RNAs (sRNAs) in Escherichia coli. Homologues of this protein have been predicted in many distantly related organisms yet their functional conservation as sRNA-binding proteins has not entirely been clear. To address this, we expressed in Salmonella the Hfq proteins of two eubacteria (Neisseria meningitides, Aquifex aeolicus) and an archaeon (Methanocaldococcus jannaschii), and analyzed the associated RNA by deep sequencing. This in vivo approach identified endogenous Salmonella sRNAs as a major target of the foreign Hfq proteins. New Salmonella sRNA species were also identified, and some of these accumulated specifically in the presence of a foreign Hfq protein. In addition, we observed specific RNA processing defects, e.g., suppression of precursor processing of SraH sRNA by Methanocaldococcus Hfq, or aberrant accumulation of extracytoplasmic target mRNAs of the Salmonella GcvB, MicA or RybB sRNAs. Taken together, our study provides evidence of a conserved inherent sRNA-binding property of Hfq, which may facilitate the lateral transmission of regulatory sRNAs among distantly related species. It also suggests that the expression of heterologous RNA-binding proteins combined with deep sequencing analysis of RNA ligands can be used as a molecular tool to dissect individual steps of RNA metabolism in vivo.

  9. Stabilization of Clostridium perfringens collagenase mRNA by VR-RNA-dependent cleavage in 5' leader sequence.

    PubMed

    Obana, Nozomu; Shirahama, Yu; Abe, Kimihiro; Nakamura, Kouji

    2010-09-01

    The small RNA (sRNA), VR-RNA that is directly regulated by the VirR/VirS two-component system, regulates many genes including toxin genes such as collagenase (colA) and phospholipase C (plc) in Clostridium perfringens. Although the VR-RNA 3' region is sufficient to regulate the colA and plc genes, the molecular mechanism of toxin gene regulation by VR-RNA remains unclear. Here, we found that colA mRNA is cleaved at position -79 and -78 from the A of the first codon (ATG) in the presence of VR-RNA. The processed transcripts were stable compared with longer intact transcripts. On the other hand, colA mRNA was labile in a VR-RNA-deficient strain, and processed transcripts were undetectable. The stability and processing of colA mRNA were restored by transformation of the 3' region of VR-RNA-expression vector. The 3' region of VR-RNA and colA mRNA had significant complementation and interacted in vitro. These results show that VR-RNA base pairs with colA mRNA and induces cleavage in the 5' untranslated region (UTR) of colA mRNA, which leads to the stabilization of colA mRNA and the activation of colA expression. © 2010 Blackwell Publishing Ltd.

  10. RNase-Resistant Virus-Like Particles Containing Long Chimeric RNA Sequences Produced by Two-Plasmid Coexpression System▿

    PubMed Central

    Wei, Yuxiang; Yang, Changmei; Wei, Baojun; Huang, Jie; Wang, Lunan; Meng, Shuang; Zhang, Rui; Li, Jinming

    2008-01-01

    RNase-resistant, noninfectious virus-like particles containing exogenous RNA sequences (armored RNA) are good candidates as RNA controls and standards in RNA virus detection. However, the length of RNA packaged in the virus-like particles with high efficiency is usually less than 500 bases. In this study, we describe a method for producing armored L-RNA. Armored L-RNA is a complex of MS2 bacteriophage coat protein and RNA produced in Escherichia coli by the induction of a two-plasmid coexpression system in which the coat protein and maturase are expressed from one plasmid and the target RNA sequence with modified MS2 stem-loop (pac site) is transcribed from another plasmid. A 3V armored L-RNA of 2,248 bases containing six gene fragments—hepatitis C virus, severe acute respiratory syndrome coronavirus (SARS-CoV1, SARS-CoV2, and SARS-CoV3), avian influenza virus matrix gene (M300), and H5N1 avian influenza virus (HA300)—was successfully expressed by the two-plasmid coexpression system and was demonstrated to have all of the characteristics of armored RNA. We evaluated the 3V armored L-RNA as a calibrator for multiple virus assays. We used the WHO International Standard for HCV RNA (NIBSC 96/790) to calibrate the chimeric armored L-RNA, which was diluted by 10-fold serial dilutions to obtain samples containing 106 to 102 copies. In conclusion, the approach we used for armored L-RNA preparation is practical and could reduce the labor and cost of quality control in multiplex RNA virus assays. Furthermore, we can assign the chimeric armored RNA with an international unit for quantitative detection. PMID:18305135

  11. Combinatory RNA-Sequencing Analyses Reveal a Dual Mode of Gene Regulation by ADAR1 in Gastric Cancer.

    PubMed

    Cho, Charles J; Jung, Jaeeun; Jiang, Lushang; Lee, Eun Ji; Kim, Dae-Soo; Kim, Byung Sik; Kim, Hee Sung; Jung, Hwoon-Yong; Song, Ho-June; Hwang, Sung Wook; Park, Yangsoon; Jung, Min Kyo; Pack, Chan Gi; Myung, Seung-Jae; Chang, Suhwan

    2018-04-25

    Adenosine deaminase acting on RNA 1 (ADAR1) is known to mediate deamination of adenosine-to-inosine through binding to double-stranded RNA, the phenomenon known as RNA editing. Currently, the function of ADAR1 in gastric cancer is unclear. This study was aimed at investigating RNA editing-dependent and editing-independent functions of ADAR1 in gastric cancer, especially focusing on its influence on editing of 3' untranslated regions (UTRs) and subsequent changes in expression of messenger RNAs (mRNAs) as well as microRNAs (miRNAs). RNA-sequencing and small RNA-sequencing were performed on AGS and MKN-45 cells with a stable ADAR1 knockdown. Changed frequencies of editing and mRNA and miRNA expression were then identified by bioinformatic analyses. Targets of RNA editing were further validated in patients' samples. In the Alu region of both gastric cell lines, editing was most commonly of the A-to-I type in 3'-UTR or intron. mRNA and protein levels of PHACTR4 increased in ADAR1 knockdown cells, because of the loss of seed sequences in 3'-UTR of PHACTR4 mRNA that are required for miRNA-196a-3p binding. Immunohistochemical analyses of tumor and paired normal samples from 16 gastric cancer patients showed that ADAR1 expression was higher in tumors than in normal tissues and inversely correlated with PHACTR4 staining. On the other hand, decreased miRNA-148a-3p expression in ADAR1 knockdown cells led to increased mRNA and protein expression of NFYA, demonstrating ADAR1's editing-independent function. ADAR1 regulates post-transcriptional gene expression in gastric cancer through both RNA editing-dependent and editing-independent mechanisms.

  12. Genome organisation and sequence comparison suggest intraspecies incongruence in M RNA of Watermelon bud necrosis virus.

    PubMed

    Kumar, Rakesh; Mandal, B; Geetanjali, A S; Jain, R K; Jaiwal, P K

    2010-08-01

    Watermelon bud necrosis virus (WBNV), a member of the genus Tospovirus, family Bunyaviridae is an important viral pathogen in watermelon cultivation in India. The complete genome sequence properties of WBNV are not available. In the present study, the complete M RNA sequence and the genome organisation of a WBNV isolate infecting watermelon in Delhi (WBNV-wDel) were determined. The M RNA was 4,794 nucleotides (nt) long and potentially coded for a movement protein (NSm) of 34.22 kDa (307 amino acids) on the viral sense strand and a Gn/Gc glycoprotein precursor of 127.15 kDa (1,121 amino acids) on the complementary strand. The two open reading frames were separated by an intergenic region of 402 nt. The 5' and 3' untranslated regions were 55 and 47 nt long, respectively, containing complementary termini typical of tospoviruses. WBNV-wDel was most closely related (79.1% identity) to Groundnut bud necrosis virus, an important tospovirus that occurs in several crops in India, and was different (63.3-75.2% identity) from the other cucurbit-infecting tospoviruses known to occur in Taiwan and Japan. Sequence analysis of NSm and Gn/Gc revealed phylogenetic incongruence between WBNV-wDel and another isolate originating from central India (WBNV-Wm-Som isolate). The Wm-Som isolate showed evolutionary divergence from the wDel isolate in the Gn/Gc protein (74.6% identity) potentially due to recombination with the other tospoviruses that are known to occur in India. This is the first report of a comparison of complete sequences of M RNA of WBNV.

  13. Isoform-level gene expression patterns in single-cell RNA-sequencing data.

    PubMed

    Vu, Trung Nghia; Wills, Quin F; Kalari, Krishna R; Niu, Nifang; Wang, Liewei; Pawitan, Yudi; Rantalainen, Mattias

    2018-02-27

    RNA sequencing of single cells enables characterization of transcriptional heterogeneity in seemingly homogeneous cell populations. Single-cell sequencing has been applied in a wide range of researches fields. However, few studies have focus on characterization of isoform-level expression patterns at the single-cell level. In this study we propose and apply a novel method, ISOform-Patterns (ISOP), based on mixture modeling, to characterize the expression patterns of isoform pairs from the same gene in single-cell isoform-level expression data. We define six principal patterns of isoform expression relationships and describe a method for differential-pattern analysis. We demonstrate ISOP through analysis of single-cell RNA-sequencing data from a breast cancer cell line, with replication in three independent datasets. We assigned the pattern types to each of 16,562 isoform-pairs from 4,929 genes. Among those, 26% of the discovered patterns were significant (p<0.05), while remaining patterns are possibly effects of transcriptional bursting, drop-out and stochastic biological heterogeneity. Furthermore, 32% of genes discovered through differential-pattern analysis were not detected by differential-expression analysis. The effect of drop-out events, mean expression level, and properties of the expression distribution on the performances of ISOP were also investigated through simulated datasets. To conclude, ISOP provides a novel approach for characterization of isoformlevel preference, commitment and heterogeneity in single-cell RNA-sequencing data. The ISOP method has been implemented as a R package and is available at https://github.com/nghiavtr/ISOP under a GPL-3 license. mattias.rantalainen@ki.se. Supplementary data are available at Bioinformatics online.

  14. Delivery of siRNA using ternary complexes containing branched cationic peptides: the role of peptide sequence, branching and targeting.

    PubMed

    Kudsiova, Laila; Welser, Katharina; Campbell, Frederick; Mohammadi, Atefeh; Dawson, Natalie; Cui, Lili; Hailes, Helen C; Lawrence, M Jayne; Tabor, Alethea B

    2016-03-01

    Ternary nanocomplexes, composed of bifunctional cationic peptides, lipids and siRNA, as delivery vehicles for siRNA have been investigated. The study is the first to determine the optimal sequence and architecture of the bifunctional cationic peptide used for siRNA packaging and delivery using lipopolyplexes. Specifically three series of cationic peptides of differing sequence, degrees of branching and cell-targeting sequences were co-formulated with siRNA and vesicles prepared from a 1 : 1 molar ratio of the cationic lipid DOTMA and the helper lipid, DOPE. The level of siRNA knockdown achieved in the human alveolar cell line, A549-luc cells, in both reduced serum and in serum supplemented media was evaluated, and the results correlated to the nanocomplex structure (established using a range of physico-chemical tools, namely small angle neutron scattering, transmission electron microscopy, dynamic light scattering and zeta potential measurement); the conformational properties of each component (circular dichroism); the degree of protection of the siRNA in the lipopolyplex (using gel shift assays) and to the cellular uptake, localisation and toxicity of the nanocomplexes (confocal microscopy). Although the size, charge, structure and stability of the various lipopolyplexes were broadly similar, it was clear that lipopolyplexes formulated from branched peptides containing His-Lys sequences perform best as siRNA delivery agents in serum, with protection of the siRNA in serum balanced against efficient release of the siRNA into the cytoplasm of the cell.

  15. SARA-Coffee web server, a tool for the computation of RNA sequence and structure multiple alignments

    PubMed Central

    Di Tommaso, Paolo; Bussotti, Giovanni; Kemena, Carsten; Capriotti, Emidio; Chatzou, Maria; Prieto, Pablo; Notredame, Cedric

    2014-01-01

    This article introduces the SARA-Coffee web server; a service allowing the online computation of 3D structure based multiple RNA sequence alignments. The server makes it possible to combine sequences with and without known 3D structures. Given a set of sequences SARA-Coffee outputs a multiple sequence alignment along with a reliability index for every sequence, column and aligned residue. SARA-Coffee combines SARA, a pairwise structural RNA aligner with the R-Coffee multiple RNA aligner in a way that has been shown to improve alignment accuracy over most sequence aligners when enough structural data is available. The server can be accessed from http://tcoffee.crg.cat/apps/tcoffee/do:saracoffee. PMID:24972831

  16. Construction of armored RNA containing long-size chimeric RNA by increasing the number and affinity of the pac site in exogenous rna and sequence coding coat protein of the MS2 bacteriophage.

    PubMed

    Wei, Baojun; Wei, Yuxiang; Zhang, Kuo; Yang, Changmei; Wang, Jing; Xu, Ruihuan; Zhan, Sien; Lin, Guigao; Wang, Wei; Liu, Min; Wang, Lunan; Zhang, Rui; Li, Jinming

    2008-01-01

    To construct a one-plasmid expression system of the armored RNA containing long chimeric RNA by increasing the number and affinity of the pac site. The plasmid pET-MS2-pac was constructed with one C-variant pac site, and then the plasmid pM-CR-2C containing 1,891-bp chimeric sequences and two C-variant pac sites was produced. Meanwhile, three plasmids (pM-CR-C, pM-CR-2W and pM-CR-W) were obtained as parallel controls with a different number and affinity of the pac site. Finally, the armored RNA was expressed and purified. The armored RNA with 1,891 bases target RNA was expressed successfully by the one-plasmid expression system with two C-variant pac sites, while for one pac site, no matter whether the affinity was changed or not, only the 1,200 bases target RNA was packaged. It was also found that the C-variant pac site could increase the expression efficiency of the armored RNA. The armored RNA with 1,891-bp exogenous RNA in our study showed the characterization of ribonuclease resistance and stability at different time points and temperature conditions. The armored RNA with 1,891 bases exogenous RNA was constructed and the expression system can be used as a platform for preparation of the armored RNA containing long RNA sequences. Copyright 2008 S. Karger AG, Basel.

  17. microRNA expression profiling in fetal single ventricle malformation identified by deep sequencing.

    PubMed

    Yu, Zhang-Bin; Han, Shu-Ping; Bai, Yun-Fei; Zhu, Chun; Pan, Ya; Guo, Xi-Rong

    2012-01-01

    microRNAs (miRNAs) have emerged as key regulators in many biological processes, particularly cardiac growth and development, although the specific miRNA expression profile associated with this process remains to be elucidated. This study aimed to characterize the cellular microRNA profile involved in the development of congenital heart malformation, through the investigation of single ventricle (SV) defects. Comprehensive miRNA profiling in human fetal SV cardiac tissue was performed by deep sequencing. Differential expression of 48 miRNAs was revealed by sequencing by oligonucleotide ligation and detection (SOLiD) analysis. Of these, 38 were down-regulated and 10 were up-regulated in differentiated SV cardiac tissue, compared to control cardiac tissue. This was confirmed by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis. Predicted target genes of the 48 differentially expressed miRNAs were analyzed by gene ontology and categorized according to cellular process, regulation of biological process and metabolic process. Pathway-Express analysis identified the WNT and mTOR signaling pathways as the most significant processes putatively affected by the differential expression of these miRNAs. The candidate genes involved in cardiac development were identified as potential targets for these differentially expressed microRNAs and the collaborative network of microRNAs and cardiac development related-mRNAs was constructed. These data provide the basis for future investigation of the mechanism of the occurrence and development of fetal SV malformations.

  18. Effect of substrate RNA sequence on the cleavage reaction by a short ribozyme.

    PubMed Central

    Ohmichi, T; Okumoto, Y; Sugimoto, N

    1998-01-01

    Leadzyme is a ribozyme that requires Pb2+. The catalytic sequence, CUGGGAGUCC, binds to an RNA substrate, GGACC downward arrowGAGCCAG, cleaving the RNA substrate at one site. We have investigated the effect of the substrate sequence on the cleavage activity of leadzyme using mutant substrates in order to structurally understand the RNA catalysis. The results showed that leadzyme acted as a catalyst for single site cleavage of a C5 deletion mutant substrate, GGAC downward arrowGAGCCAG, as well as the wild-type substrate. However, a mutant substrate GGACCGACCAG, which had G8 deleted from the wild-type substrate, was not cleaved. Kinetic studies by surface plasmon resonance indicated that the difference between active and inactive structures reflected the slow association and dissociation rate constants of complex formation induced by Pb2+rather than differences in complex stability. CD spectra showed that the active form of the substrate-leadzyme complex was rearranged by Pb2+binding. The G8 of the wild-type substrate, which was absent in the inactive complex, is not near the cleavage site. Thus, these results show that the active substrate-leadzyme complex has a Pb2+binding site at the junction between the unpaired region (asymmetric internal loop) and the stem region, which is distal to the cleavage site. Pb2+may play a role in rearranging the bases in the asymmetric internal loop to the correct position for catalysis. PMID:9837996

  19. The binding of TIA-1 to RNA C-rich sequences is driven by its C-terminal RRM domain.

    PubMed

    Cruz-Gallardo, Isabel; Aroca, Ángeles; Gunzburg, Menachem J; Sivakumaran, Andrew; Yoon, Je-Hyun; Angulo, Jesús; Persson, Cecilia; Gorospe, Myriam; Karlsson, B Göran; Wilce, Jacqueline A; Díaz-Moreno, Irene

    2014-01-01

    T-cell intracellular antigen-1 (TIA-1) is a key DNA/RNA binding protein that regulates translation by sequestering target mRNAs in stress granules (SG) in response to stress conditions. TIA-1 possesses three RNA recognition motifs (RRM) along with a glutamine-rich domain, with the central domains (RRM2 and RRM3) acting as RNA binding platforms. While the RRM2 domain, which displays high affinity for U-rich RNA sequences, is primarily responsible for interaction with RNA, the contribution of RRM3 to bind RNA as well as the target RNA sequences that it binds preferentially are still unknown. Here we combined nuclear magnetic resonance (NMR) and surface plasmon resonance (SPR) techniques to elucidate the sequence specificity of TIA-1 RRM3. With a novel approach using saturation transfer difference NMR (STD-NMR) to quantify protein-nucleic acids interactions, we demonstrate that isolated RRM3 binds to both C- and U-rich stretches with micromolar affinity. In combination with RRM2 and in the context of full-length TIA-1, RRM3 significantly enhanced the binding to RNA, particularly to cytosine-rich RNA oligos, as assessed by biotinylated RNA pull-down analysis. Our findings provide new insight into the role of RRM3 in regulating TIA-1 binding to C-rich stretches, that are abundant at the 5' TOPs (5' terminal oligopyrimidine tracts) of mRNAs whose translation is repressed under stress situations.

  20. The binding of TIA-1 to RNA C-rich sequences is driven by its C-terminal RRM domain

    PubMed Central

    Cruz-Gallardo, Isabel; Aroca, Ángeles; Gunzburg, Menachem J; Sivakumaran, Andrew; Yoon, Je-Hyun; Angulo, Jesús; Persson, Cecilia; Gorospe, Myriam; Karlsson, B Göran; Wilce, Jacqueline A; Díaz-Moreno, Irene

    2014-01-01

    T-cell intracellular antigen-1 (TIA-1) is a key DNA/RNA binding protein that regulates translation by sequestering target mRNAs in stress granules (SG) in response to stress conditions. TIA-1 possesses three RNA recognition motifs (RRM) along with a glutamine-rich domain, with the central domains (RRM2 and RRM3) acting as RNA binding platforms. While the RRM2 domain, which displays high affinity for U-rich RNA sequences, is primarily responsible for interaction with RNA, the contribution of RRM3 to bind RNA as well as the target RNA sequences that it binds preferentially are still unknown. Here we combined nuclear magnetic resonance (NMR) and surface plasmon resonance (SPR) techniques to elucidate the sequence specificity of TIA-1 RRM3. With a novel approach using saturation transfer difference NMR (STD-NMR) to quantify protein–nucleic acids interactions, we demonstrate that isolated RRM3 binds to both C- and U-rich stretches with micromolar affinity. In combination with RRM2 and in the context of full-length TIA-1, RRM3 significantly enhanced the binding to RNA, particularly to cytosine-rich RNA oligos, as assessed by biotinylated RNA pull-down analysis. Our findings provide new insight into the role of RRM3 in regulating TIA-1 binding to C-rich stretches, that are abundant at the 5′ TOPs (5′ terminal oligopyrimidine tracts) of mRNAs whose translation is repressed under stress situations. PMID:24824036

  1. Characterization of the platelet transcriptome by RNA sequencing in patients with acute myocardial infarction

    PubMed Central

    Eicher, John D.; Wakabayashi, Yoshiyuki; Vitseva, Olga; Esa, Nada; Yang, Yanqin; Zhu, Jun; Freedman, Jane E.; McManus, David D.; Johnson, Andrew D.

    2016-01-01

    Transcripts in platelets are largely produced in precursor megakaryocytes but remain physiologically-active as platelets translate RNAs and regulate protein/RNA levels. Recent studies using transcriptome sequencing (RNA-seq) characterized the platelet transcriptome in limited numbers of non-diseased individuals. Here, we expand upon these RNA-seq studies by completing RNA-seq in platelets from 32 patients with acute myocardial infarction (MI). Our goals were to characterize the platelet transcriptome using a population of patients with acute MI and relate gene expression to platelet aggregation measures and ST-segment elevation MI (STEMI) (n=16) versus non-STEMI (NSTEMI) (n=16) subtypes. Similar to other studies, we detected 9,565 expressed transcripts, including several known platelet-enriched markers (e.g., PPBP, OST4). Our RNA-seq data strongly correlated with independently ascertained platelet expression data and showed enrichment for platelet-related pathways (e.g., wound response, hemostasis, and platelet activation), as well as actin-related and post-transcriptional processes. Several transcripts displayed suggestively higher (FBXL4, ECHDC3, KCNE1, TAOK2, AURKB, ERG, and FKBP5) and lower (MIAT, PVRL3and PZP) expression in STEMI platelets compared to NSTEMI. We also identified transcripts correlated with platelet aggregation to TRAP (ATP6V1G2, SLC2A3), collagen (CEACAM1, ITGA2), and ADP (PDGFB, PDGFC, ST3GAL6). Our study adds to current platelet gene expression resources by providing transcriptome-wide analyses in platelets isolated from patients with acute MI. In concert with prior studies, we identify various genes for further study in regards to platelet function and acute MI. Future platelet RNA-seq studies examining more diverse sets of healthy and diseased samples will add to our understanding of platelet thrombotic and non-thrombotic functions. PMID:26367242

  2. Plant tRNA ligases are multifunctional enzymes that have diverged in sequence and substrate specificity from RNA ligases of other phylogenetic origins

    PubMed Central

    Englert, Markus; Beier, Hildburg

    2005-01-01

    Pre-tRNA splicing is an essential process in all eukaryotes. It requires the concerted action of an endonuclease to remove the intron and a ligase for joining the resulting tRNA halves as studied best in the yeast Saccharomyces cerevisiae. Here, we report the first characterization of an RNA ligase protein and its gene from a higher eukaryotic organism that is an essential component of the pre-tRNA splicing process. Purification of tRNA ligase from wheat germ by successive column chromatographic steps has identified a protein of 125 kDa by its potentiality to covalently bind AMP, and by its ability to catalyse the ligation of tRNA halves and the circularization of linear introns. Peptide sequences obtained from the purified protein led to the elucidation of the corresponding proteins and their genes in Arabidopsis and Oryza databases. The plant tRNA ligases exhibit no overall sequence homologies to any known RNA ligases, however, they harbour a number of conserved motifs that indicate the presence of three intrinsic enzyme activities: an adenylyltransferase/ligase domain in the N-terminal region, a polynucleotide kinase in the centre and a cyclic phosphodiesterase domain at the C-terminal end. In vitro expression of the recombinant Arabidopsis tRNA ligase and functional analyses revealed all expected individual activities. Plant RNA ligases are active on a variety of substrates in vitro and are capable of inter- and intramolecular RNA joining. Hence, we conclude that their role in vivo might comprise yet unknown essential functions besides their involvement in pre-tRNA splicing. PMID:15653639

  3. Alignment of RNA molecules: Binding energy and statistical properties of random sequences

    SciTech Connect

    Valba, O. V., E-mail: valbaolga@gmail.com; Nechaev, S. K., E-mail: sergei.nechaev@gmail.com; Tamm, M. V., E-mail: thumm.m@gmail.com

    2012-02-15

    A new statistical approach to the problem of pairwise alignment of RNA sequences is proposed. The problem is analyzed for a pair of interacting polymers forming an RNA-like hierarchical cloverleaf structures. An alignment is characterized by the numbers of matches, mismatches, and gaps. A weight function is assigned to each alignment; this function is interpreted as a free energy taking into account both direct monomer-monomer interactions and a combinatorial contribution due to formation of various cloverleaf secondary structures. The binding free energy is determined for a pair of RNA molecules. Statistical properties are discussed, including fluctuations of the binding energymore » between a pair of RNA molecules and loop length distribution in a complex. Based on an analysis of the free energy per nucleotide pair complexes of random RNAs as a function of the number of nucleotide types c, a hypothesis is put forward about the exclusivity of the alphabet c = 4 used by nature.« less

  4. RNA transcript sequencing reveals inorganic sulfur compound oxidation pathways in the acidophile Acidithiobacillus ferrivorans.

    PubMed

    Christel, Stephan; Fridlund, Jimmy; Buetti-Dinh, Antoine; Buck, Moritz; Watkin, Elizabeth L; Dopson, Mark

    2016-04-01

    Acidithiobacillus ferrivorans is an acidophile implicated in low-temperature biomining for the recovery of metals from sulfide minerals. Acidithiobacillus ferrivorans obtains its energy from the oxidation of inorganic sulfur compounds, and genes encoding several alternative pathways have been identified. Next-generation sequencing of At. ferrivorans RNA transcripts identified the genes coding for metabolic and electron transport proteins for energy conservation from tetrathionate as electron donor. RNA transcripts suggested that tetrathionate was hydrolyzed by the tetH1 gene product to form thiosulfate, elemental sulfur and sulfate. Despite two of the genes being truncated, RNA transcripts for the SoxXYZAB complex had higher levels than for thiosulfate quinone oxidoreductase (doxDAgenes). However, a lack of heme-binding sites in soxX suggested that DoxDA was responsible for thiosulfate metabolism. Higher RNA transcript counts also suggested that elemental sulfur was metabolized by heterodisulfide reductase (hdrgenes) rather than sulfur oxygenase reductase (sor). The sulfite produced as a product of heterodisulfide reductase was suggested to be oxidized by a pathway involving the sat gene product or abiotically react with elemental sulfur to form thiosulfate. Finally, several electron transport complexes were involved in energy conservation. This study has elucidated the previously unknown At. ferrivorans tetrathionate metabolic pathway that is important in biomining. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Goodness-of-fit tests and model diagnostics for negative binomial regression of RNA sequencing data.

    PubMed

    Mi, Gu; Di, Yanming; Schafer, Daniel W

    2015-01-01

    This work is about assessing model adequacy for negative binomial (NB) regression, particularly (1) assessing the adequacy of the NB assumption, and (2) assessing the appropriateness of models for NB dispersion parameters. Tools for the first are appropriate for NB regression generally; those for the second are primarily intended for RNA sequencing (RNA-Seq) data analysis. The typically small number of biological samples and large number of genes in RNA-Seq analysis motivate us to address the trade-offs between robustness and statistical power using NB regression models. One widely-used power-saving strategy, for example, is to assume some commonalities of NB dispersion parameters across genes via simple models relating them to mean expression rates, and many such models have been proposed. As RNA-Seq analysis is becoming ever more popular, it is appropriate to make more thorough investigations into power and robustness of the resulting methods, and into practical tools for model assessment. In this article, we propose simulation-based statistical tests and diagnostic graphics to address model adequacy. We provide simulated and real data examples to illustrate that our proposed methods are effective for detecting the misspecification of the NB mean-variance relationship as well as judging the adequacy of fit of several NB dispersion models.

  6. A powerful and flexible approach to the analysis of RNA sequence count data

    PubMed Central

    Zhou, Yi-Hui; Xia, Kai; Wright, Fred A.

    2011-01-01

    Motivation: A number of penalization and shrinkage approaches have been proposed for the analysis of microarray gene expression data. Similar techniques are now routinely applied to RNA sequence transcriptional count data, although the value of such shrinkage has not been conclusively established. If penalization is desired, the explicit modeling of mean–variance relationships provides a flexible testing regimen that ‘borrows’ information across genes, while easily incorporating design effects and additional covariates. Results: We describe BBSeq, which incorporates two approaches: (i) a simple beta-binomial generalized linear model, which has not been extensively tested for RNA-Seq data and (ii) an extension of an expression mean–variance modeling approach to RNA-Seq data, involving modeling of the overdispersion as a function of the mean. Our approaches are flexible, allowing for general handling of discrete experimental factors and continuous covariates. We report comparisons with other alternate methods to handle RNA-Seq data. Although penalized methods have advantages for very small sample sizes, the beta-binomial generalized linear model, combined with simple outlier detection and testing approaches, appears to have favorable characteristics in power and flexibility. Availability: An R package containing examples and sample datasets is available at http://www.bios.unc.edu/research/genomic_software/BBSeq Contact: yzhou@bios.unc.edu; fwright@bios.unc.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:21810900

  7. A powerful and flexible approach to the analysis of RNA sequence count data.

    PubMed

    Zhou, Yi-Hui; Xia, Kai; Wright, Fred A

    2011-10-01

    A number of penalization and shrinkage approaches have been proposed for the analysis of microarray gene expression data. Similar techniques are now routinely applied to RNA sequence transcriptional count data, although the value of such shrinkage has not been conclusively established. If penalization is desired, the explicit modeling of mean-variance relationships provides a flexible testing regimen that 'borrows' information across genes, while easily incorporating design effects and additional covariates. We describe BBSeq, which incorporates two approaches: (i) a simple beta-binomial generalized linear model, which has not been extensively tested for RNA-Seq data and (ii) an extension of an expression mean-variance modeling approach to RNA-Seq data, involving modeling of the overdispersion as a function of the mean. Our approaches are flexible, allowing for general handling of discrete experimental factors and continuous covariates. We report comparisons with other alternate methods to handle RNA-Seq data. Although penalized methods have advantages for very small sample sizes, the beta-binomial generalized linear model, combined with simple outlier detection and testing approaches, appears to have favorable characteristics in power and flexibility. An R package containing examples and sample datasets is available at http://www.bios.unc.edu/research/genomic_software/BBSeq yzhou@bios.unc.edu; fwright@bios.unc.edu Supplementary data are available at Bioinformatics online.

  8. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

    1992-01-01

    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  9. Genome-wide evidence for local DNA methylation spreading from small RNA-targeted sequences in Arabidopsis.

    PubMed

    Ahmed, Ikhlak; Sarazin, Alexis; Bowler, Chris; Colot, Vincent; Quesneville, Hadi

    2011-09-01

    Transposable elements (TEs) and their relics play major roles in genome evolution. However, mobilization of TEs is usually deleterious and strongly repressed. In plants and mammals, this repression is typically associated with DNA methylation, but the relationship between this epigenetic mark and TE sequences has not been investigated systematically. Here, we present an improved annotation of TE sequences and use it to analyze genome-wide DNA methylation maps obtained at single-nucleotide resolution in Arabidopsis. We show that although the majority of TE sequences are methylated, ∼26% are not. Moreover, a significant fraction of TE sequences densely methylated at CG, CHG and CHH sites (where H = A, T or C) have no or few matching small interfering RNA (siRNAs) and are therefore unlikely to be targeted by the RNA-directed DNA methylation (RdDM) machinery. We provide evidence that these TE sequences acquire DNA methylation through spreading from adjacent siRNA-targeted regions. Further, we show that although both methylated and unmethylated TE sequences located in euchromatin tend to be more abundant closer to genes, this trend is least pronounced for methylated, siRNA-targeted TE sequences located 5' to genes. Based on these and other findings, we propose that spreading of DNA methylation through promoter regions explains at least in part the negative impact of siRNA-targeted TE sequences on neighboring gene expression.

  10. MicroRNA repertoire for functional genome research in tilapia identified by deep sequencing.

    PubMed

    Yan, Biao; Wang, Zhen-Hua; Zhu, Chang-Dong; Guo, Jin-Tao; Zhao, Jin-Liang

    2014-08-01

    The Nile tilapia (Oreochromis niloticus; Cichlidae) is an economically important species in aquaculture and occupies a prominent position in the aquaculture industry. MicroRNAs (miRNAs) are a class of noncoding RNAs that post-transcriptionally regulate gene expression involved in diverse biological and metabolic processes. To increase the repertoire of miRNAs characterized in tilapia, we used the Illumina/Solexa sequencing technology to sequence a small RNA library using pooled RNA sample isolated from the different developmental stages of tilapia. Bioinformatic analyses suggest that 197 conserved and 27 novel miRNAs are expressed in tilapia. Sequence alignments indicate that all tested miRNAs and miRNAs* are highly conserved across many species. In addition, we characterized the tissue expression patterns of five miRNAs using real-time quantitative PCR. We found that miR-1/206, miR-7/9, and miR-122 is abundantly expressed in muscle, brain, and liver, respectively, implying a potential role in the regulation of tissue differentiation or the maintenance of tissue identity. Overall, our results expand the number of tilapia miRNAs, and the discovery of miRNAs in tilapia genome contributes to a better understanding the role of miRNAs in regulating diverse biological processes.

  11. GC-rich coding sequences reduce transposon-like, small RNA-mediated transgene silencing.

    PubMed

    Sidorenko, Lyudmila V; Lee, Tzuu-Fen; Woosley, Aaron; Moskal, William A; Bevan, Scott A; Merlo, P Ann Owens; Walsh, Terence A; Wang, Xiujuan; Weaver, Staci; Glancy, Todd P; Wang, PoHao; Yang, Xiaozeng; Sriram, Shreedharan; Meyers, Blake C

    2017-11-01

    The molecular basis of transgene susceptibility to silencing is poorly characterized in plants; thus, we evaluated several transgene design parameters as means to reduce heritable transgene silencing. Analyses of Arabidopsis plants with transgenes encoding a microalgal polyunsaturated fatty acid (PUFA) synthase revealed that small RNA (sRNA)-mediated silencing, combined with the use of repetitive regulatory elements, led to aggressive transposon-like silencing of canola-biased PUFA synthase transgenes. Diversifying regulatory sequences and using native microalgal coding sequences (CDSs) with higher GC content improved transgene expression and resulted in a remarkable trans-generational stability via reduced accumulation of sRNAs and DNA methylation. Further experiments in maize with transgenes individually expressing three crystal (Cry) proteins from Bacillus thuringiensis (Bt) tested the impact of CDS recoding using different codon bias tables. Transgenes with higher GC content exhibited increased transcript and protein accumulation. These results demonstrate that the sequence composition of transgene CDSs can directly impact silencing, providing design strategies for increasing transgene expression levels and reducing risks of heritable loss of transgene expression.

  12. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing.

    PubMed

    Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  13. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    PubMed Central

    Naveed, Muhammad; Mubeen, Samavia; khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization. PMID:25477935

  14. Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3.

    PubMed

    Sánchez-Navarro, J A; Pallás, V

    1997-01-01

    The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

  15. Small RNA Library Preparation Method for Next-Generation Sequencing Using Chemical Modifications to Prevent Adapter Dimer Formation.

    PubMed

    Shore, Sabrina; Henderson, Jordana M; Lebedev, Alexandre; Salcedo, Michelle P; Zon, Gerald; McCaffrey, Anton P; Paul, Natasha; Hogrefe, Richard I

    2016-01-01

    For most sample types, the automation of RNA and DNA sample preparation workflows enables high throughput next-generation sequencing (NGS) library preparation. Greater adoption of small RNA (sRNA) sequencing has been hindered by high sample input requirements and inherent ligation side products formed during library preparation. These side products, known as adapter dimer, are very similar in size to the tagged library. Most sRNA library preparation strategies thus employ a gel purification step to isolate tagged library from adapter dimer contaminants. At very low sample inputs, adapter dimer side products dominate the reaction and limit the sensitivity of this technique. Here we address the need for improved specificity of sRNA library preparation workflows with a novel library preparation approach that uses modified adapters to suppress adapter dimer formation. This workflow allows for lower sample inputs and elimination of the gel purification step, which in turn allows for an automatable sRNA library preparation protocol.

  16. De novo transcript sequence reconstruction from RNA-Seq: reference generation and analysis with Trinity

    PubMed Central

    Yassour, Moran; Grabherr, Manfred; Blood, Philip D.; Bowden, Joshua; Couger, Matthew Brian; Eccles, David; Li, Bo; Lieber, Matthias; MacManes, Matthew D.; Ott, Michael; Orvis, Joshua; Pochet, Nathalie; Strozzi, Francesco; Weeks, Nathan; Westerman, Rick; William, Thomas; Dewey, Colin N.; Henschel, Robert; LeDuc, Richard D.; Friedman, Nir; Regev, Aviv

    2013-01-01

    De novo assembly of RNA-Seq data allows us to study transcriptomes without the need for a genome sequence, such as in non-model organisms of ecological and evolutionary importance, cancer samples, or the microbiome. In this protocol, we describe the use of the Trinity platform for de novo transcriptome assembly from RNA-Seq data in non-model organisms. We also present Trinity’s supported companion utilities for downstream applications, including RSEM for transcript abundance estimation, R/Bioconductor packages for identifying differentially expressed transcripts across samples, and approaches to identify protein coding genes. In an included tutorial we provide a workflow for genome-independent transcriptome analysis leveraging the Trinity platform. The software, documentation and demonstrations are freely available from http://trinityrnaseq.sf.net. PMID:23845962

  17. Blood-induced differential gene expression in Anopheles dirus evaluated using RNA sequencing.

    PubMed

    Mongkol, W; Nguitragool, W; Sattabongkot, J; Kubera, A

    2018-06-08

    Malaria parasites are transmitted through blood feeding by female Anopheline mosquitoes. Unveiling the blood-feeding process will improve understanding of vector biology. Anopheles dirus (Diptera: Culicidae) is one of the primary malaria vectors in the Greater Mekong Subregion, the epicentre of malaria drug resistance. In this study, differential gene expression between sugar- and blood-fed An. dirus was investigated by RNA sequencing (RNA-seq). A total of 589 transcripts were found to be upregulated and 703 transcripts downregulated as a result of blood feeding. Transcriptional differences were found in genes involved in blood digestion, peritrophic matrix formation, oogenesis and vitellogenesis. The expression levels of several genes were validated by quantitative reverse transcription polymerase chain reaction. The present results provide better understanding of An. dirus biology in relation to its blood feeding. © 2018 The Royal Entomological Society.

  18. Single-cell RNA-sequencing: The future of genome biology is now

    PubMed Central

    Picelli, Simone

    2017-01-01

    ABSTRACT Genome-wide single-cell analysis represents the ultimate frontier of genomics research. In particular, single-cell RNA-sequencing (scRNA-seq) studies have been boosted in the last few years by an explosion of new technologies enabling the study of the transcriptomic landscape of thousands of single cells in complex multicellular organisms. More sensitive and automated methods are being continuously developed and promise to deliver better data quality and higher throughput with less hands-on time. The outstanding amount of knowledge that is going to be gained from present and future studies will have a profound impact in many aspects of our society, from the introduction of truly tailored cancer treatments, to a better understanding of antibiotic resistance and host-pathogen interactions; from the discovery of the mechanisms regulating stem cell differentiation to the characterization of the early event of human embryogenesis. PMID:27442339

  19. Exome Sequencing Identifies Mitochondrial Alanyl-tRNA Synthetase Mutations in Infantile Mitochondrial Cardiomyopathy

    PubMed Central

    Götz, Alexandra; Tyynismaa, Henna; Euro, Liliya; Ellonen, Pekka; Hyötyläinen, Tuulia; Ojala, Tiina; Hämäläinen, Riikka H.; Tommiska, Johanna; Raivio, Taneli; Oresic, Matej; Karikoski, Riitta; Tammela, Outi; Simola, Kalle O.J.; Paetau, Anders; Tyni, Tiina; Suomalainen, Anu

    2011-01-01

    Infantile cardiomyopathies are devastating fatal disorders of the neonatal period or the first year of life. Mitochondrial dysfunction is a common cause of this group of diseases, but the underlying gene defects have been characterized in only a minority of cases, because tissue specificity of the manifestation hampers functional cloning and the heterogeneity of causative factors hinders collection of informative family materials. We sequenced the exome of a patient who died at the age of 10 months of hypertrophic mitochondrial cardiomyopathy with combined cardiac respiratory chain complex I and IV deficiency. Rigorous data analysis allowed us to identify a homozygous missense mutation in AARS2, which we showed to encode the mitochondrial alanyl-tRNA synthetase (mtAlaRS). Two siblings from another family, both of whom died perinatally of hypertrophic cardiomyopathy, had the same mutation, compound heterozygous with another missense mutation. Protein structure modeling of mtAlaRS suggested that one of the mutations affected a unique tRNA recognition site in the editing domain, leading to incorrect tRNA aminoacylation, whereas the second mutation severely disturbed the catalytic function, preventing tRNA aminoacylation. We show here that mutations in AARS2 cause perinatal or infantile cardiomyopathy with near-total combined mitochondrial respiratory chain deficiency in the heart. Our results indicate that exome sequencing is a powerful tool for identifying mutations in single patients and allows recognition of the genetic background in single-gene disorders of variable clinical manifestation and tissue-specific disease. Furthermore, we show that mitochondrial disorders extend to prenatal life and are an important cause of early infantile cardiac failure. PMID:21549344

  20. Identification of Alternative Splicing and Fusion Transcripts in Non-Small Cell Lung Cancer by RNA Sequencing.

    PubMed

    Hong, Yoonki; Kim, Woo Jin; Bang, Chi Young; Lee, Jae Cheol; Oh, Yeon-Mok

    2016-04-01

    Lung cancer is the most common cause of cancer related death. Alterations in gene sequence, structure, and expression have an important role in the pathogenesis of lung cancer. Fusion genes and alternative splicing of cancer-related genes have the potential to be oncogenic. In the current study, we performed RNA-sequencing (RNA-seq) to investigate potential fusion genes and alternative splicing in non-small cell lung cancer. RNA was isolated from lung tissues obtained from 86 subjects with lung cancer. The RNA samples from lung cancer and normal tissues were processed with RNA-seq using the HiSeq 2000 system. Fusion genes were evaluated using Defuse and ChimeraScan. Candidate fusion transcripts were validated by Sanger sequencing. Alternative splicing was analyzed using multivariate analysis of transcript sequencing and validated using quantitative real time polymerase chain reaction. RNA-seq data identified oncogenic fusion genes EML4-ALK and SLC34A2-ROS1 in three of 86 normal-cancer paired samples. Nine distinct fusion transcripts were selected using DeFuse and ChimeraScan; of which, four fusion transcripts were validated by Sanger sequencing. In 33 squamous cell carcinoma, 29 tumor specific skipped exon events and six mutually exclusive exon events were identified. ITGB4 and PYCR1 were top genes that showed significant tumor specific splice variants. In conclusion, RNA-seq data identified novel potential fusion transcripts and splice variants. Further evaluation of their functional significance in the pathogenesis of lung cancer is required.

  1. RNAPattMatch: a web server for RNA sequence/structure motif detection based on pattern matching with flexible gaps

    PubMed Central

    Drory Retwitzer, Matan; Polishchuk, Maya; Churkin, Elena; Kifer, Ilona; Yakhini, Zohar; Barash, Danny

    2015-01-01

    Searching for RNA sequence-structure patterns is becoming an essential tool for RNA practitioners. Novel discoveries of regulatory non-coding RNAs in targeted organisms and the motivation to find them across a wide range of organisms have prompted the use of computational RNA pattern matching as an enhancement to sequence similarity. State-of-the-art programs differ by the flexibility of patterns allowed as queries and by their simplicity of use. In particular—no existing method is available as a user-friendly web server. A general program that searches for RNA sequence-structure patterns is RNA Structator. However, it is not available as a web server and does not provide the option to allow flexible gap pattern representation with an upper bound of the gap length being specified at any position in the sequence. Here, we introduce RNAPattMatch, a web-based application that is user friendly and makes sequence/structure RNA queries accessible to practitioners of various background and proficiency. It also extends RNA Structator and allows a more flexible variable gaps representation, in addition to analysis of results using energy minimization methods. RNAPattMatch service is available at http://www.cs.bgu.ac.il/rnapattmatch. A standalone version of the search tool is also available to download at the site. PMID:25940619

  2. Single-cell full-length total RNA sequencing uncovers dynamics of recursive splicing and enhancer RNAs.

    PubMed

    Hayashi, Tetsutaro; Ozaki, Haruka; Sasagawa, Yohei; Umeda, Mana; Danno, Hiroki; Nikaido, Itoshi

    2018-02-12

    Total RNA sequencing has been used to reveal poly(A) and non-poly(A) RNA expression, RNA processing and enhancer activity. To date, no method for full-length total RNA sequencing of single cells has been developed despite the potential of this technology for single-cell biology. Here we describe random displacement amplification sequencing (RamDA-seq), the first full-length total RNA-sequencing method for single cells. Compared with other methods, RamDA-seq shows high sensitivity to non-poly(A) RNA and near-complete full-length transcript coverage. Using RamDA-seq with differentiation time course samples of mouse embryonic stem cells, we reveal hundreds of dynamically regulated non-poly(A) transcripts, including histone transcripts and long noncoding RNA Neat1. Moreover, RamDA-seq profiles recursive splicing in >300-kb introns. RamDA-seq also detects enhancer RNAs and their cell type-specific activity in single cells. Taken together, we demonstrate that RamDA-seq could help investigate the dynamics of gene expression, RNA-processing events and transcriptional regulation in single cells.

  3. Transcriptomic analysis of Petunia hybrida in response to salt stress using high throughput RNA sequencing.

    PubMed

    Villarino, Gonzalo H; Bombarely, Aureliano; Giovannoni, James J; Scanlon, Michael J; Mattson, Neil S

    2014-01-01

    Salinity and drought stress are the primary cause of crop losses worldwide. In sodic saline soils sodium chloride (NaCl) disrupts normal plant growth and development. The complex interactions of plant systems with abiotic stress have made RNA sequencing a more holistic and appealing approach to study transcriptome level responses in a single cell and/or tissue. In this work, we determined the Petunia transcriptome response to NaCl stress by sequencing leaf samples and assembling 196 million Illumina reads with Trinity software. Using our reference transcriptome we identified more than 7,000 genes that were differentially expressed within 24 h of acute NaCl stress. The proposed transcriptome can also be used as an excellent tool for biological and bioinformatics in the absence of an available Petunia genome and it is available at the SOL Genomics Network (SGN) http://solgenomics.net. Genes related to regulation of reactive oxygen species, transport, and signal transductions as well as novel and undescribed transcripts were among those differentially expressed in response to salt stress. The candidate genes identified in this study can be applied as markers for breeding or to genetically engineer plants to enhance salt tolerance. Gene Ontology analyses indicated that most of the NaCl damage happened at 24 h inducing genotoxicity, affecting transport and organelles due to the high concentration of Na+ ions. Finally, we report a modification to the library preparation protocol whereby cDNA samples were bar-coded with non-HPLC purified primers, without affecting the quality and quantity of the RNA-seq data. The methodological improvement presented here could substantially reduce the cost of sample preparation for future high-throughput RNA sequencing experiments.

  4. Transcriptomic Analysis of Petunia hybrida in Response to Salt Stress Using High Throughput RNA Sequencing

    PubMed Central

    Villarino, Gonzalo H.; Bombarely, Aureliano; Giovannoni, James J.; Scanlon, Michael J.; Mattson, Neil S.

    2014-01-01

    Salinity and drought stress are the primary cause of crop losses worldwide. In sodic saline soils sodium chloride (NaCl) disrupts normal plant growth and development. The complex interactions of plant systems with abiotic stress have made RNA sequencing a more holistic and appealing approach to study transcriptome level responses in a single cell and/or tissue. In this work, we determined the Petunia transcriptome response to NaCl stress by sequencing leaf samples and assembling 196 million Illumina reads with Trinity software. Using our reference transcriptome we identified more than 7,000 genes that were differentially expressed within 24 h of acute NaCl stress. The proposed transcriptome can also be used as an excellent tool for biological and bioinformatics in the absence of an available Petunia genome and it is available at the SOL Genomics Network (SGN) http://solgenomics.net. Genes related to regulation of reactive oxygen species, transport, and signal transductions as well as novel and undescribed transcripts were among those differentially expressed in response to salt stress. The candidate genes identified in this study can be applied as markers for breeding or to genetically engineer plants to enhance salt tolerance. Gene Ontology analyses indicated that most of the NaCl damage happened at 24 h inducing genotoxicity, affecting transport and organelles due to the high concentration of Na+ ions. Finally, we report a modification to the library preparation protocol whereby cDNA samples were bar-coded with non-HPLC purified primers, without affecting the quality and quantity of the RNA-seq data. The methodological improvement presented here could substantially reduce the cost of sample preparation for future high-throughput RNA sequencing experiments. PMID:24722556

  5. CMSA: a heterogeneous CPU/GPU computing system for multiple similar RNA/DNA sequence alignment.

    PubMed

    Chen, Xi; Wang, Chen; Tang, Shanjiang; Yu, Ce; Zou, Quan

    2017-06-24

    The multiple sequence alignment (MSA) is a classic and powerful technique for sequence analysis in bioinformatics. With the rapid growth of biological datasets, MSA parallelization becomes necessary to keep its running time in an acceptable level. Although there are a lot of work on MSA problems, their approaches are either insufficient or contain some implicit assumptions that limit the generality of usage. First, the information of users' sequences, including the sizes of datasets and the lengths of sequences, can be of arbitrary values and are generally unknown before submitted, which are unfortunately ignored by previous work. Second, the center star strategy is suited for aligning similar sequences. But its first stage, center sequence selection, is highly time-consuming and requires further optimization. Moreover, given the heterogeneous CPU/GPU platform, prior studies consider the MSA parallelization on GPU devices only, making the CPUs idle during the computation. Co-run computation, however, can maximize the utilization of the computing resources by enabling the workload computation on both CPU and GPU simultaneously. This paper presents CMSA, a robust and efficient MSA system for large-scale datasets on the heterogeneous CPU/GPU platform. It performs and optimizes multiple sequence alignment automatically for users' submitted sequences without any assumptions. CMSA adopts the co-run computation model so that both CPU and GPU devices are fully utilized. Moreover, CMSA proposes an improved center star strategy that reduces the time complexity of its center sequence selection process from O(mn 2 ) to O(mn). The experimental results show that CMSA achieves an up to 11× speedup and outperforms the state-of-the-art software. CMSA focuses on the multiple similar RNA/DNA sequence alignment and proposes a novel bitmap based algorithm to improve the center star strategy. We can conclude that harvesting the high performance of modern GPU is a promising approach to

  6. DECIPHER, a Search-Based Approach to Chimera Identification for 16S rRNA Sequences

    PubMed Central

    Wright, Erik S.; Yilmaz, L. Safak

    2012-01-01

    DECIPHER is a new method for finding 16S rRNA chimeric sequences by the use of a search-based approach. The method is based upon detecting short fragments that are uncommon in the phylogenetic group where a query sequence is classified but frequently found in another phylogenetic group. The algorithm was calibrated for full sequences (fs_DECIPHER) and short sequences (ss_DECIPHER) and benchmarked against WigeoN (Pintail), ChimeraSlayer, and Uchime using artificially generated chimeras. Overall, ss_DECIPHER and Uchime provided the highest chimera detection for sequences 100 to 600 nucleotides long (79% and 81%, respectively), but Uchime's performance deteriorated for longer sequences, while ss_DECIPHER maintained a high detection rate (89%). Both methods had low false-positive rates (1.3% and 1.6%). The more conservative fs_DECIPHER, benchmarked only for sequences longer than 600 nucleotides, had an overall detection rate lower than that of ss_DECIPHER (75%) but higher than those of the other programs. In addition, fs_DECIPHER had the lowest false-positive rate among all the benchmarked programs (<0.20%). DECIPHER was outperformed only by ChimeraSlayer and Uchime when chimeras were formed from closely related parents (less than 10% divergence). Given the differences in the programs, it was possible to detect over 89% of all chimeras with just the combination of ss_DECIPHER and Uchime. Using fs_DECIPHER, we detected between 1% and 2% additional chimeras in the RDP, SILVA, and Greengenes databases from which chimeras had already been removed with Pintail or Bellerophon. DECIPHER was implemented in the R programming language and is directly accessible through a webpage or by downloading the program as an R package (http://DECIPHER.cee.wisc.edu). PMID:22101057

  7. Striking similarities in amino acid sequence among nonstructural proteins encoded by RNA viruses that have dissimilar genomic organization.

    PubMed Central

    Haseloff, J; Goelet, P; Zimmern, D; Ahlquist, P; Dasgupta, R; Kaesberg, P

    1984-01-01

    The plant viruses alfalfa mosaic virus (AMV) and brome mosaic virus (BMV) each divide their genetic information among three RNAs while tobacco mosaic virus (TMV) contains a single genomic RNA. Amino acid sequence comparisons suggest that the single proteins encoded by AMV RNA 1 and BMV RNA 1 and by AMV RNA 2 and BMV RNA 2 are related to the NH2-terminal two-thirds and the COOH-terminal one-third, respectively, of the largest protein encoded by TMV. Separating these two domains in the TMV RNA sequence is an amber termination codon, whose partial suppression allows translation of the downstream domain. Many of the residues that the TMV read-through domain and the segmented plant viruses have in common are also conserved in a read-through domain found in the nonstructural polyprotein of the animal alphaviruses Sindbis and Middelburg. We suggest that, despite substantial differences in gene organization and expression, all of these viruses use related proteins for common functions in RNA replication. Reassortment of functional modules of coding and regulatory sequence from preexisting viral or cellular sources, perhaps via RNA recombination, may be an important mechanism in RNA virus evolution. PMID:6611550

  8. Transcriptomic Modification in the Cerebral Cortex following Noninvasive Brain Stimulation: RNA-Sequencing Approach

    DTIC Science & Technology

    2017-04-20

    was attached to the skull in order to anchor the acrylic and maintain the integrity of the head cap. 2.3. Whole Transcriptome RNA-Sequencing...no. 12, article 550, 2014. [24] D. W. Huang, B. T. Sherman, and R. A. Lempicki, “Systematic and integrative analysis of large gene lists using DAVID...BMC Bioinformatics, vol. 9, article 559, 2008. [29] Z. Hu, E. S. Snitkin, and C. DeLisi, “VisANT: an integrative framework for networks in systems

  9. Pooling across cells to normalize single-cell RNA sequencing data with many zero counts.

    PubMed

    Lun, Aaron T L; Bach, Karsten; Marioni, John C

    2016-04-27

    Normalization of single-cell RNA sequencing data is necessary to eliminate cell-specific biases prior to downstream analyses. However, this is not straightforward for noisy single-cell data where many counts are zero. We present a novel approach where expression values are summed across pools of cells, and the summed values are used for normalization. Pool-based size factors are then deconvolved to yield cell-based factors. Our deconvolution approach outperforms existing methods for accurate normalization of cell-specific biases in simulated data. Similar behavior is observed in real data, where deconvolution improves the relevance of results of downstream analyses.

  10. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling

    PubMed Central

    Jones, Joshua D.; Chung, Betty Y.-W.; Siddell, Stuart G.; Brierley, Ian

    2016-01-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global “snap-shot” of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  11. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    PubMed

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  12. Synchronous detection of ebolavirus conserved RNA sequences and ebolavirus-encoded miRNA-like fragment based on a zwitterionic copper (II) metal-organic framework.

    PubMed

    Qiu, Gui-Hua; Weng, Zi-Hua; Hu, Pei-Pei; Duan, Wen-Jun; Xie, Bao-Ping; Sun, Bin; Tang, Xiao-Yan; Chen, Jin-Xiang

    2018-04-01

    From a three-dimensional (3D) metal-organic framework (MOF) of {[Cu(Cmdcp)(phen)(H 2 O)] 2 ·9H 2 O} n (1, H 3 CmdcpBr = N-carboxymethyl-(3,5-dicarboxyl)pyridinium bromide, phen = phenanthroline), a sensitive and selective fluorescence sensor has been developed for the simultaneous detection of ebolavirus conserved RNA sequences and ebolavirus-encoded microRNA-like (miRNA-like) fragment. The results from molecular dynamics simulation confirmed that MOF 1 absorbs carboxyfluorescein (FAM)-tagged and 5(6)-carboxyrhodamine, triethylammonium salt (ROX)-tagged probe ss-DNA (probe DNA, P-DNA) by π … π stacking and hydrogen bonding, as well as additional electrostatic interactions to form a sensing platform of P-DNAs@1 with quenched FAM and ROX fluorescence. In the presence of targeted ebolavirus conserved RNA sequences or ebolavirus-encoded miRNA-like fragment, the fluorophore-labeled P-DNA hybridizes with the analyte to give a P-DNA@RNA duplex and released from MOF 1, triggering a fluorescence recovery. Simultaneous detection of two target RNAs has also been realized by single and synchronous fluorescence analysis. The formed sensing platform shows high sensitivity for ebolavirus conserved RNA sequences and ebolavirus-encoded miRNA-like fragment with detection limits at the picomolar level and high selectivity without cross-reaction between the two probes. MOF 1 thus shows the potential as an effective fluorescent sensing platform for the synchronous detection of two ebolavirus-related sequences, and offer improved diagnostic accuracy of Ebola virus disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. RNA-sequencing quantification of hepatic ontogeny of phase-I enzymes in mice.

    PubMed

    Peng, Lai; Cui, Julia Y; Yoo, Byunggil; Gunewardena, Sumedha S; Lu, Hong; Klaassen, Curtis D; Zhong, Xiao-Bo

    2013-12-01

    Phase-I drug metabolizing enzymes catalyze reactions of hydrolysis, reduction, and oxidation of drugs and play a critical role in drug metabolism. However, the functions of most phase-I enzymes are not mature at birth, which markedly affects drug metabolism in newborns. Therefore, characterization of the expression profiles of phase-I enzymes and the underlying regulatory mechanisms during liver maturation is needed for better estimation of using drugs in pediatric patients. The mouse is an animal model widely used for studying the mechanisms in the regulation of developmental expression of phase-I genes. Therefore, we applied RNA sequencing to provide a "true quantification" of the mRNA expression of phase-I genes in the mouse liver during development. Liver samples of male C57BL/6 mice at 12 different ages from prenatal to adulthood were used for defining the ontogenic mRNA profiles of phase-I families, including hydrolysis: carboxylesterase (Ces), paraoxonase (Pon), and epoxide hydrolase (Ephx); reduction: aldo-keto reductase (Akr), quinone oxidoreductase (Nqo), and dihydropyrimidine dehydrogenase (Dpyd); and oxidation: alcohol dehydrogenase (Adh), aldehyde dehydrogenase (Aldh), flavin monooxygenases (Fmo), molybdenum hydroxylase (Aox and Xdh), cytochrome P450 (P450), and cytochrome P450 oxidoreductase (Por). Two rapidly increasing stages of total phase-I gene expression after birth reflect functional transition of the liver during development. Diverse expression patterns were identified, and some large gene families contained the mRNA of genes that are enriched at different stages of development. Our study reveals the mRNA abundance of phase-I genes in the mouse liver during development and provides a valuable foundation for mechanistic studies in the future.

  14. High-throughput sequencing methods to study neuronal RNA-protein interactions.

    PubMed

    Ule, Jernej

    2009-12-01

    UV-cross-linking and RNase protection, combined with high-throughput sequencing, have provided global maps of RNA sites bound by individual proteins or ribosomes. Using a stringent purification protocol, UV-CLIP (UV-cross-linking and immunoprecipitation) was able to identify intronic and exonic sites bound by splicing regulators in mouse brain tissue. Ribosome profiling has been used to quantify ribosome density on budding yeast mRNAs under different environmental conditions. Post-transcriptional regulation in neurons requires high spatial and temporal precision, as is evident from the role of localized translational control in synaptic plasticity. It remains to be seen if the high-throughput methods can be applied quantitatively to study the dynamics of RNP (ribonucleoprotein) remodelling in specific neuronal populations during the neurodegenerative process. It is certain, however, that applications of new biochemical techniques followed by high-throughput sequencing will continue to provide important insights into the mechanisms of neuronal post-transcriptional regulation.

  15. Single cell RNA sequencing of stem cell-derived retinal ganglion cells.

    PubMed

    Daniszewski, Maciej; Senabouth, Anne; Nguyen, Quan H; Crombie, Duncan E; Lukowski, Samuel W; Kulkarni, Tejal; Sluch, Valentin M; Jabbari, Jafar S; Chamling, Xitiz; Zack, Donald J; Pébay, Alice; Powell, Joseph E; Hewitt, Alex W

    2018-02-13

    We used single cell sequencing technology to characterize the transcriptomes of 1,174 human embryonic stem cell-derived retinal ganglion cells (RGCs) at the single cell level. The human embryonic stem cell line BRN3B-mCherry (A81-H7), was differentiated to RGCs using a guided differentiation approach. Cells were harvested at day 36 and prepared for single cell RNA sequencing. Our data indicates the presence of three distinct subpopulations of cells, with various degrees of maturity. One cluster of 288 cells showed increased expression of genes involved in axon guidance together with semaphorin interactions, cell-extracellular matrix interactions and ECM proteoglycans, suggestive of a more mature RGC phenotype.

  16. A double-labeling procedure for sequence analysis of picomole amounts of nonradioactive RNA fragments.

    PubMed Central

    Gupta, R C; Randerath, E; Randerath, K

    1976-01-01

    A double-labeling procedure for sequence analysis of nonradioactive polyribonucleotides is detailed, which is based on controlled endonucleolytic degradation of 3'-terminally (3H)-labeled oligonucleotide-(3') dialcohols and 5"-terminal analysis of the partial (3H)-labeled fragments following their separation according to chain length by polyethyleneimine- (PEI-)cellulose TLC and detection by fluorography. Undesired nonradioactive partial digestion products are eliminated by periodate oxidation. The 5'-termini are assayed by enzymic incorporation of (32p)-label into the isolated fragments, enzymic release of (32p)-labeled nucleoside-(5') monophosphates, two-dimensional PEI-cellulose chromatography, and autoradiography. Using this procedure, as little as 0.1 - 0.3 A260 unit of tRNA is needed to sequence all fragments in complete ribonuclease T1 and A digests, whereas radioactive derivative methods previously described by us1-4 required 4 - 6 A260 units. Images PMID:826884

  17. Analysis of microRNA profile of Anopheles sinensis by deep sequencing and bioinformatic approaches.

    PubMed

    Feng, Xinyu; Zhou, Xiaojian; Zhou, Shuisen; Wang, Jingwen; Hu, Wei

    2018-03-12

    microRNAs (miRNAs) are small non-coding RNAs widely identified in many mosquitoes. They are reported to play important roles in development, differentiation and innate immunity. However, miRNAs in Anopheles sinensis, one of the Chinese malaria mosquitoes, remain largely unknown. We investigated the global miRNA expression profile of An. sinensis using Illumina Hiseq 2000 sequencing. Meanwhile, we applied a bioinformatic approach to identify potential miRNAs in An. sinensis. The identified miRNA profiles were compared and analyzed by two approaches. The selected miRNAs from the sequencing result and the bioinformatic approach were confirmed with qRT-PCR. Moreover, target prediction, GO annotation and pathway analysis were carried out to understand the role of miRNAs in An. sinensis. We identified 49 conserved miRNAs and 12 novel miRNAs by next-generation high-throughput sequencing technology. In contrast, 43 miRNAs were predicted by the bioinformatic approach, of which two were assigned as novel. Comparative analysis of miRNA profiles by two approaches showed that 21 miRNAs were shared between them. Twelve novel miRNAs did not match any known miRNAs of any organism, indicating that they are possibly species-specific. Forty miRNAs were found in many mosquito species, indicating that these miRNAs are evolutionally conserved and may have critical roles in the process of life. Both the selected known and novel miRNAs (asi-miR-281, asi-miR-184, asi-miR-14, asi-miR-nov5, asi-miR-nov4, asi-miR-9383, and asi-miR-2a) could be detected by quantitative real-time PCR (qRT-PCR) in the sequenced sample, and the expression patterns of these miRNAs measured by qRT-PCR were in concordance with the original miRNA sequencing data. The predicted targets for the known and the novel miRNAs covered many important biological roles and pathways indicating the diversity of miRNA functions. We also found 21 conserved miRNAs and eight counterparts of target immune pathway genes in An. sinensis

  18. Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

    PubMed

    Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

    1991-11-20

    A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

  19. Improving RNA-Seq expression estimation by modeling isoform- and exon-specific read sequencing rate.

    PubMed

    Liu, Xuejun; Shi, Xinxin; Chen, Chunlin; Zhang, Li

    2015-10-16

    The high-throughput sequencing technology, RNA-Seq, has been widely used to quantify gene and isoform expression in the study of transcriptome in recent years. Accurate expression measurement from the millions or billions of short generated reads is obstructed by difficulties. One is ambiguous mapping of reads to reference transcriptome caused by alternative splicing. This increases the uncertainty in estimating isoform expression. The other is non-uniformity of read distribution along the reference transcriptome due to positional, sequencing, mappability and other undiscovered sources of biases. This violates the uniform assumption of read distribution for many expression calculation approaches, such as the direct RPKM calculation and Poisson-based models. Many methods have been proposed to address these difficulties. Some approaches employ latent variable models to discover the underlying pattern of read sequencing. However, most of these methods make bias correction based on surrounding sequence contents and share the bias models by all genes. They therefore cannot estimate gene- and isoform-specific biases as revealed by recent studies. We propose a latent variable model, NLDMseq, to estimate gene and isoform expression. Our method adopts latent variables to model the unknown isoforms, from which reads originate, and the underlying percentage of multiple spliced variants. The isoform- and exon-specific read sequencing biases are modeled to account for the non-uniformity of read distribution, and are identified by utilizing the replicate information of multiple lanes of a single library run. We employ simulation and real data to verify the performance of our method in terms of accuracy in the calculation of gene and isoform expression. Results show that NLDMseq obtains competitive gene and isoform expression compared to popular alternatives. Finally, the proposed method is applied to the detection of differential expression (DE) to show its usefulness in the

  20. Comprehensive processing of high-throughput small RNA sequencing data including quality checking, normalization, and differential expression analysis using the UEA sRNA Workbench

    PubMed Central

    Beckers, Matthew; Mohorianu, Irina; Stocks, Matthew; Applegate, Christopher; Dalmay, Tamas; Moulton, Vincent

    2017-01-01

    Recently, high-throughput sequencing (HTS) has revealed compelling details about the small RNA (sRNA) population in eukaryotes. These 20 to 25 nt noncoding RNAs can influence gene expression by acting as guides for the sequence-specific regulatory mechanism known as RNA silencing. The increase in sequencing depth and number of samples per project enables a better understanding of the role sRNAs play by facilitating the study of expression patterns. However, the intricacy of the biological hypotheses coupled with a lack of appropriate tools often leads to inadequate mining of the available data and thus, an incomplete description of the biological mechanisms involved. To enable a comprehensive study of differential expression in sRNA data sets, we present a new interactive pipeline that guides researchers through the various stages of data preprocessing and analysis. This includes various tools, some of which we specifically developed for sRNA analysis, for quality checking and normalization of sRNA samples as well as tools for the detection of differentially expressed sRNAs and identification of the resulting expression patterns. The pipeline is available within the UEA sRNA Workbench, a user-friendly software package for the processing of sRNA data sets. We demonstrate the use of the pipeline on a H. sapiens data set; additional examples on a B. terrestris data set and on an A. thaliana data set are described in the Supplemental Information. A comparison with existing approaches is also included, which exemplifies some of the issues that need to be addressed for sRNA analysis and how the new pipeline may be used to do this. PMID:28289155

  1. An optimized methodology for whole genome sequencing of RNA respiratory viruses from nasopharyngeal aspirates.

    PubMed

    Goya, Stephanie; Valinotto, Laura E; Tittarelli, Estefania; Rojo, Gabriel L; Nabaes Jodar, Mercedes S; Greninger, Alexander L; Zaiat, Jonathan J; Marti, Marcelo A; Mistchenko, Alicia S; Viegas, Mariana

    2018-01-01

    Over the last decade, the number of viral genome sequences deposited in available databases has grown exponentially. However, sequencing methodology vary widely and many published works have relied on viral enrichment by viral culture or nucleic acid amplification with specific primers rather than through unbiased techniques such as metagenomics. The genome of RNA viruses is highly variable and these enrichment methodologies may be difficult to achieve or may bias the results. In order to obtain genomic sequences of human respiratory syncytial virus (HRSV) from positive nasopharyngeal aspirates diverse methodologies were evaluated and compared. A total of 29 nearly complete and complete viral genomes were obtained. The best performance was achieved with a DNase I treatment to the RNA directly extracted from the nasopharyngeal aspirate (NPA), sequence-independent single-primer amplification (SISPA) and library preparation performed with Nextera XT DNA Library Prep Kit with manual normalization. An average of 633,789 and 1,674,845 filtered reads per library were obtained with MiSeq and NextSeq 500 platforms, respectively. The higher output of NextSeq 500 was accompanied by the increasing of duplicated reads percentage generated during SISPA (from an average of 1.5% duplicated viral reads in MiSeq to an average of 74% in NextSeq 500). HRSV genome recovery was not affected by the presence or absence of duplicated reads but the computational demand during the analysis was increased. Considering that only samples with viral load ≥ E+06 copies/ml NPA were tested, no correlation between sample viral loads and number of total filtered reads was observed, nor with the mapped viral reads. The HRSV genomes showed a mean coverage of 98.46% with the best methodology. In addition, genomes of human metapneumovirus (HMPV), human rhinovirus (HRV) and human parainfluenza virus types 1-3 (HPIV1-3) were also obtained with the selected optimal methodology.

  2. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  3. RNA Sequencing Analysis of the Gametophyte Transcriptome from the Liverwort, Marchantia polymorpha

    PubMed Central

    Sharma, Niharika; Jung, Chol-Hee; Bhalla, Prem L.; Singh, Mohan B.

    2014-01-01

    The liverwort Marchantia polymorpha is a member of the most basal lineage of land plants (embryophytes) and likely retains many ancestral morphological, physiological and molecular characteristics. Despite its phylogenetic importance and the availability of previous EST studies, M. polymorpha’s lack of economic importance limits accessible genomic resources for this species. We employed Illumina RNA-Seq technology to sequence the gametophyte transcriptome of M. polymorpha. cDNA libraries from 6 different male and female developmental tissues were sequenced to delineate a global view of the M. polymorpha transcriptome. Approximately 80 million short reads were obtained and assembled into a non-redundant set of 46,533 transcripts (> = 200 bp) from 46,070 loci. The average length and the N50 length of the transcripts were 757 bp and 471 bp, respectively. Sequence comparison of assembled transcripts with non-redundant proteins from embryophytes resulted in the annotation of 43% of the transcripts. The transcripts were also compared with M. polymorpha expressed sequence tags (ESTs), and approximately 69.5% of the transcripts appeared to be novel. Twenty-one percent of the transcripts were assigned GO terms to improve annotation. In addition, 6,112 simple sequence repeats (SSRs) were identified as potential molecular markers, which may be useful in studies of genetic diversity. A comparative genomics approach revealed that a substantial proportion of the genes (35.5%) expressed in M. polymorpha were conserved across phylogenetically related species, such as Selaginella and Physcomitrella, and identified 580 genes that are potentially unique to liverworts. Our study presents an extensive amount of novel sequence information for M. polymorpha. This information will serve as a valuable genomics resource for further molecular, developmental and comparative evolutionary studies, as well as for the isolation and characterization of functional genes that are involved in

  4. An efficient and high fidelity method for amplification, cloning and sequencing of complete tospovirus genomic RNA segments

    USDA-ARS?s Scientific Manuscript database

    Amplification and sequencing of the complete M- and S-RNA segments of Tomato spotted wilt virus and Impatiens necrotic spot virus as a single fragment is useful for whole genome sequencing of tospoviruses co-infecting a single host plant. It avoids issues associated with overlapping amplicon-based ...

  5. Identification of the bacterial etiology of culture-negative endocarditis by amplification and sequencing of a small ribosomal RNA gene.

    PubMed

    Khulordava, Irakli; Miller, Geraldine; Haas, David; Li, Haijing; McKinsey, Joel; Vanderende, Daniel; Tang, Yi-Wei

    2003-05-01

    We report two cases of culture-negative bacterial endocarditis in which the organisms were identified by amplification and sequencing of the bacterial 16S rRNA gene. These results support an important role for polymerase chain reaction followed by direct sequencing to determine the etiology of culture-negative bacterial endocarditis and to guide appropriate antimicrobial therapy.

  6. Specific binding of a HeLa cell nuclear protein to RNA sequences in the human immunodeficiency virus transactivating region.

    PubMed Central

    Gaynor, R; Soultanakis, E; Kuwabara, M; Garcia, J; Sigman, D S

    1989-01-01

    The transactivator protein, tat, encoded by the human immunodeficiency virus is a key regulator of viral transcription. Activation by the tat protein requires sequences downstream of the transcription initiation site called the transactivating region (TAR). RNA derived from the TAR is capable of forming a stable stem-loop structure and the maintenance of both the stem structure and the loop sequences located between +19 and +44 is required for complete in vivo activation by tat. Gel retardation assays with RNA from both wild-type and mutant TAR constructs generated in vitro with SP6 polymerase indicated specific binding of HeLa nuclear proteins to the TAR. To characterize this RNA-protein interaction, a method of chemical "imprinting" has been developed using photoactivated uranyl acetate as the nucleolytic agent. This reagent nicks RNA under physiological conditions at all four nucleotides in a reaction that is independent of sequence and secondary structure. Specific interaction of cellular proteins with TAR RNA could be detected by enhanced cleavages or imprints surrounding the loop region. Mutations that either disrupted stem base-pairing or extensively changed the primary sequence resulted in alterations in the cleavage pattern of the TAR RNA. Structural features of the TAR RNA stem-loop essential for tat activation are also required for specific binding of the HeLa cell nuclear protein. Images PMID:2544877

  7. Phylogeny of the Haplosporidia (Eukaryota: Alveolata) based on small subunit ribosomal RNA gene sequence.

    PubMed

    Flores, B S; Siddall, M E; Burreson, E M

    1996-08-01

    The phylogenetic position of the phylum Haplosporidia was investigated with the complete small subunit rRNA gene sequences from 5 species in the phylum: Haplosporidium nelsoni and Haplosporidium costale, parasites of the eastern oyster Crassostrea virginica; Haplosporidium louisiana, a parasite of the mudcrab Panopeus herbstii; Minchinia teredinis, a parasite of shipworms (Teredo spp.) and Urosporidium crescens, a hyperparasite found in metacercariae of the trematode Megalophallus sp. in the blue crab, Callinectes sapidus. Multiple alignments of small subunit rRNA gene sequences included the 5 haplosporidian taxa and 14 taxa in the alveolate phyla Ciliophora, Dinoflagellida, and Apicomplexa. Maximum parsimony analysis placed the phylum Haplosporidia as a monophyletic group within the alveolate clade, as a taxon of equal rank with the other 3 alveolate phyla, and as a sister taxon to the clade composed of the phyla Dinoflagellida and Apicomplexa. Transversionally weighted parsimony placed the haplosporidians as a sister taxon to the ciliates. A separate analysis focused on the relationships of species in the genus Haplosporidium. Analyses were conducted with the haplosporidians as a functional ingroup, using each of the alveolate phyla individually as functional outgroups. The results indicated that species in the genus Haplosporidium do not form a monophyletic assemblage. As such, the present morphological criteria for distinguishing the genera Haplosporidium and Minchinia are insufficient.

  8. QUANTIFYING ALTERNATIVE SPLICING FROM PAIRED-END RNA-SEQUENCING DATA.

    PubMed

    Rossell, David; Stephan-Otto Attolini, Camille; Kroiss, Manuel; Stöcker, Almond

    2014-03-01

    RNA-sequencing has revolutionized biomedical research and, in particular, our ability to study gene alternative splicing. The problem has important implications for human health, as alternative splicing may be involved in malfunctions at the cellular level and multiple diseases. However, the high-dimensional nature of the data and the existence of experimental biases pose serious data analysis challenges. We find that the standard data summaries used to study alternative splicing are severely limited, as they ignore a substantial amount of valuable information. Current data analysis methods are based on such summaries and are hence sub-optimal. Further, they have limited flexibility in accounting for technical biases. We propose novel data summaries and a Bayesian modeling framework that overcome these limitations and determine biases in a non-parametric, highly flexible manner. These summaries adapt naturally to the rapid improvements in sequencing technology. We provide efficient point estimates and uncertainty assessments. The approach allows to study alternative splicing patterns for individual samples and can also be the basis for downstream analyses. We found a several fold improvement in estimation mean square error compared popular approaches in simulations, and substantially higher consistency between replicates in experimental data. Our findings indicate the need for adjusting the routine summarization and analysis of alternative splicing RNA-seq studies. We provide a software implementation in the R package casper.

  9. Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

    SciTech Connect

    Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio

    2008-08-15

    The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, onlymore » mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library.« less

  10. Uncovering microRNA-mediated response to SO2 stress in Arabidopsis thaliana by deep sequencing.

    PubMed

    Li, Lihong; Xue, Meizhao; Yi, Huilan

    2016-10-05

    Sulfur dioxide (SO2) is a major air pollutant and has significant impacts on plants. MicroRNAs (miRNAs) are a class of gene expression regulators that play important roles in response to environmental stresses. In this study, deep sequencing was used for genome-wide identification of miRNAs and their expression profiles in response to SO2 stress in Arabidopsis thaliana shoots. A total of 27 conserved miRNAs and 5 novel miRNAs were found to be differentially expressed under SO2 stress. qRT-PCR analysis showed mostly negative correlation between miRNA accumulation and target gene mRNA abundance, suggesting regulatory roles of these miRNAs during SO2 exposure. The target genes of SO2-responsive miRNAs encode transcription factors and proteins that regulate auxin signaling and stress response, and the miRNAs-mediated suppression of these genes could improve plant resistance to SO2 stress. Promoter sequence analysis of genes encoding SO2-responsive miRNAs showed that stress-responsive and phytohormone-related cis-regulatory elements occurred frequently, providing additional evidence of the involvement of miRNAs in adaption to SO2 stress. This study represents a comprehensive expression profiling of SO2-responsive miRNAs in Arabidopsis and broads our perspective on the ubiquitous regulatory roles of miRNAs under stress conditions. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Localization of migraine susceptibility genes in human brain by single-cell RNA sequencing.

    PubMed

    Renthal, William

    2018-01-01

    Background Migraine is a debilitating disorder characterized by severe headaches and associated neurological symptoms. A key challenge to understanding migraine has been the cellular complexity of the human brain and the multiple cell types implicated in its pathophysiology. The present study leverages recent advances in single-cell transcriptomics to localize the specific human brain cell types in which putative migraine susceptibility genes are expressed. Methods The cell-type specific expression of both familial and common migraine-associated genes was determined bioinformatically using data from 2,039 individual human brain cells across two published single-cell RNA sequencing datasets. Enrichment of migraine-associated genes was determined for each brain cell type. Results Analysis of single-brain cell RNA sequencing data from five major subtypes of cells in the human cortex (neurons, oligodendrocytes, astrocytes, microglia, and endothelial cells) indicates that over 40% of known migraine-associated genes are enriched in the expression profiles of a specific brain cell type. Further analysis of neuronal migraine-associated genes demonstrated that approximately 70% were significantly enriched in inhibitory neurons and 30% in excitatory neurons. Conclusions This study takes the next step in understanding the human brain cell types in which putative migraine susceptibility genes are expressed. Both familial and common migraine may arise from dysfunction of discrete cell types within the neurovascular unit, and localization of the affected cell type(s) in an individual patient may provide insight into to their susceptibility to migraine.

  12. Recovering complete mitochondrial genome sequences from RNA-Seq: A case study of Polytomella non-photosynthetic green algae.

    PubMed

    Tian, Yao; Smith, David Roy

    2016-05-01

    Thousands of mitochondrial genomes have been sequenced, but there are comparatively few available mitochondrial transcriptomes. This might soon be changing. High-throughput RNA sequencing (RNA-Seq) techniques have made it fast and cheap to generate massive amounts of mitochondrial transcriptomic data. Here, we explore the utility of RNA-Seq for assembling mitochondrial genomes and studying their expression patterns. Specifically, we investigate the mitochondrial transcriptomes from Polytomella non-photosynthetic green algae, which have among the smallest, most reduced mitochondrial genomes from the Archaeplastida as well as fragmented rRNA-coding regions, palindromic genes, and linear chromosomes with telomeres. Isolation of whole genomic RNA from the four known Polytomella species followed by Illumina paired-end sequencing generated enough mitochondrial-derived reads to easily recover almost-entire mitochondrial genome sequences. Read-mapping and coverage statistics also gave insights into Polytomella mitochondrial transcriptional architecture, revealing polycistronic transcripts and the expression of telomeres and palindromic genes. Ultimately, RNA-Seq is a promising, cost-effective technique for studying mitochondrial genetics, but it does have drawbacks, which are discussed. One of its greatest potentials, as shown here, is that it can be used to generate near-complete mitochondrial genome sequences, which could be particularly useful in situations where there is a lack of available mtDNA data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    PubMed

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  14. Optimization of High-Throughput Sequencing Kinetics for determining enzymatic rate constants of thousands of RNA substrates

    PubMed Central

    Niland, Courtney N.; Jankowsky, Eckhard; Harris, Michael E.

    2016-01-01

    Quantification of the specificity of RNA binding proteins and RNA processing enzymes is essential to understanding their fundamental roles in biological processes. High Throughput Sequencing Kinetics (HTS-Kin) uses high throughput sequencing and internal competition kinetics to simultaneously monitor the processing rate constants of thousands of substrates by RNA processing enzymes. This technique has provided unprecedented insight into the substrate specificity of the tRNA processing endonuclease ribonuclease P. Here, we investigate the accuracy and robustness of measurements associated with each step of the HTS-Kin procedure. We examine the effect of substrate concentration on the observed rate constant, determine the optimal kinetic parameters, and provide guidelines for reducing error in amplification of the substrate population. Importantly, we find that high-throughput sequencing, and experimental reproducibility contribute their own sources of error, and these are the main sources of imprecision in the quantified results when otherwise optimized guidelines are followed. PMID:27296633

  15. Defining the Transcriptional Landscape during Cytomegalovirus Latency with Single-Cell RNA Sequencing

    PubMed Central

    2018-01-01

    ABSTRACT Primary infection with human cytomegalovirus (HCMV) results in a lifelong infection due to its ability to establish latent infection, with one characterized viral reservoir being hematopoietic cells. Although reactivation from latency causes serious disease in immunocompromised individuals, our molecular understanding of latency is limited. Here, we delineate viral gene expression during natural HCMV persistent infection by analyzing the massive transcriptome RNA sequencing (RNA-seq) atlas generated by the Genotype-Tissue Expression (GTEx) project. This systematic analysis reveals that HCMV persistence in vivo is prevalent in diverse tissues. Notably, we find only viral transcripts that resemble gene expression during various stages of lytic infection with no evidence of any highly restricted latency-associated viral gene expression program. To further define the transcriptional landscape during HCMV latent infection, we also used single-cell RNA-seq and a tractable experimental latency model. In contrast to some current views on latency, we also find no evidence for any highly restricted latency-associated viral gene expression program. Instead, we reveal that latency-associated gene expression largely mirrors a late lytic viral program, albeit at much lower levels of expression. Overall, our work has the potential to revolutionize our understanding of HCMV persistence and suggests that latency is governed mainly by quantitative changes, with a limited number of qualitative changes, in viral gene expression. PMID:29535194

  16. Multiplexed droplet single-cell RNA-sequencing using natural genetic variation.

    PubMed

    Kang, Hyun Min; Subramaniam, Meena; Targ, Sasha; Nguyen, Michelle; Maliskova, Lenka; McCarthy, Elizabeth; Wan, Eunice; Wong, Simon; Byrnes, Lauren; Lanata, Cristina M; Gate, Rachel E; Mostafavi, Sara; Marson, Alexander; Zaitlen, Noah; Criswell, Lindsey A; Ye, Chun Jimmie

    2018-01-01

    Droplet single-cell RNA-sequencing (dscRNA-seq) has enabled rapid, massively parallel profiling of transcriptomes. However, assessing differential expression across multiple individuals has been hampered by inefficient sample processing and technical batch effects. Here we describe a computational tool, demuxlet, that harnesses natural genetic variation to determine the sample identity of each droplet containing a single cell (singlet) and detect droplets containing two cells (doublets). These capabilities enable multiplexed dscRNA-seq experiments in which cells from unrelated individuals are pooled and captured at higher throughput than in standard workflows. Using simulated data, we show that 50 single-nucleotide polymorphisms (SNPs) per cell are sufficient to assign 97% of singlets and identify 92% of doublets in pools of up to 64 individuals. Given genotyping data for each of eight pooled samples, demuxlet correctly recovers the sample identity of >99% of singlets and identifies doublets at rates consistent with previous estimates. We apply demuxlet to assess cell-type-specific changes in gene expression in 8 pooled lupus patient samples treated with interferon (IFN)-β and perform eQTL analysis on 23 pooled samples.

  17. RNA sequencing reveals pronounced changes in the noncoding transcriptome of aging synaptosomes.

    PubMed

    Chen, Bei Jun; Ueberham, Uwe; Mills, James D; Kirazov, Ludmil; Kirazov, Evgeni; Knobloch, Mara; Bochmann, Jana; Jendrek, Renate; Takenaka, Konii; Bliim, Nicola; Arendt, Thomas; Janitz, Michael

    2017-08-01

    Normal aging is associated with impairments in cognitive functions. These alterations are caused by diminutive changes in the biology of synapses, and ineffective neurotransmission, rather than loss of neurons. Hitherto, only a few studies, exploring molecular mechanisms of healthy brain aging in higher vertebrates, utilized synaptosomal fractions to survey local changes in aging-related transcriptome dynamics. Here we present, for the first time, a comparative analysis of the synaptosomes transcriptome in the aging mouse brain using RNA sequencing. Our results show changes in the expression of genes contributing to biological pathways related to neurite guidance, synaptosomal physiology, and RNA splicing. More intriguingly, we also discovered alterations in the expression of thousands of novel, unannotated lincRNAs during aging. Further, detailed characterization of the cleavage and polyadenylation factor I subunit 1 (Clp1) mRNA and protein expression indicates its increased expression in neuronal processes of hippocampal stratum radiatum in aging mice. Together, our study uncovers a new layer of transcriptional regulation which is targeted by aging within the local environment of interconnecting neuronal cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Single-cell RNA sequencing reveals gene expression signatures of breast cancer-associated endothelial cells.

    PubMed

    Sun, Zhengda; Wang, Chih-Yang; Lawson, Devon A; Kwek, Serena; Velozo, Hugo Gonzalez; Owyong, Mark; Lai, Ming-Derg; Fong, Lawrence; Wilson, Mark; Su, Hua; Werb, Zena; Cooke, Daniel L

    2018-02-16

    Tumor endothelial cells (TEC) play an indispensible role in tumor growth and metastasis although much of the detailed mechanism still remains elusive. In this study we characterized and compared the global gene expression profiles of TECs and control ECs isolated from human breast cancerous tissues and reduction mammoplasty tissues respectively by single cell RNA sequencing (scRNA-seq). Based on the qualified scRNA-seq libraries that we made, we found that 1302 genes were differentially expressed between these two EC phenotypes. Both principal component analysis (PCA) and heat map-based hierarchical clustering separated the cancerous versus control ECs as two distinctive clusters, and MetaCore disease biomarker analysis indicated that these differentially expressed genes are highly correlated with breast neoplasm diseases. Gene Set Enrichment Analysis software (GSEA) enriched these genes to extracellular matrix (ECM) signal pathways and highlighted 127 ECM-associated genes. External validation verified some of these ECM-associated genes are not only generally overexpressed in various cancer tissues but also specifically overexpressed in colorectal cancer ECs and lymphoma ECs. In conclusion, our data demonstrated that ECM-associated genes play pivotal roles in breast cancer EC biology and some of them could serve as potential TEC biomarkers for various cancers.

  19. Variant discovery in the sheepmeat odour and flavour in javanese fat tailed sheep using RNA sequencing

    NASA Astrophysics Data System (ADS)

    Abuzahra, M. A. M.; Jakaria; Listyarini, K.; Furqon, A.; Sumantri, C.; Uddin, M. J.; Gunawan, A.

    2018-05-01

    High-throughput RNA sequencing (RNA-Seq) reveals new challenges for the detection of transcriptome variants (SNPs) in different tissues and species. The aims of this study was to characterize a SNP discovery analysis in the sheep meat odour and flavour transcriptome using RNA-Seq. Six liver samples from divergent sheep meat odour and flavour were analyzed using the Illumina Genome Hiseq 2500 Analyzer. The SNP detection analysis revealed 142 SNPs in sheep meat samples, and a large number of those corresponded to differences between high and low sheep meat odour and flavour ovis genome assembly OAR v4.0. Among them, about 90.4% of genes had multiple polymorphisms within 12 genes (JAML, ANGPTL8, LOC101103463, SEPW1, SCN5A, LOC101113036, DOCK6, GTSE1, KIF12, KCTD17, KANK2, CYP2A6). Several of the SNPs (JAML, CYP2A6, SEPW1, and KIF12) found in this study could be included as suitable markers in genotyping platforms to perform association analyses in commercial populations and apply genomic selection protocols in the sheep meat production.

  20. Sequence-controlled RNA self-processing: computational design, biochemical analysis, and visualization by AFM

    PubMed Central

    Petkovic, Sonja; Badelt, Stefan; Flamm, Christoph; Delcea, Mihaela

    2015-01-01

    Reversible chemistry allowing for assembly and disassembly of molecular entities is important for biological self-organization. Thus, ribozymes that support both cleavage and formation of phosphodiester bonds may have contributed to the emergence of functional diversity and increasing complexity of regulatory RNAs in early life. We have previously engineered a variant of the hairpin ribozyme that shows how ribozymes may have circularized or extended their own length by forming concatemers. Using the Vienna RNA package, we now optimized this hairpin ribozyme variant and selected four different RNA sequences that were expected to circularize more efficiently or form longer concatemers upon transcription. (Two-dimensional) PAGE analysis confirms that (i) all four selected ribozymes are catalytically active and (ii) high yields of cyclic species are obtained. AFM imaging in combination with RNA structure prediction enabled us to calculate the distributions of monomers and self-concatenated dimers and trimers. Our results show that computationally optimized molecules do form reasonable amounts of trimers, which has not been observed for the original system so far, and we demonstrate that the combination of theoretical prediction, biochemical and physical analysis is a promising approach toward accurate prediction of ribozyme behavior and design of ribozymes with predefined functions. PMID:25999318

  1. Small RNA and transcriptome deep sequencing proffers insight into floral gene regulation in Rosa cultivars

    PubMed Central

    2012-01-01

    Background Roses (Rosa sp.), which belong to the family Rosaceae, are the most economically important ornamental plants—making up 30% of the floriculture market. However, given high demand for roses, rose breeding programs are limited in molecular resources which can greatly enhance and speed breeding efforts. A better understanding of important genes that contribute to important floral development and desired phenotypes will lead to improved rose cultivars. For this study, we analyzed rose miRNAs and the rose flower transcriptome in order to generate a database to expound upon current knowledge regarding regulation of important floral characteristics. A rose genetic database will enable comprehensive analysis of gene expression and regulation via miRNA among different Rosa cultivars. Results We produced more than 0.5 million reads from expressed sequences, totalling more than 110 million bp. From these, we generated 35,657, 31,434, 34,725, and 39,722 flower unigenes from Rosa hybrid: ‘Vital’, ‘Maroussia’, and ‘Sympathy’ and Rosa rugosa Thunb. , respectively. The unigenes were assigned functional annotations, domains, metabolic pathways, Gene Ontology (GO) terms, Plant Ontology (PO) terms, and MIPS Functional Catalogue (FunCat) terms. Rose flower transcripts were compared with genes from whole genome sequences of Rosaceae members (apple, strawberry, and peach) and grape. We also produced approximately 40 million small RNA reads from flower tissue for Rosa, representing 267 unique miRNA tags. Among identified miRNAs, 25 of them were novel and 242 of them were conserved miRNAs. Statistical analyses of miRNA profiles revealed both shared and species-specific miRNAs, which presumably effect flower development and phenotypes. Conclusions In this study, we constructed a Rose miRNA and transcriptome database, and we analyzed the miRNAs and transcriptome generated from the flower tissues of four Rosa cultivars. The database provides a comprehensive genetic

  2. [Screening specific recognition motif of RNA-binding proteins by SELEX in combination with next-generation sequencing technique].

    PubMed

    Zhang, Lu; Xu, Jinhao; Ma, Jinbiao

    2016-07-25

    RNA-binding protein exerts important biological function by specifically recognizing RNA motif. SELEX (Systematic evolution of ligands by exponential enrichment), an in vitro selection method, can obtain consensus motif with high-affinity and specificity for many target molecules from DNA or RNA libraries. Here, we combined SELEX with next-generation sequencing to study the protein-RNA interaction in vitro. A pool of RNAs with 20 bp random sequences were transcribed by T7 promoter, and target protein was inserted into plasmid containing SBP-tag, which can be captured by streptavidin beads. Through only one cycle, the specific RNA motif can be obtained, which dramatically improved the selection efficiency. Using this method, we found that human hnRNP A1 RRMs domain (UP1 domain) bound RNA motifs containing AGG and AG sequences. The EMSA experiment indicated that hnRNP A1 RRMs could bind the obtained RNA motif. Taken together, this method provides a rapid and effective method to study the RNA binding specificity of proteins.

  3. Exome sequencing coupled with mRNA analysis identifies NDUFAF6 as a Leigh gene.

    PubMed

    Bianciardi, Laura; Imperatore, Valentina; Fernandez-Vizarra, Erika; Lopomo, Angela; Falabella, Micol; Furini, Simone; Galluzzi, Paolo; Grosso, Salvatore; Zeviani, Massimo; Renieri, Alessandra; Mari, Francesca; Frullanti, Elisa

    2016-11-01

    We report here the case of a young male who started to show verbal fluency disturbance, clumsiness and gait anomalies at the age of 3.5years and presented bilateral striatal necrosis. Clinically, the diagnosis was compatible with Leigh syndrome but the underlying molecular defect remained elusive even after exome analysis using autosomal/X-linked recessive or de novo models. Dosage of respiratory chain activity on fibroblasts, but not in muscle, underlined a deficit in complex I. Re-analysis of heterozygous probably pathogenic variants, inherited from one healthy parent, identified the p.Ala178Pro in NDUFAF6, a complex I assembly factor. RNA analysis showed an almost mono-allelic expression of the mutated allele in blood and fibroblasts and puromycin treatment on cultured fibroblasts did not lead to the rescue of the maternal allele expression, not supporting the involvement of nonsense-mediated RNA decay mechanism. Complementation assay underlined a recovery of complex I activity after transduction of the wild-type gene. Since the second mutation was not detected and promoter methylation analysis resulted normal, we hypothesized a non-exonic event in the maternal allele affecting a regulatory element that, in conjunction with the paternal mutation, leads to the autosomal recessive disorder and the different allele expression in various tissues. This paper confirms NDUFAF6 as a genuine morbid gene and proposes the coupling of exome sequencing with mRNA analysis as a method useful for enhancing the exome sequencing detection rate when the simple application of classical inheritance models fails. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

    PubMed Central

    Schuster, W; Brennicke, A

    1987-01-01

    We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

  5. Sequencing of mRNA identifies re-expression of fetal splice variants in cardiac hypertrophy

    PubMed Central

    Ames, EG; Lawson, MJ; Mackey, AJ; Holmes, JW

    2013-01-01

    Cardiac hypertrophy has been well-characterized at the level of transcription. During cardiac hypertrophy, genes normally expressed primarily during fetal heart development are reexpressed, and this fetal gene program is believed to be a critical component of the hypertrophic process. Recently, alternative splicing of mRNA transcripts has been shown to be temporally regulated during heart development, leading us to consider whether fetal patterns of splicing also reappear during hypertrophy. We hypothesized that patterns of alternative splicing occurring during heart development are recapitulated during cardiac hypertrophy. Here we present a study of isoform expression during pressure-overload cardiac hypertrophy induced by 10 days of transverse aortic constriction (TAC) in rats and in developing fetal rat hearts compared to sham-operated adult rat hearts, using high-throughput sequencing of poly(A) tail mRNA. We find a striking degree of overlap between the isoforms expressed differentially in fetal and pressure-overloaded hearts compared to control: forty-four percent of the isoforms with significantly altered expression in TAC hearts are also expressed at significantly different levels in fetal hearts compared to control (P < 0.001). The isoforms that are shared between hypertrophy and fetal heart development are significantly enriched for genes involved in cytoskeletal organization, RNA processing, developmental processes, and metabolic enzymes. Our data strongly support the concept that mRNA splicing patterns normally associated with heart development recur as part of the hypertrophic response to pressure overload. These findings suggest that cardiac hypertrophy shares post-transcriptional as well as transcriptional regulatory mechanisms with fetal heart development. PMID:23688780

  6. Selective amplification and sequencing of cyclic phosphate-containing RNAs by the cP-RNA-seq method

    PubMed Central

    Honda, Shozo; Morichika, Keisuke; Kirino, Yohei

    2016-01-01

    RNA digestions catalyzed by many ribonucleases generate RNA fragments containing a 2′,3′-cyclic phosphate (cP) at their 3′-termini. However, standard RNA-seq methods are unable to accurately capture cP-containing RNAs because the cP inhibits the adapter ligation reaction. We recently developed a method named “cP-RNA-seq” that is able to selectively amplify and sequence cP-containing RNAs. Here we describe the cP-RNA-seq protocol in which the 3′-termini of all RNAs, except those containing a cP, are cleaved through a periodate treatment after phosphatase treatment, hence subsequent adapter ligation and cDNA amplification steps are exclusively applied to cP-containing RNAs. cP-RNA-seq takes ~6 d, excluding the time required for sequencing and bioinformatics analyses, such downstream assays are not covered in detail in this protocol. Biochemical validation of the existence of cP in the identified RNAs takes ~3 d. Even though the cP-RNA-seq method was developed to identify angiogenin-generating 5′-tRNA halves as a proof of principle, the method should be applicable to global identification of cP-containing RNA repertoires in various transcriptomes. PMID:26866791

  7. Selective amplification and sequencing of cyclic phosphate-containing RNAs by the cP-RNA-seq method.

    PubMed

    Honda, Shozo; Morichika, Keisuke; Kirino, Yohei

    2016-03-01

    RNA digestions catalyzed by many ribonucleases generate RNA fragments that contain a 2',3'-cyclic phosphate (cP) at their 3' termini. However, standard RNA-seq methods are unable to accurately capture cP-containing RNAs because the cP inhibits the adapter ligation reaction. We recently developed a method named cP-RNA-seq that is able to selectively amplify and sequence cP-containing RNAs. Here we describe the cP-RNA-seq protocol in which the 3' termini of all RNAs, except those containing a cP, are cleaved through a periodate treatment after phosphatase treatment; hence, subsequent adapter ligation and cDNA amplification steps are exclusively applied to cP-containing RNAs. cP-RNA-seq takes ∼6 d, excluding the time required for sequencing and bioinformatics analyses, which are not covered in detail in this protocol. Biochemical validation of the existence of cP in the identified RNAs takes ∼3 d. Even though the cP-RNA-seq method was developed to identify angiogenin-generating 5'-tRNA halves as a proof of principle, the method should be applicable to global identification of cP-containing RNA repertoires in various transcriptomes.

  8. RBM24 stabilizes hepatitis B virus pregenomic RNA but inhibits core protein translation by targeting the terminal redundancy sequence.

    PubMed

    Yao, Yongxuan; Yang, Bo; Cao, Huang; Zhao, Kaitao; Yuan, Yifei; Chen, Yingshan; Zhang, Zhenhua; Wang, Yun; Pei, Rongjuan; Chen, Jizheng; Hu, Xue; Zhou, Yuan; Lu, Mengji; Wu, Chunchen; Chen, Xinwen

    2018-05-14

    The terminal redundancy (TR) sequence of the 3.5-kb hepatitis B virus (HBV) RNA contains sites that govern many crucial functions in the viral life cycle, including polyadenylation, translation, RNA packaging, and DNA synthesis. In the present study, RNA-binding motif protein 24 (RBM24) is shown to be involved in the modulation of HBV replication by targeting the TR of HBV RNA. In HBV-transfected hepatoma cell lines, both knockdown and overexpression of RBM24 led to decreased HBV replication and transcription. Ectopic expression of RBM24 inhibited HBV replication, which was partly restored by knockdown of RBM24, indicating that a proper level of RBM24 was required for HBV replication. The regulation of RBM24 of HBV replication and translation was achieved by the interaction between the RNA-binding domains of RBM24 and both the 5' and 3' TR of 3.5-kb RNA. RBM24 interacted with the 5' TR of HBV pregenomic RNA (pgRNA) to block 80S ribosome assembly on HBV pgRNA and thus inhibited core protein translation, whereas the interaction between RBM24 and the 3' TR enhanced the stability of HBV RNA. Finally, the regulatory function of RBM24 on HBV replication was further confirmed in a HBV infection model. In conclusion, the present study demonstrates the dual functions of RBM24 by interacting with different TRs of viral RNA and reveals that RBM24 is an important host gene for HBV replication.

  9. Elucidating the Small Regulatory RNA Repertoire of the Sea Anemone Anemonia viridis Based on Whole Genome and Small RNA Sequencing

    PubMed Central

    Patel, Hardip; Forêt, Sylvain; Karlsen, Bård Ove; Jørgensen, Tor Erik; Hall-Spencer, Jason M

    2018-01-01

    Abstract Cnidarians harbor a variety of small regulatory RNAs that include microRNAs (miRNAs) and PIWI-interacting RNAs (piRNAs), but detailed information is limited. Here, we report the identification and expression of novel miRNAs and putative piRNAs, as well as their genomic loci, in the symbiotic sea anemone Anemonia viridis. We generated a draft assembly of the A. viridis genome with putative size of 313 Mb that appeared to be composed of about 36% repeats, including known transposable elements. We detected approximately equal fractions of DNA transposons and retrotransposons. Deep sequencing of small RNA libraries constructed from A. viridis adults sampled at a natural CO2 gradient off Vulcano Island, Italy, identified 70 distinct miRNAs. Eight were homologous to previously reported miRNAs in cnidarians, whereas 62 appeared novel. Nine miRNAs were recognized as differentially expressed along the natural seawater pH gradient. We found a highly abundant and diverse population of piRNAs, with a substantial fraction showing ping–pong signatures. We identified nearly 22% putative piRNAs potentially targeting transposable elements within the A. viridis genome. The A. viridis genome appeared similar in size to that of other hexacorals with a very high divergence of transposable elements resembling that of the sea anemone genus Exaiptasia. The genome encodes and expresses a high number of small regulatory RNAs, which include novel miRNAs and piRNAs. Differentially expressed small RNAs along the seawater pH gradient indicated regulatory gene responses to environmental stressors. PMID:29385567

  10. Investigation of Experimental Factors That Underlie BRCA1/2 mRNA Isoform Expression Variation: Recommendations for Utilizing Targeted RNA Sequencing to Evaluate Potential Spliceogenic Variants.

    PubMed

    Lattimore, Vanessa L; Pearson, John F; Currie, Margaret J; Spurdle, Amanda B; Robinson, Bridget A; Walker, Logan C

    2018-01-01

    PCR-based RNA splicing assays are commonly used in diagnostic and research settings to assess the potential effects of variants of uncertain clinical significance in BRCA1 and BRCA2 . The Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) consortium completed a multicentre investigation to evaluate differences in assay design and the integrity of published data, raising a number of methodological questions associated with cell culture conditions and PCR-based protocols. We utilized targeted RNA-seq to re-assess BRCA1 and BRCA2 mRNA isoform expression patterns in lymphoblastoid cell lines (LCLs) previously used in the multicentre ENIGMA study. Capture of the targeted cDNA sequences was carried out using 34 BRCA1 and 28 BRCA2 oligonucleotides from the Illumina Truseq Targeted RNA Expression platform. Our results show that targeted RNA-seq analysis of LCLs overcomes many of the methodology limitations associated with PCR-based assays leading us to make the following observations and recommendations: (1) technical replicates ( n  > 2) of variant carriers to capture methodology induced variability associated with RNA-seq assays, (2) LCLs can undergo multiple freeze/thaw cycles and can be cultured up to 2 weeks without noticeably influencing isoform expression levels, (3) nonsense-mediated decay inhibitors are essential prior to splicing assays for comprehensive mRNA isoform detection, (4) quantitative assessment of exon:exon junction levels across BRCA1 and BRCA2 can help distinguish between normal and aberrant isoform expression patterns. Experimentally derived recommendations from this study will facilitate the application of targeted RNA-seq platforms for the quantitation of BRCA1 and BRCA2 mRNA aberrations associated with sequence variants of uncertain clinical significance.

  11. Investigation of Experimental Factors That Underlie BRCA1/2 mRNA Isoform Expression Variation: Recommendations for Utilizing Targeted RNA Sequencing to Evaluate Potential Spliceogenic Variants

    PubMed Central

    Lattimore, Vanessa L.; Pearson, John F.; Currie, Margaret J.; Spurdle, Amanda B.; Robinson, Bridget A.; Walker, Logan C.

    2018-01-01

    PCR-based RNA splicing assays are commonly used in diagnostic and research settings to assess the potential effects of variants of uncertain clinical significance in BRCA1 and BRCA2. The Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) consortium completed a multicentre investigation to evaluate differences in assay design and the integrity of published data, raising a number of methodological questions associated with cell culture conditions and PCR-based protocols. We utilized targeted RNA-seq to re-assess BRCA1 and BRCA2 mRNA isoform expression patterns in lymphoblastoid cell lines (LCLs) previously used in the multicentre ENIGMA study. Capture of the targeted cDNA sequences was carried out using 34 BRCA1 and 28 BRCA2 oligonucleotides from the Illumina Truseq Targeted RNA Expression platform. Our results show that targeted RNA-seq analysis of LCLs overcomes many of the methodology limitations associated with PCR-based assays leading us to make the following observations and recommendations: (1) technical replicates (n > 2) of variant carriers to capture methodology induced variability associated with RNA-seq assays, (2) LCLs can undergo multiple freeze/thaw cycles and can be cultured up to 2 weeks without noticeably influencing isoform expression levels, (3) nonsense-mediated decay inhibitors are essential prior to splicing assays for comprehensive mRNA isoform detection, (4) quantitative assessment of exon:exon junction levels across BRCA1 and BRCA2 can help distinguish between normal and aberrant isoform expression patterns. Experimentally derived recommendations from this study will facilitate the application of targeted RNA-seq platforms for the quantitation of BRCA1 and BRCA2 mRNA aberrations associated with sequence variants of uncertain clinical significance. PMID:29774201

  12. Fast selection of miRNA candidates based on large-scale pre-computed MFE sets of randomized sequences.

    PubMed

    Warris, Sven; Boymans, Sander; Muiser, Iwe; Noback, Michiel; Krijnen, Wim; Nap, Jan-Peter

    2014-01-13

    Small RNAs are important regulators of genome function, yet their prediction in genomes is still a major computational challenge. Statistical analyses of pre-miRNA sequences indicated that their 2D structure tends to have a minimal free energy (MFE) significantly lower than MFE values of equivalently randomized sequences with the same nucleotide composition, in contrast to other classes of non-coding RNA. The computation of many MFEs is, however, too intensive to allow for genome-wide screenings. Using a local grid infrastructure, MFE distributions of random sequences were pre-calculated on a large scale. These distributions follow a normal distribution and can be used to determine the MFE distribution for any given sequence composition by interpolation. It allows on-the-fly calculation of the normal distribution for any candidate sequence composition. The speedup achieved makes genome-wide screening with this characteristic of a pre-miRNA sequence practical. Although this particular property alone will not be able to distinguish miRNAs from other sequences sufficiently discriminative, the MFE-based P-value should be added to the parameters of choice to be included in the selection of potential miRNA candidates for experimental verification.

  13. Fast selection of miRNA candidates based on large-scale pre-computed MFE sets of randomized sequences

    PubMed Central

    2014-01-01

    Background Small RNAs are important regulators of genome function, yet their prediction in genomes is still a major computational challenge. Statistical analyses of pre-miRNA sequences indicated that their 2D structure tends to have a minimal free energy (MFE) significantly lower than MFE values of equivalently randomized sequences with the same nucleotide composition, in contrast to other classes of non-coding RNA. The computation of many MFEs is, however, too intensive to allow for genome-wide screenings. Results Using a local grid infrastructure, MFE distributions of random sequences were pre-calculated on a large scale. These distributions follow a normal distribution and can be used to determine the MFE distribution for any given sequence composition by interpolation. It allows on-the-fly calculation of the normal distribution for any candidate sequence composition. Conclusion The speedup achieved makes genome-wide screening with this characteristic of a pre-miRNA sequence practical. Although this particular property alone will not be able to distinguish miRNAs from other sequences sufficiently discriminative, the MFE-based P-value should be added to the parameters of choice to be included in the selection of potential miRNA candidates for experimental verification. PMID:24418292

  14. Sequence Variation in the Small-Subunit rRNA Gene of Plasmodium malariae and Prevalence of Isolates with the Variant Sequence in Sichuan, China

    PubMed Central

    Liu, Qing; Zhu, Shenghua; Mizuno, Sahoko; Kimura, Masatsugu; Liu, Peina; Isomura, Shin; Wang, Xingzhen; Kawamoto, Fumihiko

    1998-01-01

    By two PCR-based diagnostic methods, Plasmodium malariae infections have been rediscovered at two foci in the Sichuan province of China, a region where no cases of P. malariae have been officially reported for the last 2 decades. In addition, a variant form of P. malariae which has a deletion of 19 bp and seven substitutions of base pairs in the target sequence of the small-subunit (SSU) rRNA gene was detected with high frequency. Alignment analysis of Plasmodium sp. SSU rRNA gene sequences revealed that the 5′ region of the variant sequence is identical to that of P. vivax or P. knowlesi and its 3′ region is identical to that of P. malariae. The same sequence variations were also found in P. malariae isolates collected along the Thai-Myanmar border, suggesting a wide distribution of this variant form from southern China to Southeast Asia. PMID:9774600

  15. Draft genome sequence of a KPC-2-producing Klebsiella pneumoniae ST340 carrying blaCTX-M-15 and blaCTX-M-59 genes: a rich genome of mobile genetic elements and genes encoding antibiotic resistance.

    PubMed

    Casella, Tiago; de Morais, Andressa Batista Zequini; de Paula Barcelos, Diego Diniz; Tolentino, Fernanda Modesto; Cerdeira, Louise Teixeira; Bueno, Maria Fernanda Campagnari; Francisco, Gabriela Rodrigues; de Andrade, Leonardo Neves; da Costa Darini, Ana Lucia; de Oliveira Garcia, Doroti; Lincopan, Nilton; Nogueira, Mara Corrêa Lelles

    2018-06-01

    Klebsiella pneumoniae is considered an opportunistic pathogen and an important agent of nosocomial and community infections. It presents the ability to capture and harbour several antimicrobial resistance genes and, in this context, the extensive use of carbapenems to treat serious infections has been responsible for the selection of several resistance genes. This study reports the draft genome sequence of a KPC-2-producing K. pneumoniae strain (Kp10) simultaneously harbouring bla CTX-M-15 and bla CTX-M-59 genes isolated from urine culture of a patient with Parkinson's disease. Classical microbiological methods were applied to isolate and identify the strain, and PCR and sequencing were used to identify and characterise the genes and the genetic environment. Whole-genome sequencing (WGS) was performed using a Nextera XT DNA library and a NextSeq platform. WGS analysis revealed the presence of 5915 coding genes, 46 RNA-encoding genes and 255 pseudogenes. Kp10 belonged to sequence type 340 (ST340) of clonal complex 258 (CC258) and carried 20 transferable genes associated with antimicrobial resistance, comprising seven drug classes. Although the simultaneous presence of different bla CTX-M genes in the same strain is rarely reported, the bla KPC-2 , bla CTX-M-15 and bla CTX-M-59 genes were not associated with the same genetic mobile structure in Kp10. These results confirm the capacity of K. pneumoniae to harbour several antimicrobial resistance genes. Thus, this draft genome could help in future epidemiological studies regarding the dissemination of clinically relevant resistance genes. Copyright © 2018 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

  16. Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.

    PubMed

    Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E

    1999-09-01

    Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within